Mass spectrometry-based proteomic analysis of inhibitor of kappa b kinase beta and its role in cytokine-induced drug resistance in cancer

PDF

Download

Open document

Flip pages

Summarize

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

MASS SPECTROMETRY-BASED PROTEOMIC ANALYSIS OF INHIBITOR
OF KAPPA B KINASE BETA AND ITS ROLE IN CYTOKINE-INDUCED
DRUG RESISTANCE IN CANCER

by

Ling-Chi Wang

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

December 2007

Copyright 2007 Ling-Chi Wang
DEDICATION
This dissertation is dedicated to Jehovah. For without Him, I would have
given up. May blessing and glory and wisdom and thanksgiving and honor
and power and might be to our God forever and ever. Amen. (Holy Bible,
Revelation 7:12)

“Therefore do not cast away your confidence, which has great reward. For
you have need of endurance, so that after you have done the will of God, you
may receive the promise.”
～Holy Bible, Hebrews 10:35-36
ii
ACKNOWLEDGEMENTS
First of all, I would like to offer my whole-hearted appreciation to my
parents, grandparents and everyone in the family: You encouraged me to
come to America for my dreams. Most of all, whether I succeed or not, you
are always proud of me—that has kept me going till now.
Secondly, I would like to thank my Ph. D. mentor, Dr. Ebrahim Zandi,
for your support throughout the years. Moreover, my thanks to all the current
and previous laboratory members, who had kept me company—both
scientifically and non-scientifically, and enriched our lives together.
Further more, more thanks to my first advisors in biological science
research, Dr. Hsiu-Ming Shih and Dr. Chou-Zen Giam: You showed me how
fascinating and attractive this field is. On top of that, the training you
provided prepared me with the appropriate mindset to excel in my graduate
studies.
Additionally, I would like to thank my friends in the XYZ in Christ
Ministry: Your prayers lifted me up through my darkest and weakest nights.
Your overwhelmingly unconditional love makes me realize that I am much
better than I thought.
Last but not least, I would like to thank my best friend Chieh-Ping Lin,
who gloriously went home with the Lord on June 14
th
, 2006: Even during
your toughest fight against leukemia, you listened and encouraged me
through each and every one of my complaints and strengthening us in
believing that we should never give up. At your very last few breaths, you
iii
uttered, “We have to fight on until the very last second. Always trust that
God is on our side.” Therefore, I made it—finally! Completing your Ph.D.
studies in civil engineering was one of your unfulfilled hopes and dreams.
Hence, I am writing this dissertation in memory of you. See you in Heaven.

iv
TABLE OF CONTENTS

Dedication ii

Acknowledgements iii

List of Tables vi

List of Figures vii

Abstract ix

Chapter One: Introduction 1

Chapter Two: TNF alpha-dependent Drug Resistance to Purine and
Pyrimidine Analogues in Human Colon Tumor Cells is Mediated
Through IKK
13
Summary 13
Introduction 14
Materials and Methods 18
Results 23
Discussion 54

Chapter Three: A Simple and Inexpensive Combination of Frit-
fabricated Fused Silica Capillary Columns with a Spray Tip Column
Increases the Capacity and the Versatility of LC-MS/MS Analysis of
Protein Mixtures
55
Summary 55
Introduction 56
Materials and Methods 57
Results and Discussion 63
Concluding Remarks 79

Chapter Four: Identification of novel phosphorylation sites in IKK β
subunit by mass spectrometry and the effect of mutagenesis of these
sites on IKK activity
81
Summary 81
Introduction 82
Materials and Methods 85
Results 94
Discussion 112

Chapter Five: Conclusions 115

Bibliography 119
v
LIST OF TABLES

Table 3-1 Proteins identified by 1-D and 2-D chromatography in
UPS.
69

Table 3-2 Summary of identified protein numbers in MEF
conditioned media.
73

Table 3-3 Summary of four secreted proteins identified in MEF
media.
77

vi
LIST OF FIGURES

Figure 2-1 Short and long term effects of TNF α on the
cytotoxicity of FdUrd in two human colon tumor cell
lines.
25

Figure 2-2 Selection of TNF α-dependent FdUrd-resistant
Colo201 cells.
29

TNF α does not alter the uptake of
14
C-FdUrd in
Colo201 cells.
31 Figure 2-3

TNF α arrests specifically P35-Colo201 cells in G
0
-G
1

phase of cell cycle and blocks DNA synthesis.
33 Figure 2-4

Figure 2-5 P35-Colo201 cells selected for TNF α-dependent
resistance to FdUrd are resistant to other
antimetabolites in the DNA synthesis pathway.
36

Figure 2-6 Specificity of TNF-induced drug resistance, cell cycle
arrest, and IKK activation in P35-Colo201 cells.
38

Figure 2-7 IKK mediates TNF α-induced colony survival in P35-
Colo201 cells.
40

Figure 2-8 Knocking down of IKK α, IKK β, or RelA/p65 by RNAi
reduces TNF α-induced colony survival in FdUrd-
treated cells.
43

Figure 2-9 IKK inhibitor, PS1145, blocks the TNF α-induced G
0
-
G
1
cell cycle arrest in P35-Colo201 cells.
45

Figure 2-10 In an IKK-dependent manner, TNF α reduces Rb,
E2F1, and Cdk4 proteins specifically in P35-Colo201
cells.
47

Figure 3-1 Microscopy of on-column frit

65

Figure 3-2 Nanoflow ESI chromatography

67

Figure 3-3 Representatives of total ion chromatograms 72

vii
Figure 3-4 MS/MS spectra that lead to the identification of four
proteins described in Table 3-3.
74

Figure 3-5 Validation of expression of FSTL-1, M-CSF, PEDF,
and SPARC in the conditioned media of MEF feeder
layers.
78

Figure 4-1 Purification of IKK β produced in yeast by
immunoprecipitation.
95

Figure 4-2 Identification of phosphorylation sites in LZ of IKK β by
mass spectrometry.
96

Figure 4-3 In the first experiment, mutating three serines to
alanines in the LZ of IKK β results in reduced basal
level and TNF α-induced kinase activity of IKK.
99

Figure 4-4 Kinase activity of HA-IKK β LZ3SA is similar to wild
type IKK β in different cell lines.
101

Figure 4-5 HA-IKK β LZ3SA is incorporated into endogenous IKK
complex in a similar manner as wild type IKK β.
103

Figure 4-6 Comparison of kinase activity of wild type and LZ3SA
IKK β in stable cell pools of MEF IKK β
-/-
or COS-7
cells.
105

Figure 4-7 Analysis of the kinase activities of HA-IKK β wild type,
HA-IKK β LZ3SA and HA-IKK β LZ3SE expressed in
yeast.
107

Phosphoantibodies against S
471
, S
474
, and S
476
are
unable to detect IKK β.
109 Figure 4-8

Figure 4-9 Anti-p-476 antibody does not precipitate IKK activity. 111
viii
ABSTRACT
IKK β is the key kinase in the TNF α-NF- κB pathway that
phosphorylates I κB α and targets it for polyubiquitination and degradation. As
a result, NF- κB is released and moves into the nucleus, where it binds to the
promoters of target genes and activates transcription that increases cell
proliferation or prevents apoptosis. In the chapter two of this dissertation, a
novel role for the TNF α-IKK-NF- κB signaling pathway in anti-cancer drug
resistance is described. Contrary to its physiological function, TNF α induced
G
0
-G
1
cell cycle arrest through IKK in cancer cells, which provided a
mechanism for developing drug resistance to the purine and pyrimidine
antimetabolites. A specific IKK β inhibitor prevented TNF α-induced drug
resistance. Thus IKK inhibitors can enhance the effectiveness of
antimetabolites in chemotherapy.
Phosphorylation regulates the kinase activity of IKK β. In chapters
three and four of this dissertation, mass spectrometry-based proteomic
methods was developed to analyze post-translational modifications of IKK β.
A simple and inexpensive frit fabrication method for micro chromatography
columns was developed to improve peptide separation in tandem liquid
chromatography mass spectrometry. This technology simplifies the use of
micro one- or multiple-dimensional chromatography. Using mass
spectrometry, three novel phosphorylation sites S
471
, S
474
, and S
476
in the
leucine zipper of IKK β were identified. The potential role of these serines on
IKK β kinase activity was studied.
ix
CHAPTER ONE: INTRODUCTION

IKK/NF- κB Signaling Pathway
The nuclear factor kappa B (NF- κB) transcription factor family includes
RelA (p65), RelB, c-Rel, p50/p105 (NF- κB1), and p52/p100 (NF- κB2). These
proteins share a highly conserved Rel homology domain in their N-termini,
which is required for DNA-binding and dimerization (Gilmore, 1990). NF- κB
proteins form homodimers and heterodimers to generate different NF- κB
complexes with distinct transcriptional activities.
The activities of NF- κB proteins are regulated by extracellular signals.
In the cytoplasm of unstimulated cells, NF- κB is kept in an inactive state by
binding to the inhibitor of NF- κB (I κB) proteins. Three distinct signaling
pathways for NF- κB activation have been described. In the canonical NF- κB
activation pathway, pro-inflammatory cytokines such as tumor necrosis factor
α (TNF α) and interleukin-1 β (IL-1 β) activate the I κB kinase (IKK) complex.
Activated IKK phosphorylates the regulatory serine residues S
32
and S
36
on
I κB α (DiDonato et al., 1997). This targets I κB α for ubiquitination and
degradation by the 26S proteasome (Chen et al., 1995). Freed NF- κB
translocates to the nucleus, where it binds to the promoter sites of target
genes and regulates their transcription. The non-canonical NF- κB activation
pathway, which plays a central role in the development and maintenance of
secondary lymphoid organs, is activated by other members of the TNF family
such as lymphotoxin (Claudio et al., 2002; Coope et al., 2002; Dejardin et al.,
1
2002). Activated IKK complex directly phosphorylates p100, resulting in
proteasomal degradation of p100 to p52. This activates and translocates
p52-RelB into the nucleus. In the third pathway, the atypical NF- κB
activation pathway, tyrosine kinases phosphorylate Y
42
on I κB α in response
to hypoxia. This results in dissociation of I κB α from NF- κB (Bui et al., 2001;
Imbert et al., 1996; Kato et al., 2003; Mukhopadhyay et al., 2000; Romieu-
Mourez et al., 2002; Schoonbroodt et al., 2000). I κB α is not degraded by
proteasome in this pathway.
The canonical pathway is the main activation mechanism for NF- κB in
all cell types and regulates the transcription of genes that are involved in
inflammation, immunoregulation, cell differentiation, cell proliferation, anti-
apoptosis, and stress (Hayden and Ghosh, 2004; Hayden et al., 2006; Karin
et al., 2002).
The Role of IKK/NF- κB in Anti-cancer Drug Resistance
NF- κB plays an important role in tumorigenesis as it activates proteins
involved in cell cycle progression and inhibition of apoptosis (Guttridge et al.,
1999; Hinz et al., 1999; Perkins et al., 1997; Wolff and Naumann, 1999). IKK
and NF- κB are the targets of oncoproteins. Viral oncoprotein Tax, which
leads to human T cell leukemia, interacts with the IKK complex and
constitutively activates IKK and NF- κB (Chu et al., 1999; Harhaj et al., 2007;
Jin et al., 1999). Other oncoproteins, such as EBV nuclear antigen, Ras, and
Bcr-Abl, are also reported to be able to induce NF- κB activation (Finco et al.,
1997; Mosialos, 1997; Reuther et al., 1998).
2
Constitutive activation of NF- κB is observed in many malignant tumors.
It is reported that constitutive activation of NF- κB prevents cancer cells from
apoptosis and increases cell proliferation rates and metastatic potential
(Gilmore et al., 2002). Activation of NF- κB has also been shown to reduce
the cytotoxic effect of a number of anti-cancer drugs (Li and Karin, 1998;
Pahl, 1999). Cells with constitutively activated NF- κB are highly resistant to
anti-cancer drugs or ionizing radiation, and inhibition of NF- κB activity in
these cells sensitized them to these treatments (Arlt et al., 2001; Cusack et
al., 2000; Jones et al., 2000; Wang et al., 1999). In addition, several
chemotherapeutic agents, such as Ara-C (1- β-D-Arabinofuranosyl-cytosine),
doxorubicin, daunorubicin, taxol, vinblastine, and vincristine, have been
reported to activate IKK/NF- κB (Boland et al., 1997; Brach et al., 1992; Das
and White, 1997; Sreenivasan et al., 2003). Taken together, activation of
IKK/NF- κB by anti-cancer drugs resulting in the inhibition of cell death is
believed to be an effective mechanism to reduce the cytotoxicity of the anti-
cancer drugs. This could ultimately result in the development of drug
resistance (Berenson et al., 2001; Jeremias et al., 1998; Wang et al., 1999).
Mechanisms of Drug Resistance to Antimetabolites
Purine and pyrimidine antimetabolites are widely used in cancer
chemotherapy. They inhibit enzymes involved in DNA and RNA synthetic
pathways, thereby affect both DNA and RNA metabolisms (Hatse et al.,
1999). The main cytotoxicity pathway of antimetabolites is through the arrest
of DNA synthesis in the S phase of the cell cycle. One of the widely used
3
and effective antimetabolites is 5-fluoro-2'-deoxyuridine (FdUrd). FdUrd is
used for the treatment of colon, rectum, breast, esophagus, prostate,
stomach, head and neck carcinomas, and metastatic cancers. It is an
antimetabolite that interferes with pyrimidine synthesis by inhibiting the de
novo thymidylate synthesis. It can also be metabolized and be incorporated
into RNA to inhibit its function.
Development of drug resistance is the major cause of failed cancer
chemotherapies. As a result no cancer treatment is fully effective. Common
mechanisms of drug resistance include the mutation or change of expression
of drug transporters (Gottesman, 2002), the induction of drug-detoxifying
enzymes, and the insensitivity to drug-induced apoptosis of cancer cells
(Lowe et al., 1993; Synold et al., 2001). Individual variations in patients and
somatic genetic differences in cancer cells from the same tissue can also
give rise to drug-resistant cancers (Green et al., 1999; Pluen et al., 2001).
Purine and pyrimidine antimetabolites are S phase-active anti-cancer
drugs. Their effectiveness is greatly reduced in cells arrested in the G
0
-G
1

phase of the cell cycle. Therefore, signals generated by cancer, normal, or
infiltrating immune cells in a tumor microenvironment that can cause a slow
growth or G
0
-G
1
cell cycle arrest in cancer cells may provide conditions for
cell survival against antimetabolites. Given time, survived cancer cells can
acquire additional mutations and develop drug resistance.
It has been shown that NF- κB is activated by anti-cancer drugs and,
as a result, the cytotoxicity of these drugs are reduced (Baldwin, 2001; Wang
4
et al., 1999). Many antimetabolites used in cancer therapy do not activate
IKK/NF- κB directly. However, cytokines produced in a tumor
microenvironment are able to activate the IKK/NF- κB signaling pathway and
may change the cytotoxicity of antimetabolites. Whether or not activation of
IKK/NF- κB signaling pathway by inflammatory cytokines such as TNF α and
IL-1 β commonly found in the microenvironment of many tumors provides a
mechanism for drug resistance to antimetabolites is not known.
TNF α and the Activation of IKK/NF- κB Pathway
TNF α is a proinflammatory cytokine produced by macrophages and
other immune cells in local responses to infection, tissue injury, and repair. It
is also found to be produced by many tumors (Ardizzoia et al., 1992;
Takeyama et al., 1991), and its level is elevated in the sera of cachectic
patients with advanced tumors (Miwa et al., 2001). TNF α regulates signaling
pathways of NF- κB, AP-1, p38, ERK, and programmed cell death (Aggarwal,
2003; MacEwan, 2002). Activation of the IKK/NF- κB signaling pathway by
TNF α protects cells from apoptosis and is required for the production of cell
cycle and immune regulatory proteins (Aggarwal, 2003).
The binding of trimeric TNF α to the TNF α receptors (TNFR) leads to
receptor trimerization and conformational changes, which expose the death
domain on the C-terminus to the cytosol. The cytoplasmic domains of the
TNFRs do not have enzymatic activities. Trimerization of the TNFRs results
in recruitment of intracellular adaptors and signaling molecules to initiate
signal transduction and to activate the IKK complex. Once the IKK complex
5
is activated by phosphorylation, in turn it phosphorylates I κB α, which leads to
the polyubiquitination and proteasome-mediated degradation of I κB α.
The molecular mechanisms of signal transduction from TNFR to IKK
are the focus of intense research. The current model indicates that the
unfolded C-terminus of TNFR can associate with death domain protein
(TRADD), which then recruits receptor interacting protein 1 (RIP1), TNFR-
associated factor 2 (TRAF2) and TRAF5 (Dempsey et al., 2003; Hsu et al.,
1996; Hsu et al., 1995). It is reported that TRAF2 recruits the IKK complex to
the TNFR through binding to the leucine zipper domain of IKK α and IKK β
subunits, and cells lacking TRAF2 and TRAF5 show essentially no TNF α-
dependent IKK activity (Devin et al., 2001; Tada et al., 2001). The activation
of NF-κB does not require the kinase activity of RIP1 (Ting et al., 1996).
Although it has been much learned about the pathways that lead to IKK
activation, the direct molecular event(s) that lead to IKK activation as well as
the inter- and intra-molecular events of IKK complex regulation remain
unclear.
The IKK Complex and Its Regulatory Mechanisms
The IKK complex is a key regulator of the canonical NF- κB activation
pathway. It is a multimeric enzyme complex consisting of four subunits: two
catalytic subunits, IKK α and/or IKK β, and two regulatory IKK γ subunits. IKK α
and IKK β are serine-specific kinases with similar structural domains including
a kinase domain that contains a T loop, a leucine zipper (LZ) domain, a helix-
loop-helix (HLH) domain, a serine-rich domain, and an IKK γ binding domain
6
( γBD). The IKK α and IKK β have a high degree of sequence identity, but their
biological functions are quite different. The primary function of IKK α is in skin
and limb development and is dispensable for NF- κB activation in response to
cytokines, whereas IKK β is critical for the activation of NF- κB in response to
cytokines. The regulatory subunit, IKK γ, also known as NF- κB essential
modulator (NEMO), is required for the formation of the large IKK complex
and for the signal-induced activation of IKK α and IKK β. IKK β and IKK γ are
required for the activation of NF- κB by most of the pro-inflammatory
cytokines such as TNF α and IL-1 β (Karin et al., 2004).
As discuss earlier, direct regulators of IKK activation are not known.
Addition of ubiquitin and small ubiquitin-like modifier (SUMO) are reported to
play a role in IKK regulation. The K63-linked polyubiquitination of IKK γ was
reported to serve as a binding site for unknown signaling molecules to
activate the catalytic subunits of IKK (Burns and Martinon, 2004; Chen et al.,
2005; Krappmann and Scheidereit, 2005). SUMO modification induced by
genotoxic stress leads to mono-ubiquitination of IKK γ, which causes the
activation of the IKK complex (Huang et al., 2003). These mechanisms
seem to be required for activation of phosphorylation of IKK, which is the
essential step for signal-induced IKK activation.
Regulation of IKK β by Phosphorylation
Phosphorylation plays an essential role in the activation of IKK β.
There are at least 16 serine residues in IKK β whose phosphorylation is
involved in the regulation of IKK activity. These include 2 serines (S
177
and
7
S
181
) in the T loop, 12 serines adjacent to the HLH domain (between amino
acids 664 to 707), and 2 serines (S
740
and S
750
) in and adjacent to the γBD
(Delhase et al., 1999). The function of the phosphorylation of the γBD is not
known yet. It is hypothesized that phosphorylation of these sites reduces the
affinity of IKK γ binding, thereby resulting in inactivation of IKK (May et al.,
2002; Schomer-Miller et al., 2006). Dephosphorylation of the γBD by
unknown upstream stimuli would increase the affinity of the interaction
between IKK β and IKK γ, which causes the autophosphorylation of T loop in
the kinase domain of IKK β (Delhase et al., 1999; Mercurio et al., 1997;
Schomer-Miller et al., 2006). Phosphorylation of the T loop in IKK β is
necessary and sufficient to activate the IKK complex. This phosphorylation is
followed by the autophosphorylation of serines adjacent to the HLH domain,
which, with the help of IKK γ, is suggested to down regulate the activity of the
IKK complex (Schomer-Miller et al., 2006).
To date it has not been possible to show which of the 12 serines at the
C-terminus of IKK β are phosphorylated in vivo. The kinetics of
phosphorylation and de-phosphorylation of these serines in response to
stimulation remain unknown, too. Because several serines are
phosphorylated in the C-terminus of IKK β, it is possible that at a given time
different populations of C-terminally phosphorylated IKK β exist. This
complicates the analysis of IKK β phosphorylation by conventional methods.

8
Mass Spectrometry-based Proteomics
Identification and analysis of post-translational modifications (PTMs) in
proteins are paramount in understanding molecular mechanisms of cell
regulation. There are several commonly used technologies to identify and
analyze the effect of PTMs on protein structure and function. Expression of
wild-type or mutated proteins using recombinant plasmid DNA in mammalian
cells allows analysis of protein functions to a certain degree. Protein
depletion by RNA interference (RNAi) has become a very powerful technique
for knocking down target proteins (Elbashir et al., 2001). RNAi is a technique
that introduces an exogenous RNA, which is complimentary to a target
mRNA, into cells to specifically destroy a particular mRNA, and thereby
diminishes or abolishes gene expression (Hammond et al., 2001). These
methods are critical for protein research. However, they also have limitations.
First, introducing foreign materials into cells and changing their normal
growth environment may result in unexpected or undetectable responses.
Second, overexpression or knock-down of target proteins may result in
abnormal physiological protein levels and change their function. Other
methods, such as in vivo metabolic labeling and immunoprecipitation using
specific antibodies that detect unmodified or modified amino acid residues
(e.g. phosphorylation or ubiquitination), are extremely useful for the detection
of endogenous protein modifications (Beynon and Pratt, 2005). A limitation
of these methods is that only one or two protein modifications are detected at
one time. Furthermore, kinetic studies are laborious.
9
An ideal protein function analysis method should be able to isolate
native proteins from small numbers of cells (10
7
~10
8
) and to examine entire
protein sequences and their PTMs. It should also allow scientists to easily
observe changes of PTMs at different time points in response to stimulation.
Mass spectrometry-based proteomics is a more recent technique that has
shown great promise in dynamic analysis of proteins and their PTMs (Beck et
al., 2006; Brand et al., 2004; Zhang et al., 2005). In our lab, we use a
Finnigan LTQ Linear Ion Trap Mass Spectrometer from Thermo Electro Co.
(San Jose, CA), which is a linear ion trap MS that is capable of sequencing
proteins. There are four major parts in this mass spectrometer system. A
high performance liquid chromatography (HPLC) system is used for sample
(peptide mixture) introduction to a column. A pump system helps to mix
different solvents for peptides to be moved into or to be eluted out of a
column. A mass spectrometer is used for peptide separation and analysis.
A computer system is used to collect and to analyze data. This mass
spectrometer has a fast scan speed and can generate 10 subsequent
MS/MS (or MS2) spectra of the 10 most abundant parent ions per second.
Electrospray ionization-mass spectrometry (ESI-MS) is one of the
methods used for protein sequencing and PTM identification. ESI-MS, when
coupled with HPLC, can analyze complex mixture of proteins with accuracy
and high speed. There are several advantages in applying mass
spectrometry to protein analysis. First, mass spectrometry can sequence
very small quantities of proteins. For instance, laboratories using an ion trap
10
mass spectrometer are able to detect about 6x10
5
molecules (Du et al., 2005;
Le Blanc et al., 2003). As a comparison, the detection limit of a very good
silver-stained gel is about 1 ng of protein, which is 6x10
12
molecules of a 100
kilodaltons (kDa) protein (Gatlin et al., 1998; Gygi et al., 2000). Second, by
using mass spectrometry, scientists can sequence a single protein from a gel
or identify several proteins in one set of experiments. In addition, PTMs are
identified simultaneously with identification of proteins. Third, when
combined with immunoprecipitation of endogenous protein complexes, the
large amount of data generated by the mass spectrometer can help to
identify proteins and PTMs as well as provide sufficient information for
mapping networks of protein signaling. An promising area of use for the
mass spectrometer is real-time protein kinetic studies, whereby stimulation-
dependent changes of protein quantities, protein modifications, and protein-
protein interactions can be analyzed as a function of time (Eyles et al., 1999;
Furdui et al., 2006; Sobott et al., 2002; van den Heuvel et al., 2005).
For proteins to be sequenced by an ion trap MS, they first are
fragmented by proteases (e.g. trypsin). Proteins can be digested in a gel or
in a solution of complex mixtures. Peptides are separated by HPLC prior to
their introduction to MS. Separation of digested peptides by HPLC is a critical
step in accurate sequencing of individual peptides (Liu et al., 2007). The
more individual peptides of a protein are sequenced and identified, the higher
the sequence coverage of a protein is. Several factors contribute to
obtaining high sequence coverage of a protein: (1) The size of a protein; the
11
larger the protein, the more difficult it is to obtain 100% coverage. (2)
Fragmentation of a protein by proteases; partial digestion that results in very
long peptides (composed by 25 amino acids or more) makes a protein
difficult to be sequenced. (3) HPLC separation of peptides; high resolution
separation of peptides results in more efficient MS analysis and increased
sequence coverage. (4) Fragmentation of peptides in MS; individual
peptides are fragmented inside the MS by collision with helium. This is a
critical step in peptides sequencing (see below). (5) Accuracy of mass
determination; the more accurate the masses of peptides and their
corresponding fragments are determined by MS, the higher the probability of
identifying their sequences is. 6) Bioinformatics and MS/MS interpretation
software.
In the second chapter of this dissertation, a role for IKK in mediating
TNF α-induced cancer drug resistance to antimetabolites is discovered. In
the third and fourth chapters, a mass spectrometry-based proteomic
approach is established for protein identification and PTM determination of
complex mixtures. Novel phosphorylation sites on IKK β are identified and
their functions are studied by molecular biology techniques.

12
CHAPTER TWO:
TNF ALPHA-DEPENDENT DRUG RESISTANCE TO PURINE
AND PYRIMIDINE ANALOGUES IN HUMAN COLON TUMOR
CELLS IS MEDIATED THROUGH IKK

Cindy Yen Okitsu, who was a research assistant in Dr. Zandi’s laboratory,
had a significant contribution in the experimental part of this chapter.

SUMMARY
Development of drug resistance in cancer is one of the main
challenges in chemotherapy, and many mechanisms are still unknown. In
this study we show that TNF α increases post-drug survival from FdUrd in two
human colon tumor cell lines. This resulted in the development of drug-
resistant cells in a TNF α-dependent manner. Interestingly, although the
drug-resistant cells were selected using FdUrd, they were also resistant to a
number of other antimetabolites in the DNA synthesis pathway in a TNF α-
dependent manner. TNF α treatment resulted in G
0
-G
1
arrest only in the
drug-resistant cells (P35-Colo201) but not in the parental Colo201 and other
cell types. Blocking TNF α-induced cell cycle arrest sensitized drug-resistant
cells to FdUrd, and the cell cycle arrest required IKK. IKK inhibition by a
small molecule inhibitor or by the knockdown of IKK α, IKK β or RelA/p65
using siRNA, but not the inhibition of JNK, MEK, p38, or caspase8 pathways,
blocked TNF α-induced G
0
-G
1
arrest and restored sensitivity to FdUrd of
13
drug-resistant cells. TNF α reduced the transcripts and the protein levels of
p-RB, RB, E2F1, and Cdk4 only in drug-resistant P35-Colo201 cells. This
effect of TNF α was reversed by IKK inhibitor, suggesting that TNF α-induced
cell cycle arrest is likely due to the reduction of RB, E2F1, and Cdk4. Taken
together, this study shows that in vitro, TNF α-induced cell cycle arrest
through IKK and can provide a mechanism for the development of drug
resistance to anti-cancer drugs, such as purine and pyrimidine analogues.

INTRODUCTION
Intrinsic or acquired resistance to anticancer drugs is the major cause
of failure in cancer chemotherapy. Intrinsic resistance is present at the time
of treatment and often can be diagnosed. Acquired resistance develops
during and after chemotherapy (Pinedo, 1996; Pinedo and Giaccone, 1997).
Known intrinsic mechanisms of drug resistance in cancer include changes in
drug influx and efflux, intracellular activation and catabolism, or drug target
modifications (Banerjee et al., 2002; Kinsella et al., 1997; Pinedo, 1996). For
example, increased expression of thymidylate synthase in some colon
tumors is associated with intrinsic fluoroprymidine resistance (Mader et al.,
1998). However, there still are a large number of drug-resistant cancers with
unknown mechanisms (Gottesman, 2002). Unraveling these mechanisms is
essential for rationale design of combination chemotherapy.
Antimetabolites of purine and pyrimidine nucleotide metabolism, such
as 5-fluorouracil (5-FU), 5-fluoro-2’-deoxyuridine (FdUrd), methotrexate
14
(MTX), 3-deazauridine, ribavirin, hydroxyurea, and cytosine arabinoside (Ara-
C, an inhibitor of DNA polymerases α and β), inhibit enzymes at different
steps of biosynthetic pathways of DNA and RNA (Hatse et al., 1999). These
antimetabolites are widely used in cancer chemotherapy. These agents
inhibit the proliferation of dividing cells and very importantly exhibit relatively
lower toxic side effects than other drugs such as DNA damaging agents (Chu
et al., 1994). However, a relatively high number of cancers have either
intrinsic or acquired resistance to these agents (Spears, 1995). To overcome
the drug resistance and increase the anti-cancer efficacy, these
antimetabolites are combined together or with cytotoxic agents (Skeel, 2003).
However, the high degree of systemic toxicity and harmful side effects of
cytotoxic drugs limit their usage.
Purine and pyrimidine antimetabolites affect both DNA and RNA
metabolisms. The effects of antimetabolites on RNA and proteins are
transient, and thus the main pathway of cytotoxicity is through the arrest of
DNA synthesis in the S phase of cell cycle (Spears, 1995). Fully
differentiated or “quasi” quiescent cells, which are arrested in the G
0
-G
1

phase of the cell cycle, are resistant to the anti-proliferative activity of
antimetabolites (Hatse et al., 1999). Furthermore, slow-growing tumors show
poor sensitivity to chemotherapy. Conditions or extra cellular signals that
cause a slow growth or a G
0
-G
1
cell cycle arrest in cancer cells can provide
conditions for survival against antimetabolites. Cytokines produced by cells
15
of immune system and by normal or cancer cells in a tumor
microenvironment can generate such signals.
Many cytokines regulate cell proliferation, differentiation, and death.
Cytokines, such as tumor necrosis factor α (TNF α), tumor growth factor β
(TGF β), and interleukin-1 β (IL-1 β), have cell stimulatory or growth inhibitory
effects in different cell types. TNF α is a pro-inflammatory cytokine produced
by macrophages and other immune cells in local responses to infection,
tissue injury and repair. TNF α has a wide range of functions including
stimulation of the immune system, tissue differentiation, induction of
programmed cell death, and tissue repair (Aggarwal, 2003; MacEwan, 2002).
In some cells, TNF α induces cell cycle arrest at G
0
-G
1
phase (Harvat and
Jetten, 1996; Jeoung et al., 1995; Merli et al., 1999; Nalca and Rangnekar,
1998). TNF α was also shown to induce resistance to doxyrubicin in a lung
cancer cell line by shifting S phase to G
0
-G
1
phase (Prewitt et al., 1994).
TNF α is produced by many tumors (Ardizzoia et al., 1992; Takeyama et al.,
1991), and its level is elevated in the sera of cachectic patients with
advanced tumors (Miwa et al., 2001). TNF α at high levels (10
-7
M) kills
certain tumors, but it also causes systemic toxicity leading to septic shock
(Borrelli et al., 1996). TNF α at levels comparable to its concentration in local
inflammatory areas (10
-9
M) causes G
0
-G
1
arrest in A375-C6 melanoma cells,
and the mechanism of TNF α-induced cell cycle arrest in these cells includes
the induction of hypophosphorylated retinoblastoma (Rb) protein (Morinaga
et al., 1989; Muthukkumar et al., 1996). Unphosphorylated or
16
hypophosphorylated Rb is present at early to mid G
1
phase, which
associates with E2F1 and suppress its activity. Phosphorylation of Rb by
Cdk4 and Cdk6 at late G
1
phase results in the activation of E2F1 and the S
phase entry of cells (Tetsu and McCormick, 2003).
TNF α exerts its biological functions by activating signaling pathways
that regulate NF- κB, AP-1, p38, ERK, and death pathways. Activation of
IKK/NF- κB by TNF α protects cells from apoptosis and is required for the
production of cell cycle and immune regulatory proteins (Aggarwal, 2003).
NF- κBs are homo- and hetero-dimeric transcription factors that are kept in an
inactive state by inhibitory proteins I κB. Activated IKK phosphorylates
regulatory serines on I κB, marking them for polyubiquitination and
subsequent degradation. Free NF- κB binds to target gene promoters and
activates the rate of transcription of a large number of genes including cyclin
D and anti-apoptotic proteins (Karin et al., 2002). Hence, IKK/NF- κB
activation in most cell types results in increased proliferation and prevention
of cell death. Activation of NF- κB by a number of anti-cancer drugs has also
been shown to protect cells from death, thus reduced the cytotoxic effect of
drugs (Greten and Karin, 2004). IKK complex is a multi-subunit kinase. It is
composed of two catalytic subunits, IKK α and IKK β, and a regulatory factor,
IKK γ. IKK β and IKK γ are required for the activation of NF- κB by most of the
pro-inflammatory cytokines such as TNF α and IL-1 β (Karin et al., 2004).
This paper reports that TNF α, in an IKK-dependent manner, increases
the post-drug recovery and survival of a human colon tumor cell line from
17
FdUrd, resulting in the development of drug-resistant cells. Only in drug-
resistant cells, TNF α, through IKK, prevents S phase entry by reducing p-Rb,
Rb, E2F1, and Cdk4 levels.

MATERIALS AND METHODS
Cell Culture and Small Molecule Inhibitors
Human colon cancer cell lines, Colo201 & Colo320, were generously
provided by Dr. Heinz Lenz. The cells are maintained in RPMI1640 (Cellgro,
Herndon, VA) supplemented with 10% fetal bovine serum, 2 mM L-glutamine,
100 unit/ml penicillin, and 100 μg/ml streptomycin at 37 °C in the presence of
5% CO
2
. The supplement reagents were purchased from Gibco Life
Technologies (Carlsbad, CA). Cells were trypsinized and split 1:10 every 3-4
days. On the day before each experiment, the cells were seeded at
indicated densities to maintain exponential growth throughout the duration of
experiment. Small molecule inhibitors were purchased from CalBiochem
(EMD, Gibbstown, NJ). PS1145 was a generous gift from Millennium
Pharmaceuticals, Inc. (Cambridge, MA).
Cell Proliferation Assay
Cells were seeded at 2500 cells per well in a 96-well plate in triplicates
and were treated with or without drugs the next day. Cell proliferation was
followed each day using Promega CellTiter 96AQ
uous
One Solution Cell
Proliferation Assay kit (Madison, WI) according to manufacturer's
recommendations. Concentration of TNF α was 10-20 ng/ml and
18
concentration of 5-fluoro-2'-deoxyuridine (FdUrd; Sigma-Aldrich, St. Louis,
MO) was 10 μM unless otherwise stated. Percent cell survival was
calculated as percentage of cell proliferation in the presence of drug(s)
divided by cell proliferation in the absence of drug(s).
Cell Death Assay
Colo201 cells were seeded at 500,000 cells per well in a 6-well plates
in triplicates and were grown for 24 hrs. Cells were left untreated or treated
with FdUrd (10 μM) or FdUrd+TNF α (20 ng/ml) for 24, 48, 72, or 98 hrs. At
indicated times cells were harvested by scraping, counted, and apoptosis
was determined using the ApoAlert Annexin V staining kit (BD Biosciences
Pharmingen, San Jose, CA) using the manufacturer’s specifications. The
results shown are the mean ± SD of three independent experiments.
Survival Plate Assay
Cells were seeded at 250,000 cells per well in a 6-well plate in
triplicates. FdUrd at 10 μM or other drugs as indicated in the figures was
added individually or in combination with TNF α at 20 ng/ml for 5 days. Cells
were then washed free of the drugs, and fresh media were replenished every
3-4 days thereafter. Each plate was followed for 9 to 21 days post-release.
The plates were stained and documented using a scanner and colonies were
counted manually. Drug combination usually consisted of 1-6 hrs of TNF α
pretreatment followed by the treatment of FdUrd or other drugs unless
otherwise stated.
Cell Cycle Analysis by Fluorescence-Activated Cell Sorter (FACS)
19
For each assay, approximately 5x10
5
cells were used. At the time of
harvest, cells were washed with PBS and were removed from dish by trypsin.
Cells were fixed by 70% ethanol and stained in dark with 1 mg/ml propidium
iodide in PBS containing 1% Triton X-100 and 1 mg/ml RNAase A. Cell cycle
profiles were analyzed by FACS (USC/Norris Comprehensive Cancer Center
Flow Cytomery and Immune Monitoring Core, Los Angeles, CA).

3
H-Thymidine Incorporation Assay
Cells were seeded in 96 well plates at 1000 cells per well. After 24
hrs, drugs and/or TNF α were added as indicated in the figures. One μCi
3
H-
thymidine (0.5 Ci/mmol; Amersham Biosciences, Buckinghamshire, UK) was
added 24 hrs later, and cells were harvested on glass fiber filter using a
Skatron cell harvester (Skatron Instruments, Lier, Norway) and analyzed in
the Tri-CaRb 2100TR Liquid Scintillation Counter (Packard Instrument Co.,
Waltham, MA). Results are mean cpm of triplicate wells.
Cell Lysate Preparation
Whole cell lysates were prepared as described (Zandi et al., 1998).
Briefly, cells were lysed in an all-purpose buffer (APB, consisting of 20 mM
Tris, 20 mM NaF, 20 mM β-glycerophosphate. 0.5 mM sodium
orthovanadate, 2.5 mM metabisulphite, 5 mM benzamidine, 1 mM EDTA, 0.5
mM EGTA, 10% glycerol, pH 7.6) supplemented with 300 mM NaCl, 1%
triton X-100 and freshly-added protease/phosphatase inhibitors (2.5 μg/ml
leupeptin, 20 μg/ml aprotinin, 8.5 μg/ml bestatin, 2 μg/ml pepstatin A, 2 mM
DTT, 1 mM phenylmethylsulfonyl fluoride, 1 mM ρ-nitrophenol phosphate).
20
Lysed cells were centrifuged at maximum speed for 30 min at 4 °C, and
whole cell lysates were separated and stored at -80 °C after protein
concentrations were determined.
In Vitro Kinase Assay
Whole cell lysate proteins (100 μg) were immunoprecipitated with 1 μg
of rabbit anti-IKK α antibodies (Santa Cruz, Santa Cruz, CA) overnight in the
presence of Protein G Sepharose (Amersham Biosciences, Buckinghamshire,
UK). Kinase assay was determined as described (Miller and Zandi, 2001).
Briefly, kinase activity was assessed after 30 min at 30 °C in 30 μl of kinase
buffer (20 mM Tris, 10 mM MgCl
2
, pH 7.5) containing 20 μM ATP, 2 mM DTT,
5-10 μCi γ-
32
P-ATP, and 1 μg GST-I κB α 1-54 protein as substrate followed
by 10% SDS-PAGE. The unbound γ-
32
P-ATP at the dye front was removed
before the remaining SDS-PAGE gel was subjected to protein transfer onto a
PVDF membrane (Bio-Rad, Hercules, CA) at 300 mA for 2hr. The
membrane was exposed to a Molecular Dynamics phosphoimager
(Amersham Biosciences, Buckinghamshire, UK) overnight and analyzed via
ImageQuant software (Amersham Biosciences, Buckinghamshire, UK).
Each membrane was blocked in 5% milk and then was probed with mouse
anti-IKK α antibodies (Pharmingen, San Jose, CA) to judge
immunoprecipitation efficiency. After stripping (50 mM glycine, 200 mM NaCl,
pH 3.0, 2hr at 50 °C), each membrane was blocked and probed with mouse
anti-IKK β antibodies (Imgenex, San Diego, CA) again to evaluate the
immunoprecipitated IKK β levels.
21
Immunoblot Assay and Antibodies
For immunoblot, 20-40 μg of whole cell lysates was used. The
following antibodies were purchased from Cell Signaling (Danvers, MA): Anti-
phospho-Rb (phospho-S
807
and S
811
), anti-phospho-c-jun (phospho- S
63
),
anti-phospho-ATF2 (phospho-T
71
), anti-Rb, anti-phospho-I κB α, anti-I κB α,
anti-Cdk4, and anti-Cdk6. The following antibodies were purchased from
Santa Cruz (Santa Cruz, CA): anti-E2F1 and anti-phospho-ERK. Anti-
p65/RelA was purchased from Zymed (South San Francisco, CA).
Cell Transfection and siRNAs
Cell transfection for siRNAs was done by using Oligofectamine
reagent (Gibco Life Technologies, Carlsbad, CA) as described by the vendor
protocol. In preliminary experiments, various concentrations (1-100 nM) of
duplex oligonucleotides were used to determine the optimal concentration of
siRNA for the knockdown of each protein described in figures. The
sequences of oligonucleotides used are: IKK α siRNA, sense strand: 5’-
AGGAAGGACCUGUUGACCUUTT, antisense strand: 5’-
AAGGUCAACAGGUCCUCCUTT; IKK β siRNA, sense strand: 5’-
UGGUGAGCUUAAUGAAUGATT, antisense strand: 5’-
UCAUUCAUUAAGCUCACCATT; inverted IKK α control siRNA, sense strand:
5’-UUCCAGUUGUCCAGGAGGATT, antisense strand: 5’-
UCCUCCUGGACAACUGGAATT; p65/RelA siRNA, sense strand: 5’-
AGAGGACAUUGAGGUGUAUTT, antisense strand: 5’-
AUACACCUCAAUGUCCUCUTT.
22
Ribonuclease Protection and RT-PCR Assay
RNA isolation and the ribonuclease protection assay (RPA) were
performed as described by the BD RiboQuant (BD Biosciences) instruction
manual. The multi-probe template set hCC2 (Cat. No. 556160) containing
cell cycle regulators templates p130, Rb, p107, p53, p57, p27, p21, p19, p18,
p16, p14/15, L32, and GAPDH was used. For RT-PCR, total 10 μg RNA was
first reverse transcribed using ProtoScript First Strand cDNA Synthesis Kit
(New England Biolabs, Ipswich, MA) in 16 μl reactions. For RCR, 1-3 μl of
first strand cDNA was used. The following primers sets were used to amplify
GAPDH, E2F1 and Cdk4: Cdk4, sense strand: 5'-GAGAGTCCCCAATG,
antisense strand: 5'-GTGGGGGTGCCTTG, E2F1, sense strand: 5'-
CTGACCACCAAGCG, antisense strand: 5'-GTCCGCCGACGCCC, GAPDH
(provided by the "ProtoScript First Strand cDNA Synthesis Kit from New
England Biolabs), sense strand: 5'-TGC(A/C)TCCTGCACCACCAACT,
antisense strand: 5'-(C/T)GCCTGCTTCACCACCTTC.

RESULTS
TNF α Increases Post-drug Survival of A Small Number of FdUrd-treated
Colo201 and Colo320 Cells
To investigate whether pro-inflammatory cytokine TNF α modifies
cancer cell response to antimetabolites of purine and pyrimidine nucleotides,
we examined its effect on the short term cytotoxicity and the post-drug
23
survival of FdUrd in two human colon tumor cell lines Colo201 and Colo320.
We first examined the effect of TNF α by itself and in combination with 10 μM
FdUrd on the cell proliferation of Colo201. The 10 μM FdUrd concentration
is 100-folds above the 50% growth inhibitory (GI50) concentration of FdUrd
in Colo201 cells in culture for up to four days of treatment. We determined
the GI50 of FdUrd for these cells to be about 0.1 μM (data not shown). TNF α
at 5, 10, or 20 ng/ml reduced cell proliferation for only 10-15% (Fig. 2-1A).
Treatment of cells with 10 μM FdUrd alone reduced cell proliferation up to
95% after 4 days of treatment (Fig. 2-1A). Pretreatment of the cells with
TNF α did not significantly reduce or increase the cytotoxicity of FdUrd (Fig.
2-1A). As cell proliferation assay is not an indicator of cell death, we also
examined the combined effect of TNF α and FdUrd on the cell death by
annexin V assay. TNF α by itself did not increase cell death in Colo201 cells
above the basal level in culture (Fig. 2-1B). TNF α also did not change cell
death induced by FdUrd (Fig. 2-1B). Thus, TNF α did not seem to alter the
cytotoxicity of FdUrd in overwhelming majority of Colo201 cells. However,
with or without TNF α, consistently a small fraction (about 5%) of Colo201
cells survived after 4-5 days of FdUrd treatment (Fig. 2-1A).
Using a colony survival assay, we next examined whether TNF α alters the
post-drug recovery and survival of the small percentage of cells that survived.
We pre-treated or not Colo201 and Colo320 cells with 20 ng/ml TNF α for 1 hr
prior to the treatment with 10 μM FdUrd. Cells were treated for five days,
after which the floating cells were washed off the plate, and FdUrd-
24
Figure 2-1 Short and long term effects of TNF α on the cytotoxicity of
FdUrd in two human colon tumor cell lines.
(A) Cells were seeded at 2500 cells per well in a 96-well plate in triplicates.
After 24 hrs, cells were treated with 10 μM FdUrd with or without different
concentrations of TNF α. Cell proliferation was measured at 24, 48, 72 and
96 hrs as described in the Material and Methods. Percent cell survival was
plotted against time. (B) Colo201 cells were seeded at 500,000 cells per well
in a 6-well plate in triplicates and grown for 24 hrs. Cells were left untreated
or treated with FdUrd (10 μM) or FdUrd+TNF α (20 ng/ml) for 24, 48, 72, or
98 hrs. At indicated times cell death in each plate was determined as
described in the Material and Methods. Mean average of triplicates ± SD
percent cell death was plotted against the time of cell incubation with or
without TNF. (C) Cells were seeded at 250,000 cells per well in a 6-well
plate in triplicates and grown for 24 hrs, at which time cells were or were not
treated with 20 ng/ml TNF α for 1 hr. FdUrd (10 μM) was then added. Five
days later, floating cells were washed off the plates and drug-free media was
added and replenished every 3-4 days. After 3 weeks, cells were fixed and
stained, and plates were documented by a scanner. Duplicates
representative of plates are shown. (D) Colony survival assay was
performed as in C. TNF α (20ng/ml) was omitted, added 1 hr before, or 6, 12,
24, or 72 hrs after FdUrd. Mean colony counts of triplicate plates are shown.

25

26
and TNF-free culture media was added. The cells that remained adhered to
the plate were grown for 3 weeks, after which the cells were fixed and the
colonies were counted. In both cell lines, significantly more colonies grew on
TNF α pre-treated plates than the FdUrd-only treated plates (Fig. 2-1C).
Thus, TNF α increased the recovery of a small fraction of Colo201 and
Colo320 cells that were treated with 10 μM FdUrd. Pre-treatment of cells
with TNF α prior to FdUrd was essential for the TNF α-induced post-drug
recovery, as TNF α added to the cells 6 hours or longer after FdUrd did not
have the effect (Fig. 2-1D).
Increased post-drug recovery induced by TNF α results in selection of
drug-resistant cells
The data above indicates that TNF α increases the post-drug survival
of Colo201 and Colo320 cells. To test whether surviving colonies are
resistant to FdUrd in a TNF α-dependent manner, several single Colo201
colonies from TNF α+FdUrd plate were separately grown for two weeks and
were subjected to colony survival assays as described above. The TNF α-
dependent colony survival was on average only 2-3-fold higher for cells that
originated from the colonies of the first round of survival assay relative to
those of parental Colo201 cells (data not shown). This indicated that only a
small number of cells originating from these colonies used the TNF α signal
for post-drug survival. Thus, the TNF α-dependent post-drug recovery does
not seem to be based on a permanent genetic change. Nevertheless, as
there was a 2-3-fold increase in the TNF α-dependent colony survival, we
27
examined whether this trend would continue and whether a population of
TNF α-dependent drug-resistant cells would emerge. For this purpose,
colonies from TNF α+FdUrd-treated plates were pooled, grown for one to two
weeks, and were subjected to another round of colony survival assay. This
procedure was repeated for 35 rounds. Indeed, after each round of
TNF α+FdUrd treatment and post-drug recovery selection, the number of
TNF α-dependent colonies increased slowly at first, but it grew exponentially
after round 15 (Fig. 2-2A). To allow a more quantitative colony count, after
rounds 10 and 17 the colonies were evaluated after 12 and 9 days post-
release, respectively, as opposed to 3 weeks. After 30 rounds of
treatment/recovery, the entire plate was covered with confluent colonies.
Representative colony survival plates comparing the TNF α-dependent colony
survival of the parental (P1) Colo201 cells to the cells after 35 rounds (called
hereafter P35-Colo201) of FdUrd+TNF α treatment and recovery illustrates a
large difference (Fig. 2-2B). It is important to note that even after 35 rounds
of treatment/recovery, not the entire population, but more than 30% of P35-
Colo201 were resistant to FdUrd in a TNF α-dependent manner. The data
clearly demonstrates that TNF α treatment has selected a conditional drug-
resistant cell population. Furthermore, TNF α-independent drug-resistant
colonies began to emerge as well, but with much slower rate than TNF α-
dependent colonies (Fig. 2-2A).
Incorporation of FdUrd is not affected by TNF α treatment
One of the common causes of drug resistance is reduced drug uptake
28
Figure 2-2 Selection of TNF α-dependent FdUrd-resistant Colo201 cells.
(A) Logarithmic scale of colony counts of FdUrd (empty circle) and
TNF α+FdUrd (filled square) treatment and selection is shown as the function
of rounds of treatment/selection. (B) Representative survival assay plates
comparing parental Colo201 to P35-Colo201 cells (cells selected after 35
rounds of treatment/selection) is shown.

29
and/or increased drug efflux. To determine whether these mechanisms are
at play in TNF α-induced resistance to FdUrd, we determined the total
incorporation of FdUrd into the P35-Colo201 cells in the presence or
absence of TNF α at various times as a means for drug uptake and efflux
measurements. Cells were incubated with 10 μM
14
CFdUrd in the presence
and absence of TNF α and were harvested at various times from 5 min to 24
hrs (Fig. 2-3). TNF α treatment did not significantly change the amount of
14
C-FdUrd incorporation into cells, indicating that drug uptake and efflux were
not altered by TNF α.
TNF α prevents S phase entry specifically in P35-Colo201 cells
The cytotoxicity of purine and pyrimidine nucleotide antimetabolites is
associated with the arrest of proliferating cells at S phase (Chu et al., 1994).
TNF α has been reported to be cytostatic in certain cell lines (Harvat and
Jetten, 1996; Jeoung et al., 1995; Merli et al., 1999; Nalca and Rangnekar,
1998). We examined whether TNF α alters cell cycle, e.g., prevents S phase
entry, in P35-Colo201 cells by FACS and
3
H-thymidine incorporation. TNF α
did not cause a detectable change of cell cycle profile in parental Colo201
cells after 1, 2, 3, 4 days of treatment (Fig. 2-4A). On the other hand, in P35-
Colo201 cells after 2, 3, and 4 days of treatment, TNF α increased cell cycle
arrest at G
0
-G
1
phase by about 20%, 25%, and 22%, respectively (Fig. 2-4A).
Concomitant with increased cell populations in G
0
-G
1
phase, the fraction of
cells in S phase decreased in TNF α-treated cells (Fig. 2-4A, P35-Colo201
panel). To examine whether the G
0
-G
1
arrest in P35-Colo201 is due to cell
30
Figure 2-3 TNF α does not alter the uptake of
14
C-FdUrd in Colo201 cells.
Cells were seeded in triplicates for each time point at 50,000 cells per well in
12-well plates for 24 hrs, at which time they were treated with TNF α (20
ng/ml) or left untreated. One hour post-TNF treatment, 3 μCi of
14
C-FdUrd
was added at 10 μM final concentration. Cells were washed twice with PBS
and harvested by trypsinization after 5, 10, 15, 30 min, and 1, 3, 5, and 24
hrs. Cells were mixed with Scintiverse and counts per minute of
14
C were
counted. Cpms were converted to pmoles and were plotted against
incubation time of
14
C-FdUrd with cells. Results are mean pmols of triplicate
wells.

31
confluence in culture after 4 days, we cultured the cells with or without TNF α
for 4 days, after which TNF α was removed and fresh media was added. Cell
cycle profiles were analyzed at day 4 of TNF α treatment, and one or two
days after TNF α was removed (Fig. 2-4B). The cell cycle profiles showed
that four days of TNF α treatment increased the G
0
-G
1
arrest as before (Fig.
2-4B). One or two days after TNF α was removed, the G
0
-G
1
fraction of cells
decreased, which was concomitant with an increase of cells in S phase (Fig.
2-4B). The untreated cells did not show any cell cycle arrest after 4 days, or
after one or two days upon replenishing the culture media (Fig. 2-4B). Thus,
under the culture conditions we used here, the cell cycle arrest observed in
P35-Colo201 was mediated by TNF α. To test whether TNF α indeed arrests
P35-Colo201 before the S phase, we measured
3
H-thymidine incorporation
in the presence or absence of TNF α. Untreated cells incorporated increasing
amounts of
3
H-thymidine into their DNA after 1, 2, 3, and 4 days (Fig. 2-4C).
TNF α treatment strongly reduced
3
H-thymidine incorporation to almost basal
levels (Fig. 2-4C). Thus TNF α prevented a significant number of P35-
Colo201cells from entering S phase.
To further examine whether TNFα induces G
0
-G
1
arrest in other
commonly used cell lines, we compared the effect of TNF α on P35-Colo201
to HeLa, Cos-7, and HEK293 cells. Again, TNF α caused G
0
-G
1
arrest of
P35-Colo201 cells, whereas it did not alter the cell cycle profile of the other
cells (Fig. 2-4D). TNF-dependent sensitivity of HeLa, Cos-7, and HEK293

32
Figure 2-4 TNF α arrests specifically P35-Colo201 cells in G
0
-G
1
phase
of cell cycle and blocks DNA synthesis.
(A) Parental and P35-Colo201 cells were left untreated or treated with 20
ng/ml TNF α for 1, 2, 3, or 4 days. Cell cycle phases were determined by
FACS. Representative percentages of cells in G
0
/G
1
, S, and G
2
/M phases
are plotted against the number of days. (B) Six sets of 1x10
5
P35-Colo201
cells were seeded in triplicates. One day later, TNF α (20 ng/ml) was added
to three sets of plates. Cell cycle profiles were determined four days later for
two sets of plates with or without TNF α treatment (Day4). TNF α was
removed from the remaining plates and fresh media was added. Cell cycle
profiles were determined after one (Day1) and two (Day2) days. Mean
averages of triplicate ± SD percent of cells in G
0
/G
1
, S, and G
2
/M are plotted
against the time of TNF treatment and removal. (C) Total DNA synthesis as
a function of TNF α treatment for 1, 2, 3, and 4 days were determined by
3
H-
thymidine incorporation in P35-Colo201 cells. Mean average of triplicates ±
SD of cpm are shown. (D) Cell cycle phase analysis by FACS was done as
above. Representative cell cycle profiles of P35-Colo201, HeLa, Cos-7, and
HEK293 cells without and with TNF α treatment for 48 hrs are shown.

33

34
cells to FdUrd in a survival assay was comparable to parental Colo201 cells
(data not shown).
Colo201 cells selected for TNF α-dependent resistance to FdUrd are
also resistant to other purine and pyrimidine analogues
If the cytostatic function of TNF α is a mechanism for P35-Colo201
cells to be resistant to FdUrd, we reasoned these cells to also be resistant to
other purine and pyrimidine analogues after TNF α treatment. We tested the
effect of TNF α on the colony survival in P35-Colo201 cells treated with 5-FU,
MTX, Ara-C, hyrdoxyurea, 3-deazauridine, and ribavirin. A DNA damaging
agent, cisplatin, was used as a control. Each of these antimetabolites
inhibits different steps of the biosynthesis of DNA (Hatse et al., 1999). 5-FU
and MTX inhibit a similar pathway as FdUrd. Hydroxyurea inhibits
ribonucleotide reductase. 3-Deazauridine inhibits CTP synthase. Ara-C
inhibits DNA polymerases α and β. TNF α indeed reduced the effectiveness
of all these antimetabolites to a similar degree of that of FdUrd (Fig. 2-5).
P35-Colo201 cells were resistant to ribavirin independent of TNF α. TNF α
reduced cytotoxicity of cisplatin only marginally (Fig. 2-5). Thus, as the
above tested purine and pyrimidine analogues inhibit different steps in DNA
synthesis and the fact that Ara-C inhibits DNA polymerases directly, the
mechanism of TNF α action must be either to render the cell cycle arrest
induced by antimetabolites at S phase ineffective, or to prevent the cells from
reaching S phase.

35
Figure 2-5 P35-Colo201 cells selected for TNF α-dependent resistance
to FdUrd are resistant to other antimetabolites in the DNA synthesis
pathway.
Colony survival assay was preformed in triplicates as described above. The
indicated drugs were used with three different concentrations.

36
Inhibition of IKK, but not JNK, p38, ERK, or caspase 8, blocks both the
TNF α-induced cell cycle arrest and colony survival in P35-Colo201
To examine the specificity of anti-antimetabolites activity of TNF α, we
tested whether IL-1 β, LPS, and TGF β would have such effect. IL-1 β and
LPS did not reduce the killing of FdUrd in parental Colo201 cells (data not
shown). IL-1 β and TGF β are known to induce cell cycle arrest (Nalca and
Rangnekar, 1998; Satterwhite and Moses, 1994) and activate signaling
pathways that are overlapping (IL-1 β and LPS) or different (TGF β) from
those of TNF α. This would also shed light on the specificity of signaling
pathways responsible for TNF α-induced drug resistance. We treated cells
with TGF β, IL-1 β, and LPS or a combination of TGF β+IL-1 β followed by
FdUrd treatment, and survival assays were carried out. None of these
cytokines or LPS had a survival effect as TNF α did (Fig. 2-6A).
IL-1 β and TGF β have been shown to arrest the cell cycle at G
0
-G
1

phase in a cell type specific manner (Nalca and Rangnekar, 1998;
Satterwhite and Moses, 1994). We examined whether these agents cause a
cell cycle arrest in P35-Colo201 cells. After 48 hrs of treatment, TNF α
induced G
0
-G
1
arrest, but IL-1 β, TGF β, and LPS did not alter the cell cycle in
P35-Colo201 cells (Fig. 2-6B).
TNF α, IL-1 β, and LPS activate IKK/NF- κB in many cell types (Karin,
1999). We examined whether activation of IKK by these agents is
comparable in P35-Colo201, and whether it plays a role in TNF α-induced
protection from purine and pyrimidine analogues. TNF α strongly activated
37
Figure 2-6 Specificity of TNF-induced drug resistance, cell cycle arrest,
and IKK activation in P35-Colo201 cells.
(A) P35-Colo201 cells were pre-treated with TNF α, TGF β, IL-1 β, TGF β+IL-
1 β, or LPS prior to the treatment with FdUrd. Survival assay was performed
as in Fig. 2-1. Representative plates are shown. (B) P35-Colo201 cells
were not (-) or were treated with cytokines used in A for 48 hrs. Cell cycle
phases were determined by FACS. The histograms show the percentages of
cells in different phases. (C) P35-Colo201 cells were treated with indicated
cytokines for 10 and 30 min. IKK kinase activity was determined as
described in the Materials and Methods. Kinase activity (KA) of IKK complex
and immunoblot (IB) of IKK β are shown.

38
IKK in P35-Colo201 cells, whereas IL-1 β and LPS, surprisingly, did not (Fig.
2-6C). TGF β, as expected did not activate IKK (Fig. 2-6C). Similarly NF- κB
was activated only by TNF α but not by IL-1 β, LPS or TGF β in these cells
(data not shown).
We next investigated whether IKK and other pathways downstream of
TNF α play a role in TNF α-induced protection from FdUrd in P35-Colo201
cells. TNF α activates multiple pathways including IKK/NF-κB, JNK/AP1,
p38/ATF, ERK/MAPKK, and caspases (Karin and Delhase, 1998). We used
small molecule inhibitors utilized widely as blockers of these pathways.
These inhibitors have a reasonable degree of specificity, but they may also
have yet unknown targets and activities. Nevertheless, they do inhibit their
respective targets. We used inhibitors of IKK (PS1145), JNK (SP00125), p38
kinase (SB203580), MEK (PD98059), and caspase 8 (z-IETD-fmk) in colony
survival assays. In a dose dependent manner, IKK inhibitor, PS1145, was
the only agent that blocked TNF α-induced colony survival in FdUrd-treated
P35-Colo201 cells (Fig. 2-7A). None of the other inhibitors altered the
effectiveness of FdUrd in the absence or presence of TNF α (Fig. 2-7A). The
effective concentration of PS1145 to inhibit the TNF α effect was between 1-
10 μM. To ensure that inhibitors of the other pathways functioned properly in
blocking their respective known targets, we determined their inhibitory effect
on their specific pathways. The IKK, JNK, MEK, and p38 inhibitors did inhibit
I κB α, c-Jun, ERK, and ATF2 phosphorylation, respectively at the
concentration range used for the colony survival assay (Fig. 2-7B-E). The
39
40
Figure 2-7 IKK mediates TNF α-induced colony survival in P35-Colo201
cells.
(A) IKK inhibitor, PS1145, but not JNK, p38, MEK, or caspase 8 inhibitors
blocks TNF-induced colony survival in P35-Colo201 cells. The effects of
increasing concentrations (as indicated in the figure) of small molecule
inhibitors for IKK (PS1145), JNK (SP600125), p38 kinase (SB203580), MEK
(PD98059), and caspase 8 (z-IETD-fmk), on the TNF α-induced colony
survival were determined in FdUrd-treated P35-Colo201 cells. Cells were
pre-incubated with inhibitors for 1 hr prior to TNF α treatment. (B, C, D, E)
Inhibitors used in A inhibit their respective targets as determined by Western
blot using antibodies against I κB α, phospho-c-Jun, phospho-ERK1/2,
phospho-ATF2 to determine the cellular activities of IKK, JNK, ERK1/2, and
p38 kinase, respectively.

41

inhibitors of JNK, p38, MEK and caspase 8 did not have any effect on the
TNF-induced degradation of I κB α (Fig. 2-7B). Together the data show that
IKK activation, but not the other known downstream pathways of TNF α, is
required for the TNF α-induced anti-FdUrd activity.
To support the involvement of IKK in the TNF α-induced protection of
P35-Colo201 cells from FdUrd, we knocked down IKK α and IKK β individually
or together, and the RelA (p65) member of NF- κB using specific siRNAs.
The siRNAs used against each protein were effective and reduced the
respective protein levels by about 70-80% two days after transfection (Fig. 2-
8). Transfection of cells with IKK α, IKK β, individually or together, or RelA
reduced TNFα-induced colony survival of FdUrd-treated cells (Fig. 2-8). The
inhibition of TNF α-dependent colony survival using siRNAs of IKK α, IKK β,
and RelA, though clear and reproducible, are not as impressive as the
inhibition seen with IKK inhibitor, PS1145. The reason may be due to the
fact that siRNA does not completely eliminate IKK and RelA proteins, as
shown also in western blots (Fig. 2-8, top panel). Nevertheless, together the
data from inhibitor and RNAi experiments support the notion that TNF α
requires IKK for its cell protective activity against FdUrd.
IKK inhibitor blocks TNF α-induced cell cycle arrest
Prevention of S phase entry in P35-Colo201 cells by TNF α could be a
plausible mechanism for its anti-antimetabolite activity. As IKK inhibitor
efficiently blocked TNF α-induced colony survival in FdUrd-treated cells (Fig.
2-7A), we asked whether IKK inhibitor prevents TNF α-induced G
0
-G
1
cell
42

Figure 2-8 Knocking down of IKK α, IKK β, or RelA/p65 by RNAi reduces
TNF α-induced colony survival in FdUrd-treated cells.
P35-Colo201 cells were transfected with control, IKK α, IKK β, or RelA/p65
siRNAs (see Materials and Methods) for 24 hrs prior to the beginning of a
colony survival assay using FdUrd and TNF α+FdUrd conditions. Top panel,
Western blot analysis of IKK β, IKK α, and p65 shows the reduction of each
protein by their respective siRNA. I κB α was used as the control for loading
and specificity of RNAi effects. Bottom panel, Survival assay plates of
FdUrd- and TNF α+FdUrd-treated cells.

43

cycle arrest in P35-Colo201 cells. Treatment of P35-Colo201 cells with
PS1145 alone for 1, 2, 3, or 4 days did not change the cell cycle profile when
compared to the untreated cells (Fig. 2-9A and B). Treatment with TNF α
resulted in G
0
-G
1
arrest as also shown in figure 2-4 (Fig. 2-9C). PS1145
indeed blocked TNF α-induced G
0
-G
1
arrest, as cells co-treated with PS1145
and TNF α did not show the G
0
-G
1
cell cycle arrest (Fig. 2-9D). Thus,
PS1145 prevented TNF α-induced cell cycle arrest, indicating that TNF α
requires IKK for its cytostatic function in P35-Colo201 cells.
TNF α reduces phospho-Rb, E2F1, and Cdk4 protein levels in an IKK-
dependent manner
Cell cycle progression from G
1
to S phase is controlled by regulating
the expression levels and the activities of a complicated network of cyclin-
dependent kinases (Cdk), their upstream kinase or phosphatase
activators/inhibitors, cyclins A, D, and E, and their direct inhibitors (CKIs, p27,
p21, p19, p18, p16, and p14/p15). For S phase transition, Cdk4 and/or Cdk6
phosphorylate Rb proteins, resulting in activation of bound E2F1 transcription
factor. E2F1 increases the transcription of genes required for G
1
to S phase
transition and DNA synthesis. Elevated expression of CKIs are often
associated with cell cycle arrest (Sherr, 2000). By RNase protection assays,
we first examined whether TNF α increases the mRNA levels of a panel of
CKIs (p27, p21, p19, p18, p16, p14/15), as well the expression of p53 and
p57 mRNAs. TNF α did not alter CKIs, p53 and p57 mRNAs in P35-Colo201
cells (data not shown). Similar results were observed when we
44

Figure 2-9 IKK inhibitor, PS1145, blocks the TNF α-induced G
0
-G
1
cell
cycle arrest in P35-Colo201 cells.
Cell cycle profiles were determined by FACS 1, 2, 3, and 4 days after
indicated treatments. Representative cell cycle data are shown in
histograms indicating percentages of cells in Apoptosis (dead cells), G
0
/G
1
, S,
and G
2
/M phases of the cell cycle in P35-Colo201 cells untreated or treated
with TNF α in the presence or absence of 10 μM PS1145.

45

examined the protein expression of CKIs (data not shown). It is important to
note that p53 is mutated in Colo201 cells (Yamamoto et al., 1999). Thus
TNF α-induced cell cycle arrest was not due to increased CKI levels.
Next, we examined the effect of TNF α on the protein levels of Rb,
phospho-Rb, E2F1, Cdk4, and Cdk6 in parental and P35-Colo201 cells. It is
well documented that the levels of expression and the activities of these
proteins increase at the G
1
to S phase transition (Muller et al., 2001; Muller
and Helin, 2000). We compared the protein levels of phospho-Rb, residues
Ser
807/811
, which were reported to be phosphorylated by Cdk4 (Tetsu and
McCormick, 2003), Rb, E2F1, Cdk4, and Cdk6, in parental and P35-Colo201
cells before and after 48 hrs of TNF α treatment. TNF α did not alter the levels
of these proteins in parental Colo201 cells (Fig. 2-10A, lanes 1-2). However,
TNF α significantly reduced the levels of Rb, E2F1, and Cdk4, but not Cdk6,
in P35-Colo201 cells (Fig. 2-10A, lanes 3-4). TNF α also reduced the
phosphorylation of Rb because a second faster migrating band appeared in
the Rb immunoblot, and the phospho-Rb band was significantly reduced (Fig.
2-10A, lanes 3-4). Reduced Cdk4 protein correlates well with the reduced
phosphorylation of Rb and the appearance of the faster migrating band in Rb
immunoblot. This faster migrating band was not detected by phospho-Rb
antibody. Thus, TNF α reduces the levels of three major proteins required for
G
1
to S transition in drug-resistant P35-Colo201 cells, but not in parental
Colo201 cells.
46

Figure 2-10 In an IKK-dependent manner, TNF α reduces Rb, E2F1, and
Cdk4 proteins specifically in P35-Colo201 cells.
(A) Western blot analysis of Rb, phospho-Rb, E2F1, Cdk4, and Cdk6
proteins in lysates of parental and P35-Colo201 cells untreated or treated
with TNF α for 48 hrs is shown. P35-Colo201 cells were also pre-treated for
1 hr separately with either inhibitor of IKK (PS1145), JNK (SP600125), or p38
kinase (SB203580). (B) Western blot analysis shows a comparison of
phospho-Rb, E2F1, Cdk4, and Cdk6 proteins in parental and P35-Colo201,
HeLa, COS-7, and HEK293 cells. (C) mRNA levels of p130, Rb, and p107 in
P35-Colo201 cells with and without TNF α treatment (24 hrs) were analyzed
by S1-nuclease protection assay. L32 and GAPDH mRNA were used as
controls. (D) Agarose gel analysis of semi-quantitative RT-PCR of GAPDH
(control), Cdk4, and E2F1 mRNAs from parental and P35-Colo201 cells that
were either untreated or treated with TNF α for 24 hrs.
47

48

In the same experimental regimen, we also examined whether IKK
plays a role in TNF α-induced reduction of these cell cycle regulators. P35-
Colo201 cells were pre-treated with IKK inhibitor (PS1145), JNK inhibitor
(SP600125), or p38 inhibitor (SB203580) prior to TNF α treatment. PS1145
completely blocked TNF α-induced reduction of Rb, phospho-Rb, E2F1, and
Cdk4 levels (Fig. 2-10A, lanes 5-6). JNK and p38 inhibitors did not alter the
TNF α-induced reduction of these proteins (Fig. 2-10A, lanes 7-10). Thus,
IKK mediates the TNF α signaling for the regulation of RB, E2F1, and Cdk4.
TNF α did not cause G
0
-G
1
arrest in HeLa, Cos-7 and HEK293 cells
(Fig. 2-5). We compared the effect of TNF α on Rb, E2F1, and Cdk4 in these
cell lines to P35-Colo201 cells. Although the basal levels of Rb, E2F1, Cdk4,
and Cdk6 are different in these cells, these protein levels did not change
after 48 hrs treatment with TNF α (Fig. 2-10B). As shown above and here
again, TNF α down regulated Rb, E2F1, and Cdk4 in P35-Colo201 but not in
parental Colo201 cells (Fig. 2-10B).
To examine whether TNF α regulates the transcription of Rb, E2F1,
and Cdks, we determined the steady-state levels of their mRNAs in P35-
Colo201 cells. The mRNA of Rb family, p130, Rb, and p107, was
determined by S1-nuclease protection assay (Fig. 2-10C). TNF α did not
reduce the mRNA of Rb family members. As determined by semi-
quantitative RT-PCR, the mRNA of Cdk4 and E2F1 were reduced in
response to TNF α in P35-Colo201 cells, but did not change significantly in
parental Colo201 cells (Fig. 2-10D). This indicates that the transcription of
49

E2F1 and Cdk4 are suppressed by TNF α in P35-Colo201 cells. Together,
the data establish a connection between TNF α, IKK, and the regulation of Rb,
E2F1, and Cdk4 that leads to the cell cycle arrest before S phase and is
specific to P35-Colo201 drug-resistant cells.

DISCUSSION
In this study, we show that the cyctostatic function of TNF α protects a
small population of colon tumor cells from cytotoxicity of purine and
pyrimidine analogues. Repeated treatment with FdUrd and recovery resulted
in the selection of a TNF α-dependent drug-resistant Colo201 cell population.
The mechanism of TNF α-induced resistance to FdUrd includes cell cycle
arrest at G
0
-G
1
phase, which explains the resistance of P35-Colo201 cells to
a number of other antimetabolites such as 5-FU, MTX, Ara-C, ribavirin, 3-
deazauridine, and hydroxyurea in a TNF α-dependent manner. This suggests
that, TNF α-induced drug-resistance may apply to a broad range of
antimetabolites used in cancer therapy.
An important question is whether this cell culture mechanism for the
development of drug resistance applies to the in vivo situation. The first
question is the in vivo availability of TNF α in tumor microenvironments.
TNF α is produced in tumor microenvironments by infiltrating macrophages
and T cells and/or by some tumors (Negus and Balkwill, 1996). In patients
with advanced and metastasized tumors, systemic TNF α levels are often
high, which is also the cause of muscle wasting (Tisdale, 1999). Thus, in
50

vivo availability of TNF α for the development of TNF α-dependent drug
resistance in cancer is quite plausible.
The second question is the criticism that many mechanisms of drug
resistance discovered using cell culture systems have been found to be
unique to in vitro conditions. This is also a valid criticism to the model
system that we have developed here. Often protocols used to select for
drug-resistant cells in vitro do not mimic the in vivo treatment of cancer.
Drug-resistant cells in vitro are selected by continuous exposure of cells to
drugs for a long period. Clinically, however, patients are treated with multiple
rounds for short periods followed by recovery. The method we used here
mimics such protocols. Thus, there is a reasonable likelihood that the drug
resistance mechanism we describe here bears substantial relevance to the in
vivo situation.
Mechanistically, a necessary function of TNF α in protecting Colo201
cells from purine and pyrimidine analogues is the cell cycle arrest at the G
0
-
G
1
phase. In general, TNF α is not known to induce cell cycle arrest, but it
does so in number of cases reported (Cheng et al., 1994; Harvat and Jetten,
1996; Jeoung et al., 1995; Merli et al., 1999; Nalca and Rangnekar, 1998;
Prewitt et al., 1994). In the cell types tested here, including the parental
Colo201, the great majority of cells did not arrest at the G
0
-G
1
phase by
TNF α (Fig. 2-4). The fact that only in a very small fraction of cells did TNF α
prevent S phase entry indicates that this is not a normal function for TNF α.
51

This function of TNF α may be part of its pathology. Whether this pathology
is unique to cancer cells is currently not known.
Are there differences between TNF α signaling in cells that are
arrested in G
0
-G
1
phase versus those that are not? The majority of cells
originating from a colony that survived the first round of FdUrd treatment in a
TNF α-dependent manner were not able to utilize TNF α to survive in the next
round of FdUrd treatment. This indicates that the initial genetic changes
causing a rewiring of TNF α signaling are weakly penetrant. However, they
become dominant under drug selection pressure, possibly after acquiring
additional mutations.
Given the time and drug selection pressure, the TNF α-dependent
drug-resistant cell population increased exponentially (Fig. 2-2). From these
conditional drug-resistant cells, TNF α-independent drug-resistant cells also
emerged (Fig. 2-2A). Thus, TNF α-dependent survival of cancer cells during
treatment can also be considered as a mechanism to provide time and
survival conditions for the emergence of new mutations leading to TNF α-
independent drug-resistant cells. TNF α is known to produce reactive oxygen
species, which by themselves or in combination with drugs can cause
mutations in DNA (Imlay and Linn, 1988).
At this point, a genetic cause for the rewiring of the TNF α signaling
pathway downstream of IKK is not known, and it appears to be complex.
Nevertheless, we have determined that the IKK pathway, but not JNK, p38,
or ERK pathway, plays an essential role in transducing the TNF α signal
52

eventually to prevent cells entering DNA synthesis. In many cell types, NF-
κB activation by IKK has been linked with accelerated cell cycle progression
through the induction of D cyclins (Cao et al., 2001). In parental and P35-
Colo201 cells, mRNA and protein expression of D cyclins were not elevated
by TNF α (data not shown). Rather TNF α down regulates Rb, E2F1, and
Cdk4 in an IKK-dependent manner in cells that developed drug resistance
(Fig. 2-10). Hypophosphorylation of Rb as a result of TNF α treatment of
cells has also been reported in A375-C6 melanoma cells, which also arrest in
G
0
-G
1
phase (Muthukkumar et al., 1996). The fact that TNF α does not up-
regulate D cyclins in P35-Colo201 but rather down regulates the transcription
of E2F1 and Cdk4 suggests that the molecular mechanisms downstream of
IKK/NF- κB that regulate cell cycle events are changed, most likely at the
level of transcription (Fig. 2-10). In epidermis, activation of NF- κB has also
been associated with cell growth arrest, though the mechanism is not known
(Takao et al., 2003).
Our strongest evidence for the involvement of IKK and NF- κB is the
reversal effect of PS1145 on the TNF α-induced colony survival, cell cycle
arrest, and restoration of Rb, E2F1, and Cdk4 expressions. The siRNAs for
IKK α, IKK β, and RelA had a significant reversal effect on TNF α-induced
colony survival. The reversal effects of siRNA experiments were not as
strong as the IKK inhibitor effect. This is most likely due to incomplete
knockdown of these proteins by siRNA. It is also possible that PS1145
inhibits other kinases in addition to IKK, in which case the IKK/NF- κB
53

pathway, though required, is not the sole mediator of TNF α action in P35-
Colo201 cells.
The effective reversal of TNF α-induced drug resistance by PS1145
provides a reasonable rationale for potential combination of IKK small
molecule inhibitors with purine and pyrimidine analogues in cancer therapy.
The IKK inhibitor, PS1145, by itself did not result in cellular toxicity, which is
an advantage over cytotoxic agents that are currently used in the
combination therapy of cancer.

54

CHAPTER THREE:
A SIMPLE AND INEXPENSIVE COMBINATION OF
FRIT-FABRICATED FUSED SILICA CAPILLARY COLUMNS
WITH A SPRAY TIP COLUMN INCREASES THE CAPACITY
AND THE VERSATILITY OF LC-MS/MS ANALYSIS OF
PROTEIN MIXTURES

ABSTRACT
A modified sol-gel method for a one step on-column frit preparation for
fused silica capillaries and its utility for peptide separation in LC-MS/MS is
described. This method is inexpensive, reproducible, and does not require
specialized equipment. Because the frit fabrication process does not
damage the polyimide coating, the frit-fabricated column can be tightly
connected on-line for high pressure HPLC. These columns can replace any
capillary liquid transfer tubing without any specialized connections upstream
of a spray tip column. Therefore multiple columns with different phases can
be connected in series for one- or multiple-dimensional chromatography. We
tested the performance of the columns in combination with a spray tip by
using reverse phase-only and reverse phase plus ion exchange
chromatography coupled to tandem mass spectrometry, and analyzed the
proteome of conditioned media of irradiated mouse embryonic fibroblast
(MEF) cells.
55

INTRODUCTION
Fused silica based capillary liquid chromatography mircocolumns are
an essential component in high-resolution and high-sensitivity separation of
peptides in LC-MS/MS. Microcapillary columns with pulled tips (10 cm in
length and 50-100 μm id) packed with one, two, or three independent
chromatography phases are widely used (Link et al., 1999). Two limitations
of these columns/spray tips are the low capacity and the frequent clogging of
the tip. To increase capacity and versatility and to reduce the frequent
clogging of a pulled microcapillary column, the end portion of an upstream
fused silica buffer transfer tubing can be packed with one or more
independent chromatography phases. To pack such columns reproducible
on-column frit fabrication is required. The key impediment in making on-
column frits for fused silica capillary is that either the processes are
complicated or in the process of on-column frit preparations the polyimide
coating is destroyed (Piraino and Dorsey, 2003).
The on-column frit has to be sufficiently strong to retain the packing
material and to resist the pressure applied for packing and flushing the
column. The frit also needs to be highly permeable for different solvents.
Very importantly, the polyimide coating of the fused silica microcapillary,
which renders flexibility and prevents breaking of the glass for tight
connections, has to be intact after frit fabrication. Here we describe an
inexpensive, reproducible and simple modified sol-gel method for fabrication
of on-column frits for fused silica capillaries. In this frit-fabrication process,
56

the polyimide coating is preserved and columns are easily connected for
high-pressure chromatography without breaking the tubing. The procedure is
simple and reproducible, and does not require complicated instrumentation.
We reproducibly prepare on-column frits for fused silica capillaries with inner
diameters of 50, 75, 100, and 200 micrometer. We tested the utility of these
columns in combination with a spray tip column by analyzing the proteome of
secreted proteins from irradiated MEF cells required for human stem cell
(hES) growth and self-renewal.

MATERIALS AND METHODS
On-column Frit Preparation
Standard polyimide coating flexible fused silica capillary tubings with
different inner diameters (50, 75, 100, or 200 μm) but the same outer
diameter (360 μm) were purchased from Polymicro Technology (Phoenix,
AZ). These fused silica capillaries were cut into 40 cm in length, washed
with HPLC-grade methanol (J.T. Baker, Phillipsburg, NJ), and dried with ultra
high pure grade compressed helium gas (Gilmore, South El Monte, CA).
Each fused silica capillary was dipped into dry lichrosorb 5 μ Si 60A resins
(Varian, Palo Alto, CA) until approximately 0.5 mm resin was packed into the
fused silica capillary. A mixture of 170 μl Kasil 1 potassium silicate (PQ,
Valley Forge, PA) and 20 μl formamide (EM, Gibbstown, NJ) was vortexed
for 1 minute and centrifuged at maximum speed for 1 minute. The
supernatant (1 μl) was spotted on a small piece of parafilm, and the
57

lichrosorb-packed fused silica capillary was dipped into the solution for 10
seconds with the resin side toward the solution. Then the fused silica
capillary was incubated in Precision vacuum oven (GCA, Chicago, IL), which
was pre-warmed to 120
o
C, for 24 hours.
The frit-fabricated fused silica capillary was washed and tested with
the following solution introduced by pressure injection platform (New
Objective, Woburn, MA) under 400 psi of helium gas: 1 M ammonium nitrate
(J.T. Baker, Phillipsburg, NJ), 1 N HCl (EM, Gibbstown, NJ), HPLC-grade
water, and 100% HPLC-grade ACN. Frit-fabricated fused silica capillaries
were then dried with helium gas and kept dry in room temperature for future
use.
Primary Capillary Column (PCC) Preparation
Isopropyl alcohol (HPLC-grade; Burdick and Jackson; Muskegon, MI)
slurry of Polaris 5 μ C18-A RP resin (RP-C18) or 5 μ SCX cation exchange
resins (Varian, Palo Alto, CA) was packed into a frit-fabricated fused silica
capillary by pressure injection platform to generate a RP or SCX PCC. PCC
was kept wet in 50% methanol until use.
Fused Silica Capillary Spray Tip Column Preparation
Protocol for microcolumns with pulled tips preparation was described
by Gatlin et al (Gatlin et al., 1998). Briefly, a P-2000 Laser Based
Micropipette Puller (Sutter Instrument, Novato, CA) was used to pull spray
tips from polyimide coating flexible fused silica capillary tubing (75 μm id, 360
μm od). Two tips are generated after one single pull.
58

In order to pack resins into the spray tip, isopropyl alcohol slurry of 5 μ
or 10 μ C18 resins (Varian, Palo Alto, CA) were packed into the tip by
pressure injection platform at 400 psi of ultra high pure grade compressed
helium gas. The tip was first packed with 0.1 cm of 10 μm C18 resins, which
did not pass through the tip serving as a frit. Then column was packed with 5
μm RP-C18 resins to desired length. The RP spray tip column was kept wet
in 50% methanol before use.
High Performance Liquid Chromatography (HPLC)
A split tee with a fused silica capillary (25 μm id) on one end was used
to split the HPLC flow from 50 μl/min to 500 nl/min. The other end of the tee
was connected to a six-port divert/inject valve, which was used to introduce
peptide samples into the column, by a piece of fused silica capillary with 75
μm id.
For 1-D chromatography, a 10 cm RP spray tip column was connected
with a 10 cm RP PCC through a MicroTee with in-union high voltage contact
(Figure 2-2). Sample was loaded to the column using a 2 μl sample loop.
For 1-D RP chromatography, peptides were eluted into the mass
spectrometer using the following gradients: 5-50% ACN + 0.1% formic acid
over 75 minutes and 50-90% ACN + 0.1% formic acid over 40 min. For 2-D
chromatography, the method of Washburn et al., (Washburn et al., 2001),
was modified as follows. A RP spray tip column was connected with a 5 cm
SCX PCC through a MicroTee with in-union high voltage contact (Figure 2).
Peptides were eluted from SCX PCC to RP spray tip column by 10%, 20%,
59

30%, 40, and 80% of 500 mM ammonium acetate containing 5% ACN and
0.1% formic acid over 9 minutes. Each salt elution step was followed by a
gradient of 5% to 70% ACN containing 0.1% formic acid over 80 minutes to
elute peptides from RP spray tip column into the mass spectrometer. As a
last step, peptides were eluted from SCX PCC by 95% salt over 9 minutes
followed by a gradient of 5% to 90% ACN containing 0.1% formic acid.
The alignment of the spray tip with the ion sweep cone inlet was
observed in real time by a Pulnix TM-200 CCD camera (San Jose, CA)
coupled to Navitar Precise Eye 1.33X Standard Adapter and 3 mm fine focus
body tube (Rochester NY). The video output was displayed with Osprey
Swift Capture Application version 3.0 (Plano, TX).
Mass Spectrometry
Eluted peptides were analyzed on a Finnigan LTQ linear ion trap mass
spectrometer equipped with a nanospray ion source (Thermo Fisher
Scientific, Waltham, MA). The LTQ was operated at 2.6 kV spray voltage
and 275°C capillary temperature. Full scan was generated and 10 most
intensive ions above minimum signal threshold (500 counts) in each full scan
were subjected for MS/MS fragmentation. The MS/MS experiment was
performed with normalized collision energy of 35% and isolation width of 2
m/z.
Data Analysis
The resulting spectra were searched against different databases using
SEQUEST in BioWorks Browser 3.2 EF1, and on a SageN Sorcerer
60

Integrated Data Appliances (San Jose, CA, USA). The results were filtered
using ΔCn and cross-correlation score (XCorr) versus charge state. ΔCn
was always set at ≥ 0.1 and Xcorr was set at 1.50 for +1 charged peptides,
2.00 for +2 charged peptides, and 2.50 for +3 or higher charged peptides.
Preparation of Conditioned Medium from MEF Feeder Layers
MEF cells (Chemicon, Temecula, CA) were plated at a density of 2 x
10
4
cells/cm
2
in 10 cm plates with DMEM (Invitrogen, Carlsbad, CA) plus
10% FBS (Invitrogen, Carlsbad, CA) . Culture media were removed after 24
hours. After two rinses with 10 ml PBS (Invitrogen, Carlsbad, CA) each time,
each plate was replenished with 5 ml of serum-free knockout DMEM
(Invitrogen, Carlsbad, CA). For each experiment, 10 ng/ml bFGF (Invitrogen,
Carlsbad, CA) was added to one plate and no bFGF was added to the other
plate. Media were collected after 6 hours of incubation, and spun at 2000
rpm in an IEC HN-S benchtop centrifuge (Thermo Fisher Scientific, Waltham,
MA) for 10 minutes. The supernatant was transferred to a fresh tube, and
HPLC-grade ACN was added to a final concentration of 5%. Each sample
was passed through a Bio-Spin chromatography column (Bio-Rad, Hercules,
CA), which was packed with 5 μm of C8 resins (Sigma-Aldrich, St. Louis, MO)
and washed with 10 ml 5% ACN. After the sample was passed through the
column, the column was washed with 5 ml of 5% ACN. Peptides bounded to
C8 resins were eluted with 1 ml 75% ACN, dried by SpeedVac Plus Vacuum
System (Thermo, Waltham, MA), and stored in -80
o
C.
In Solution Digestion
61

The protein pellet was dissolved in 50 mM ammonium bicarbonate
and was reduced by adding DTT to 1 mM. The sample was then alkylated
by adding iodoacetamide to 5 mM. After digestion with 1 μg sequencing
grade modified trypsin (Promega, Madison, WI) or 1 μg elastase (Sigma-
Aldrich, St. Louis, MO) in 37
o
C overnight, the sample was evaporated by
SpeedVac and stored in -80
o
C. Peptides were dissolved in 5% ACN
containing 1% acetic acid for MS analysis.
SDS-PAGE and Immunoblot
Concentrated proteins of conditioned media were resolved on a SDS-
PAGE. The gel was transferred to a polyvinylidene fluoride membrane (Bio-
Rad, Hercules, CA) at 375 mA for 2 hours. The membrane was first blotted
in 5% non-fat milk in Western blot wash buffer (128.4 mM NaCl, 4.57 mM
Tris, 0.025% Tween 20; pH 8.0) and then probed with indicated antibody in
1% non-fat milk for overnight. Antibodies against mouse Follistatin-Like 1
(FSTL-1), mouse macrophage colony stimulating factor (M-CSF), mouse
serpin F1/ Pigment epithelium-derived factor precursor (PEDF), mouse
secreted protein acidic and rich in cysteine (SPARC) were purchased from
R&D Systems (Minneapolis, MN). After washing with Western blot wash
buffer, the membrane was probed with proper HRP-linked secondary
antibody (GE, Buckinghamshire, England) for one hour and wash again. The
membranes were incubated with Pico chemiluminescent or with SuperSignal
West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL) and
62

exposure pictures were taken by Fluor-S MAX Multi-Imager (Bio-Rad,
Hercules, CA).
Scanning Electron Microcopy
The fused silica tubes containing on-column frits were first stripped of
their outer coating cover with a razor blade. They were then cracked open
with a razor blade to expose the silica plug within. Next the cut tubes were
affixed onto aluminum specimen mounts (Ted Pella Inc. Redding, CA) with
double adhesive tape and liquid silver. After allowing the liquid silver to dry,
the samples were sputter coated with an Electron Microscopy Sciences 550x
sputter coater (Fort Washington, PA) with 25 angstroms of gold and
palladium. Finally, the samples were imaged at 20 kV on a Hitachi S-3400N
scanning electron microscope
(Woodbury, NY).

RESULTS AND DISCUSSION
Frit Fabrication and Column Packing
Various combinations of sol-gel technique for on-column frit
preparations for fused silica capillaries have been reported (Cortes et al.,
1987; Piraino and Dorsey, 2003; Schmid et al., 1999). We sought a simple
and reproducible method in which mechanically stable and permeable frits
were fabricated and in the process the polyimide coating was not damaged.
We were unable to produce stable and permeable frits reproducibly using the
original sol-gel method of polycondensation of potassium silicate and
63

formamide with different ratios. We modified the sol-gel method of
polycondensation of potassium silicate and formamide by including lichrosorb
silica particles to the process. The rationale behind the addition of lichrosorb
was that if potassium silicate would crosslink the silica particles to the inner
wall of the glass and to each other, a stable and permeable frit would be
generated. This mixture did not polymerize at room temperature and
required heating. We tested several temperatures and different times for frit
fabrication and found that relatively low temperature (120
o
C in a regular
laboratory oven) for 24 hrs generated mechanically stable and porous frits,
without damaging the polyimide coat. It is important to note that this process
reproducibly generated frits with similar permeability and stability. The
strength and permeability of the frits were maintained when the temperature
was kept between 100
o
C and 150
o
C, however, 24 hrs at 120
o
C was optimal
for generation of stable frits with best permeability. Another advantage of
using the lichrosorb particles is that the length of the frits can be controlled by
the amount of the resin packed in the capillary. We used this protocol to
prepare frits of 0.2-0.5 mm in length for fused silica tubings with inner
diameters of 50, 75, 100, and 200 μm. As shown in Figure 3-1A, the frit
fabrication process did not result in any discernable deformity or shrinkage in
the fused silica capillary under light microscope. In addition, the polyimide
coat was intact and as a result fused silica columns maintain their flexibility,
64

Figure 3-1 Microscopy of on-column frit
(A) Micrograph at 100X magnification shows an overview of an on-column frit.
The inner diameter of the fused silica capillary is 75 μm (measured by the
manufacturer), the length of the frit is approximately 0.3 mm. Scanning
electron micrograph at 400X (B), 10,000X (C), and 45,000 X (D)
magnifications are shown. (B) The smooth slanted wall is the fused silica
capillary tube, whereas the middle, rocky part shows the frit consisting of
cross-linked silica. (C, D) Silica resins were cross-linked by fibers (C) and
these fibers were about 71.10 nm in width (D).

65

which is essential for making tight connections. Scanning electron
microscopy of the frits showed that silica particles were cross-linked to each
other and to the inner wall of the capillary through a three-dimensional
network of fibers, which were about 71 nm in width (Figures 3-1B-D). The
frits did not generate excessive backpressure during chromatography and
were routinely packed at 400 psi pressure.
Fritted capillaries (40 cm in length) were packed with different
chromatography phases and different bed lengths (0.5-30 cm) using a high-
pressure injection “bomb” at 400 psi. Routinely, we pack the columns
[hereafter called primary capillary column (PCC)] with 2-10 cm bed length
with 5-10 μ RP, ion exchange, or titansphere TiO resins. The PCC can be
packed with one or more independent phases for multidimensional
chromatography applications. Packing 10 cm of bed often requires 30-60 min.
Combination of Primary Capillary Columns with Spray Tip Columns as
a Modular Chromatography System
Home made and commercially available spray tip columns such as
Picofrit (New Objectives) are widely used in LC/MS applications. The PCC is
an inexpensive and simple way to increase the capacity, life, and versatility
of the spray tip columns. The schematic in figure 3-2 shows the positioning of
PCC relative to a spay tip column. Essentially, PCC replaces the buffer
transfer capillary from divert/inject valve to the MicroTee. Depending on the
requirements of a particular experiment, with this arrangement, PCC can
serve several purposes. First, when there is no need to increase the
66

Figure 3-2 Nanoflow ESI chromatography
A spray tip column was connected through a MicroTee to a frit-fabricated
PCC, which essentially replaces the liquid transfer line. High voltage was
applied to the liquid through a high voltage pin lead which was also
connected to the MicroTee. A divert/inject valve was used to apply sample
or solution to the column at flow rate of 500 nl/min.

67

capacity of a spray tip column, we have used PCC as a pre-column, packed
with a small amount of RP bed (e.g., 0.5 cm), which has increased the life of
spray tip column significantly and prevented clogging. Second, when there is
a need to increase the capacity and the resolution of peptide separation
before MS, we have packed up to 30 cm of bed length of RP particles. Third,
the PCC can be packed with different chromatography beds to allow two or
multi-dimensional applications.
We tested the utility of combining the PCC and a spray tip column by
analyzing a complex mixture of 48 proteins (Sigma Universal Proteomics
Standard set; Sigma-Aldrich, St. Louis, MO). One hundred femtomole of
trypsin-digested mixture of the 48 human proteins was applied to either a 10
cm RP-C18 PCC upstream to a 10 cm RP-C18 spray tip column or a 5 cm
SCX cation exchange PCC upstream to a 10 cm RP-C18 spray tip column
followed by mass spectrometry on an ion trap LTQ as described in the
Materials and Methods (see Fig. 3-2 for relative positioning of the PCC to
spray tip column). The SEQUEST program was used to match MS/MS
spectra for peptide and protein identification. The C18-C18 column
combination identified a total of 28 proteins (Table 3-1). A total of 56 peptides
were identified, and the number of identified peptide per protein was mostly
between 1 and 3 (Table 3-1). The SCX-C18 column combination identified a
total of 44 proteins. In this case, a total of 207 peptides were identified, 3.7
times more peptides than the C18-C18 column combination. Therefore, the
68

Table 3-1 Proteins identified by 1-D and 2-D chromatography in UPS.
10 cm RP PCC 5 cm SCX PCC
UniProt
#
Name
Coverage
(%)
ID Pep
#
Coverage
(%)
ID Pep
#
P00709 Alpha-lactalbumin 12.06 2
P08758 Annexin A5 7.26 3 20.19 7
P01008 Antithrombin-III 4.79 4 36.82 13
P61769 Beta-2-microglobulin 16.95 2
P55957 BH3 interacting domain death agonist [BID] 5.18 1
P00915 Carbonic anhydrase 1 6.20 1 25.58 5
P00918 Carbonic anhydrase 2 19.07 3 36.96 8
P04040 Catalase 11.32 3 20.54 9
P07339 Cathepsin D 9.34 2
P08311 Cathepsin G 15.48 2 37.30 8
P01031 Complement C5 [Complement C5a] 3.38 3 3.68 6
P02741 C-reactive protein 2.701 3.15 2
P06732 Creatine kinase M-type [CK-MM] 19.89 7 41.91 16
P00167 Cytochrome b5 10.53 1
P99999 Cytochrome c [Apocytochrome c] 32.04 3
P01133 Epidermal growth factor 1.42 1 3.19 3
P05413 Fatty acid-binding protein 13.64 1 31.06 4
P06396 Gelsolin 2.33 1 13.32 8
P08263 Glutathione S-transferase A1 [GST A1-1] 7.27 2 11.82 3
P09211 Glutathione S-transferase P [GST]
P01112 GTPase HRas [Ras protein] 15.51 2 10.70 2
P69905 Hemoglobin alpha chain 17.99 2
P68871 Hemoglobin beta chain 15.97 1
P12081 Histidyl-tRNAsynthetase [Jo-1] 1.59 1 15.51 9
P01344 Insulin-like growth factor II 15.17 1 29.21 3
P10145 Interleukin-8 23.47 2
P02788 Lactotransferrin 7.54 3 34.14 18
P41159 Leptin 16.36 2
P61626 Lysozyme C 4.11 1
P10636 Microtubule-associated protein tau [Tau protein] 2.67 1 17.09 11
P02144 Myoglobin 9.801 9.80 1
P15559 NAD(P)H dehydrogenase [quinine] 1 [DT Diaphorase] 6.64 1 21.40 5
Q15843 Neddylin [Nedd8]
P62937 Peptidyl-prolyl cis-trans isomerase A [Cyclophilin A] 5.56 1
Q06830 Peroxiredoxin1 13.20 3 27.92 5
P01127 Platelet-derived growth actor B chain 6.69 1 5.02 1
P02753 Retinol-binding protein
P16083 Retinoldihydronicotinamide dehydrogenase (quinine)
[Quinone oxidoreductase 2 or NQO2]
22.27 3
P02787 Serotransferrin [Apotransferrin] 3.91 2 14.93 9
P02768 Serum albumin 7.14 3 13.29 9
P63165 Small ubiquitin-related modifier 1 [SUMO-1] 7.00 1
P00441 Superoxide dismutase [Cu-Zn] 18.30 1 13.07 2
P10599 Thioredoxin 33.65 3
P01375 Tumor necrosis factor [TNF-alpha] 6.93 1 14.29 2
P62988 Ubiquitin 33.33 2
P63279 Ubiquitin-conjugating enzyme E2 I [UbcH9] 14.10 3
O00762 Ubiquitin-conjugating enzyme E2 C [UbcH10] 10.73 2 57.06 6
P51965 Ubiquitin-conjugating enzyme E2 E1 [UbcH6] 9.42 1
Total Protein Identified: 28 44
Total Peptide Identified: 56 207
69

SCX-C18 combination not only increased the number of identified proteins
(44 versus 28), but very importantly it increased the number of identified
peptides per protein (the coverage) significantly by an average of 2-4 folds
(Table 3-1).
Utility of PCC in identifying secreted proteins from irradiated MEF
required for in vitro maintenance of human stem cells
To further test the utility of PCC, we analyzed a more complex mixture
of unknown proteins. The protein mixture was derived from the conditioned
medium of MEF feeder layers, which support the growth and self-renewal of
hES cells in vitro. The hES cells are pluripotent cells with the potential to
differentiate into a variety of cell types. The growth of hES cells in culture
depends on secreted proteins from irradiated MEF feeder layers (Reubinoff
et al., 2000; Shamblott et al., 1998; Thomson et al., 1998). The hES cells will
differentiate spontaneously in an unpredictable manner if the feeder cells are
removed. In order to grow hES under more controlled conditions and
understand the pathways leading to their differentiation, it is necessary to
identify the critical factors for the growth of hES cells. Recently insulin-like
growth factor 2 was identified as one of the factors capable of supporting
hES growth in vitro (Bendall et al., 2007). Given the complexity of the hES
cells proliferation and differentiation potential, it is reasonable to expect that
many other factors play important roles in these processes.
Culture supernatants (10 ml) of irradiated MEF feeder cells in serum
free culture medium were harvested and proteins were concentrated on a C8
70

RP column as described in the Material and Methods. Proteins were
digested in solution with trypsin in 500 μl. One twentieth of the peptide
mixture was subjected to either a PCC packed with 10 cm RP-C18 resin
upstream of a spray tip column packed with 10 cm of RP-C18 phase (1-D
chromatography set up) or a PCC with 10 cm of SCX phase upstream of a
10 cm spray tip column packed with RP-C18 resins (2-D chromatography set
up) followed by MS analysis on an LTQ ion trap mass spectrometer. For
each set up, two independent sample preparations were analyzed.
Representative examples of total ion current chromatograms for a 1-D and a
2-D analysis are shown in Fig. 3-3. The MS/MS spectra of all runs were
analyzed using the SEQUEST algorithm on a Sorcerer server. Using the 1-D
set up, 139 and 242 proteins were identified in each run (Table 3-2). A total
of 50 identified proteins were common between both runs (Table 3-2). Using
the 2-D set up, 906 and 1570 proteins were identified in each run. A total of
345 proteins were common between run number 1 and 2 in the 2-D set up.
The 2-D set up identified about 7.4-fold more proteins than the 1-D set up,
which can be attributed to an increased resolution and capacity of the
peptide separation.
Four representative MS/MS spectra that led to the identification of four
secreted proteins, follistatin-related protein 1 precursor (FSTL-1),
macrophage colony-stimulating factor 1 precursor (M-CSF), pigment
epithelium-derived factor precursor (PEDF) also known as stromal cell-
derived factor 3, and SPARC are shown in figure 3-4. A summary of the
71

Figure 3-3 Representatives of total ion chromatograms
Total ion chromatograms of a 1-D (A) and a 2-D (B) chromatography using
PCC are shown as time (x-axis) against relative abundance (y-axis). (A) For
1-D chromatography, peaks with higher abundance occurred within the
gradient of 5-50 % acetonitrile over the first 100 minutes. (B) For 2-D
chromatography, higher relative abundance peaks are at 70% acetonitrile
after each salt elution, which were at 110, 220, 330, 440, and 550 minutes.

72

Table 3-2 Summary of identified protein numbers in MEF conditioned
media.
Two independent runs of either 1-D or 2-D chromatography were performed
and the number of identified proteins are summarized.

1-D 2-D
Run #1 139 906
Run #2 242 1573
Common 50 345

73

74
Figure 3-4 MS/MS spectra that lead to the identification of four proteins
described in Table 3-3.
The MS/MS spectra of FSTL-1, amino acids 123 to 139 (A), M-CSF, amino
acids 13 to 33 (B), PEDF, amino acids 60 to 85 (C), and SPARC, amino
acids 205 to 217 (D) are shown. Peaks representing b and y ions for +1 or
+2 charged peptide are labeled.

75

function of these proteins is shown in Table 3-3. These proteins are extra-
cellular and are known to have a role in cell growth and differentiation in
other cell types. PEDF and secreted protein acidic and rich in cysteine
(SPARC precursor) were also previously identified by 2-D gel analysis as
components of conditioned media from MEF feeder layers (Lim and Bodnar,
2002). We chose these proteins for validation by Western blotting. All four
proteins were readily detectable in the conditioned MEF media (Fig. 3-5). As
bFGF is required for higher cloning efficiency with continued undifferentiated
proliferation of hES cells (Amit et al., 2000), we also examined whether bFGF
changes the expression of these proteins. Whereas the amount of FSTL-1
and M-CSF did not change significantly in bFGF-treated cells, the levels of
both PEDF and SPARC increased after bFGF treatment (Fig. 3-5). Together
the data confirms that these four proteins that were identified by MS indeed
were present in the conditioned media of MEF cells and their levels were
changed by bFGF treatment. Functional analysis is required to examine a
potential role for these proteins in proliferation and differentiation of hES cells.
Taken together, the analysis of the conditioned media of MEF cells indicates
further the utility of the PCC column when combined with a spray tip column.

76

Table 3-3 Summary of four secreted proteins identified in MEF media.
Information of four secreted proteins identified in conditioned media of MEF
was obtained from Universal Protein Resource (UniProt;
http://www.ebi.uniprot.org/index.shtml).

Accession
#
Protein
Name
Subcellular
Location
Function
Q62356 FSTL-1 Secreted May modulate the action of some
growth factors on cell proliferation
and differentiation.
P07141 M-CSF Plasma
membrane
and
secreted
Control the production,
differentiation, and function of
granulocytes and
monocytes/macrophages.
P97298 PEDF Secreted Neurotrophic protein which induces
extensive neuronal differentiation in
retinoblastoma cells.
P07214 SPARC Extracellular
and
secreted
Regulates cell growth through
interactions with the extracellular
matrix and cytokines.

77

Figure 3-5 Validation of expression of FSTL-1, M-CSF, PEDF, and
SPARC in the conditioned media of MEF feeder layers.
Western blotting shows that FSTL-1, M-CSF, PEDF, and SPARC were
expressed in both non-treated and bFGF-treated conditioned media at
different levels.

78

CONCLUDING REMARKS
We describe an improved sol-gel method for preparation method for
an inexpensive, simple, highly reproducible, and durable on-column frit. This
frit fabrication method allows the end section of a fused silica liquid transfer
line anywhere along the path from an LC system to MS inlet to be used as a
chromatography column. The frit fabrication process does not damage the
polyimide coating of the fused silica tubing and as a result tight connections
are made without breaking the fused silica. The frits can withstand pressures
as high as 1500 psi on-line after packed with 30 cm 5 μ resins. Different
chromatography phases can be packed into such columns. Depending on
the chromatography phase of a down stream spray tip column, it can
increase the capacity (e.g., if RP-C18 phase are used in both PCC and spray
tip), or it can be used for two or multi-dimensional chromatography
applications. The length of a bed in a PCC can be easily adjusted for
different applications. For example, a short bed (e.g., 0.5 cm) can serve as a
pre-column to prevent clogging of the spray tip column, and longer beds can
be used to increase capacity and separation resolution of peptides. An
important use for PCC will be in on-line phospho-protein and other affinity
chromatography enrichment applications.
We demonstrate the utility of the PCC combination with a spray tip
pulled column by analyzing a known protein mixture, Universal Protein
Standard, and a more complex mixture of unknown proteins, the secreted
proteins of irradiated MEF that support hES cell self-renewal. In both cases,
79

combining a PCC packed with 5 cm of a SCX cation exchange phase with a
commonly used C18-RP spray tip column resulted in significant increases in
the number as well as the coverage of the identified proteins.

80

CHAPTER FOUR:
IDENTIFICATION OF NOVEL PHOSPHORYLATION SITES
IN IKK β SUBUNIT BY MASS SPECTROMETRY
AND THE EFFECT OF MUTAGENESIS OF THESE SITES
ON IKK ACTIVITY

SUMMARY
IKK β is the key kinase in the TNF α-NF- κB pathway that
phosphorylates I κB α and targets it for polyubiquitination and degradation. As
a result, NF- κB is released and translocates into the nucleus. The activity of
IKK β is regulated by phosphorylation. Three novel phosphorylation sites S
471
,
S
474
, and S
476
in the leucine zipper of IKK β were identified by mass
spectrometry. These serines were mutated to alanines or glutamates for
functional studies. The mutated IKK β did not show altered kinase activity in
transfected mammalian cells, stable cell pools, or yeast. Three
phosphoantibodies were generated against three peptides each containing a
corresponding single phospho-serine. Neither of these antibodies was able to
detect phosphorylated IKK β in immunoblot experiments. The anti-phospho-
S
476
antibody was also unable to immunoprecipitate IKK β in cell lysates. In
conclusion, serine to alanine mutations of the three identified phosphorylation
sites in the leucine zipper of IKK β did not affect the kinase activity of IKK. It
81

is still possible that the leucine zipper of IKK β is phosphorylated on the three
serines identified in this study, but the function remains to be determined.

INTRODUCTION
Nuclear factor kappa B (NF- κB) is comprised of transcription factors that
control the transcription of genes involved in immunity, cell differentiation, cell
proliferation, cell death, and stress responses (Gilmore, 2006). Because of
such an important role in gene regulation, NF- κB is tightly regulated by the
association with inhibitor kappa B (I κB) proteins. In resting cells, NF- κB
binds to I κB α and is kept in the cytoplasm so that its DNA-binding ability is
inhibited (Rothwarf and Karin, 1999). After stimulation by cytokines or other
factors, IKK is activated and is able to phosphorylate regulatory serine
resides S
32
and S
36
on I κB α. This targets I κB α for ubiquitination and
proteasomal degradation. As a result, NF- κB is freed from I κB α and can
translocate to the nucleus, where it binds to the promoter region of many
genes and regulates their transcription (Siebenlist et al., 1994). Hence, IKK
is a key regulator of the NF- κB pathway that controls the transient stability of
I κB α, which inhibits NF- κB.
IKK is a multimeric enzyme complex consisting of three subunits: two
catalytic subunits, IKK α (85 kDa) and/or IKK β (87 kDa), and a regulatory
IKK γ subunit (50/52 kDa) (Scheidereit, 2006). The core of IKK complex
contains a total of four subunits: two catalytic subunits and two regulatory
subunits. The native IKK consists of 3 to 4 core units (Miller and Zandi, 2001).
82

IKK α and IKK β are serine-specific kinases with similar structural domains
including an N-terminal kinase domain that contains a T loop, a leucine
zipper (LZ) domain, a helix-loop-helix (HLH) domain, a C-terminal serine-rich
domain, and an IKK γ-binding domain ( γBD) at the very end of the C-terminus.
It is reported that IKK α and IKK β can form both homodimers and
heterodimers (Zandi et al., 1998). The LZ domain is required for the
dimerization of the catalytic subunits (Karin, 1999), and the HLH domain is
important for full IKK activation (Delhase et al., 1999; Zandi et al., 1998;
Zandi and Karin, 1999). The regulatory subunit, IKK γ, also known as NF- κB
essential modulator (NEMO), is required for the formation of the large IKK
complex and for the signal-induced activation of IKK α and IKK β.
Although IKK α and IKK β have 52% overall protein sequence identity and
are found in most cell types to be associated in IKK complex, these two
catalytic subunits have different biological functions (Zandi et al., 1997). The
primary function of IKK α is in the development of skin and limb (Hu et al.,
1999; Li et al., 1999; Takeda et al., 1999). IKK α homodimer has much less
kinase activity towards I κB α phosphorylation than IKK β homodimer (Zandi et
al., 1998), and IKK α is dispensable for NF- κB activation in response to
cytokines. On the other hand, IKK β, together with IKK γ, are critical for the
phosphorylation of I κB α and the activation of NF- κB in response to cytokines
(Bonizzi and Karin, 2004), which regulates immune and inflammatory
responses, cell survival, and development. Because IKK βγ complex is the
83

central regulator of the transcription factor family NF- κB, it is important to
have a molecular understanding of its regulation.
Phosphorylation of IKK β plays an important role in regulating its activity
(Miller and Zandi, 2001). It is reported that S
177
and S
181
, both located in the
T-loop of the kinase domain, are phosphorylated in activated IKK β and are
required for the kinase activity of IKK complex (Mercurio et al., 1997; Wang
et al., 2001). Mutating these two residues to alanine in IKK β leads to a dead
kinase. The 14 serines immediately following the HLH are reported to be
autophosphorylated in activated IKK β (Delhase et al., 1999). Yet, to date it
has not been possible to show which of these 14 serines at the C-terminus of
IKK β are phosphorylated in vivo.
It is reported that Saccharomyces cerevisiae does not have NF- κB and
its upstream signaling molecules, including the IKK complex (Epinat et al.,
1997). Therefore, yeast provides an excellent environment to study the
biochemistry of proteins in the TNF α-IKK-NF- κB pathway without the
interference of homologous endogenous factors. Human IKK β expressed in
yeast (yIKK β) has a comparable activity to the IKK β made in human cells
(hIKK β) (Miller and Zandi, 2001). Auto-phosphorylation is an important
mechanism for IKK regulation and it is also possible that yeast kinases would
phosphorylate IKK in a similar manner to mammalian kinases. Therefore, it
is expected that some of the post-translational modifications (PTMs) such as
phosphorylation to be similar between IKK β made in yeast and in human.
Large quantities of IKK β can easily be produced in yeast and be purified by
84

simple immuno-affinity steps. In this study, IKK β, produced in yeast, was
analyzed by mass spectrometry for PTM determination. Three novel
phosphorylation sites were identified in the LZ region of IKK β. A potential role
for these phosphorylations in regulating the activity of IKK was examined in
different mammalian cells.

MATERIALS AND METHODS
IKK Expression Plasmids
Plasmids pESC-TRP-met HA-IKK β, pESC-TRP-met HA-IKK β+HA-IKK γ,
pESC-TRP-met 6xHis-Flag-IKK β, and pESC-LEU-met HA-IKK γ were used to
express IKK in yeast (Miller and Zandi, 2001). pRC- β-actin HA-IKK β wild
type (WT) was used to express IKK β in mammalian cells (Delhase et al.,
1999).
The mutated IKK β LZ3SA, in which all three serines were mutated to
alanines, was generated by site-directed mutagenesis using Pfu DNA
polymerase (Stratagene, La Jolla, CA) and primers 5’-
CAAAATGAAGAATGCCATGGCTGCCATGGCTCAGCAGCTC-3’ and 5’-
GAGCTGCTGAGCCATGGCAGCCATGGCATTCTTCATTTT G-3’
(USC/Norris Comprehensive Cancer Center DNA core facility, Los Angeles,
CA) to mutate S
471
, S
474
, and S
476
to alanine. To make IKK β LZ3SE, in which
all three serines were mutated to glutamates, S
474
and S
476
were mutated to
glutamates by primers 5’-
AAGAATTCCATGGCTGAGATGGAGCAGCAGCTCAAG-3' and 5’-
85

CTCGAGCGGCCGCTTCATGAG-3’. After subcloning to replace wild type
IKK β, site-directed mutagenesis was performed with primers 5’-
CCAAAATGAAGAATGAGATGGCTGAGATGGAGCAGCAGCTCAAG-3’ and
5’-CTTGAGCTGCTGCTCCATCTCAGCCATCTCATTCTTCATTTTGG-3’ to
mutate S
471
to glutamate.
All mutagenesis and PCR products were verified by DNA sequencing
(USC/Norris Comprehensive Cancer Center DNA Core Facility, Los Angeles,
CA) and then were digested and used to replace IKK β in all the plasmids
containing IKK β WT by restriction enzymes and T4 DNA ligase (New
England Biolabs, Ipswich, MA) to generate IKK β LZ3SA or LZ3SE plasmids.
Expression of IKK in Yeast and Yeast Lysate Preparation
Plasmids were transformed separately or together into Saccharomyces
cerevisiae strain YPH499 (Stratagene, La Jolla, CA) using lithium acetate as
described by vendor protocol. The growing of yeast and protein harvest
procedures were performed as described (Miller and Zandi, 2001). Briefly, a
2 ml culture of transformed yeast was grown in growth medium that consists
of selective drop-out medium (Q-Biogene, Irvine, CA) plus 4 mM methionine
(Q-Biogene, Irvine, CA) at 30
o
C overnight with shaking at 300 rpm. This
culture was amplified in 400 ml of growth medium for 30 hours and then
induced with selective drop-out medium without methionine for 10 hours.
For protein harvesting, yeast cells were collected and washed with
400 mM (NH
4
)
2
SO
4
, 200 mM Tris-HCl (pH 8.0), 10 mM MgCl
2
, and 10%
glycerol. All the yeast cells collected from the 400 ml culture were
86

resuspended in 2 ml of lysis buffer consisting of 20 mM Tris (pH 7.6), 20 mM
NaF, 20 mM β-glycerophosphate, 0.5 mM Na
3
VO
4
, 2.5 mM sodium
metabisulfite, 5 mM benzaminide, 1 mM EDTA, 0.5 mM EGTA, 10% glycerol,
300 mM NaCl, 1% Triton X-100, 2.5 μg/ml leupeptin, 1 mM
phenylmethylsulfonyl fluoride (PMSF), 2 mM dithiotheitol (DTT), and 13 mM
ρ-Nitrophenyl Phosphate ( ρNPP). Lysates were transferred to FastProtein
Red Matrix tubes (Q-Biogene, Irvine, CA; 1 ml per tube) and were frozen at -
80
o
C overnight. The lysates were thawed on ice and then processed using a
FastPrep instrument (Q-Biogene, Irvine, CA) in the cold room. Yeast lysates
were lysed for 20 seconds on setting six, vortexed for 5 minutes in the cold
room, and then lysed for another 20 seconds on setting six. Matrix tubes
were centrifuged for 1 minute at maximum speed and the supernatants were
transferred into new microcentrifuge tubes. The extraction process was
repeated for three additional times by adding 1 ml of lysis buffer to the yeast
pellet in a Matrix tube every time. All supernatants from the same yeast
pellet were combined together and were ultracentrifuged at 35,000 rpm for 2
hours. The supernatant was collected and frozen at -80
o
C.
Immunoprecipitation and Double Immunoprecipitation
Yeast cell lysates (20 μg) or 200 μg of mammalian cell lysates were
incubated with selected antibody for 30 minutes on ice. After adding 10 μl of
packed protein G sepharose beads (GE, Buckinghamshire, England),
samples were incubated at 4
o
C for 2 hours. The beads were washed with
lysis buffer, pelleted, boiled in 1x SDS Laemmli buffer plus β-
87

mercaptoethanol for 5 minutes, and were resolved by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE).
To perform double immunoprecipitation, 30 mg of yeast protein extract
was diluted to 20 ml with 1x PBS, and imidazole (Sigma-Aldrich, St. Louis,
MO) was added to a final concentration of 20 mM. After adding 0.25 ml of
packed Ni-NTA agarose beads (Qiagen, Valencia, CA), the sample was
rotate at 4
o
C overnight. The beads were washed with wash buffer (1%
Triton+0.3 M NaCl+10 mM imidazole in PBS) and then eluted with elution
buffer (1% Triton+0.3M NaCl+200mM imidazole+2mM DTT in PBS).
Fractions were collected in 2 ml aliquots. Fractions containing higher levels
of IKK β were combined and dialyzed overnight in 1 L of 0.5M NaCl+1%
Trition X-100 in PBS at 4
o
C. The second immunoprecipitation was
performed by the addition of 50 μl of packed M2-Flag agarose beads (Sigma-
Aldrich, St. Louis, MO) and the sample was rotated at 4
o
C overnight. After
washing with 0.5M NaCl+1% Trition X-100 in PBS, beads were boiled in 100
μl of 1%SDS in PBS and then resolved by SDS-PAGE.
SDS-PAGE, Coomassie Blue Staining, Silver Staining and Western Blot
Cell lysates were loaded and resolved by SDS-PAGE to separate
proteins according to their electrophoretic mobility. The gel was then
subjected to staining or Western blot.
For Coomassie blue staining, the gel was stained with 0.1% (w/v)
Coomassie Brilliant Blue R-250 (ICN, Aurora, OH) in 50% methanol
(J.T.Baker, Muskegon, MI) and 10% acetic acid (J.T.Baker, Muskegon, MI) in
88

a glass container for 30 minutes at room temperature. The gel was
destained with 50% methanol and 10% acetic acid for 20 minutes and then
with 10% methanol and 10% acetic acid overnight.
For silver staining, the gel was fixed with fixing solution (50%
methanol, 12% acetic acid, and 0.05% formaldehyde (J.T.Baker, Muskegon,
MI)) in a glass container overnight. After washing with 35% ethyl alcohol
(AAPER, Shelbyville, KY) and ddH
2
O, the gel was sensitized with
sensitization buffer (100 mM sodium thiosulfate (EMD, Gibbstown, NJ)), and
30 mM of potassium ferricyanide (EMD, Gibbstown, NJ)) for 2 minutes. The
gel was then washed with ddH
2
O thoroughly and stained with 0.2% silver
nitrate (Spectrum, Gardena, CA) plus 0.076% formaldehyde in H
2
O. After
rinsing with ddH
2
O to remove excess staining solution, the gel was
developed with developing solution (6% sodium carbonate (EMD, Gibbstown,
NJ), 0.05% formaldehyde, and 0.0004% sodium thiosulfate)). After reaching
the desire darkness, the gel was incubated in 50% methanol and 12% acetic
acid for 5 minutes and stored in 1% acetic acid.
For Western blot, the gel was transferred to a polyvinylidene fluoride
(PVDF) membrane (Bio-Rad, Hercules, CA) at 380 mA for 1 hour after SDS-
PAGE. The PVDF membrane was blocked in 5% non-fat milk in Western
wash buffer (128.4 mM NaCl, 4.57 mM Tris, 0.025% Tween 20; pH 8.0) and
then probed with indicated primary antibody overnight. Anti-IKK γ antibody
was purchased from Abgent (San Diego, CA). Phosphoantibodies against
S
471
, S
474
, or S
476
were special order from Antagene (Mountain View, CA).
89

After washing with Western wash buffer, the PVDF membrane was probed
with the appropriate horseradish peroxidase-linked secondary antibody (GE,
Buckinghamshire, England) for one hour and washed again. SuperSignal
West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL) was
incubated with the PVDF membrane for 3 minutes and exposure pictures
were taken by Fluor-S MAX MultiImager (Bio-Rad, Hercules, CA).
In Gel Digestion
Bands corresponding to the stained proteins were excised from SDS-
PAGE gels and cut into small pieces. The gel pieces were destained with
5% glacial acetic acid (J.T. Baker, Phillipsburg, NJ) in 50% HPLC-grade
methanol (J.T. Baker, Phillipsburg, NJ) for 2 hrs. For gels stained with silver
nitrate, further destaining was required by applying a one-to-one mixture of
30 mM potassium ferricyanide (EM, Gibbstown, NJ) and 100 mM sodium
thiosulfate (EMD, Gibbstown, NJ). Then the gel pieces were destained again
with 5% acetic acid in 50% methanol for 1 hr. After dehydration with HPLC-
grade acetonitrile (Burdick & Jackson, Muskegon, MI), gel pieces were
evaporated in SpeedVac Plus Vacuum System (Thermo, Waltham, MA).
Proteins were reduced in gel pieces with 30 μl of 10 mM DTT (EM,
Gibbstown, NJ) in 100 mM ammonium bicarbonate (Mallinckrodt, Paris, KY)
for 30 minutes. This was followed by addition of 30 μl of 50 mM
iodoacetamide (Aldrich, Milwaukee, WI) in 100 mM ammonium bicarbonate
for 30 minutes to alkylate cysteine residues. After incubating with 100 mM
ammonium bicarbonate for 10 minutes, the gel pieces were dehydrated in
90

acetonitrile. The gel pieces were then treated with 100 mM ammonium
bicarbonate followed by HPLC-grade isopropyl alcohol (Burdick & Jackson,
Muskegon, MI), and this step was repeated once more. After dehydration
with acetonitrile and evaporation in SpeedVac, the gel pieces were
rehydrated in 30 μl of 20 ng/ μl trypsin (Promega, Madison, WI) on ice for 30
minutes. The excess trypsin was removed and 30 μl of 50 mM ammonium
bicarbonate was added to the sample and incubated at 37
o
C overnight. The
supernatant was collected into a new tube, and the digested peptides were
extracted from the gel pieces with 20 μl of 5% formic acid (EMD, Gibbstown,
NJ) for 10 minutes and with 30 μl of 5% formic acid in 50% acetonitrile for 10
minutes twice. The extracted peptides were combined, and solvent
evaporated in SpeedVac and stored at -80
o
C. Peptides were dissolved in 20
μl of 1% acetic acid in 5% acetonitrile. The solution was vortexed and spun
at maximum speed for 1 minute. Two microlitters of the digested peptides
was used for mass spectrometry analysis.
Mass Spectrometry
Detail materials and methods for mass spectrometry were described in
chapter three.
Cell Culture
Human embryonic kidney 293 (HEK293), COS-7, IKK β-knockout mouse
embryonic fibroblast (MEF IKK β
-/-
), and HeLa cells were maintained in
DMEM (Cellgro, Herndon, VA) supplemented with 10% fetal bovine serum
(Cellgro, Herndon, VA), 100 units/ml penicillin, and 100 μg/ml streptomycin
91

(USC/Norris Comprehensive Cancer Center Bioreagent and Cell Culture
Core Facility, Los Angeles, CA) at 37
o
C under 5% CO
2
. MCF7, HL-60, and
Colo201 cells were maintained in RPMI-1640 (Cellgro, Herndon, VA)
supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100
μg/ml streptomycin at 37
o
C under 5% CO
2
.
Expression of IKK in Mammalian Cells and Cell Lysate Preparation
Cells were seeded at 1x10
6
cells per 100 mm
2
dish one day before
transfection. Plasmids were transfected using Lipofectamine and PLUS
reagent (Invitrogen, Carlsbad, CA). Cells were fed with fresh medium 24
hours after transfection and were harvested 48 hours after transfection. If
needed, cells were treated with 20 ng/ml TNF α (gift of Dr. Weber, JS, H. Lee
Moffitt Cancer Center, Tampa, Florida) for 10 minutes prior to harvest. For
protein harvesting, cells were washed with PBS and then lysed in lysis buffer
consisting of 20 mM Tris (pH 7.6), 250 mM NaCl, 3 mM EDTA, 3 mM EGTA,
0.5% Triton X-100, 10 mM β-glycerophosphate, 100 μM Na
3
VO
4
, 1 mM
PMSF, 1 mM ρNPP, 1 mM DTT, and 2.5 μg/ml Leupeptin. Lysed cells were
centrifuged at maximum speed for 15 minutes and supernatants were frozen
at -80
o
C.
In Vitro Kinase Assays
After immunoprecipitation, beads were washed with lysis buffer and then
1x kinase assay buffer (200 mM Tris-HCl, pH 7.6, 100 mM MgCl
2,
10 mM
EDTA, 10 mM EGTA, 100 mM β-glycerophosphate, 1mM sodium vanadate,
10 mM ρNPP, and 2mM DTT). Kinase activity was assessed by incubating
92

beads with 30 μl kinase assay mixture (20 μM ATP, 2 mM DTT, 10 μCi [ γ-
32
P]ATP, and 1 μg glutathione S-transferase-I κB α amino acids 1-54 protein in
1x kinase buffer) for 30 minutes at 30
o
C and then subjected to SDS-PAGE
resolution. The PVDF membrane was exposed to Molecular Dynamics
Storage Phosphor Screen (Amersham Biosciences, Buckinghamshire, UK),
read by PhosphoImager (Amersham Biosciences, Buckinghamshire, UK),
and analyzed by ImageQuant software (Amersham Biosciences,
Buckinghamshire, UK).
Stable Cell Pools Establishment
MEF and Cos-7 cells were transfected with pRc- β-actin IKK β WT or
LZ3SA carrying a neomycin resistance gene. Transfected cells were fed with
2 mg/ml of G418 sulfate (Cellgro, Herndon, VA) in complete medium 24
hours after transfection for 6 weeks. After selection, stable cell pools were
maintained in 1 mg/ml of G418 in complete medium.
Gel Filtration
A sample (0.5 ml) was loaded onto a Superose 6 gel filtration column
(Amersham Biosciences, Buckinghamshire, UK) and fractionated with gel
filtration buffer (20 mM Tris, pH 7.6, 20 mM NaF, 20 mM β–glycerophosphate,
0.5 mM Na
3
VO
4
, 2.5 mM sodium metabisulfite, 5 mM benzamadine, 1 mM
EDTA, 0.5 mM EGTA, 10% glycerol, 150mM NaCl, and 0.5% Triton) with a
flow rate of 0.3 ml per minute. Fractions in 1 ml volume were collected.

93

RESULTS
Novel Phosphorylation Sites in the LZ Domain on IKK β were Identified
by Mass Spectrometry
The yIKK β was purified from yeast cell lysates by immunoprecipitation
or double immunoprecipitation. The eluants were run on SDS-PAGEs
followed by Coomassie blue staining or silver staining to roughly distinguish
the bands that correspond to IKK β (Fig. 4-1). These bands were excised
from the gel and in-gel digested with different proteases in the presence or
absence of 10-15% isopropanol. Digested samples were analyzed by LC-
MS/MS. More than 45,500 spectra were generated from several
preparations of yIKK β and the coverage map is shown in figure 4-2A. Not all
regions of yIKK β generated high quality MS/MS spectra, indicating that the
corresponding peptides did not fragment well. These spectra were searched
against human protein databases by SEQUEST-Sorcerer and other
computer programs such as InsPecT (Tanner et al., 2005).
Analysis of a large number of MS/MS spectra resulted in the
identification of three novel phosphorylation sites, S
471
, S
474
, and S
476
, in the
LZ domain of yIKK β (Fig. 4-2B). The MS/MS spectrum of the peptide
containing these three phosphorylation sites is very reliable because most of
the b ions were presented (Fig. 4-2B). These serines are located in the LZ
domain. The LZ domain is the region where IKK β dimerizes, which is
essential for IKK activity. Therefore it was hypothesized that LZ
phosphorylation may regulate the activity of IKK β.
94

Figure 4-1 Purification of IKK β produced in yeast by
immunoprecipitation.
An 8% SDS-PAGE that resolved eluants from double immunoprecipitation of
yIKK were stained with silver nitrate. Different markers were used for
different purposes. Lane 1: Precision Plus Protein Dual Color Standards
(Bio-Rad, Hercules, CA), which was used to roughly determine molecular
weight of target proteins. Lane 2 to 4: LMW-SDS Marker Kit (Amersham
Biosciences, Buckinghamshire, UK) for determining the size and the amount
of a target protein. The protein amount of the 94 kDa band was 50 ng, 100
ng, and 200 ng from lane 2 to lane 4. The single asterisk indicates the band
representing IKKβ and the double-asterisk indicates the band representing
IKK γ.

95

Figure 4-2 Identification of phosphorylation sites in LZ of IKK β by
mass spectrometry.
(A) Sequence coverage of IKK β protein produced in yeast by mass
spectrometry is shown. The numbers of spectra were plotted against the
sequential number of amino acid residues to show the spectral coverage of
yIKK β. Not all regions and domains of IKK β were sequenced with equal
accuracy. (B) The MS/MS spectrum of one of the many peptides containing
phosphorylated serines 471, 474, and 476 in the LZ region is shown. Most b
ions were detected (7 out of 10).

96

97

Mutating S-to-A in LZ of IKK β Resulted in Reduced IKK Activity
The S
471
, S
474
, and S
476
were mutated to alanines by site-directed
mutagenesis to generate the IKK β LZ3SA. Different amount of pRC- β-actin
HA-IKK β WT and HA-IKK β LZ3SA plasmids were transfected into HEK293
cells and the lysates were immunoprecipitated with anti-HA antibody for
kinase assay. When treated with TNF α, the kinase activity of IKK β WT
increased (Fig. 4-3, compare lane #2 to #1 and #6 to #5). There was no
kinase activity in the control lysate, which did not contain any HA-IKK β(lane
#13 and #14). The basal kinase activity of HA-IKK β LZ3SA is similar
(compare lane #3 to #1) or decreased slightly (compare lane #7 to #5) as
apposed to WT, but TNF α treatment did not activate IKK β LZ3SA as strongly
as WT (compare lane #3~4 to #1~2 and #7~8 to #5~6). When IKK β proteins
were overexpressed in cells, i.e. 500 ng of DNA was transfected to the cells,
kinase activities of IKK β were very similar regardless of cell treatment with
TNF α (compare lane #9~12). This demonstrated that IKK β LZ3SA affected
IKK β activation induced by TNF α but did not affect the basal activity of IKK β.
This was the first experiment with these mutations showing that the S-to-A
mutation of S
471
, S
474
, and S
476
in the LZ of IKK β resulted in reduced basal
level and TNF α-induced kinase activity of IKK. However, we were unable to
reproduce this data after many trials. Therefore we decided to perform the
same experiment in other cell lines.

98

Figure 4-3 In the first experiment, mutating three serines to alanines in
the LZ of IKK β results in reduced basal level and TNF α-induced kinase
activity of IKK.
HEK293 cells were transfected with different amounts of either wild type (WT)
or leucine zipper-mutated (LZ3SA) IKK β plasmid. The top and middle panels
show the results of kinase assay performed with cell lysates after
immunoprecipitation with anti-HA antibody. The top panel shows the
expression of auto-phosphorylated IKK β and the middle one shows
phosphorylated I κB α. The bottom panel shows the result of immunoblot with
anti-HA antibody after cell lysates were immunoprecipitated with anti-HA
antibody.

99

Reduced Enzymatic Activity of IKK β LZ3SA was not Detected in
Different Transfected Mammalian Cells
A different line of HEK293 cells were obtained from Dr. CL Hsieh
(University of Southern California, Los Angeles, CA) and transfected with
pRC- β-actin HA-IKK β WT or HA-IKK β LZ3SA plasmids. After 10 minutes of
TNF α treatment, cells were harvested in lysis buffer and lysates were
immunoprecipitated with anti-HA antibody for kinase assay. In figure 4-4A,
IKK β LZ3SA and WT had similar activities in cells that were transfected with
25 ng or 100 ng of DNA. A slightly reduced IKK β kinase activity was only
detected in cells that were transfected with 50 ng of IKK β LZ3SA DNA, but
this reduction is not as significant as the one in Fig. 4-3. In this cell line,
TNF α did not significantly increase the kinase activity of IKK β as in Fig. 4-3.
In order to find a cell line in which the transfected IKK β activity is
stimulated significantly by TNF α, COS-7, HeLa, MCF7, and MEF IKK β
-/-
cells
were examined. Transfected MEF IKK β
-/-
cells were treated with TNF α for 0,
10, and 30 minutes before harvest in order to see if the length of TNF α
treatment affects its activation of IKK β kinase activity. In figure 4-4B, kinase
activities of IKK β in HeLa and MCF7 cells, but not in COS-7 cells, increased
after TNF α treatment. However, the kinase activity of IKK β LZ3SA was
similar to WT in these cell lines. It was reported that the kinase activity of
IKK β reaches its peak activity between 5 and 15 minutes after TNF α
treatment in HeLa cells (Zandi et al., 1997). However, in MEF IKK β
-/-
cells

100

Figure 4-4 Kinase activity of HA-IKK β LZ3SA is similar to wild type
IKK β in different cell lines.
(A) HEK293 cells were transfected with different amounts of WT or LZ3SA
IKK β and were treated with TNF α for 10 minutes before harvesting. Kinase
activity of IKK β WT and LZ3SA are shown. Both WT and LZ3SA IKK β have
similar kinase activities. (B) COS-7, HeLa, or MCF7 cells were transfected
with 100 ng pRC- β-actin (Ctrl), pRC- β-actin HA-IKK β wild type (WT), or pRC-
β-actin HA-IKK β LZ3SA (LZ3SA) plasmids and treated with TNF α for 10
minutes before harvesting. Kinase activity of WT and LZ3SA IKK β are
shown. (C) MEF IKK β
-/-
cells were transfected with 100 ng of IKK β WT or
LZ3SA plasmids. Cells were treated with TNF α for 10 minutes or 30 minutes
before harvest and IKK β kinase activities were determined. In (B) and (C),
both IKK β WT and LZ3SA have similar kinase activities.

101

the kinase activity is higher at 30 minutes post-TNF α-treatment (Fig 4-4C).
Nevertheless, IKK β LZ3SA and WT had similar kinase activities.

Incorporation of HA-IKK β LZ3SA into Endogenous IKK Complex was
not Affected by the Mutations
Because only IKK β in an IKK complex associated with IKK γ responds
to stimulation, we examined whether HA-IKK β LZ3SA is incorporated into
endogenous IKK complex. Gel filtration analysis was used to separate HA-
IKK β in larger complex from HA-IKK β-only in smaller complex. MCF7 cells
were transfected with HA-IKK β WT or LZ3SA. Cells were treated or not with
TNF α, and 500 μl of each lysates was used for gel filtration. HA-IKK β WT or
LZ3SA were immunoprecipitated from 800 μl each of fractions #7 to #17, and
kinase activity of IKK β was measured. In figure 4-5, fractions #9 to #11
represent the large IKK complexes and fractions #13 to #16 represent free
HA-IKK β subunits (Zandi et al., 1997). Comparably high levels of kinase
activities were present in both large and small complexes for both WT and
LZ3SA. The levels of kinase activities in the small complex (free IKK β) were
higher than the larger IKK complex. Surprisingly, the activity of the large IKK
complexes for both WT and LZ3SA were constitutively high and not
responsive to TNF α. This may be due to the high levels of expression of HA-
IKK β, which can self activate its kinase activity (Schomer-Miller et al., 2006).
The immunoblot using anti HA antibody showed the presence of IKK β LZ3SA
in the large IKK complex to a similar level as the IKK β WT. Thus HA-IKK β
102

Figure 4-5 HA-IKK β LZ3SA is incorporated into endogenous IKK
complex in a similar manner as wild type IKK β.
MCF7 were transfected with HA-IKK β WT or LZ3SA, and cell lysates were
fractionated to isolate IKK complex-containing HA-IKK β and free IKK β.
Fractions #9 to # 11 represent HA-IKK β that was associated with the IKK
complex and fractions #13 to #16 represent free HA-IKK β. Fractions (800 μl)
were immunoprecipitated with anti-HA antibody for kinase assay (KA). The
same PVDF membrane was probed with anti-HA antibody to detect HA-IKK β
(IB).

103

LZ3SA incorporated into the large IKK complex indicates that mutations
introduced in the LZ domain of IKK β did not prevent large complex formation.

Analysis of IKK β LZ3SA in Stable Transfected Cell Pools
IKK can form different complexes, and only the large complex containing
IKK γ subunit is signal-responsive. Integration of transiently transfected IKK β
mutant into the endogenous IKK complex is essential for determining the
signal-induced responsiveness in mammalian cells. Overexpression of wild
type or mutant IKK β in a transient manner as shown above resulted in
constitutively active IKK. The reason for this is due to an over-flow of free
IKK β that is not integrated into the large IKK complex, and it can result in self
activation. Transfecting low amounts of IKK β plasmids into cells in order to
overcome this limitation did not provide informative data. Further to
overcome this limitation, stable pools of two different cells (Cos-7 and MEF
IKK β
-/-
) expressing wild type HA-IKK β or HA-IKK β LZ3SA were generated.
MEF IKK β
-/-
and Cos-7 + HA-IKK β WT or HA-IKK β LZ3SA stable cell pools
were treated with or without TNF α. Cell lysates were immunoprecipitated
with anti-HA antibody and the kinase activities of IKK β were measured by
kinase assay. In both cell types, stable cell pools had very low IKK β kinase
activities before TNF α treatment (Fig. 4-6). After 10 minutes of TNF α
treatment, the activities of both HA-IKK β WT and HA-IKK β LZ3SA were
induced, though the HA-IKK β LZ3SA had decreased kinase activity when
compared with WT. This reduction was mainly due to a decreased
104

Figure 4-6 Comparison of kinase activity of wild type and LZ3SA IKK β
in stable cell pools of MEF IKK β
-/-
or COS-7 cells.
(A) MEF IKK β
-/-
and COS-7 cells were stably transfected with either HA-IKK β
WT or HA-IKK β LZ3SA and the cell pools were tested for IKK β kinase activity.
The same PVDF membrane that was used to test IKK β activity in COS-7
cells were probed with anti-HA antibody (bottom panel).

105

expression of HA-IKK β LZ3SA. We used different selection conditions by
lowering or increasing the G418 and determined that both cell types do not
tolerate high levels of HA-IKK β WT and LZ3SA expression (data not shown).
In this regard, it was evident that cells had lower tolerance for HA-IKK β
LZ3SA expression. This may indicate that there is an unknown function for a
potential phosphorylation of serine residues in the LZ of IKK β.
Taken together, the experiment in stable pool of two cell types showed
that HA-IKK β LZ3SA is activated in a similar manner to the wild type IKK β.

Comparison of the Activities of IKK β WT, LZ3SA, and LZ3SE in Yeast
To comprehensively compare the effect of the serine to alanine
mutations in the LZ domain of IKK β in the absence of endogenous IKK, HA-
IKK β WT and HA-IKK β LZ3SA were expressed in yeast with or without co-
expression of IKK γ. In addition, to mimic the phosphorylation state of the
serines, they were mutated to glutamates. Yeast cells were transformed with
pESC-TRP-met HA-IKK β WT, LZ3SA, or LZ3SE alone or with pESC-LEU-
met HA-IKK γ. Yeast cell lysates were immunoprecipitated with anti-HA
antibody and kinase assay was carried out to test HA-IKK β activities. The
protein expression levels of IKK β WT, LZ3SA, and LZ3SE in yeast varied
significantly (Fig. 4-7). To obtain a semi-quantitative measure for
comparison of the activities, the band densities corresponding to the kinase
activities of each protein was quantified and divided by the band densities of
the corresponding immunoblot data (KA/IB) (Fig. 4-7). The HA-IKK β LZ3SA
106

Figure 4-7 Analysis of the kinase activities of HA-IKK β wild type, HA-
IKK β LZ3SA and HA-IKK β LZ3SE expressed in yeast.
Yeast cells were transformed with different plasmid combinations indicated
on the top of the figure, and HA-IKK β kinase activities were tested after
immunoprecipitation of the lysates with anti-HA antibody. The same PVDF
membrane was probed with anti-HA antibody to detect expression levels of
HA-IKK β and HA-IKK γ. The KA/IB ratio was calculated by dividing the band
density of kinase assay to that of immunoblot. Average KA/IB ratio was
calculated and indicated for every yeast clone.

107

and LZ3SE alone showed reduced KA/IB ratio when compared with HA-IKK β
WT. This may be because mutated LZ domain may affect the dimerization of
IKK β to some degree, which in turn affects the kinase activity. IKK β
dimerization through LZ is essential for kinase activity. When HA-IKK β was
co-expressed with HA-IKK γ, the KA/IB ratios of HA-IKK β WT, LZ3SA, and
LZ3SE were very similar. This may be an indication that IKK stabilizes the
IKK β dimers within an IKK complex.

Antibodies Generated Against Phospho-LZ Peptides were Unable to
Detect IKK β
To further examine whether phosphorylated S
471
, S
474
, or S
476
exists
in IKK, three phosphoantibodies were generated against phospho-peptides
containing phosphorylated S
471
, S
474
, or S
476
. HeLa cells and HA-IKK β WT-
or HA-IKK β LZ3SA-transfected HEK293 cells were treated with 20 ng/ml of
hTNF α or not before harvest, and 100 μg of cell lysates were resolved in
SDS-PAGE. After transfer, the PVDF membrane was blotted with
phosphoantibodies against S
471
(p-471), S
474
(p-474), or S
476
(p-476). These
phosphoantibodies were expected to detect phosphorylated IKK β in HeLa
cells and HA-IKK β WT transfected in HEK293 cells but not in HA-IKK β
LZ3SA transfected in HEK293 cells. However, all three phosphoantibodies
failed to detect protein that was specifically expressed in HA-IKKβ WT-
transfected HEK293 cells but not in HA-IKK β LZ3SA-transfected cells (Fig 4-
8). The PVDF membrane was also blotted with anti-IKK β to show that these
108

Figure 4-8 Phosphoantibodies against S
471
, S
474
,and S
476
are unable to
detect IKK β.
HEK293 cells were transfected with HA-tagged wild type or LZ3SA IKK β
plasmids. These transfected cells, together with untransfected HeLa cells,
were treated with TNF α before harvest. The PVDF membranes were blotted
with anti-p-471, anti-p-474, anti-p-476, or anti-IKK β antibody. Bands
representing IKKβ and HA-IKK β are indicated by arrows. A specific band
that was detected in HeLa cells but not transfected HEK293 cells is labeled
with an asterisk.

109

cells indeed express endogenous IKK β and exdogenous HA-IKK β.
Nevertheless, there was one band (labeled with an asterisk in Fig 4-8) that
was detected in HeLa cells but not in transfected HEK293 cells. The level of
this band was not affected by the treatment of TNF α.
To further investigate the identity of the extra band that exists in HeLa
cells but not in HEK293 cells, HeLa, HEK293, COS-7, HL-60, Colo201,
MCF7, and MEF IKK β
-/-
cell extracts (100 μg) were resolved by SDS-PAGE
and the transferred PVDF membrane was blotted with anti-p-476 antibody.
As shown in figure 4-9A, p-476 detected a single band in HeLa and HL-60
cells, two bands in HEK293, COS-7, and MEF IKK β
-/-
cells, and three bands
in MCF7 and Colo201 cells. The intensities of these bands do not correlate
with the expression level of IKK β.
Neither of the phosphoantibodies was able to detect IKK β in Western
blot experiments. As some antibodies may not detect their specific target in
Western blot but be able to detect the target in native form in solution, we
examined whether p-476 antibody would immunoprecipitate IKK β. Colo201
and HL-60 cells were treated or not with 20 ng/ml of TNF α for 10 minutes
before harvest. Cell lysates were used to immunoprecipitate with anti-p-476
or anti-IKK γ,  and kinase activities of IKK β were measured. As shown in
figure 4-9B, anti-p-476 antibody was unable to pull down IKK β in either
Colo201 or HL-60 cell lysates, and as a result there was no phosphorylated
I κB α detected. In the control experiment, anti-IKK γ pulled down IKK β, which
in turn phosphorylated I κB α, in Colo201 and HL-60 cell lysates. The
110

Figure 4-9 Anti-p-476 antibody does not precipitate IKK activity.
(A) HeLa, HEK293, Cos-7, HL-60, Colo201, MCF7, and MEF IKK β
-/-
cell
lysates showed different patterns when immunoblotted with anti-p-476
antibody. MEF IKK β
-/-
cells lacking IKK β showed a similar pattern of
identified bands to other cell types. (B) Anti-p-476 or anti-IKK γ antibody was
used to immunoprecipitate TNF α-treated or untreated Colo201 and HL-60
cell lysates. Kinase activities of precipitated proteins were tested for their
ability to phosphorylate I κB α. Anti-p-476 antibody did not immunoprecipitate
any IKK kinase activity. Anti-IKK γ antibody precipitated TNF α-induced IKK
activity (KA).

111

phosphorylation of I κB α was stimulated by TNF α treatment. These data
showed that anti-p-471, p-474, and p-476 antibodies failed to detect any
target site on IKK β WT and LZ3SA.

DISCUSSION
The main objective of this study was to use mass spectrometry to fully
sequence recombinant human IKK β produced in yeast. As it has been
shown previously, IKK β produced in yeast has similar activity to the IKK from
HeLa cells (Miller and Zandi, 2001). Large quantities of IKK β were produced
in yeast and were purified by immunoaffinity steps. Having large quantities
of pure IKK β allowed a comprehensive mass spectrometry-based analysis of
the protein. Although almost 80% of IKK β was sequenced, there were still
many peptides that were not fragmented well in mass spectrometer and a
clear sequence determination was not possible (Fig. 4-2). Importantly,
peptides containing the T loop region (residues 177-181), and the serine-rich
C-terminus did not generate high quality MS/MS spectra, and as a result
phosphorylation sites could not be mapped. It is now well known that
peptides containing phospho-serine and/or phospho-threonine are
particularly resistant to collision induced (CID) fragmentation, which is
essential for peptide sequencing in ion trap mass spectrometers.
Furthermore, CID mediated peptide fragmentation is highly dependent on the
sequence of a peptide in general. This limitation is exacerbated when a
peptide contains more than one phospho-serine or phospho-threonine. Only
112

recently new mass spectrometers with novel fragmentation technologies (for
example, electron transfer dissociation (ETD)) are becoming available that
can overcome the fragmentation limitation to some degree.
Despite the limitations associated with CID-mediated fragmentation of
phosphopeptides, we identified three novel phosphorylation sites, S
471
, S
474
,
and S
476
, located in the LZ domain of IKK β by mass spectrometry. The LZ
domain mediates the dimerization of IKK α and/or IKK β, which is required for
IKK kinase activity. The potential role of these novel phosphorylation sites
on regulation of IKK activity was tested. In vitro and in vivo studies in
different mammalian cell lines showed that serine-to-alanine mutation of
these amino acids had no effect on the basal or TNF α-induced IKK β activity.
Human IKK β made in yeast cells, where no endogenous IKK β exists,
showed that serine-to-alanine and serine-to-glutamate mutations had
reduced IKK activities. This demonstrated that mutating three amino acids in
the LZ of IKK β may weaken the LZ dimerization and may affect the stability
of IKK β. This confirmed that LZ in IKK β is important for IKK activity. When
IKK γ was co-expressed with IKK β in yeast system, IKK activities were similar
in WT, LZ3SA, and LZ3SE. This may be because binding of IKK γ through
γBD to IKK β stabilized the dimerization of IKK β and compensated for the
weakened LZ domain in mutated IKK β.
Antibodies raised against phoshpo-LZ peptides did not detect IKK β in
cells (Fig 4-8 and 4-9). Often phosphoantibodies raised against a
corresponding phospho-peptide do not necessarily detect the corresponding
113

phospho-protein. Therefore at this point, the negative results of
phosphoantibodies not detecting IKK β do not preclude the possibility that the
LZ of IKK β is phosphorylated in cells. Further studies are required to
determine the state of phosphorylation of LZ in IKK β.

114

CHAPTER FIVE: CONCLUSIONS

In 1990, the U.S. Department of Energy and the National Institutes of
Health coordinated the Human Genome Project, which determined the
sequence of the three billion nucleotide base pairs of human DNA and
identified all the potential genes (http://genomics.energy.gov/). The detail
mapping of the human genome provided by the Human Genome Project is
an invaluable resource for scientists to study the complex human biology.
DNA provides the blueprint of life, whereas proteins execute most of the
biochemical functions. Primary protein sequences are encoded in DNA.
However, the function of a protein not only depends on the primary amino
acid sequence, which determines its primary structure, but also depends on
the interaction with other proteins or molecules and post-translational
modifications (PTMs) of amino acids. Together, these determine the 3-
dimensional structures of proteins and their functions. Dynamic changes of
PTMs often regulate the state of activity of a protein. In the post-genomic era,
exploring dynamic changes of PTMs and how they regulate protein functions
and activities are essential to examine complex biological systems.
In this dissertation, a mass spectrometry-based proteomic approach
was established to identify novel PTMs on the IKK β subunit in response to
TNF α stimulation. In order to increase the capacity and adaptability of the
chromatography, the liquid transfer tubing of HPLC was replaced by a frit-
fabricated fused silica capillary. An improved and reproducible sol-gel frit
115

fabrication method was developed to generate a simple, inexpensive, and
durable on-column frit. A frit-fabricated fused silica capillary can take the
place of a liquid transfer line anywhere along the path from an LC system to
the mass spectrometer inlet and can be packed with one or more
independent chromatographic phases. Depending on the chromatography
phase of a spray tip column, the PCC can either increase the capacity and
the resolution of the peptide separation or can be used for two or multi-
dimensional chromatographic applications. The utility of a 10 cm of C18 (1-D)
or a 5 cm of SCX PCC (2-D) in combination with a 10 cm C-18 spray tip
column was tested by analyzing a mixture of 48 known proteins, the
Universal Protein Standard, and a complex mixture of unknown proteins, the
conditioned medium of irradiated MEF that supports hES cell self-renewal.
In both cases, 2-D chromatography (5 cm SCX+ 10 cm C-18), when
compared with 1-D chromatography (10 cm C18 PCC+ 10 cm C-18),
resulted in significant increases in the quantity as well as the coverage of the
identified proteins.
With the modified setting of mass spectrometry that improves the
ability of protein identification, PTMs on IKK β were identified. Although the
upstream kinase of IKK β activation is still unclear, phosphorylation of IKK β
regulates the activity of both IKK β and the IKK complex (Schomer-Miller et
al., 2006). By mass spectrometry, three novel phosphorylation sites, S
471
,
S
474
, and S
476
, located in the LZ domain of IKK β were identified. Because
the LZ domain is important for IKK α and/or IKK β dimerization, which is
116

required for IKK kinase activity, the potential role of these novel
phosphorylation sites on the regulation of IKK activity was studied. One
experiment performed in transfected HEK293 cells showed that serine-to-
alanine mutations of these amino acids reduce the activity of IKK β upon
TNF α stimulation. Further in vitro and in vivo studies in different mammalian
cell lines showed that the mutations had no effect on IKK β activity. Both
alanine and glutamate mutations of these serines in the LZ domain of human
IKK β made in yeast cells, where no endogenous IKK β exists, showed
reduced IKK activities, which demonstrated that mutated LZ domain in IKK β
may weaken its dimerization ability and therefore influence the stability and
the activity of IKK β. This confirmed that LZ in IKK β is important for IKK
activity. Further studies are required to determine the function of
phosphorylation of LZ in regulating IKK β.
The role of IKK in cancer drug resistance was also studied in this
dissertation. It was discovered that the cytostatic function of TNF α protects a
small population of colon tumor cells from cytotoxicity of purine and
pyrimidine antimetabolites. Repeated treatment with FdUrd and recovery
resulted in the selection of a TNF α-dependent drug-resistant Colo201 cell
population. The mechanism of TNF α-induced resistance to FdUrd includes
cell cycle arrest at G
0
-G
1
, which explains the resistance of P35-Colo201 cells
to a number of other S phase active antimetabolites. It was also determined
that the IKK pathway, but not the JNK, p38, or ERK pathways, plays an
essential role in transducing the TNF signal eventually to prevent cells to
117

engage in DNA synthesis. The fact that TNF α does not up-regulate D cyclins
in P35-Colo201, but rather down regulates the transcription of E2F1 and
Cdk4 suggests that the molecular mechanisms downstream of IKK/NF- κB
that regulate cell cycle events are changed, most likely at the level of
transcription.
118

BIBLIOGRAPHY

Aggarwal, B. B. (2003). Signalling pathways of the TNF superfamily: a
double-edged sword. Nat Rev Immunol 3, 745-756.

Amit, M., Carpenter, M. K., Inokuma, M. S., Chiu, C. P., Harris, C. P.,
Waknitz, M. A., Itskovitz-Eldor, J., and Thomson, J. A. (2000). Clonally
derived human embryonic stem cell lines maintain pluripotency and
proliferative potential for prolonged periods of culture. Dev Biol 227, 271-278.

Ardizzoia, A., Lissoni, P., Brivio, F., Tisi, E., Perego, M. S., Grassi, M. G.,
Pittalis, S., Crispino, S., Barni, S., and Tancini, G. (1992). Tumor necrosis
factor in solid tumors: increased blood levels in the metastatic disease. J Biol
Regul Homeost Agents 6, 103-107.

Arlt, A., Vorndamm, J., Breitenbroich, M., Folsch, U. R., Kalthoff, H., Schmidt,
W. E., and Schafer, H. (2001). Inhibition of NF-kappaB sensitizes human
pancreatic carcinoma cells to apoptosis induced by etoposide (VP16) or
doxorubicin. Oncogene 20, 859-868.

Baldwin, A. S. (2001). Control of oncogenesis and cancer therapy resistance
by the transcription factor NF-kappaB. J Clin Invest 107, 241-246.

Banerjee, D., Mayer-Kuckuk, P., Capiaux, G., Budak-Alpdogan, T., Gorlick,
R., and Bertino, J. R. (2002). Novel aspects of resistance to drugs targeted to
dihydrofolate reductase and thymidylate synthase. Biochim Biophys Acta
1587, 164-173.

Beck, H. C., Nielsen, E. C., Matthiesen, R., Jensen, L. H., Sehested, M., Finn,
P., Grauslund, M., Hansen, A. M., and Jensen, O. N. (2006). Quantitative
proteomic analysis of post-translational modifications of human histones. Mol
Cell Proteomics 5, 1314-1325.

Bendall, S. C., Stewart, M. H., Menendez, P., George, D., Vijayaragavan, K.,
Werbowetski-Ogilvie, T., Ramos-Mejia, V., Rouleau, A., Yang, J., Bosse, M.,
et al. (2007). IGF and FGF cooperatively establish the regulatory stem cell
niche of pluripotent human cells in vitro. Nature 448, 1015-1021.

Berenson, J. R., Ma, H. M., and Vescio, R. (2001). The role of nuclear factor-
kappaB in the biology and treatment of multiple myeloma. Semin Oncol 28,
626-633.

Beynon, R. J., and Pratt, J. M. (2005). Metabolic labeling of proteins for
proteomics. Mol Cell Proteomics 4, 857-872.

119

Boland, M. P., Foster, S. J., and O'Neill, L. A. (1997). Daunorubicin activates
NFkappaB and induces kappaB-dependent gene expression in HL-60
promyelocytic and Jurkat T lymphoma cells. J Biol Chem 272, 12952-12960.

Bonizzi, G., and Karin, M. (2004). The two NF-kappaB activation pathways
and their role in innate and adaptive immunity. Trends Immunol 25, 280-288.

Borrelli, E., Roux-Lombard, P., Grau, G. E., Girardin, E., Ricou, B., Dayer, J.,
and Suter, P. M. (1996). Plasma concentrations of cytokines, their soluble
receptors, and antioxidant vitamins can predict the development of multiple
organ failure in patients at risk. Crit Care Med 24, 392-397.

Brach, M. A., Kharbanda, S. M., Herrmann, F., and Kufe, D. W. (1992).
Activation of the transcription factor kappa B in human KG-1 myeloid
leukemia cells treated with 1-beta-D-arabinofuranosylcytosine. Mol
Pharmacol 41, 60-63.

Brand, M., Ranish, J. A., Kummer, N. T., Hamilton, J., Igarashi, K.,
Francastel, C., Chi, T. H., Crabtree, G. R., Aebersold, R., and Groudine, M.
(2004). Dynamic changes in transcription factor complexes during erythroid
differentiation revealed by quantitative proteomics. Nat Struct Mol Biol 11,
73-80.

Bui, N. T., Livolsi, A., Peyron, J. F., and Prehn, J. H. (2001). Activation of
nuclear factor kappaB and Bcl-x survival gene expression by nerve growth
factor requires tyrosine phosphorylation of IkappaBalpha. J Cell Biol 152,
753-764.

Burns, K. A., and Martinon, F. (2004). Inflammatory diseases: is ubiquitinated
NEMO at the hub? Curr Biol 14, R1040-1042.

Cao, Y., Bonizzi, G., Seagroves, T. N., Greten, F. R., Johnson, R., Schmidt,
E. V., and Karin, M. (2001). IKKalpha provides an essential link between
RANK signaling and cyclin D1 expression during mammary gland
development. Cell 107, 763-775.

Chen, L. F., Williams, S. A., Mu, Y., Nakano, H., Duerr, J. M., Buckbinder, L.,
and Greene, W. C. (2005). NF-kappaB RelA phosphorylation regulates RelA
acetylation. Mol Cell Biol 25, 7966-7975.

Chen, Z., Hagler, J., Palombella, V. J., Melandri, F., Scherer, D., Ballard, D.,
and Maniatis, T. (1995). Signal-induced site-specific phosphorylation targets I
kappa B alpha to the ubiquitin-proteasome pathway. Genes Dev 9, 1586-
1597.

120

Cheng, K., Sawamura, Y., Sakuma, S., Tada, M., Sudo, M., Aida, T., and
Abe, H. (1994). Antiproliferative effect of tumor necrosis factor-alpha on
human glioblastoma cells linked with cell cycle arrest in G1 phase. Neurol
Med Chir (Tokyo) 34, 274-278.

Chu, E., Johnston, P. G., Grem, J. L., Takimoto, C. H., Van Groeningen, C.,
Chabner, B. A., and Allegra, C. J. (1994). Antimetabolites. Cancer
Chemother Biol Response Modif 15, 1-31.

Chu, Z. L., Shin, Y. A., Yang, J. M., DiDonato, J. A., and Ballard, D. W.
(1999). IKKgamma mediates the interaction of cellular IkappaB kinases with
the tax transforming protein of human T cell leukemia virus type 1. J Biol
Chem 274, 15297-15300.

Claudio, E., Brown, K., Park, S., Wang, H., and Siebenlist, U. (2002). BAFF-
induced NEMO-independent processing of NF-kappa B2 in maturing B cells.
Nat Immunol 3, 958-965.

Coope, H. J., Atkinson, P. G., Huhse, B., Belich, M., Janzen, J., Holman, M.
J., Klaus, G. G., Johnston, L. H., and Ley, S. C. (2002). CD40 regulates the
processing of NF-kappaB2 p100 to p52. Embo J 21, 5375-5385.

Cortes, H. J., Pfeiffer, C. D., Richter, B. E., and Stevens, T. S. (1987).
Porous Ceramic Bed Supports for Fused Silica Packed Capillary Columns
Used in Liquid Chromatography. Journal of High Resolution Chromatography
& Chromatography Communications 10, 446-448.

Cusack, J. C., Jr., Liu, R., and Baldwin, A. S., Jr. (2000). Inducible
chemoresistance to 7-ethyl-10-[4-(1-piperidino)-1-piperidino]-
carbonyloxycamptothe cin (CPT-11) in colorectal cancer cells and a
xenograft model is overcome by inhibition of nuclear factor-kappaB activation.
Cancer Res 60, 2323-2330.

Das, K. C., and White, C. W. (1997). Activation of NF-kappaB by
antineoplastic agents. Role of protein kinase C. J Biol Chem 272, 14914-
14920.

Dejardin, E., Droin, N. M., Delhase, M., Haas, E., Cao, Y., Makris, C., Li, Z.
W., Karin, M., Ware, C. F., and Green, D. R. (2002). The lymphotoxin-beta
receptor induces different patterns of gene expression via two NF-kappaB
pathways. Immunity 17, 525-535.

Delhase, M., Hayakawa, M., Chen, Y., and Karin, M. (1999). Positive and
negative regulation of IkappaB kinase activity through IKKbeta subunit
phosphorylation. Science 284, 309-313.
121

Dempsey, P. W., Doyle, S. E., He, J. Q., and Cheng, G. (2003). The
signaling adaptors and pathways activated by TNF superfamily. Cytokine
Growth Factor Rev 14, 193-209.

Devin, A., Lin, Y., Yamaoka, S., Li, Z., Karin, M., and Liu, Z. (2001). The
alpha and beta subunits of IkappaB kinase (IKK) mediate TRAF2-dependent
IKK recruitment to tumor necrosis factor (TNF) receptor 1 in response to TNF.
Mol Cell Biol 21, 3986-3994.

DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E., and Karin, M.
(1997). A cytokine-responsive IkappaB kinase that activates the transcription
factor NF-kappaB. Nature 388, 548-554.

Du, C., Ramaley, C., McLean, H., Leonard, S. C., and Miller, J. (2005). High-
performance liquid chromatography coupled with tandem mass spectrometry
for the detection of amyloid Beta peptide related with Alzheimer's disease. J
Biomol Tech 16, 356-363.

Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and
Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 411, 494-498.

Epinat, J. C., Whiteside, S. T., Rice, N. R., and Israel, A. (1997).
Reconstitution of the NF-kappa B system in Saccharomyces cerevisiae for
isolation of effectors by phenotype modulation. Yeast 13, 599-612.

Eyles, S. J., Dresch, T., Gierasch, L. M., and Kaltashov, I. A. (1999).
Unfolding dynamics of a beta-sheet protein studied by mass spectrometry. J
Mass Spectrom 34, 1289-1295.

Finco, T. S., Westwick, J. K., Norris, J. L., Beg, A. A., Der, C. J., and Baldwin,
A. S., Jr. (1997). Oncogenic Ha-Ras-induced signaling activates NF-kappaB
transcriptional activity, which is required for cellular transformation. J Biol
Chem 272, 24113-24116.

Furdui, C. M., Lew, E. D., Schlessinger, J., and Anderson, K. S. (2006).
Autophosphorylation of FGFR1 kinase is mediated by a sequential and
precisely ordered reaction. Mol Cell 21, 711-717.

Gatlin, C. L., Kleemann, G. R., Hays, L. G., Link, A. J., and Yates, J. R., 3rd
(1998). Protein identification at the low femtomole level from silver-stained
gels using a new fritless electrospray interface for liquid chromatography-
microspray and nanospray mass spectrometry. Anal Biochem 263, 93-101.

122

Gilmore, T., Gapuzan, M. E., Kalaitzidis, D., and Starczynowski, D. (2002).
Rel/NF-kappa B/I kappa B signal transduction in the generation and
treatment of human cancer. Cancer Lett 181, 1-9.

Gilmore, T. D. (1990). NF-kappa B, KBF1, dorsal, and related matters. Cell
62, 841-843.
Gilmore, T. D. (2006). Introduction to NF-kappaB: players, pathways,
perspectives. Oncogene 25, 6680-6684.

Gottesman, M. M. (2002). Mechanisms of cancer drug resistance. Annu Rev
Med 53, 615-627.

Green, S. K., Frankel, A., and Kerbel, R. S. (1999). Adhesion-dependent
multicellular drug resistance. Anticancer Drug Des 14, 153-168.

Greten, F. R., and Karin, M. (2004). The IKK/NF-kappaB activation pathway-
a target for prevention and treatment of cancer. Cancer Lett 206, 193-199.

Guttridge, D. C., Albanese, C., Reuther, J. Y., Pestell, R. G., and Baldwin, A.
S., Jr. (1999). NF-kappaB controls cell growth and differentiation through
transcriptional regulation of cyclin D1. Mol Cell Biol 19, 5785-5799.

Gygi, S. P., Corthals, G. L., Zhang, Y., Rochon, Y., and Aebersold, R. (2000).
Evaluation of two-dimensional gel electrophoresis-based proteome analysis
technology. Proc Natl Acad Sci U S A 97, 9390-9395.

Hammond, S. M., Caudy, A. A., and Hannon, G. J. (2001). Post-
transcriptional gene silencing by double-stranded RNA. Nat Rev Genet 2,
110-119.

Harhaj, N. S., Sun, S. C., and Harhaj, E. W. (2007). Activation of NF-kappa B
by the human T cell leukemia virus type I Tax oncoprotein is associated with
ubiquitin-dependent relocalization of I kappa B kinase. J Biol Chem 282,
4185-4192.

Harvat, B. L., and Jetten, A. M. (1996). Gamma-interferon induces an
irreversible growth arrest in mid-G1 in mammary epithelial cells which
correlates with a block in hyperphosphorylation of retinoblastoma. Cell
Growth Differ 7, 289-300.

Hatse, S., De Clercq, E., and Balzarini, J. (1999). Role of antimetabolites of
purine and pyrimidine nucleotide metabolism in tumor cell differentiation.
Biochem Pharmacol 58, 539-555.

123

Hayden, M. S., and Ghosh, S. (2004). Signaling to NF-kappaB. Genes Dev
18, 2195-2224.

Hayden, M. S., West, A. P., and Ghosh, S. (2006). NF-kappaB and the
immune response. Oncogene 25, 6758-6780.

Hinz, M., Krappmann, D., Eichten, A., Heder, A., Scheidereit, C., and Strauss,
M. (1999). NF-kappaB function in growth control: regulation of cyclin D1
expression and G0/G1-to-S phase transition. Mol Cell Biol 19, 2690-2698.

Hsu, H., Huang, J., Shu, H. B., Baichwal, V., and Goeddel, D. V. (1996).
TNF-dependent recruitment of the protein kinase RIP to the TNF receptor-1
signaling complex. Immunity 4, 387-396.

Hsu, H., Xiong, J., and Goeddel, D. V. (1995). The TNF receptor 1-
associated protein TRADD signals cell death and NF-kappa B activation. Cell
81, 495-504.

Hu, Y., Baud, V., Delhase, M., Zhang, P., Deerinck, T., Ellisman, M.,
Johnson, R., and Karin, M. (1999). Abnormal morphogenesis but intact IKK
activation in mice lacking the IKKalpha subunit of IkappaB kinase. Science
284, 316-320.

Huang, T. T., Wuerzberger-Davis, S. M., Wu, Z. H., and Miyamoto, S. (2003).
Sequential modification of NEMO/IKKgamma by SUMO-1 and ubiquitin
mediates NF-kappaB activation by genotoxic stress. Cell 115, 565-576.

Imbert, V., Rupec, R. A., Livolsi, A., Pahl, H. L., Traenckner, E. B., Mueller-
Dieckmann, C., Farahifar, D., Rossi, B., Auberger, P., Baeuerle, P. A., and
Peyron, J. F. (1996). Tyrosine phosphorylation of I kappa B-alpha activates
NF-kappa B without proteolytic degradation of I kappa B-alpha. Cell 86, 787-
798.

Imlay, J. A., and Linn, S. (1988). DNA damage and oxygen radical toxicity.
Science 240, 1302-1309.

Jeoung, D. I., Tang, B., and Sonenberg, M. (1995). Effects of tumor necrosis
factor-alpha on antimitogenicity and cell cycle-related proteins in MCF-7 cells.
J Biol Chem 270, 18367-18373.

Jeremias, I., Kupatt, C., Baumann, B., Herr, I., Wirth, T., and Debatin, K. M.
(1998). Inhibition of nuclear factor kappaB activation attenuates apoptosis
resistance in lymphoid cells. Blood 91, 4624-4631.

124

Jin, D. Y., Giordano, V., Kibler, K. V., Nakano, H., and Jeang, K. T. (1999).
Role of adapter function in oncoprotein-mediated activation of NF-kappaB.
Human T-cell leukemia virus type I Tax interacts directly with IkappaB kinase
gamma. J Biol Chem 274, 17402-17405.

Jones, D. R., Broad, R. M., Madrid, L. V., Baldwin, A. S., Jr., and Mayo, M. W.
(2000). Inhibition of NF-kappaB sensitizes non-small cell lung cancer cells to
chemotherapy-induced apoptosis. Ann Thorac Surg 70, 930-936; discussion
936-937.

Karin, M. (1999). How NF-kappaB is activated: the role of the IkappaB kinase
(IKK) complex. Oncogene 18, 6867-6874.

Karin, M., Cao, Y., Greten, F. R., and Li, Z. W. (2002). NF-kappaB in cancer:
from innocent bystander to major culprit. Nat Rev Cancer 2, 301-310.
Karin, M., and Delhase, M. (1998). JNK or IKK, AP-1 or NF-kappaB, which
are the targets for MEK kinase 1 action? Proc Natl Acad Sci U S A 95, 9067-
9069.

Karin, M., Yamamoto, Y., and Wang, Q. M. (2004). The IKK NF-kappa B
system: a treasure trove for drug development. Nat Rev Drug Discov 3, 17-
26.

Kato, T., Jr., Delhase, M., Hoffmann, A., and Karin, M. (2003). CK2 Is a C-
Terminal IkappaB Kinase Responsible for NF-kappaB Activation during the
UV Response. Mol Cell 12, 829-839.

Kinsella, A. R., Smith, D., and Pickard, M. (1997). Resistance to
chemotherapeutic antimetabolites: a function of salvage pathway
involvement and cellular response to DNA damage. Br J Cancer 75, 935-945.

Krappmann, D., and Scheidereit, C. (2005). A pervasive role of ubiquitin
conjugation in activation and termination of IkappaB kinase pathways. EMBO
Rep 6, 321-326.

Le Blanc, J. C., Hager, J. W., Ilisiu, A. M., Hunter, C., Zhong, F., and Chu, I.
(2003). Unique scanning capabilities of a new hybrid linear ion trap mass
spectrometer (Q TRAP) used for high sensitivity proteomics applications.
Proteomics 3, 859-869.

Li, N., and Karin, M. (1998). Ionizing radiation and short wavelength UV
activate NF-kappaB through two distinct mechanisms. Proc Natl Acad Sci U
S A 95, 13012-13017.

125

Li, Q., Van Antwerp, D., Mercurio, F., Lee, K. F., and Verma, I. M. (1999).
Severe liver degeneration in mice lacking the IkappaB kinase 2 gene.
Science 284, 321-325.

Lim, J. W., and Bodnar, A. (2002). Proteome analysis of conditioned medium
from mouse embryonic fibroblast feeder layers which support the growth of
human embryonic stem cells. Proteomics 2, 1187-1203.

Link, A. J., Eng, J., Schieltz, D. M., Carmack, E., Mize, G. J., Morris, D. R.,
Garvik, B. M., and Yates, J. R., 3rd (1999). Direct analysis of protein
complexes using mass spectrometry. Nat Biotechnol 17, 676-682.

Liu, T., Belov, M. E., Jaitly, N., Qian, W. J., and Smith, R. D. (2007). Accurate
Mass Measurements in Proteomics. Chem Rev 107, 3621-3653.

Lowe, S. W., Ruley, H. E., Jacks, T., and Housman, D. E. (1993). p53-
dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74,
957-967.

MacEwan, D. J. (2002). TNF ligands and receptors--a matter of life and
death. Br J Pharmacol 135, 855-875.

Mader, R. M., Muller, M., and Steger, G. G. (1998). Resistance to 5-
fluorouracil. Gen Pharmacol 31, 661-666.

May, M. J., Marienfeld, R. B., and Ghosh, S. (2002). Characterization of the
Ikappa B-kinase NEMO binding domain. J Biol Chem 277, 45992-46000.

Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J.,
Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997). IKK-
1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB
activation. Science 278, 860-866.

Merli, M., Benassi, M. S., Gamberi, G., Ragazzini, P., Sollazzo, M. R.,
Molendini, L., Magagnoli, G., Ferrari, C., Maltarello, M. C., and Picci, P.
(1999). Expression of G1 phase regulators in MG-63 osteosarcoma cell line.
Int J Oncol 14, 1117-1121.

Miller, B. S., and Zandi, E. (2001). Complete reconstitution of human
IkappaB kinase (IKK) complex in yeast. Assessment of its stoichiometry and
the role of IKKgamma on the complex activity in the absence of stimulation. J
Biol Chem 276, 36320-36326.

126

Miwa, M., Kojima, T., and Naruse, T. (2001). Serum factors attenuating the
anti-tumor activity of 5-fluorouracil. Cancer Biother Radiopharm 16, 317-322.

Morinaga, Y., Suzuki, H., Takatsuki, F., Akiyama, Y., Taniyama, T.,
Matsushima, K., and Onozaki, K. (1989). Contribution of IL-6 to the
antiproliferative effect of IL-1 and tumor necrosis factor on tumor cell lines. J
Immunol 143, 3538-3542.

Mosialos, G. (1997). The role of Rel/NF-kappa B proteins in viral
oncogenesis and the regulation of viral transcription. Semin Cancer Biol 8,
121-129.

Mukhopadhyay, A., Manna, S. K., and Aggarwal, B. B. (2000). Pervanadate-
induced nuclear factor-kappaB activation requires tyrosine phosphorylation
and degradation of IkappaBalpha. Comparison with tumor necrosis factor-
alpha. J Biol Chem 275, 8549-8555.

Muller, H., Bracken, A. P., Vernell, R., Moroni, M. C., Christians, F., Grassilli,
E., Prosperini, E., Vigo, E., Oliner, J. D., and Helin, K. (2001). E2Fs regulate
the expression of genes involved in differentiation, development, proliferation,
and apoptosis. Genes Dev 15, 267-285.

Muller, H., and Helin, K. (2000). The E2F transcription factors: key regulators
of cell proliferation. Biochim Biophys Acta 1470, M1-12.
Muthukkumar, S., Sells, S. F., Crist, S. A., and Rangnekar, V. M. (1996).
Interleukin-1 induces growth arrest by hypophosphorylation of the
retinoblastoma susceptibility gene product RB. J Biol Chem 271, 5733-5740.

Nalca, A., and Rangnekar, V. M. (1998). The G1-phase growth-arresting
action of interleukin-1 is independent of p53 and p21/WAF1 function. J Biol
Chem 273, 30517-30523.

Negus, R. P., and Balkwill, F. R. (1996). Cytokines in tumour growth,
migration and metastasis. World J Urol 14, 157-165.

Pahl, H. L. (1999). Activators and target genes of Rel/NF-kappaB
transcription factors. Oncogene 18, 6853-6866.

Perkins, N. D., Felzien, L. K., Betts, J. C., Leung, K., Beach, D. H., and Nabel,
G. J. (1997). Regulation of NF-kappaB by cyclin-dependent kinases
associated with the p300 coactivator. Science 275, 523-527.

Pinedo, H. M. (1996). Drug resistance, illustration of the complexity of
translational research. Steiner Award lecture 1995. Int J Cancer 65, 561-566.
127

Pinedo, H. M., and Giaccone, G. (1997). Chemotherapy. Lancet 349 Suppl 2,
SII7-9.

Piraino, S. M., and Dorsey, J. G. (2003). Comparison of frits used in the
preparation of packed capillaries for capillary electrochromatography. Anal
Chem 75, 4292-4296.

Pluen, A., Boucher, Y., Ramanujan, S., McKee, T. D., Gohongi, T., di
Tomaso, E., Brown, E. B., Izumi, Y., Campbell, R. B., Berk, D. A., and Jain,
R. K. (2001). Role of tumor-host interactions in interstitial diffusion of
macromolecules: cranial vs. subcutaneous tumors. Proc Natl Acad Sci U S A
98, 4628-4633.

Prewitt, T. W., Matthews, W., Chaudhri, G., Pogrebniak, H. W., and Pass, H.
I. (1994). Tumor necrosis factor induces doxorubicin resistance to lung
cancer cells in vitro. J Thorac Cardiovasc Surg 107, 43-49.

Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., and Bongso, A.
(2000). Embryonic stem cell lines from human blastocysts: somatic
differentiation in vitro. Nat Biotechnol 18, 399-404.

Reuther, J. Y., Reuther, G. W., Cortez, D., Pendergast, A. M., and Baldwin, A.
S., Jr. (1998). A requirement for NF-kappaB activation in Bcr-Abl-mediated
transformation. Genes Dev 12, 968-981.

Romieu-Mourez, R., Landesman-Bollag, E., Seldin, D. C., and Sonenshein,
G. E. (2002). Protein kinase CK2 promotes aberrant activation of nuclear
factor-kappaB, transformed phenotype, and survival of breast cancer cells.
Cancer Res 62, 6770-6778.

Rothwarf, D. M., and Karin, M. (1999). The NF-kappa B activation pathway: a
paradigm in information transfer from membrane to nucleus. Sci STKE 1999,
RE1.

Satterwhite, D. J., and Moses, H. L. (1994). Mechanisms of transforming
growth factor-beta 1-induced cell cycle arrest. Invasion Metastasis 14, 309-
318.

Scheidereit, C. (2006). IkappaB kinase complexes: gateways to NF-kappaB
activation and transcription. Oncogene 25, 6685-6705.

128

Schmid, M., Bäuml, F., Köhne, A. P., and Welsch, T. (1999). Preparation of
On-Column Frits in Packed Fused Silica Capillaries by Sol-Gel Technology.
Journal of High Resolution Chromatography 22, 438 - 442.

Schomer-Miller, B., Higashimoto, T., Lee, Y. K., and Zandi, E. (2006).
Regulation of IkappaB kinase (IKK) complex by IKKgamma-dependent
phosphorylation of the T-loop and C terminus of IKKbeta. J Biol Chem 281,
15268-15276.

Schoonbroodt, S., Ferreira, V., Best-Belpomme, M., Boelaert, J. R., Legrand-
Poels, S., Korner, M., and Piette, J. (2000). Crucial role of the amino-terminal
tyrosine residue 42 and the carboxyl-terminal PEST domain of I kappa B
alpha in NF-kappa B activation by an oxidative stress. J Immunol 164, 4292-
4300.

Shamblott, M. J., Axelman, J., Wang, S., Bugg, E. M., Littlefield, J. W.,
Donovan, P. J., Blumenthal, P. D., Huggins, G. R., and Gearhart, J. D.
(1998). Derivation of pluripotent stem cells from cultured human primordial
germ cells. Proc Natl Acad Sci U S A 95, 13726-13731.

Sherr, C. J. (2000). Cell cycle control and cancer. Harvey Lect 96, 73-92.
Siebenlist, U., Franzoso, G., and Brown, K. (1994). Structure, regulation and
function of NF-kappa B. Annu Rev Cell Biol 10, 405-455.

Skeel, R. T. (2003). Handbook of cancer chemotherapy, 6th edn
(Philadelphia: Lippincott Williams & Wilkins).

Sobott, F., Benesch, J. L., Vierling, E., and Robinson, C. V. (2002). Subunit
exchange of multimeric protein complexes. Real-time monitoring of subunit
exchange between small heat shock proteins by using electrospray mass
spectrometry. J Biol Chem 277, 38921-38929.

Spears, C. P. (1995). Clinical resistance to antimetabolites. Hematol Oncol
Clin North Am 9, 397-413.

Sreenivasan, Y., Sarkar, A., and Manna, S. K. (2003). Mechanism of
cytosine arabinoside-mediated apoptosis: role of Rel A (p65)
dephosphorylation. Oncogene 22, 4356-4369.

Synold, T. W., Dussault, I., and Forman, B. M. (2001). The orphan nuclear
receptor SXR coordinately regulates drug metabolism and efflux. Nat Med 7,
584-590.

129

Tada, K., Okazaki, T., Sakon, S., Kobarai, T., Kurosawa, K., Yamaoka, S.,
Hashimoto, H., Mak, T. W., Yagita, H., Okumura, K., et al. (2001). Critical
roles of TRAF2 and TRAF5 in tumor necrosis factor-induced NF-kappa B
activation and protection from cell death. J Biol Chem 276, 36530-36534.

Takao, J., Yudate, T., Das, A., Shikano, S., Bonkobara, M., Ariizumi, K., and
Cruz, P. D. (2003). Expression of NF-kappaB in epidermis and the
relationship between NF-kappaB activation and inhibition of keratinocyte
growth. Br J Dermatol 148, 680-688.

Takeda, K., Takeuchi, O., Tsujimura, T., Itami, S., Adachi, O., Kawai, T.,
Sanjo, H., Yoshikawa, K., Terada, N., and Akira, S. (1999). Limb and skin
abnormalities in mice lacking IKKalpha. Science 284, 313-316.

Takeyama, H., Wakamiya, N., O'Hara, C., Arthur, K., Niloff, J., Kufe, D.,
Sakarai, K., and Spriggs, D. (1991). Tumor necrosis factor expression by
human ovarian carcinoma in vivo. Cancer Res 51, 4476-4480.

Tanner, S., Shu, H., Frank, A., Wang, L. C., Zandi, E., Mumby, M., Pevzner,
P. A., and Bafna, V. (2005). InsPecT: identification of posttranslationally
modified peptides from tandem mass spectra. Anal Chem 77, 4626-4639.

Tetsu, O., and McCormick, F. (2003). Proliferation of cancer cells despite
CDK2 inhibition. Cancer Cell 3, 233-245.

Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel,
J. J., Marshall, V. S., and Jones, J. M. (1998). Embryonic stem cell lines
derived from human blastocysts. Science 282, 1145-1147.

Ting, A. T., Pimentel-Muinos, F. X., and Seed, B. (1996). RIP mediates tumor
necrosis factor receptor 1 activation of NF-kappaB but not Fas/APO-1-
initiated apoptosis. Embo J 15, 6189-6196.

Tisdale, M. J. (1999). Wasting in cancer. J Nutr 129, 243S-246S.

van den Heuvel, R. H., Tahallah, N., Kamerbeek, N. M., Fraaije, M. W., van
Berkel, W. J., Janssen, D. B., and Heck, A. J. (2005). Coenzyme binding
during catalysis is beneficial for the stability of 4-hydroxyacetophenone
monooxygenase. J Biol Chem 280, 32115-32121.

Wang, C., Deng, L., Hong, M., Akkaraju, G. R., Inoue, J., and Chen, Z. J.
(2001). TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412,
346-351.

130

Wang, C. Y., Cusack, J. C., Jr., Liu, R., and Baldwin, A. S., Jr. (1999).
Control of inducible chemoresistance: enhanced anti-tumor therapy through
increased apoptosis by inhibition of NF-kappaB. Nat Med 5, 412-417.

Washburn, M. P., Wolters, D., and Yates, J. R., 3rd (2001). Large-scale
analysis of the yeast proteome by multidimensional protein identification
technology. Nat Biotechnol 19, 242-247.

Wolff, B., and Naumann, M. (1999). INK4 cell cycle inhibitors direct
transcriptional inactivation of NF-kappaB. Oncogene 18, 2663-2666.

Yamamoto, M., Maehara, Y., Oda, S., Ichiyoshi, Y., Kusumoto, T., and
Sugimachi, K. (1999). The p53 tumor suppressor gene in anticancer agent-
induced apoptosis and chemosensitivity of human gastrointestinal cancer cell
lines. Cancer Chemother Pharmacol 43, 43-49.

Zandi, E., Chen, Y., and Karin, M. (1998). Direct phosphorylation of IkappaB
by IKKalpha and IKKbeta: discrimination between free and NF-kappaB-
bound substrate. Science 281, 1360-1363.

Zandi, E., and Karin, M. (1999). Bridging the gap: composition, regulation,
and physiological function of the IkappaB kinase complex. Mol Cell Biol 19,
4547-4551.

Zandi, E., Rothwarf, D. M., Delhase, M., Hayakawa, M., and Karin, M. (1997).
The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha
and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB
activation. Cell 91, 243-252.

Zhang, Y., Wolf-Yadlin, A., Ross, P. L., Pappin, D. J., Rush, J.,
Lauffenburger, D. A., and White, F. M. (2005). Time-resolved mass
spectrometry of tyrosine phosphorylation sites in the epidermal growth factor
receptor signaling network reveals dynamic modules. Mol Cell Proteomics 4,
1240-1250.

131

Abstract (if available)

Abstract IKKbeta is the key kinase in the TNFalpha-NF-kB pathway that phosphorylates IkBalpha and targets it for polyubiquitination and degradation. As a result, NF-kB is released and moves into the nucleus, where it binds to the promoters of target genes and activates transcription that increases cell proliferation or prevents apoptosis. In the chapter two of this dissertation, a novel role for the TNFalpha-IKK-NF-kB signaling pathway in anti-cancer drug resistance is described. Contrary to its physiological function, TNFalpha induced G0-G1 cell cycle arrest through IKK in cancer cells, which provided a mechanism for developing drug resistance to the purine and pyrimidine antimetabolites. A specific IKKbeta inhibitor prevented TNFalpha-induced drug resistance. Thus IKK inhibitors can enhance the effectiveness of antimetabolites in chemotherapy.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Discovery of novel small molecules for ovarian cancer treatment

Asset Metadata

Creator Wang, Ling-Chi (author)

Core Title Mass spectrometry-based proteomic analysis of inhibitor of kappa b kinase beta and its role in cytokine-induced drug resistance in cancer

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Molecular Microbiology

Publication Date 11/14/2009

Defense Date 10/25/2007

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag cancer drug resistance,frit fabrication,IKK,mass spectrometry,OAI-PMH Harvest,proteomics,tumor neurosis factor

Language English

Advisor Zandi, Ebrahim (committee chair), Chen, Jeannie (committee member), Lieber, Michael R. (committee member)

Creator Email lingchiw@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m924

Unique identifier UC1230428

Identifier etd-Wang-20071114 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-590663 (legacy record id),usctheses-m924 (legacy record id)

Legacy Identifier etd-Wang-20071114.pdf

Dmrecord 590663

Document Type Dissertation

Rights Wang, Ling-Chi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu