Bimodal effects of bone morphogenetic proteins in prostate cancer

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
BIMODAL EFFECTS OF BONE MORPHOGENETIC PROTEINS
IN PROSTATE CANCER

by
Linda Kim Pham

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

May 2011

Copyright 2011 Linda Kim Pham
ii
ACKNOWLEDGEMENTS
I would like to take this time to thank everyone who made this possible. In
particular I would express my gratitude to my mentor, Dr. Pradip Roy-Burman,
for all the patience and guidance he has shown. I would especially like to thank
Dr. Stanley Tahara, for guiding me every step of the way. Additionally, I also
appreciate all of the advice Dr. Cheng-Ming Chuong and Dr. James Ou had
given during their service on my committee. I would like to acknowledge all of
my collaborators as well as the past and current members of the Roy-Burman
laboratory with whom I have had the great pleasure of working with. I also owe
all of my friends and family a debt of gratitude for their love and support. Last
but certainly not least, I would like to thank Jesus Christ for all the grace he has
shown.
iii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS......................................................................................... iii
LIST OF TABLES.........................................................................................................v
LIST OF FIGURES ..................................................................................................... vi
ABSTRACT............................................................................................................... viii
CHAPTER 1: Introduction ...........................................................................................1
1.1 Prostate Cancer and the Tumor Microenvironment ............................1
1.2 Bone Morphogenetic Proteins and Prostate Cancer ............................3
1.3 Hypothesis and Rationale....................................................................8
CHAPTER 2: BMP7 Protects Prostate Cancer Cells from Stress-Induced
Apoptosis via both Smad and JNK Pathways ................................................10
2.1 Abstract .............................................................................................10
2.2 Introduction .......................................................................................11
2.3 Material and Methods........................................................................12
2.4 Results ...............................................................................................15
2.5 Discussion .........................................................................................30
CHAPTER 3: A Novel Bone Morphogenetic Protein Signaling in Heterotypic
Cell Interactions in Prostate Cancer ...............................................................33
3.1 Abstract .............................................................................................33
3.2 Introduction .......................................................................................34
3.3 Materials and Methods ......................................................................36
3.4 Results ...............................................................................................41
3.5 Discussion .........................................................................................58
CHAPTER 4: Regulation of Bone Morphogenetic Activity in the Cancer
Cells or Cancer Microenvironment ................................................................62
iv
4.1 Abstract .............................................................................................62
4.2 Introduction .......................................................................................63
4.3 Material and Methods........................................................................65
4.4 Results ...............................................................................................71
4.5 Discussion .........................................................................................94
CHAPTER 5: Conclusion...........................................................................................99
5.1 Discussion .........................................................................................99
5.2 Suggestions for Future Work ..........................................................102
REFERENCES ..........................................................................................................105
v
LIST OF TABLES
Table 1. List of Semiquantitative and real-time PCR primer. ....................................40
Table 2. List of real-time PCR primers.......................................................................68

vi
LIST OF FIGURES
Figure 1. BMP7 did not affect survivin phosphorylation level or G2/M phase
in C4-2B cells.................................................................................................16
Figure 2. BMP7 up-regulates survivin transcription after serum starvation in
C4-2B cells..................................................................................................17
Figure 3. BMP7 up-regulates survivin promoter activity after serum starvation
in a Smad-dependent manner. .....................................................................20
Figure 4. BMP7 has no significant regulatory effect on survivin promoter
activity in LNCaP cells after serum starvation............................................21
Figure 5. Increased survivin expression and Smad and JNK activation in the
prostate tumor tissues. .................................................................................21
Figure 6. BMP7 up-regulates JNK activity after serum starvation in C4-2B
cells..............................................................................................................23
Figure 7. JNK activity is important for survival in C4-2B cells.................................24
Figure 8. Inhibition of JNK activity has no significant effect on survivin
promoter activity or survivin protein expression in C4-2B cells. ...............25
Figure 9. Neither BMP7 or serum starvation affects JNK activity in LNCaP
cells..............................................................................................................26
Figure 10. Stable endogenous over-expression of BMP7 also protects C4-2B
cells against serum starvation-induced apoptosis........................................28
Figure 11. Stable endogenous over-expression of BMP7 protects C4-2B cells
through similar mechanisms as exogenous BMP7......................................29
Figure 12. Detection of BMP2/4 expression in mouse prostate adenocarcinoma
by Western blot analysis and semiquantitative RT-PCR. ...........................42
Figure 13. Characterization of the CAF cells. ............................................................44
Figure 14. BMP2 and BMP7 stimulate SDF-1 secretion and induce Smad
phosphorylation in CAF-1 and CAF-2 cells................................................46
vii
Figure 15. BMP2 and BMP7 stimulate SDF-1 α secretion and Smad
phosphorylation in the fibroblasts isolated from the normal prostate
tissue............................................................................................................49
Figure 16. BMP2 transcriptionally up-regulates SDF-1 in CAF. ...............................51
Figure 17. BMP2 and BMP7 up-regulate SDF-1 RNA expression in the
fibroblasts isolated from the normal prostate tissue....................................53
Figure 18. Matrigel-based capillary-like tube formation assay using HMVEC. ........55
Figure 19. Assessment of the apoptotic percentage in CAF cells with BMP2 or
SDF-1 treatment after serum starvation. .....................................................57
Figure 20. Schematic of vector carrying murine Noggin constructed for
lentivirus production....................................................................................67
Figure 21. cE1 over expresses Noggin which suppresses basal level of Smad
signaling. .....................................................................................................72
Figure 22. qPCR profile for BMP, BMPRs in cE1/Control and cE1/Noggin
lines. ............................................................................................................74
Figure 23. Proliferation and migration of cE1/Control versus cE1/Noggin. ..............75
Figure 24. Histological analyses of tumors induced by the cE1/Control or
cE1/Noggin cell lines in male NOD.SCID mice.........................................78
Figure 25. Overexpression of Noggin in tumor cells does not affect tumor
stroma. .........................................................................................................81
Figure 26. Noggin expression in CAF cultures. .........................................................83
Figure 27. Characteristics of new murine prostatic epithelial cell line, E8. ...............86
Figure 28. Analyses of tumors induced by the E8 cells in male NOD.SCID
mice. ............................................................................................................89
Figure 29. Overexpression of Noggin in CAF cells promotes anaplastic growth
of tumor cells...............................................................................................91
Figure 30. Effect of Noggin overexpression in fibroblasts of the tumor stroma. .......93
viii
ABSTRACT
This dissertation describes observations made on the effect of bone morphogenetic
protein (BMP) signaling in an aggressive human prostate cancer cell line, C4-2B, two
murine prostate cancer cell lines, E8 and cE1, derived from the primary site of androgen
dependent and recurrent tumors of prostate cancer, respectively, and primary cultures of
murine cancer associated fibroblasts (CAFs). We previously described that BMP7 could
protect C4-2B cells from serum starvation induced apoptosis by sustaining Survivin
expression. We further examine the mechanisms behind BMP7 mediated protection from
stress induced apoptosis. When C4-2B cells are treated with BMP7, we find that
Survivin promoter activity correlates with Smad activation and is ameliorated by
dominant negative Smad5. Furthermore JNK activity is also observed to be sustained by
BMP7 treatment in the face of serum starvation and co-treatment with a JNK inhibitor
abolished the anti-apoptotic effect of BMP7 in a survivin independent manner. Thus we
found that anti-apoptotic activity of BMP7 is mediated by both Smad and JNK, albeit
with autonomous mechanisms. Using primary cultures of CAFs, isolated from our
conditional Pten deletion model of prostate cancer, we tested the effect of BMP2 and 7,
both of which are upregulated during tumor growth. Interestingly, each BMP is able to
induce secretion of the cytokine, SDF-1/CXCL12. SDF-1 secretion is correlated with
Smad phosphorylation and can be blocked by Noggin treatment. BMP treatment
increases pre-spliced SDF-1 mRNA and actinomycin D can block the induced secretion
of SDF-1 by BMPs, indicating a transcriptional modulation of SDF-1 expression by
BMP. Using human microvascular endothelial cells, we demonstrate that increased SDF-
ix
1 levels can stimulate tube formation in vitro, implicating a role in tumor angiogenesis.
We also find that BMP can protect CAFs from stress induced apoptosis independent of
SDF-1. Thus, the study identifies a novel BMP-SDF-1 signaling axis as well as a
protective effect of BMP in CAFs. Finally, we examined the effect of BMP inhibitor,
Noggin, on the biology of murine prostate cancer cell lines. In vitro data show that
Noggin overexpression in cE1 cells decreases cell proliferation while enhancing cell
migration. In contrast the in vivo data show that Noggin overexpression increases the
mass of the grafts and Ki67 staining shows increased proliferation. We also transduced
CAF cells with Noggin and formed subcutaneous grafts in combination with cE1 or E8
cells. When E8 cells were co-injected with CAF/Noggin, larger tumors lacking glandular
structures were produced. In the case of cE1 cells mixed with CAF/Noggin however,
tumors grew mostly resembling those with CAF/Control with evidence of decreased
CD31 staining. Disparate results seen with cE1/Noggin grafts and cE1 grafts mixed with
CAF/Noggin implicate a modulation of Noggin activity by the tumor microenvironment.
Similarly, the effect of Noggin released from the CAFs appears to influence the cancer
cells differentially based on their differentiation status/origin. The majority of the in vivo
data support a role of BMP as tumor suppressor in primary prostate cancer progression.
However, BMP is shown to have pro-tumorigenic effects on metastatic cell lines as well
as via activation of fibroblasts in the tumor microenvironment on certain hallmarks of
cancer progression, such as angiogenesis. The positive and negative effects of BMP thus
may be linked to stage-specific aspects of cancer progression, and when better
understood, may provide new opportunities to combat prostate cancer.
1
CHAPTER 1
Introduction
1.1 Prostate Cancer and the Tumor Microenvironment
It has long been recognized that prostate adenocarcinoma is a major age-related cancer of
Western society. It is typically characterized as a slow progressing tumor and it is
believed to develop in an orderly fashion from prostate intraepithelial neoplastic lesions
(Ding et al. 2011) into adenocarcinoma. Since prostate cancer is a gradual process, many
PIN lesions may form and never progress to become an advanced tumor. For this reason
many clinicians take a “watchful waiting” approach with patients diagnosed with benign
hyperplasia or prostate cancer. However, if the tumor begins to spread beyond the
prostate, the approach to treatment becomes more aggressive and will then involve
hormone therapy. Hormone therapy, which involves either medical or surgical castration,
involves the depletion of androgens in the tumor which results in the regression of
androgen dependent tumor growth. Unfortunately, in a majority of these cases,
reoccurrence will happen resulting in the growth of castration resistant prostate cancer
(CRPC), which turns to terminal disease.
Hormone therapy is an example of how manipulation of the tumor microenvironment can
drastically affect tumor progression. Besides hormones, growth factors, and cytokines,
tumor stroma also consists of a heterogeneous population of cells including endothelial
cells, immune cells, smooth muscle cells, and most abundantly fibroblast cells (Tuxhorn
et al. 2001). The tumor cells as well as all stromal cells are connected by the
extracellular matrix (ECM), a network of fibrous proteins and adhesive glycoproteins. In
2
the normal prostate, this mesh of cells, proteins, and hormones function together to
maintain tissue homeostasis including growth and differentiation (Hayward et al. 1996).
Once transformation of the prostate epithelial cells occur, it is believed that the altered
cells can either recruit or induce adjacent fibroblast cells to become ‘activated’ which
may in turn start the conversion of a normal microenvironment into a tumor associated
one (Xouri et al. 2010).
In the tumor stroma, these ‘activated’ fibroblasts resembles and behaves much like those
seen in wound healing, thus giving tumors the moniker ‘the wound that never heals
(Dvorak 1986).’ Similar to fibroblasts in wound healing, cancer associated fibroblasts
(CAFs) appear to have phenotypically switched into a myofibroblastic state.
Myofibroblasts are characterized by high Vimentin and α-Smooth Muscle Actin
expression (Schmitt-Graff et al. 1994; Ronnov-Jessen et al. 1996). They display a higher
rate of proliferation, increased ECM production, as well as increased secretion of MMPs
and other proteases which modulate ECM turnover(Angeli et al. 2009). In addition to the
presence of myofibroblasts, tumor stroma has increased angiogenesis as well as greater
immune cell infiltration than seen in the normal microenvironment.
In many different types of cancer including prostate, the tumor microenvironment has
been shown to contribute to both the development of the primary tumor and metastasis.
In Paget’s widely supported ‘seed and soil’ hypothesis (Paget 1989; Mendoza et al.
2009), the site of metastasis is dependent on the microenvironment of the distant organ.
Prostate cancer has shown a clear propensity for bone metastasis, occurring in 65-75% of
3
advanced cases. Once bone metastasis has occurred, 90% of patients will succumb to the
accompanying skeletal complications including extreme bone pain, impaired mobility,
hypercalcemia, and spinal cord compression (Coleman 1997; Bubendorf et al. 2000). It
should be noted that in contrast to a number of other cancers that exhibit propensity for
osteoclastic, or bone resorption, bone metastasis, prostate tumor bone metastasis tends to
form osteoblastic, or bone-forming, lesions. Thus it is of great interest what factors in the
bone microenvironment leads to tumor colonization as well as contribute to the
osteoblastic nature of prostate bone metastasis.
1.2 Bone Morphogenetic Proteins and Prostate Cancer
Bone morphogenetic proteins (BMPs) were first isolated from adult bone matrix and
named after their ability to induce bone remodeling (Reddi 1997). Subsequently, they
were shown to be imperative in development and skeletal formation (Dudley et al. 1995;
Chen et al. 1999). Deregulated expression or signaling of BMPs have been implicated in
a number of diseases include those of the bone, kidney, and a variety of cancers. Due to
its high expression in bone as well as its ability to promote bone formation, there have
been a number of studies attempting to correlate the expression of BMP or its receptors to
prostate cancer.
BMPs are a member of the TGF β superfamily comprising of almost a third of the entire
family (Ducy et al. 2000). Like other members of the TGF β family, BMP signaling is
initiated by the complexing of a type I and type II transmembrane serine/threonine
receptor with the BMP protein. Activation of signaling pathways downstream of receptor
4
signaling falls into two categories: Smad-dependent and Smad-independent pathways.
In Smad-dependent signaling, phosphorylation of the serine/threonine sites on the type I
receptor leads to recruitment and phosphorylation of R-Smads (Smad 1, 5, and 8).
Phospho-Smad 1, 5, and 8 are able to dimerize with Co-Smad (Smad 4) and this complex
is able to translocate to the nucleus. Once in the nucleus, the Smad complex is able to
interact with a number of other co-activators/repressors and bind DNA via MH1 domains
to regulate transcription of a variety of genes (Nohe et al. 2004). Not much is known
about Smad independent pathways although it is established that TGF β Activated Kinase
1 (TAK1) activation by association with BMPRIA initiates these pathways(Bragdon et al.
2011). TAK1 association is mediated by TAK1 Binding Protein (TAB1) which has been
shown to be recruited to the receptor by X-link Inhibitor of Apoptosis (XIAP) or BRAM1
(Bone morphogenetic protein Receptor Associated Molecule 1). Downstream pathways
of TAK1 include NFκB, JNK, and p38. Through other unclear mechanisms, BMP is also
able in induce ERK and Ras signaling (Nohe et al. 2004).
BMP signaling is tightly regulated by a number of intracellular and extracellular factors.
Inhibitory Smads (I-Smad) 6 and 7 are among the most well known intracellular factors
known to downregulate TGF β and BMP signaling. It has been shown that their
mechanism includes binding to type I receptors and interfering with phosphorylation of
R-Smads and binding to Smad responsive DNA elements in the nucleus thereby
preventing the R-Smad/Co-Smad complex from activation gene transcription (Goto et al.
2007; Zhang et al. 2007). It has also been shown that Smad 6 can form a complex with
SMAD 1 thwarting its binding to Smad 4 (Miyazono et al. 2010). Another point of
5
regulation occurs with the expression and phosphorylation level of the R-Smads in which
the former is controlled by ubiquitination and subsequent degradation and the latter is
regulated by a number of different phosphatases including PP1/PP2A, Pyruvate
Dehydrogenase Phosphatase, and Small C-terminal Domain Phosphatases (Miyazono et
al. 2010).
Extracellularly, a number of antagonists exist to bind BMP in the microenvironment and
prevent its association with its receptors. During development it is these inhibitors that
tightly regulate BMP action and disrupting BMP antagonist function have been shown to
cause skeletal disorders in mouse models and are implicated in a number of fibrotic
diseases and cancer (Walsh et al. 2010). Over 15 antagonists are known to bind specific
subsets of BMPs with different affinities and some also bind to other TGF β superfamily
members. Some of these antagonists can also act as agonists directly enhancing BMP
activity (e.g. CV2 (Serpe et al. 2008)) or by mutually antagonizing their inhibitory
activities (e.g. TSG and Chordin (Oelgeschlager et al. 2000; Winkler et al. 2004)). There
has been in vitro evidence that expression of some of these antagonists is BMP dependent
suggesting a feedback mechanism modulating BMP action (Gazzerro et al. 1998;
Haudenschild et al. 2004; Ye, Lewis-Russell, Kynaston et al. 2007). Thus, the
bioavailability of BMP for signaling is dependent on the type and concentration of BMPs
and BMP antagonists in the environment as well as their relative binding affinities for
each other.
6
Early research showed that BMP 1-5 were expressed in both malignant and benign
human prostate tissue, while BMP6 expression appeared to be specific to more
progressed and metastatic tumors (Bentley et al. 1992; Barnes et al. 1995; Hamdy et al.
1997; Yuen et al. 2008). Later studies found that BMP7 expression was elevated in bone
metastatic lesions although its expression in organ-confined adenocarcinoma was lower
than that found in normal prostate tissue (Masuda et al. 2003; Masuda et al. 2004;
Bobinac et al. 2005; Spanjol et al. 2010). Studies concerning BMP2/4 expression showed
that expression is either lower or unchanged when comparing localized tumor to normal
prostate, although like BMP7 they are highly expressed in bone metastatic lesions
(Horvath et al. 2004; Bobinac et al. 2005; Spanjol et al. 2010). Interestingly, there was
one study which shows that malignant prostate tissue exhibits a loss of three BMP
receptors (BMPRIA, BMPRIB, and BMPRII) when compared to normal tissue(Kim et al.
2000), a similar pattern to BMP7 and BMP2/4 expression. These studies indicate a
correlation between BMP expression and metastasis, although it is unclear whether BMP
is associated with primary adenocarcinoma.
Besides its role in development and bone homeostasis, BMP has been shown to also
mediate cell proliferation, apoptosis, migration, and differentiation (Chen et al. 1999;
Reddi 2005) —important functions needed for tumor progression which seem to support
a role for BMP in prostate tumorigenesis. How BMP may regulate these functions does
appear to be very context dependent and cell type specific. For example, it was found
that BMP2 inhibited the growth of the androgen-dependent prostate cancer cell line,
LNCaP (Ide et al. 1997; Tomari et al. 2005) but in castration resistant PC-3 cells, some
7
findings reported BMP2 stimulated migration, invasion, as well as proliferation (Feeley
et al. 2006; Kwon et al. 2010). Still, others reported opposing data in the same PC-3 cell
line (Benelli et al. 2010). BMP4 was also able to stimulate migration and invasion in PC-
3(Feeley et al. 2006) but not in LNCaP or C4-2B cell lines (Graham et al. 2010). Several
reports agree that BMP4 inhibited growth of a number of cell lines, although with less
effect in castration resistant lines (Shaw et al. 2010; Wahdan-Alaswad et al. 2010).
BMP6 was reported to inhibit growth in DU145 cells (Haudenschild et al. 2004) however
another report stated it had no effect on proliferation and instead enhanced migration and
invasion in PC-3 and DU145 cells (Darby et al. 2008). BMP7 was found to have an anti-
proliferative effect on LNCaP, PC-3, and DU145 (Miyazaki et al. 2004; Shaw et al. 2010)
but not on C4-2B cells (Morrissey et al. 2010). However Feeley et al. found that BMP7
had no effect on the proliferation, migration, and invasion of PC-3 cells (Feeley et al.
2006). In contrast to the findings of Feeley et al., Ye et al. found that loss of endogenous
BMP7 increased migration and invasion in PC-3 (Ye, Lewis-Russell, Kynaston et al.
2007). Somewhat related to this finding, Buijs et al. found that BMP7 actually helped
maintain the epithelial phenotype of PC-3M cells (Buijs et al. 2007), while our lab has
shown that BMP7 induced an epithelial-mesenchymal transition (EMT)-like transition in
PC-3 cells (Yang et al. 2005). Notably, it was found that conditioned media of BMP7
treated LNCaP and C4-2B lead to increased osteoblast activity (Dai et al. 2004) in
osteoblasts. There is evidence that BMP9 and 10 may act as a tumor suppressor by
inducing apoptosis in PC-3 cells as well as slowing migration and invasion (Ye et al.
2008; Ye et al. 2009). GDF 9 was able to promote cell growth by inhibiting Caspase 3
8
mediated apoptosis of PC-3 and DU145 cells and, only in the case of PC-3, increase
invasiveness, likely via an EMT-like process (Bokobza et al. 2011). In conclusion, the
effects of the BMP family are varied and highly dependent on context. In some cases
reports from the literature appear to be conflicting reflecting an uncertainty in the field
about how BMP may influence prostate cancer progression.
1.3 Hypothesis and Rationale
The role of BMPs in prostate cancer has been a question of interest for some time now,
particularly the role of BMPs in bone metastasis. Since the survival rate for a patient
diagnosed with prostate cancer is much lower after metastasis and prostate tumor cells
have a clear propensity for bone metastasis, there has been great interest in studying the
interactions between tumor cells and the bone microenvironment. It is often asked what
factors in the microenvironment and in the tumor cause the bias for bone metastasis. It is
believed that bone morphogenetic proteins may, in part, answer the question in two
possible ways: 1) BMPs in the bone microenvironment may promote cancer cell
colonization and survival and 2) BMPs expressed by the tumor cells may contribute to
tumor progression, metastasis, as well as promote osteomimetic properties in the cell
allowing them to thrive in the bone microenvironment.
Currently the effect of BMP on tumor cells is not clearly understood. To this end, our lab
has been conducting experiments on the effect of BMPs on tumor cells. Using our Pten
null prostate tumor mouse model, we observe that BMP7 and BMP2/4 are consistently
upregulated in the tumor bearing mice (Yang et al. 2005; Yang et al. 2008). To
9
determine the relevance of this observation to human prostate cancer, we find that several
BMPs and their receptors, both type I and type II, were over expressed in a number of
different human prostate non-neoplastic cell lines, cancer cell lines, and stromal cell
lines. When treating the cell lines with BMP7, we observe that effects were cell line
specific with BMP7 opposing proliferation in BPH-1 cells, but having more pro-
tumorigenic effects in the cancer cell lines (e.g. stimulates an EMT-like process in PC-3
cells and protects C4-2B and LNCaP from apoptosis) (Yang et al. 2005). The objective
of this dissertation was to expand on observations made previously as well as to extend
the study of BMPs onto the prostate tumor microenvironment. Our overall hypothesis is
that BMPs serve a regulatory role in prostate cancer in general, and that this role is
exerted by a combination of BMP effects on the tumor cells and on the tumor
microenvironment via heterotypic cell-cell interactions.
10
CHAPTER 2
BMP7 Protects Prostate Cancer Cells from Stress-Induced
Apoptosis via both Smad and JNK Pathways
The following chapter was originally published in Cancer Research (Yang et al. 2006).
The paper describes our efforts to further study the molecular mechanisms of how BMP7
is able to protect LNCaP and C4-2B cells from serum starvation-induced apoptosis.
Using both exogenous treatment as well as endogenous overexpression of BMP7, we
show that BMP7 upregulates Survivin in a Smad dependent manner in C4-2B cells but
not LNCaP cells. We also show that the JNK pathway is important in the anti-apoptotic
effect of BMP7 on C4-2B cells and that the protection conferred by the JNK pathway is
not related to the induction of Survivin expression.
2.1 Abstract
We reported earlier that exposure to exogenous BMP7 could strongly inhibit serum
starvation-induced apoptosis to C4-2B cell line, a variant of the LNCaP human prostate
cancer cell line with propensity for bone metastasis. While serum starvation suppressed
the expression of survivin, a member of the inhibitor of apoptosis (IAP) protein family,
its expression was sustained in the presence of BMP7. In this study, we present evidence
that BMP7 exposure up-regulated survivin promoter activity, an effect that was
associated with activation of Smad, and could be repressed by dominant negative Smad5.
Additionally, serum starvation-induced suppression of JNK activity in C4-2B cells could
be mostly restored by BMP7, and a JNK inhibitor could counteract the anti-apoptotic
effect of BMP7, without a significant effect on the level of survivin expression. Thus, we
11
identified JNK pathway as another signaling mode for the anti-apoptotic function of
BMP7. To test the effect of endogenous up-regulation of BMP7, we genetically
modulated the C4-2B cell line to over-express BMP7 protein. Not only was this altered
cell line resistant to serum starvation-induced apoptosis, but it also exhibited patterns of
Smad activation, survivin up-regulation, and JNK activation similar to those of the
parental C4-2B cells exposed to exogenous BMP7. Consistent with these in vitro
findings of BMP7 action, we acquired correlative results of Smad activation, survivin
expression, and JNK activation in the progression of prostate cancer in the conditional
Pten deletion mouse model, in which we first obtained the evidence of BMP7 over-
expression.
2.2 Introduction
Previously, we reported that BMP7, a member of the bone morphogenetic protein family,
was strikingly up-regulated (Yang et al. 2005) during the development of primary
prostatic adenocarcinoma in the conditional Pten deletion mouse model (Trotman et al.
2003; Wang et al. 2003), which, for brevity, could be referred to as cPten
-/-
model
(Khodavirdi et al. 2006). We also described that exposure to BMP7 could inhibit stress-
induced apoptosis in the human prostate cancer cell line, LNCaP and more significantly,
in its variant C4-2B, and identified survivin, a member of the Inhibitor of Apoptosis
(IAP) family of proteins, as one of the targets that contribute to the protection of C4-2B
by BMP7. Thus, we became interested in dissecting the signaling pathways induced by
BMP7 that promoted survival to C4-2B cells. Although the canonical pathway induced
12
by BMPs involves Smad signaling, there are reports that BMPs can also activate MAPK,
including ERK, JNK and p38, and in many circumstances, both Smad and MAPK
pathways are activated by BMPs simultaneously (Derynck et al. 2003; Nohe et al. 2004).
After the demonstration that BMP7 could induce strong Smad activation in C4-2B cells,
we specifically wished to examine whether Smad-dependent or Smad-independent or
both signaling pathways were involved in the pro-survival effect of BMP7.
2.3 Material and Methods
Cell Lines and BMP7 Protein
C4-2B and LNCaP cells were cultured as previously described in (Yang et al. 2005).
Human recombinant BMP7 protein (BMP7), a gift from Dr. T.K. Sampath of Creative
Biomolecules, Hopkinton, MA, was used at a concentration of 50 ng/ml in all
experiments for the analysis of signaling from BMP7 exposure.
Semi-quantitative RT-PCR
The primers and PCR conditions for the measurement of survivin transcripts were the
same as described (Kishi et al. 2004). By varying PCR from 18 to 40 cycles in
increments of 3 cycles, 32 cycles were determined to be optimal for survivin
quantification, and 21 cycles for GAPDH as internal control.
13
Cell Cycle Assay and Apoptosis Analysis (Terminal Deoxynucleotidyl Transferase-
Mediated dUTP Nick End Labeling)
These analyses were carried out as described before (Yang et al. 2005). After staining
with propidium iodide/RNase solution (Phoenix Flow Systems, Inc., San Diego, CA),
cells were analyzed by a flow cytometer for cell cycle distributions. Cellular apoptosis
was assayed using APO-BRDU kit (Phoenix Flow Systems, Inc., San Diego, CA).
Transient Transfection and Luciferase/ -Galactosidase Expression Assays
Cells were transiently transfected by Tfx-20 Reagent (Promega, Madison, WI) following
the instructions of the manufacturer. Briefly, cells were seeded in a 6-well plate with 5 
10
5
cells per well. Before transfection, cells were serum starved for 24 hours in 0.1%
serum medium with or without BMP7 treatment. One g of pLuc1430 and 0.5 g of
pSV- -Galactosidase control vector (Promega) were co-transfected in each well. The
Myc- tagged dnSmad5 construct was used as described before (Kendall et al. 2005).
After transfection, cells were kept in 0.1% serum medium with or without BMP7. For
the control groups, cells were always incubated in 10% serum medium. Two days after
transfection, cells were lysed in 1  lysis buffer (Promega) and used for either luciferase
assay or -galactosidase assay as described (Li and Altieri 1999). The luciferase activity
under the various conditions tested was normalized to the value of -galactosidase
activity.
14
Western Blot Analysis
The whole cell lysates, conditioned media and tissue lysates were prepared as described
earlier (Yang et al. 2005). The antibodies used in the Western blots were anti-BMP7
(R&D Systems, Minneapolis, MN), anti-Smad1, anti-Smad5, anti-phospho-Smad1,5,8,
anti-ERK, anti-phospho-ERK, anti-JNK, anti-phospho-JNK, anti-p38, anti-phospho-p38,
anti-Myc-Tag (Cell Signaling Technology, Beverly, MA), anti-phospho-survivin (Thr34)
and anti-actin (Santa Cruz Biotechnology, Santa Cruz, CA).
Construction of Recombinant Lentivirus, Infection and Sorting of Infected C4-2B
Cells
Human BMP7 cDNA was PCR amplified with XbaI and RsrII linkers and inserted into
the polycloning site of the transducing lentivirus vector pSIN-GFP. Lentiviruses were
produced by the three-plasmid system as described (Song et al. 2000; Zhong et al. 2003).
Briefly, human 293T cells in T75 flasks at about 80% confluency were transfected with
7.5 g of the VSV env-coding plasmid, pMD.G; 15 g of the packaging plasmid,
pCMV 8.91; and 15 g of either the control vector pSIN-GFP or the transgene vector
pSIN-BMP7. The pseudo-typed lentivirions were collected 48-72 hours later. The C4-2B
cells at 80% confluency in 6-well plates were incubated with 1 ml of the conditioned
medium containing lentiviruses in the presence of 5 g/ml polybrene for 6 hours, washed
with PBS twice, and grown in complete medium. The procedure was repeated several
times until approximately 5% of the cells had shown green fluorescence under the
microscope. Cells were then sorted by flow cytometry on the basis of GFP fluorescence.
15
Statistical Analysis
All experiments were performed in triplicates and repeated at least twice. Statistical
comparisons were made using an unpaired, two-tailed t-test.
2.4 Results
BMP7 Up-regulates Survivin Transcription after Serum Starvation Without
Affecting Survivin Phosphorylation Level or G2/M Phase in C4-2B Cells
Previously we showed that BMP7 was able to rescue the survivin protein expression that
was suppressed by serum starvation. We proposed two possibilities for this effect,
namely, transcriptional regulation and post-translational regulation (phosphorylation at
Thr34) by BMP7 signaling (Yang et al. 2005). Since survivin expression is cell cycle
regulated, it is also possible that, by affecting the cell cycle, BMP7 might influence
survivin levels. To test the possibility of post-translational regulation by BMP7, we used
Western blot analyses to examine the level of phospho-survivin (Thr34) in C4-2B cells,
with or without BMP7 treatment after serum starvation, at different time points. The
pattern of phospho-survivin turned out to be very similar to what we found previously for
total level of survivin (Fig. 1A), and the ratio between phospho-survivin and total level of
survivin was not significantly changed by either serum starvation or BMP7 treatment
(Fig. 1B). These results suggested that BMP7 did not affect the phosphorylation of
survivin in C4-2B cells. We then tested the possibility of transcriptional regulation by
BMP7 by using semi-quantitative RT-PCR to determine the survivin mRNA level in C4-
2B cells. While serum starvation suppressed survivin mRNA expression, BMP7
16
significantly up-regulated the mRNA level (Fig. 2A). We also examined whether cell
cycle in C4-2B was affected by BMP7 treatment. Serum starvation suppressed G2/M cell
Figure 1. BMP7 did not affect survivin phosphorylation level or G2/M phase in C4-
2B cells.
A

B

A, Western blot analysis for phospho-survivin level in C4-2B cells cultured in 10% serum
medium (normal condition), or 0.1% serum medium (serum starvation) with (+) or
without (-) BMP7 at the indicated different time points. B, Determination of the ratio of
2B cells. The data for total survivin expression in the same extracts were from our
previous report (Yang et al. 2005).
17
Figure 2. BMP7 up-regulates survivin transcription after serum starvation in C4-
2B cells.
A

B

A, Semi-quantitative RT-PCR was used to compare the mRNA level of survivin in C4-2B
cells cultured in 10% serum medium and 0.1% serum medium with (+) or without (-)
BMP7 at different time points. B, Cell cycle assay was done to determine the % of C4-
C4-2B cells at G2/M before and after 2 or 4 days of serum starvation in the presence (+)
or absence (-) of BMP7.
percentage from 40% to 15%, but there was no significant difference between BMP7
treated and non-treated C4-2B cells (Fig. 2B).
18
BMP7 Up-regulates Survivin Promoter Activity after Serum Starvation in a Smad-
dependent Manner
Following the finding that BMP7 could up-regulate survivin mRNA expression in C4-2B
cells after serum starvation, we investigated this transcriptional regulation further. A
luciferase reporter construct pLuc1430, which contained 1430-bp DNA sequence
upstream of survivin gene was shown to exhibit the maximal survivin promoter activity
(Li and Altieri 1999). By transient transfection of pLuc1430 into C4-2B cells, we found
that serum starvation suppressed survivin promoter activity to about 47% of the normal
level, which could be fully rescued by BMP7 (Fig. 3A). Since we demonstrated that
BMP7 induced strong Smad activation in C4-2B cells, it was important to determine
whether the effect of BMP7 on up-regulation of survivin promoter activity was through
Smad signaling. To this end, we attempted to interrupt Smad activation by co-
transfecting pLuc1430 with a dnSmad5 construct. Indeed, the up-regulation of survivin
promoter activity by BMP7 could be counteracted by the dnSmad5 in a dose-dependent
manner (Fig. 3A). A control vector, TK-Luc, which is not responsive to BMP7 signaling,
was used as a marker for normalizing transfection efficiency (Fig. 3B). In LNCaP cells,
consistent with what we found previously that BMP7 could not rescue survivin
expression suppressed by serum starvation, there was no significant difference of survivin
promoter activity between BMP7 treated and control LNCaP cells (Fig. 4).
19
Both Survivin Expression and Smad Activation Increase with the Growth of
Prostate Tumors
After observing that in C4-2B cells BMP7 could up-regulate survivin expression through
Smad signaling, we went back to the cPten
-/-
mouse prostate tumor model to evaluate the
levels of survivin expression and Smad activation in the course of the disease. As shown
by Western blot analyses, the growth of primary prostate tumors in the anterior prostate
lobe of the cPten
-/-
mice was associated with progressively increased expression of
survivin as well as the level of phospho-Smad1,5,8 over an age range of 1.6 to 11 months
(Fig. 5A). From an 11-month-old cPten
-/-
mouse and its littermate control, we extracted
proteins from different prostate lobes, including anterior lobe (AP), ventral lobe (VP) and
dorsolateral lobe (DLP). The Western blot analysis showed that in tumors of all lobes
there was over-expression of survivin and increased Smad activation compared to the
corresponding tissues from the littermate control (Fig. 5B). Interestingly, Smad5
expression level in AP was also increased in the tumor tissues at the advanced age of 11
months.
20
Figure 3. BMP7 up-regulates survivin promoter activity after serum starvation in a
Smad-dependent manner.
A

B

C

Luciferase reporter activity measured in C4-2B cells 48 hours after transfection with
various vectors. A, Cells were transfected with the survivin promoter reporter construct
pLuc1430 (1.0 g/well) alone or co-transfected with 0.5 g or 1.0 g/well of dominant
negative (dn) Smad5 construct. *, There was significant difference between serum-
starved cells with or without BMP7 (P<0.01). **, dnSmad5 significantly suppressed the
promoter activity in BMP7 treated cells after serum starvation (P<0.01). B, Cells were
transfected with a control vector (1.0 g/well) to determine transfection efficiency. A and
B, all values were normalized by -galactosidase activity and in each experiment, the
value for cells cultured in 10% serum medium was adjusted to 100 as control. C,
Detection of expression of dnSmad5 protein by western blot in the transfected cells using
Myc-Tag polyclonal antibody.
21
Figure 4. BMP7 has no significant regulatory effect on survivin promoter activity in
LNCaP cells after serum starvation.

Luciferase assay was done to examine the promoter activity in LNCaP cells 48 hours
after transfection with the survivin promoter reporter construct pLuc1430 before serum
starvation (10% serum) and after 24 hours of serum starvation (0.1% serum) with or
without BMP7.
Figure 5. Increased survivin expression and Smad and JNK activation in the
prostate tumor tissues.
A

22
Figure 5: continued
B

Western blot assays for survivin, activated Smad, and activated JNK in the prostate
tissues from the cPten
-/-
mice relative to the littermate control tissues. A, Proteins from
AP of the animals at different ages as indicated in months (M). B, Proteins from
individual lobes, AP, VP and DLP, from an 11-month-old pair. In both A and B: c,
littermate control, homozygous for the floxed Pten allele; p
-/-
, Cre-mediated homozygous
deletion of the floxed Pten allele. Western blot analyses of Smad5 and JNK were used as
control for Smad and JNK activity, respectively, and actin was used as loading control.
BMP7 also Activates JNK Pathway, Independent of Smad/Survivin Pathway, to
Promote Cell Survival
We examined the influence of serum starvation and BMP7 treatment on the activities of
three major MAPKs, namely JNK, ERK and p38 by Western blot analyses. Although the
patterns of ERK and p38 activities between the control and BMP7 treated cells were not
significantly affected, we found that JNK activity was suppressed by serum starvation,
while BMP7 strongly up-regulated its activity (Fig. 6). By using JNK specific inhibitor
SP600125 to block JNK activation (Fig. 7A), we found that the anti-apoptotic effect of
23
BMP7 was counteracted by JNK inhibitor in a dose-dependent manner (Fig. 7B). As
serum starvation of C4-2B cells resulted in 96% apoptosis and to only 21% in the
presence of BMP7, 51% or 79% of apoptosis was induced when 10 M or 20 M
SP600125 was present, respectively, along with BMP7. To test whether the JNK
pathway could also regulate survivin expression, we first compared the survivin promoter
activity in C4-2B cells treated with BMP7 in presence or absence of 20 M SP600125.
As shown in Fig. 8A, JNK inhibitor could not suppress the survivin promoter activity.
We then examined the survivin protein expression by Western blot analyses, and found
that 20 M SP600125 could not suppress the survivin protein level, that was sustained by
BMP7 treatment after serum starvation (Fig. 8B and C). These results indicated that JNK
pathway was involved in apoptosis regulation but not survivin regulation. Recalling
Figure 6. BMP7 up-regulates JNK activity after serum starvation in C4-2B cells.

Western blots for the activities of JNK, ERK and p38 in C4-2B cells, cultured in 10%
serum medium or in 0.1% serum medium with (+) or without (-) BMP7 treatment for the
indicated time periods.
24
Figure 7. JNK activity is important for survival in C4-2B cells.
A

B

A, A JNK-specific inhibitor SP600125 (20 M) along with or without BMP7 was used to
treat C4-2B cells after serum starvation, and the JNK activity was determined by Western
blots. B, Determination of the percentage of apoptotic cells in serum starved (6 days) C4-
2B cells, grown without BMP7, with BMP7 alone or with BMP7 and two different doses
of SP600125. *, There was significant increases in apoptosis when serum starved cells
were treated with BMP7 in the presence of SP600125 (P<0.001).
25
Figure 8. Inhibition of JNK activity has no significant effect on survivin promoter
activity or survivin protein expression in C4-2B cells.
A

B

C

A, Luciferase assay was done to determine the survivin promoter activity in BMP7
treated cells with or without JNK specific inhibitor SP600125 (20 M) under serum
starvation. B, Western blots were done to examine survivin expression in cells cultured
in 10% serum medium and 0.1% serum medium treated with BMP7 alone or co-treated
with BMP7 and 20 M SP600126 at different time points as indicated. C, Estimation of
changes in survivin protein levels at the various conditions as in B.
26
Figure 9. Neither BMP7 or serum starvation affects JNK activity in LNCaP cells.
A

B

A, Western blot analysis indicating that serum starvation could not suppress the JNK
activity in LNCaP cells, and that there was no difference of JNK activity between cells
treated with or without BMP7. B, The effect of JNK inhibitor SP600125 on apoptosis in
LNCaP cells. While serum starvation alone led to 35% apoptosis, addition of SP600125
caused a further increase in apoptosis (48%), thus implying involvement of JNK
activation as a contributory factor in survival of the LNCaP cells. Although BMP7 could
suppress apoptosis induced by serum starvation (15% vs. 35%), addition of SP600125
with BMP7 did not lead to significant increase in apoptosis (20% vs. 15%), indicating
that JNK inhibitor did not counteract the pro-survival activity of BMP7 in LNCaP cells.
that LNCaP cells were not very sensitive to serum starvation (only 35% of apoptosis was
induced by serum starvation), we found that there was no suppression of JNK activity by
serum starvation in LNCaP cells, and BMP7 did not exhibit a significant effect on JNK
27
activation (Fig. 9A). Although JNK inhibitor SP600125 (20 M) could induce more
apoptosis after serum starvation, it did not counteract the anti-apoptotic effect of BMP7
in LNCaP cells, as the extent of the apoptosis inhibition by BMP7 with or without
SP600125 was very similar (Fig. 9B).
In the analysis of prostate tissues from the cPten
-/-
mice, we found that like BMP7,
activated Smad and survivin, there was an increase in the level of activated JNK with the
growth of the tumors (Fig. 5A and B). Besides p-JNK, the level of JNK also appeared to
increase in the tumor tissues, especially in those collected at the advanced age of 11
months.
Endogenous Over-expression of BMP7 Protects C4-2B Cells from Stress-induced
Apoptosis through Similar Mechanisms as Exogenous BMP7
We created a C4-2B cell line over-expressing BMP7 (C4-2B/BMP7) and also a control
GFP expressing C4-2B cell line (C4-2B/GFP) by lentivirus mediated gene transduction.
The over-expression of BMP7 protein was confirmed by Western blot analysis with the
conditioned medium. There was more than six fold increase in secreted BMP7 protein in
C4-2B/BMP7 cells compared to C4-2B parental cells or C4-2B/GFP control cells (Fig.
10A). By testing the response of C4-2B/BMP7 and C4-2B/GFP cells to serum starvation,
we found that, similar to the observations with the C4-2B parental cells that were treated
with exogenous BMP7 protein, C4-2B/BMP7 exhibited much more resistance to serum
starvation-induced apoptosis. As shown in Fig. 10B, 6 days of serum starvation induced
68% apoptosis in C4-2B/GFP cells, but only 18% in C4-2B/BMP7 cells. We then
28
compared the JNK, Smad activities and survivin expression in these two cell lines after 6
days of serum starvation by Western blots. In C4-2B/GFP cells, serum starvation
suppressed JNK activity, while in C4-2B/BMP7 a robust JNK activity was maintained
(Fig. 11A). Although there was no detectable Smad phosphorylation in C4-2B/GFP cells
cultured both in 10% or 0.1% serum medium, there was strong Smad activation in C4-
2B/BMP7 cultured in 10% serum medium, and less but still significant Smad activation
in C4-2B/BMP7 after 6 days of serum starvation. Finally, we examined the expression
level of survivin protein in these two cell lines. In C4-2B/GFP cells, serum starvation
suppressed the survivin expression to only 20% of the normal level. In contrast, there
was still 51% of survivin expression in C4-2B/BMP7 after serum starvation (Fig. 11B).
Figure 10. Stable endogenous over-expression of BMP7 also protects C4-2B cells
against serum starvation-induced apoptosis.
A B

A, Determination of secreted BMP7 protein level by Western blots of conditioned
medium from C4-2B parental cells, C4-2B/GFP cells and C4-2B/BMP7 cells (upper
panel). Coomassie blue staining was used to assess loading in each lane (lower panel).
B, The percentage of apoptotic cells in C4-2B/GFP cells compared to C4-2B/BMP7 cells
after 6 days of serum starvation (P<0.001).
29
Figure 11. Stable endogenous over-expression of BMP7 protects C4-2B cells
through similar mechanisms as exogenous BMP7.
A

B

A, Western blot analyses of the JNK and Smad activities and survivin expression in C4-
2B/GFP or C4-2B/BMP7 cells before and after 6 days of serum starvation. B, Estimation
of survivin protein levels in A. *, The difference in survivin expression between C4-
2B/GFP and C4-2B/BMP7 cells after serum starvation was significant (P<0.01).
30
2.5 Discussion
The fact that survivin is over-expressed in almost all human cancers has drawn much
attention to cancer research (Li 2003). There is a large body of studies showing the
association between survivin expression and prostate carcinoma, and the anti-apoptotic
role of survivin in prostate cancer cells (Pennati et al. 2004; Shariat et al. 2004; Zhang et
al. 2005). Because the protein stability of survivin could be increased by the
phosphorylation at Thr34, it is possible that BMP7 signaling leads to post-translational
regulation of survivin by increasing its phosphorylation level. Since survivin expression
is cell cycle dependent and mostly expressed in G2/M phase, another possibility would be
that BMP7 might cause a shift to G2/M phase, thereby promoting survivin expression
indirectly. However, these possibilities are now ruled out in C4-2B cells, as BMP7 has
no major effect on either the phosphorylation of survivin or on the cell cycle. On the
other hand, it is clearly shown that BMP7 can induce transcriptional up-regulation of
survivin through promoter activation in these cells grown under serum starvation. Since
dominant negative Smad5 is able to counteract the up-regulation of survivin promoter
activity by BMP7 in a dose-dependent manner, we conclude that this effect is Smad-
dependent. Unlike the C4-2B cells, in LNCaP cells BMP7 cannot rescue the survivin
promoter activity that is suppressed by serum starvation, a point consistent with what we
found previously that BMP7 did not sustain the survivin protein level after serum
starvation in these cells.
31
The findings that BMP7/Smad signaling is able to up-regulate survivin expression in C4-
2B cells led us to go back to the cPten
-/-
tumor model in which we first observed the
over-expression of BMP7. Conceivably, increased BMP7 availability should result in
increased Smad activation, and possibly, increasing Smad activation could result in
progressively more survivin expression. In this regard, both elevated Smad activity and
over-expression of survivin is now documented in the model. This provides the first
evidence to suggest that BMP/Smad pathway is most likely to be one of the pathways
that up-regulate survivin expression in the prostate tumorigenesis in vivo.
Another point of interest, BMP7 not only activates Smad pathway, but also JNK
pathway. While most studies show that JNK expression or activation is increased in
neoplastic cells, the role of JNK in apoptosis is context-dependent, as in different types of
cells or even under different conditions in the same type of cells, JNK can be either pro-
death or pro-life (Maroni et al. 2004; Wada et al. 2004). In our study, serum starvation
suppresses JNK activity while BMP7 rescues it, thus JNK activity must be important for
cell survival because JNK inhibitor could counteract the pro-survival effect of BMP7.
These results indicate that BMP7 also utilizes the JNK pathway to protect C4-2B cells
from apoptosis. Through a BMP7 over-expressing cell line C4-2B/BMP7, we showed
that endogenous BMP7 can also protect C4-2B cells against stress-induced apoptosis via
both Smad/survivin and JNK pathways similar to what we found when C4-2B cells were
treated with exogenous BMP7. In LNCaP cells, JNK activity was not suppressed by
serum starvation, which partially explains why LNCaP cells are less sensitive to serum-
32
starvation induced apoptosis. Consistent with increased BMP7 expression in the tumors
of cPten
-/-
mice, however, a correlation exists between JNK activity and tumor growth.
In summary, for the first time we demonstrated the relationship between BMP/Smad
signaling and survivin expression in the prostate cancer cell line C4-2B. We also
identified JNK activation as another pathway that contributes to the pro-survival effect of
BMP7. These results also correlate well with the BMP7 up-regulation, Smad activation,
survivin over-expression, and JNK activation that we observed in tumor progression in
the prostate tumor mouse model examined. Further work is necessary to understand the
mechanisms by which Smad signaling regulate survivin promoter activity, and what other
major pro-survival molecules may be regulated by Smad or JNK signaling in prostate
cancer cells that is induced by BMP7. It would also be important now to define the role
of BMP/Smad or BMP/JNK signaling in prostate cancer progression and metastasis, and
to test the potential of these pathways as therapeutic targets for prostate cancer.
33
CHAPTER 3
A Novel Bone Morphogenetic Protein Signaling in Heterotypic
Cell Interactions in Prostate Cancer
In this chapter, also published in Cancer Research (Yang et al. 2008), we extended the
scope of our study to include the effect of BMP on fibroblast cells. The most striking
effect of exogenous BMP treatment of fibroblast cells, derived from tumors harvested
from Pten null mice, was the enhanced secretion of SDF-1. We go on to show that the
increase in SDF-1 present in conditioned media from BMP-treated cells has similar
effects on endothelial cells as exogenous SDF-1 treatment does. We also show that,
similar to the subject of the previous chapter, BMP-2 is able to protect cancer associated
fibroblasts (CAFs) from stress induced apoptosis.
3.1 Abstract
We examined the effect of the extracellular bone morphogenetic protein (BMP) 2 and 7,
which are up-regulated in the prostate adenocarcinomas of the conditional Pten deletion
mouse model, on primary cultures of cancer-associated fibroblasts (CAF) derived from
these tumors. In the CAF, we show that BMP2 or BMP7, but not transforming growth
factor β-1, can strikingly stimulate secretion of stromal cell–derived factor-1 (SDF-1),
also known as CXCL12. The CAF cells express type I and type II BMP receptors as well
as the receptor for SDF-1, CXCR4. SDF-1 activation is associated with BMP-induced
Smad phosphorylation, and the stimulatory effect is blocked by BMP antagonist, Noggin.
The findings that BMP treatment can increase SDF-1 pre-mRNA levels in a time-
dependent manner and actinomycin D treatment can abolish stimulatory effect of BMP
34
suggest a transcriptional modulation of SDF-1 by BMP signaling. Using a human
microvascular endothelial cell line, we show that SDF-1 present in the conditioned
medium from the stimulated CAF can significantly induce tube formation, an effect
relating to angiogenic function. Furthermore, we found that BMP2 can also protect the
CAF from serum starvation–induced apoptosis independent of SDF-1, implying that
BMP may induce other factors to sustain the survival of these cells. In short, this report
establishes a novel BMP-SDF-1 axis in the prostate tumor along with a new prosurvival
effect of BMP that when considered together with our previously described oncogenic
properties of BMP indicate a circuitry for heterotypic cell interactions potentially critical
in prostate cancer.
3.2 Introduction
The stromal microenvironment of the tumor plays a critical role in support of the growth,
survival, and dissemination of tumor cells. The majority of the stromal cells are
fibroblasts and among them, the myofibroblasts or so-called “activated fibroblasts”,
which are characterized by expression of α-Smooth Muscle Actin ( α-SMA), are most
prominent in prostate cancer. The enriched population of myofibroblasts in the tumor
stroma is associated with the production of increased levels of stromal cell–derived
factor-1 (SDF-1), also called CXCL12 ligand (Orimo et al. 2005; Orimo et al. 2006)
SDF-1 is widely expressed by stromal cells from various tissues including dendritic cells,
endothelial cells, pericytes, fibroblasts, and vascular smooth muscle cells from the skin;
osteoblasts and endothelial cells from the bone marrow; and astrocytes and neurons from
35
the brain (Tanabe et al. 1997; Pablos et al. 1999; Ponomaryov et al. 2000; Salvucci et al.
2002). Two SDF-1 isoforms, SDF-1 α and SDF-1 β, have been identified in human and
mouse. These two isoforms arise from a single gene through alternative splicing and the
only difference is that SDF-1 β contains a four amino acid COOH-terminal extension
(Shirozu et al. 1995). SDF-1 is highly conserved between species. Human and mouse
SDF-1 α and SDF-1 β are 99% and 97% identical in amino acid sequences, respectively.
No differences have been reported between SDF-1 α– and SDF-1 β–regulated expression
and biological activity.
SDF-1 binds primarily to CXCR4 cytokine receptor and the SDF-1-CXCR4 axis has a
prominent role in regulating leukocyte and hematopoietic progenitor cell functions,
including the survival and migration of hematopoietic progenitor cells to the bone during
embryonic development (Nagasawa et al. 1996; Ma et al. 1999). Recent research has
shown that SDF-1-CXCR4 axis also plays an important role in tumorigenesis by
regulating tumor cell proliferation, survival, migration, and invasion (Darash-Yahana et
al. 2004; Orimo et al. 2005; Sutton et al. 2007). It has been shown that CXCR4 protein
expression correlates with tumor grade in human prostate cancer and SDF-1 mRNA
expression is elevated in metastatic prostate tumors although not in benign or localized
tumors (Sun et al. 2003). Particular attention has been paid to the SDF-1-CXCR4 axis in
prostate cancer bone metastasis, as SDF-1 is able to significantly increase the adhesion of
human prostate cancer cells to the osteoblast and endothelial cell culture models, and to
enhance their migration and invasion (Taichman et al. 2002). In vivo, administration of a
CXCR4-neutralizing antibody or blocking peptides significantly reduces the ability of
36
PC-3 prostate cancer cells to metastasize and grow in bone (Sun et al. 2005). SDF-1 is
also important in angiogenesis where it promotes vascular endothelial cell migration and
induces capillary tube formation (Salcedo et al. 1999; Kanda et al. 2003).
Previously, we and other groups have shown that the aberrant expression of bone
morphogenetic protein (BMP) is linked to prostate cancer progression and bone
metastasis, and that BMP can promote prostate cancer cell survival and invasion, and
stimulate angiogenesis (Dai et al. 2004; Dai et al. 2005; Yang et al. 2005; Yang et al.
2006; Ye, Lewis-Russell, Kyanaston et al. 2007). Thus far, however, these studies have
been limited to the tumor cells only. In this study, we focus on the BMP signaling in the
cancer-associated fibroblasts (CAF) and their heterotypic interactions in prostate cancer
where BMP is found to be highly up-regulated and seem to facilitate both paracrine and
autocrine circuits.
3.3 Materials and Methods
Isolation of CAF
The conditional Pten deletion/luciferase reporter activation (cPten
−/ −
L) mice were
monitored by bioluminescence imaging for the tumor growth (Liao et al. 2007) and then
euthanized at desired time points to collect tumors. The tumor tissues were carefully
dissected, minced with crossed scalpels (size 11 blades), and cultured in Bfs medium:
DMEM (Invitrogen) supplemented with 5% fetal bovine serum, 5% Nu serum (BD
Biosciences), 0.5 μg/mL R1881 (PerkinElmer), 5 μg/mL insulin (Sigma-Aldrich), and
1% penicillin/streptomycin. After 1 week of culturing, cells that migrated from the tissue
37
clumps were trypsinized, transferred to new culture dishes, and allowed for surface
attachment for a short period of time, varying from 1 to 10 min. Cells that were not
attached were then removed, and the dishes with firmly attached cells were washed with
PBS to further eliminate loosely attached cells. Based on the observations of the cell
morphology, the cultures that contained most homogenous fibroblastic-like cells were
expanded and used for experiments within 12 passages. The dorsolateral lobes of the
prostate from littermate controls were similarly processed to obtain normal prostate
fibroblast cultures.
Cell culture, recombinant proteins, SDF-1 neutralizing antibody, and conditioned
medium
CAF cells were cultured in the same Bfs medium that was used to isolate them. Human
microvascular endothelial cells (HMVEC) were cultured in Medium 131 with
Microvascular Growth Supplement (Cascade Biologics) in 0.1% gelatin coated dishes.
The human recombinant proteins BMP2, BMP7, transforming growth factor (TGF β-1),
and Noggin, and SDF-1 neutralizing antibody were purchased from R&D Systems, Inc.
The recombinant murine SDF-1 α was purchased from PeproTech, Inc. To collect the
conditioned medium from the CAF, cells were washed with PBS and incubated with the
serum-free medium (SFM) with 0.1% bovine serum albumin, 5 μg/mL insulin, and 0.5
μg/mL R1881 for 24 h. The debris in the conditioned medium was separated by
centrifuge, and the aliquots of the supernatant fluid were stored at −80°C. The SFM with
38
the same supplements indicated above was used to serum starve the CAF for the
apoptosis experiments.
Immunofluorescence analysis
Cells cultured on 4-well chamber slide (Nalgen Nunc International) were washed with
PBS twice, fixed with 4% (weight/volume) paraformaldehyde in PBS for 30 min, and
permeabilized by 0.05% Triton X-100 in PBS for 10 min. After washing with PBS twice,
slides were incubated in the TBS buffer containing 0.05% Tween and 3% normal horse
serum for 30 min. Monoclonal SMA-Cy3 antibody (Sigma) was added at 1:200 dilution
and allowed to bind at room temperature for 1.5 h. The chamber slides were then washed
in PBS thrice and mounted with Vectorshield mounting medium containing nucleus
staining solution 4 ′,6-diamidino-2-phenylindole (DAPI; Vector Laboratories).
Western blot analysis
The tissue lysates and whole cell lysates were prepared as described before (Yang et al.
2005). The antibodies used in the Western blot experiments were goat anti-BMP2/4
(R&D Systems), rabbit anti-Smad5, anti–phospho-Smad1,5,8, (Cell Signaling
Technology), and goat anti-actin (Santa Cruz Biotechnology).
SDF-1 ELISA
The mouse SDF-1 α concentration in the conditioned medium from CAF was measured
using a commercially available SDF-1 ELISA kit (R&D Systems). Because the number
of the CAF cells and the volume of SFM used for conditioned medium preparation varied
39
in different experiments, the ELISA results were further normalized by cell number and
presented as total amount of SDF-1 α secretion per one million cells (ng/million cells).
RNA preparation, semiquantitative, and real-time reverse transcription-PCR
Total RNA was extracted by TRIzol Reagent (Invitrogen, Inc.) or RNeasy Mini kit
(Qiagen) after the protocols recommended by the manufacturers. DNaseI (Ambion) was
used to remove contaminants of genomic DNA in the RNA samples. The RNA (2 μg)
was reverse transcribed by using iScript DNA Synthesis kit (Bio-Rad). The synthesized
cDNA was subjected to PCR with the primers described in Table 1. The optimal cycle
that can reflect the amount of original template was determined and used in the
semiquantitative PCR experiment at the indicated annealing temperatures. Real-time
PCR was carried out using 13 μL of 2× Brilliant SYBER Green QPCR Master Mix
(Stratagene) with 1 μL of cDNA in a total volume of 25 μL. The PCR conditions were as
follows: 1 cycle of 95°C for 10 min; 40 cycles of 95°C for 30 s, 55°C for 1 min, and
72°C for 30 s; and 1 cycle of 95°C for 1 min and 55°C for 30 s. Reactions were carried
out with the Stratagene Mx3000P PCR machine, and the cycle thresholds were
determined with its accompanying software. Actin was used for each sample as control.
Real-time PCR primers are also listed in Table 1.
40
Table 1. List of Semiquantitative and real-time PCR primer.
Gene Forward Primer Reverse Primer PCR Product
(bp)
mSDF-1 mRNA GCTCTGCATCAGTGACGGTA AAGTCCTTTGGGCTGTTGTG 247
mSDF-1 pre-
mRNA
CCTTGTGTTTTGGCAGTGCA AAGTCCTTTGGGCTGTTGTG 128
mCXCR4 AAGGAAACTGCTGGCTGAAA GGCAGAGCTTTTGAACTTGG 514
mBMP-2 AGATCTGTACCGCAGGCACT GTCGAAGCTCTCCCACTGAC 382
mBMP-4 TGAGAGACCCCAGCCTAAGAC ATAAAACGACCATCAGCATTC 365
mBMP-7 CCTTTAGCCAGCCTGCAGGAC GTCCAATCAGGCCTGCCAACT 452
mBMPR-IA AGGTCAAAGCTGTTCGGAGA CGCCATTTACCCATCCATAC 932
mBMPR-IB TGAGTGTCTCAGGCAGATGG GGTGTGTCGGGCAGTAAGTT 593
mActR-I GCATCCTTGGAGTTGCTCTC AGCGAGGTTAGGGTGGTTTT 1299
mBMPR-II AATGGAACGTACCGCTTTTG GTGAGCCTCTCGTCTCCAAC 476
mActR-II GTTACACCGAAGCCACCCTA TGATTAGCCACAGGTCCACA 412
mActR-IIB CTGTGCGGACTCCTTTAAGC CTTGTGGACAACCACCTCCT 814
hSDF-1 CCAAACTGTGCCCTTCAGAT ACACACACACCTGGTCCTCA 235
hCXCR-4 GGCAGCAGGTAGCAAAGTGA TGATGACAAAGAGGAGGTCGG 343
Tube formation assay
Forty-eight–well plates were coated with 150 μL Matrigel (BD Biosciences) at 4°C and
were incubated for 1 h at 37°C. HMVEC cells (2 × 10
4
) were added to the Matrigel-
coated wells in 0.5 mL SFM or conditioned medium from fibroblasts. After 24-h
incubation, cells were photographed under phase-contrast microscopy, and tubes were
counted at low-power magnification from five randomly chosen fields in each well.
41
Apoptosis analysis (TUNEL)
Cellular apoptosis was assayed using APO-BRDU kit (Phoenix Flow Systems) following
the instructions of the manufacturer.
Statistical analysis
All experiments were performed in triplicates and repeated at least twice. Statistical
comparisons were made using an unpaired, two-tailed t test.
3.4 Results
BMP2 is overexpressed in prostate adenocarcinomas. Previously, we reported that
BMP7 was strikingly up-regulated with the growth of primary prostate tumors (Yang et
al. 2005) in the conditional Pten deletion (cPten
−/ −
) mouse model (Wang et al. 2003;
Zhong et al. 2006). Here, we analyzed the expression levels of two other BMPs: BMP2
and BMP4. We extracted proteins from the anterior lobe, the ventral lobe, and the
dorsolateral lobes of tumor-harboring cPten
−/ −
or cPten
−/ −
L mice and the corresponding
normal tissues of their littermate controls. In preliminary experiments, we found that the
presence of the reporter gene in cPten
−/ −
L model did not significantly affect any of the
expression analyses we described for the cPten
−/ −
model. Considering this matter, we
interchangeably used tissues from either of these models for this work. Western blot
analysis of the dorsolateral lobes with antibodies that recognize both BMP2 and BMP4
revealed progressive over expression of these proteins in parallel to tumor development.
As shown in Fig. 12A, at age 1.5 months, when tumors are yet to form (Yang et al. 2005),
42
there was no significant difference in the BMP2/4 protein level between the prostates
from the experimental mice and their littermate controls. At age 3 months, BMP2/4
protein levels increased in tumors as illustrated for dorsolateral lobes. In a 12.5-month-
old mouse, BMP2/4 protein expression was strongly up-regulated in tumors of all lobes
(Fig. 12B). Because the antibody used in the Western blot was not able to distinguish
between BMP2 and BMP4 protein, we used semiquantitative reverse transcription-PCR
(RT-PCR) to detect the specific transcripts for BMP2 and BMP4 individually in a 13-
month-old mouse model and its littermate control. As shown in Fig. 12C, BMP2 mRNA
expression was consistently higher in every lobe of the tumor model compared with the
normal prostate. No increase in BMP4 mRNA levels was detected in any of the tumor-
bearing lobes of the prostate. Together, the results support a pattern of BMP2
overexpression, similar to that of BMP7, with the growth of primary prostate tumors.
Figure 12. Detection of BMP2/4 expression in mouse prostate adenocarcinoma by
Western blot analysis and semiquantitative RT-PCR.

A

43
Figure 12: continued

B

C

A, Western blots of the dorsolateral lobes (DLP) from the experimental mice and the
normal littermate controls at different ages as indicated in months (mo). B, Western blots
of individual lobes, anterior lobes (AP), ventral lobes (VP), and dorsolateral lobes, from a
12.5-mo-old tumor mouse and its littermate control. C, total RNA was extracted from
anterior lobes, ventral lobes, and dorsolateral lobes from a 13-mo-old animal and its
littermate control, and subjected to semiquantitative RT-PCR for BMP2 and BMP4.
Actin served as loading control. c, littermate control; p
−/ −
, Pten deletion model.
CAF cells express α-SMA, BMPs, and BMP receptors
We derived two primary cultures of CAF, CAF-1 and CAF-2, from tumors of cPten
−/ −
L
mice of two different ages, 4.5 and 7.5 months, respectively. The cultured CAF cells,
exhibited fibroblastic cell morphology, and most cells were strongly positive for α-SMA
(Fig. 13A). In addition to the expression of BMP members (BMP2, BMP4, and BMP7),
the expression of the three type I and three type II receptors was also examined by RT-
PCR assays. A representative pattern of expression is shown in Fig. 13B. In both CAF-1
44
and CAF-2, mRNAs corresponding to BMP2, BMP4, and BMP7, and all six BMP
receptors, were readily detected, although CAF-1 and CAF-2 varied in the expression
levels of specific receptors. Although CAF-1 displayed a relatively higher level of
BMPRIB, CAF-2 expressed more ActRI and ActRIIB.
Figure 13. Characterization of the CAF cells.
A

B

45
Figure 13: continued
C

A, photographs of live CAF cells were taken under a brightfield microscope (left). Right,
CAF cells were fixed and detected for the expression of α-SMA by immunofluorescence.
The Cy3-labeled α-SMA antibody gives rise to red fluorescence in the cytoplasm, and the
DAPI to blue fluorescence in the cell nuclei. B, RT-PCR assays for BMP2, BMP4, and
BMP7, and each of the six known BMP receptors (BMPR), including three type I
(BMPRIA, BMPRIB, and ActRI) and three type II (BMPRII, ActRII, and ActRIIB) in
the CAF. C, RT-PCR assays for SDF-1 and CXCR4 expression in CAF and HMVEC
cells.
BMP2 and BMP7 stimulate SDF-1 secretion in CAF
We examined the mRNA expression of SDF-1 and CXCR4 in the CAF and in HMVEC
and found that all of these cell cultures express SDF-1 and CXCR4 constitutively (Fig.
13C). To test a possible relationship between BMP and SDF-1 signaling in CAF, we
measured SDF-1 secretion in our two CAF cultures after treatment with BMP2 or BMP7
or other extracellular signaling molecules that may potentially influence SDF-1 secretion,
namely TGF β-1, interleukin 8 (IL-8), and osteopontin. BMP2 or BMP7 was found to
strongly up-regulate SDF-1 α secretion in both CAF-1 and CAF-2 in a dose-dependent
manner (Fig. 14A (a) and C (a)). The effect of BMP2 was stronger, with 6-fold up-
regulation observed at the 200 ng/mL concentration (Fig. 14A (a)). This was paralleled
by phosphorylation of BMP-Smads, where BMP2 again was more effective than BMP7
(Fig. 14A (b) and C (b)). TGF β-1 (Fig. 14A (a) and C (a)), IL-8, and osteopontin (data
not shown), which were tested at various concentrations, could not significantly affect
46
SDF-1 α secretion. In the presence of Noggin, which abolished the ability of BMP2 and
BMP7 to cause Smad phosphorylation (Fig. 14B (b) and C (b)), the stimulatory effect on
SDF-1 secretion was also similarly nullified (Fig. 149B (a) and C (a)). Although CAF-1
and CAF-2 seemed to respond similarly to BMP treatment, the basal level of SDF-1 was,
however, determined to be 3- to 4-fold higher in CAF-1 compared with CAF-2. To test
whether SDF-1 can also be up-regulated in the fibroblasts from normal prostate tissue, we
tested a primary fibroblast culture from a normal control mouse and observed a very
similar effect of BMP2 and BMP7 on these fibroblasts. The SDF-1 secretion is increased
by BMP2 or BMP7 treatment in a dose-dependent manner, accompanied by
phosphorylation of Smad that could also be blocked by Noggin (Fig. 15).
Figure 14. BMP2 and BMP7 stimulate SDF-1 secretion and induce Smad
phosphorylation in CAF-1 and CAF-2 cells.
A
47
Figure 14: continued

B

48
Figure 14: continued
C

A (a), B (a), and C (a), conditioned medium (CM) from CAF-1 or CAF-2 cells with
different 24 h treatments as indicated in the charts were assayed for SDF-1 α
concentration by ELISA, and the level of secreted SDF-1 α, represented as nanogram per
one million cells (ng/million cells), was compared among different groups by
normalization with conditioned medium volume and cell number. A (b), B (b) and C (b),
the same CAF cells that are used for ELISA were lysed and subjected to Western blot
analysis to detect Smad phosphorylation and the expression of Smad5. Analysis of actin
was used as a loading control.
49
Figure 15. BMP2 and BMP7 stimulate SDF-1 α secretion and Smad
phosphorylation in the fibroblasts isolated from the normal prostate tissue.

A

B

C

50
Figure 15: continued
D

A and C, determination of the SDF-1 α level by ELISA in the fibroblasts with various
treatment as indicated. B and D, cells with the same treatments in A and C, respectively,
were lysed and subjected to Western blot analysis for the detection of phosphorylated
Smad1,5,8. Smad5 and Actin are served as loading control.
BMP2 transcriptionally up-regulates SDF-1 expression.
When we measured the levels of SDF-1 mRNA by quantitative RT-PCR (qRT-PCR),
BMP2 treatment for 24 h was found to increase the level by 1.9-fold in CAF-1 and 1.7-
fold in CAF-2 (Fig. 16A). This indicated a transcriptional regulation. However, an
alternative could be that the increased SDF-1 expression was due to mRNA stabilization.
We addressed this issue by measuring the effect of BMP2 on SDF-1 pre-mRNA, which
provides a close estimate of the transcription rate of the gene. Therefore, the SDF-1
transcripts were analyzed by qRT-PCR using primers that spanned an exon-intron
boundary of this gene. DNaseI treatment and appropriate controls without reverse
transcription verified that genomic DNA was excluded from our RNA preparations (data
not shown). As shown in Fig. 16B, BMP2 treatment increased the SDF-1 pre-mRNA
level in a time-dependent manner, with a 2-fold stimulation observed after a short
treatment for a period of 2 h. These results suggest direct effect of BMP2 on SDF-1
51
expression at the level of transcription. To further confirm that BMP2 regulates SDF-1 at
the transcriptional level, we measured the effects of BMP-2 on SDF-1 mRNA and SDF-1
secretion in transcriptionally arrested CAF-1 cells. As shown in Fig. 16C, pretreatment
with the transcriptional inhibitor actinomycin D abolished the stimulatory effect of BMP2
on SDF-1 secretion. Consistent with the ELISA results, the SDF-1 RNA level did not
change significantly when the cells were pretreated with actinomycin D before exposure
to BMP2 as shown in Fig. 16D. Interestingly, actinomycin D itself seemed to slightly
stimulate SDF-1 expression (Fig. 16C and D), an effect that could possibly be due to
suppression of one or more negative regulatory mechanisms of SDF-1 expression. In
fibroblasts from normal prostate tissue, it was also shown that the SDF-1 mRNA level
was increased by BMP2 and BMP7 by both semiquantitative PCR and qRT-PCR (Fig.
17), and that actinomycin D was able to suppress BMP2 stimulated SDF-1 secretion (data
not shown).
Figure 16. BMP2 transcriptionally up-regulates SDF-1 in CAF.
A

52
Figure 16: continued
B

C

D

A, RNA was extracted from CAF-1 and CAF-2 cells with or without BMP2 (100 ng/mL)
treatment for 24 h and used to determine the SDF-1 α RNA quantity by real-time RT-
PCR. The quantity for control cells was adjusted to 1 and the results are shown by the
fold increase. Bottom, the results of semiquantitative RT-PCR for SDF-1 α and actin by
using the same cDNA. B, the pre-mRNA levels of SDF-1 α were measured by real-time
RT-PCR using the RNA samples from CAF-1 treated with BMP2 (100 ng/mL) at the
indicated time periods. Primers were designed to span an exon-intron boundary, and
absence of genomic DNA was confirmed by eliminating the reverse transcription step
(data not shown). C, conditioned medium from CAF-1 cells in the absence or presence
of BMP2 (100 ng/mL), with or without pretreatment of actinomycin D (10 μg/mL), was
measured for SDF-1 α level by ELISA. D, RNA extracted from the same CAF-1 cells
with the different treatments indicated above was subjected to semiquantitative RT-PCR
for SDF-1 α.
53
Figure 17. BMP2 and BMP7 up-regulate SDF-1 RNA expression in the fibroblasts
isolated from the normal prostate tissue.

A

B

A, semi-quantitative RTPCR was done to detect the SDF-1 α RNA level in the control
cells and cells treated with 100 ng/ml BMP2 or 200 ng/ml BMP7. B, real-time
quantitative RT-PCR (Q-PCR) was done to determine the SDF-1 α RNA levels in the
same samples used in A. The quantity for control cells was adjusted to 1 and the results
are shown by the fold increase.

54
Increased SDF-1 secretion by BMP2 treatment enhances the ability of CAF to
stimulate microvascular tube formation.
Using a human dermal microvascular endothelial cell line, HMVEC, recombinant murine
SDF-1 α, and BMP2 were examined for their ability to stimulate HMVEC tube formation.
As shown in Fig. 18A and B, BMP2 could not stimulate more tube formation than the
SFM, whereas low concentrations (1 to 10 ng/mL) of SDF-1 increased the tube formation
in a dose-dependent manner. At high concentrations (100 ng/mL), SDF-1 however
displayed a rather inhibitory effect (data not shown). It would be important to note that
the concentrations of SDF-1 (as determined by ELISA) in the conditioned medium from
CAF in our experiments ranged from 0.2 to 0.6 ng/mL at basal level and to 1 to 6 ng/mL
after BMP2/7 stimulation (data not shown). We then used the conditioned medium from
the variously treated CAF-1 for the HMVEC tube formation assay. The conditioned
medium from CAF-1 with BMP2 treatment, which contained a higher level of SDF-1,
stimulated relatively more tube formation (45%) than the conditioned medium from
nontreated or Noggin-treated CAF-1 cells, and this stimulatory effect was reversed when
CAF cells were cotreated with BMP2 and Noggin (Fig. 18A and C). The stimulatory
effect was also abolished, as shown in Fig. 18D, when the HMVEC cells were cotreated
with SDF-1–neutralizing antibody (20 μg/mL).
55
Figure 18. Matrigel-based capillary-like tube formation assay using HMVEC.
A

B

C

56
Figure 18: continued
D

A, HMVEC cells were seeded into a Matrigel-coated 48-well plate with various
treatments for 24 h, and the photographs showing tube formation were taken under a light
microscope. B, HMVEC cells were treated in SFM with BMP2 (100 ng/mL) or SDF-1 (1
or 10 ng/mL). The tube numbers were counted from five randomly selected fields at high
power (×20), and the number shown in the chart represents the sum of these counts. C,
HMVEC cells were treated with conditioned medium from control CAF-1 cells and CAF-
1 cells that were treated with 1 μg/mL Noggin, 100 ng/mL BMP2, or 1 μg/mL Noggin,
and 100 ng/mL BMP2 together for 24 h. The tube number was counted the same way as
described above. D, HMVEC cells were treated with conditioned medium from control
CAF-1 or CAF-1 cells treated with 100 ng/mL BMP2 for 24 h, in the absence or presence
of 20 μg/mL SDF-1 neutralizing antibody.
BMP2 protects CAF from serum starvation induced apoptosis. To examine whether
BMP might confer survival advantage to CAF, we serum starved the CAF-1 and CAF-2
with or without BMP2 treatment and measured the apoptotic rate in these cells. As
shown in Fig. 19A, serum starvation for 4 days induced 15% apoptosis in CAF-1,
whereas BMP2 treatment significantly reduced this apoptotic rate to only 6%. At days
beyond 4 days, most of these cells underwent apoptosis irrespective of the presence or
absence of the added BMP in the medium. In CAF-2, which was found to be more
resistant to serum starvation compared with CAF-1, the experiment could be extended to
6 days. The reasons for differences in the sensitivity for apoptosis between CAF-1 and
CAF-2 are not clear at this time. Under serum starvation for 6 days, the apoptosis was
57
80% for CAF-2 but reduced to only 29% in the presence of BMP2 (Fig. 19B). This
protective effect of BMP2 is independent of SDF-1 up-regulation, as SDF-1 alone could
not significantly enhance the survival of CAF cells (Fig. 19A and B).
Figure 19. Assessment of the apoptotic percentage in CAF cells with BMP2 or SDF-
1 treatment after serum starvation.
A

B

A and B, CAF-1 and CAF-2 cells were cultured in SFM in the absence or presence of 100
ng/mL BMP2, or in the presence of 10 ng/mL SDF-1 for 4 d and 6 d, respectively, and
collected for TUNEL assay. N.S., not statistically significant.
58
3.5 Discussion
Previously, we showed that BMP7 expression increases progressively with the growth of
the prostate adenocarcinoma in the conditional Pten deletion mouse model (Yang et al.
2005). Here, we show that BMP2 expression is also increased during the progression of
prostate tumor in this model. This new observation is consistent with the findings that
describe elevated expression of BMP2 in human prostate cancer (Harris et al. 1994;
Bobinac et al. 2005; Dai et al. 2005; Doak et al. 2007). The most exciting finding in this
report, however, is the observation that BMP can strongly induce in CAF the expression
of SDF-1, a chemokine that functions as both chemoattractant for cell migration and
mitogen for cell proliferation and survival. By using two different CAF primary cultures,
CAF-1 and CAF-2 isolated from 4.5- and 7.5-month-old animals, respectively, we have
shown a similar response. Both CAF cultures exhibit myofibroblastic traits and a major
difference between them is the basal level of SDF-1, which is higher in CAF-1 relative to
CAF-2. They also differ in their sensitivity to serum starvation, CAF-1 being more
susceptible to apoptosis. In contrast to BMP, we show that TGF β-1, representing a major
member of the superfamily to which BMP belongs, practically lacks the ability to induce
SDF-1 in CAF. CAF cells are critical in prostate tumorigenesis, a point that was
originally shown by the potency of human prostatic CAF, but not normal prostatic
fibroblasts, to induce tumor formation from initiated, nontumorigenic human prostatic
epithelial cells (Olumi et al. 1999; Cunha et al. 2003). Of the multiple mechanisms by
which CAF may support tumor growth, secretion of elevated levels of proteases, growth
regulators, and extracellular matrix proteins have been implicated to date (Micke et al.
59
2007). In human breast and prostate cancer, several studies have shown that SDF-1 is
overexpressed in CAF and can contribute to both tumor growth and angiogenesis (Orimo
et al. 2005; Ao et al. 2007; Micke et al. 2007).
The pivotal role of SDF-1/CXCR4 axis in tumor progression and metastasis has been
widely recognized. However, the current knowledge on how SDF-1 may be regulated,
especially in tumors, is very limited. It is reported that IL-17 induces the production of
SDF-1, as well as the expression of SDF-1 mRNA, in cultured Rheumatoid synovial
fibroblasts in a dose-dependent manner (Kim et al. 2007). Interestingly, in a murine bone
stromal cell line, SDF-1 expression is found to be down-regulated by TGF β-1, both at the
mRNA level and at the protein level (Wright et al. 2003). In dermal wound healing, it
has also been shown that IL-1 and tumor necrosis factor– α inhibit the expression of SDF-
1 by human fibroblasts in vitro (Fedyk et al. 2001). The SDF-1 induction by BMPs that
we describe in our study is not confined to only CAF. A similar effect is observed in the
fibroblasts derived from normal prostate tissues. These results imply that regardless of
the origin of the prostate fibroblasts, and despite the variation of the constitutive levels of
SDF-1 in these cell populations, any increase in extracellular BMP is likely to positively
induce SDF-1 expression in the prostate tissue microenvironment.
We show that supernatants from CAF cells treated with BMP2 correlated with increased
in vitro capillary tube formation by human microvascular endothelial cells. Many
previous studies have shown that SDF-1 induces tube-like structure formation in
endothelial cells such as human umbilical vein endothelial cells, murine brain capillary
60
endothelial cells, and endothelial progenitor cells (Salvucci et al. 2002; Kanda et al. 2003;
Segal et al. 2006). In our study, the increased level of SDF-1 secreted by CAF after BMP
exposure is indeed shown to be a major contributory factor in tube formation, implying
that BMP signaling in the fibroblasts may be an important factor for angiogenesis in the
prostate tumor.
Another function of BMP observed in this study is that BMP2 can protect CAF cells from
serum starvation–induced apoptosis. This effect seems to be independent of SDF-1. We
have reported previously that BMP7 is able to inhibit serum starvation–induced apoptosis
in the LNCaP prostate cancer cell line and, more remarkably, in its bone metastatic
variant C4-2B, through up-regulation of survivin expression and c-Jun-NH
2
-kinase
activation (Yang et al. 2006). Further investigation will be needed to determine if a
similar or a different mechanism is involved in this protection of the CAF cells by BMP.
One important issue arising from this study is whether BMP functions in a paracrine or
an autocrine fashion or both for the induction of SDF-1. Based on our results that were
reported previously and studies from other groups, it is clear that prostate cancer cells do
generally express high levels of BMP. Although we show that CAF cells also express
detectable levels of BMP, we did not observe any significant inhibition of the basal level
of SDF-1 by Noggin treatment, indicating that the endogenous functional levels of BMP
in CAF may not be sufficient to enhance SDF-1 expression. However, Noggin treatment
was found to induce increased apoptosis in CAF under the serum starvation condition
(data not shown), which may suggest a possible protective mechanism of the endogenous
61
BMP in relation to antiapoptosis signaling in the CAF. As CXCR4 is found to be present
in the CAF, whether SDF-1 may also have autocrine effects on CAF is still another point
that remains to be defined.
Taken together, the evidence for strong induction of SDF-1 by BMP in CAF along with
the demonstrated expression of BMPR and CXCR4 in both prostate cancer and CAF
cells, and expression of CXCR4 in endothelial cells seem to indicate potentially
important heterotypic cell-cell interactions driven by both autocrine and paracrine
mechanisms in prostate cancer. This newly identified BMP-SDF-1 axis as well as the
SDF-1–independent protective function of BMP on the CAF that we describe highlight
novel BMP signaling variables in the prostate cancer microenvironment. These results
further underscore the contention that the intervention of BMP signaling activity may
lead to a potential therapeutic treatment for prostate cancer.
62
CHAPTER 4
Regulation of Bone Morphogenetic Activity in the Cancer Cells
or Cancer Microenvironment
4.1 Abstract
There have been many studies, including our previous works, focusing on the impact of
BMP on human prostate cancer cell lines derived from metastatic lesions, but very few
on how BMP signaling may affect tumor progression at the primary site. To address this,
we used cell lines that have been isolated from the primary site of tumors derived from
the conditional Pten knockout mouse model of prostate cancer. In cE1 cells we observed
that overexpression of Noggin inhibited cell proliferation while migration was increased.
However subcutaneous grafts of the cells showed that cE1/Noggin grafts had more mass
and greater Ki67 staining than cE1/Control. To study if BMP may also impact tumor
progression via the stroma, we transduced cancer associated fibroblast cells (CAFs) and
formed grafts with the CAF cells combined with cE1 and E8, a novel cell line first
characterized in this study. With E8 cells, CAF/Noggin had increased tumor mass and
lacked glandular structure in contrast to E8 cell mixed with CAF/Control, but with cE1
cells, CAF/Noggin did not induce any changes in tumor growth compared to its control
and only a moderate decrease in CD31 staining. The majority of the in vivo results
suggests that opposing BMP signaling may suppress tumorigenesis at the primary site of
cancer development. However dissimilar results for E8 and cE1 grafts formed with
transduced CAF cell lines emphasize that the impact of BMP signaling is dependent on
the tumor cell. Additionally, disparate results for cE1/Noggin and cE1 mixed with
63
CAF/Noggin allude to the modulation of the impact of Noggin by the microenvironment.
The overall impact of BMP signaling is an amalgam of its effect on the
microenvironment, its effect on the tumor cells, and of the heterotypic interactions
between the microenvironment and the tumor.
4.2 Introduction
Previously our laboratory showed that Bone Morphogenetic Proteins (BMPs) 2 and7
have potent pro-tumorigenic effects on human prostate tumor cell lines (Yang et al. 2005;
Yang et al. 2006; Lim et al. 2010) as well as on primary fibroblast cultures (Yang et al.
2008) in vitro. Since our laboratory first published these reports, a number of articles has
since been published on the effects BMP2 or BMP7 on prostate cancer cells.
Unfortunately, these publications do not necessarily have consistent observations. For
example, there are papers (Feeley et al. 2006; Kwon et al. 2010) that agree with our
observations that BMP treatment can promote migration and invasion in PC-3 cells,
however there are also articles that imply that BMP treatment inhibits migration and
invasion in PC-3 cells (Buijs et al. 2007; Ye, Lewis-Russell, Kynaston et al. 2007;
Benelli et al. 2010). It appears that observing the effect of only one BMP may not be the
most effective approach for determining its effect on prostate cancer since many BMPs in
the transforming growth factor- β (TGF β) superfamily appear to have both similar and
opposing effects. To assess the overall impact of BMP signaling in prostate cancer, we
use Noggin, an inhibitor of multiple BMPs, to study how the loss of BMP signaling
might influence tumor progression.
64
Noggin is a secreted glycoprotein with a molecular weight of 32 kDa as a monomer, but
usually exists as a homodimer (Yanagita 2005; Krause et al. 2011). Like other BMP
antagonists it has a cysteine rich C-terminal region which, via cysteine knots, confers a
distinct ring structure used to classify the antagonists into three subfamilies. Noggin,
with its 10-membered ring structure belongs to the Chordin and Noggin Family (Avsian-
Kretchmer et al. 2004). Crystal structures of both BMP7 and Noggin show that Noggin
binding to BMP7 occludes both the type I and type II BMP receptor binding sites on
BMP7. This prevents BMP7, and presumably other BMPs that Noggin binds, from
activating both SMAD dependent and SMAD independent signaling via the BMP
receptors (Groppe et al. 2002). Noggin has been reported to bind with varying affinities
to BMPs 2, 4, 5, 6, 7, 13, and 14 (Krause et al. 2011). Song et al. demonstrated that
Noggin binds to BMP 2 and 4 more strongly than 7 and BMP 6 with low affinity (Song et
al. 2010). Shaw et al. has also noted that under their culture conditions, Noggin was able
to impede BMP 4 associated gene transcription and not BMP 7 associated gene
expression in LNCaP cells (Shaw et al. 2010). Notably, another BMP antagonist,
Sclerostin (Sost), has also been shown to bind Noggin, although in this case when Sost
and Noggin bind they are mutually inhibitory and this increases BMP availability
(Winkler et al. 2004).
In the prostate cancer field, there has been interest in studying how Noggin affects the
ability of prostate cancer cells to metastasize. Yuen et al. shows that while BMP6
expression by itself is not a good prognostic indicator of distant metastasis in prostate
tumors, combining high BMP6 expression with low Noggin and Sost expression is a
65
predictor (Yuen et al. 2008). In vitro data show that adding Noggin to conditioned media
from prostate cancer cell lines reduces their ability to induce osteoblastic activity (Dai et
al. 2004; Dai et al. 2005). Consistent with these observations, Schwaninger et al. shows
that osteolytic cell lines (PC-3, PC-3M-Pro4) express Noggin while osteoblastic cell lines
(LNCaP, C4-2, C4-2b) did not (Schwaninger et al. 2007). In vivo data consists mostly of
implantation of Noggin overexpressing cell lines into bone. Regardless of the
osteoblastic or osteolytic nature of the cell line, osteoblastic/-lytic response is reduced
although tumor growth is not always necessarily inhibited (Feeley et al. 2005; Feeley et
al. 2006; Schwaninger et al. 2007; Virk et al. 2009; Virk et al. 2011). Notably a recent
paper shows that Noggin silencing in PC-3 cells preserved bone formation in the
osteolytic lesions and decreased tumor growth (Secondini et al. 2011). Thus far, most
studies of Noggin in prostate cancer are limited to its influence in the bone
microenvironment. In this study we use a newly established murine prostate epithelial
cell line as well as a previously published cell line from a recurrent tumor to study how
the overall inhibition of BMP signaling in both the tumor and stroma compartments of
prostate cancer affects tumor growth in a subcutaneous environment.
4.3 Material and Methods
Cell Lines
E8 cells were isolated from a non-castrated Pten deletion mouse tumor following a
similar procedure as described for the generation of E2 and E4 cell lines (Liao et al.
2010). Both E8 and cE1 are maintained at 5% CO
2
, 37
o
c, in a media of DMEM, 10%
FBS, 25 µg/mL bovine pituitary extract (Invitrogen), 5 µg/mL insulin (Sigma-Aldrich)
66
and 6 ng/mL recombinant human epidermal growth factor (rhEGF) (Invitrogen). cE1
cells were later switched to a media similar to above but with the addition of 1nM R1881
(Perkin Elmer) and the replacement of 10% FBS with 10% Charcoal:Dextran stripped
serum (Gemini) to control for androgen concentration in the media. CAF cells were
isolated and cultured as previously described (Yang et al. 2008).
Lentivirus Infection
The plasmid containing Noggin cDNA was a kind gift from Dr. Cheng-Ming Chuong.
The lentivirus construction was done in collaboration with Dr. Nori Kasahara of the
UCLA Vector Core (Fig. 20). E8 and cE1 cells were plated at 100,000 cells per well in
6-well plates and incubated with 1 ml of growth media containing lentiviruses, at an MOI
of 100, in the presence of 5 g/ml polybrene for overnight. The next morning they were
washed with PBS twice, and grown in complete medium. The procedure was repeated
once more and was then the transduced cells sorted by flow cytometry on the basis of
RFP fluorescence.
67
Figure 20. Schematic of vector carrying murine Noggin constructed for lentivirus
production.

ORF of mNoggin was amplified with primers 5-mNoggin-BamHI
(GATCGGATCCATGGAGCGCTGCC) and 3-mNoggin-EcoRI
(GCTAGAATTCCTAGCAGGAACACTTACACTCG) using Phusion HF PCR reaction
mix. PCR product was gel isolated and digested with BamHI-HF and EcoRI-HF(New
England Bioscience). pRRL-sin-cPPT-MCS-IRES-emdRFP plasmid was digested with
the same enzymes. Two products were ligated and transformed in STBL3 cells.
RNA preparation and real-time reverse transcription-PCR
Total RNA was extracted by using the Tissue RNA miniprep kit with DNase I set
(Bioland) following the recommended protocol by the manufacturers. The RNA (1 μg)
was reverse transcribed by using qScript™ cDNA Synthesis Kit (Quanta). Real-time
PCR was carried out using 12.5 μL of FastStart Universal SYBR Green Master (Roche)
with 1 μL of cDNA in a total volume of 25 μL. The PCR conditions were as follows: 1
68
cycle of 95°C for 10 min; 40 cycles of 95°C for 30 s, 55°C for 1 min, and 72°C for 30 s;
and 1 cycle of 95°C for 1 min and 55°C for 30 s. Reactions were carried out with the
Stratagene Mx3000P PCR machine, and the cycle thresholds were determined with its
accompanying software. Actin was used for each sample as control. Real-time PCR
primers are listed in Table 2.
Table 2. List of real-time PCR primers.
Gene Forward Primer Reverse Primer Source
Noggin TGTACGCGTGGAATGACCTA TGAGGTGCACAGACTTGGA (Reinhold
et al. 2004)
Sclerostin ATGACGCCAAAGATGTGTCCGAG
T
CACCACTTCACGCGCCCGAT This paper
BMP2 AGATCTGTACCGCAGGCACT CCGTTTTCCCACTCATCTCT This paper
BMP4 TGAGCCTTTCCAGCAAGTTT CTTCCCGGTCTCAGGTATCA This paper
BMP5 CATGGTCATGAGCTTTGTCA CTCCATGTGGAATCTGGGTC This paper
BMP6 CAAGTCTTGCAGGAGCATCA CAAGTCTTGCAGGAGCATCA This paper
BMP7 GAAAACAGCAGCAGTGACCA GGTGGCGTTCATGTAGGAGT This paper
BMP9 AGGAGACCCTGGAAGGGTTA AGTTTCTGCCTGGTTTCCTG This paper
BMP10 ATTCGCCACAGACCGGACCTCC CAACCGCAGTTCAGCCATGACG This paper
BMP11 ACCACCGAGACGGTCATAAG GGCCTTCAGTACCTTGGTGA This paper
BMP12 GATGTCGCTTTACAGGAGCC ACGTCGAACAGGAAGCTCTG This paper
BMP13 CGCGTGGTGCCTCACGAGTA GGAGTGTGCGAGAGATCGTCCAG
T
This paper
BMP14 TCGAGAGCCCAAGGAGCCGTT GCAGGGCCTCGGTCATCTTGCC This paper
ALK1 CGGCTCTGGACGTGAGAC GGTGAGATCTGCAAAACGTG This paper
ALK2 TGCTAATGATGATGGCTTTCC CCTTCACAGTGGTCCTCGTT This paper
ActRII AGCGAGAACTTCCTACGGCT CCTGAGTTTCTGATCTGCCA This paper
69
Table 2: continued
`
Gene Forward Primer Reverse Primer Source
ActRIIB CGACAAGGGCTCCCTCACGGA GCCCTCACCACGACACCACG This paper
BMPRIA ATGCAAGGATTCACCGAAAG AACAACAGGGGGCAGTGTAG This paper
BMPRIB CTCCCTCTGCTGGTCCAAAGGACA CCAGCTGGCTTCCTCCGTGGT This paper
BMPRII ACCGCTTTTGCTGCTGTAGT CAGAAACTGATGCCAAAGCA This paper

Proliferation Curve
Growth curves done in serum-free media with varying amounts of R1881 was performed
as described previously (Liao et al. 2010). Growth curves of transduced cell lines were
done by plating 50,000 cells in growth media into six well plates (Day 0). Media was
refreshed every two days and the proliferation rate was determined by cell counting at the
indicated time points using a Beckman Coulter Counter.
Immunostainings
Immunostaining were done according to previously published methods (Liao et al. 2010).
For immunohistochemistry the following primary antibodies were used: AR (1:200;
Santa Cruz), CK8 (TROMA-1) (1:100; Developmental Studies Hybridoma Bank,
University of Iowa), CK5 (1: 1000; Covance), Vimentin (1:50; Cell Signaling), Ki67
(1:200; Vector Laboratories), or CD31 (PECAM-1) (1:1000; Santa Cruz). Secondary
antibody consisted of biotinylated goat, rabbit, or rat IgG (1:200; Vector Laboratories).
For α-Smooth Muscle Actin (SMA) and CK8 co-immunofluorescence staining, sections
were incubated in the above CK8 antibody overnight and then stained with FITC-
conjugated anti-rat IgG (1:80; Sigma Aldrich) as well as Cy3-conjugated anti-SMA
70
(1:200; Sigma Aldrich). Ki67 quantitation was performed by counting positively stained
cells in three 400x fields per graft and dividing over the number of nuclei found in those
fields. CD31 quantitation involved counting the number of positive structure per 400x
field. Calculation of areas containing glandular structure involved taking low
magnification pictures of the whole graft and using ImageJ to measure areas with
glandular structure.
Western Blot
Cell lysates and conditioned media were collected as previously described (Yang et al.
2005). Primary antibodies were used as follows: goat anti-Noggin (1:1000; R&D
Systems), goat anti-BMP2/4 (1:500 R&D Systems), goat anti-Smad1,5 (1:500; Santa
Cruz Biotechnology), anti–phospho-Smad1,5,8, (1:1000; Cell Signaling Technology),
and goat anti-actin (1:5000; Santa Cruz Biotechnology).
Migration Assay
E8, cE1, and CAF cells were allowed reached 90% to 100% confluency in six well plates.
The growth media was saved and fresh media added that contained 10 µg/mL of
Mitomycin C (Sigma Aldrich). The cells were incubated at 37
o
c for two hours, after
which the wound line was made with a 200µL pipet tip on the monolayer cultures of the
cells. Cells were washed with PBS twice, the saved growth media was added, and
photographs were taken at indicated time points. Gap distance was measured by ImageJ
and divided over time to obtain migration rate.
71
Tumorigenicity Assay
1×10
6
transduced E8 or cE1 cells were suspended in 50 µL growth media and mixed with
50 µL Matrigel (BD bioscience) then inoculated subcutaneously into NOD.SCID mice of
8–12 weeks of age. Grafts were collected surgically at six weeks post-inoculation from
the euthanized animals. For Assays involving CAF, 2×10
6
transduced CAF cells were
added to 1×10
6
E8 or cE1 in 100 µL growth media and were treated as above.
Statistical Analysis
Results were evaluated as the mean±SD of at least two different experiments performed
in triplicate. Differences between individual groups were analyzed by independent t test.
P values of <0.05 were considered statistically significant.
4.4 Results
Signaling, growth, and migration of Noggin transduced cE1 cell line. Stable cell lines
of Noggin overexpressing cE1 cells were created via lentivirus mediated infection of
either Noggin-RFP or RFP alone. The former is referred to cE1/Noggin and the latter,
cE1/Control. After FACS sorting, overexpression of Noggin was confirmed by both
qPCR and western blot. qPCR data showed that Noggin transcript in cE1/Noggin cells is
>10,000 fold higher than in cE1/Control and parental lines (Fig. 21A) and the Noggin
western blot confirms that a similar pattern of expression is seen in the conditioned media
(Fig. 21B). Note that conditioned media from parental and control cells do not show any
detectable amount of Noggin although all lanes contain detectable amounts of BMP2/4.
After confirming overexpression of Noggin, we tested the ability of Noggin to inhibit
72
BMP2 signaling. Immunoblotting for phospho-Smad 1,5,8 demonstrated that
cE1/Control already had high basal activation of the Smad pathway. The addition of
BMP2 was not enough to induce further phosphorylation of Smad 1,5,8 in cE1/Control
cells, however as expected, expression of Noggin reduced the amount of detectable
phospho-Smad and addition of BMP2 was not able to increase Smad activation (Fig.
20C).

Figure 21. cE1 over expresses Noggin which suppresses basal level of Smad
signaling.
A
0.00E+00
5.00E+01
1.00E+02
1.50E+02
2.00E+02
2.50E+02
3.00E+02
3.50E+02
4.00E+02
cE1 (parental) cE1/Control cE1/Noggin
Mean Ratio to Actin

B
cE1 cE1/C cE1/N
Noggin
BMP2/4
p<0.01
73
Figure 21: continued
C cE1/C cE1/N
BMP2 - + - +
P-Smad
Smad 1,5
Actin
A, qPCR data showing that Noggin mRNA is signficantly upregulated (p<0.01) in
Noggin-RFP transduced cells compared to the parental and RFP Control cells. B, Western
blot of conditioned media collected from parental (cE1), cE1/Control (cE1/C), and
cE1/Noggin (cE1/N) cell lines showing increased Noggin secretion in cE1/Noggin versus
parental of cE1/Control. Media was collected from cells incubating in DMEM for 24 hrs.
C Western blot showing that overexpressed Noggin suppresses Smad 1,5,8
phosphorylation. cE1 cells were cultured in 0.1% serum overnight and then treated with
100 ng/mL BMP2 for 1 hour before the cell lysate was collected.

Since it has been well established that forced expression of BMPs can induce Noggin
expression and that knockdown of BMPs decreases Noggin (Haudenschild et al. 2004;
Ye, Lewis-Russell, Kynaston et al. 2007), we checked whether Noggin overexpression
might affect BMP expression in cE1 cells. We performed qPCR analysis and saw that
the BMP profile for cE1/Control was similar to cE1/Noggin. Of the ten BMPs assayed,
only BMP4 showed significantly higher transcript levels in cE1/Noggin versus
cE1/Control (Fig. 22A). Sost expression was also assessed as we wanted to know the
likelihood of Noggin function being antagonized and we saw that transcript levels were
similarly low in both cell lines (Fig. 22B). We also assayed the expression of the four
74
type I (BMPRIA, BMPRIB, Alk1, Alk2)and three type II (BMPRII, ActRII, ActRIIB)
BMP receptors known to bind BMPs and found that both cell lines express BMPRIA and
BMPRII the highest. There is also modest expression of Alk2, ActRII, and ActRIIB.
There was little to no expression of BMPRIB and Alk1 (Fig. 22C).
Figure 22. qPCR profile for BMP, BMPRs in cE1/Control and cE1/Noggin lines.
A
0
0.0005
0.001
0.0015
0.002
0.0025
0.003
BMP2 BMP4 BMP5 BMP6 BMP7 SOST
Mean Ratio to Actin
cE1/Control
cE1/Noggin

B
0
0.005
0.01
0.015
0.02
0.025
BMPRIA BMPRIB Alk1 Alk2 BMPRII ActRII ActRIIB
Mean Ratio to Actin
cE1/Control
cE1/Noggin

qPCR analysis of A, BMPs and Sost, and B, BMPRs. Bmps 9-14 were also assayed with
no significant differences found (data not shown). Cells were seeded in growth media
and cDNA was extracted the next day. Except for BMP4, which was higher in
cE1/Noggin, all assayed transcript levels did not appear significantly different.
p<0.01
75

Next we assayed whether Noggin overexpression influenced any characteristics known to
contribute to tumor progression. Commonly, BMPs are studied for their affect on growth
and migration, so we performed a growth curve assay and a migration assay on
cE1/Control and cE1/Noggin lines. Fig. 23A shows that by Day 4 we saw a reduction in
cell number in cE1/Noggin cultures. At Day 6 the number of cells in the cE1/Noggin
plates was significantly less (p<0.01) than in cE1/Control. To assess migration, a wound
healing assay was done and as Fig. 23B illustrates, it was found that cE1/Noggin cells
penetrated the wound line and closed the gap faster than cE1/Control cells. Using
ImageJ, an image analysis tool available on the NCBI website, we measured the gap over
time and found that the migration rate for cE1/Noggin cells is significantly faster than
cE1/Control (Fig. 22C).

Figure 23. Proliferation and migration of cE1/Control versus cE1/Noggin.
A
0
500000
1000000
1500000
2000000
2500000
3000000
Day 0 Day 2 Day 4 Day 6
Ce ll Nu m ber
cE1/Control
cE1/Noggin

* p<0.01
76
Figure 23: continued
B
0 hrs 4hrs 7hrs
cE1/Control

0 hrs 4hrs 7hrs
cE1/Noggin
C

A, cE1/Control and cE1/Noggin cell growth in maintenance media was determined by
counting the cell number every 2 days. B, Representative brightfield micrographs to
indicate increased motility when cE1 cells overexpress Noggin. C, Quantitation of the
migration rate in the wound healing assay. Using pictures taken at zero and four hours,
the gap distance was measured in microns and divided by time in hours. Shown are mean
+/- standard deviation.

p<0.05
77
Forced expression of Noggin increases tumor proliferation in vivo. In vitro data
supports BMP signaling participating in promoting tumor growth but not migration of
cE1 cells. To determine whether these observations would be supported in vivo, we
subcutaneously injected 1×10
6
cE1/Control or cE1/Noggin cells into NOD.SCID mice
and harvested the resultant grafts after six weeks. Tumor incidence was 100% for both
cell lines. Surprisingly, in contrast to the in vitro data, the tumors composed of
cE1/Noggin cells were almost two-fold larger than that of cE1/Control cells (Fig. 24A).
Histopathological analysis revealed that both cE1/Control grafts and cE1/Noggin grafts
were of similar cell types. In both types of grafts, CK8 positive, AR positive cells
formed glandular-like structures with epithelial cell penetrating into Vimentin positive
stroma like layers (Fig. 24B). AR staining was confined largely to the nucleus of CK8
postitive cells as is expected for adenocarcinoma. Vimentin staining was present only in
the stroma and not detected in epithelial structures. Ki67, a cell proliferation marker,
staining was abundant in all grafts with at least 10% of all cells staining positive.
Quantitation was done using ImageJ to count positive cells and total nuclei in three
random 100x fields. Consistent with Fig. 23A, the Ki67 proliferation index was
significantly higher in cE1/Noggin versus cE1/Control cells (Fig. 24 C).
78
Figure 24. Histological analyses of tumors induced by the cE1/Control or
cE1/Noggin cell lines in male NOD.SCID mice.
A

B
cE1/Control cE1/Noggin
H&E
CK8
p<0.05
79
Figure 24: continued
AR
Vimentin
C
cE1/Control cE1/Noggin
Ki67

80
Figure 24: continued
0
0.05
0.1
0.15
0.2
0.25
cE1/Control cE1/Noggin
Ki67 Positive/Total Cells

A, Bar graph showing significantly higher tumor mass (g) was seen for cE1/Noggin grafts
versus cE1/Control. Shown are mean +/- standard deviation. B, 100x micrographs
showing H&E and IHC staining of sections from cE1/Control and cE1/Noggin grafts for
CK8, AR, and Vimentin. Inset shows sections at 400x magnification. Bar, 100µm. C,
IHC staining of the grafts for Ki67. Inset shows sections at 400x magnification. Bar,
100µm. (bottom) Bar graph of Ki67 quantitation. Shown are mean +/- standard
deviation.
Previously we have shown that BMPs not only have influence on carcinoma cells but can
also contribute to tumor progression by signaling to the stroma. We demonstrated that
BMP treatment of CAFs can induce SDF-1 expression and that this was accompanied by
increased tube formation in an in vitro matrigel angiogenesis assay (Yang et al. 2008). In
order to evaluate whether disruption of BMP signaling via Noggin secretion by the
epithelial component could affect angiogenesis in vivo, we did an immunohistochemical
analysis of CD31 expression. As Fig. 25A and B illustrates, there does not appear to be a
significant difference in the number of positive CD31 structures among cE1/Control or
cE1/Noggin grafts indicating that angiogenesis was not impacted. We also wanted to
p<0.05
81
evaluate whether Noggin expression was able to affect the ‘activation’ of surrounding
fibroblasts by the tumor cells by performing a co-immunofluorescent staining of both
CK8, an epithelial marker, and α-Smooth Muscle Actin(SMA), a myofibroblast marker.
As one can see in Fig. 25C, there is presence of SMA positive cells (red) surrounding
CK8 positive cells (green) in both grafts, however it is not apparent if there is any
difference in number.
Figure 25. Overexpression of Noggin in tumor cells does not affect tumor stroma.
A
cE1/Control cE1/Noggin
CD31
B
0
5
10
15
20
25
30
35
40
45
cE1/Control cE1/Noggin
Positive Structures/Field

82
Figure 25: continued
C
cE1/Control cE1/Noggin
CK8+SMA

A, 200x micrographs showing IHC staining of cE1/Control and cE1/Noggin grafts. Inset
shows section at 400x magnification. Bar, 100μm. B, Bar graph showing quantitation of
CD31 IHC staining. Shown are mean values +/- standard deviation. The number of
positive structure in three independent 400x fields in each graft where counted and
averaged. C, co-Immunofluorescence staining showing presence of activated fibroblasts
with CK8 (green) and SMA (red). Inset shows section at 100x magnification. Bar,
100μm.

Expression of Noggin in cancer associated fibroblast cells (CAFs). As stated
previously, we published evidence that the effects of BMP are seen not only on cancer
cells, but that fibroblast cells are affected too. Our in vivo evidence showed that while
transduction of Noggin into carcinoma cells does affect tumor growth, the pathology of
the tumor remains unaffected. To determine whether Noggin overexpression in a
different compartment might have more striking results, we first transduced primary CAF
cultures with RFP or Noggin-RFP. Fig. 26A shows that conditioned media collected
from CAF/Noggin cells contains significant amounts of Noggin protein while
conditioned media from CAF/Control cells and parental CAF had no detectable
expression of Noggin. There were only barely detectable levels of BMP2/4 in all three
83
lanes with CAF/Control conditioned media having the highest. BMP2 treatment of
CAF/Control cells show only a marginal increase in phospho-SMAD 1,5,8 although like
cE1/Control, control treatment already showed readily detectable activation of SMAD
(Fig. 26B). Transduction of Noggin into CAF reduced the phosphorylation level of
SMAD 1,5,8, although it does not abolish it. In order to ascertain the effect of BMP on
CAF, we again examined cell proliferation and migration in Control and Noggin lines.
Over expression of Noggin in CAF does decrease CAF cell numbers as seen in cE1 cells
(Fig. 26C). Unlike cE1 cells, CAF migration is not affected by the presence of Noggin
(Fig. 26D and E).
Figure 26. Noggin expression in CAF cultures.
A
CAF CAF/C CAF/N
Noggin
BMP 2/4
B
CAF/C CAF/N
BMP2 - + - +
P-Smad 1,5,8
Smad 1/5
Actin
84
Figure 26: continued
C

D
0 hrs 4hrs 8hrs
CAF/Control
CAF/Noggin
0
100000
200000
300000
400000
500000
600000
700000
800000
900000
1000000
Day 0Day 2 Day 4Day 6
Cell Number
CAF/Control
CAF/Noggin
* p<0.01
85
Figure 26: continued
E
0
2
4
6
8
10
12
14
CAF/Control CAF/Noggin
Migration Rate (um/hr)

A, Western blot of conditioned media collected from parental, CAF/Control, and
CAF/Noggin cell lines showing increased Noggin secretion in cE1/Noggin versus
parental or cE1/Control lanes. B, Western blot showing that overexpressed Noggin
suppresses Smad 1,5,8 phosphorylation. CAF cells were cultured in 0.1% serum
overnight and then treated with 100 ng/mL BMP2 for 1 hour before the cell lysate was
collected. C, Growth curve of CAF/Control and CAF/Noggin cell lines as determined by
counting the cell numbers every 2 days. D, Representative brightfield micrographs of
migration assay showing no difference in rate. E, Quantitation of the migration rate in the
wound healing assay. Using pictures taken at zero and four hours, the gap distance was
measured in microns and divided by time in hours. Shown are mean +/- standard
deviation.

Characterization of a new murine prostate epithelial cell line. As we were preparing
and characterizing the CAF cultures, our lab was able to establish a new line of androgen
dependent prostate cancer cells derived from our conditional Pten null mouse model.
Our cell line, dubbed E8, was isolated in the same manner as previously published cell
lines, E2 and E4 (Liao et al. 2010). E8 cells appear polygonal and grow very rapidly,
although they do not grow in clumps as seen in cE1 cells (Fig. 27A). Using real-time
PCR, we checked for the expression of epithelial markers, CK8, p63, and E-cadherin
86
(Fig. 27B). We saw that there was high expression of CK8 and no detectable expression
of p63, likening the cells to luminal epithelial cells. E-cadherin expression was only
moderate, likely due to the lack of cell to cell adhesion. Since other androgen dependent
cell lines isolated from this mouse model, had a tendency to undergo an epithelial-
mesenchymal like transition (EMT), we also checked E8 cells for expression of fibroblast
and EMT markers. We found that while there was high expression of Vimentin, there
was little to no expression of N-Cadherin or EMT markers: Twist, Snail, and Slug (Fig.
27C). E8 cells were isolated from an intact mouse and should be androgen dependent, so
to determine how proliferation of the cells would be affected by the absence and presence
of androgens, proliferation assays were done in a modified serum-free media containing
0, 1, or 5 nM R1881. Fig 27D shows that in the absence of androgen, E8 proliferation is
inhibited. Generally no cell proliferation is observable after three days in culture. The
addition of R1881, however, helped to sustain cell proliferation and increased the
calculated doubling time by two-fold regardless of the concentration used (1 or 5 nM
R1881).
Figure 27. Characteristics of new murine prostatic epithelial cell line, E8.
A

87
Figure 27: continued
B
0.00E+00
5.00E-02
1.00E-01
1.50E-01
2.00E-01
2.50E-01
CK8 p63 E-Cadherin AR
Mean Ratio to Actin

C
0.00E+00
2.00E-01
4.00E-01
6.00E-01
8.00E-01
1.00E+00
1.20E+00
1.40E+00
1.60E+00
1.80E+00
Vimentin N-Cadherin Twist Snail Slug
Mean Ratio to Actin

88
Figure 27: continued
D
0
200000
400000
600000
800000
1000000
1200000
1400000
Day 1 Day 3 Day 5
Cell Numbers
0 nM R1881
1 nM R1881
5 nM R1881

A, 100x brightfield micrograph of E8 cells in their normal growth media showing
polygonal shaped morphology and lack of cell attachment. Bar, 100µm. B, epithelial
(CK8, p63, E-cadherin) and C, fibroblast (Vimentin, N-Cadherin) and EMT (Twist,
Snail, Slug) expression profile for E8 cell lines as observed by real-time PCR analysis. D,
Comparison of E8 growth rate when cultured in SFM containing 0, 1, or 5 nM R1881.
Cultures containing androgen had significantly higher cell numbers than those that were
androgen free.

To confirm that E8 cells would behave like adenocarcinoma-inducing cells in vivo, 1×10
6

E8 cells were subcutaneously injected into male NOD.SCID mice. Tumor incidence was
at 100%. Histological analysis shows that the grafts resembled adenocarcinoma
containing glandular structures composed of multiple layers of epithelial cells expressing
AR and CK8 (Fig. 28) penetrating surrounding stroma. CK5, a basal epithelial cell
maker, positive staining can been seen in cells lining the lumen. Grafts also stained
positive for Ki67, but proliferative index was not calculated.
* p<0.01
89
Figure 28. Analyses of tumors induced by the E8 cells in male NOD.SCID mice.

H&E CK8

CK5 AR

100x micrographs of H&E and IHC staining of sections of E8 grafts for AR, CK8, CK5,
and Ki67 showing an adenocarcinoma-like morphology. 400x magnification of the
section is shown in upper-left corner of each section. Bar, 100µm.

Expression of Noggin in CAFs increases anaplastic growth in E8, but not in cE1. To
study how Noggin overexpression in CAF cells may affect tumor progression in vivo, we
mixed transduced CAF cells with non-transduced epithelial cells, androgen-dependent E8
90
and castration resistant cE1, at a 2:1 ratio and subcutaneously injected male NOD.SCID
mice. Tumor incidence was 100% (12/12) in all mice with grafts containing transduced
CAF and cE1 cells generally larger than grafts formed of CAF and E8 cells. While we
observed a trend of grafts containing CAF/Noggin cells being larger than ones with
corresponding tumor cells with CAF/Control, there was only a significant difference in
tumor mass in E8+CAF/Noggin grafts versus E8+CAF/Control (Fig. 29A). H&E and
CK8 IHC staining showed that there was a striking difference in morphology between
E8+CAF/Noggin and E8+CAF/Control grafts with little to no glandular structure being
formed in E8+CAF/Noggin grafts (Fig. 29B and C). In grafts containing cE1, only one
cE1+CAF/Noggin graft lacked any glandular structure whereas the rest including all
cE1+CAF/Control grafts contained glandular structure which stained strongly for CK8
and AR. In grafts containing no glandular structure, CK8-positive cells with Vimentin
expression and large nuclei were detected leading us to believe that these grafts contain
anaplastic tumor cells, indicative of a high grade tumor. Vimentin staining in all other
grafts were confined to spindle shaped fibroblast cells. Interestingly nuclear AR staining
was stronger in grafts containing CAF/Control than CAF/Noggin cells and that CAF cells
showed some nuclear AR staining and strong cytoplasmic AR staining. Ki67 staining
was high in all grafts with at least 20% of cells staining positive and no significant
differences were found among the grafts. All grafts also showed areas containing a high
density of spindle shaped cells which IHC staining for RFP indicated were composed of
our transduced CAF cells (data not shown).
91
Figure 29. Overexpression of Noggin in CAF cells promotes anaplastic growth of
tumor cells.
A

B
E8+CAF/Control E8+CAF/Noggin cE1+CAF/Control cE1+CAF/Noggin
H&E

CK8

AR

p<0.05
92
Figure 29: continued
E8+CAF/Control E8+CAF/Noggin cE1+CAF/Control cE1+CAF/Noggin
Vimentin

Ki67

C

A, Bar graph showing significantly higher tumor mass (g) was seen for E8+CAF/Noggin
grafts versus E8+CAF/Control. No differences were seen between cE1+CAF/Noggin
grafts and cE1+CAF/Control. Shown are mean +/- standard deviation. B, 100x
micrographs showing H&E and IHC staining of sections from E8+CAF/Control,
E8+CAF/Noggin, cE1+CAF/Control, and cE1+CAF/Noggin grafts for CK8,AR,
Vimentin, and Ki67. Inset shows sections at 400x magnification. Bar, 100µm. C, Bar
graph showing percentage of tumor area containing glandular structures. All grafts in
E8+CAF/Noggin group and one graft in cE1+CAF/Noggin group had little to no
structured growth. Shown are mean +/- standard deviation.

p<0.01
93
As we did for cE1/Control and cE1/Noggin grafts, we determined whether there were any
alterations to be found in the stroma of grafts composed of CAF/Control and
CAF/Noggin by CD31 immunohistochemistry and co-immunofluorescence of α-Smooth
Muscle Actin and CK8. Fig. 30A illustrates CD31 staining in E8+CAF/Noggin grafts is
slightly, but not significantly lower than in E8+CAF/Control grafts. However in
cE1+CAF/Noggin grafts, the level of positive staining is moderately, but significantly
lower than in cE1+CAF/Control (Fig. 30B). Similar to cE1 grafts co-
immunofluorescence staining was done for SMA and CK8. In E8+CAF/Control,
cE1+CAF/Control, and cE1+CAF/Noggin grafts, SMA positive cells can be seen mostly
around the glandular structures. No obvious differences were found in the pattern of
staining between the different groups except that E8+CAF/Noggin has clusters of cells
which are clearly CK8 positive, but show only sporadic SMA positive cells (Fig. 30C).
Figure 30. Effect of Noggin overexpression in fibroblasts of the tumor stroma.
A
E8+CAF/Control E8+CAF/Noggin cE1+CAF/Control cE1+CAF/Noggin
CD31

94
Figure 30: continued
B

C
E8+CAF/Control E8+CAF/Noggin cE1+CAF/Control cE1+CAF/Noggin

CK8+SMA

A, 100x micrographs showing IHC staining of E8+CAF/Control, E8+CAF/Noggin,
cE1+CAF/Control, and cE1+CAF/Noggin grafts. Inset shows section at 400x
magnification. Bar, 100μm. B, Bar graph showing quantitation of CD31 IHC staining.
Shown are mean values +/- standard deviation. The number of positive structure in three
independent 400x fields in each graft where counted and averaged. C, co-
Immunofluorescence staining showing presence of activated fibroblasts with CK8 (green)
and SMA (red). Inset shows section at 400x magnification. Bar, 100μm.

4.5 Discussion
The role of BMP in tumorigenesis is not currently well understood and is inherently
complicated as effects are highly specific to the type of BMP, cell type, and
p<0.05
95
environmental context. While it is important to note specific effects of individual BMPs,
especially as BMPs are increasingly used for therapeutic purposes, it is clear that it is also
as important to study them collectively, as BMPs as a group bind to the same set of
receptors and are subject to the same group of antagonists. In order to understand how
the overall impact of BMP signaling might affect tumor cells, we took advantage of the
ability of Noggin to inhibit a number of different BMPs, particularly 2, 4, and 7. Many
other studies have also studied how Noggin overexpression in cancer cells may affect
progression; however the majority of these studies had focused on the bone
microenvironment, using cell lines isolated from metastatic lesions. To our knowledge,
this is the first study to focus on the overexpession of Noggin in cell lines derived directly
from the prostate as well as its in vivo effects in a microenvironment other than bone. To
do this, we used two cell lines: androgen dependent E8 cells and castration resistant cE1
cells isolated from the prostate of the conditional Pten knockout model of prostate cancer.
The E8 cell line was first characterized in this study and we demonstrate that E8 is a
stable cell line that expresses epithelial markers, has limited proliferative capacity
without androgen, and forms adenocarcinoma in vivo.
Our study consists of two major parts: 1) the effect of Noggin overexpression on
castration resistant cE1 prostate tumor cells and 2) the effect of Noggin overexpression in
the stroma of grafts created by E8 or cE1 cells. We demonstrated that overexpression of
Noggin in cE1 cells had negatively impacted tumor proliferation although it promoted
cell migration in vitro. However, the implication that inhibition of BMPs decreased
tumor growth in vitro is partly mitigated by our in vivo findings that cE1/Noggin grafts
96
were larger and more proliferative than the corresponding control. The disparity between
the in vitro and in vivo results highlights the importance of the tumor microenvironment
in modulating the effects of Noggin. Although no obvious differences were apparent in
the morphology of the tumor, it seems logical to conclude that, in vivo, the overall effect
of BMP signaling on cE1 is anti-tumorigenic. A tumor suppressive effect of BMP on
cE1 cells is consistent with many studies that demonstrate that in prostate tissue,
expression of BMPs or its receptors is reduced or lost (Kim et al. 2000; Thomas et al.
2001; Masuda et al. 2004) in tumors that have not become metastatic. Also, the idea of
BMP as a tumor suppressor is consistent with a recent study showing that prostate
epithelial specific knock out of Smad signaling in the conditional Pten prostate cancer
model, increases aggressiveness of tumor progression and occurrence of metastasis (Ding
et al. 2011), although it should be noted that it in this study TGF β signaling was also
abrogated.
Since we have shown evidence that BMP was able to stimulate tumor promoting
properties of cancer associated fibroblast cells in vitro (Yang et al. 2008), we also
investigated whether overexpressing Noggin in our CAF cells and mixing them with
prostate tumor cell lines derived from the primary site might affect tumor development.
Note that both the CAF and tumor cells are derived from different mice of our
conditional Pten knockout model. Although the model has a mixed genetic background
(Liao et al. 2007), we believed that reconstituting a tumor with these cells might
recapitulate a tumor more similar to a naturally occurring growth. The most noticeable
difference was the anaplastic morphology seen in 100% (3/3) of E8 grafts with
97
CAF/Noggin indicative of a high grade tumor. E8+CAF/Noggin grafts were also had
greater tumor mass than its CAF/Control counterpart. These results support a tumor
suppressor role for BMPs consistent with the data seen in cE1/Noggin grafts. Notably,
the castration resistant tumor cell line, cE1, only had one graft with CAF/Noggin that
contained similar morphology to the E8+CAF/Noggin group. cE1+CAF/Noggin, unlike
E8+CAF/Noggin, showed no increase in tumor growth and somewhat decreased
angiogenesis, when compared to its CAF/Control counterpart. Disparate results between
cE1/Noggin and cE1+CAF/Noggin grafts again highlight the importance of the
microenvironment in modulating Noggin activity.
It is possible that the contrasting results we see with E8 and cE1 cells may be due to the
differentiation status of the two cell lines. It may be that the CAF used, which is from an
androgen dependent tumor, was not able to promote tumorigenesis in cE1 cells as well as
in E8 cells, because cE1 cells were isolated from a castration-resistant tumor and thus a
different microenvironment may be restrictive. We have observed that cells isolated
from a castration resistant tumor respond better to castration resistant CAF than androgen
dependent CAF (not published). Morrissey et al. had recently noted that their results with
BMP7 were dependent on the androgen dependent/castration resistant status of the
LNCaP and C4-2B cell lines (Morrissey et al. 2010). Alternatively, we had shown earlier
that E8 cells had high Vimentin expression, although it otherwise behaved as an epithelial
cell. Perhaps the ability of CAF/Noggin to induce anaplasia in E8 cells was facilitated by
the partially de-differentiated state of the cell originally. Anyhow it is clear that
inhibiting BMP signaling in CAF cells can increase its ability to support tumor
98
progression, but whether it actually does so may be determined by the status of the tumor
cell, be it in regards to androgen dependence or differentiation state.
The focus of current BMP research is on metastasis and nearly all in vitro and in vivo
studies done use cell lines derived from metastatic lesions. To my knowledge, this is the
first study done using prostate tumor cells from the primary site, and so far, the majority
of observations made in this study imply that BMP has a negative impact on tumor
progression at the prostate. This is supported by a number of studies that suggested that
BMP had tumor suppressive properties on prostate progression based on its
downregulation in primary tumors. However the striking differences in the E8 and cE1
grafts mixed with CAF/Noggin highlight that the overall effect of BMPs cannot be
studied solely in the context of tumor cells, nor can it be measured only through the
stroma compartment. The impact of BMP signaling on primary tumor progression is also
dependent on the heterotypic interactions between the tumor and stroma.

99

CHAPTER 5
Conclusion
5.1 Discussion
This dissertation is an accumulation of studies, focusing on the effect of BMP signaling
in three discrete areas: a prostate cancer cell line derived from metastasis, primary
cultures of prostate carcinoma associated fibroblasts, and prostate cancer cell lines
derived from tumors at the primary site, whether at the androgen dependent or castration
resistant phase. Furthermore, it should be noted that the first two studies focused on in
vitro work, the last study focused on BMP signaling in vivo.
In the first study, we further investigated anti-apoptotic mechanisms that BMP7 employs
with C4-2B cells, a LNCaP derivative from bone metastasis, in the face of serum
starvation. It is observed that Smad was able to induce Survivin expression to inhibit
apoptosis and that while JNK signaling was involved, it utilized a different mechanism.
Currently, it is well established that survivin expression is upregulated in a variety of
cancers (Yamamoto et al. 2008; Ryan et al. 2009). Due to its high specificity as a marker
for tumor cells, as well as the clear growth advantage survivin bestows on the cells, it has
been a popular target for cancer therapies that has, so far, proven successful. This study
hints at possible mechanisms behind the aberrant expression which contributes to the
current understanding of survivin regulation. A recent study expanded even further on
this work, finding the Runx2 was upregulated by BMP7 and was involved in survivin
100
transcription (Lim et al. 2010). Hopefully a clearer picture of survivin regulation can
contribute to the advancement of tumor therapies targeting survivin. Unfortunately, the
understanding behind JNK mediated protection from stress induced apoptosis is not as
simple. It is well established that how JNK regulates apoptosis is highly context
dependent (Shaulian 2010) differing even within the same cell type (Yoo et al. 2008).
Regardless of this, it is clear that, at least in our conditional Pten knockout mouse model,
JNK activity is increased during tumor progression, implying a pro-tumorigenic effect for
prostate carcinogenesis.
Our major finding from exogenous treatment of CAFs with BMP2 was the upregulation
of functional SDF-1 that followed. The implications of this induction of SDF-1
expression are clearly pro-tumorigenic. While multiple papers have published findings
that implicate the role in SDF-1 and its cognate receptor, CXCR4, in prostate tumor
metastasis, showing that CXCR4 positive tumor cells are able to ‘home’ in on SDF-1 rich
sites of metastasis (Taichman et al. 2002; Furusato et al. 2010), there has also been
evidence that SDF-1 secretion in the tumor microenvironment can play pro-tumorigenic
roles also. It has been shown that SDF-1 treatment of prostate cancer cells or
overexpression of CXCR4 could increase adhesion, migration, and invasion of the tumor
cells (Darash-Yahana et al. 2004; Xing et al. 2008). It has also been shown that SDF-1
secretion from fibroblast cells can stimulate prostate epithelial cell proliferation (Begley
et al. 2005). Interestingly, there is a recent study that shows bone marrow stromal cells
are able to target tumors via CXCR4 expression (Song et al. 2010), implying that tumors
expressing higher SDF-1 levels will better recruit fibroblasts, contributing to the
101
development of a more permissive microenvironment. Clearly increased BMP2 induced
SDF-1 production by CAFs has a high potential to promote tumorigenesis via direct
effects on the tumor cells and on CAFs. It will be interesting to see if BMP induction of
SDF-1 is similar to that seen in Survivin, as a recent publication implicated Runx2 in the
upregulation of SDF-1 transcription (Baniwal et al. 2010).
The most consistent finding noted in our report of the overexpression of Noggin in cE1
cells and in CAF cells was that inhibition of BMP signaling appeared to promote
tumorigenesis in vivo. A tumor suppressive role for BMP in primary adenocarcinoma is
not unexpected given various studies of BMP downregulation in tumor tissue compared
to normal tissues; however I believe that this study is the first to observe tumor
suppressing properties of BMP using prostate cancer cells from the primary site of the
tumor. Our observations that Noggin overexpression in tumor cells derived from the
prostate promotes growth and our observations that BMP treatment of cell lines from
metastatic lesions had pro-tumorigenic effects and published observations demonstrate
Noggin overexpression decreases bone metastatic lesions, is reminiscent of the bimodal
role of TGF β in tumor progression. In early tumorigenesis, TGF β is considered a tumor
promoter, and during the course of progression, the tumor cell becomes immune to its
inhibitory properties, which then causes the effect of TGF β signaling to become
oncogenic (Bello-DeOcampo et al. 2003; Diener et al. 2010). As seen with BMP
receptors, many tumors lose or have aberrant TGF β receptor expression (Lee et al. 1999;
Juarez et al. 2011). Smad expression is also observed to be mutated in primary prostate
cancers, both ones specific for BMP signal transduction(Horvath et al. 2004), TGF β
102
signal transduction(Teicher 2001), and also Smad 4 (Perttu et al. 2006) a common Smad
where the two pathways converge. Notably, Ding et al. observed the concomitant
knockdown of Smad 4 and Pten, drove tumor progression and increased propensity for
metastasis (Ding et al. 2011).
5.2 Suggestions for Future Work
The research done in this dissertation has hopefully contributed to a better understanding
of BMPs and prostate cancer, although much remains to be elucidated. The following are
possible studies that arise out of our own findings and may provide further insight into
the complexity of the role of BMPs in tumorigenesis.
Our first study implicated two signaling pathways in the BMP induced protection from
stress-induced hypothesis. While survivin upregulation by Smad via Runx2 was been
characterized (Lim et al. 2010), it remains to be seen how the c-Jun NH
2
-terminal Kinase

(JNK) pathway mediates BMP protection for prostate cancer cells. The JNK pathway is
part of a subset of MAPK responses that is stimulated primarily via cytokine stimulation
or environmental cues (Weston et al. 2002). Once activated, it phosphorylates c-Jun, an
oncogenic transcription factor. It is also known to phosphorylate JunD (Kallunki et al.
1996) and controversially, has been shown to activate JunB (Li, Tournier et al. 1999).
It’s role in tumorigenesis is largely dependent on phosphorylation levels among the Jun
proteins although the most highly phosphorylated one, c-Jun, has been positioned in the
literature as an oncogene (Shaulian 2010). Its affect on apoptosis is context dependent,
but there are studies which may give us insight into JNK mediate apoptosis protection. In
103
anaplastic large cell lymphoma repression of a c-Jun complex was found to increase
apoptosis (Mathas et al. 2002). Additionally in hepatocellular carcinoma cells, c-Jun was
found to prevent apoptosis through antagonizing effects on p53 (Eferl et al. 2003). Most
promising, it was found that activation of JNK mediates Fas induction of anti-apoptotic
protein Bcl-2 in DU-145 prostate cancer cells (Park et al. 2010).
The second study showed upregulation of SDF-1 by BMPs which leads us to ask whether
the induction may actually be due to BMP induced activation of fibroblast cells. BMPs
are closely related to TGF β, the most well studied ‘activator’ of fibroblast cells, and
many of their functions appear to overlap. We also have preliminary data (not shown)
that BMP2 can increase metallomatrix protease (MMP) activity, another characteristic,
including increased SDF-1 secretion, of fibroblasts isolated from activated stroma. If
BMP2 does facilitate conversion of a normal fibroblast to a myofibroblast, this would be
a novel finding that could support a potent tumorigenic role of BMP2 in tumor
progression. Our preliminary data is supported by a few studies which show that BMP2
and 4, specifically, can upregulate MMP activity in other types of fibroblast cells (Hu et
al. 2008; Rothhammer et al. 2008). It has most recently been shown that BMP2 can
induce MMP3 activity in MC3T3-E1 pre-osteoblastic fibroblast cells (Hughes-Fulford et
al. 2011). The effects may be limited to BMP2/4 as BMP7 has been shown to oppose
fibrosis and downregulate MMP activity in fibroblasts (Pegorier et al. 2010; Walsh et al.
2010). Certainly at least the relationship between BMP2 and MMP activity should be
explored as it may elucidate the positive association between BMP expression and
metastasis (Harris et al. 1994; Bobinac et al. 2005).
104
Lastly, the results of the third study implied that BMP had some tumor suppressive
properties on adenocarcinoma line, cE1 derived from a recurrent tumor at the primary
site, contrasting with our first study which showed pro-tumorigenic effects of BMP on
cell lines derived from metastasis. Earlier we suggested that BMP may, like the related
TGF β, have bimodal effects on tumor progression. To investigate this, further study
would need to be done, ideally with two cell lines isolated from a metastatic conditional
Pten knockout mouse, one cell line from the tumor in the prostate of the metastatic mouse
and one cell line isolated from one of its metastatic lesions. The comparison of the effect
of Noggin or BMP treatment on cells isolated from the prostate of a tumor that has
metastasized and its effect on a line originating from the metastatic lesion of the same
tumor should provide insight into how response to BMP signaling is altered as the tumor
progresses. Certainly comparison of the effects of BMP signaling would be facilitated by
the identical genetic background of both lines.
The role of BMP in tumor progression is complex in that one must take into account the
influence of other BMPs and BMP antagonists. Thus it is important to design studies that
can account for multiple BMPs, such as the use of BMP or receptor antagonists or the
targeting of molecules downstream of signaling (e.g. receptors or SMADs). However the
study of the effect of individual BMPs is still important as BMPs are being used for
therapeutic purposes and such work may predict effectiveness of treatment as well as
potential dangers.
105
REFERENCES
Angeli, F, Koumakis, G, Chen, MC, et al. (2009). "Role of stromal fibroblasts in cancer:
promoting or impeding?" Tumour Biol 30(3): 109-20.
Ao, M, Franco, OE, Park, D, et al. (2007). "Cross-talk between paracrine-acting cytokine
and chemokine pathways promotes malignancy in benign human prostatic
epithelium." Cancer Res 67(9): 4244-53.
Avsian-Kretchmer, O and Hsueh, AJ (2004). "Comparative genomic analysis of the
eight-membered ring cystine knot-containing bone morphogenetic protein
antagonists." Mol Endocrinol 18(1): 1-12.
Baniwal, SK, Khalid, O, Gabet, Y, et al. (2010). "Runx2 transcriptome of prostate cancer
cells: insights into invasiveness and bone metastasis." Mol Cancer 9: 258.
Barnes, J, Anthony, CT, Wall, N, et al. (1995). "Bone morphogenetic protein-6
expression in normal and malignant prostate." World J Urol 13(6): 337-43.
Begley, L, Monteleon, C, Shah, RB, et al. (2005). "CXCL12 overexpression and
secretion by aging fibroblasts enhance human prostate epithelial proliferation in
vitro." Aging Cell 4(6): 291-8.
Bello-DeOcampo, D and Tindall, DJ (2003). "TGF-betal/Smad signaling in prostate
cancer." Curr Drug Targets 4(3): 197-207.
Benelli, R, Monteghirfo, S, Vene, R, et al. (2010). "The chemopreventive retinoid 4HPR
impairs prostate cancer cell migration and invasion by interfering with
FAK/AKT/GSK3beta pathway and beta-catenin stability." Mol Cancer 9: 142.
Bentley, H, Hamdy, FC, Hart, KA, et al. (1992). "Expression of bone morphogenetic
proteins in human prostatic adenocarcinoma and benign prostatic hyperplasia." Br
J Cancer 66(6): 1159-63.
Bobinac, D, Maric, I, Zoricic, S, et al. (2005). "Expression of bone morphogenetic
proteins in human metastatic prostate and breast cancer." Croat Med J 46(3): 389-
96.
Bokobza, SM, Ye, L, Kynaston, H, et al. (2011). "Growth and differentiation factor 9
(GDF-9) induces epithelial-mesenchymal transition in prostate cancer cells." Mol
Cell Biochem.
Bragdon, B, Moseychuk, O, Saldanha, S, et al. (2011). "Bone Morphogenetic Proteins: A
critical review." Cell Signal 23(4): 609-20.
106
Bubendorf, L, Schopfer, A, Wagner, U, et al. (2000). "Metastatic patterns of prostate
cancer: an autopsy study of 1,589 patients." Hum Pathol 31(5): 578-83.
Buijs, JT, Rentsch, CA, van der Horst, G, et al. (2007). "BMP7, a putative regulator of
epithelial homeostasis in the human prostate, is a potent inhibitor of prostate
cancer bone metastasis in vivo." Am J Pathol 171(3): 1047-57.
Chen, MY, Carpenter, D and Zhao, GQ (1999). "Expression of bone morphogenetic
protein 7 in murine epididymis is developmentally regulated." Biol Reprod 60(6):
1503-8.
Coleman, RE (1997). "Skeletal complications of malignancy." Cancer 80(8 Suppl): 1588-
94.
Cunha, GR, Hayward, SW, Wang, YZ, et al. (2003). "Role of the stromal
microenvironment in carcinogenesis of the prostate." Int J Cancer 107(1): 1-10.
Dai, J, Keller, J, Zhang, J, et al. (2005). "Bone morphogenetic protein-6 promotes
osteoblastic prostate cancer bone metastases through a dual mechanism." Cancer
Res 65(18): 8274-85.
Dai, J, Kitagawa, Y, Zhang, J, et al. (2004). "Vascular endothelial growth factor
contributes to the prostate cancer-induced osteoblast differentiation mediated by
bone morphogenetic protein." Cancer Res 64(3): 994-9.
Darash-Yahana, M, Pikarsky, E, Abramovitch, R, et al. (2004). "Role of high expression
levels of CXCR4 in tumor growth, vascularization, and metastasis." FASEB J
18(11): 1240-2.
Darby, S, Cross, SS, Brown, NJ, et al. (2008). "BMP-6 over-expression in prostate cancer
is associated with increased Id-1 protein and a more invasive phenotype." J Pathol
214(3): 394-404.
Derynck, R and Zhang, YE (2003). "Smad-dependent and Smad-independent pathways in
TGF-beta family signalling." Nature 425(6958): 577-84.
Diener, KR, Need, EF, Buchanan, G, et al. (2010). "TGF-beta signalling and immunity in
prostate tumourigenesis." Expert Opin Ther Targets 14(2): 179-92.
Ding, Z, Wu, CJ, Chu, GC, et al. (2011). "SMAD4-dependent barrier constrains prostate
cancer growth and metastatic progression." Nature 470(7333): 269-73.
Doak, SH, Jenkins, SA, Hurle, RA, et al. (2007). "Bone morphogenic factor gene dosage
abnormalities in prostatic intraepithelial neoplasia and prostate cancer." Cancer
Genet Cytogenet 176(2): 161-5.
107
Ducy, P and Karsenty, G (2000). "The family of bone morphogenetic proteins." Kidney
Int 57(6): 2207-14.
Dudley, AT, Lyons, KM and Robertson, EJ (1995). "A requirement for bone
morphogenetic protein-7 during development of the mammalian kidney and eye."
Genes Dev 9(22): 2795-807.
Dvorak, HF (1986). "Tumors: wounds that do not heal. Similarities between tumor
stroma generation and wound healing." N Engl J Med 315(26): 1650-9.
Eferl, R, Ricci, R, Kenner, L, et al. (2003). "Liver tumor development. c-Jun antagonizes
the proapoptotic activity of p53." Cell 112(2): 181-92.
Fedyk, ER, Jones, D, Critchley, HO, et al. (2001). "Expression of stromal-derived factor-
1 is decreased by IL-1 and TNF and in dermal wound healing." J Immunol
166(9): 5749-54.
Feeley, BT, Gamradt, SC, Hsu, WK, et al. (2005). "Influence of BMPs on the formation
of osteoblastic lesions in metastatic prostate cancer." J Bone Miner Res 20(12):
2189-99.
Feeley, BT, Krenek, L, Liu, N, et al. (2006). "Overexpression of noggin inhibits BMP-
mediated growth of osteolytic prostate cancer lesions." Bone 38(2): 154-66.
Furusato, B, Mohamed, A, Uhlen, M, et al. (2010). "CXCR4 and cancer." Pathol Int
60(7): 497-505.
Gazzerro, E, Gangji, V and Canalis, E (1998). "Bone morphogenetic proteins induce the
expression of noggin, which limits their activity in cultured rat osteoblasts." J Clin
Invest 102(12): 2106-14.
Goto, K, Kamiya, Y, Imamura, T, et al. (2007). "Selective inhibitory effects of Smad6 on
bone morphogenetic protein type I receptors." J Biol Chem 282(28): 20603-11.
Graham, TR, Agrawal, KC and Abdel-Mageed, AB (2010). "Independent and
cooperative roles of tumor necrosis factor-alpha, nuclear factor-kappaB, and bone
morphogenetic protein-2 in regulation of metastasis and osteomimicry of prostate
cancer cells and differentiation and mineralization of MC3T3-E1 osteoblast-like
cells." Cancer Sci 101(1): 103-11.
Groppe, J, Greenwald, J, Wiater, E, et al. (2002). "Structural basis of BMP signalling
inhibition by the cystine knot protein Noggin." Nature 420(6916): 636-42.
108
Hamdy, FC, Autzen, P, Robinson, MC, et al. (1997). "Immunolocalization and messenger
RNA expression of bone morphogenetic protein-6 in human benign and malignant
prostatic tissue." Cancer Res 57(19): 4427-31.
Harris, SE, Harris, MA, Mahy, P, et al. (1994). "Expression of bone morphogenetic
protein messenger RNAs by normal rat and human prostate and prostate cancer
cells." Prostate 24(4): 204-11.
Haudenschild, DR, Palmer, SM, Moseley, TA, et al. (2004). "Bone morphogenetic
protein (BMP)-6 signaling and BMP antagonist noggin in prostate cancer."
Cancer Res 64(22): 8276-84.
Hayward, SW, Cunha, GR and Dahiya, R (1996). "Normal development and
carcinogenesis of the prostate. A unifying hypothesis." Ann N Y Acad Sci 784:
50-62.
Horvath, LG, Henshall, SM, Kench, JG, et al. (2004). "Loss of BMP2, Smad8, and
Smad4 expression in prostate cancer progression." Prostate 59(3): 234-42.
Hu, J, Cui, D, Yang, X, et al. (2008). "Bone morphogenetic protein-2: a potential
regulator in scleral remodeling." Mol Vis 14: 2373-80.
Hughes-Fulford, M and Li, CF (2011). "The role of FGF-2 and BMP-2 in regulation of
gene induction, cell proliferation and mineralization." J Orthop Surg Res 6(1): 8.
Ide, H, Yoshida, T, Matsumoto, N, et al. (1997). "Growth regulation of human prostate
cancer cells by bone morphogenetic protein-2." Cancer Res 57(22): 5022-7.
Juarez, P and Guise, TA (2011). "TGF-beta in cancer and bone: implications for
treatment of bone metastases." Bone 48(1): 23-9.
Kallunki, T, Deng, T, Hibi, M, et al. (1996). "c-Jun can recruit JNK to phosphorylate
dimerization partners via specific docking interactions." Cell 87(5): 929-39.
Kanda, S, Mochizuki, Y and Kanetake, H (2003). "Stromal cell-derived factor-1alpha
induces tube-like structure formation of endothelial cells through
phosphoinositide 3-kinase." J Biol Chem 278(1): 257-62.
Kendall, SE, Battelli, C, Irwin, S, et al. (2005). "NRAGE mediates p38 activation and
neural progenitor apoptosis via the bone morphogenetic protein signaling
cascade." Mol Cell Biol 25(17): 7711-24.
Khodavirdi, A, Song, Z, Yang, S, et al. (2006). "Increased Expression of Osteopontin
Contributes to the Progression of Prostate Cancer." Cancer Res(Jan 15 (in press)).
109
Kim, IY, Lee, DH, Ahn, HJ, et al. (2000). "Expression of bone morphogenetic protein
receptors type-IA, -IB and -II correlates with tumor grade in human prostate
cancer tissues." Cancer Res 60(11): 2840-4.
Kim, KW, Cho, ML, Kim, HR, et al. (2007). "Up-regulation of stromal cell-derived
factor 1 (CXCL12) production in rheumatoid synovial fibroblasts through
interactions with T lymphocytes: role of interleukin-17 and CD40L-CD40
interaction." Arthritis Rheum 56(4): 1076-86.
Kishi, H, Igawa, M, Kikuno, N, et al. (2004). "Expression of the survivin gene in prostate
cancer: correlation with clinicopathological characteristics, proliferative activity
and apoptosis." J Urol 171(5): 1855-60.
Krause, C, Guzman, A and Knaus, P (2011). "Noggin." Int J Biochem Cell Biol.
Kwon, H, Kim, HJ, Rice, WL, et al. (2010). "Development of an in vitro model to study
the impact of BMP-2 on metastasis to bone." J Tissue Eng Regen Med 4(8): 590-
9.
Lee, C, Sintich, SM, Mathews, EP, et al. (1999). "Transforming growth factor-beta in
benign and malignant prostate." Prostate 39(4): 285-90.
Li, B, Tournier, C, Davis, RJ, et al. (1999). "Regulation of IL-4 expression by the
transcription factor JunB during T helper cell differentiation." EMBO J 18(2):
420-32.
Li, F (2003). "Survivin study: what is the next wave?" J Cell Physiol 197(1): 8-29.
Li, F and Altieri, DC (1999). "The cancer antiapoptosis mouse survivin gene:
characterization of locus and transcriptional requirements of basal and cell cycle-
dependent expression." Cancer Res 59(13): 3143-51.
Li, F and Altieri, DC (1999). "Transcriptional analysis of human survivin gene
expression." Biochem J 344 Pt 2: 305-11.
Liao, CP, Liang, M, Cohen, MB, et al. (2010). "Mouse prostate cancer cell lines
established from primary and post-castration recurrent tumors." Horm Cancer
1(1): 44-54.
Liao, CP, Zhong, C, Saribekyan, G, et al. (2007). "Mouse models of prostate
adenocarcinoma with the capacity to monitor spontaneous carcinogenesis by
bioluminescence or fluorescence." Cancer Res 67(15): 7525-33.
Lim, M, Zhong, C, Yang, S, et al. (2010). "Runx2 regulates survivin expression in
prostate cancer cells." Lab Invest 90(2): 222-33.
110
Ma, Q, Jones, D and Springer, TA (1999). "The chemokine receptor CXCR4 is required
for the retention of B lineage and granulocytic precursors within the bone marrow
microenvironment." Immunity 10(4): 463-71.
Maroni, PD, Koul, S, Meacham, RB, et al. (2004). "Mitogen Activated Protein kinase
signal transduction pathways in the prostate." Cell Commun Signal 2(1): 5.
Masuda, H, Fukabori, Y, Nakano, K, et al. (2004). "Expression of bone morphogenetic
protein-7 (BMP-7) in human prostate." Prostate 59(1): 101-6.
Masuda, H, Fukabori, Y, Nakano, K, et al. (2003). "Increased expression of bone
morphogenetic protein-7 in bone metastatic prostate cancer." Prostate 54(4): 268-
74.
Mathas, S, Hinz, M, Anagnostopoulos, I, et al. (2002). "Aberrantly expressed c-Jun and
JunB are a hallmark of Hodgkin lymphoma cells, stimulate proliferation and
synergize with NF-kappa B." EMBO J 21(15): 4104-13.
Mendoza, M and Khanna, C (2009). "Revisiting the seed and soil in cancer metastasis."
Int J Biochem Cell Biol 41(7): 1452-62.
Micke, P, Kappert, K, Ohshima, M, et al. (2007). "In situ identification of genes
regulated specifically in fibroblasts of human basal cell carcinoma." J Invest
Dermatol 127(6): 1516-23.
Miyazaki, H, Watabe, T, Kitamura, T, et al. (2004). "BMP signals inhibit proliferation
and in vivo tumor growth of androgen-insensitive prostate carcinoma cells."
Oncogene 23(58): 9326-35.
Miyazono, K, Kamiya, Y and Morikawa, M (2010). "Bone morphogenetic protein
receptors and signal transduction." J Biochem 147(1): 35-51.
Morrissey, C, Brown, LG, Pitts, TE, et al. (2010). "Bone morphogenetic protein 7 is
expressed in prostate cancer metastases and its effects on prostate tumor cells
depend on cell phenotype and the tumor microenvironment." Neoplasia 12(2):
192-205.
Nagasawa, T, Hirota, S, Tachibana, K, et al. (1996). "Defects of B-cell lymphopoiesis
and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-
1." Nature 382(6592): 635-8.
Nohe, A, Keating, E, Knaus, P, et al. (2004). "Signal transduction of bone morphogenetic
protein receptors." Cell Signal 16(3): 291-9.
111
Oelgeschlager, M, Larrain, J, Geissert, D, et al. (2000). "The evolutionarily conserved
BMP-binding protein Twisted gastrulation promotes BMP signalling." Nature
405(6788): 757-63.
Olumi, AF, Grossfeld, GD, Hayward, SW, et al. (1999). "Carcinoma-associated
fibroblasts direct tumor progression of initiated human prostatic epithelium."
Cancer Res 59(19): 5002-11.
Orimo, A, Gupta, PB, Sgroi, DC, et al. (2005). "Stromal fibroblasts present in invasive
human breast carcinomas promote tumor growth and angiogenesis through
elevated SDF-1/CXCL12 secretion." Cell 121(3): 335-48.
Orimo, A and Weinberg, RA (2006). "Stromal fibroblasts in cancer: a novel tumor-
promoting cell type." Cell Cycle 5(15): 1597-601.
Pablos, JL, Amara, A, Bouloc, A, et al. (1999). "Stromal-cell derived factor is expressed
by dendritic cells and endothelium in human skin." Am J Pathol 155(5): 1577-86.
Paget, S (1989). "The distribution of secondary growths in cancer of the breast. 1889."
Cancer Metastasis Rev 8(2): 98-101.
Park, IJ, Kim, MJ, Park, OJ, et al. (2010). "Cryptotanshinone sensitizes DU145 prostate
cancer cells to Fas(APO1/CD95)-mediated apoptosis through Bcl-2 and MAPK
regulation." Cancer Lett 298(1): 88-98.
Pegorier, S, Campbell, GA, Kay, AB, et al. (2010). "Bone morphogenetic protein (BMP)-
4 and BMP-7 regulate differentially transforming growth factor (TGF)-beta1 in
normal human lung fibroblasts (NHLF)." Respir Res 11: 85.
Pennati, M, Binda, M, Colella, G, et al. (2004). "Ribozyme-mediated inhibition of
survivin expression increases spontaneous and drug-induced apoptosis and
decreases the tumorigenic potential of human prostate cancer cells." Oncogene
23(2): 386-94.
Perttu, MC, Martikainen, PM, Huhtala, HS, et al. (2006). "Altered levels of Smad2 and
Smad4 are associated with human prostate carcinogenesis." Prostate Cancer
Prostatic Dis 9(2): 185-9.
Ponomaryov, T, Peled, A, Petit, I, et al. (2000). "Induction of the chemokine stromal-
derived factor-1 following DNA damage improves human stem cell function." J
Clin Invest 106(11): 1331-9.
Reddi, AH (1997). "Bone morphogenetic proteins: an unconventional approach to
isolation of first mammalian morphogens." Cytokine Growth Factor Rev 8(1): 11-
20.
112
Reddi, AH (2005). "BMPs: from bone morphogenetic proteins to body morphogenetic
proteins." Cytokine Growth Factor Rev 16(3): 249-50.
Reinhold, MI, Abe, M, Kapadia, RM, et al. (2004). "FGF18 represses noggin expression
and is induced by calcineurin." J Biol Chem 279(37): 38209-19.
Ronnov-Jessen, L, Petersen, OW and Bissell, MJ (1996). "Cellular changes involved in
conversion of normal to malignant breast: importance of the stromal reaction."
Physiol Rev 76(1): 69-125.
Rothhammer, T, Braig, S and Bosserhoff, AK (2008). "Bone morphogenetic proteins
induce expression of metalloproteinases in melanoma cells and fibroblasts." Eur J
Cancer 44(16): 2526-34.
Ryan, BM, O'Donovan, N and Duffy, MJ (2009). "Survivin: a new target for anti-cancer
therapy." Cancer Treat Rev 35(7): 553-62.
Salcedo, R, Wasserman, K, Young, HA, et al. (1999). "Vascular endothelial growth
factor and basic fibroblast growth factor induce expression of CXCR4 on human
endothelial cells: In vivo neovascularization induced by stromal-derived factor-
1alpha." Am J Pathol 154(4): 1125-35.
Salvucci, O, Yao, L, Villalba, S, et al. (2002). "Regulation of endothelial cell branching
morphogenesis by endogenous chemokine stromal-derived factor-1." Blood
99(8): 2703-11.
Schmitt-Graff, A, Desmouliere, A and Gabbiani, G (1994). "Heterogeneity of
myofibroblast phenotypic features: an example of fibroblastic cell plasticity."
Virchows Arch 425(1): 3-24.
Schwaninger, R, Rentsch, CA, Wetterwald, A, et al. (2007). "Lack of noggin expression
by cancer cells is a determinant of the osteoblast response in bone metastases."
Am J Pathol 170(1): 160-75.
Secondini, C, Wetterwald, A, Schwaninger, R, et al. (2011). "The role of the BMP
signaling antagonist noggin in the development of prostate cancer osteolytic bone
metastasis." PLoS One 6(1): e16078.
Segal, MS, Shah, R, Afzal, A, et al. (2006). "Nitric oxide cytoskeletal-induced alterations
reverse the endothelial progenitor cell migratory defect associated with diabetes."
Diabetes 55(1): 102-9.
Serpe, M, Umulis, D, Ralston, A, et al. (2008). "The BMP-binding protein Crossveinless
2 is a short-range, concentration-dependent, biphasic modulator of BMP signaling
in Drosophila." Dev Cell 14(6): 940-53.
113
Shariat, SF, Lotan, Y, Saboorian, H, et al. (2004). "Survivin expression is associated with
features of biologically aggressive prostate carcinoma." Cancer 100(4): 751-7.
Shaulian, E (2010). "AP-1--The Jun proteins: Oncogenes or tumor suppressors in
disguise?" Cell Signal 22(6): 894-9.
Shaw, A, Gipp, J and Bushman, W (2010). "Exploration of Shh and BMP paracrine
signaling in a prostate cancer xenograft." Differentiation 79(1): 41-7.
Shirozu, M, Nakano, T, Inazawa, J, et al. (1995). "Structure and chromosomal
localization of the human stromal cell-derived factor 1 (SDF1) gene." Genomics
28(3): 495-500.
Song, K, Krause, C, Shi, S, et al. (2010). "Identification of a key residue mediating bone
morphogenetic protein (BMP)-6 resistance to noggin inhibition allows for
engineered BMPs with superior agonist activity." J Biol Chem 285(16): 12169-
80.
Song, Z, Powell, WC, Kasahara, N, et al. (2000). "The effect of fibroblast growth factor
8, isoform b, on the biology of prostate carcinoma cells and their interaction with
stromal cells." Cancer Res 60(23): 6730-6.
Spanjol, J, Djordjevic, G, Markic, D, et al. (2010). "Role of bone morphogenetic proteins
in human prostate cancer pathogenesis and development of bone metastases:
immunohistochemical study." Coll Antropol 34 Suppl 2: 119-25.
Sun, YX, Schneider, A, Jung, Y, et al. (2005). "Skeletal localization and neutralization of
the SDF-1(CXCL12)/CXCR4 axis blocks prostate cancer metastasis and growth
in osseous sites in vivo." J Bone Miner Res 20(2): 318-29.
Sun, YX, Wang, J, Shelburne, CE, et al. (2003). "Expression of CXCR4 and CXCL12
(SDF-1) in human prostate cancers (PCa) in vivo." J Cell Biochem 89(3): 462-73.
Sutton, A, Friand, V, Brule-Donneger, S, et al. (2007). "Stromal cell-derived factor-
1/chemokine (C-X-C motif) ligand 12 stimulates human hepatoma cell growth,
migration, and invasion." Mol Cancer Res 5(1): 21-33.
Taichman, RS, Cooper, C, Keller, ET, et al. (2002). "Use of the stromal cell-derived
factor-1/CXCR4 pathway in prostate cancer metastasis to bone." Cancer Res
62(6): 1832-7.
Tanabe, S, Heesen, M, Yoshizawa, I, et al. (1997). "Functional expression of the CXC-
chemokine receptor-4/fusin on mouse microglial cells and astrocytes." J Immunol
159(2): 905-11.
114
Teicher, BA (2001). "Malignant cells, directors of the malignant process: role of
transforming growth factor-beta." Cancer Metastasis Rev 20(1-2): 133-43.
Thomas, R, True, LD, Lange, PH, et al. (2001). "Placental bone morphogenetic protein
(PLAB) gene expression in normal, pre-malignant and malignant human prostate:
relation to tumor development and progression." Int J Cancer 93(1): 47-52.
Tomari, K, Kumagai, T, Shimizu, T, et al. (2005). "Bone morphogenetic protein-2
induces hypophosphorylation of Rb protein and repression of E2F in androgen-
treated LNCaP human prostate cancer cells." Int J Mol Med 15(2): 253-8.
Trotman, LC, Niki, M, Dotan, ZA, et al. (2003). "Pten dose dictates cancer progression in
the prostate." PLoS Biol 1(3): E59.
Tuxhorn, JA, Ayala, GE and Rowley, DR (2001). "Reactive stroma in prostate cancer
progression." J Urol 166(6): 2472-83.
Virk, MS, Alaee, F, Petrigliano, FA, et al. (2011). "Combined inhibition of the BMP
pathway and the RANK-RANKL axis in a mixed lytic/blastic prostate cancer
lesion." Bone 48(3): 578-87.
Virk, MS, Petrigliano, FA, Liu, NQ, et al. (2009). "Influence of simultaneous targeting of
the bone morphogenetic protein pathway and RANK/RANKL axis in osteolytic
prostate cancer lesion in bone." Bone 44(1): 160-7.
Wada, T and Penninger, JM (2004). "Mitogen-activated protein kinases in apoptosis
regulation." Oncogene 23(16): 2838-49.
Wahdan-Alaswad, RS, Song, K, Krebs, TL, et al. (2010). "Insulin-like growth factor I
suppresses bone morphogenetic protein signaling in prostate cancer cells by
activating mTOR signaling." Cancer Res 70(22): 9106-17.
Walsh, DW, Godson, C, Brazil, DP, et al. (2010). "Extracellular BMP-antagonist
regulation in development and disease: tied up in knots." Trends Cell Biol 20(5):
244-56.
Wang, S, Gao, J, Lei, Q, et al. (2003). "Prostate-specific deletion of the murine Pten
tumor suppressor gene leads to metastatic prostate cancer." Cancer Cell 4(3): 209-
21.
Weston, CR and Davis, RJ (2002). "The JNK signal transduction pathway." Curr Opin
Genet Dev 12(1): 14-21.
115
Winkler, DG, Yu, C, Geoghegan, JC, et al. (2004). "Noggin and sclerostin bone
morphogenetic protein antagonists form a mutually inhibitory complex." J Biol
Chem 279(35): 36293-8.
Wright, N, de Lera, TL, Garcia-Moruja, C, et al. (2003). "Transforming growth factor-
beta1 down-regulates expression of chemokine stromal cell-derived factor-1:
functional consequences in cell migration and adhesion." Blood 102(6): 1978-84.
Xing, Y, Liu, M, Du, Y, et al. (2008). "Tumor cell-specific blockade of CXCR4/SDF-1
interactions in prostate cancer cells by hTERT promoter induced CXCR4
knockdown: A possible metastasis preventing and minimizing approach." Cancer
Biol Ther 7(11): 1839-48.
Xouri, G and Christian, S (2010). "Origin and function of tumor stroma fibroblasts."
Semin Cell Dev Biol 21(1): 40-6.
Yamamoto, H, Ngan, CY and Monden, M (2008). "Cancer cells survive with survivin."
Cancer Sci 99(9): 1709-14.
Yanagita, M (2005). "BMP antagonists: their roles in development and involvement in
pathophysiology." Cytokine Growth Factor Rev 16(3): 309-17.
Yang, S, Lim, M, Pham, LK, et al. (2006). "Bone morphogenetic protein 7 protects
prostate cancer cells from stress-induced apoptosis via both Smad and c-Jun NH2-
terminal kinase pathways." Cancer Res 66(8): 4285-90.
Yang, S, Pham, LK, Liao, CP, et al. (2008). "A novel bone morphogenetic protein
signaling in heterotypic cell interactions in prostate cancer." Cancer Res 68(1):
198-205.
Yang, S, Zhong, C, Frenkel, B, et al. (2005). "Diverse biological effect and Smad
signaling of bone morphogenetic protein 7 in prostate tumor cells." Cancer Res
65(13): 5769-77.
Ye, L, Kynaston, H and Jiang, WG (2008). "Bone morphogenetic protein-9 induces
apoptosis in prostate cancer cells, the role of prostate apoptosis response-4." Mol
Cancer Res 6(10): 1594-606.
Ye, L, Kynaston, H and Jiang, WG (2009). "Bone morphogenetic protein-10 suppresses
the growth and aggressiveness of prostate cancer cells through a Smad
independent pathway." J Urol 181(6): 2749-59.
Ye, L, Lewis-Russell, JM, Kyanaston, HG, et al. (2007). "Bone morphogenetic proteins
and their receptor signaling in prostate cancer." Histol Histopathol 22(10): 1129-
47.
116
Ye, L, Lewis-Russell, JM, Kynaston, H, et al. (2007). "Endogenous bone morphogenetic
protein-7 controls the motility of prostate cancer cells through regulation of bone
morphogenetic protein antagonists." J Urol 178(3 Pt 1): 1086-91.
Yoo, J, Park, SS and Lee, YJ (2008). "Pretreatment of docetaxel enhances TRAIL-
mediated apoptosis in prostate cancer cells." J Cell Biochem 104(5): 1636-46.
Yuen, HF, Chan, YP, Cheung, WL, et al. (2008). "The prognostic significance of BMP-6
signaling in prostate cancer." Mod Pathol 21(12): 1436-43.
Zhang, M, Latham, DE, Delaney, MA, et al. (2005). "Survivin mediates resistance to
antiandrogen therapy in prostate cancer." Oncogene 24(15): 2474-82.
Zhang, S, Fei, T, Zhang, L, et al. (2007). "Smad7 antagonizes transforming growth factor
beta signaling in the nucleus by interfering with functional Smad-DNA complex
formation." Mol Cell Biol 27(12): 4488-99.
Zhong, C, Saribekyan, G, Liao, CP, et al. (2006). "Cooperation between FGF8b
overexpression and PTEN deficiency in prostate tumorigenesis." Cancer Res
66(4): 2188-94.
Zhong, C, Yang, S, Huang, J, et al. (2003). "Aberration in the expression of the retinoid
receptor, RXRalpha, in prostate cancer." Cancer Biol Ther 2(2): 179-84.

Asset Metadata

Creator Pham, Linda Kim (author)

Core Title Bimodal effects of bone morphogenetic proteins in prostate cancer

Contributor Electronically uploaded by the author (provenance)

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Molecular Microbiology & Immunology

Publication Date 04/18/2011

Defense Date 03/17/2011

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag angiogenesis,apoptosis,BMP2,BMP7,BMPs,Bone Morphogenetic Proteins,C4-2B,cancer associated fibroblasts,cE1,E8,JNK,Noggin,OAI-PMH Harvest,prostate cancer,Pten prostate cancer mouse model,SDF-1,Smad,survivin,tumor microenvironment

Language English

Advisor Roy-Burman, Pradip (committee chair), Tahara, Stanley M. (committee chair), Chuong, Cheng-Ming (committee member), Ou, Jing-Hsiung James (committee member)

Creator Email lindakimpham@hotmail.com,lindakph@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3752

Unique identifier UC1223293

Identifier etd-Pham-4480 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-441828 (legacy record id),usctheses-m3752 (legacy record id)

Legacy Identifier etd-Pham-4480.pdf

Dmrecord 441828

Document Type Dissertation

Rights Pham, Linda Kim

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email uscdl@usc.edu

Abstract (if available)

Abstract This dissertation describes observations made on the effect of bone morphogenetic protein (BMP) signaling in an aggressive human prostate cancer cell line, C4-2B, two murine prostate cancer cell lines, E8 and cE1, derived from the primary site of androgen dependent and recurrent tumors of prostate cancer, respectively, and primary cultures of murine cancer associated fibroblasts (CAFs). We previously described that BMP7 could protect C4-2B cells from serum starvation induced apoptosis by sustaining Survivin expression. We further examine the mechanisms behind BMP7 mediated protection from stress induced apoptosis. When C4-2B cells are treated with BMP7, we find that Survivin promoter activity correlates with Smad activation and is ameliorated by dominant negative Smad5. Furthermore JNK activity is also observed to be sustained by BMP7 treatment in the face of serum starvation and co-treatment with a JNK inhibitor abolished the anti-apoptotic effect of BMP7 in a survivin independent manner. Thus we found that anti-apoptotic activity of BMP7 is mediated by both Smad and JNK, albeit with autonomous mechanisms. Using primary cultures of CAFs, isolated from our conditional Pten deletion model of prostate cancer, we tested the effect of BMP2 and 7, both of which are upregulated during tumor growth. Interestingly, each BMP is able to induce secretion of the cytokine, SDF-1/CXCL12. SDF-1 secretion is correlated with Smad phosphorylation and can be blocked by Noggin treatment. BMP treatment increases pre-spliced SDF-1 mRNA and actinomycin D can block the induced secretion of SDF-1 by BMPs, indicating a transcriptional modulation of SDF-1 expression by BMP. Using human microvascular endothelial cells, we demonstrate that increased SDF-1 levels can stimulate tube formation in vitro, implicating a role in tumor angiogenesis. We also find that BMP can protect CAFs from stress induced apoptosis independent of SDF-1.