University of Southern California Dissertations and Theses

c-JUN mediated alteration of SLC2A2 expression in hepatoma cell line HepG2

(USC Thesis Other)

c-JUN mediated alteration of SLC2A2 expression in hepatoma cell line HepG2

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Copyright 2020 Raphael Serna

c-JUN MEDIATED ALTERATION OF SLC2A2 EXPRESSION IN HEPATOMA CELL LINE
HEPG2

By

Raphael Serna Jr

A Thesis Presented to the
FACULTY OF THE KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

December 2020

ii

Acknowledgments
I would like to express my sincere gratitude to the University of Southern California for
giving me the opportunity to fulfill my dream of one day being a student here. I would also like
to thank the Molecular Microbiology and Immunology department for providing me with
encouragement and guidance throughout my education at USC. This thesis could not have been
completed without the help of special mentors who challenged, supported, and guided me along
the way.
I would like to give special thanks to my committee chair and PI, Dr. Keigo Machida,
who has continually pushed me to achieve my full potential. It was a great honor to be part of Dr.
Machida’s lab, and I am grateful for all the time he has taken to have individual meetings. His
encouragement and guidance made completing long days full of tedious work feel very
rewarding. I would also like to thank my committee members, who each deserve individual
recognition.
A big thank you to Dr. Jie Li, who has shown me nothing less of support and
encouragement since I arrived at USC. I enjoyed having learned from you in my MICB courses
and I am truly grateful to have received your feedback on my presentations and writing. I would
also like to give a big thanks to Dr. Louis Dubeau. It was a great privilege to have learned from
you during a year of Pathology courses. Your lectures have helped me obtain better experimental
results and have also made a positive impact on my future education. Lastly, I would like to give
a big thank you to Dr. Chengyu Liang. I have learned so much from your lectures on autophagy
and it was a privilege to have you in my thesis committee. I wish you nothing but the best in
your future endeavors at The Wistar Institute.
iii

TABLE OF CONTENTS

Acknowledgements………………………………………………………………………………..ii
List of Tables…………………………………………………………………………………..…iv
List of Figures……………………………………………………………………………………..v
Abstract…………………………………………………………………………………………...vi
Introduction………………………………………………………………………………………..1
Materials and Methods…………………………………………………………………………….5
Results…………………………………………………………………………………………....12
Discussion………………………………………………………………………………………..16
Conclusions and Future Directions………………………………………………........................18
Tables…………………………………………………………………………………………….20
Figures…………………………………………………………………………………………....22
References………………………………………………………………………………..………35

iv

List of Tables
Table 1: Plasmids used in the present study…………………………………………………….20
Table 2: ShRNA oligonucleotides used for c-JUN knockdown in HepG2 cells………………..20
Table 3: Clinical pathological information of FFPE tissue……………………………………...20
Table 4: Oligonucleotides used for in-vitro mutagenesis of AP-1 sites on GLUT2 promoter….21
Table 5: RT-QPCR primers used in the present study…………………………………………..21
Table 6: Antibodies used in the present study…………………………………………………..21

v

List of Figures
Figure 1: Hypothetical model of c-JUN mediated transcriptional suppression
of GLUT2 expression…………...…………………………………………………….…22
Figure 2: Liver specific c-JUN knockout in TG mice reduced the tumor
incidence and weight gained induced by NS5A and HCFD……………………………..23
Figure 3: Disruption of c-JUN improves insulin resistance and glucose tolerance……………..24
Figure 4: Inverse relationship between c-JUN and GLUT2 staining in
tumor and non-tumor tissue……………………………………………………………..25
Figure 5: Effects of cellular c-JUN expression on various regions of
the GLUT2 promoter………………………………………………………………...…..26
Figure 6: In-vitro mutagenesis of AP-1 consensus sequences on the GLUT2 promoter………..27
Figure 7: Validation of c-JUN silencing in HepG2 cells using Immunoblot and staining……...28
Figure 8: Knockdown of c-JUN produced insignificant change in GLUT2 mRNA
and protein levels in HepG2 cells………………………………………………………..29
Figure 9: Activation of c-JUN at Serine 63/73 increase GLUT2 mRNA and
protein expression in HepG2 cells……………………………………………………….30
Figure 10: Greater expression of c-JUN in CD133+ HepG2 cells……………………………...31
Figure 11: Alternative hypothetical model of c-JUN mediated suppression of
glucose uptake and GLUT expression in hepatocytes…………………………………...32
Figure 12. c-JUN mediated disruption of AKT-FOXO1 signaling via RICTOR
suppression potentially reduces GLUT2 expression……………………………………..33
Figure 13. Inverse relationship between c-JUN and RICTOR staining in tumor
and non-tumor tissue……………………………………………………………………..34

vi

Abstract
The expression of Glucose transporter 2 (GLUT2), which is encoded by SLC2A2 gene,
has been reported to be negatively correlated in advance stages of hepatocellular carcinoma
(HCC). It is also suppressed in Hepatitis C virus (HCV) infected tissue and most hepatoma cell
lines. Studies of the GLUT2 promoter in rat hepatocytes have indicated c-JUN/AP-1-mediated
transcriptional suppression of GLUT2. AP-1 binding sites on the promoter of the human GLUT2
gene have been reported, but they have yet to be analyzed to determine their role in c-JUN’s
ability to alter SLC2A2 expression. In our present study, we observed that liver specific c-JUN
disruption reduced plasma glucose levels in HCFD mice, and that c-JUN overexpression
decreased glucose uptake but increased glucose production. We postulated that c-JUN alters
plasma glucose homeostasis and glucose metabolism in hepatocytes by directly disrupting
GLUT2 expression. We hypothesized that c-JUN attenuates GLUT2 expression through AP-1
binding consensus sequences on the promoter of GLUT2. We used a dual-reporter gene assays,
RT-qPCR and western blot to quantify GLUT2 expression at the transcriptional and protein
levels when c-JUN was overexpressed or silenced in HepG2 cells. Immunohistochemistry was
also used to characterize the relationship between c-JUN and GLUT2 expression in patient HCC
tumors. We report that the upregulation of subcellular c-JUN moderately promotes GLUT2
expression. Activation of c-JUN by N-terminal phosphorylation further increases expression of
GLUT2 mRNA and protein levels.
1

Introduction
As one of the major causes of cancer related mortality, hepatocellular carcinoma (HCC)
is thought to be the result of cirrhosis secondary to chronic viral hepatitis. However, emerging
risk factors, have shifted the focus of HCC etiology to earlier stages (Mittal. et al). In developing
countries, these emerging factors include alcoholism, metabolic syndrome, type 2 diabetes
mellitus, and obesity (Tsoulfas. et al). From 2000 to 2018, the prevalence of obesity amongst
adults in the United States has increased from 30.5% to 42.4% (Hales CM. et al). Obesity is an
established risk factor for the development of hepatocellular carcinoma , non-alcoholic fatty liver
disease (NAFLD), and a major cause of Type 2 diabetes (T2DM) (Vanni. et al), (Martyn et al).
T2DM alone is associated with increased risk of certain cancers, including pancreatic and liver
(Giovannucci, et al). Furthermore, insufficient blood glucose maintenance has also been shown
to be associated with increased incidence of HCC recurrence (Hosokawa T. et al).
Hepatitis C virus (HCV) infection has not only been known to cause intrahepatic
diseases like HCC, but also diseases beyond the liver including metabolic disorders such as
T2DM (Shoji. et al). In studying the pathogenesis of hepatitis induced HCC and metabolic
disorders, conventional methods have used the overexpression of a variety of hepatitis virus
proteins. The overexpression of HCV structural proteins, E1, E2, and P7 and non-structural
proteins NS2, NS3, NS4A, NS4B, NS5A, and NS5B have been used to study carcinogenesis and
metabolic changes in hepatocytes. Previous studies have reported that HCV protein expression
mediates activation of different signaling pathways involved in cell proliferation, differentiation,
and apoptosis.
2

Several studies have reported HCV mediated activation of c-JUN N-terminal Kinase
(JNK) and its substrate c-JUN (Park KJ.et al), (Shrivastava A. et al), (Tsutsumi T. et al), (Shoji et
al). C-Jun is a proto-oncogene that is part of the basic leucine zipper transcription factor family,
which include JUNB, JUND and c-FOS. c-JUN can form a homodimer or heterodimer with other
family proteins to form the transcription factor activator protein 1 complex (AP-1). The c-JUN
protein contains a highly conserved N-terminal transactivation domain and C-terminal DNA
binding domain (Sakai, et al). Transcriptional activity is enhanced through phosphorylation of
Serine 63 and Serine 73 residues in the transactivation domain by JNKs (Smeal. et al), (Behrens.
et al).
c-JUN has been reported to have biological effects on cell transformation, differentiation,
proliferation and apoptosis (Bossy-Wetzel. et al), (Watson. et al), (Angel P. et al). Knockout
experiments have shown that c-JUN is important in hepatogenesis (Hilberg. et al) and mediates
HCV induced hepatocarcinogenesis (Machida. et al). Studies have also linked the JNK signaling
pathway to obesity-induced insulin resistance (Feng J. et al) and have shown that inflammatory
molecules, such as Lipopolysaccharide (LPS), can activate JNK and c-JUN via toll-like receptor
4 (TLR4) (Lee Y. et al). Thus, understanding c-JUN’s role in linking inflammation, obesity,
T2DM, and HCV can help bring to light how these risk factors synergistically promote
hepatocarcinogenesis and other diseases beyond the liver.
In our present study, we used a transgenic mouse model to understand how liver specific
c-JUN disruption affects the synergistic tumor incidence with a high-calorie/high-fat diet
(HCFD) and HCV infection. Liver specific c-JUN knockout resulted in lower tumor incidence
and a surprisingly leaner phenotype.
3

To reveal the underlying metabolic changes that produced the observed phenotype in the
liver specific c-JUN knockout mice, glucose tolerance and insulin resistance tests were
performed in these mice. In addition, glucose uptake and glucose production were quantified in
HepG2 cells overexpressing c-JUN. Liver specific disruption of c-JUN reduced the amount of
weight gained in mice fed HCFD. In addition, these mice had improved insulin resistance and
glucose tolerance compared to control groups. We postulated that c-JUN altered plasma glucose
homeostasis and reprogramed glucose metabolism in hepatocytes by reducing glucose uptake in
hepatocytes. We therefore hypothesized that c-JUN attenuates expression of glucose transporter
2 at the plasma membrane through transcriptional suppression.
Cells acquire energy from various sources, including monosaccharides such as glucose, to
supply their metabolic demand. Glucose and other monosaccharides are transported into
mammalian cells by a family of membrane transporters known as the solute-carrier 2A family
(SLC2A), also known as the GLUT family of transporters (Burant. et al). There are currently 14
identified members in the GLUT family. GLUT2, encoded by the SLC2A2 gene, is one isoform
in the family of glucose transporters (Burant. et al). GLUT2 is the main glucose transporter
expressed in kidney, pancreatic β-cells, and hepatocytes (Fukumoto. et al), (Takeda. et al).
Hepatocytes are important in maintaining plasma glucose homeostasis through gluconeogenesis
and glycolytic pathways (shoji et al.).
In patients with HCC, SLC2A2 expression has been reported to be suppressed in the tumor.
Previous studies using data obtained from The Cancer Genome Atlas (TCGA) have reported
decreased SLC2A2 expression being correlated with poor overall survival in HCC patients with
alcohol history. In addition, GLUT2 mRNA was shown to decrease with advance stage HCC
4

(Kim et al.). GLUT2 expression has also been reported to be suppressed in hepatoma cell line
HepG2 and in cultures of primary hepatocytes (Thorens B. et al) (Mueckler. et al).
Researchers have investigated the role of HCV in disrupting glucose homeostasis in
hepatocytes by focusing on the molecular mechanism of HCV mediated gluconeogenesis and
glycolysis disruption. Studies using HCV models have reported decreased expression of GLUT2
in hepatocytes (Hervé. et al), (Kasai. et al), (Shoji. et al). A study published in 2012 also reported
that HCV suppresses GLUT2 at the transcriptional level via hepatocyte nuclear factor-1α (HNF-
1α). These studies also report the presence of an AP-1 consensus sequence on the human GLUT2
promoter (Matsui et al.).
Studies in Sprague-Dawley rats have also shown the presence of AP-1 binding sites on the
rat promoter of GLUT2 (Kim et al., 1998). It has later shown that c-JUN bind to these AP-1
consensus sequences in a manner that competes with the binding site for CCAAT/enhancer
binding protein (C/EBP), a transcription factor shown to activate GLUT2 transcription in
hepatocytes (Kim. et al, 2002). The ability of c-JUN to alter GLUT2 expression in human
hepatocytes still remains to be elucidated.
In the present study, we hypothesized that c-JUN attenuates the expression of GLUT2
through AP-1 consensus sequences on the promoter (Figure 1). We used immunostaining on
formalin fixed paraffin embedded tissue sections (FFPE) to characterize c-JUN and GLUT2
protein expression in tumor sections. To determine if c-JUN alter GLUT2 expression, we
silenced and overexpressed c-JUN in the hepatoma cell line HepG2. In addition, we used c-JUN
N-terminus mutants to determine if activation of c-JUN further alters GLUT2 expression.

5

Materials and Methods
Mice and Feeding.
Hepatocyte-specific Cre expression from Albumin promoter (Alb::Cre) was used to generate
liver-specific knockout of c-Jun (c-Jun
fl/fl
;Alb::Cre) (Palmada et al., 2002). c-Jun
fl/fl
mice are
gifts from Dr. Carter in Vanderbilt University. NS5A Tg mice were crossbred with c-
Jun
fl/fl
;Alb::Cre or c-Jun
fl/fl
to establish c-Jun
Δ h e p
and c-Jun+/+ Ns5a Tg mice. (Haluzik et al.,
2004; Van Heek et al., 1997). To determine the effect of c-Jun gene disruption on synergistic
tumor incidence influenced by high-cholesterol high-fat diet (HCFD) in the NS5A Tg mice,
NS5A Tg mice were crossed with Alb::Cre;Jun
fl/fl
(c-Jun
Δ h e p
) mice or wild type mice to produce
the double Tg mice in the c-Jun knockout background. These mice were fed HCFD to determine
whether synergistic consequences of c-Jun expression on tumor incidence was abrogated by
TLR4 deficiency. Twenty-five mice in each treatment group (based on the power analysis) were
used for this experiment. These mice were fed HCFD to determine the effect of c-Jun deficiency
on synergism of diet with tumor incidence. At the end of the study period (12 months), mice
were euthanized for gross observation and digital photography of the excised whole livers for
determination of the presence, size, and number of liver tumors. All mice experiments were
approved by the Institutional Animal Care and Use Committee.

6

Glucose Production Assay.
HepG2 cells (5 x 10
5
/6-well) were washed three times with PBS to remove glucose and then
were incubated in a 6 well plate for 16 h in 2 ml of glucose production medium (glucose- and
phenol red-free DMEM containing gluconeogenic substrates, 20 mM sodium lactate, and 2
mM sodium pyruvate) and in the presence of 1 nM insulin (Usbio) during the last 3 h. A quantity
of 300 μl of medium was sampled for measurement of glucose concentration using a glucose
assay kit (Sigma).
Flow Cytometry Glucose Uptake Assay.
A glucose uptake assay using (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose)
(2-NBDG) was performed as previously described with minor modifications. Briefly, HepG2
cells transfected with c-JUN expression vector or vector control were cultured for 24 h,
maintained in serum-free DMEM with or without 1 mM insulin with the absence or presence of
10 mM 2-NBDG for 2 h. The fluorescence intensity of 2-NBDG was recorded on the FL1
channel using a Caliber flow cytometer. Data from 10,000 single-cell events were collected. To
exclude false-positivity, cells in the absence of 2-NBDG were measured and used as the
background. The relative fluorescence intensities minus the background were used for
subsequent data analysis.

7

Cell Culture.
HepG2 and HEK293T cells were maintained in Dulbecco’s Modified Eagle’s Medium
(Genclone) supplemented with 10% heat-inactivated fetal bovine serum (CAT 100-106, Gemini),
Non-essential amino acids, L-glutamine, and antibiotic-antimycotic (Ref 11140-050, Ref 35050-
061, Ref 15240-062 Gibco). Cells were maintained at 37°C and 5% CO2 in a humidified
incubator.
Transfection
HepG2 cells were grown to 60-75% confluency and transiently transfected using a lipid based
transfection reagent (BioT, Bioland). Following manufacture protocol, mixtures of transfection
complexes were prepared using a 1.5:1 ratio of BioT (µl) to DNA (µg). Entire mixture was
directly added to cells and plates were returned to CO2 incubators. 16 to 24h after transfection,
the media was replaced with fresh growth medium. Cells were harvested after 48h for analysis.
Mutant c-JUN plasmids were a gift from Dr. Bohmann at the University of Rochester and
pGLUT2-Luc constructs were a gift from Matsui et al. 2012.
Lentiviral transduction of shRNA
To prepare stable c-JUN knock down in HepG2 cells, lentiviral transduction of shRNA was used.
HEK293T cells were plated in T-75 flasks and were grown to 50-70% confluency. Transfection
mixture were prepared using packaging plasmid (psPAX2), envelope plasmid (pMD2.G), shc-
JUN vector plasmid, transfection reagent and serum free DMEM or PBS. Mixtures were
incubated for 5-15 minutes at room temperature then added to the cells. After 14-16h post-
transfection, the media was replaced and the media was harvested after 48hrs and 72hrs. The
media was centrifuged and filtered using 0.22um syringe driven filter. Lentivirus was
8

concentrated by ultra-centrifugation at 20,000 rpm for 2h. Lentiviral pellet was re-suspended in
PBS and stored at -80°C. HepG2 cells were infected with lentivirus and screen for GFP
expression after 48hrs. Knockdown cells were selected using puromycin.
Immunohistochemistry
To characterize c-JUN and GLUT2 expression in patient HCC tissue, formalin fixed
paraffin embedded (FFPE) sections were used. Selection criteria of patient material included the
presence of tumor and adjacent non-tumor sections with comorbidities of HCV and/or alcoholic
cirrhosis. Only tissue sections that produced quantifiable c-JUN and GLUT2 staining were
included for analysis (n=3). Table 2 summarizes the clinical pathological information of the
tissue sections used in this study.
IHC staining of liver tumor sections was optimized by altering individual variables.
Optimization of paraffin removal was achieved by varying the time the slides baked and time
spent in xylene. Rehydration of tissue was optimized by altering the concentration and time spent
in each ethanol solution. Antigen retrieval was optimized by comparing four different antigen
retrieval solutions at different pH, temperature, and pressure. Titration of antibodies (1:1000 to
1:200) was used to identify the antibody concentration for optimal staining.
FFPE tissue sections were heated at 60°C overnight. Slides were de-paraffinized with
xylene and rehydrated using dilutions of ethanol. Antigen retrieval was performed in Citrate
ETDA buffer (10mM Citric Acid, 2mM EDTA, 0.05% Tween-20, pH 6.2) using a Tender
cooker ( Nordic Ware, #62104) and conventional microwave for 20min on High. Slides were
blocked overnight using 5% goat serum and 10% BSA in PBS. Slides were incubated with
primary antibodies overnight at 4°C and for 2hrs at room temperature with secondary antibodies.
9

Slides were mounted and DNA was stained using anti-fade mounting media with DAPI (H-1200,
Vector). Images were captured using confocal microscopy using Leica software. Immuno-
Reactivity Score (IRS) was calculated by multiplying the frequency and intensity of staining on
five different areas of each tissue section. An average IRS score was calculated for each tumor
section.
Luciferase assay.
To study the role of c-JUN on mediating human GLUT2 promoter activity, a series of truncated
GLUT2 promoter-Luciferase PGL4 plasmids were used (Table 1). HepG2 cells were seeded onto
24-well plate (7x10
4
cells/well) and transfected with luciferase constructs and appropriate control
plasmids (500ng total plasmid DNA). At 48 h post-transfection, samples were harvested and
assayed for luciferase activity using a dual-luciferase reporter assay system (E1980, Promega).
Luciferase activity was measured with a Lumat LB 9501 instrument (Berthold). Firefly
luciferase activity was normalized to Renilla luciferase activity for each sample (n=3).
In-Vitro Mutagenesis.
To determine if c-JUN mediated suppression of GLUT2 is dependent on AP-1/c-JUN consensus
binding sites on the human GLUT2 promoter, we mutated three AP-1/c-JUN consensus regions
on the GLUT2 promoter luciferase constructs. AP-1 consensus sequence at -1100 was previously
reported (Matsui, et al). Transcription factor binding site analysis software (TRANSFAC) was
used to confirm the -1100 consensus sequence and identify the -144 and -123 consensus
sequences. Mutant primers (Table 4) were used in polymerase chain reaction to create mutated
GLUT2 promoter-luciferase plasmids. To generate the -1100 AP-1 mutant, the construct
containing the full length GLUT2 promoter was used (-1291/+308). To generate the -144 and -
10

123 AP-1 mutants, the (-206/+308) construct was used. Un-mutated parental DNA template was
digested using Dpn1 enzyme. Mutations were confirmed through DNA sequencing (Genewiz).
Real-Time Quantitative Reverse Transcription-PCR
Total cellular RNA was isolated from cells using TRIzol reagent according to manufacturer’s
protocol (Life technologies). First strand of cDNA was synthesized from RNA using oligo (dT)18
primers, 10mM dNTPs and the SuperScript III First-Strand Synthesis System (Invitrogen). Real
time PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems).
SYBR green chemistry was quantified in a StepOnePlus system (Applied Biosystems). The
expression level of each gene was normalized to endogenous GAPDH. Table 5 displays the
sequence of the primers used.
Western blot.
Protein extracts were prepared by lysing cultured cells using NP-40 lysis buffer supplemented
with protease inhibitor. Proteins were quantified using the Bradford assay (Biorad).The cell
lysates were separated by 7.5% and 10% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred to 0.45 or 0.2µm polyvinylidene fluoride
membrane (Immobilon, IPVH00010). The membranes were blocked with 5% skim milk
overnight at 4°C followed by primary antibody incubation overnight at 4°C. Blots were then
incubated with peroxidase-conjugated secondary antibodies for 2h at room temperature. Bands
were visualized using ECL detection reagents (Advansta, K12042).

11

Spheroid formation assay.
Shc-JUN and shGLUT2 HepG2 cells were seeded in 96 well ultra-low adhesion plates
(2,000cells/96-well, n=3). Cells were grown in low glucose Dulbecco’s Modified Eagle’s
Medium (Genclone). Cells were maintained at 37°C and 5% CO2 in a humidified incubator.
After 7 days of incubation, spheroids were counted.

12

Results
Disruption of c-JUN in the liver reduces tumor incidence and weight gained in Tg mice fed
HCFD.
Transgenic mice with either c-JUN
fl/fl
or Alb-Cre; c-JUN
fl/fl
were crossed with NS5A Tg
mice to produce four different conditions (Figure 2A). Mice were placed on either a HCFD or
control diet. HCFD alone, produced an increase in weight gained and tumor incidence in the
mice. Mice that contained NS5A expression and were on HCFD had increased tumor incidence,
but had lower weight gain. Knockout of c-JUN reduced the tumor incidence induced by HCFD
and/or NS5A expression. Knockout of c-JUN also produced a significant reduction in the weight
gained by mice on HCFD with or without NS5A expression (Figure 2B).
c-Jun negatively impacts insulin resistance, glucose tolerance and glucose uptake while
upregulating glucose production.
Plasma glucose levels were measured in the groups of mice to determine if c-Jun altered insulin
resistance and glucose tolerance to produce the leaner phenotype in the c-JUN knockout mice.
Disruption of liver specific c-JUN, improved insulin resistance and glucose tolerance in the Tg
mice fed HCFD with or without NS5A expression (Figure 3A and B). Glucose uptake and
glucose production assays were performed in HepG2 cells overexpressing c-JUN to determine if
c-JUN altered glucose metabolism in hepatocytes. Overexpression of c-JUN produced an
increase in glucose production and a decrease in glucose uptake (Figure 3C and D).

13

Inverse c-JUN and GLUT2 staining in HCC tumor tissue.
To characterize the expression of c-JUN and GLUT2 in HCC patients with HCV
infection and/or alcoholism, formalin fixed paraffin-embedded tissue sections were analyzed
using immunohistochemistry to stain for c-JUN and GLUT. Immunoreactivity scoring (IRS) was
used to quantify protein levels based on frequency and intensity of staining. Significantly greater
c-JUN staining was observed in the tumors compared to their adjacent non-tumor sections (p<
0.01, n=3). Significantly lower GLUT2 staining was observed in the tumors compared to their
adjacent non-tumor section (p<0.01). Further experiments were performed to determine if c-JUN
altered GLUT2 expression.
AP-1 mediated regulation of GLUT2 promoter-luciferase expression.
To determine if c-Jun alters GLUT2 expression through AP-1 consensus sequences on
the promoter, a series of human GLUT2 promoter-LUC constructs (Table 1) were transfected
into c-JUN silenced HepG2 cells. Knockdown of c-JUN resulted in greater luciferase expression
in all constructs compared with respective controls. However, overexpression of c-JUN produced
no significant change compared with the control. Truncation of the -1100 AP-1 binding
consensus sequence produced insignificant change when c-JUN was silenced or overexpressed.
The large increases in promoter activity observed with constructs containing shorter promoter
regions, suggested the possibility that AP-1 sites proximal to the TSS might have greater
influence than distal AP-1 sites.
AP-1 site mutagenesis alters c-JUN’s effect on luciferase activity.
To further determine if c-JUN is able to alter GLUT2 expression through AP-1 consensus
sequences on the promoter, mutant primers (Table 4) were used to mutate three AP-1 sites
14

(Figure 6A). Mutation of the -1100 site resulted in a decreased promoter activity, while
overexpression of c-JUN produced greater luciferase expression compared with the control
(Figure 6B). In contrast, mutagenesis of -123 or -144 AP-1 sites produced an increase in
promoter activity. Overexpression of c-JUN reduced luciferase expression in the WT condition
compared with the control vector, but showed significant increase in promoter activity when the
AP-1 site was mutated (Figure 6C). Our luciferase results produced conflicting results and
further analysis was required to determine if c-JUN has any role in altering GLUT2 mRNA and
protein expression.
Silencing c-Jun in HepG2 cells produced no significant change in GLUT2 mRNA and
protein levels.
We next assessed whether cellular c-JUN levels alone affected GLUT2 mRNA and protein
expression. Validation of successful c-JUN knockdown was confirmed using immunoblot and
immunostaining (Figure 7A and B). RT-qPCR and immunoblot analysis were used to quantify
mRNA and protein levels. Western blot analysis showed that c-JUN silencing in HepG2 cells
produced no noticeable change in GLUT2 protein levels. In concurrence, RT-qPCR results
showed an insignificant decrease in GLUT2 mRNA when c-JUN was silenced in HepG2 cells
(Fig 8, p=0.9).
Overexpression of c-JUN moderately increases GLUT2 mRNA and protein levels in
HepG2.
To study the role overexpression and activation of c-JUN had on altering GLUT2 expression,
HepG2 cells were transfected with three different expression vectors containing His6-tagged c-
JUN WT (S63/73S) MT35, His6-tagged c-JUN (A63/73A) MT111 and His6-tagged c-JUN
15

(D63/73D) MT112. RT-qPCR results showed an increase in GLUT2 mRNA when WT (MT35)
and phosphomimmetic c-JUN (MT112) was overexpressed. In contrast, overexpression of non-
phosphoralatable c-JUN (MT111) decreased GLUT2 mRNA (Fig 9A). In agreement, western
blot analysis shows that overexpression of MT35 c-JUN slightly increased GLUT2 protein
levels, overexpression of MT112 c-JUN produces an even greater increase in GLUT2 protein
levels and overexpression MT111 c-JUN did not produce a noticeable change in GLUT2 band
size (Fig 9B).
c-JUN mRNA expression is greater in CD133+ HepG2 compared with CD133- cells.
To further understand how liver specific c-JUN knockout reduced tumor incidence in the
transgenic mice, we postulated that c-JUN mediated suppression of glucose uptake promotes a
slow growing phenotype. To determine the relative expression of c-JUN in cancer stem cells, we
quantified c-JUN mRNA levels in CD133+ HepG2 cells (n=3). We hypothesized that c-JUN is
highly expressed in CD133+ HCC cells. Furthermore, we conducted a spheroid formation assay
using c-JUN and GLUT2 silenced HepG2 cell lines to determine the effects of silencing c-JUN
or GLUT2 on self-renewal ability. We hypothesized that silencing of c-JUN diminishes self-
renewal ability of spheroids while silencing of GLUT2 promotes the self-renewal ability of
spheroids. Our results show that c-JUN mRNA is significantly higher in CD133+ HepG2 cells
compared with CD133- HepG2 cells (p<0.05). Silencing of c-JUN produced an insignificant
reduction in spheroids formed (p=0.5). However, silencing of GLUT2 produced an insignificant
increase in spheroids formed (p=0.3), (Figure 10).

16

Discussion
The expression of GLUT2 protein has previously been reported to be suppressed in cases
of HCC, HCV infection and in hepatoma cell lines. Studies have identified several genes that
have the potential to alter GLUT2 expression in hepatocytes. Of these genes, c-JUN is of
particular interest, because it is an oncogene at the intersections of cancer progression,
inflammation and metabolic disorders. In our study, we observed that liver specific disruption of
c-JUN decreased tumor incidence and weight gained resulting from HCV and HCFD
respectfully. Our initial experiments showed that c-JUN knockdown improved insulin resistance
and glucose tolerance in transgenic mice, while in-vitro experiments showed c-JUN increased
glucose production and reduced glucose uptake in HepG2 cells. We therefore hypothesized that
c-JUN alters plasma glucose homeostasis and hepatocyte glucose metabolism by suppressing the
expression of GLUT2 in hepatocytes. To determine if our proposed correlation is observed in
HCC patients, we aimed to characterize the expression of c-JUN and GLUT2 in tumor and
adjacent non-tumor tissue sections. In addition c-Jun was silenced and overexpressed
respectively in HepG2 cells to determine c-JUN’s effects on the transcription and protein levels
of GLUT2.
Our immunostaining results showed lower GLUT2 staining in tumor sections with
greater nuclear c-JUN staining compared to adjacent non-tumor sections which had lower
nuclear c-JUN staining. Interestingly, tumor sections that did not contain nuclear c-JUN staining
had similar GLUT2 staining compared with adjacent non-tumor sections (data not shown). These
results suggested the possibility of an inverse relationship between c-JUN and GLUT2
expression in hepatocytes.
17

Reporter gene assay results showed that knock down of c-JUN in HepG2 cells resulted in
significant increases in luciferase expression, but overexpression produce variable changes. In
addition, the truncation of the -1100 AP-1 binding regions did not significantly alter promoter
activity. To complement these experiments, three AP-1 consensus sequences on the GLUT2
promoter were mutated. Mutation of the -1100 AP-1 site produced a significant decrease in
promoter activity, while mutations at the -144 or -123 sites increased luciferase expression.
Despite our efforts, luciferase data alone did not conclude whether c-JUN activates or suppresses
GLUT2 transcription. We then investigate if c-JUN produced any changes at GLUT2 mRNA or
protein levels.
Silencing of c-JUN showed insignificant changes in GLUT2 mRNA and protein
expression compared with the control. Likewise, the overexpression of c-JUN produced a small
but significant increase in the GLUT2 mRNA and protein levels. In addition to manipulating c-
JUN levels in HepG2 cells, we also investigated if c-JUN activity is an important factors in
altering GLUT2 expression. Overexpression of a constitutively active c-JUN (D63/73D)
significantly increased GLUT2 mRNA and protein levels. These results indicate that WT c-JUN
does not significantly alter human GLUT2 expression. However, when phosphorylated at
Ser63/73, c-JUN is a moderate activator of GLUT2 expression.
In terms of the results, silencing and overexpression of c-JUN produced slight changes in
GLUT2 expression. It is quite possible that at physiological level, c-JUN expression level does
not alter GLUT2 transcription. Instead, it is the specific patterns of posttranslational
modifications on c-JUN that determines c-JUN’s effect on GLUT2.

18

Conclusion and Future Directions
Taken together, our results do not support our original hypothesis that c-JUN suppresses
GLUT2 expression. Instead, our data suggest c-JUN moderately promotes GLUT2 expression
when c-JUN is overexpressed in vitro. Our results also indicate that canonical phosphorylation at
Serine 63/73 further induces c-JUN’s ability to upregulate GLU2 expression. These results also
suggest that suppression of GLUT2 observed in HCC/HCV patients and in hepatoma cell lines is
not a direct result of c-JUN expression. Further studies are necessary to explore other
possibilities for c-JUN to alter plasma glucose homeostasis and glucose uptake in hepatocytes.
A previous study investigated the correlation between the uptake of Fluorine-18
Fluorodeoxyglucose uptake and the expression of both glucose transporters and p53 in HCC cell
lines (Brito et al.). This study used HepG2 (WTp53), HuH7 (overexpressed WTp53), and
Hep3B2.1-7 (p53 null). They reported no significant difference in the expression of GLUT2
(cytoplasmic and membrane) among the cell lines of HepG2, Huh7 and Hep3B2.1-7. Their
GLUT expression analysis also suggest that GLUT2 is not the dominant glucose transporter in
these HCC cell lines. Glucose transporters 1, 3 or 12 had the greatest expression level in the cell
lines. Thus, future experiments would have to be conducted to determine if c-JUN alters the
expression of the dominant glucose transporter of these cell lines to reduce glucose uptake
(Figure 11a).
We postulate that alternative posttranslational modifications on c-JUN might be a better
determinant in c-JUN’s ability to suppress or activate transcription of glucose transporters. Our
results indicate that c-JUN at D63/73D mutant enhanced GLUT2 expression while c-JUN mutant
A63/73A produced negative effects. Our study focused on canonical JNK-mediated
19

phosphorylation sites on c-JUN. Other JNK independent phosphorylation sites should be
explored. For example, the protein glycogen synthase kinase 3 (GSK-3) is known to be
constitutively active in quiescent cells. It has been reported to inhibit c-JUN by phosphorylation
at threonine 239 (Tullai JW. et al). In addition, GSK-3 has been reported to be a negative
regulator of basal glucose uptake and GLUT1 expression (Buller C. L et al.). The effects of
GSK-3-mediated c-JUN phosphorylation on GLUT expression have yet to be reported. It would
be interesting to investigate the role of these phosphorylation sites on c-JUN in altering glucose
uptake and GLUT expression in hepatocytes (Figure 11B).
Our investigation also considered that c-JUN suppressed GLUT2 expression indirectly.
Transcription factor FOXO1 has been shown to suppress GLUT2 expression in hESCs (Yu F et
al). AKT mediated phosphorylation of FOXO1 leads to its inactivation and exit from the nucleus.
AKT is phosphorylated and activated by several kinases, including the mTORC2 complex. We
hypothesize that c-JUN disrupts AKT activation through suppression of mTORC2, leading to
FOXO1 activation and suppression of GLUT2 (Figure 12A). Our initial studies has shown that c-
JUN attenuates the expression of RICTOR, a component of the mTORC2 complex (Figure 12B
and C). We have also seen that tumor sections contain less RICTOR staining than non-tumor
sections (Figure 13). Therefore, further experiments would need to be conducted to determine if
this pathway suppresses GLUT2 expression.

20

Tables
Table 1: Plasmids used in the present study.

Table 2. ShRNA oligonucleotides used for c-JUN knockdown in HepG2 cells.

Table 3. Clinical pathological information of FFPE tissue.
ID # Tumor? Age Gender Primary Diagnosis HCV
1308 Yes 66.99 M HCC/ Alcoholic cirrhosis Pos
1306 Yes 57.46 F HCC/ Alcoholic cirrhosis Neg
12742 Yes ? ? HCC Pos
1264 Yes 46 M HCC/Alcoholic cirrhosis Pos
1342 Yes 57.92 M HCC/Alcoholic cirrhosis Pos
1366 Yes 52.75 M HCC/Alcoholic cirrhosis Pos

Plasmid Name Backbone Insertion
Full GLUT2 promoter pGL4 Vector Plasmid (promega) pGLUT2 (-1291/+308)-LUC
∆C/EBP pGL4 Vector Plasmid (promega) pGLUT2 (-1193/+308)-LUC
∆CRE pGL4 Vector Plasmid (promega) pGLUT2 (-1155/+308)-LUC
∆AP-1 pGL4 Vector Plasmid (promega) pGLUT2 (-1100/+308)-LUC
∆HNF-1α pGL4 Vector Plasmid (promega) pGLUT2 (-1030/+308)-LUC
∆CAAT pGL4 Vector Plasmid (promega) pGLUT2 (-206/+308)-LUC
∆TATA pGL4 Vector Plasmid (promega) pGLUT2 (+29/+308)-LUC
∆ Transcriptional
Initiation
pGL4 Vector Plasmid (promega) pGLUT2 (+126/+308)-LUC
PGL3 pGL3 Vector Plasmid (promega)
MT35 Blue script SK- His6-Tagged c-JUN (S63/73S)
MT112 Blue script SK- His6-Tagged c-JUN (D63/73D)
MT111 Blue script SK- His6-Tagged c-JUN (A63/73A)
Shc-JUN pGreenPuro (System Bioscience) c-Jun ShRNA (Table 2)
ShGLUT2 pGreenPuro (System Bioscience) GLUT2 ShRNA (Table 2)
Shc-JUN
oligonucleotide
Sequence
Shc-JUN1 Fwd
5’-GATCGAACAGGTGGCACAGCTTAAATTCAAGAGATTTAAGCTGTGCCACCTGTTCTTTTT-3’
Shc-JUN1 Rev
5’-AATTAAAAAGAACAGGTGGCACAGCTTAAATCTCTTGAATTTAAGCTGTGCCACCTGTTC-3’
Shc-JUN2 Fwd
5’-GATCGAAAGTCATGAACCACGTTAATTCAAGAGATTAACGTGGTTCATGACTTTCTTTTT-3’
Shc-JUN2 Rev
5’-AATTAAAAAGAAAGTCATGAACCACGTAATCTCTTGAATTAACGTGGTTCATGACTTTC-3’
ShGLUT2 Fwd
5’ GATCCATCGTCACGGGCATTCTTATTTCAAGAGAATAAGAATGCCCGTGACGATGTTTTT-3’
ShGLUT2 Rev
5’ AATTAAAAACATCGTCACGGGCATTCTTATTCTCTTGAAATAAGAATGCCCGTGACGATG-3’
21

Table 4: Oligonucleotides used for in-vitro mutagenesis of AP-1 sites on GLUT2 Promoter.
AP1/c-JUN
mutant
promoter
site
Mutant Primer
GLUT2 -123 5'-CAAGTCTAATCTTCTCAGCGGCAGCCAAACATTGATGGGAATCTAATCAATAAGT-3'
GLUT2 -123 5'-ACTTATTGATTAGATTCCCATCAATGTTTGGCTGCCGCTGAGAAGATTAGACTTG-3'
GLUT2 -144 5'-GCAGCTGAATATTGATGGGAATCTAACAAACAAGTGCTTTGCCTCAGCAACC-3'
GLUT2 -144 5'-GGTTGCTGAGGCAAAGCACTTGTTTGTTAGATTCCCATCAATATTCAGCTGC-3'
GLUT2 -1100 5'-GGAGGCTGTGACTTATTTATCCCGGTTGTCTCGGAGCATGGAACTGTGC-3'

GLUT2 -1100 5'-GCACAGTTCCATGCTCCGAGACAACCGGGATAAATAAGTCACAGCCTCC-3'

Table 5. RT-QPCR primers used in this study.
Primer Sequence
c-JUN (FWD) 5’-ACAGAGCATGACCCTGAACC-3’
c-JUN (Rev) 5’-CCGTTGCTGGACTGGATTAT-3’
GLUT2 #1 (FWD) 5’-GGCTAATTTCAGGACTGGTT-3’
GLUT2 #1 (REV) 5’-AGACTTTCCTTTGGTTTCTGG-3’
GLUT2 #2 (FWD) 5’-TACATTGCGGACTTCTGTGG-3’
GLUT2 #2 (REV) 5’-AGACTTTCCTTTGGTTTCTGG-3’
GLUT2 #3 (FWD) 5’-ATGTCAGTGGGACTTGTGCTGC-3’
GLUT2 #3 (REV) 5’-AACTCAGCCACCATGAACCAGG-3’

Table 6: Antibodies used in the present study.
Designation Manufacturer and
Catalogue number
Antibody
characterization
Dilution
(WB)
Dilution
(IHC)
GLUT2 C-10, sc-518022 Mouse Monoclonal 1:250 1:250
c-JUN 60A8, 9165S Rabbit Monoclonal 1:500 1:500
β-ACTIN AC-15, sc-69879 Mouse Monoclonal 1:1000 N/A

22

Figures
Figure 1. Hypothetical model of c-JUN mediated transcriptional suppression of GLUT2
expression. Overexpression and activation of transcription factor c-JUN promotes transcriptional
suppression of the SLC2A2 gene reducing GLUT2 expression resulting in decreased glucose uptake in
hepatocytes.

23

Figure 2: Liver specific c-Jun knockout in Tg mice reduced the tumor incidence and weight gained
induced by NS5A and HCFD. Alb-Cre: c-Jun
fl/fl
Tg mice were crossed with NS5A mice to produce the
Alb-Cre; c-Jun
fl/fl
; NS5A Tg mice (Fig 2A). Mice on HCFD had greater incidence of tumors and larger
increase in weight gained. NS5A expression in HCFD mice significantly increased tumor incidence, but
produced mice with lower weight gain. Liver specific knockout of c-Jun reduced the incidence of tumors
in HCFD fed mice and significantly reduced the weight gain induced by HCFD (Figure 2B).

24

Figure 3. Disruption of c-Jun improves insulin resistance and glucose tolerance.
Transgenic NS5A mice on HCFD had greater plasma glucose levels compared to their corresponding
control. The disruption of c-Jun reduced plasma glucose levels in both NS5A and non-NS5A transgenic
mice fed HCFD (Figure 3A and B). Overexpression of c-JUN in HepG2 cells increased glucose
production and reduced glucose uptake (Figure 3 C and D).

25

Figure 4. Inverse relationship between c-JUN and GLUT2 staining in tumor and non-tumor tissue.
Significantly greater (p<0.01) nuclear c-JUN staining was observed in the tumors compared to their
adjacent non-tumor sections. Significantly lower GLUT2 staining was observed in the tumors compared
to their adjacent non-tumor section with lower nuclear c-JUN staining (p<0.01). Immunoreactivity
scoring (IRS) was calculated based on frequency and intensity of immuno-staining. Data is displayed as
average IRS for five images per section. Error bars are standard deviation.
* = p<0.05, ** = p<0.01, *** = p<0.001.

26

Figure 5. Effects of cellular c-JUN expression on various regions of the GLUT2 promoter.
Silencing of c-JUN produced significant increases in all GLUT promoter-luciferase constructs compared
to the control (Figure 5A). However, overexpression of c-JUN produced no significant changes in
luciferase expression in the series of GLUT2 promoter-luciferase constructs. No significant difference in
luciferase activity was observed when -1100 AP-1 binding region was truncated. * = p<0.05, ** =
p<0.01, *** = p<0.001

27

Figure 6. In-vitro mutagenesis of AP-1 consensus sequences on the GLUT2 promoter.
Mutant primers (Table 4) were used to alter three AP-1 consensus sequences on the GLUT2 promoter
(Figure 6A). Constructs containing the full length (-1291) GLUT2 promoters were mutated at the -1100
AP-1 site. Mutation of the -1100 AP-1 site resulted in decreased luciferase activity while the
overexpression of c-JUN produce a greater luciferase expression compared with the empty vector control
(Figure 6B). The (-206/+308) GLUT2 promoter-luciferase constructs were used to produce mutated AP-1
sites at -144 or -123. Mutation at the -144 AP-1 site resulted in significantly greater luciferase activity.
Overexpression of c-JUN reduced luciferase expression in the un-mutated condition. In contrast,
overexpression continued to produce a significant increase in luciferase activity in the mutant condition. *
= p<0.05, ** = p<0.01, *** = p<0.001

28

Figure 7. Validation of c-JUN silencing in HepG2 cells using Immunoblot and staining.
c-JUN was silenced in HepG2 cells using lentiviral transduction. After puromycin selection and
enrichment, cells were grown and harvested for knockdown validation using western-blot analysis (Figure
7A) and immunostaining (Figure 7B).

29

Figure 8. Knockdown of c-Jun produced insignificant change in GLUT2 mRNA and protein levels
in HepG2 cells. Quantitative PCR analysis was used to determine the relative mRNA expression of c-
JUN and GLUT2 in c-JUN knock down HepG2 cells. An insignificant decrease in GLUT2 mRNA was
observed when c-JUN was knock down compared with control (Fig 8A). In addition, no noticeable
change was observed in the GLUT2 protein band between the silenced and control groups (Fig 8B).* =
p<0.05, ** = p<0.01, *** = p<0.001.

30

Figure 9. Activation of c-JUN at Serine 63/73 increase GLUT2 mRNA and protein expression in
HepG2 cells.
HepG2 cells were seeded into T-25 flasks and transfected with 500ng of expression vectors containing
WT S63/73S His 6-tagged c-JUN (MT35), non-phosphorylatable A63/73A His 6-tagged c-JUN (MT111),
phosphomimetic D63/73D His 6-tagged c-JUN (MT112), or empty vector control (PBSK). Overexpression
of MT35 c-JUN produced a mild increase in GLUT2 mRNA (p<0.05) and protein. Overexpression of
MT112 c-JUN produced a pronounced increase in GLUT2 mRNA (p<0.001) and protein. However,
MT111 c-JUN overexpression produced a decrease in GLUT2 mRNA (p<0.01) with mild change in
protein levels. * = p<0.05, ** = p<0.01, *** = p<0.001

31

Figure 10. Greater expression of c-JUN in CD133+ HepG2 cells.
The expression of c-JUN mRNA is significantly greater in CD133+ HepG2 cells compared with
CD133- HepG2 cells (Fig A). Shc-JUN and shGLUT2 HepG2 cells were grown in ultra-low
adhesion plates with low glucose media to promote spheroid formation. Spheroids were counted
after 7days of incubation. Knockdown of c-JUN resulted in an insignificant (P=0.5) reduction of
Spheroid formed while knockdown of GLUT2 produced an insignificant (P=0.3) increase in
spheroid formation. * = p<0.05, ** = p<0.01, *** = p<0.001

32

Figure 11. Alternative hypothetical model of c-JUN mediated suppression of glucose uptake and
GLUT expression in hepatocytes.
GlUT2 is noted as the main glucose transporter in normal hepatocytes. However, several studies suggest
that GLUT2 is not the main transporter in HCC cell lines. Therefore, c-JUN may reduce glucose uptake
by suppressing the transcription of the dominant glucose transporter expressed in HCC cell lines (Figure
11A). Alternatively, c-JUN’s ability to alter GLUT expression might be dependent on where c-JUN is
phosphorylated (Figure 11B).

33

Figure 12. c-JUN mediated disruption of AKT-FOXO1 signaling via RICTOR suppression
potentially reduces GLUT2 expression.
Alternative hypothesis describing GLUT2 suppression via c-JUN mediated disruption of mTORC2-AKT-
FOXO1 signaling via suppression of RICTOR (Figure 12A). Western blot analysis showed that
overexpression of c-JUN in HepG2 cells decreases the phosphorylation of AKT at Serine 473 and
phosphorylation of FOXO1. Western blot analysis also showed that c-JUN disrupts AKT activation by
suppressing mTORC2 component RICTOR (Figure 12B). Knockdown of c-JUN in HepG2 cells also
produced an increase in RICTOR mRNA and immunostaining for RICTOR (Figure 12C). * = p<0.05, **
= p<0.01, *** = p<0.001

34

Figure 13. Inverse relationship between c-JUN and RICTOR staining in tumor and non-
tumor tissue. Significantly greater (p<0.01) nuclear c-JUN staining was observed in the tumors
compared to their adjacent non-tumor sections. Significantly lower RICTOR staining was observed in the
tumors compared to their adjacent non-tumor section with lower nuclear c-JUN staining (p<0.01).
Immunoreactivity scoring (IRS) was calculated based on frequency and intensity of immuno-staining.
Data is displayed as average IRS for five images per section. Error bars are standard deviation.
* = p<0.05, ** = p<0.01, *** = p<0.001.

35

References
1. Angel P, Karin M. The role of Jun, Fos and the AP-1 Complex in Cell-proliferation and
transformation. Biochim Biophys Acta. 1991; 1072: 129-157.
2. Behrens, A., Sibilia, M. & Wagner, E. Amino-terminal phosphorylation of c-Jun
regulates stress-induced apoptosis and cellular proliferation. Nat Genet 21, 326–329
(1999). https://doi.org/10.1038/6854
3. Bossy-Wetzel E, Bakiri L, Yaniv M. Induction of apoptosis by the transcription factor c-
Jun. EMBO J. 1997; 16: 1695-1709.
4. Buller, C. L., Loberg, R. D., Fan, M. H., Zhu, Q., Park, J. L., Vesely, E., Inoki, K., Guan,
K. L., & Brosius, F. C., 3rd (2008). A GSK-3/TSC2/mTOR pathway regulates glucose
uptake and GLUT1 glucose transporter expression. American journal of physiology. Cell
physiology, 295(3), C836–C843. https://doi.org/10.1152/ajpcell.00554.2007
5. Burant CF, Sivitz WI, Fukumoto H, et al. Mammalian glucose transporters: structure and
molecular regulation. Recent Prog Horm Res. 1991;47:349 ‐388. doi:10.1016/b978-0-12-
571147-0.50015-9
6. Feng, J., Lu, S., Ou, B., Liu, Q., Dai, J., Ji, C., Zhou, H., Huang, H., & Ma, Y. (2020).
The Role of JNk Signaling Pathway in Obesity-Driven Insulin Resistance. Diabetes,
metabolic syndrome and obesity : targets and therapy, 13, 1399–1406.
https://doi.org/10.2147/DMSO.S236127
7. Giovannucci, E., Harlan, D. M., Archer, M. C., Bergenstal, R. M., Gapstur, S. M., Habel,
L. A., Pollak, M., Regensteiner, J. G., & Yee, D. (2010). Diabetes and cancer: a
consensus report. Diabetes care, 33(7), 1674–1685. https://doi.org/10.2337/dc10-0666
8. Gurney AL, Park EA, Giralt M, Liu J, Hanson RW. Opposing actions of Fos and Jun on
transcription of the phosphoenolpyruvate carboxykinase (GTP) gene. Dominant negative
regulation by Fos. J Biol Chem. 1992;267(25):18133 ‐18139.
9. Hilberg, F., Aguzzi, A., Howells, N. et al. c-Jun is essential for normal mouse
development and hepatogenesis. Nature 365, 179–181 (1993).
https://doi.org/10.1038/365179a0
10. Hosokawa T, Kurosaki M, Tsuchiya K, et al. Hyperglycemia is a significant prognostic
factor of hepatocellular carcinoma after curative therapy. World J Gastroenterol.
2013;19(2):249-257. doi:10.3748/wjg.v19.i2.249
11. Kasai D, Adachi T, Deng L, Nagano-Fujii M, Sada K, Ikeda M, Kato N, Ide YH, Shoji I,
Hotta H. HCV replication suppresses cellular glucose uptake through down-regulation of
cell surface expression of glucose transporters. J Hepatol. 2009; 50:883–894.
12. Kim JW, Kim YK, Ahn YH. A mechanism of differential expression of GLUT2 in
hepatocyte and pancreatic beta-cell line. Exp Mol Med. 1998;30(1):15 ‐20.
doi:10.1038/emm.1998.2
13. Kim, J., Ahn, Y. C/EBP binding activity to site F of the rat GLUT2 glucose transporter
gene promoter is attenuated by c-Jun in vitro. Exp Mol Med 34, 379–384 (2002).
https://doi.org/10.1038/emm.2002.54
14. Kim YH, Jeong DC, Pak K, Han ME, Kim JY, Liangwen L, Kim HJ, Kim TW, Kim TH,
Hyun DW, Oh SO (2017) SLC2A2 (GLUT2) as a novel prognostic factor for
hepatocellular carcinoma. Oncotarget 8(40):68381–68392
36

15. Lee, Y., Kim, Y., Jung, Y. et al. Hepatocyte toll-like receptor 4 mediates
lipopolysaccharide-induced hepcidin expression. Exp Mol Med 49, e408 (2017).
https://doi.org/10.1038/emm.2017.207
16. Machida, K., Tsukamoto, H., Liu, J. C., Han, Y. P., Govindarajan, S., Lai, M. M., Akira,
S., & Ou, J. H. (2010). c-Jun mediates hepatitis C virus hepatocarcinogenesis through
signal transducer and activator of transcription 3 and nitric oxide-dependent impairment
of oxidative DNA repair. Hepatology (Baltimore, Md.), 52(2), 480–492.
https://doi.org/10.1002/hep.23697
17. Martyn JA, Kaneki M, Yasuhara S. Obesity-induced insulin resistance and
hyperglycemia: etiologic factors and molecular mechanisms. Anesthesiology.
2008;109(1):137-148. doi:10.1097/ALN.0b013e3181799d45
18. Matsui, C., Shoji, I., Kaneda, S., Sianipar, I. R., Deng, L., and Hotta, H. (2012) Hepatitis
C virus infection suppresses GLUT2 gene expression via downregulation of hepatocyte
nuclear factor 1α. J. Virol. 86, 12903–12911
19. Mittal, S., & El-Serag, H. B. (2013). Epidemiology of hepatocellular carcinoma: consider
the population. Journal of clinical gastroenterology, 47 Suppl(0), S2–S6.
https://doi.org/10.1097/MCG.0b013e3182872f29
20. Mueckler, M., Caruso, C., Baldwin, S. A., Panico, M., Blench, I., Morris, H. R., Allard,
W. J., Lienhard, G.E. and Lodish, H.F. (1985) Science 229, 941-945
21. Park KJ, Choi SH, Choi DH, et al. 1Hepatitis C virus NS5A protein modulates c-Jun N-
terminal kinase through interaction with tumor necrosis factor receptor-associated factor
2. J Biol Chem. 2003;278(33):30711-30718. doi:10.1074/jbc.M209623200
22. Hales CM, Carroll MD, Fryar CD, Ogden CL. Prevalence of obesity and severe obesity
among adults: United States, 2017–2018. NCHS Data Brief, no 360. Hyattsville, MD:
National Center for Health Statistics. 2020
23. Hervé Lerat, Mohamed Rabah Imache, Jacqueline Polyte, Aurore Gaudin, Marion
Mercey, Flora Donati, Camille Baudesson, Martin R. Higgs, Alexandre Picard,
Christophe Magnan, Fabienne Foufelle, and Jean-Michel Pawlotsky. Hepatitis C virus
induces a prediabetic state by directly impairing hepatic glucose metabolism in mice J.
Biol. Chem. 2017 292: 12860-. doi:10.1074/jbc.M117.785030
24. Sakai M, Okuda A, Hatayama I, Sato K, Nishi S, Muramatsu M. Structure and expression
of the rat c-jun messenger RNA: tissue distribution and increase during chemical
hepatocarcinogenesis. Cancer Res. 1989;49(20):5633 ‐5637.
25. Schwabe RF, Seki E, Brenner DA. Toll-like receptor signaling in the
liver. Gastroenterology. 2006;130(6):1886 ‐1900. doi:10.1053/j.gastro.2006.01.038
26. Shoji I Deng L and Hotta H (2012) Molecular mechanism of hepatitis C virus-induced
glucose metabolic disorders. Front. Microbio. 2:278. doi: 10.3389/fmicb.2011.00278
27. Shrivastava A, Manna SK, Ray R, Aggarwal BB. Ectopic expression of hepatitis C virus
core protein differentially regulates nuclear transcription factors. J Virol.
1998;72(12):9722-9728.
28. Smeal T, Binetruy B, Mercola DA, Birrer M, Karin M. Oncogenic and transcriptional
cooperation with Ha-Ras requires phosphorylation of c-Jun on serine 63 and 73.
29. Takeda, J., Kayano, T., Fukumoto, H. and Bell, G. I. (1993) Organization of the human
GLUT2 (pancreatic beta-cell and hepatocyte) glucose transporter gene. Diabetes 42:773-
777.
30. Thorens, B., Sarkar, H. K., Kaback, H. R. and Lodish, H. F. (1988) Cell 55, 281-290
37

31. Tsoulfas G. (2019). Hepatocellular carcinoma and metabolic syndrome: The times are
changing and so should we. World journal of gastroenterology, 25(29), 3842–3848.
https://doi.org/10.3748/wjg.v25.i29.3842
32. Tsutsumi T, Suzuki T, Moriya K, et al. Alteration of intrahepatic cytokine expression and
AP-1 activation in transgenic mice expressing hepatitis C virus core protein. Virology.
2002;304(2):415-424. doi:10.1006/viro.2002.1702
33. Tullai JW, Tacheva S, Owens LJ, Graham JR, Cooper GM. AP-1 is a component of the
transcriptional network regulated by GSK-3 in quiescent cells. PLoS One.
2011;6(5):e20150. doi:10.1371/journal.pone.0020150
34. Vanni E, Bugianesi E. Obesity and liver cancer. Clin Liver Dis. 2014;18(1):191-203.
doi:10.1016/j.cld.2013.09.001
35. Watson A, Eilers A, Lallemand D, Kyriakis J, Rubin LL, Ham J. Phosphorylation of c-
Jun is necessary for apoptosis induced by survival signal withdrawal in cerebellar granule
neurons. J Neurosci. 1998; 18: 751-762
36. Yu F, Wei R, Yang J, et al. FoxO1 inhibition promotes differentiation of human
embryonic stem cells into insulin producing cells. Exp Cell Res. 2018;362(1):227-234.
doi:10.1016/j.yexcr.2017.11.022

Abstract (if available)

Abstract The expression of Glucose transporter 2 (GLUT2), which is encoded by SLC2A2 gene, has been reported to be negatively correlated in advance stages of hepatocellular carcinoma (HCC). It is also suppressed in Hepatitis C virus (HCV) infected tissue and most hepatoma cell lines. Studies of the GLUT2 promoter in rat hepatocytes have indicated c-JUN/AP-1-mediated transcriptional suppression of GLUT2. AP-1 binding sites on the promoter of the human GLUT2 gene have been reported, but they have yet to be analyzed to determine their role in c-JUN’s ability to alter SLC2A2 expression. In our present study, we observed that liver specific c-JUN disruption reduced plasma glucose levels in HCFD mice, and that c-JUN overexpression decreased glucose uptake but increased glucose production. We postulated that c-JUN alters plasma glucose homeostasis and glucose metabolism in hepatocytes by directly disrupting GLUT2 expression. We hypothesized that c-JUN attenuates GLUT2 expression through AP-1 binding consensus sequences on the promoter of GLUT2. We used a dual-reporter gene assays, RT-qPCR and western blot to quantify GLUT2 expression at the transcriptional and protein levels when c-JUN was overexpressed or silenced in HepG2 cells. Immunohistochemistry was also used to characterize the relationship between c-JUN and GLUT2 expression in patient HCC tumors. We report that the upregulation of subcellular c-JUN moderately promotes GLUT2 expression. Activation of c-JUN by N-terminal phosphorylation further increases expression of GLUT2 mRNA and protein levels.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Synergism between TLR4-c-JUN axis and surface receptor stimulation translocate c-MYC into Ig loci, through AID leading to lymphomagenesis

PDF

MSI2 level alters histone transcription rate in HepG2 cells

PDF

A truncating mutation in the autophagy gene UVRAG drives inflammation and tumorigenesis in mice

PDF

Musashi-2 promotes c-MYC expression through IRES-dependent translation and self-renewal ability in hepatocellular carcinoma

PDF

UVRAG maintains genomic integrity

PDF

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

PDF

Transcriptional regulation of IFN-γ and PlGF in response to Epo and VEGF in erythroid cells

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Lnc-RNA and WNT signal synergistically promotes self-renewal of tumor initiating stem-like cells via epigenetic regulation

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Novel long non-coding RNA, LINC00824, contributes to stemness in hepatocytes

PDF

Placental growth factor mediated transcriptional and post-transcriptional regulation of hemeoxygenase-1

PDF

Roles of epithelial-mesenchymal transition and niche in tumorigenesis of tumor-initiating cells

PDF

Characterizing and manipulating homology-directed gene editing in human cells

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

Establishing a human EGFR expressing murine mammary carcinoma cell line-D2F2, as a syngeneic immunocompetent model

PDF

The role of ErbB signaling in dendritic cells during inflammatory bowel disease

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Single cell gene expression analysis of KSHV infection in three-dimensional oral epithelial tissue cultures

Asset Metadata

Creator Serna, Raphael Jr. (author)

Core Title c-JUN mediated alteration of SLC2A2 expression in hepatoma cell line HepG2

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 11/01/2020

Defense Date 10/29/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag AP-1,c-Jun,GLUT2,OAI-PMH Harvest,SLC2A2

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Machida, Keigo (committee chair), Dubeau, Louis (committee member), Li, Jie (committee member), Liang, Chengyu (committee member)

Creator Email rlphserna@yahoo.com,Rserna@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-390354

Unique identifier UC11666378

Identifier etd-SernaRapha-9092.pdf (filename),usctheses-c89-390354 (legacy record id)

Legacy Identifier etd-SernaRapha-9092.pdf

Dmrecord 390354

Document Type Thesis

Rights Serna, Raphael Jr.

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA