University of Southern California Dissertations and Theses

Genetic alterations in nuclear receptor coactivators in breast cancer

(USC Thesis Other)

Genetic alterations in nuclear receptor coactivators in breast cancer

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
GENETIC ALTERATIONS IN NUCLEAR RECEPTOR COACTIVATORS IN
BREAST CANCER

by

Anamaria Ioan Munteanu

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)

August 2010

Copyright 2010 Anamaria Ioan Munteanu

ii

Dedication
I dedicate this dissertation to my husband Dragos Stefan Munteanu and to
my parents Mariana and Adrian Ioan. Their invaluable support made possible the
accomplishment of this project.

iii

Acknowledgments
I would like to thank the Los Angeles County+USC Medical Center and the
Cooperative Human Tissue Network for providing frozen and paraffin embedded
tissue samples as well as the USC-Norris Tumor Repository and Dr Wendy
Cozen for providing paraffin embedded blocks of breast cancer tissue. The
USC/Norris Cancer Center DNA Core Facility provided the sequencing data for
the study and their helpful expertise. I would like to thank them for their
promptness and flexibility. I am grateful for the significant contribution of Melinda
Sue Epstein and Lucy Xia to the sequencing project. They participated in the
sequencing experiments and the extensive sequencing analysis. Dr. Amit Joshi
contributed with his expertise in statistical analysis, establishing the significant
associations described in the project. Technical assistance with the Tumor
Microarray and FISH experiments was provided by my colleagues Armen
Gasparyan, Angela Santiago, and Roberta Guzman. I appreciate the assistance
of all the volunteers involved in this project, Jillian Crocetti, Kyle Wong, Winnie
Luong, Michelle Ruan, Eric Welder, Andrew Wang, and Pradip Chandrasoma.
Finally I am grateful for the guidance provided by the members of my
Graduate Committee, Michael Stallcup, Chris Haiman, Alan Epstein, and my PI
Michael Press.
Thank you for all of your help.
iv

Table of Contents

Dedication ii

Acknowledgments iii

List of Tables vi

List of Figures vii

Abstract viii

Chapter 1: Background 1
1.1 The Genetic Foundation of Cancer 1
1.2 Risk Factors of Breast Cancer 2
1.3 Hormone Receptor Pathway in Breast Cancer 3
1.4 Nuclear Receptor Coactivators 5

Chapter 2: Characterization of the Study Population 13
2.1 Selection of the Study Population 13
2.2 Materials and Methods 16
2.3 Patient Characteristics and Tumor Markers 21

Chapter 3: Sequence Alterations in Nuclear Receptor Coactivators 25
3.1 Introduction 25
3.1.1 Polymorphisms 26
3.1.2 Somatic Mutations 27
3.2 Materials and Methods 29
3.3 Results 34
3.3.1 Inherited DNA Variations in Nuclear Receptor Coactivators 34
3.3.2 Somatic Mutations in Breast Cancer 48
3.3.3 Summary 54
3.4 Conclusions 60
3.4.1 SNPs 60
3.4.2 Somatic Mutations 61

Chapter 4: Gene Amplification in Nuclear Hormone Receptor Coactivators 62
4.1 Introduction 62
4.1.1 Gene Amplification and Breast Cancer Markers 62
4.1.2 Co-Amplification of Genes in Breast Cancer 65
4.1.3 Breast Cancer Subtypes and Gene Amplification Profiles 67
4.1.4 Nuclear Receptor Coactivator Genes on Chromosome 20 72
4.2 Materials and Methods 74
v

4.3 Results 82
4.3.1 Amplification and Overexpression of Nuclear Receptor
Coactivators in Cell Lines 82
4.3.2 Co-Amplification of Coactivator Genes on Chromosome 20 in
Breast Cancer Samples 87
4.4 Discussion 91
4.4.1 Breast Cancer Cell Lines 91
4.4.2 Breast Cancers Samples 92

Chapter 5: Implications of Genetic Alterations in Breast Cancer Therapy 96
5.1 Contemporary Treatment in Breast Cancer 96
5.2 Genetic Profiling in Breast Cancer Treatment 98

Chapter 6: Overall Conclusions 101
6.1 Conclusions 101
6.2 Future Directions 103
6.3 Study Significance 105

Bibliography 106

Appendix 119

vi

List of Tables
Table 1.1 Candidate Nuclear Receptor Coactivator genes 6

Table 2.1 Characterization of the Study Population 15

Table 2.2 Samples Organization in the Tissue Microarray 19

Table 2.3 Characterization of Biomarkers in Breast Cancers from Paraffin
Embedded Tissue Sections 24

Table 3.1 Distribution of Breast Cancer Patients with Sequence Variations,
Classified by Ethnicity 43

Table 3.2 NCOA3 Genotype Frequency in the Study Population 46

Table 3.3 Different Sequence Variations Identified in Nuclear Receptor
Coactivator Genes 55

Table 4.1 Cell Lines Classification by Breast Cancer Subtype 71

Table 4.2 Cell Lines Characterization by Breast Cancer Subtype, Breast
Cancer Markers, and Coactivators Amplification Status 86

Table 4.3 Increased Gene Copy Number and Amplification in Breast Cancer
Samples 88

Table 1 List of All Genetic Alterations Identified in the Genes of Interest,
Breakdown by Ethnicity 119

vii

List of Figures
Figure 1.1 Structural and Functional Domains of Candidate Nuclear Receptor
Coactivator Proteins 12

Figure 2.1 The Tissue Microarray – H&E and IHC Staining 18
Figure 3.1 Non-Synonymous Sequence Alterations in Nuclear Receptor
Coactivators 57

Figure 4.1 Heatmap of Chromosome 20 84

viii

Abstract
Steroid hormones play an important role in the development of breast
cancer. Genetic alterations involving hormone receptor coactivator genes in
breast cancer cells may influence tumor development by altering patterns of
transcriptional activation or repression of target genes in hormone pathways.
These alterations might cause changes in gene expression of key proteins
involved in cellular homeostasis initiating proliferative changes providing a
survival, growth, or expansion advantage for the cells containing the alterations.
Snap-frozen samples of breast cancer were analyzed for sequence
alterations in coactivator genes involved in the estrogen receptor pathway
(NCOA1, NCOA2, NCOA3, NCOA5, NCOA6, FLII, ZNF282, CARM1, and
CALCOCO1). Sequence alterations were characterized as somatic mutations
(SM), polymorphisms (SNPs), or short tandem repeat variations. Paraffin-
embedded samples were used to assess gene copy number in coactivator genes
located on chromosome 20q (NCOA3 NCOA5 and NCOA6), a region known to
be amplified in breast cancer. The study population was comprised of 115
African-American, Latina, Asian, and Caucasian women diagnosed with breast
cancer. A Fisher exact test was used to evaluate the correlation between the
presence of genetic alterations and clinical and pathological patient
characteristics as well as tumor biomarkers.
ix

Somatic mutations were identified in three genes (3/9), non-synonymous
SNPs were identified in seven genes (7/9), short tandem repeat variations were
identified in two genes (2/2) and amplifications were identified in three genes
(3/3). Somatic mutations were located in the C-terminal regions of NCOA3,
NCOA6 and FLII genes of four different breast cancers (4/115, 3.5%). There
were no significant correlations between these mutations and the factors
considered in the analysis.
Non-synonymous SNPs were present at 33 different locations in 69 cases,
synonymous SNPs were identified at 36 locations in 97 cases and short tandem
repeat variations were identified in the polyglutamine region of NCOA3 or
NCOA6 genes in 72 tumors. There were significant correlations detected
between specific SNPs identified in the sequences of coactivator genes and
patient ethnicity.
Polyglutamine region alterations were identified in NCOA3 and NCOA6.
There were significant correlations between the specific genotypes of NCOA3
polyglutamine repeats with age at diagnosis and the presence or absence of
lymph node metastasis in these patients.
Increased copy number was identified in 31 samples (31/115, 27%) in one
or more of three genes: NCOA3, NCOA5 and NCOA6 and coamplification of all
three genes was identified in 12 samples. The presence of increased gene copy
number in these coactivators was correlated with HER2 amplification.
x

Nuclear receptor coactivators were relatively conserved. Few alterations
were identified in the coding sequences and amplification status of the studied
genes in breast cancers. The novel somatic mutations were found in functionally
important regions of these genes and might have significant functional influence
on the encoded protein, in breast epithelial cells.

1

Chapter 1: Background
1.1 The Genetic Foundation of Cancer
Cancer is the result of accumulating multiple sequential mutations in
genes encoding for protein members of key cellular transduction pathways (the
somatic mutation theory of carcinogenesis) (Blagosklonny, 2005; Vogelstein &
Kinzler, 1993, 2004). Cells containing these genetic alterations acquire tumor-like
attributes, such as low sensitivity to regulatory signals, limitless proliferation
capacity, impaired apoptotic regulatory mechanisms and enhanced migration,
invasion, and angiogenesis potential (Hanahan & Weinberg, 2000). Their
functional attributes provide these altered cells with a growth advantage that
leads to tumorigenesis.
All cancers are genetic in origin due to an accumulation of genetic errors
which result in tumor formation. These genetic alterations may arise at the
somatic level, as occurs in sporadic cancers, or may be inherited through the
germline, in which case they are hereditary. There are four general classes of
genetic alterations which can occur in cancers (Lengauer, Kinzler, & Vogelstein,
1998): translocations (reciprocal exchange of portions of different chromosomes
with one another), aneuploidy (alteration in chromosome number), amplifications
2

(multiple repeats of large regions of a chromosome), and mutations at the base-
pair level (substitutions, insertions, and deletions).
1.2 Risk Factors of Breast Cancer
Breast cancer is one of the most frequent and most studied human
cancers. It is one of the most commonly diagnosed cancers in women and is the
second leading cause of death for women, accounting for approximately 23% of
all female deaths in the United States each year. Many risk factors contribute to
its frequent occurrence, such as high-fat diet, increased alcohol use, high body
mass index, UV-exposure, as well as physiologic factors such as older age at
first birth, young age at menarche, older age at menopause (Veronesi, Boyle,
Goldhirsch, Orecchia, & Viale, 2005). Studies show an increased risk of breast
cancer associated with the presence of high estrogen hormone levels in the
blood, either endogenous, or administered for therapeutic purposes (James D.
Yager & Nancy E. Davidson, 2006).
Genetic disorders are also important predisposing factors. Breast cancer
represents a heterogeneous group of diseases with diverse genetic profiles
involving somatic mutations, gene amplification, and variable gene expression
(Lin et al., 2007; Sjoblom et al., 2006; Wood et al., 2007). Genetic modifications
either inherited or acquired are important mechanisms of oncogenesis affecting
the function of over a thousand genes participating in multiple signal transduction
3

pathways involved in breast cancer initiation and progression. Among them,
genes involved in hormone receptor pathways and in growth receptor pathways
are responsible for increased growth and proliferation of breast cancer cells.
1.3 Hormone Receptor Pathway in Breast Cancer
The events triggered by steroid hormones and their receptors can be
responsible for the transcriptional regulation of numerous target genes involved
in cell growth, differentiation, and resistance to apoptosis in breast cancer cells
(Herynk & Fuqua, 2004).
Steroid receptors are part of the nuclear hormone receptor superfamily of
transcription factors, and their actions are initiated by the binding of specific
hormone ligands. In the context of steroid hormone-mediated carcinogenesis, an
important role is played by the estrogen receptors and their ligands (17 β
estradiol, estrone, and estriol) (Hart & Davie, 2002; J. D. Yager & N. E. Davidson,
2006). Although there are two subtypes of estrogen receptors, ER α and ER β, a
strong association was proven to exist between ER α and breast cancer (Herynk
& Fuqua, 2004). Estrogen receptor alpha is the main component for estrogen-
induced responsiveness in all ER expressing cells. The classical effector
pathway for ER is dimerization upon activation by estrogen hormones followed
by binding of the dimer to estrogen responsive gene promoters through an
estrogen responsive element (ERE) (J. D. Yager & N. E. Davidson, 2006).
4

Activation and repression of transcription of ER target genes involves the
participation of nuclear protein regulators known as coactivators (Glass &
Rosenfeld, 2000; Smith CL, 2004). When recruited by ER, coactivators facilitate
transcriptional activation by promoting histone modification, by engaging RNA
polymerase II and by recruiting other proteins to the complex (Y. H. Lee, Koh,
Zhang, Cheng, & Stallcup, 2002; R. C. Wu, Smith, & O'Malley, 2005). In contrast,
in the absence of estrogen, ER will recruit corepressors, resulting in the inhibition
of transcription of estrogen regulated genes (Glass & Rosenfeld, 2000; Leo &
Chen, 2000). Each protein participating in the formation of the nuclear receptor
coactivator complex has a distinctive role in the complex. Coactivators have the
important role of determining the configuration of the coactivator complex and
subsequently the target genes for ER mediated transcriptional activation.
Although there are over 200 proteins known to be involved in steroid-
triggered response ("NURSA"), little is known about genetic alterations of the
members in this pathway. As a key component of estrogen driven pathway, ER
has been the main target of research involving point mutation and gene
amplification analysis (Brown et al., 2008; Conway et al., 2005; Herynk & Fuqua,
2004; Holst et al., 2007; Horlings et al., 2008; Reis-Filho et al., 2008; Tebbit,
Bentley, Olson, & Marks, 2004; Vincent-Salomon, Raynal, Lucchesi, Gruel, &
Delattre, 2008; Zhang et al., 2003). Few studies have focused on identifying
genetic alterations in the ER coactivator genes in breast cancer. We analyzed
the genes encoding nine ER coactivators in breast carcinomas from 115 women
5

diagnosed with infiltrating ductal carcinoma, the most frequent type of breast
cancer. We have assessed the prevalence and ethnic distribution of sequence
alterations and amplifications in this group of coactivators.
1.4 Nuclear Receptor Coactivators
The selected candidate genes (Table 1.1) encode nuclear receptor
coactivators which bind directly to ER, the p160 family of coactivators (NCOA1,
NCOA2, and NCOA3)(S. L. Anzick et al., 1997; McKenna & O'Malley, 2002),
NCOA5 (Sauve et al., 2001), and NCOA6 (S. K. Lee et al., 1999), as well as
secondary coactivators recruited to the coactivator complex formed by the p160
members. Among those, we selected coactivator-associated arginine methyl
transferase-1 (CARM1) (Y. H. Lee et al., 2002), calcium binding and coiled
domain 1 (CALCOCO1) (Kim, Li, & Stallcup, 2003), flightless-I (FLII) (Y. H. Lee,
Campbell, & Stallcup, 2004), and zinc-finger protein 282 (ZNF282) (Jeong Hoon
Kim, and Michael R. Stallcup, unpublished data).

6

Table 1.1 Candidate Nuclear Receptor Coactivator genes
* members of the p160 family of coactivators
The structural and functional domains of candidate nuclear receptor
coactivator proteins are presented in Figure 1. They have been studied
intensively and characterized, but the substrates for their respective molecular
functions are still not completely understood for all the coactivators.
The p160 family of coactivators is composed of three proteins: NCOA1,
NCOA2, and NCOA3. They are considered primary coactivators which bind
directly with ER and recruit other coactivators in the complex. There is high
homology in the functional domains of the members of this family (Leo & Chen,
2000).
The N-terminus of these proteins contains a basic helix loop
helix/Per/ARNT/Sim (bHLH-PAS) motif which is usually involved in DNA binding,
and in heterodimerization. The putative DNA binding site is very well conserved
in the p160 family (Leo & Chen, 2000), but there is no clear evidence for the DNA
GENE
Accession
number
Genome
location
Number
of Exons
RNA
(bp)
Protein
NCOA1/SRC1* NM_003743 2p23 21 6895 157 kda (1441aa)
NCOA2/TIF2/GRIP1* NM_006540 8q13 23 6157 159 kda (1464aa)
NCOA3/SRC3/AIB1* NM_181659 20q13 23 7996 155 kda (1424aa)
NCOA5/ KIAA1637 NM_020967 20q12-13.2 8 3209 65 kda (579aa)
NCOA6/AIB3/ASC2/ NM_014071 20q11 15 7062 219 kda (2063aa)
ZNF282/HUB1 NM_003575 7q21 8 3736 74kda (671aa)
FLII NM_002018 17p11 30 4176 144kda (1269aa)
CALCOCO1/KIAA1536 NM_020898 12q13 15 3046 77 kda (691aa)
CARM1/PRMT4 NM_199141 19p13 16 2968 66 kda (608aa)
7

binding function of this domain in any of the family members. There is however
evidence for its implications in protein-protein interaction with the coiled-coil
coactivator (CALCOCO1) (Kim et al., 2003). Downstream of the HLH-PAS
domain there is a serine-threonine (S/T) rich region that is phosphorylated at
specific sites (R. C. Wu et al., 2004; R. C. Wu et al., 2005). Nuclear receptor
binding is facilitated through a receptor interaction domain (RID) located in the
middle of these coactivators (R. C. Wu et al., 2005). This region contains leucine
rich motifs (LXXLL) responsible for the protein-protein interaction with the
activation function domain 2 (AF2) on nuclear receptors. LXXLL motifs are also
present in the coactivator interaction domains (CID). The CID contains the
activation domain 1 (AD1), involved in protein-protein interactions with other
coactivators (CBP/ p300) (H. Chen et al., 1997; Leo & Chen, 2000; Liao et al.,
2002). The C-terminus of the proteins contains a second activation domain, AD2,
with a role in protein-protein interaction with CARM1 (D. Chen, Huang, &
Stallcup, 2000), and in the case of NCOA1 and NCOA3 it also contains a HAT
domain that provides an intrinsic acetyltransferase function (H. Chen et al.,
1997). A region of interest contained by all p160 coactivators is the polymorphic
polyglutamine (polyQ) sequence. In NCOA3 this region is larger than in the other
members of the family and is located close to the C-terminus of the protein. This
domain has been shown to be variable and somatically unstable in breast
cancers.
8

An important aspect involving the NCOA3 gene is that it has been shown
to be amplified in about 10 % of breast cancers (S. L. Anzick et al., 1997; Azorsa,
Cunliffe, & Meltzer, 2001; Bautista et al., 1998; Glaeser, Floetotto, Hanstein,
Beckmann, & Niederacher, 2001). It is located on the q arm of chromosome 20
which has multiple regions of amplification. Two other genes coding for nuclear
receptor coactivators are located on the same arm with NCOA3 on chromosome
20, in regions susceptible to amplification, NCOA6 in region 20q11 and NCOA5
in region 20q13 (Guan et al., 1996; M. M. Tanner et al., 1995; M. M. Tanner et
al., 1996).
NCOA5 protein is also called CIA (coactivator independent of AF-2
function) since it was characterized as interacting with nuclear receptors in an
AF-2 independent manner (Sauve et al., 2001). It can act as an activator and a
repressor. It can also bind with estrogen receptor alpha in vitro in the presence of
estradiol (AF-2 dependent binding) and enhance its transcriptional activation
functions. NCOA5-ER interactions are mediated by bifunctional NR boxes which
contain LxxLL and FxxFF motifs (Sauve et al., 2001).
NCOA6 is an important coactivator not only in the steroid hormone
pathway, but also in apoptosis and cell cycle regulating pathways and it has been
shown to be amplified and overexpressed in breast cancer (S. L. Anzick et al.,
1997; Caira, Antonson, Pelto-Huikko, Treuter, & Gustafsson, 2000; S. K. Lee et
al., 1999; Mahajan & Samuels, 2005; Zhu et al., 2000). It presents as multiple
9

splice variants but generally contains two activation domains, one located in the
N-terminal region and a second centrally located activation domain, both rich in
glutamine and proline residues. NCOA6 also contains two NR boxes with LXXLL
motifs with important roles in binding of nuclear receptors. The protein can
function as a dimer and can repress its own function through an inhibitory region
rich in serine, threonine and leucine residues located at the C-terminus (Mahajan
& Samuels, 2000, 2005).
The binding of one of the primary coactivators in the p160 family to the
activated ER dimer is an essential event leading to the formation of the
coactivator complex. This triggers a signaling cascade by engaging other
coactivators with distinctive roles that increase the coactivator function of nuclear
hormone receptors. Acetyl transferases and methyl transferases accomplish
histone acetylation and methylation and greater chromatin accessibility (Y. H.
Lee et al., 2002). CARM1, CALCOCO1, FLII and ZNF282 are secondary
coactivators which can participate in the coactivator complex recruited by the
p160 family of proteins, and especially by GRIP1 (Kim et al., 2003; Y. H. Lee et
al., 2004; Y. H. Lee et al., 2002). They cooperate with CBP and P300 towards
opening of chromatin and leading to enhanced transcription.CARM1 is an
arginine methyl-transferase involved in histone H3 chromatin remodeling during
activation of transcription. In its central region CARM1 contains a domain similar
to other arginine methyl transferases, a region which mediates binding to the C-
terminal AD2 domain of p160 coactivators (D. Chen et al., 1999). However, the
10

N-terminal region of p160 coactivators can recruit other coactivators,
CALCOCO1 and FLII. CALCOCO1 has two activation domains and three coiled-
coil domains. It binds to GRIP1 (central coiled-coil region), and p300 (C-terminal
AD) (Kim et al., 2003). FLII is a newly described member of the nuclear receptor
coactivator family. It contains 16 leucine-rich repeats with a role in protein-protein
interaction and 2 gelsolin-like repeats with a role in actin binding. Both regions
contribute to the coactivator function of FLII. The protein binds to CARM1, GRIP1
and ER within the coactivator complex (Y. H. Lee et al., 2004). ZNF282 is
another GRIP1 coactivator, and is part of the Krueppel C2H2-type zinc finger
protein family. It is a small protein containing five C2H2-type zinc fingers and one
KRAB domain.
In the normal tissue there is equilibrium with a natural degree of variation
in the expression and distribution of these proteins at cellular level, among
different organs and among different ethnic populations. Variation occurs due to
post-translational modifications of the proteins which can determine their
degradation or accumulation in the cell and their distribution within different
cellular compartments. There is variation throughout the tissues in the body due
to the diverse level of expression of different isoforms of nuclear receptor
coactivators. There is also variation in the sequence of these proteins in the
general population due to inherited alterations (SNPs). During tumorigenesis the
state of equilibrium is affected, bringing qualitative and quantitative changes in
the expression of different classes of proteins. Modifications in the normal
11

structure or cellular concentration of any of the nuclear receptor coactivators
could lead to perturbation in this finely tuned process of regulation of transcription
initiation of estrogen-responsive genes. This study describes the types of genetic
variations identified in nine members of ER driven pathway, the co-localizations
of these genetic aberrations in breast tumor samples, and the correlations
between different types of DNA variations. This analysis at DNA level lays the
foundation for further studies involving subsequent functional implications of
these alterations.
12

Figure 1.1 Structural and Functional Domains of Candidate
Nuclear Receptor Coactivator Proteins
Figure legend: PAS/bHLH- PER/ARNT/SIM motif, basic motif, helix-loop-helix region; CID-
coactivator interaction domain; RID- receptor interaction domain; HAT- histone acetyl-transferase
activity domain; KRAB- Kruppel associated box; AD, AD1, AD2- activation domains; Co- coiled
coil domain; PRMT-protein arginine methyl-transferase domain; DD-dimerization; LRR- leucine-
rich repeat; M- methionine rich region; S- serine rich region; Q- glutamine rich region; P- proline
rich region; K-lysine rich region; A-alanine rich regionR/N- arginine/ asparagine rich region; STL-
serine/threonine/leucine rich region("Uniprot http://www.uniprot.org/uniprot/,").
(Note: not drawn to scale)
13

Chapter 2: Characterization of the Study Population
2.1 Selection of the Study Population
The study population consisted of 115 cases of breast cancer selected
from the tissue bank to represent four different ethnic groups: African-American,
Hispanic, Asian, and Caucasian women. The number of patients analyzed for
each gene varied with tumor tissue availability. The study design permitted a
higher than 80% power to discover genetic alterations with a frequency as low as
1% in a population of at least 93 patients in all the genes of interest, and a higher
than 85% power to discover genetic alterations with a frequency as low as 5% in
each ethnic group containing at least 20 patients.
In this study snap frozen breast cancer tissue specimens were collected
from LAC/USC County Hospital and the Cooperative Human Tissue Network.
Corresponding formalin-fixed paraffin-embedded tumor and normal tissue blocks
were collected for 113 of the patients in the study population. All frozen
specimens were stored in liquid nitrogen prior to analysis and selection. Each
sample included in the study had 70% or more infiltrative ductal carcinoma cells
(DCIS cases were not included), as evaluated in a hematoxylin-and-eosin
stained slide. Therefore, contaminating normal DNA was estimated to be less
than 30% of the DNA extracted from the fresh-frozen specimens. The DNA was
used for sequencing analysis and identification of mutated cancer samples.
14

A complete pathology report was obtained for 110 of 115 patients in the
study. Information was collected for these women on age at diagnosis, as well as
tumor characteristics used for the traditional classification of breast cancer.
Factors considered for categorization and treatment decisions in breast cancer
patients are anatomical disease attributes including microscopic histopathologic
classification, histological grade, tumor size, and involvement of axillary lymph
nodes, as well as molecular characteristics of tumors including presence or
absence of steroid hormone receptors (ER and PR) and HER2 gene
amplification and overexpression. Histological grade was assessed according to
the most common cancer grading system, the Scarff-Bloom-Richardson (Bloom
& Richardson, 1957) system scoring samples as Grade 1 (well-differentiated
adenocarcinoma), Grade 2 (moderately-differentiated), or Grade 3 (poorly-
differentiated). Tumor size as well as the number of involved lymph nodes were
described and classified in conformity with the TNM classification system, where
T refers to the size of the primary carcinoma, N characterizes involvement of
axillary lymph nodes, and M refers to the extent of metastatic disease.
Designations for tumor size are: T1-<2cm in diameter, 2< T2<5cm in diameter,
T3>5cm in diameter. Lymph node (LN) metastasis are designated as N0, no
lymph node involved, N1, less than 3 lymph nodes involved, N2, 4-9 lymph
nodes, and N3-more than 10 lymph nodes involved. Biomarker status was
determined for ER, PR and HER2 by immunohistochemistry and FISH on 113
patients with available paraffin-embedded tumor tissue blocks (Table 2).
15

Table 2.1 Characterization of the Study Population

Estrogen
Receptor (IHC)
Progesterone
Receptor (IHC)
HER2
(IHC and FISH)
Cohort
+ - + - + - + - total
Age at diagnosis
<40 6 (50) 6 (50) 5 (42) 7 (58) 3 (25) 9 (75) 12 0 12 (11)
40-49 21 (62) 13 (38) 14 (41) 20 (59) 5 (15) 29 (85) 34 0 34 (31)
50-59 18 (58) 13 (42) 13 (42) 18 (58) 7 (23) 24 (77) 31 2 33 (30)
60-69 10 (45) 12 (55) 6 (27) 16 (73) 4 (18) 18 (82) 22 0 22 (20)
>70 4 (44) 5 (56) 3 (33) 6 (67) 4 (44) 5 (56) 9 0 9 (8)
total
analyzed
59 (55) 49 (45) 41 (38) 67 (62) 23 (21) 85 (79) 108 2 110*
unknown
age
2 3 1 4 3 2 5 0 5
Race/ethnicity
Afr-Am 10 (38) 16 (62) 7 (27) 19 (73) 7 (27) 19 (73) 26 1 27 (23.5)
Asian 20 (65) 11 (35) 13 (42) 18 (58) 9 (29) 22 (71) 31 0 31 (27)
Cauc 10 (38) 16 (62) 5 (19) 21 (81) 7 (27) 19 (73) 26 1 27 (23.5)
Hisp 21 (70) 9 (30) 17 (57) 13 (43) 3 (10) 27 (90) 30 0 30 (26)
total
analyzed
61 (54) 52 (46) 42 (37) 71 (63) 26 (23) 87 (77) 113 2 115
Tumor size (cm)
<2 13 (68) 6 (32) 10 (53) 9 (47) 3 (16) 16 (84) 19 0 19 (19)
2 to 5 27 (53) 24 (47) 19 (37) 32 (63) 14 (27) 37 (73) 51 0 51 (50.5)
>5 13 (43) 17 (57) 7 (23) 23 (77) 5 (17) 25 (83) 30 1 31 (30.5)
total
analyzed
53 (53) 47 (47) 36 (36) 64 (64) 22 (22) 78 (78) 100 1 101*
unknown
size
8 5 6 7 4 9 13 1 14
Tumor grade
1 1 (100) 0 (0) 1 (100) 0 (0) 0 (0) 1 (100) 1 0 1 (1)
2 22 (71) 9 (29) 16 (52) 15 (48) 6 (19) 25 (81) 31 0 33 (32)
3 32 (46) 38 (54) 21 (30) 49 (70) 15 (21) 55 (79) 70 0 70 (67)
total
analyzed
55 (54) 47 (46) 38 (37) 64 (63) 21 (21) 81 (79) 102 2 104*
unknown
grade
6 5 4 7 5 6 11 0 11
Lymph node status
Negative 15 (41) 22 (59) 13 (35) 24 (65) 7 (19) 30 (81) 37 0 37 (39)
1-3 LN 9 (45) 11 (55) 7 (35) 13 (65) 4 (20) 16 (80) 20 0 20 (21)
4-9 LN 15 (75) 5 (25) 9 (45) 11 (55) 4 (20) 16 (80) 20 0 20 (21)
>10 LN 7 (41) 10 (59) 2 (12) 15 (88) 6 (35) 11 (65) 17 1 18 (19)
total
analyzed
46 (49) 48 (51) 31 (33) 63 (67) 21 (22) 73 (78) 94 1 95*
unknown
meta
15 4 11 8 5 14 19 1 20
TOTAL
Cohort
61 (54) 52 (46) 42 (37) 71 (63) 26 (23) 87 (77) 113 2 115
*Information was not available for all patients included in the analysis
16

2.2 Materials and Methods
Tissue Microarrays (TMA)
Paraffin embedded tumor tissue blocks were organized in a tissue
microarray format containing the breast cancer tissue cores (Figure 2.1). The
tissue architecture of the available blocks was evaluated with hematoxylin-and-
eosin stained tissue sections by light microscope. Tissue representative for
carcinoma was sampled from each case using a Beecher tissue microarrayer
with a 0.6 mm core needle as described (Kononen et al., 1998). The individual
cases were arranged by column and row as summarized in Table 2.2. Four
micron TMA sections were mounted on slides, and used for IHC and FISH
analyses as described below.
Immunohistochemistry (IHC)
ER and PR and HER2 expression were characterized by IHC using tissue
microarrays. IHC staining was performed using the following primary antibodies:
a monoclonal mouse anti-ER IgG antibody, 6F11 (Abcam) at 5ug/ml dilution
(1:50 of the manufacturer concentration), a monoclonal mouse anti-PR IgG
antibody, PgR636 DAKO) at 6ug/ml dilution, and a monoclonal mouse anti-
HER2 antibody, 10H8 (in house) at 4ug/ml dilution. A goat anti-mouse antibody
conjugated to HRP-labeled-dextran polymer (DAKO) was used as the secondary
antibody. The immunoperoxidase technique was conducted using antigen
17

retrieval for ER and PR but not HER2 (M. Press et al., 2002; Press et al., 2005;
M. F. Press et al., 2002).The slides were dried at 60C, deparaffinized in xylene,
then rehydrated in graded ethanols, bleached for endogenous peroxidase (3%
H2O2 in PBS), and blocked with 10% normal goat serum prior to the addition of
the primary antibody. In the case of the ER and PR staining the protocol included
antigen retrieval by heating for 1 hour in 0.1M citrate buffer. Next, the slides were
incubated for one hour at room temperature with the primary antibody and then
rinsed in PBS, and incubated with the secondary antibody for 30 minutes. The
last steps of the procedure involved drop-wise addition to the slides of the DAB
substrate solution (BioGenex Inc.) and then counterstaining with Ethyl -Green
solution. A positive control and a normal mouse IgG negative control was
included in every staining procedure. ER/PR immunostaining was evaluated in at
least 100 cells for each case. The percentage of nuclei with weak (1+), moderate
(2+) and strong (3+) immunostaining was recorded. The samples with less than
10% of tumor nuclei stained were interpreted as negatively stained. The samples
with more than 10 % of nuclei stained were considered positively stained for
ER/PR. The interpretation for HER2 staining was subjectively interpreted
according to the presence of tumor cell membrane staining as follows: 1+ for
detectable but weak staining, 2+ for moderate staining intensity, and 3+ for
strong staining. Absence of HER2 staining (0, 1+) was considered normal, and
moderate (2+) or strong staining (3+) was interpreted as HER2 overexpression.

18

Figure 2.1 The Tissue Microarray – H&E and IHC Staining
Figure legend: A-organization of the tissue microarray by rows and columns, H&E staining; B-5X
enlarged view of boxed region, samples 1a, 2a, and 3a, H&E staining; C-20X magnification of
individual samples in the tissue microarray; IHC staining: 1i-ER staining using 6F11 antibody, 1h-
PR staining using PgR636 antibody, and 1g-HER2 staining using 10H8 antibody.

19

Table 2.2 Samples Organization in the Tissue Microarray
Case
ID row site
Case
ID row site
Case
ID row site
Case
ID row site
2956 1 a 5402 4 a 2474 7 a 549 10 a
3087 1 b 5420 4 b 3071 7 b 588 10 b
2966 1 c 5422 4 c 3140 7 c 1019 10 c
2523 1 d 5423 4 d 2961 7 d 1826 10 d
2990 1 e 5446 4 e 2250 7 e 2070 10 e
2952 1 f 5448 4 f 2494 7 f 2190 10 f
2929 1 g 5112 4 g 3524 7 g 2194 10 g
2236 1 h 5449 4 h 5004 7 h 2196 10 h
3222 1 i 5450 4 i 3473 7 i 2220 10 i
2255 1 j 5451 4 j 5404 7 j 2225 10 j
3192 1 k 5452 4 k 5424 7 k 2235 10 k
2835 1 l 5011 4 l 5419 7 l 2459 10 l
2548 2 a 3333 5 a 5445 8 a 2475 10 m
2481 2 b 2965 5 b 5434 8 b 3198 10 n
3733 2 c 3250 5 c 5456 8 c 3416 10 o
2585 2 d 2550 5 d 5428 8 d
1592 2 e 3548 5 e 5191 8 e
2940 2 f 2357 5 f 5463 8 f
2696 2 g 2478 5 g 5050 8 g
3520 2 h 3107 5 h 5467 8 h
5037 2 i 5069 5 i 5477 8 i
5092 2 j 5130 5 j 5417 8 j
5115 2 k 5063 5 k 3415 9 a
5039 2 l 5033 5 l 3077 9 b
3419 3 a 5016 6 a 5545 9 c
3261 3 b 5132 6 b 5486 9 d
3684 3 c 5176 6 c 5636 9 e
3700 3 d 5228 6 d 2988 9 f
3702 3 e 5409 6 e 3036 9 g
3331 3 f 5070 6 f 3011 9 h
5060 3 g 5077 6 g
5064 3 h 5098 6 h
5113 3 i 5121 6 i
5164 3 j 5150 6 j
5405 3 k 3076 6 k
5410 3 l 3096 6 l

20

Fluorescent In Situ Hybridization (FISH)
The amplification status of HER2 in the breast cancer tumors was
assessed by fluorescent in situ hybridization (FISH), using a gene-specific probe
which anneals to HER2 (Press et al., 2005). The paraffin-embedded tumors on a
TMA slide, a negative control from a HER2 non-amplified sample, as well as a
positive amplification control from an HER2 amplified cell line (SKBR3) were all
processed in the same time. The processing procedure included
deparaffinization, pretreatment and fixation steps which were completed in a
VP2000 tissue processor using the Paraffin Pretreatment Reagent kit (Abbott-
Vysis, Inc). Deparaffinization steps included baking overnight at 56C, Citrisolv for
10 minutes and 100% ethanol for 5 minutes. Pretreatment steps were: 0.2N HCL
for 20 minutes, pretreatment solution (80°C) for 30 minutes, then digestion with
protease (37°C) for 15 minutes. Fixation was carried out in neutral buffered
formalin and a series of graded alcohols: 70%, 95%, and 100%. The slides were
air dried, denatured at 72C for 5 minutes and then dehydrated in alcohols prior to
probe mixture hybridization and incubation at 37C overnight. The fluorescent
probe mixture was purchased from Abbott-Vysis Inc and contained the HER2
specific probe directly labeled with Spectrum Orange, fluorescence, mixed with a
chromosome 17 specific probe labeled with Spectrum Green. The nuclei were
counterstained with an intercalating fluorescent counterstain (DAPI).The number
of signals was assessed by fluorescence microscopy with a Zeiss Axioplan2
microscope (Carl Zeiss). Signals were counted in at least 20 interphase tumor
21

cell nuclei from at least two different microscopic fields. The ratio of HER2
signals to chromosome 17 centromere signals was calculated by dividing the
average HER2 signals per cell to the average chromosome 17 signals per cell. If
the ratio was higher than 2.0 then the sample was considered to have HER2
gene amplification as approved by the U.S. Food and Drug Administration.
2.3 Patient Characteristics and Tumor Markers
The study population was comprised of 115 women with breast cancer,
classified by ethnicity into 27 African-American, 30 Latina, 31 Asian, and 27
Caucasian (Table 2.1). There were 65 women (59%) less than 54 years of age,
and 45 women (41%) older than 54 years of age at diagnosis. With regard to
tumor grade, 34 patients (33%) had well differentiated or moderately
differentiated carcinomas (grade1 and 2) and 70 patients (67%) had poorly
differentiated adenocarcinomas (grade 3). With regard to tumor size, 19 patients
(19%) had small tumors (T1), and 82 patients (81%) had tumors T2 and T3
cancers, larger than 2 cm in diameter. With regard to lymph node metastasis 37
patients (39%) had no lymph node involvement and 58 patients (61%) had lymph
node metastases at the time of diagnosis.
Sixty one of 113 (54%) breast carcinomas were ER positive, and 52 (46%)
were ER negative. Out of 61 ER positive carcinomas, 42 (69%) were also
positive for PR while 19 (31%) were PR negative (Table 2.3). There were no PR
22

positive tumors that lacked ER. Therefore the overall number of PR positive
cases was of 42 (37%), and the overall number of PR negative cases was of 71
(63%). The prevalence of ER positive tumors (p=0.024) and the prevalence of
PR positive tumors (p=0.02) was higher among women of Hispanic and Asian
ethnicity and lower in women of Caucasian and African-American ethnicity.
HER2 gene amplification was analyzed by FISH in 109 samples of 113
available cases, with 26 cancers demonstrating HER2 amplification (Table 2.3A).
HER2 overexpression by IHC was identified in 22 (19%) out of 113 cases. Four
cases with HER2 amplified breast cancers by FISH, which showed no
immunostaining by IHC, were classified as HER2 positive. Therefore, 26 women
were considered to have HER2 amplified breast cancers distributed across all
ethnic groups: three Hispanic, seven Caucasian, seven African American and
nine Asian (Table 2.1). Four samples failed analysis by FISH, and were scored
negative by IHC. Since we observed a high correlation between the two methods
for assessing HER2 receptor activity (97%, p<0.01), cases lacking HER2 FISH
results were classified according to their HER2 IHC status. Thus 87 (77%) of 113
tumors were considered HER2 negative. Out of 26 HER2 positive tumors, 18
(70%) were ER negative and PR negative, 6 (23%) were ER-positive and PR-
negative, and 2 (7%) were ER-positive and PR-positive (Table 2.3B). Among the
HER2-negative tumors, 34 were “triple negative” tumors that lacked expression
for ER, PR and HER2. These cases were identified in all ethnic groups, 10
23

African American, 6 Asian, 11 Caucasian, and 7 Hispanic women, and
represented 30% of all women in this study evaluated for tumor markers.
Patient and tumor characteristics of the study population showed
distinctive features most likely related to the requirement that specimens be
composed of at least 70% carcinoma cells, in order to facilitate our analysis of
tumor DNA. When compared to population traits reported by SEER registry
(Horner MJ, 2009), the present study population was comprised of women with a
higher percentage of characteristics correlated with tumor aggressiveness and
poor prognosis. More patients had younger age at diagnosis, higher tumor grade,
larger tumor size, more involvement of axillary lymph nodes and a higher
incidence of triple negative tumors than expected in the average breast cancer
population.

24

Table 2.3 Characterization of Biomarkers in Breast Cancers from
Paraffin Embedded Tissue Sections
A: Concordance of HER2 Status by IHC and by FISH
HER2 by IHC
0 1+ 2+ 3+ total
HER2
by
FISH
Not Amplified 81 2 0 0 83
Amplified 3 1 11* 11 26
total 84 3 11 11 109
*Four samples have HER2 heterogeneity with focal HER2 gene amplification and overexpression
B: Comparison of ER, PR, and HER2 Status

ER positive ER negative

PR
positive
PR
negative
PR
positive
PR
negative total
HER2
positive 2 6 0 18 26
negative 40 13 0 34 87

total 42 19 0 52 113
25

Chapter 3: Sequence Alterations in Nuclear Receptor
Coactivators
3.1 Introduction
The completion of the human genome sequence project, the development
of computational biology as well as new technological advances (sequencing
technologies, microarrays) facilitate extensive genetic analyses of human
cancers. The characterization of genetic alterations involved in human
carcinogenesis has been more and more successful in the last few years and a
more comprehensive overview of the ‘genomic landscapes’ (Wood et al., 2007)
of human cancers has emerged.
Numerous studies have been investigating the role of genetic variations in
breast cancer. Sequence alterations in genes such as BRCA1/2, p53, and lately,
HER2 (polymorphism I655V) (Lu, Wang, Liu, & Hao) have been analyzed in
various populations and were correlated with breast cancer risk. More
comprehensive projects have been assessing breast cancer risk associations for
polymorphisms in multiple genes (Knechtel et al.), and even in the entire genome
(Azzato et al.; Easton et al., 2007). Somatic mutations in breast cancer have also
been investigated in individual genes (Herynk & Fuqua, 2004) as well as part of
genome-wide association studies (Sjoblom et al., 2006).
26

3.1.1 Polymorphisms
The presence of SNPs in ER was extensively studied, and in all cases
estrogen receptor polymorphisms have only shown borderline or no association
with either increased or decreased breast cancer risk. Most published studies
concern the SNP pair of restriction fragment length polymorphisms discovered
for the enzymes PvuII (rs2234693) and XbaI RFLPs (rs9340799) (Hill, Fuqua,
Chamness, Greene, & McGuire, 1989; Yaich, Dupont, Cavener, & Parl, 1992)
located in the intron 1 of ESR1 gene. In a recent study correlation analysis was
performed on 10,300 cases and 16,620 controls and SNPs rs1801132 and
rs2234693 were found to be protective and were associated with decreased
breast cancer risk (N. Li, Dong, Hu, Shen, & Dai). On the contrary, an extensive
project conducted in 55000 women from studies of the Breast Cancer
Association Consortium (BCAC) reported no highly significant associations
involving 396 variations in the ESR1 gene (Dunning et al., 2009). Only one SNP,
rs3020314, located in an intronic region of ESR1 was weakly associated with
breast cancer susceptibility in European women.
Studies of common germline variations in the coactivators of ER were not
as comprehensive or as detailed as the estrogen receptor studies. SNPs
identified so far in the blood of women diagnosed with breast cancer showed
weak correlations with breast cancer risk (Haiman et al., 2009; Hartmaier et al.,
2009). Haiman et al have described novel SNPs and their breast cancer risk
27

associations of polymorphisms in various nuclear receptor coregulators, and
among those, some of the coactivators investigated in the present study,
NCOA1, NCOA2, NCOA3, CARM1, and CALCOCO1. The study was conducted
in a Multiethnic Cohort comprising 1612 cases and 1961 controls from similar
ethnic groups with the present study (African-American, Hispanic, Caucasian,
Japanese and Native Hawaiians). Among the multiple SNPs analyzed in the
study, one of the variants of CALCOCO1, R12H, showed association with breast
cancer risk. Another recent study involving multiple ER coregulator genes, and
among those the p160 coactivators, reported 12 novel SNPs in NCOA1 and
NCOA3. Noteworthy was the NCOA3 SNP, H586Q, which was described to have
a protective effect in breast cancer on multiple occasions by the same group of
investigators (Burwinkel et al., 2005; Hartmaier et al., 2009).
Additional information is needed in order to prove conclusive correlations
between the presence of SNPs in the coactivator genes and patient
characteristics and tumor markers. The literature contains no significant studies
involving the role of polymorphisms in other coactivator genes selected to be
sequenced in this project, NCOA5, NCOA6, FLII and ZNF282.
3.1.2 Somatic Mutations
Somatic mutations have been described in ER α in breast cancer patients
and some of them are suggested to play a role in tumorigenesis and in
28

metastatic spread of primary tumors(Herynk & Fuqua, 2004). The ER α A86V
mutation is predicted to lead to lower activity of the receptor. ER α K303R is
hypothesized to give the receptor the ability to react to smaller concentrations of
the stimulating hormone than the wild type ER α. ER α 437Stop, identified only in
metastatic breast cancers, might have an important role in the spread of the
disease. All these alterations reported in breast cancer patients as well as the
ones identified by targeted mutagenesis studies provide additional insight on the
molecular mechanisms involving the estrogen receptor, including the effect of
mutagenesis on the dynamic of protein-protein interaction of ER α with its
coactivators. Subsequent studies of ER α mutations have suggested that these
mutations are much less frequent than originally reported (Conway et al., 2005;
Tebbit et al., 2004; Zhang et al., 2003).
Although somatic mutations in the ER α gene and their potential clinical
implications have been described and investigated in detail, the analysis of
mutations in other members of the ER pathway has been less conclusive.
Somatic mutations in nuclear receptor coactivator genes were investigated
as part of a detailed sequence analysis of eleven breast cancers involving over
18000 genes(Lin et al., 2007; Sjoblom et al., 2006; Wood et al., 2007). The
authors identified approximately 80 different mutations occurring in the coding
regions of the genome of each tumor. The study focused on the identification of
mutated cellular pathways rather than the analysis of mutations in specific genes,
29

providing a new perspective on analyzing comprehensive sequencing data. In
the ER pathway, only one coactivator was found to be mutated in that study,
NCOA6, and it had alterations in one breast cancer cell line, P1060S (in
HCC1954) and one tumor, S1191R.
Other studies have been investigating genetic variations in the genes
encoding coactivators of the estrogen receptor pathway using genetically
engineered cell lines and xenografts, and revealing important information on
possible functional effects of mutations in these coactivators. However, molecular
analysis involving specific mutations identified in breast cancers from patients
would be more relevant for application in clinical setting. We will assess the
presence of sequence alterations in the proposed genes and identify candidate
somatic mutations for subsequent evaluation in larger studies.
3.2 Materials and Methods
DNA Extraction
Genomic DNA from tissue samples was isolated using the DNEasy tissue
kit (Qiagen). Tumor DNA was extracted from an average of 10 frozen sections, 7
microns thick, for each column. Normal DNA from selected cases was extracted
from paraffin-embedded tissue sections using a deparaffinization protocol
involving xylene, then rehydration in graded ethanols, and centrifugation for 5
minutes after each step. The DNEasy system involves silica-based DNA-binding
30

membrane columns that retain DNA strands larger than 100 bases. The samples
were lysed overnight, then the DNA was selectively bound to the membrane,
washed, and then eluted, according to the manufacturer’s protocol (Qiagen). The
DNA samples were quantified using the Quant-iT™ PicoGreen dsDNA Assay
(Invitrogen). Following extraction and quantification, 10 ng of DNA was used for
each PCR amplification reaction.
PCR Amplification
DNA extracted from breast tumors was whole-genome amplified (WGA)
by Qiagen following the Repli-g method. The WGA DNA was subsequently
amplified by the polymerase chain reaction (PCR), purified, and sequenced for
the following genes of interest: NCOA1, NCOA2, NCOA3, NCOA5, NCOA6, FLII,
ZNF282, CARM1, and CALCOCO1. All reactions were carried out in a 96-well
plate format, including a negative control (one well without DNA template added).
PCR and sequencing primers used were obtained from NCBI Probe
Database("NCBI Probes"). PCR amplification of each exon in each gene was
performed in 25ul reactions using Go Taq hot start green master mix, (Promega).
The following were added to the reaction mixture: 1uM forward primer and 1uM
reverse primer, 10 ng DNA template, and water up to 25 ul. Reactions were
performed in an Eppendorf Mastercycler EpGradient S thermocycler using a
PCR protocol with the following cycles: 1 cycle of 95°C for 2 min; 40 cycles of
95°C for 30 sec, 60°C for 45 sec, and 72°C for 1 min; 1cycle of 72°C for 5 min.
31

PCR products were purified using the Exo-SAP-IT enzyme (USB Corporation).
Cleaning reactions contained 10ul of PCR product and 2 ul of cleaning enzyme
and ran for 45 minutes, with a 30 min cleaning cycle at 37°C and an enzyme
inactivation cycle of 15 min at 80°C. After purification, samples were quantified
by agarose gel electrophoresis for DNA sequence analysis.
DNA Sequencing
Sequencing reactions were performed in 10 ul reactions using the BigDye
Terminator kit (Applied Biosystems), with 5 pmol universal primer, 10 ng DNA,
1X BigDye Buffer and 1ul BigDye enzyme. The reaction conditions were as
follows: 1 cycle of 96°C for 1 min; 25 cycles of 96°C for 10 seconds, 50°C for 5
seconds, 60°C for 4 minutes. These reactions were carried out in an ABI
GeneAmp PCR system 9700 thermocycler (Applied Biosystems). The DNA
products were cleaned by removing the Dye terminators using DyeDx cleaning
column plates (Qiagen) by centrifuging the samples at 910 rcf for 3 minutes.
Sequencing was then performed using the fluorescent capillary sequencing
method(Conway et al., 2005; Haiman et al., 2009), in an automated ABI3730
DNA Analyzer (Applied Biosystems). Sequence scanner version 1.0 software
from Applied Biosystems was used for DNA sequence analysis. The DNA
sequences obtained were analyzed for alterations by comparison with gene
sequences available on Genbank ("GenBank") and Ensembl ("Ensembl")
websites.
32

Microsatellite Assay (MSA)
DNA available from 107 patients was used as template for the identifying
different genotypes in the polyglutamine region of NCOA3. Primers were
designed flanking a fragment of 189 nucleotides, containing the region encoding
for the glutamine repeats. Sequences of the primers were: forward
AACGCAGCAGAGAGCTGCTAA, and reverse TGGGGGAAGCAGTCACATTA.
Unlabeled primers as well as a forward primer labeled with green fluorescence
were ordered from ABI. The first part of the assay was an amplification reaction,
performed in 96 well plates in a very similar way and using the same reagents
and cyclers as described in the PCR amplification section. The mixture for each
well contained: 2 ul of DNA, 1 ul primer mix (forward labeled, forward unlabeled
and reverse unlabeled mixture), 2 ul H2O and 5 ul 2X GoTaq Mastermix in a 10
ul reaction. Reactions were performed in an Eppendorf Mastercycler EpGradient
S thermocycler following a PCR protocol with the following cycles: 1 cycle of 95
for 2 min; 14 cycles of 95 for 45 sec, 62 for 45 sec, and 72 for 1 min; 35 cycles of
95 for 45 sec, 55 for 45 sec, and 72 for 1 min. After amplification, 0.5ul of the
sample was used in the genotyping reaction mixture containing 0.5ul size
standard and 9.0ul Hi-Di formamide. The loading cocktail was denatured for 3
minutes at 95C, then immediately chilled on ice for 3 minutes. The samples were
processed using an automated ABI3730 DNA Analyzer (Applied Biosystems) and
then analyzed using the GeneMarker program version 1.9 from SoftGenetics.
33

Statistical Analysis
The presence of DNA sequence alterations in tumor DNA from the
patients was compared with the presence or absence of various tumor markers
(ER, PR, and HER2 status), tumor characteristics (size, grade, and lymph node
metastases) and patient characteristics (ethnicity, and age at diagnosis) by using
a Fisher exact test not controlled for multiple comparisons. Correlations were
calculated for each biomarker and the presence of alterations in general,
synonymous alterations, and non-synonymous alterations in each gene.
Correlations were also investigated in relation to the most frequently occurring
SNP in each gene. The presence of genetic variations (total, synonymous and
non-synonymous) in all coactivators in general was also considered in the
correlation analysis with patient biomarkers. In NCOA3 and NCOA6 genes there
were variations identified in the polyglutamine region, concerning the number of
codons coding for glutamine. These variations were considered in an analysis
calculating correlations of biomarkers with the heterozygous or homozygous
status of the patient and with the presence or absence of variations in this region.

34

3.3 Results
3.3.1 Inherited DNA Variations in Nuclear Receptor Coactivators
Nuclear receptor coactivator genes were characterized in DNA from
infiltrative ductal carcinomas by sequence analysis. The presence of DNA
polymorphisms in the coding exons of these genes was correlated with clinical
and pathological patient characteristics as well as with the presence or absence
of tumor biomarkers. Genes NCOA1, NCOA2, NCOA3, and NCOA5, were
successfully analyzed in 108 samples, NCOA6 was analyzed in 115 samples,
while FLII, ZNF282, CARM1, and CALCOCO1 were analyzed in 93 samples.
3.3.1.1 Single Nucleotide Polymorphisms
NCOA1
A total of 41 people out of 108 had carcinomas with alterations identified
throughout NCOA1 in exons 6, 8, 9, 11, 15, 16, 18, 20, and 21. Among those,
nine women out of 108 had cancers with non-synonymous SNPs and 34 women
had cancers with synonymous alterations. The distribution by ethnicity of women
with altered tumors was as follows: nine Hispanics, eleven Caucasians, six
Asian, and fifteen African American (Table 3.1).
Six different non-synonymous germinal alterations were identified in the
NCOA1 gene: R572S, N600S and E757G, P1048L, L1376P and P1272S. One of
35

these alterations was an established polymorphism, P1272S, and was identified
in four patients, one African American, one Caucasian and two Hispanics. The
other five alterations were characterized as rare germinal mutations, each
occurring in one out of 108 women.
There were also nine synonymous alterations identified with various
frequencies in this gene. Variations P504P, T154T, and L1267L, were more
frequent, while A641A, L1068L, D1395D, G1037G, Y1277Y, and V292V were
only identified in one patient each. The presence of non-synonymous alterations
in NCOA1 was correlated with African-American ethnicity (p=0.006). The most
frequent SNP in NCOA1, P504P was present in 16 patients, five African
Americans, four Asians, four Hispanics, and three Caucasians. The P504P
variation was found to be correlated with grade 2 tumors (p=0.045). Nine women
had the T154T variant in their NCOA1 sequence and among these, eight also
had the variant L1267L. These last two variations were identified in five African-
American and three Caucasian patients. The ninth person who only had the
T154T variant and did not have the L1267L variant was one African-American
patient. T154T as well as L1267L were associated with African –American and
Caucasian ethnicity (p=0.001, p=0.005 respectively). Two patients had two
sequence alterations each in NCOA1, one synonymous and one non-
synonymous, D1395D with P1272S, and G1037G with L1376P.

36

NCOA2
The presence of sequence alterations in NCOA2 was identified in 14 out
of the 108 patients included in the analysis. Among those, there were five
African-American, six Asians, and three Caucasians. These patients had NCOA2
altered at seven different positions in the DNA: E6E in exon 3, N616I in exon 11,
Q957Q in exon 14, N1212S and P1222P in exon 18, M1282I in exon 19, and
H1332H in exon 20.
Non-synonymous sequence alterations were identified in NCOA2 in nine
of 108 patients included in the analysis. Among those, one was African-
American, three were Caucasian, and five were Asian (Table 3.1). The presence
of non-synonymous alterations in NCOA2 was significantly associated with HER2
positivity (p=0.017). The germinal variation M1282I was the most prevalent
alteration in NCOA2, and was also associated with HER2 positivity (p=0.019). It
was identified in seven patients, five Asian and two Caucasian and its presence
was correlated significantly with Asian and Caucasian ethnicity (p=0.02). Two
other patients had one non-synonymous germinal alterations each, one
Caucasian (N1212S) and one African-American (N616I).
Synonymous alterations were identified in five patients and they were
correlated with African-American ethnicity. One African-American patient had
three synonymous alterations in NCOA2, Q957Q, P1222P, and H1332H. E6E
was present in another African American patient. The most frequently
37

encountered synonymous alteration was P1222P, identified in the DNA of four
people, three African-American and one Asian.
NCOA3
In the sequence of NCOA3 42 out of 108 women were identified with
polymorphisms in exons 7, 8, 12, 15, 19, and 20. The presence of non-
synonymous alterations was correlated with African-American and Hispanic
ethnicity (p=0.035). Thirteen of 108 women had six different non-synonymous
SNPs in NCOA3. Among those SNPs, three were frequent germinal alterations,
P559S, R218C and Q586H, encountered in 11 women. The most frequently
identified non-synonymous variation in NCOA3 was Q586H and it was present in
five patients, three Hispanic and two Caucasian women, and P559S and R218C
were identified in three different women each. Three of the encountered SNPs
were rare germinal alterations P264L, T1199A, and M1247L discovered each in
one patient, and furthermore two of them, P264L and T1199A were identified in
the same African-American patient.
There were 35 cancer samples with one, two or three synonymous
alterations in NCOA3, identified in various combinations. Among those, 29
samples had a common variation, the Q1251Q SNP, and fourteen of those
samples had a second SNP, T960T. T960T was found to occur frequently
together with a third common variation A927A, identified in seven samples. One
of the seven cancers could not be sequenced for the Q1251Q SNP, but the other
38

six samples had all three variations in their DNA sequence. Four cancers only
had T960T. K729K and Q1303Q were also present in one sample each, and
were considered rare SNPs.
There were six patients who had synonymous and non-synonymous
variations in their DNA. Among those, two patients had four variations in this
gene, containing all three synonymous common variations (T960T, A927A, and
and Q1251Q) and a non-synonymous alteration, R218C or Q586H.
NCOA5
NCOA5 was one of the most conserved genes in the group of nuclear
receptor coactivators analyzed. There were four out of 108 people identified to
have variations in the DNA of this gene. All of them were synonymous
alterations: R121R (exon 3) identified in one African American and one Hispanic,
L130L (exon 4) identified in the carcinoma from an Asian patient and R278R
(exon 7) identified in another Asian patient.
NCOA6
NCOA6 is a gene known to have genetic alterations in the form of SNPs,
somatic mutations and also gene amplification. In the population analyzed in this
study there were 33 people identified with sequence alterations: two patients with
somatic mutations, 16 with non-synonymous SNPs, 17 with synonymous SNPs,
and two patients with variations in the polyglutamine region. The presence of
39

NCOA6 alterations was found to be associated with smaller sized tumors at
diagnosis, under 2.5 cm in diameter (p=0.043).
Two African American patients had an alteration of serine S1913, one had
a somatic mutation, and the other had a polymorphism. In the patient with a
somatic mutation, the tumor DNA encoded a mutated protein with a threonine in
position 1913, while the normal DNA encoded the wild type serine at that
position. In the patient with polymorphism, the same position was altered in the
DNA, but the mutation encoded an asparagine at aminoacid 1913, and was
present in the normal tissue as well as in the carcinoma.
Additional non-synonymous NCOA6 SNPs were identified in15 breast
cancers. Among those, the rare SNPs I1965V, R1330H, and T1402A identified in
one sample each. In contrast, the common variation N955S was identified in
cancers from 12 patients and among those, there were four patients who also
had another variation in the sequence of NCOA3. When analyzed in relation to
age group, the presence of N955S correlated with a younger age at diagnosis
(<60 years old, p=0.03). Genetic alterations in NCOA6 (p=0.005), particularly
N955S (p=0.003), occur more frequently in African-American and Hispanic
patients than in Asian and Caucasian patients.
Among the 108 patients analyzed 17 patients had one of the following
synonymous alterations: P749P, G633G, Q1855Q, T1880T, A995A, I1439I, and
N669N. Among those, 10 patients from all four ethnic groups had the same
40

common SNP, P749P, one Caucasian, two African-American, three Asian and
four Hispanic. The presence of synonymous NCOA6 alterations was associated
with smaller sized tumors at diagnosis, under 2.5 cm in diameter (p=0.018).
Synonymous SNPs were also correlated with ER positivity (p=0.038), PR
positivity (p=0.043) and HER2 negativity (p=0.011) in NCOA6.
CALCOCO1
CALCOCO1 was the most frequently altered gene in the population with
69 out of 93 patients having polymorphisms in this gene. Among those, there
were 66 patients with synonymous variations and 40 patients with non-
synonymous variations. Both synonymous and non-synonymous SNPs were
associated with Asian ethnicity and inversely associated with Caucasian ethnicity
(p=0.001, p=0.002 respectively).
There were six non-synonymous SNPs identified with various frequencies
in 40 patients in CALCOCO1. The most common non-synonymous alteration,
affecting 36 out of 93 patients, was the R393K variation. All the other non-
synonymous alterations were rare, encountered in one, two, or three people out
of 93: Q222R, R373K, A527T, G561V, and T639P. R393K was associated with
Asian ethnicity and inversely associated with Caucasian ethnicity (p<0.001).
Each of the 36 patients also had a second silent CALCOCO1 SNP, S368S.
Eleven of the 36 patients also had a third SNP (Q222R, R373K, A527T, or
41

T639P). One of these patients had four alterations in the coding sequence of
CALCOCO1: A527T, S368S, R393K, and T639P.
The majority of women identified to have synonymous alterations in their
CALCOCO1 sequence had one, two or three of the following alterations: S368S,
V181V, and A284A. There were 59 patients with the variation S368S in their
DNA. Among those, 17 patients had a second synonymous SNPs, V181V in 7
patients, and A284A in 10 patients and two patients had all three variations:
S368S, V181V, and A284A. The other seven patients only had A284A.
FLII
Three out of 93 patients had cancers which contained polymorphisms in
FLII, and each one had a different alteration in their DNA. These patients had two
non-synonymous variations, D234Y in one Hispanic patient and E240K in one
Caucasian patient, and one silent alteration, G584G in another Hispanic patient.
Due to the low number and frequency of alterations, there were no significant
correlations obtained by statistical analysis for the SNPs in this gene.
CARM1
Four patients had carcinomas with altered CARM1 gene. Each of these
patients had one synonymous alteration identified in the coding region of the
gene: V226V was identified in two African-American patients, S282S was
identified in one Hispanic patient, and T499T was identified in another African-
42

American patient. Although the analysis of genetic alterations in correlation with
patient characteristics and tumor markers revealed that statistical significance
was not attained, it is notable that among the affected patients there were three
African-Americans and one Hispanic and that all the cancers with SNPs were
HER2-neu negative tumors.
ZNF282
There was only one alteration identified in ZNF 282 in one Asian patient in
the population. This alteration was not characterized in the normal DNA of the
patient due to lack of availability; therefore the alteration may be either a somatic
mutation or a rare polymorphism.

43

Table 3.1 Distribution of Breast Cancer Patients with Sequence
Variations, Classified by Ethnicity
African-American
GENE
Cases
analyzed
Cases
with syn
alt
Cases w non-
syn alt
Cases with
polyQ alt
Cases w
any alt
NCOA1 25 15 1 - 15
NCOA2 25 4 1 - 5
NCOA3 25 7 5* 19 22
NCOA5 25 1 0 - 1
NCOA6 27 4 8* 1 11
FLII 20 0 0 - 0
ZNF282 20 0 0 - 0
CALCOCO1 20 13 10 - 13
CARM1 20 3 0 - 3
Any gene 27 22 18 19 25
Asian
GENE
Cases
analyzed
Cases
with syn
alt
Cases w non-
syn alt
Cases with
polyQ alt
Cases w
any alt
NCOA1 29 5 1 - 6
NCOA2 29 1 5 - 6
NCOA3 29 6 0 17 18
NCOA5 29 2 0 - 2
NCOA6 31 3 0 1 4
FLII 25 0 0 - 0
ZNF282 25 0 1 - 1
CALCOCO1 25 24 18 - 24
CARM1 25 0 0 - 0
Any gene 31 26 21 17 29

Caucasian
GENE
Cases
analyzed
Cases
with syn
alt
Cases w non-
syn alt
Cases with
polyQ alt
Cases w
any alt
NCOA1 27 8 4 - 11
NCOA2 27 0 3 - 3
NCOA3 27 12 3 20 23
NCOA5 27 0 0 - 0
NCOA6 27 3 3 0 6
FLII 21 0 2* - 2
ZNF282 21 0 0 - 0
CALCOCO1 21 9 5 - 11
CARM1 21 0 0 - 0
Any gene 27 22 16 20 25

44

Table 3.1 Continued

Hispanic
GENE
Cases
analyzed
Cases w
syn alt
Cases w non-
syn alt
Cases with
polyQ alt
Cases w
any alt
NCOA1 27 6 3 - 9
NCOA2 27 0 0 - 0
NCOA3 27 10 6 16 21
NCOA5 27 1 0 - 1
NCOA6 30 7 6* 0 12
FLII 27 1 1 - 2
ZNF282 27 0 0 - 0
CALCOCO1 27 20 7 - 21
CARM1 27 1 0 - 1
Any gene 30 27 14 16 28
All samples
GENE
Cases
analyzed
Cases w
syn alt
Cases w non-
syn alt
Cases with
polyQ alt
Cases w
any alt
NCOA1 108 34 9 - 41
NCOA2 108 5 9 - 14
NCOA3 108 35 14 72 84
NCOA5 108 4 0 - 4
NCOA6 115 17 17 2 33
FLII 93 1 3 - 4
ZNF282 93 0 1 - 1
CALCOCO1 93 66 40 - 69
CARM1 93 4 0 - 4
Any gene 115 97 69 72 107

*One somatic mutation included.
Note: Some cancers have more than one alteration in more than one gene, therefore the “Any
gene” and “Any alterations” totals are not equivalent to the sum of the number of alterations in the
individual genes.

45

3.3.1.2 Variations of Polyglutamine Repeats
Glutamine rich regions are present in all the members of the p160 family
of coactivators and also in NCOA6 and FLII. As a result of the sequencing
analysis, in the study population two of the genes, NCOA3 and NCOA6, showed
variation in this region affecting the number of codons encoding for glutamine.
This polymorphism has been previously described for NCOA3 in multiple
studies but no consistent association was found with breast cancer or patient
characteristics (C. A. Haiman et al., 2000; Montgomery et al., 2005). It has been
shown to be associated with familial breast cancer risk (BRCA1/BRCA2 mutation
carriers) but not with postmenopausal breast cancer in white women in the
general population (Dai & Wong, 2003; Christopher A Haiman et al., 2000;
Rebbeck et al., 2001). There is not enough evidence to conclude whether or not
the variability of this region affects the coactivator function of NCOA3.
Polyglutamine variants have been previously identified in breast cancer
cell lines and tumors (Dai & Wong, 2003). In the current study there was a
significant degree of variation among patients. Fifteen genotypes of poglutamine
repeats were identified in the study population with variable allelic length
spanning from 21 to 31 glutamine residues (Table 3.2). Four homozygous states
were identified for 26, 28, 29, and 30 repeats; eight heterozygous states with two
combinations were identified with variable frequency; and three heterozygous
states containing three patterns were identified in one sample each.
46

Table 3.2 NCOA3 Genotype Frequency in the Study Population
PolyQ_NCOA3 Freq. Percent
21/29 1 0.87
26/26 1 0.87
26/27/29 1 0.87
26/28 5 4.35
26/28/29 1 0.87
26/29 3 2.61
27/29 1 0.87
28/28 10 8.7
28/29 46 40
28/29/30 1 0.87
28/30 1 0.87
28/31 1 0.87
29/29 38 33.04
29/30 2 1.74
30/30 1 0.87
Missing
information
2 1.74
Total 115 100

Two genotypes were more frequently encountered, as expected: the
normal homozygous state 29/29 (38 patients) and a known polymorphism in the
normal population, 28/29 (46 patients). Another homozygous genotype, 28/28
was encountered in 10 patients, more frequently than the other variants. All the
tumors which did not have the normal 29/29 genotype were considered to have a
variation in the polyglutamine region (polymorphism). When polyglutamine
patterns were analyzed in relation with patient characteristics and tumor markers,
two correlations were repeatedly assessed as statistically significant, age group
at diagnosis and lymph node metastasis. The normal genotype 29/29 was
47

correlated with age at diagnosis of 40-50, and no patient within the normal group
was under 40 (p=0.021). The polymorphic heterozygous genotype 28/29 was
associated with the absence of lymph node metastasis (p=0.038)
The presence of one or more allele containing patterns with 30 or 31
polyglutamine repeats in a group of six patients was significantly associated with
specific patient characteristics and with tumor markers. Three of these patients
were African-American and none of them were Caucasian. Lymph node
metastasis was positive for all the patients in this group (p=0.017). In relation to
tumor markers, these patients were all HER2 negative, five with ER and PR
positive breast cancers, and one with a triple negative breast cancer. Statistical
significance was only attained for PR positivity in this context (p=0.028).
In the sequence of NCOA6 two variations were identified in the
polyglutaminic region in two patients, one Asian and one African-American.
These variations were not previously described in other studies, therefore this is
a novel SNP, affecting the polyglutamine region in NCOA6. Due to the low
number of samples affected, the analysis was not expected to reveal any
significant correlations between the presence of the polymorphism and other
relevant patient and tumor information; therefore there were no further
investigations performed for polyglutamine variations in this gene.
48

3.3.2 Somatic Mutations in Breast Cancer
The nine coactivator genes contained relatively few somatic mutations,
four mutations in the 115 breast cancers analyzed (3.5%). The ethnicity of the
women with mutated tumors was: 1 Hispanic, 1 Caucasian, and 2 African-
Americans. The four somatic mutations, two in NCOA6 gene (N1716D and
S1913T), one in the NCOA3 gene (Y1111H) and one in the FLII gene (R569H),
were each identified in individual patients. All mutations were identified in HER2
negative cancers, with either positive or negative ER and PR. However, due to
the low number of events, the presence of these mutations could not be
correlated with any patient or tumor characteristics.
The possibility of these mutations being passenger non-functional
mutations was taken into consideration. However a relatively small region of the
genome (50 000 base pairs) was covered by sequencing and calculation of the
rate of passenger mutations is not required when a small number of genes is
analyzed. In general the frequency of encountering passenger mutations is
approximately 1.2 mutations for every 1 Mb of DNA sequenced in breast cancer
(Sjoblom et al., 2006). A total of 5 Mb of DNA were sequenced in this study,
calculations leading to the expected number of 6 passenger mutations to be
identified.
Functional importance of mutations of specific amino acids depends on
their role and position in protein functional domains, and might affect the primary,
49

secondary or tertiary structure of the protein. Gain or loss of protein function
might lead to deregulated downstream activation or repression by ER of target
genes. All somatic mutations identified in this study occurred in amino acids
susceptible to post-translational modifications with possible functional
importance. Asparagines are deamidation or glycosylation sites, serines and
tyrosines are modified by phosphorylation, and arginines by methylation. Each
one of the mutations was individually analyzed in-silico and predicted to have
potential functional significance, using SIFT (sorting intolerant from tolerant)(Ng
& Henikoff, 2003), NetPhos (phosphorylation) (Blom, Gammeltoft, & Brunak,
1999), The Sulfinator (sulfination) (Monigatti, Gasteiger, Bairoch, & Jung, 2002),
MeMo (methylation) (H. Chen, Xue, Huang, Yao, & Sun, 2006), NetOGlyc
(Julenius, Molgaard, Gupta, & Brunak, 2005) and NetNGlyc (R. Gupta, 2004)
(glycosylation), software resources available online.
3.3.2.1 Mutations in NCOA3, NCOA6 and FLII
NCOA6
In NCOA6 breast cancers from two patients were characterized with two
novel somatic mutations, N1716D and S1913T. Mutation of asparagine 1716 to
an aspartic acid was identified in one Hispanic patient, with a grade 3, triple
negative breast cancer, with no involvement of lymph nodes. The serine at
position 1913 was also altered through a germline variation identified in this study
(S1913N). In the patient with a somatic mutation, the tumor DNA encoded a
50

mutated protein with a threonine in position 1913, while the normal DNA encoded
the wild type serine at that position. It was a grade 2 infiltrative ductal carcinoma,
ER and PR positive, and HER2 negative. In the patient with a polymorphism at
the same position the alteration encoded an asparagine at amino acid 1913, and
was present both in the tumor as well as in the normal DNA. In this case the
patient had a grade 3, triple negative infiltrative ductal carcinoma.
Both mutations, N1716D and S1913T, were located in the C-terminal half
of NCOA6, and both were predicted by SIFT to not have a high impact on the
protein function (SIFT scores 0.05). This region interacts with other nuclear
receptor coactivators, (CBP/p300, DRIP130) and with a nuclear enzyme (DNA-
PKc) responsible for phosphorylation and activation of NCOA6 (Ko, Cardona, &
Chin, 2000; Ko & Chin, 2003; Mahajan & Samuels, 2005). Although not a
probable target of posttranslational modification by glycosylation, N1716 could be
a deamidation site involved in protein inactivation. The serine at position 1913
located in this domain might be an altered phosphorylation site (NetPhos score
0.956). NCOA6 has been previously characterized as having somatic mutations
in breast cancer, and notably two other mutated serine sites were described in
the sequence of this protein. One somatic mutation S1191R has been previously
described in one breast cancer specimen (Sjoblom et al., 2006), and three other
NCOA6 mutations have been observed in breast cancer cell lines, P1060S
(HCC1954) (Sjoblom et al., 2006), P1591L (MDA-MB-435s), and S2038C
51

(SKBR3) (Anamaria Ioan, Michael Press, unpublished). However, none of these
mutations were identified in any of the breast carcinomas analyzed in this study.
NCOA3
In the coding region of the NCOA3 gene one breast cancer contained a
single non-synonymous somatic mutation, Y1111H. This African-American 45-
year-old woman had a grade 3 tumor with lymph node metastasis to 12 lymph
nodes. The tumor tested negative for ER, PR and HER2 markers (triple
negative). The mutation affects tyrosine 1111 located in the C-teminal region of
the protein which also contains the histone acetyl transferase functional domain
of the protein. It was predicted to be functionally important by SIFT with a score
of 0.00, showing that the 1111 position in the protein is a site highly conserved
evolutionarily.
In-vitro mutation analysis conducted in NCOA3 shows that alteration of
specific sites involving phosphorylation locations in this protein might lead to
disturbance in its hormone receptor coactivator function (R. C. Wu et al., 2004;
Zheng, Wu, Smith, & O'Malley, 2005). Phosphorylation of NCOA3 plays a role in
both its activation and transportation from the cytoplasm to the nucleus, as well
as in interactions with other proteins. This phosphorylation can be carried out by
many kinases such as mitogen activated protein kinase (MAPK), IkB kinase
(IKK), and HER2. Different cellular signals activate different pathways inducing
patterns of phosphorylation on NCOA3 and determining its affinity for the
52

different nuclear receptors (estrogen receptor, progesterone receptor , and
androgen receptor ) and for other transcription factors such as nuclear factor
kappa B (NF-kB) (R.-C. Wu et al., 2004; R.-C. Wu, Smith, & O’Malley, 2005).
Engineered mutations of phosphorylation sites affect the described protein-
protein interactions and perturb NCOA3’s function as a coactivator, resulting in
reduced target gene transcription, decreasing cell growth, survival and
proliferation. Furthermore, mutations of phosphorylation sites might reduce the
oncogenic potential of NCOA3 (R.-C. Wu et al., 2004).
Somatic mutations in NCOA3 can also have an effect on the protein
transportation and turnover. The protein is usually located in the cytoplasm and
upon phosphorylation at specific sites by kinases is transported to the nucleus
(Zheng et al., 2005). Series of Ser/Thr motifs are phosphorylated and become
substrates for an isomerase enzyme (Pin1) promoting nuclear transportation of
the protein (Yi et al., 2005). Modifications in NCOA3 providing changes in the
binding of Pin1 could lead to accumulation of the protein in the nucleus or in the
cytoplasm. Another mechanism which can be targeted by mutation may be the
protein degradation pathway which when affected may lead to increased
concentration of NCOA3. The turnover rate of NCOA3 is controlled by multiple
mechanisms. One major degradation pathway is the 26S proteasome proteolysis
dependent upon ubiquitination (Yan, Gao, Lonard, & Nawaz, 2003).
Phosphoryation and methylation at specific sites is hypothesized to be the
mechanism targeting the NCOA3 for ubiquitination (Yi et al., 2005). A second
53

pathway for NCOA3 degradation, independent of ubiquitin or ATP hydrolysis,
involves the REG- γ protein, a proteasome activator protein which binds to the
HAT domain of NCOA3 and promotes it’s degradation by the 20S proteasome
cap (X. Li et al., 2006). Therefore, alteration of specific phosphorylation sites or
protein binding sites in the HAT domain might lead to decreased degradation and
accumulation of the protein in the nucleus. The effect of this accumulation on cell
function would be similar to the results of NCOA3 overexpression, an increased
gene transcription rate induced by ER activation.
Tyrosine 1111 has not been shown to be a phosphorylation or sulfination
site, but no research has been done so far on the functional importance of this
particular site.
FLII
In FLII a somatic mutation, R569H, was identified in a 63 year old
Caucasian patient. The grade 3 infiltrating ductal carcinoma was metastasized
and characterized as ER positive, PR negative, and HER2neu negative. The
mutation identified in FLII, is predicted to have a functional impact on the protein
(SIFT score 0.00). The mutated amino acid is an arginine, a possible methylation
site, situated in the gelsolin-like region of the protein. It affects a functional region
of FLII involved in stimulating gene expression driven by ER and binding of
coactivators such as CARM1 (Y. H. Lee et al., 2004; Way, Pope, & Weeds,
1992). FLII is proposed to have a double function, as a nuclear receptor
54

coactivator and as a cytoplasmic structural protein. In-vitro mutation experiments
have been previously conducted in the gelsolin domain of FLII protein in MCF7
breast cancer cells showing that mutations in that region lead to reduced actin
binding and reduced transcriptional coactivator function of the protein (Y. H. Lee
et al., 2004). Experimental evidence also led to the suggestion that FLII might be
a key factor in the connection between the p160 coactivators and another group
of nucleosome-remodeling coactivators, the SWI/SNF protein complex. The
protein binding activity of FLII might be perturbed through somatic mutation
leading to loss of association with one or more of the members of the multiple
coactivator complexes.
3.3.3 Summary
3.3.3.1 Sequence Alterations in Candidate Coactivator Genes
Tumor DNA was analyzed for sequence variations in the following nuclear
receptor coactivator genes: NCOA1, NCOA2, NCOA3, NCOA5, NCOA6, FLII,
ZNF282, CARM1, and CALCOCO1 (Table 3.3). Between all genes analyzed, 71
different sequence variations were identified, and among them, 33 were non-
synonymous, 36 were synonymous and two were polyglutamine repeats size
variations. The instability of the polyglutamine region was detected in this study
in genes which were also affected by somatic mutations, NCOA3 and NCOA6.
55

Table 3.3 Different Sequence Variations Identified in Nuclear
Receptor Coactivator Genes

Non-synonymous
alterations
Synonymous
alterations
Polyglutamine
region size
variation
Total
alterations
SNPS SMs Total
NCOA1 6 0 6 9
-
15
NCOA2 3 0 3 4
-
7
NCOA3 6 1 7 5
1
13
NCOA5 0 0 0 3
-
3
NCOA6 5 2 7 7
1
15
FLII 2 1 3 1
-
4
ZNF282 1 0 1 0
-
1
CALCOCO1 6 0 6 4
-
10
CARM1 0 0 0 3
-
3
total 29 4 33 36
2
71

The overall rate of transitions to transversions is of 56:13 (4.3), higher
than the ratio of 2.1 which would be the expected ratio in the genome. When
comparing the rates calculated for each gene region we distinguished two groups
of genes. One group was composed of NCOA1, NCOA2, NCOA5, ZNF282, and
CARM1 with ratios anywhere between 2 and 3, and the second group containing
NCOA3, NCOA6, FLII and CALCOCO1 with ratios equal to or greater than 4
(rates of 4, 5, 6, and 9 respectively).This altered rate of transitions to
transversions might indicate that in the study population these genes have a
different distribution of genetic alterations than the variations in the normal
population and might be influenced by the presence of somatic mutations.
Synonymous variations do not have a known impact on the final protein
primary sequence unless they affect RNA splicing sites. None of the synonymous
56

alterations were located on mRNA splice-junctions for any of the genes, therefore
synonymous variations were not considered for detailed analysis. All 33 non-
synonymous alterations identified were missense, and there were no non-sense
or frame-shift alterations. However, in the NCOA3 and NCOA6 genes, there were
size variations of the polyglutamine repeat region.
The identification of non-synonymous alterations in breast cancer was of
particular interest for this study since they are associated with amino-acid
changes in the encoded protein (Figure 3.1).
57

Figure 3.1 Non-Synonymous Sequence Alterations in Nuclear
Receptor Coactivators
Figure Legend: PAS/bHLH- PER/ARNT/SIM motif, basic motif, helix-loop-helix region; CID-
coactivator interaction domain; RID- receptor interaction domain; HAT- histone acetyl-transferase
activity domain; KRAB- Kruppel associated box; AD, AD1, AD2- activation domains; Co- coiled
coil domain; TD- transactivation domain; LRR- leucine-rich repeat; M- methionine rich region; S-
serine rich region; Q- glutamine rich region; P- proline rich region; K-lysine rich region; R/N-
arginine/ asparagine rich region. SNPs-are flagged with yellow and somatic mutations are flagged
in red color at their approximate position in the protein.
(Note: not drawn to scale)
58

Non-synonymous sequence alterations were most frequently observed in
NCOA1 (six alterations), NCOA3 (seven alterations), NCOA6 (seven alterations),
and CALCOCO1 (six alterations), while fewer were identified in NCOA2 (three
alterations), FLII (three alterations) and ZNF282 (one alteration), and no non-
synonymous alterations were observed in NCOA5 and CARM1 (Table 3.3).
The non-synonymous alterations were considered to be either germinal
mutations (single nucleotide polymorphisms) or somatic mutations (Table 3.3).
Public online databases for published polymorphisms (National Center for
Biotechnology Information-NCBI ("NCBI") demonstrated that 11 out of 33 non-
synonymous and 17 out of 36 synonymous alterations present in the study
population are previously reported polymorphisms. The unknown non-
synonymous alterations (n=22) were investigated as possible somatic mutations.
The sequence variations were confirmed by a second independent analysis of
the original tumor DNA, and normal DNA from the same patients was also
analyzed to determine if the sequence variation was acquired or not by the
carcinoma. This analysis determined if the alterations were germinal or if they
were somatic mutations. Genetic alterations which are inherited (germline
mutations) are present in all cell types of the patient including the tumor, and
somatic mutations are acquired in the somatic or body cells that undergo
malignant transformation during the life of the individual. The latter are present in
tumor cells only. Only one alteration in ZNF282 could not be evaluated due to
lack of normal tissue, and was considered to be a polymorphism for the analysis.
59

Eighteen new rare polymorphisms and four new somatic mutations were
identified in this way (Appendix 1). Each one of these rare alterations was
identified in one patient of 115, therefore individual correlations with any of the
tumor and patient characteristics were not statistically relevant.
3.3.3.2 Breast Cancer Patients with DNA Sequence Variations
Almost all patients, 107of 115 (93%) had sequence alterations in one or
more of the analyzed genes (table 3.1). The same proportion of patients was
affected by alterations in all ethnic groups. In the African-American and
Caucasian groups 25 of 27 patients (92.7%) had alterations, in the Asian group
29 of 31 (93.5%), and in the Hispanic group 28 of 30 patients (93.3%) were
affected. Among the 107 patients with DNA variations, 97 had synonymous
variations, while 69 had non-synonymous alterations and 72 had variations in the
polyglutaminic region of NCOA3 or NCOA6 (Table 3.1). Among the 69 patients
with non-synonymous alterations, four patients had tumors with non-silent
somatic mutations, one Hispanic, one Caucasian, and two African-American.
Overall In the study population 41 patients had sequence variations in
NCOA1, 14 in NCOA2, 84 in NCOA3, 4 in NCOA5, 33 in NCOA6, 4 in FLII, 1 in
ZNF282, 69 in CCALCOCO1, and 4 in CARM1. There were 21 patients who had
alterations in more than one gene, 18 patients in two genes, and 3 patients in
three genes.
60

3.4 Conclusions
3.4.1 SNPs
The current study involving breast cancer tissue supports published data
that some of the common variants correlate significantly with patient
ethnicity("NCBI") and show possible correlations with breast cancer
characteristics before adjusting the p values for multiple comparisons.
Alterations in NCOA1, NCOA2, and NCOA6 genes correlated with African
American ethnicity and alterations in CALCOCO1 correlated with Asian ethnicity.
In NCOA2, M1282I correlated with Asian and Caucasian patient ethnicity and
HER2 positivity; in NCOA6, N955S correlated with African American ethnicity
and younger age at diagnosis; and in CALCOCO1 R393K correlated with Asian
ethnicity. In NCOA6 non-synonymous alterations were associated with smaller
sized tumors at diagnosis, ER positivity PR positivity HER2 negativity.
The size of polyglutamine repeats in NCOA3 was correlated with patient
characteristics in this population. Normal homozygous status was correlated with
age at diagnosis of over 40 years of age. Polymorphic states were correlated
with, either positive (30 or 31 repeats) or negative (28/29 repeats) lymph node
status. Due to the large number of statistical comparisons conducted in this
study, the significant correlations we identified may be due to chance, and will
need to be confirmed.
61

3.4.2 Somatic Mutations
Mutations identified in breast cancers in this study might play a significant
role in the alteration of ER target gene expression profiles in breast cells leading
to perturbation of normal cellular homeostasis.
Discussion should not be limited solely to the analysis of mutations in
specific genes, but should also involve the identification of mutated cellular
pathways. Multiple members of the same family may be involved in a specific
signal transduction pathway, but the mutation of any single protein in a given
pathway is probably sufficient to disturb the function of the pathway (R. C. Wu et
al., 2004; Zheng et al., 2005).
Mutations of any of the ER coactivators might change the normal estrogen
induced response in tumor cells, and might lead to deregulated downstream
activation of target genes of the ER pathway, involved in growth, survival or
expansion of the cancer. Although mutations occurred in less than 5% of the
cases in the nuclear receptor coactivator genes in this study, these mutations are
hypothesized to be part of the background on which the carcinoma is building its
survival advantages (Wood et al., 2007) (Lin et al., 2007; Sjoblom et al., 2006;
Wood et al., 2007).
62

Chapter 4: Gene Amplification in Nuclear Hormone
Receptor Coactivators
4.1 Introduction
Genetic amplification, an increase in copy number of genes or
chromosomal regions, is a pathological change commonly associated with
increased mRNA transcription and protein expression of affected genes. Gene
copy number aberrations are relatively common in human cancers with
approximately 50% of breast cancers considered “amplified” in terms of
genome-wide copy number assessment (K. Chin et al., 2006). Amplification is
presumed to occur early in tumorigenesis and to be preserved through selection
pressure to provide a functional advantage to the cancer(Albertson, 2006)
4.1.1 Gene Amplification and Breast Cancer Markers
The significance of gene amplification in breast cancer has been
established for several amplification regions in the breast cancer genome which
contain oncogenes. Specifically, the chromosome 17q12 contains the HER2
gene, the 8q24 amplification region contains the myc gene, and the 11q13 region
contains the cyclin D1 gene, all of which are oncogenes amplified and
overexpressed in breast cancer (Kallioniemi et al., 1994).
63

HER2
HER2 is a well known overexpressed oncogene, and a widely used breast
cancer marker (D. J. Slamon et al., 1987). HER2 gene amplification assessed by
FISH is a reliable diagnostic and prognostic tool. HER2 amplification is also
observed in gynecological cancers, such as ovarian and endometrial carcinomas,
as well as in carcinomas of stomach and salivary gland (Press et al., 1994;
Ranzani et al., 1990; Saffari et al., 1995; Slamon et al., 1989), and it is
associated with a high recurrence rate and poor overall survival in each of these
types of carcinomas (Press et al., 1997; Press et al., 1994; Ranzani et al., 1990;
Saffari et al., 1995; Slamon et al., 1989). HER2 is a member of the epidermal
growth factor receptor family. It is a receptor tyrosine kinase reported to be
overexpressed in as much as 30% of breast cancers (D.J. Slamon et al., 1987).
HER2 gene amplification is associated with high levels of HER2 messenger RNA
and p185
HER2
protein expression, referred to as pathologic overexpression
(Slamon et al., 1989). Overexpression of HER2 leads to receptor
homodimerization and autophosphorylation with enhanced function in the
absence of ligand. This unregulated stimulation of the HER2 pathway is
associated with aggressive biological behavior and an invasive phenotype.
ESR1
Expression of the ER protein has been used as a well established breast
cancer prognostic and predictive marker. Recently the ER α gene (ESR1) has
64

been reported as amplified in 20% of human breast cancers (Holst et al., 2007).
ESR1 amplification has been correlated with both high level of ER protein
expression and increased responsiveness to tamoxifen therapy (Holst et al.,
2007). ESR1 amplification has been identified in preneoplastic lesions as well as
in advanced invasive tumors and is suggested to be an early genetic alteration in
some breast cancers (Holst et al., 2007). Although this is a potentially clinically
important finding, several groups have not been able to reproduce the results
and found ESR1 to be infrequently amplified (Brown et al., 2008; Horlings et al.,
2008; Reis-Filho et al., 2008; Vincent-Salomon et al., 2008). The conflicting
evidence concerning the prevalence and the implications of ESR1 amplification
cannot be explained by different FISH scoring procedures, or technological
differences between the two different methods used for the assessment of gene
amplification, CGH and FISH (Albertson, 2008). In the light of latest publications
ESR1 is not considered to be amplified in breast cancer in a clinically significant
manner (Brown et al., 2008; Horlings et al., 2008; Reis-Filho et al., 2008;
Vincent-Salomon et al., 2008).
Although ESR1 appears to be only infrequently amplified (5% of breast
cancer cases) , approximately 70% of breast carcinomas have ER α expression
determined by immunohistochemistry (Hart & Davie, 2002). Therefore, in this
case the clinical relevance of gene amplification is only fractional since
amplification is presumed to be one of the multiple mechanisms leading to the
expression of estrogen receptor in breast cancer.
65

Other genes encoding proteins involved in the estrogen receptor pathway
have been shown to be amplified in breast cancer, and among those are the
nuclear receptor coactivators NCOA3 (also called amplified in breast cancer 1)
and NCOA6 (also called amplified in breast cancer 3). NCOA3 and NCOA6
together with another nuclear receptor coactivator NCOA5 are located on the q
arm of chromosome 20, in a region well known to be amplified in breast cancer.
4.1.2 Co-Amplification of Genes in Breast Cancer
An increase in gene copy number over large DNA regions, referred to as
amplicons, has been described in breast cancer as in other cancers. Genomic
regions of breast cancers frequently identified as high-level amplification areas
involve chromosomes 8,11,12,17 and 20. Although specific applications and
clinical roles for some of these genes have not been identified, the presence of
multiple amplified genes in breast cancer is, in itself, a marker of a breast cancer
class with a poor clinical outcome (K. Chin et al., 2006). The frequency of gene
amplification and co-amplification in breast cancer is suggestive of chromosome
instability and is viewed as a potential prognostic factor (Al-Kuraya et al., 2004).
The number of amplicons is correlated with shorter telomeres, suggesting that
telomere dysfunction might play a role in chromosome stability and in the
induction of gene copy number aberrations (Fridlyand et al., 2006; Hackett,
Feldser, & Greider, 2001).
66

Multiple genes encompassed in susceptible amplification areas such as
the 17q22-q24 amplicon and the 20q11-q13 amplicon, may be activated and
could contribute to the disease process or in resistance to treatment (Kauraniemi
& Kallioniemi, 2006; M. M. Tanner et al., 1996). Amplification of genes at these
locations have repeatedly been confirmed as playing important roles in breast
cancer pathogenesis and disease progression (S. F. Chin et al., 2007). Not all
the genes in a given chromosomal region are consistently amplified. The size
and extent of the amplicon is variable and the number of genes included in a
particular amplicon also varies among carcinomas (Kauraniemi & Kallioniemi,
2006).
The chromosome region 17q22-24 (HER2 amplicon) may contain a
variable number of genes in this region of the chromosome, such as
topoisomerase II-alpha (TOP2A), RARA (Keith et al., 1993) or PPARB (Zhu et
al., 1999) which are frequently co-amplified with HER2 in breast cancer.
Approximately 35% of breast cancers with HER2 amplification also have
amplification of the TOP2A gene. Recent studies show that co-amplification of
HER2 and TOP2A is significantly correlated with response to anthracycline-
containing chemotherapy (Arriola et al., 2007; M. Tanner et al., 2006). TOP2A is
well-established as the primary target for anthracyclines and its amplification is
proposed as a potential marker for responsiveness to this type of chemotherapy
(Arriola et al., 2007).
67

There are numerous genes in these regions of chromosome 20 which
represent good candidates for promoting cell immortality and which might
contribute to tumor progression. Among those, there are apoptotic genes (BCL-
X), transcription factor encoding genes (E2F) (M. M. Tanner et al., 1996) and
nuclear receptor coactivator genes. Three nuclear receptor coactivators are
encoded on the q arm of chromosome 20 (NCOA3, NCOA5 and NCOA6), and at
least two of them have already been shown to be amplified in breast cancer,
NCOA3 and NCOA6 (Guan et al., 1996).
4.1.3 Breast Cancer Subtypes and Gene Amplification Profiles
Extensive gene-expression profiling studies have been performed by
several groups leading to the definition of novel molecular subtypes of breast
cancer and to new approaches for classification of breast cancers (K. Chin et al.,
2006; S. F. Chin et al., 2007; Feng et al., 2007; Hu et al., 2006; Jeffrey, Fero,
Borresen-Dale, & Botstein, 2002; Johnson, Speirs, Curtin, & Hall, 2007; Lin et al.,
2007; Neve et al., 2006; Paik et al., 2004; Perou et al., 2000; van 't Veer et al.,
2002; Wang et al., 2005). One of the landmark studies of this nature (Perou et
al., 2000) is based on expression data for over 8000 human genes. In this study
breast cancers were separated into four different categories. Additional studies
unveiled further clinical characteristics, as well as new molecular subsets of
these clusters, each with a different expression profile (Sorlie et al., 2001).
68

One group of breast cancers reveals an expression pattern which
resembles that of breast epithelial cells lining the ductal lumen or a luminal-like
cluster of cases which express, among other characteristic genes, ER. Among
luminal subsets, luminal A is a category of tumors with higher expression of
genes implicated in estrogen-regulated signaling and fatty acid metabolism.
Luminal B breast cancers also express ER but have lower expression of ER and
higher expression of genes associated with the basal or HER2 overexpressing
cancers.
Another group of breast cancers exhibits an expression pattern which
resembles that of breast reserve cells or basal myoepithelial cells, a group
referred to as basal-like showing an ER-negative, HER2 negative phenotype;
The basal-like breast cancer phenotype expresses genes implicated in cell cycle
control, cell proliferation and differentiation, or protein phosphorylation (Sorlie et
al., 2006). Carcinomas in this group are associated with a poor prognosis.
One group of breast cancers displays an expression pattern which
includes high expression of HER2, referred to as HER2-positive tumors. The
carcinomas in the HER2 overexpressing group show co-amplification of HER2
with other genes such as GRB7 located nearby on chromosome 17 and
coordinately amplified as part of the HER2 amplicon. As expected, the HER2
overexpression group has a poor prognosis compared to the other expression
groups.
69

The final group of breast cancers demonstrates a pattern of expression
similar to normal ductal epithelium, referred to as the normal-like breast cancer
category.
Additional studies, involving breast cancer cell lines, describe gene
amplification identified in breast cancer cell lines as well as expression profiles
which are close replications of the expression profiles in tumors (Hoeflich et al.,
2009; Neve et al., 2006) (Table 4.1). The clustering of cell lines by cancer
subtype supports the relevance of this classification in breast cancer and the
significance of genetic abnormalities in the pathology of the disease (Neve et al.,
2006). However, the presence of the HER2 cluster among cell lines is not
accepted in all the publications which analyze gene expression profiles in human
breast cancer cell lines
91, 117
. The classification used in the current study was
provided together with the microarray data by the Hoeflich et al group (K. Chin et
al., 2006; Hoeflich et al., 2009; Neve et al., 2006) in a publication which presents
the HER2 amplified cell lines to have the expression profiles of breast cancers
clustering in the HER2-like group.
Cell lines with a similar genetic profile as luminal cancers are: ZR751,
HCC1428, HCC1500, BT483, T47D, CAMA1, MDAMB415, EVSAT, KPL1,
EFM19, MCF7, MFM223, and MDAMB175 (Hoeflich et al., 2009). Luminal cells
grown in culture prove to be more differentiated, more adherent and less invasive
than other cell types (Neve et al., 2006). Cell lines which clustered by genes
70

expressed in the basal-like category of breast cancers are: CAL148, BT549,
HCC70, SW527, MDAMB436, MX1, HCC1806, HCC1937, CAL51, CAL85-1,
HS578T, HDQP1, MDAMB134, DU4475, MDAMB468, CAL120, BT20, HCC38,
HCC1143, MDAMB231, and HCC1395 (Hoeflich et al., 2009). This group is
represented by less differentiated, more invasive cells that have a
‘mesenchymal-like appearance’ or a ‘stem-like’ genetic signature (Neve et al.,
2006). Sixteen of the cell lines used in the current study were HER2 amplified
and all of them clustered in the HER2 subtype: HCC202, HCC1954, MDAMB453,
KPL4, ZR7530, UACC893, AU565, HCC1569, MDAMB361, SKBR3, UACC812,
HCC1419, EFM192A, BT474, JIMT1, HCC2218 (Hoeflich et al., 2009) (Table
4.1). Although not many cell lines fall into the normal-type category, HBL-100 is
the cell line with most features of normal breast epithelial cells.

71

Table 4.1 Cell Lines Classification by Breast Cancer Subtype
(Hoeflich et al., 2009)
Luminal Cell
Lines
Basal Cell
Lines
HER2-type Cell
Lines
BT483 BT20 AU565
CAMA1 BT549 BT474
EFM19 CAL120 EFM192A
EVSAT CAL148 HCC1419
HCC1428 CAL51 HCC1569
HCC1500 CAL85-1 HCC1954
KPL1 DU4475 HCC202
MCF7 HCC1143 HCC2218
MDAMB175 HCC1395 JIMT1
MDAMB415 HCC1806 KPL4
MFM223 HCC1937 MDAMB361
T47D HCC38 MDAMB453
ZR751 HCC70 SKBR3
HDQP1 UACC812
HS578T UACC893
MDAMB134 ZR7530
MDAMB231
MDAMB435
MDAMB436
MDAMB468
MX1
SW527

72

4.1.4 Nuclear Receptor Coactivator Genes on Chromosome 20
Amplification of chromosome 20 can occur independently or concurrently
in one to three regions containing the genes of interest on 20q11, 20q12, and
20q13.2 (M. M. Tanner et al., 1995).
NCOA3
NCOA3 is considered an oncogene and it’s located in the 20q13 amplicon.
It promotes cell growth (G. Zhou, Hashimoto, Kwak, Tsai, & Tsai, 2003) (List et
al., 2001), upon overexpression induces tumor formation in mice (Torres-Arzayus
et al., 2004) and might have the capability to regulate cell invasion (Bai, Uehara,
& Montell, 2000). This protein is relevant to human breast cancer since it has
been shown to play an important role in breast development (Xu et al., 2000).
NCOA3 has been shown to be amplified in 5% (Bautista et al., 1998; Kirkegaard
et al., 2007) and overexpressed in 30% of breast cancers (Bouras, Southey, &
Venter, 2001). The amplification status of this gene has been correlated with ER
positivity (Sarah L. Anzick et al., 1997; Azorsa et al., 2001; Bautista et al., 1998)
and overexpression has been correlated with HER2 overexpression (Bouras et
al., 2001; Thorat et al., 2008). Some studies have shown correlations of NCOA3
with tumor size, tumor grade and lymph node metastasis, however no clear
association has been reported between NCOA3 amplification and clinical or
pathological factors (Bautista et al., 1998; Bouras et al., 2001; Thorat et al.,
2008) (Sarah L. Anzick et al., 1997).
73

Amplification and overexpression of NCOA3 are not correlated either in
breast cancer cell lines or in tumor samples (Bautista et al., 1998; Glaeser et al.,
2001). Samples amplified for NCOA3 overexpress the protein, however the
reverse is not uniformly observed. High levels of mRNA and high protein levels
are often found in cells that are not amplified for NCOA3. Up to 60% of breast
cancers might have NCOA3 overexpression (Sarah L. Anzick et al., 1997). This
apparent discrepancy may be related to other mechanisms for protein
accumulation in the nucleus, besides the increased production related to gene
amplification. Proposed alternate mechanisms for NCOA3 buildup in the nucleus
are increased mRNA stability, increased targeting of NCOA3 from the cytoplasm
to the nucleus or its reduced degradation (X. Li et al., 2006; R. C. Wu et al.,
2004; R. C. Wu et al., 2005; Yan et al., 2003; Yi et al., 2005; Zheng et al., 2005).
NCOA5
NCOA5 is located on chromosome 20 in the 20q12 region in close
proximity with NCOA3. Although chromosome 20 has been the subject of many
studies concerning amplification (M. M. Tanner et al., 1995; M. M. Tanner et al.,
1996), amplification of NCOA5 in breast cancer has not been previously
described.
NCOA6
NCOA6 is located in close proximity of the centromeric region of
chromosome 20, at 20q11. It has been shown to be amplified and overexpressed
74

in breast cancers as well as colon cancers and small cell lung carcinomas
(Bautista et al., 1998; S. K. Lee et al., 1999; M. M. Tanner et al., 1995; M. M.
Tanner et al., 1996). NCOA6 interacts with multiple nuclear hormone receptors
including RAR, vitamin D3, thyroid hormone, and steroid hormone receptors (ER-
alfa). Therefore NCOA6 amplification and overexpression can have multiple
effects on cell homeostasis through different pathways. In the ER pathway
NCOA6 interacts with other nuclear receptor coactivators, CBP, SRC1, and
methyltranferases (H3K4MTs). Unlike NCOA3, amplification of NCOA6 has not
been studied for involvement in tumor development and response to treatment in
breast cancer.
This study is investigating co-amplification among nuclear receptor
coactivators located on chromosome 20 and associations with patient
characteristics and cancer attributes (size, grade, and lymph node metastasis).
Because of their involvement in important pathways in breast cancer progression
these genes have the potential of becoming new breast cancer markers used for
selection of patients for treatment options.
4.2 Materials and Methods
Cell Lines Culture
Breast cancer cell lines (HCC1419,HCC1954, HCC2218, ZR7530, BT474,
MDAMB453, HS578T, EFM192A, SKBR3, SUM225, SUM190, UACC812,
75

HCC202, HCC1569, MDAMB361, UACC893, MCF7, MDAMB231 and JIMT1), as
well as a normal immortalized breast epithelial cell line (HBL100) were obtained
from American Type Culture Collection (ATCC) and cultured in sterile conditions.
Normal lymphocyte cell lines (GM8299, GM10636, GM7421, GM1638, and
GM67415) were also cultured.
Several breast cancer cell lines (HCC1419, HCC1954, HCC2218,
ZR7530, BT474, EFM192A, and HCC202) and lymphocytes were cultured in
RPMI 1640 medium, while others (HS578T, MCF7, and JIMT1) were cultured in
DMEM or McCoy’s 5A medium (SKBR3). All media were supplemented with 10%
fetal bovine serum (FBS). The medium for BT474 and HS578T was also
supplemented with insulin 10 ug/ml. Cells were maintained in 5% CO
2
at 37C
and split at 80-90% confluency.
UACC893, UACC812, MDAMB 361, MDAMB453, and MDAMB231cell
lines were maintained in L-15 medium, with 20 % FBS and grown in 0% CO
2
.
The medium for UACC812 was also supplemented with 20ng/ml human
epidermal growth factor (EGF).
SUM225 and SUM190 were grown in Ham's F12, 5ug/mL insulin, 1ug/mL
hydrocortisone, 10mM HEPES, and 5%FBS with 5% CO2 in the air. The medium
for SUM190 also contained 5ug/mL transferrin, 10nM triiodothyronine, 50nM
Sodium selenite, 1.0g/L bovine serum albumin, and 5mM ehtanolamine.
76

L-glutamine (2mM), and antimicrobial factors (100 units/ml Penicillin-G,
100mcg/ml Streptomycin, and 0.25 ng/ml AmphotericinB) were added to all
media. All cell lines were harvested at 75% confluency, trypsinized and pelleted.
Four T-75 flasks (aprox 1.5 million cells each) were used for each pellet. The
cells were used for DNA extraction, RNA extraction and extraction of cell lysates.
One pellet from each cell line was formalin-fixed for 6 hours, paraffin embedded
and used for IHC staining and FISH.
SNP Arrays
DNA extracted from twenty cell lines grown in our lab (as described above
in Cell lines culture) was tested for copy number variations using the Affymetrix
Genome-Wide Human SNP Array 6.0.
Affymetrix Genome-Wide Human SNP Array 6.0 was used for DNA copy
number analysis. This array interrogates 906,000 SNPs across the genome, as
well as 945,826 copy number probes, for a total of 1.8 million genetic markers.
The array assay was conducted according to the manufacturer’s protocol
(Affymetrix Inc.). Brifely, genomic DNA isolated from cell lines was digested with
StyI or NspI restriction endonuclease. The digested DNA was then ligated to
adaptors for NspI and StyI, and PCR amplified using a common primer for the
adaptors. The PCR products were then combined and fragmented with DNaseI,
and labeled with biotin. DNA was then injected onto arrays, stained, and
77

scanned. Raw image files were converted to CEL files using the Affymetrix
genotyping console.
Raw data for 32 additional cell lines was obtained with an academic
license from the Cancer Genome Project (CGP) of the Wellcome Trust Sanger
Institute. CEL files were downloaded from the CGP website
(http://www.sanger.ac.uk/genetics/CGP/ (Greenman et al.)).
All 52 CEL files were imported into Partek Genomics Suite version 6.3
software package (Partek). Allelic ratios for each SNP were generated and
normalized against a set of 270 HapMap reference samples. Copy number data
for each SNP was then generated based on the allelic ratios.
A data search in Oncomine ("Oncomine") resulted in the identification of
studies with publicly available microarray gene expression data from relevant
breast cancer cell lines. Multiple studies were analyzed for association with copy
number data. To simplify the final data analysis, raw data from a single study was
chosen based on matching cell lines for which copy number data had been
created, as well as study design and resolution of the microarray. Raw data
made available from a study by Hoeflich et al was downloaded and imported into
Partek Genomics Suite and subsequently analyzed (Hoeflich et al., 2009). The
data was generated for 51 breast cancer cell lines using Affymetrix
HGU_133Plus2.0 arrays.
78

Using statistical analysis features provided in Partek Genomics Suite,
individual and combined analyses of copy number data and gene expression
data was performed. First, segmentation analysis of copy number data was
performed to identify regions of significant amplification or deletion. Next, an
ANOVA analysis of gene expression data based on known amplification status of
a single gene of interest was performed to identify regions of overexpression.
The segmentation and ANOVA analyses were then combined to identify whether
genes of interest were amplified and overexpressed in the cell lines.
Metaphase Spreads
Normal lymphocytes as well as breast cancer cells were grown as shown
in the paragraph above (Cell lines). When the cells reach 75 % confluence they
were arrested in metaphase by addition of colcemid (GIBCO) at 200 ng/ml to cell
culture. The cells were incubated for 30 min-2 hours depending on the length of
cell cycle. Afterwards the cells were trypsinized, collected and slowly
resuspended in 2 ml of hypotonic solution (KCL solution, Invitrogen). After a10
min incubation at 37ºC the cells were pelleted and fixed in three 10 minute steps
in cold fixative (three parts of methanol and one part of acetic acid). The cells
were stored in cell suspension in 10 ml fixative, at -20C. Metaphase spreads
were obtained by dropping 2-3 drops of cell suspension on very cold slides (-
20C). The metaphase slides were steamed for 2-3 minutes, and dried for 2-3
79

hours. The slides were denatured and hybridized according to the FISH protocol
presented below.
Fluorescent In Situ Hybridization (FISH)
FISH Probe Certification.
Analytical sensitivity and specificity of FISH probes was assessed by
hybridization of the probe to cells arrested in metaphase. Chromosomes
representing 200 distinct genomic targets were visualized and counted for each
probe. In brief, chromosome spreads from 50 cells (four chromosomes per
metaphase) from five different individuals were analyzed for co-localization of
chromosome 20 centromere signal with the probe signal.
Gene Amplification
The amplification status of target genes in the breast cancer tumors was
assessed by fluorescent in situ hybridization (FISH), using a gene-specific
probe(Press et al., 2005). The paraffin-embedded tumor tissue microarray (TMA)
was cut in 4 micron thick tissue sections and mounted on slides and processed
as described in Materials and Methods, Chapter 2. The slides were
deparaffinized and fixed in a VP2000 tissue processor using the Vysis Paraffin
Pretreatment Reagent kit (Abbott-Vysis, Inc). The sections were baked overnight
at 56°C, deparaffinized in Citrisolv for 10 minutes and dehydrated in 100%
ethanol for 5 minutes. The sections were pretreated in 0.2N HCL for 20 minutes
80

and Pretreatment Solution at 80°C for 30 minutes, then digested with protease
(37°C, 15 minutes). The samples were fixed in neutral buffered formalin and a
series of graded alcohols: 70%, 95%, and 100%. The slides were air dried,
denatured at 72°C for 5 minutes and then dehydrated in alcohols prior to probe
hybridization and incubation at 37°C overnight. The nuclei were counterstained
with an intercalating fluorescent counterstain, 4'-6'-diamidino-2'-phenylindole
(DAPI).
FISH probes derived from BAC clones were purchased for all three gene
of interest (Empire Genomics): for NCOA6 RP11-45A2, for NCOA5 RP11-
177B15, and for NCOA3 RP11-976F15. The probes were labeled with either
Spectrum Orange or Spectrum Green. Two chromosome 20 specific probes - a
centromere enumeration probe (CEP20) and a telomere probe 20 (TEL20p) were
purchased from Vysis (Abbott Molecular) and used as chromosome reference
probes. The centromere probe was directly labeled with Spectrum Orange, and
annealed to the alpha satellite DNA sequence at the centromeric region of
chromosome 20. The telomere probe was directly labeled with Spectrum Green,
and annealed to the DNA sequence at the telomeric region of the p arm of
chromosome 20. Gene interrogation probe and a reference probe of a different
color were mixed and denatured prior to their hybridization on slides. The final
probe mixture contained 2 ul gene probe, 1ul CEP20/TEL20, and 7ul
hybridization buffer for each slide.
81

Hybridization of the probe mixture on breast cancer specimens was
performed as described earlier in Chapter 2. Both a negative control slide, an
NCOA6/NCOA3 non-amplified cell line (HBL-100), as well as a positive
amplification control, an NCOA6/NCOA3 amplified cell line (BT474) were
included in the procedure. The number of signals was assessed by fluorescence
microscopy with a Zeiss Axioplan2 microscope (Carl Zeiss, Inc). Signals were
counted for at least 20 interphase nuclei of interphase cells from at least two
different microscopic fields. If the average number of gene signals per cell was
higher than 4, the sample was considered to have increased gene copy number,
based on previous published data (Press et al., 1997). The ratio of gene to
chromosome 20 reference was calculated by dividing the average number of
gene signals per tumor cell by the average number of reference signals per cell.
If the ratio was higher than 2 the sample was considered to have gene
amplification. Pictures were taken with a Spot Flex camera (Diagnostic
Instruments).
Statistical Analysis
Amplification and expression status was calculated in the cell lines for
NCOA3, NCOA5 and NCOA6 from SNP array and expression array data. Based
on the clustering of cell lines with normal gene copy number we assessed that
copy number of over 3.00 in the microarray data should be considered to
represent an increased gene copy number. In the cell lines correlations were
82

sought between gene copy number and protein expression and between gene
copy number and breast cancer subtype. In the tumor samples amplification and
gene copy number status were calculated for the genes of interest from the FISH
data. Previous studies assessed that a gene to reference ratio equal to or higher
than 2.00 should be considered to represent gene amplification and a copy
number of over 4.00 in the FISH data should be considered to represent an
increased gene copy number. In the tumor samples associations were sought
between amplification/gene copy number of each gene and clinical and
pathological patient characteristics as well as DNA polymorphisms. The same
comparisons were made for co-amplification/gene copy number in all three
genes. A Pearson’s chisquare test and Fisher’s exact test were used for the
analysis where appropriate.
4.3 Results
4.3.1 Amplification and Overexpression of Nuclear Receptor
Coactivators in Cell Lines
The use of whole genome approaches facilitates the identification of
genetic differences between tumors and leads to the discovery of specific genes
responsible for characteristic tumor behaviors. Combined information on gene
expression profiles and on genome copy number abnormalities (CNA) has been
83

gathered using microarray analysis (Bergamaschi et al., 2006; K. Chin et al.,
2006; S. F. Chin et al., 2007; Neve et al., 2006). This data provides a complex
association between the presence of genetic abnormalities in tumors, and the
classification based on gene expression profiles.
A total of 52 cell lines were examined for copy number variations using the
Affymetrix technology (Figure 4.1). Microarray gene expression data from
matching breast cancer cell lines was identified using Oncomine ("Oncomine").
Raw data made available for 51 breast cancer cell lines (Hoeflich et al., 2009)
was downloaded and analyzed for the genes of interest. Both copy number data
and expression data was available for 40 overlapping cell lines in the two data
sets. Copy number and expression status was calculated for the genes of
interest, NCOA3, NCOA5 and NCOA6 and was used for investigating the
relationship between gene copy number and protein expression in the cell lines.
84

Figure 4.1 Heatmap of Chromosome 20
Figure legend: Copy number variations on chromosome 20 and ploidy in 52 cell lines.
Amplifications are depicted in red color and deletions in blue color. Each cell line is represented
by one row in the heatmap. Chromosome 20 regions are represented horizontally from p13 on
the left side of the image until q13.33 on the right side of the image. Chromosome 20 centromere
is depicted by a transversal black line crossing all the rows of the heatmap.

85

Statistical significance was achieved in all three genes for correlation
between increased copy number and overexpression. NCOA3 had high values
for copy number and expression in two cell lines, BT474 and MCF7. Low end
increase in copy number and overexpression was identified in four other cell
lines, JIMT1, EFM192A, SKBR3, and HCC1569. In NCOA5 there were four cell
lines with both increased gene copy number and higher than normal expression
of protein, HCC1569, SKBR3, AU565, and HCC38. The NCOA6 gene
demonstrated high copy number and expression values in BT474 and low end
aberrations in HCC1569, UACC812, SKBR3, HCC1419, JIMT1, and HCC1143.
Amplification in the three genes was analyzed in relation breast cancer
subtypes (luminal, basal and HER2), as well as breast cancer markers (table 4.2)
Amplification in each of the NCOA3, NCOA5 and NCOA6 genes was associated
with HER2 subtype (p= 0.014, p=0.011, and p=0.004 respectively).

86

Table 4.2 Cell Lines Characterization by Breast Cancer Subtype,
Breast Cancer Markers, and Coactivators Amplification Status
CELL LINE LUMINAL BASAL
HER2
type
HER2
status
ER
status
PR
status
NCOA3
status
NCOA5
status
NCOA6
status
AU565 - - + + - - - + -
BT20 - + - - - - - - -
BT474 - - + + + + + - +
BT549 - + - - - - - - -
CAL120 - + - - - - -
CAL148 - + - - + - - -
CAL51 - + - - - - - - -
CAL85-1 - + - - + - - -
CAMA1 + - - - + + - - -
DU4475 - + - - - - - - -
EFM19 + - - - + + - - -
EFM192A - - + + - - + - -
EVSAT + - - - - + - - -
HCC1143 - + - - - - - - +
HCC1395 - + - - + - - - -
HCC1419 - - + + - - - - +
HCC1569 - - + + - - + + +
HCC1806 - + - - - - - - -
HCC1937 - + - - - - - - -
HCC1954 - - + + - - - - -
HCC2218 - - + + - + - - -
HCC38 - + - - - - - - -
HCC70 - + - - - - - - -
HS578T - + - - - - - - -
JIMT1 - - + + - - + + +
MCF7 + - - - + + + - -
MDAMB134 - + - - + - - - -
MDAMB175 + - - - + - - - -
MDAMB231 - + - - - - - - -
MDAMB361 - - + + + + - - -
MDAMB415 + - - - + - - - -
MDAMB435 - + - - - - - - -
MDAMB453 - - + + - - - - -
MDAMB468 - + - - - - - - -
MFM223 + - - - - - - - -
SKBR3 - - + + - - + + +
T47D + - - - + + - - -
UACC812 - - + + + + - - +
UACC893 - - + + - - - - -
ZR7530 - - + + + - - - -

87

4.3.2 Co-Amplification of Coactivator Genes on Chromosome 20
in Breast Cancer Samples
Amplification of nuclear receptor coactivator genes NCOA3, NCOA5 and
NCOA6 was characterized in breast cancer samples from 113 women. The
presence of amplification in these genes was correlated with clinical and
pathological patient characteristics, with the presence or absence of tumor
biomarkers as well as the presence or absence of sequence alterations in
coactivator genes.
Amplification was assessed by FISH through hybridization of gene-specific
probes to tissue microarrays as described in the methods section. For some
cases successful probe hybridization was achieved for the gene probe but not for
the reference probe therefore the amplification ratio was not calculated for those
samples, but only the gene copy number. Amplification status was assessed in
NCOA3 for 94 out of 97 hybridized samples, in NCOA5 for 88 of 90 samples and
in NCOA6 for 98 of 100 cases.
4.3.2.1 Correlation of Gene Amplifications with Clinic-Pathologic
Characteristics
NCOA3 and NCOA5 were co-amplified in three samples (3.5%) in the
study population. Among amplified samples, two were ER and PR positive, and
HER2 negative and one sample had triple negative markers. NCOA6 was co-
88

amplified with NCOA3 and NCOA5 in three samples and was solely amplified in
three more samples (6%) (Table 4.3). Among those, four were ER and PR
positive, and HER2 negative and two samples had triple negative markers.
Table 4.3 Increased Gene Copy Number and Amplification in
Breast Cancer Samples
GENE Samples Analyzed
Samples with
Amplification
Samples
with High
Copy
Number

Reference
Probe
Gene
Probe
NCOA3 94 97 3 15
NCOA5 88 90 3 19
NCOA6 98 100 6 26
Any Gene 100 106 6 31
All Genes 85 85 3 12

NCOA3 increased copy number was identified in 15 samples (15.5%),
NCOA5 increased copy number in 19 samples (21%) and NCOA6 increased
copy number in 26 samples (26%) (Table 4.3). Increased gene copy number was
correlated with large tumors (> 5 cm) for all three genes (p=0.006 in NCOA3,
p=0.017 in NCOA5, and p=0.035 in NCOA6). High gene copy number was also
correlated with PR negativity (p=0.039, and p=0.045 respectively) and HER2
positivity (p=0.039, and p=0.004 respectively) for NCOA3 and NCOA5, but not
for NCOA6 (p=0.189 for PR and p=0.294 for HER2). Correlations with high tumor
grade (grade 3) were barely significant (p= 0.038) for NCOA3. In the case of
89

NCOA5 and NCOA6 the p values of tumor grade correlation were not significant,
but 13 of 16 and 18 of 24 samples with high copy number were poorly
differentiated and scored with grade 3.
4.3.2.2 Correlation of Gene Amplifications with Sequence Alterations
Although somatic mutations and amplifications were both present in the
NCOA3 and NCOA6 genes, due to the low number of events the presence or
absence of somatic mutations was not significantly correlated with amplification
of these genes. Among the four mutated samples, none had amplification in any
of the three genes analyzed. Among the three amplified samples in all three
genes none had any non-synonymous alterations in any of the nine coactivator
genes analyzed for sequence alterations. Among the six amplified samples in
NCOA6 only one had a non-synonymous SNP, located in the coding region of
NCOA1, P1272S.
Somatic mutations were also absent from all the samples identified with
increased copy number in NCOA3, NCOA5 or NCOA6. However the presence of
non-synonymous SNPs was assessed in all except three of the nine sequenced
genes in these samples, CARM1, NCOA5 and ZNF282. The only statistically
significant correlation was identified between increased copy number of
coactivator genes NCOA3 and NCOA6 and the absence of the NCOA3 SNP
T960T (p=0.044, and p= 0.007 respectively).
90

Among cancers with increased copy number in NCOA3, eight of fifteen
samples had non-synonymous alterations in the sequenced genes, four samples
with alterations in one gene, and four samples with alterations in two genes. Five
samples had non-synonymous SNPs in CALCOCO1, three samples in NCOA2,
two in NCOA3, and one sample each in NCOA1 and NCOA6.
When analyzed in correlation with alterations in the polyglutamine region
of NCOA3, samples with increased number of the NCOA3 gene were found to
have a maximum number of 29 repeats, and none of the samples were found to
have more than the normal number of polyglutamine repeats (29). In addition to
the normal genotype (29/29), all the polymorphic genotypes encountered
contained 28 repeats (28/26, 28/28, and 28/29). Seven patients had homozygous
genotypes (29/29 and 28/28), and eight samples had heterozygous genotypes
(26/28, and 28/29).
Nineteen samples had increased copy number of NCOA5 and among
these, nine also had non-synonymous alterations (SNPs) in the nine sequenced
genes. Five patients had alterations in one gene, and four had alterations in two
genes. Five samples had non-synonymous SNPs in CALCOCO1, three in
NCOA3, two samples in NCOA2, two samples in NCOA1, and one in NCOA6.
Among cancers with increased copy number in NCOA6, 16 of 26 samples
had non-synonymous SNPs in the sequenced genes, twelve samples with
alterations in one gene, and four samples with alterations in two genes. Eight
91

samples had non-synonymous SNPs in CALCOCO1, four samples in NCOA2,
three samples in NCOA6, two in NCOA3, two samples in NCOA1, and one in
FLII.
4.4 Discussion
4.4.1 Breast Cancer Cell Lines
Microarray technology was used to assess increased gene copy number
and expression of breast cancer cell lines. A total of ten out of 40 cell lines
revealed increased copy number and overexpression of the genes of interest. All
three genes had an increased copy number in three cell lines, JIMT1, SKBR3
and HCC1569; one cell line, BT474 had increased copy number of two genes
(NCOA3 and NCOA6); and the other six amplified cell lines had high copy
number of any one gene (Table 4.2).
In the current study correlations were sought between increased copy
number of nuclear receptor coactivators in cell lines and breast cancer subtypes.
Since the candidate genes are ER interacting molecules, cell lines with high copy
number of these genes were expected to be of luminal subtype, with ER/PR
overexpression. The analysis revealed no correlation with the luminal subtype,
but showed a significant correlation with the HER2 subtype.
92

Other regions of chromosome 20 also showed increased genomic copies
in these cell lines, including occasionally the centromere (13 out of 52 cell lines).
The presence of more than 2 copies of chromosome 20 centromere might be due
to aneuploidy, often encountered in cancer, or to co-amplification of different
regions on chromosome, including the centromere. Aneuploidy is included as a
factor in the calculation of amplification ratios for FISH experiments. FISH
amplification is determined by the ratio of gene copy number to centromere copy
number. Since the centromere region might be co-amplified with other genes on
the chromosome we also included the increased copy number of genes as a
factor in the analysis, besides the amplification status of genes in breast cancer
samples.
4.4.2 Breast Cancers Samples
FISH was used to assess gene amplification in 115 breast cancer samples
and among those, 85 samples were successfully interpreted for all three genes.
Three patients had DNA amplification in all three genes and six patients (7%)
had DNA amplification in at least one of the coactivator genes analyzed. Among
those six, two were Asian, two were Caucasian and two were of Hispanic
ethnicity. There were no African-American women with amplification in any of
these genes. Gene amplification was not significantly correlated with ER, PR or
HER2 markers or any other patient or tumor marker. Amplification was also
93

neither positively nor negatively correlated with the presence of sequence
alterations in these samples. The samples amplified in all three genes (NCOA3,
NCOA5 and NCOA6) did not have any non-synonymous alterations in any of the
nine coactivator genes analyzed for sequence alterations. Also, none of the
amplified samples or samples with increased copy number of the NCOA3,
NCOA5 or NCOA6 gene had any somatic mutations in their sequence.
There were thirty one patients with increased copy number in at least one
of the three genes and among those, fourteen had high copy number of one
gene, five had two genes affected, and twelve of those patients had high copy
number of all three genes (Table 4.3). The twelve people with high copy number
in all genes were three African-American, three Asian, five Caucasian and one
Hispanic.
Supporting the associations identified individually in the three genes and
in the cell lines in this study, increased copy number of all three genes in the
same sample was correlated with large tumors (> 5 cm) (p=0.023), with HER2
amplification (p=0.039), and with specific sequence alterations.
When analyzed in correlation with alterations in the polyglutamine region
of NCOA3, samples with increased number of all three genes were found to have
a maximum number of 29 repeats. In addition to the normal genotype (29/29-four
samples), the polymorphic genotypes encountered were heterozygous with 28
94

repeats (28/26, and 28/29). Three patients had the 28/26 genotype which was
correlated with the presence increased copy number in all three genes (p=0.045).
When analyzed in association with non-synonymous alterations, there
were statistically significant correlations identified for the samples with increased
copy number in all genes. Seven samples with non-synonymous alterations were
identified in four genes, NCOA2, NCOA3, NCOA6 and CALCOCO1 in these
twelve samples.
The presence of a significant connection between DNA amplification of
genes on chromosome 20 and HER2 amplification is noteworthy. Previous
studies involving DNA analysis identified correlation of NCOA3 with ER and
PR(Bautista et al., 1998; Iwase et al., 2003), and other studies using mRNA or
protein analysis (expression) identified correlations of NCOA3 with HER2
amplification (Bouras et al., 2001; Thorat et al., 2008). Multiple studies examined
the hypothesis that amplification/overexpression of NCOA3 plays a role in
tamoxifen resistance in hormone-responsive breast cancers, in correlation with
the presence of HER2 amplification (Haugan Moi et al.; Kirkegaard et al., 2007;
C. K. Osborne et al., 2003; J. Shou et al., 2004). In the present study there were
only two and three samples respectively which had NCOA3 and NCOA6
increased copy number and ER and HER2 positivity; therefore the low number of
samples prevented the assessment of a statistically significant relation with
patient and tumor characteristics.
95

The correlation between NCOA3 and tumors size has been previously
identified in one study (Bautista et al., 1998). However, the newly identified
significant association between the increased copy number of all three genes
and tumor size is indicative of possible clinical involvement of amplification of
nuclear receptor coactivators on chromosome 20. Due to their possible
association with tumor progression, NCOA3, NCOA5 and NCOA6 genes have
the potential of becoming new molecular markers in breast cancer. Larger
studies, with available clinical and treatment information on patients will be able
to better assess the involvement of coactivators gene amplification in breast
cancer progression and response to tamoxifen treatment.

96

Chapter 5: Implications of Genetic Alterations in
Breast Cancer Therapy
5.1 Contemporary Treatment in Breast Cancer
Two main lines of therapy were developed for breast cancer, based on the
two important molecular markers identified to be involved in disease progression:
HER2 amplification and ER expression.
Trastuzumab (Herceptin) is a humanized antibody directed against the
extracellular domain of HER2 which is established as an effective treatment
against HER2 overexpressing tumors. Trastuzumab used alone or in
combination with chemotherapy has been proved to offer a survival advantage
for breast cancer patients. Although doxorubicin and cyclophosphamide are the
drugs most often used in combination with Herceptin, microtubule inhibitors
(taxanes) can also be included in the combination therapy (Mass et al., 2005;
Piccart-Gebhart et al., 2005; Press & Lenz, 2007; Ross & Fletcher, 1998; Slamon
et al., 2001) (Kaklamani & Gradishar, 2005).
In cancers exhibiting ER activity, hormonal therapies such as tamoxifen or
aromatase inhibitors are recommended. Tamoxifen is a partial estrogen
antagonist, which by competitive binding to ER inhibits transcription of estrogen
regulated genes. It is indicated as the main therapeutic agent in ER positive
97

breast cancers (C. Kent Osborne, 1998). However, many tumors will develop
resistance to tamoxifen, and revert to an estrogen receptor negative phenotype.
Although the exact cause of tamoxifen resistance remains unknown, altered
expression of cofactors involved in the ER pathway might influence the response
to treatment. NCOA3 might be involved in tamoxifen resistance by promoting
tamoxifen agonist activity on the hormone receptors (Haugan Moi et al.;
Kirkegaard et al., 2007; C. K. Osborne et al., 2003; J. Shou et al., 2004).
Tamoxifen resistance might also be acquired by alternate activation of
estrogen targeted genes involved in other cellular pathways (Schiff et al., 2005).
There is evidence of crosstalk between the different pathways involved in breast
cancer. HER2 (Jiang Shou et al., 2004) and NF/kB (Y. Zhou, Eppenberger-
Castori, Eppenberger, & Benz, 2005) are shown to play a role in ER activation
and in the recruitment of the coactivator complex, in detriment to the
corepressors. The ER cofactors might also be involved in the crosstalk between
pathways. NCOA3 might be a major factor in this cooperation for it can be
activated by different kinases from EGFR and NF/kB family (Jiang Shou et al.,
2004). The correlation between NCOA3 amplification and HER2 amplification in
breast cancer samples supports this hypothesis. Also the correlations with the
two other genes in this study NCOA5 and NCOA6 suggest these might also
benefit from HER2 amplification and promote the crosstalk between pathways.
98

Continuous genetic and molecular investigations in breast cancer have the
potential to lead to the development of new complementary treatment tools by
combining the known clinical parameters with new genetic determinants of the
disease.
5.2 Genetic Profiling in Breast Cancer Treatment
Genetic alterations identified through high-through-put techniques such as
comparative genomic hybridization (CGH), cDNA expression microarrays and
analysis of single-nucleotide polymorphisms (SNPs), are currently considered the
key for selecting relevant information for patient benefit (Jeffrey et al., 2002;
Johnson et al., 2007; Pusztai, Mazouni, Anderson, Wu, & Symmans, 2006; Reis-
Filho, Simpson, Gale, & Lakhani, 2005).
Although relatively new, genetic profiling of breast cancer has already
been adapted for clinical use. These accomplishments in molecular forecasting
add to the traditional methods of staging and prediction in breast cancer. Two
tests, Mammaprint
TM
, and Oncotype-Dx
TM
are commercially available to aid
oncologists in making treatment decisions. The tests assign patients to different
risk groups based on the association of their breast cancer molecular profile and
risk for metastatic recurrence or death from their disease.
Mammaprint
TM
is a 70 gene prognostic marker panel used to identify
young, node-negative breast cancer patients who are at high-risk or low-risk for
99

recurrent or metastatic disease. Those women with high-risk disease are
selected for treatment with chemotherapy, while those with low-risk disease may
be spared treatment with chemotherapy. This approach identifies those women
at risk for recurrent or metastatic disease who do not benefit significantly from
chemotherapy and, thereby, to reduce the number of patients that have such
treatment (Buyse et al., 2006; Caldas & Aparicio, 2002). The 70 genes selected
for the Mammaprint profile are involved in the regulation of cell cycle, invasion
and angiogenesis. Interestingly, the gene expression signature panel does not
include genes well known as prognostic markers for breast cancer, such as ER-
α, PR, or HER2.
Oncotype DX is a 21 gene expression assay of 16 known cancer related
genes and 5 reference genes, which provides a recurrence score (0-100) (Paik et
al., 2004) based on the evaluation of gene expression levels of several known
markers of proliferation along with genes that are known to be important in breast
cancer. The 16 selected genes represent different functional groups including
proliferation markers, genes involved in invasion, the HER2 group which contains
the HER2 gene and the GRB7 gene, a growth factor receptor binding protein
located near the chromosomal site for HER2 gene, the estrogen group including
the estrogen and progesterone receptors, and three other proteins (Paik et al.,
2004). The recurrence score estimates low (<18), intermediate or high risk (>31)
of distant recurrence within 10 years in node negative, ER positive breast cancer
100

patients treated with tamoxifen and also assesses the potential benefit of
chemotherapy.
Findings in this study confirm that amplifications of specific regions of
chromosome 20 should be considered as candidates for new molecular markers
in breast cancer due to their probable implication in tumor progression and
possible involvement in response to treatment. The identification of new genetic
markers will lead to constant update and improvement of prediction methods for
disease outcome based on new molecular classifications.

101

Chapter 6: Overall Conclusions
6.1 Conclusions
The work presented in this dissertation focused on the identification of
novel genetic alterations in nuclear receptor coactivators in breast cancer and
their correlation with breast cancer markers and patient characteristics. DNA
sequence analysis of nuclear receptor coactivator genes demonstrated a limited
number of somatic mutations as well as non-synonymous SNPs in breast
cancers. DNA amplification was identified in all the coactivator genes located on
chromosome 20 coding for proteins involved in ER pathway.
The current study supports other published data from the Human Genome
Study and NCBI concerning ethnic correlations for single nucleotide
polymorphisms ("NCBI") of nuclear receptor coactivators. Variations in the size of
polyglutamine repeats in NCOA3 were also correlated with patient characteristics
in this population. Larger studies, with more statistical power, will be able to
assess more accurately the prevalence and importance of these SNPs. However,
the present study adds to the discovery of genetic variations in genes involved in
ER-mediated pathways in breast cancer. The number of SNPs identified in
breast cancer patients is increasing due to the availability of new, wide-ranged
and less expensive sequencing technologies, leading to the development of a
more comprehensive image of germ-line variations involved in human cancers
102

The presence of somatic mutations in three of the coactivators analyzed in
this study shows that the ER transcriptional activation mechanism contains
proteins mutated in breast cancer. These genetic alterations might influence the
coactivators’ capacity to interact with other cellular proteins and alter their
function in breast epithelial cells. The transcriptional and translational
implications of these mutations as well as the presence of significant correlations
with breast cancer markers will have to be assessed in future studies.
In the current study we assessed the presence of nuclear receptor
coactivator gene amplification in breast cancer cell lines as well as tumor
samples. Breast cancer cell lines were considered for analysis because they
show similar genetic aberration profiles as the primary breast cancers. This
represents a confirmation that breast cancer cell lines, although propagated in
culture, maintain the similar molecular characteristics and behavior as the
spectrum of breast carcinomas from which they arise.
The analysis conducted in breast cancer cell lines revealed a significant
correlation between increased copy number of the coactivator genes and their
overexpression, as well as a significant correlation with the HER2 subtype. In
breast cancer samples amplification of NCOA3, NCOA5 and NCOA6 genes
involved in the estrogen receptor pathway is also associated with HER2
overexpression as well as tumor size.
103

In addition this study sought correlations between sequence alterations
and amplification of nuclear receptor coactivators in breast cancer samples.
Although we could not establish a correlation between somatic mutations and
amplifications none of the mutated samples had amplification or increased copy
number in any of the three genes analyzed. In addition, none of the amplified
samples in all three genes had non-synonymous alterations in any of the nine
coactivator genes analyzed for sequence alterations. The presence of non-
synonymous SNPs was randomly distributed among the samples with and
without increased copy number in NCOA3, NCOA5 and NCOA6.
6.2 Future Directions
Somatic mutations were identified in the sequences of three out of nine
genes analyzed and amplification was identified in all three genes analyzed.
Future studies will determine if the mutated and amplified coactivator proteins
have a functional impact in breast cancer. In vivo and in vitro research on cell
lines expressing the specific mutations or overexpressing the proteins would give
insight into the functional implications of these genetic alterations.
The present study is limited by investigating only mutations in the coding
exons of the genes of interest, which are translated into changes in aminoacids
in the final protein. Further investigation of alterations in introns and untranslated
regions might provide more information on other types of genetic alterations in
104

the considered genes. MicroRNA binding sites, new splice sites, target sites for
epigenetic modifications (CpG islands), enhancer and promoter regions for these
genes are all susceptible to mutational modification and might have functional
relevance (Tchatchou et al., 2009).
Analysis was performed by sequencing on nine and by FISH on three of
the genes encoding for ER coactivators. Although there are many factors
involved in signaling transduction pathways, alteration of any single protein in a
given pathway may be sufficient to disturb the function of the entire pathway.
Therefore, genetic alterations in any of the approximately 200 of known estrogen
receptor coactivators ("NURSA") could have an impact on the ER- induced
transcription activation pathway. Investigation of genetic alterations in nuclear
receptor coactivators should continue in order to achieve a more accurate image
of genetically modified members of the hormone receptor pathways, leading to a
comprehensive genetic profiling of breast cancers.
Genetic characterization of cancers should be considered in correlation
with clinical information and treatment follow-up on patients. Larger studies, with
available clinical and treatment patient history will be able to evaluate the
possible involvement of coactivator gene mutations and amplifications in disease
progression and response to treatment in breast cancer. Further molecular
investigations in this direction have the potential to improve classification of the
disease by using new molecular markers, and to improve selection of patients for
105

therapy, leading to better individualized treatment strategies for breast cancer
patients.
6.3 Study Significance
This study is supporting the increasing tendency of treatment decision
based on the genetic heterogeneity of breast cancers. Since breast cancer is the
result of alterations in multiple genes, the identification of new molecular
markers, associated with clinical outcome, is leading to the development of a
new, improved approach to classification of breast carcinomas that is based on
evaluation of multiple genes. In breast cancer, this concept implies an accurate
identification and characterization of genetically modified members of the
hormone receptor pathways as well as the development of targeted therapeutic
plans for different genetic profiles. In the future, the potential for successful
treatment of breast cancer is believed to lie in the availability of more
individualized options for diagnosis and treatment of women affected by this
disease.

106

Bibliography
Al‐Kuraya, K., Schraml, P., Torhorst, J., Tapia, C., Zaharieva, B., Novotny, H., et al. (2004).
Prognostic relevance of gene amplifications and coamplifications in breast cancer.
Cancer Res, 64(23), 8534‐8540.
Albertson, D. G. (2006). Gene amplification in cancer. Trends Genet, 22(8), 447‐455.
Albertson, D. G. (2008). Conflicting evidence on the frequency of ESR1 amplification in breast
cancer. Nat Genet, 40(7), 821‐822.
Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X.‐Y., et al. (1997).
AIB1, a Steroid Receptor Coactivator Amplified in Breast and Ovarian Cancer. Science,
277, 965‐968.
Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X. Y., et al. (1997).
AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science,
277(5328), 965‐968.
Arriola, E., Rodriguez‐Pinilla, S. M., Lambros, M. B., Jones, R. L., James, M., Savage, K., et al.
(2007). Topoisomerase II alpha amplification may predict benefit from adjuvant
anthracyclines in HER2 positive early breast cancer. Breast Cancer Res Treat, 106(2),
181‐189.
Azorsa, D. O., Cunliffe, H. E., & Meltzer, P. S. (2001). Association of steroid receptor coactivator
AIB1 with estrogen receptor‐alpha in breast cancer cells. Breast Cancer Res. Treat.,
70(2), 89‐101.
Azzato, E. M., Pharoah, P. D., Harrington, P., Easton, D. F., Greenberg, D., Caporaso, N. E., et al. A
genome‐wide association study of prognosis in breast cancer. Cancer Epidemiol
Biomarkers Prev, 19(4), 1140‐1143.
Bai, J., Uehara, Y., & Montell, D. J. (2000). Regulation of invasive cell behavior by taiman, a
Drosophila protein related to AIB1, a steroid receptor coactivator amplified in breast
cancer. Cell, 103(7), 1047‐1058.
Bautista, S., Valles, H., Walker, R. L., Anzick, S., Zeillinger, R., Meltrzer, P., et al. (1998). In breast
cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with
estrogen and progesterone receptor positivity. Clinical Cancer Research, 4(12), 2925‐
2929.

107

Bergamaschi, A., Kim, Y. H., Wang, P., Sorlie, T., Hernandez‐Boussard, T., Lonning, P. E., et al.
(2006). Distinct patterns of DNA copy number alteration are associated with different
clinicopathological features and gene‐expression subtypes of breast cancer. Genes
Chromosomes Cancer, 45(11), 1033‐1040.
Blagosklonny, M. V. (2005). Molecular theory of cancer. Cancer Biol Ther, 4(6), 621‐627.
Blom, N., Gammeltoft, S., & Brunak, S. (1999). Sequence and structure‐based prediction of
eukaryotic protein phosphorylation sites. J Mol Biol, 294(5), 1351‐1362.
Bloom, H. J., & Richardson, W. W. (1957). Histological grading and prognosis in breast cancer; a
study of 1409 cases of which 359 have been followed for 15 years. Br J Cancer, 11(3),
359‐377.
Bouras, T., Southey, M. C., & Venter, D. J. (2001). Overexpression of the steroid receptor
coactivator AIB1 in breast cancer correlates with the absence of estrogen and
progesterone receptors and positivity for p53 and HER2/neu. Cancer Res, 61(3), 903‐
907.
Brown, L. A., Hoog, J., Chin, S. F., Tao, Y., Zayed, A. A., Chin, K., et al. (2008). ESR1 gene
amplification in breast cancer: a common phenomenon? Nat Genet, 40(7), 806‐807;
author reply 810‐802.
Burwinkel, B., Wirtenberger, M., Klaes, R., Schmutzler, R. K., Grzybowska, E., Forsti, A., et al.
(2005). Association of NCOA3 polymorphisms with breast cancer risk. Clin Cancer Res,
11(6), 2169‐2174.
Buyse, M., Loi, S., van't Veer, L., Viale, G., Delorenzi, M., Glas, A. M., et al. (2006). Validation and
clinical utility of a 70‐gene prognostic signature for women with node‐negative breast
cancer. J Natl Cancer Inst, 98(17), 1183‐1192.
Caira, F., Antonson, P., Pelto‐Huikko, M., Treuter, E., & Gustafsson, J. A. (2000). Cloning and
characterization of RAP250, a novel nuclear receptor coactivator. J Biol Chem, 275(8),
5308‐5317.
Caldas, C., & Aparicio, S. A. (2002). The molecular outlook. Nature, 415(6871), 484‐485.
Chen, D., Huang, S. M., & Stallcup, M. R. (2000). Synergistic, p160 coactivator‐dependent
enhancement of estrogen receptor function by CARM1 and p300. J Biol Chem, 275(52),
40810‐40816.
Chen, D., Ma, H., Hong, H., Koh, S. S., Huang, S. M., Schurter, B. T., et al. (1999). Regulation of
transcription by a protein methyltransferase. Science, 284(5423), 2174‐2177.
108

Chen, H., Lin, R. J., Schiltz, R. L., Chakravarti, D., Nash, A., Nagy, L., et al. (1997). Nuclear receptor
coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation
complex with P/CAF and CBP/p300. Cell, 90(3), 569‐580.
Chen, H., Xue, Y., Huang, N., Yao, X., & Sun, Z. (2006). MeMo: a web tool for prediction of
protein methylation modifications. Nucleic Acids Res, 34(Web Server issue), W249‐253.
Chin, K., DeVries, S., Fridlyand, J., Spellman, P. T., Roydasgupta, R., Kuo, W. L., et al. (2006).
Genomic and transcriptional aberrations linked to breast cancer pathophysiologies.
Cancer Cell, 10(6), 529‐541.
Chin, S. F., Wang, Y., Thorne, N. P., Teschendorff, A. E., Pinder, S. E., Vias, M., et al. (2007). Using
array‐comparative genomic hybridization to define molecular portraits of primary breast
cancers. Oncogene, 26(13), 1959‐1970.
Conway, K., Parrish, E., Edmiston, S. N., Tolbert, D., Tse, C. K., Geradts, J., et al. (2005). The
estrogen receptor‐alpha A908G (K303R) mutation occurs at a low frequency in invasive
breast tumors: results from a population‐based study. Breast Cancer Res, 7(6), R871‐
880.
Dai, P., & Wong, L.‐J. C. (2003). Somatic instability of the DNA sequences encoding the
polymorphic polyglutamine tract of the AIB1 gene. J. Med. Genet., 40, 885‐890.
Dunning, A. M., Healey, C. S., Baynes, C., Maia, A. T., Scollen, S., Vega, A., et al. (2009).
Association of ESR1 gene tagging SNPs with breast cancer risk. Hum Mol Genet, 18(6),
1131‐1139.
Easton, D. F., Pooley, K. A., Dunning, A. M., Pharoah, P. D., Thompson, D., Ballinger, D. G., et al.
(2007). Genome‐wide association study identifies novel breast cancer susceptibility loci.
Nature, 447(7148), 1087‐1093.
Ensembl http://uswest.ensembl.org/Homo_sapiens/.
Feng, Y., Sun, B., Li, X., Zhang, L., Niu, Y., Xiao, C., et al. (2007). Differentially expressed genes
between primary cancer and paired lymph node metastases predict clinical outcome of
node‐positive breast cancer patients. Breast Cancer Res Treat, 103(3), 319‐329.
Fridlyand, J., Snijders, A. M., Ylstra, B., Li, H., Olshen, A., Segraves, R., et al. (2006). Breast tumor
copy number aberration phenotypes and genomic instability. BMC Cancer, 6, 96.
GenBank http://www.ncbi.nlm.nih.gov/Genbank/.
Glaeser, M., Floetotto, T., Hanstein, B., Beckmann, M. W., & Niederacher, D. (2001). Gene
amplification and expression of the steroid receptor coactivator SRC3 (AIB1) in sporadic
breast and endometrial carcinomas. Horm. Metab. Res., 33(3), 121‐126.
109

Glass, C. K., & Rosenfeld, M. G. (2000). The coregulator exchange in transcriptional functions of
nuclear receptors. Genes Dev, 14(2), 121‐141.
Greenman, C. D., Bignell, G., Butler, A., Edkins, S., Hinton, J., Beare, D., et al. PICNIC: an
algorithm to predict absolute allelic copy number variation with microarray cancer data.
Biostatistics, 11(1), 164‐175.
Guan, X. Y., Xu, J., Anzick, S. L., Zhang, H., Trent, J. M., & Meltzer, P. S. (1996). Hybrid selection of
transcribed sequences from microdissected DNA: isolation of genes within amplified
region at 20q11‐q13.2 in breast cancer. Cancer Res, 56(15), 3446‐3450.
Hackett, J. A., Feldser, D. M., & Greider, C. W. (2001). Telomere dysfunction increases mutation
rate and genomic instability. Cell, 106(3), 275‐286.
Haiman, C. A., Garcia, R. R., Hsu, C., Xia, L., Ha, H., Sheng, X., et al. (2009). Screening and
association testing of common coding variation in steroid hormone receptor co‐
activator and co‐repressor genes in relation to breast cancer risk: the Multiethnic
Cohort. BMC Cancer, 9, 43.
Haiman, C. A., Hankinson, S. E., Spiegelman, D., Colditz, G. A., Willett, W. C., Speizer, F. E., et al.
(2000). Polymorphic repeat in AIB1 does not alter breast cancer risk. Breast Cancer Res,
2(5), 378‐385.
Haiman, C. A., Hankinson, S. E., Spiegelman, D., Colditz, G. A., Willett, W. C., Speizer, F. E., et al.
(2000). Polymorphic repeat in AIB1does not alter breast cancer risk. Breast Cancer Res.,
2, 378‐385.
Hanahan, D., & Weinberg, R. A. (2000). The hallmarks of cancer. Cell, 100(1), 57‐70.
Hart, L. L., & Davie, J. R. (2002). The estrogen receptor: more than the average transcription
factor. Biochem Cell Biol, 80(3), 335‐341.
Hartmaier, R. J., Tchatchou, S., Richter, A. S., Wang, J., McGuire, S. E., Skaar, T. C., et al. (2009).
Nuclear receptor coregulator SNP discovery and impact on breast cancer risk. BMC
Cancer, 9, 438.
Haugan Moi, L. L., Hauglid Flageng, M., Gandini, S., Guerrieri‐Gonzaga, A., Bonanni, B., Lazzeroni,
M., et al. Effect of low‐dose tamoxifen on steroid receptor coactivator 3/amplified in
breast cancer 1 in normal and malignant human breast tissue. Clin Cancer Res, 16(7),
2176‐2186.
Herynk, M. H., & Fuqua, S. A. (2004). Estrogen receptor mutations in human disease. Endocr Rev,
25(6), 869‐898.
110

Hill, S. M., Fuqua, S. A., Chamness, G. C., Greene, G. L., & McGuire, W. L. (1989). Estrogen
receptor expression in human breast cancer associated with an estrogen receptor gene
restriction fragment length polymorphism. Cancer Res, 49(1), 145‐148.
Hoeflich, K. P., O'Brien, C., Boyd, Z., Cavet, G., Guerrero, S., Jung, K., et al. (2009). In vivo
antitumor activity of MEK and phosphatidylinositol 3‐kinase inhibitors in basal‐like
breast cancer models. Clin Cancer Res, 15(14), 4649‐4664.
Holst, F., Stahl, P. R., Ruiz, C., Hellwinkel, O., Jehan, Z., Wendland, M., et al. (2007). Estrogen
receptor alpha (ESR1) gene amplification is frequent in breast cancer. Nat Genet, 39(5),
655‐660.
Horlings, H. M., Bergamaschi, A., Nordgard, S. H., Kim, Y. H., Han, W., Noh, D. Y., et al. (2008).
ESR1 gene amplification in breast cancer: a common phenomenon? Nat Genet, 40(7),
807‐808; author reply 810‐802.
Horner MJ, R. L., Krapcho M, Neyman N, Aminou R, Howlader N, Altekruse SF, Feuer EJ, Huang L,
Mariotto A, Miller BA, Lewis DR, Eisner MP, Stinchcomb DG, Edwards BK (eds). (2009).
SEER Cancer Statistics Review, 1975‐2006. [ based on November 2008 SEER data
submission, posted to the SEER web site].
Hu, Z., Fan, C., Oh, D. S., Marron, J. S., He, X., Qaqish, B. F., et al. (2006). The molecular portraits
of breast tumors are conserved across microarray platforms. BMC Genomics, 7, 96.
Iwase, H., Omoto, Y., Toyama, T., Yamashita, H., Hara, Y., Sugiura, H., et al. (2003). Clinical
significance of AIB1 expression in human breast cancer. Breast Cancer Res Treat, 80(3),
339‐345.
Jeffrey, S. S., Fero, M. J., Borresen‐Dale, A. L., & Botstein, D. (2002). Expression array technology
in the diagnosis and treatment of breast cancer. Mol Interv, 2(2), 101‐109.
Johnson, N., Speirs, V., Curtin, N. J., & Hall, A. G. (2007). A comparative study of genome‐wide
SNP, CGH microarray and protein expression analysis to explore genotypic and
phenotypic mechanisms of acquired antiestrogen resistance in breast cancer. Breast
Cancer Res Treat.
Julenius, K., Molgaard, A., Gupta, R., & Brunak, S. (2005). Prediction, conservation analysis, and
structural characterization of mammalian mucin‐type O‐glycosylation sites.
Glycobiology, 15(2), 153‐164.
Kaklamani, V. G., & Gradishar, W. J. (2005). Adjuvant Therapy of Breast Cancer. Cancer
Investigation, 23, 548–560.
Kallioniemi, A., Kallioniemi, O. P., Piper, J., Tanner, M., Stokke, T., Chen, L., et al. (1994).
Detection and mapping of amplified DNA sequences in breast cancer by comparative
genomic hybridization. Proc Natl Acad Sci U S A, 91(6), 2156‐2160.
111

Kauraniemi, P., & Kallioniemi, A. (2006). Activation of multiple cancer‐associated genes at the
ERBB2 amplicon in breast cancer. Endocr Relat Cancer, 13(1), 39‐49.
Keith, W. N., Douglas, F., Wishart, G. C., McCallum, H. M., George, W. D., Kaye, S. B., et al.
(1993). Co‐amplification of erbB2, topoisomerase II alpha and retinoic acid receptor
alpha genes in breast cancer and allelic loss at topoisomerase I on chromosome 20. Eur J
Cancer, 29A(10), 1469‐1475.
Kim, J. H., Li, H., & Stallcup, M. R. (2003). CoCoA, a nuclear receptor coactivator which acts
through an N‐terminal activation domain of p160 coactivators. Mol Cell, 12(6), 1537‐
1549.
Kirkegaard, T., McGlynn, L. M., Campbell, F. M., Muller, S., Tovey, S. M., Dunne, B., et al. (2007).
Amplified in breast cancer 1 in human epidermal growth factor receptor ‐ positive
tumors of tamoxifen‐treated breast cancer patients. Clin Cancer Res, 13(5), 1405‐1411.
Knechtel, G., Hofmann, G., Gerger, A., Renner, W., Langsenlehner, T., Szkandera, J., et al.
Analysis of common germline polymorphisms as prognostic factors in patients with
lymph node‐positive breast cancer. J Cancer Res Clin Oncol.
Ko, L., Cardona, G. R., & Chin, W. W. (2000). Thyroid hormone receptor‐binding protein, an
LXXLL motif‐containing protein, functions as a general coactivator. Proc Natl Acad Sci U S
A, 97(11), 6212‐6217.
Ko, L., & Chin, W. W. (2003). Nuclear receptor coactivator thyroid hormone receptor‐binding
protein (TRBP) interacts with and stimulates its associated DNA‐dependent protein
kinase. J Biol Chem, 278(13), 11471‐11479.
Kononen, J., Bubendorf, L., Kallioniemi, A., Barlund, M., Schraml, P., Leighton, S., et al. (1998).
Tissue microarrays for high‐throughput molecular profiling of tumor specimens. Nat
Med, 4(7), 844‐847.
Lee, S. K., Anzick, S. L., Choi, J. E., Bubendorf, L., Guan, X. Y., Jung, Y. K., et al. (1999). A nuclear
factor, ASC‐2, as a cancer‐amplified transcriptional coactivator essential for ligand‐
dependent transactivation by nuclear receptors in vivo. J Biol Chem, 274(48), 34283‐
34293.
Lee, Y. H., Campbell, H. D., & Stallcup, M. R. (2004). Developmentally essential protein flightless I
is a nuclear receptor coactivator with actin binding activity. Mol Cell Biol, 24(5), 2103‐
2117.
Lee, Y. H., Koh, S. S., Zhang, X., Cheng, X., & Stallcup, M. R. (2002). Synergy among nuclear
receptor coactivators: selective requirement for protein methyltransferase and
acetyltransferase activities. Mol Cell Biol, 22(11), 3621‐3632.
112

Lengauer, C., Kinzler, K. W., & Vogelstein, B. (1998). Genetic instabilities in human cancers.
Nature, 396(6712), 643‐649.
Leo, C., & Chen, J. D. (2000). The SRC family of nuclear receptor coactivators. Gene, 245(1), 1‐11.
Li, N., Dong, J., Hu, Z., Shen, H., & Dai, M. Potentially functional polymorphisms in ESR1 and
breast cancer risk: a meta‐analysis. Breast Cancer Res Treat, 121(1), 177‐184.
Li, X., Lonard, D. M., Jung, S. Y., Malovannaya, A., Feng, Q., Qin, J., et al. (2006). The SRC‐3/AIB1
Coactivator Is Degraded in a Ubiquitin‐ and ATP‐Independent Manner by the REGγ
Proteasome. Cell, 124, 381‐392.
Liao, L., Kuang, S. Q., Yuan, Y., Gonzalez, S. M., O'Malley, B. W., & Xu, J. (2002). Molecular
structure and biological function of the cancer‐amplified nuclear receptor coactivator
SRC‐3/AIB1. J Steroid Biochem Mol Biol, 83(1‐5), 3‐14.
Lin, J., Gan, C. M., Zhang, X., Jones, S., Sjoblom, T., Wood, L. D., et al. (2007). A multidimensional
analysis of genes mutated in breast and colorectal cancers. Genome Res, 17(9), 1304‐
1318.
List, H. J., Lauritsen, K. J., Reiter, R., Powers, C., Wellstein, A., & Riegel, A. T. (2001). Ribozyme
targeting demonstrates that the nuclear receptor coactivator AIB1 is a rate‐limiting
factor for estrogen‐dependent growth of human MCF‐7 breast cancer cells. J Biol Chem,
276(26), 23763‐23768.
Lu, S., Wang, Z., Liu, H., & Hao, X. HER2 Ile655Val polymorphism contributes to breast cancer
risk: evidence from 27 case‐control studies. Breast Cancer Res Treat.
Mahajan, M. A., & Samuels, H. H. (2000). A new family of nuclear receptor coregulators that
integrate nuclear receptor signaling through CREB‐binding protein. Mol Cell Biol, 20(14),
5048‐5063.
Mahajan, M. A., & Samuels, H. H. (2005). Nuclear hormone receptor coregulator: role in
hormone action, metabolism, growth, and development. Endocr Rev, 26(4), 583‐597.
Mass, R. D., Press, M. F., Anderson, S., Cobleigh, M. A., Vogel, C. L., Dybdal, N., et al. (2005).
Evaluation of clinical outcomes according to HER2 detection by fluorescence in situ
hybridization in women with metastatic breast cancer treated with trastuzumab. Clin
Breast Cancer, 6(3), 240‐246.
McKenna, N. J., & O'Malley, B. W. (2002). Combinatorial control of gene expression by nuclear
receptors and coregulators. Cell, 108(4), 465‐474.
Monigatti, F., Gasteiger, E., Bairoch, A., & Jung, E. (2002). The Sulfinator: predicting tyrosine
sulfation sites in protein sequences. Bioinformatics, 18(5), 769‐770.
113

Montgomery, K. G., Chang, J. H., Gertig, D. M., Dite, G. S., McCredie, M. R., Giles, G. G., et al.
(2005). The AIB1 glutamine repeat polymorphism is not associated with risk of breast
cancer before age 40 years in Australian women. Breast Cancer Res, 7(3), R353‐356.
NCBI http://www.ncbi.nlm.nih.gov/projects/SNP/.
NCBI Probes http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=search&db=probe.
Neve, R. M., Chin, K., Fridlyand, J., Yeh, J., Baehner, F. L., Fevr, T., et al. (2006). A collection of
breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell,
10(6), 515‐527.
Ng, P. C., & Henikoff, S. (2003). SIFT: Predicting amino acid changes that affect protein function.
Nucleic Acids Res, 31(13), 3812‐3814.
NURSA http://www.nursa.org/index.cfm.
Oncomine www.oncomine.org.
Osborne, C. K. (1998). Tamoxifen in the treatment of breast cancer. N Engl J Med, 339(22), 1609‐
1618.
Osborne, C. K., Bardou, V., Hopp, T. A., Chamness, G. C., Hilsenbeck, S. G., Fuqua, S. A., et al.
(2003). Role of the estrogen receptor coactivator AIB1 (SRC‐3) and HER‐2/neu in
tamoxifen resistance in breast cancer. J Natl Cancer Inst, 95(5), 353‐361.
Paik, S., Shak, S., Tang, G., Kim, C., Baker, J., Cronin, M., et al. (2004). A multigene assay to
predict recurrence of tamoxifen‐treated, node‐negative breast cancer. N Engl J Med,
351(27), 2817‐2826.
Perou, C. M., Sorlie, T., Eisen, M. B., van de Rijn, M., Jeffrey, S. S., Rees, C. A., et al. (2000).
Molecular portraits of human breast tumours. Nature, 406(6797), 747‐752.
Piccart‐Gebhart, M. J., Procter, M., Leyland‐Jones, B., Goldhirsch, A., Untch, M., Smith, I., et al.
(2005). Trastuzumab after adjuvant chemotherapy in HER2‐positive breast cancer. N
Engl J Med, 353(16), 1659‐1672.
Press, M., Spaulding, B., Groshen, S., Kaminsky, D., Hagerty, M., Sherman, L., et al. (2002).
Comparison of different antibodies for detection of progesterone receptor in breast
cancer. Steroids, 67(9), 799‐813.
Press, M. F., Bernstein, L., Thomas, P. A., Meisner, L. F., Zhou, J. Y., Ma, Y., et al. (1997). HER‐
2/neu gene amplification characterized by fluorescence in situ hybridization: poor
prognosis in node‐negative breast carcinomas. J Clin Oncol, 15(8), 2894‐2904.
Press, M. F., & Lenz, H. J. (2007). EGFR, HER2 and VEGF pathways: validated targets for cancer
treatment. Drugs, 67(14), 2045‐2075.
114

Press, M. F., Pike, M. C., Hung, G., Zhou, J. Y., Ma, Y., George, J., et al. (1994). Amplification and
overexpression of HER‐2/neu in carcinomas of the salivary gland: correlation with poor
prognosis. Cancer Res, 54(21), 5675‐5682.
Press, M. F., Sauter, G., Bernstein, L., Villalobos, I. E., Mirlacher, M., Zhou, J. Y., et al. (2005).
Diagnostic evaluation of HER‐2 as a molecular target: an assessment of accuracy and
reproducibility of laboratory testing in large, prospective, randomized clinical trials. Clin
Cancer Res, 11(18), 6598‐6607.
Press, M. F., Slamon, D. J., Flom, K. J., Park, J., Zhou, J. Y., & Bernstein, L. (2002). Evaluation of
HER‐2/neu gene amplification and overexpression: comparison of frequently used assay
methods in a molecularly characterized cohort of breast cancer specimens. J Clin Oncol,
20(14), 3095‐3105.
Pusztai, L., Mazouni, C., Anderson, K., Wu, Y., & Symmans, W. F. (2006). Molecular classification
of breast cancer: limitations and potential. Oncologist, 11(8), 868‐877.
R. Gupta, E. J. a. S. B. (2004). Prediction of N‐glycosylation sites in human proteins.Unpublished
manuscript.
Ranzani, G. N., Pellegata, N. S., Previdere, C., Saragoni, A., Vio, A., Maltoni, M., et al. (1990).
Heterogeneous protooncogene amplification correlates with tumor progression and
presence of metastases in gastric cancer patients. Cancer Res, 50(24), 7811‐7814.
Rebbeck , T. R., Wang, Y., Kantoff, P. W., Krithivas, K., Neuhausen, S. L., Godwin, A. K., et al.
(2001). Modification of BRCA1‐ and BRCA2‐associated breast cancer risk by AIB1
genotype and reproductive history. Cancer Research, 61(14), 5420‐5424.
Reis‐Filho, J. S., Drury, S., Lambros, M. B., Marchio, C., Johnson, N., Natrajan, R., et al. (2008).
ESR1 gene amplification in breast cancer: a common phenomenon? Nat Genet, 40(7),
809‐810; author reply 810‐802.
Reis‐Filho, J. S., Simpson, P. T., Gale, T., & Lakhani, S. R. (2005). The molecular genetics of breast
cancer: the contribution of comparative genomic hybridization. Pathol Res Pract,
201(11), 713‐725.
Ross, J. S., & Fletcher, J. A. (1998). The HER‐2/neu Oncogene in Breast Cancer: Prognostic Factor,
Predictive Factor, and Target for Therapy. Oncologist, 3(4), 237‐252.
Saffari, B., Jones, L. A., el‐Naggar, A., Felix, J. C., George, J., & Press, M. F. (1995). Amplification
and overexpression of HER‐2/neu (c‐erbB2) in endometrial cancers: correlation with
overall survival. Cancer Res, 55(23), 5693‐5698.
Sauve, F., McBroom, L. D., Gallant, J., Moraitis, A. N., Labrie, F., & Giguere, V. (2001). CIA, a novel
estrogen receptor coactivator with a bifunctional nuclear receptor interacting
determinant. Mol Cell Biol, 21(1), 343‐353.
115

Schiff, R., Massarweh, S. A., Shou, J., Bharwani, L., Arpino, G., Rimawi, M., et al. (2005).
Advanced concepts in estrogen receptor biology and breast cancer endocrine
resistance: implicated role of growth factor signaling and estrogen receptor
coregulators. Cancer Chemother. Pharmacol., 56, s10‐s20.
Shou, J., Massarweh, S., Osborne, C. K., Wakeling, A. E., Ali, S., Heidi Weiss, et al. (2004).
Mechanisms of Tamoxifen Resistance: Increased Estrogen Receptor‐HER2/neu Cross‐
Talk in ER/HER2–Positive Breast Cancer. Journal of the National Cancer Institute, 96(12),
926‐935.
Shou, J., Massarweh, S., Osborne, C. K., Wakeling, A. E., Ali, S., Weiss, H., et al. (2004).
Mechanisms of tamoxifen resistance: increased estrogen receptor‐HER2/neu cross‐talk
in ER/HER2‐positive breast cancer. J Natl Cancer Inst, 96(12), 926‐935.
Sjoblom, T., Jones, S., Wood, L. D., Parsons, D. W., Lin, J., Barber, T. D., et al. (2006). The
consensus coding sequences of human breast and colorectal cancers. Science,
314(5797), 268‐274.
Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., & McGuire, W. L. (1987). Human
breast cancer: correlation of relapse and survival with amplification of the HER‐2/neu
oncogene. Science, 235(4785), 177‐182.
Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., & McGuire, W. L. (1987). Human
breast cancer: correlation of relapse and survival with amplification of the HER‐2/new
oncogene. Science, 235(4785), 177‐182.
Slamon, D. J., Godolphin, W., Jones, L. A., Holt, J. A., Wong, S. G., Keith, D. E., et al. (1989).
Studies of the HER‐2/neu proto‐oncogene in human breast and ovarian cancer. Science,
244(4905), 707‐712.
Slamon, D. J., Leyland‐Jones, B., Shak, S., Fuchs, H., Paton, V., Bajamonde, A., et al. (2001). Use
of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer
that overexpresses HER2. N Engl J Med, 344(11), 783‐792.
Smith CL, O. M. B. (2004). A key to understandinng tissue specificity of selective receptor
modulators. Endocr Rev, 25, 45‐71.
Sorlie, T., Perou, C. M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., et al. (2001). Gene
expression patterns of breast carcinomas distinguish tumor subclasses with clinical
implications. Proc Natl Acad Sci U S A, 98(19), 10869‐10874.
Sorlie, T., Wang, Y., Xiao, C., Johnsen, H., Naume, B., Samaha, R. R., et al. (2006). Distinct
molecular mechanisms underlying clinically relevant subtypes of breast cancer: gene
expression analyses across three different platforms. BMC Genomics, 7, 127.
116

Tanner, M., Isola, J., Wiklund, T., Erikstein, B., Kellokumpu‐Lehtinen, P., Malmstrom, P., et al.
(2006). Topoisomerase IIalpha gene amplification predicts favorable treatment response
to tailored and dose‐escalated anthracycline‐based adjuvant chemotherapy in HER‐
2/neu‐amplified breast cancer: Scandinavian Breast Group Trial 9401. J Clin Oncol,
24(16), 2428‐2436.
Tanner, M. M., Tirkkonen, M., Kallioniemi, A., Holli, K., Collins, C., Kowbel, D., et al. (1995).
Amplification of chromosomal region 20q13 in invasive breast cancer: prognostic
implications. Clin Cancer Res, 1(12), 1455‐1461.
Tanner, M. M., Tirkkonen, M., Kallioniemi, A., Isola, J., Kuukasjarvi, T., Collins, C., et al. (1996).
Independent amplification and frequent co‐amplification of three nonsyntenic regions
on the long arm of chromosome 20 in human breast cancer. Cancer Res, 56(15), 3441‐
3445.
Tchatchou, S., Jung, A., Hemminki, K., Sutter, C., Wappenschmidt, B., Bugert, P., et al. (2009). A
variant affecting a putative miRNA target site in estrogen receptor (ESR) 1 is associated
with breast cancer risk in premenopausal women. Carcinogenesis, 30(1), 59‐64.
Tebbit, C. L., Bentley, R. C., Olson, J. A., Jr., & Marks, J. R. (2004). Estrogen receptor alpha (ESR1)
mutant A908G is not a common feature in benign and malignant proliferations of the
breast. Genes Chromosomes Cancer, 40(1), 51‐54.
Thorat, M. A., Turbin, D., Morimiya, A., Leung, S., Zhang, Q., Jeng, M. H., et al. (2008). Amplified
in breast cancer 1 expression in breast cancer. Histopathology, 53(6), 634‐641.
Torres‐Arzayus, M. I., Mora, J. F. d., Yuan, J., Vazquez, F., Bronson, R., Rue, M., et al. (2004). High
tumor incidence and activation of the PI3K/AKT pathway in transgenic mice define AIB1
as an oncogene. Cancer Cell, 6, 263‐274.
Uniprot http://www.uniprot.org/uniprot/.
van 't Veer, L. J., Dai, H., van de Vijver, M. J., He, Y. D., Hart, A. A., Mao, M., et al. (2002). Gene
expression profiling predicts clinical outcome of breast cancer. Nature, 415(6871), 530‐
536.
Veronesi, U., Boyle, P., Goldhirsch, A., Orecchia, R., & Viale, G. (2005). Breast cancer. Lancet,
365(9472), 1727‐1741.
Vincent‐Salomon, A., Raynal, V., Lucchesi, C., Gruel, N., & Delattre, O. (2008). ESR1 gene
amplification in breast cancer: a common phenomenon? Nat Genet, 40(7), 809; author
reply 810‐802.
Vogelstein, B., & Kinzler, K. W. (1993). The multistep nature of cancer. Trends Genet, 9(4), 138‐
141.
117

Vogelstein, B., & Kinzler, K. W. (2004). Cancer genes and the pathways they control. Nat Med,
10(8), 789‐799.
Wang, Y., Klijn, J. G., Zhang, Y., Sieuwerts, A. M., Look, M. P., Yang, F., et al. (2005). Gene‐
expression profiles to predict distant metastasis of lymph‐node‐negative primary breast
cancer. Lancet, 365(9460), 671‐679.
Way, M., Pope, B., & Weeds, A. G. (1992). Are the conserved sequences in segment 1 of gelsolin
important for binding actin? J Cell Biol, 116(5), 1135‐1143.
Wood, L. D., Parsons, D. W., Jones, S., Lin, J., Sjoblom, T., Leary, R. J., et al. (2007). The genomic
landscapes of human breast and colorectal cancers. Science, 318(5853), 1108‐1113.
Wu, R.‐C., Qin, J., Yi, P., Wong, J., Tsai, S. Y., Tsai, M.‐J., et al. (2004). Selective Phosphorylations
of the SRC‐3/AIB1 Coactivator Integrate Genomic Reponses to Multiple Cellular Signaling
Pathways. Molecular Cell, 15, 937–949.
Wu, R.‐C., Smith, C. L., & O’Malley, B. W. (2005). Transcriptional Regulation by Steroid Receptor
Coactivator Phosphorylation. Endocrine Reviews, 26(3), 393‐399.
Wu, R. C., Qin, J., Yi, P., Wong, J., Tsai, S. Y., Tsai, M. J., et al. (2004). Selective phosphorylations
of the SRC‐3/AIB1 coactivator integrate genomic reponses to multiple cellular signaling
pathways. Mol Cell, 15(6), 937‐949.
Wu, R. C., Smith, C. L., & O'Malley, B. W. (2005). Transcriptional regulation by steroid receptor
coactivator phosphorylation. Endocr Rev, 26(3), 393‐399.
Xu, J., Liao, L., Ning, G., Yoshida‐Komiya, H., Deng, C., & O’Malley, B. W. (2000). The steroid
receptor coactivator SRC‐3 (p/CIP/RAC3/AIB1/ACTR/TRAM‐1) is required for normal
growth, puberty, female reproductive function, and mammary gland development.
PNAS, 97(12), 6379–6384.
Yager, J. D., & Davidson, N. E. (2006). Estrogen carcinogenesis in breast cancer. N Engl J Med,
354(3), 270‐282.
Yager, J. D., & Davidson, N. E. (2006). Estrogen Carcinogenesis in Breast Cancer. N Engl J Med,
354, 270‐282.
Yaich, L., Dupont, W. D., Cavener, D. R., & Parl, F. F. (1992). Analysis of the PvuII restriction
fragment‐length polymorphism and exon structure of the estrogen receptor gene in
breast cancer and peripheral blood. Cancer Res, 52(1), 77‐83.
Yan, F., Gao, X., Lonard, D. M., & Nawaz, Z. (2003). Specific Ubiquitin‐Conjugating Enzymes
Promote Degradation of Specific Nuclear Receptor Coactivators. Mol. Endocrinol., 17(7),
1315–1331.
118

Yi, P., Wu, R.‐C., Sandquist, J., Wong, J., Tsai, S. Y., Tsai, M.‐J., et al. (2005). Peptidyl‐Prolyl
Isomerase 1 (Pin1) Serves as a Coactivator of Steroid Receptor by Regulating the Activity
of Phosphorylated Steroid Receptor Coactivator 3 (SRC‐3/AIB1). Mol. Cell. Biol., 25(21),
9687–9699.
Zhang, Z., Yamashita, H., Toyama, T., Omoto, Y., Sugiura, H., Hara, Y., et al. (2003). Estrogen
receptor alpha mutation (A‐to‐G transition at nucleotide 908) is not found in different
types of breast lesions from Japanese women. Breast Cancer, 10(1), 70‐73.
Zheng, F. F., Wu, R. C., Smith, C. L., & O'Malley, B. W. (2005). Rapid estrogen‐induced
phosphorylation of the SRC‐3 coactivator occurs in an extranuclear complex containing
estrogen receptor. Mol Cell Biol, 25(18), 8273‐8284.
Zhou, G., Hashimoto, Y., Kwak, I., Tsai, S. Y., & Tsai, M.‐J. (2003). Role of the Steroid Receptor
Coactivator SRC‐3 in Cell Growth. Mol. Cell. Biol., 23(21), 7742–7755.
Zhou, Y., Eppenberger‐Castori, S., Eppenberger, U., & Benz, C. C. (2005). The NFκB pathway and
endocrine‐resistant breast cancer. Endocrine‐Related Cancer, 12, S37–S46.
Zhu, Y., Kan, L., Qi, C., Kanwar, Y. S., Yeldandi, A. V., Rao, M. S., et al. (2000). Isolation and
characterization of peroxisome proliferator‐activated receptor (PPAR) interacting
protein (PRIP) as a coactivator for PPAR. J Biol Chem, 275(18), 13510‐13516.
Zhu, Y., Qi, C., Jain, S., Le Beau, M. M., Espinosa, R., 3rd, Atkins, G. B., et al. (1999). Amplification
and overexpression of peroxisome proliferator‐activated receptor binding protein
(PBP/PPARBP) gene in breast cancer. Proc Natl Acad Sci U S A, 96(19), 10848‐10853.

119

Appendix
Table 1 List of All Genetic Alterations Identified in the Genes of
Interest, Breakdown by Ethnicity
Gene Variant
Reference
number
Asian
African
American
Caucasian Latin Total
NCOA1 L1376P 0/28 0/24 1/27 0/27 1/106
P1048L 1/28 0/24 0/27 0/27 1/106
N600S 0/28 0/24 0/27 1/27 1/106
E757G 0/28 0/24 1/27 0/27 1/106
P1272S rs1804645 0/28 1/25 1/27 2/27 4/107
R572S 0/28 0/24 1/27 0/27 1/106
P504P rs3731628 4/28 5/24 3/27 4/27 16/106
T154T rs11125744 0/28 6/24 3/27 0/27 9/106
Y1277Y rs55684998 0/29 1/25 0/27 0/27 1/108
L1267L rs11125763 1/28 6/25 3/27 0/27 10/108
A641A rs41281515 0/28 0/24 1/27 1/27 2/106
L1068L rs13430401 0/18 1/22 0/22 0/21 1/83
D1395D 0/29 1/24 0/27 0/27 1/107
G1037G 0/28 0/24 1/27 0/27 1/106
V292V 0/28 0/24 0/27 1/27 1/106
NCOA2 Q957Q 0/29 1/25 0/27 0/27 1/108
H1332H 0/29 1/25 0/27 0/27 1/108
M1282I rs2228591 5/29 0/25 2/26 0/27 7/107
N1212S
+
rsunknown 0/29 0/25 1/27 0/27 1/108
N616I 0/28 1/25 0/27 0/27 1/107
P1222P rs2228592 1/29 3/25 0/27 0/27 4/108
E6E rs61753707 0/28 1/25 0/27 0/27 1/107
NCOA3 K730K 0/29 0/25 1/27 0/27 1/108
Q1303Q 0/27 0/17 0/27 1/27 1/98
A927A rs2076547 1/28 3/25 1/27 2/27 7/107
T960T rs2076546 2/28 6/25 5/27 6/27 19/107
Q1251Q rs6018623 6/27 4/17 10/27 9/27 29/98
*Y1111H 0/28 1/24 0/27 0/27 1/106
T1199A 0/28 1/24 0/27 0/27 1/106
M1247L rs72645298 0/28 1/23 0/27 0/27 1/105
P264L 0/28 1/24 0/27 0/27 1/106
120

Table 1 Continued
P559S rs2230781 0/28 2/25 0/26 1/27 3/106
Q586H rs2230782 0/28 0/25 2/26 3/27 5/106
R218C rs6094752 0/29 0/25 1/27 2/27 3/108
NCOA5 L130L rs6032647 1/27 0/25 0/26 0/27 1/105
R121R 0/28 1/24 0/26 1/27 2/105
R278R 1/27 0/24 0/26 0/27 1/104
NCOA6 T1880T rs61751051 0/31 0/26 1/27 0/30 1/114
G633G rs61736335 0/31 1/26 0/27 0/30 1/114
P749P rs3787220 3/31 2/26 1/27 4/30 10/114
A995A 0/30 1/27 0/27 0/30 1/114
I1439I 0/31 0/27 0/27 1/30 1/115
Q1855Q 0/31 0/26 1/27 1/30 2/114
N669N 0/31 0/26 0/27 1/30 1/114
N955S rs17092079 0/31 7/27 1/27 4/30 12/115
I1964V 0/31 0/26 1/27 0/30 1/114
R1330H 0/31 0/27 0/27 1/30 1/115
*S1913N 0/31 1/26 0/27 0/30 1/114
T1402A 0/31 0/27 1/27 0/30 1/115
S1913T 0/31 1/26 0/27 0/30 1/114
*N1716D 0/30 0/26 0/27 1/29 1/112
CALCOCO1 A527T 0/25 1/20 0/21 0/27 1/93
G561V rs34229062 0/24 0/20 2/21 1/26 3/91
T639P rs34281379 0/25 2/20 0/21 0/27 2/93
Q222R 0/25 0/20 0/21 1/27 1/93
R373K 0/25 1/20 0/21 0/27 1/93
R393K rs3741659 18/25 9/20 3/21 6/27 36/93
S368S rs3741568 24/25 13/20 6/21 16/27 59/93
V181V 8/25 0/20 0/21 1/27 9/93
A284A rs2277369 8/25 1/20 3/21 7/27 19/91
L436L 0/25 0/20 1/21 0/27 1/93
FLII D234Y 0/25 0/20 0/21 1/27 1/93
E240K 0/25 0/20 1/21 0/27 1/93
*R569H 0/25 0/20 1/21 0/27 1/93
G584G 0/25 0/20 0/21 1/27 1/93
CARM1 S282S 0/22 0/20 0/21 1/26 1/89
T499T 0/25 1/20 0/21 0/27 1/93
V226V 0/22 2/20 0/21 0/26 2/89
121

Table 1 Continued
ZNF282 V529A 1/25 0/20 0/20 0/26 1/91
*confirmed somatic mutations;
+
published in Haiman et al. 2009;
Note: Reference numbers were retrieved from http://www.ncbi.nlm.nih.gov/SNP/

Abstract (if available)

Abstract Steroid hormones play an important role in the development of breast cancer. Genetic alterations involving hormone receptor coactivator genes in breast cancer cells may influence tumor development by altering patterns of transcriptional activation or repression of target genes in hormone pathways. These alterations might cause changes in gene expression of key proteins involved in cellular homeostasis initiating proliferative changes providing a survival, growth, or expansion advantage for the cells containing the alterations.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Screening and association testing of coding variation in steroid hormone coactivator and corepressor genes in relationship with breast cancer risk in multiple populations

PDF

Estrogen receptor-β characterization in breast cancer: development of a reliable assay for measuring expression

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

Roles of three domains of CCAR1 in transcription activation by nuclear receptors

PDF

Genes and hormonal factors involved in the development or recurrence of breast cancer

PDF

Context-dependent role of androgen receptor (AR) in estrogen receptor-positive (ER+) breast cancer

PDF

Functional analyses of androgen receptor structure pertaining to prostate cancer

PDF

Modulation of Runx proteins by steroid hormone receptors

PDF

HER2 and co-amplified genes in breast and gastric cancer

PDF

Identifying and characterizing a unique enhancer for Y537S mutant estrogen receptor (ER) in breast cancer cells

PDF

The mechanism of recruitment of Tip60 to ER target genes

PDF

Genomics and transcriptomic alterations of the glutamate receptors in acute myeloid leukemia

PDF

Molecular mechanism of the recruitment of SWI/SNF chromatin remodeling complex and histone acetyltransferase to estrogen-responsive promoters

PDF

Breast epithelial cell type specific enhancers and functional annotation of breast cancer risk loci

PDF

Characteristics of hydrogen peroxide inducible clone-5 and its potential role as a nuclear receptor coactivator

PDF

Pathogenic variants in cancer predisposition genes and risk of non-breast multiple primary cancers in breast cancer patients

PDF

Identification of CBP/FOXM1 as a molecular target in triple negative breast cancer

PDF

The role of heritability and genetic variation in cancer and cancer survival

PDF

Effects of chromatin regulators during carcinogenesis

PDF

Interaction of Hic-5 with different steroid receptors and its selective coregulator activity

Asset Metadata

Creator Ioan Munteanu, Anamaria (author)

Core Title Genetic alterations in nuclear receptor coactivators in breast cancer

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Pathobiology

Publication Date 02/05/2011

Defense Date 05/24/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag breast cancer,Fish,gene amplification,nuclear receptor coactivator,OAI-PMH Harvest,SNP,somatic mutation

Place Name USA (countries)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Press, Michael F. (committee chair), Epstein, Alan L. (committee member), Haiman, Christopher A. (committee member), Stallcup, Michael R. (committee member)

Creator Email anamariaioan@gmail.com,ioan@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3279

Unique identifier UC1211715

Identifier etd-Ioan-3900 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-368786 (legacy record id),usctheses-m3279 (legacy record id)

Legacy Identifier etd-Ioan-3900.pdf

Dmrecord 368786

Document Type Dissertation

Rights Ioan Munteanu, Anamaria

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu