University of Southern California Dissertations and Theses

The effect of urinary bladder matrix on irradiated wound healing

(USC Thesis Other)

The effect of urinary bladder matrix on irradiated wound healing

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content The Effect of Urinary Bladder Matrix on Irradiated
Wound Healing
by
Jingxin Yao
A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(Biochemistry and Molecular Medicine)
August 2020
Copyright 2020 Jingxin Yao
ii

Acknowledgments

I would like to express my appreciation to my advisor, Dr. Alex Wong, for giving me the
opportunity to conduct my master thesis research in his lab as well as encouraging and guiding me
during my research. I would like to thank my thesis committee members, Dr. Young-Kwon Hong,
Dr. Wei Li and Dr. Baruch Frenkel, who have provided valuable comments and suggestions to my
thesis.

I would like to thank Dr. Wan Jiao and Sun Young Park for their teaching and support in the
laboratory. I would also like to thank my lab members Cynthia Sung, Roy Yu, Anjali Raghuram
and Jin Wang for being an excellent supportive team. I would like to thank student advisor Dr.
Judd Rice and Monica Pan for providing enormous help both in study and in life.

Last but not least, I would like to thank my classmates, my friends and my parents for their support
and company.

iii

Table of Contents

Acknowledgments ..................................................................................................... ii
List of Tables .............................................................................................................. v
List of Figures ............................................................................................................ v
Abstract .................................................................................................................... vi
1. Introduction ............................................................................................................ 1
1.1 Radiation Therapy and its side effects ....................................................................... 1
1.2 Extracellular Matrix Biomaterials .............................................................................. 2
1.3 Four stages of wound healing ..................................................................................... 3
1.4 Chronic irradiated wound healing .............................................................................. 5
2. Materials and Methods ........................................................................................... 6
2.1 Animals ....................................................................................................................... 6
2.2 Radiation Procedure ................................................................................................... 7
2.3 Surgical Procedure and Treatment Application .......................................................... 7
2.4 Measurement of Wound Healing ................................................................................ 8
2.5 Histological Analysis .................................................................................................. 9
2.6 Immunohistochemical Analysis ............................................................................... 10
2.7 Total RNA Isolation and Quantitative Real-Time PCR ........................................... 11
2.8 Statistical Analysis ................................................................................................... 11
3. Results ..................................................................................................................12
3.1 UBM Group Shows Accelerated Wounds Healing Compared with Controls .......... 12
3.2 UBM-treated Group Shows Thicker and Healthier Epidermis ................................ 14
3.3 UBM Application Increased Collagen Deposition by Day 14 ................................. 16
iv

3.4 UBM Increases Contraction Activity in Chronic Irradiated Wound Healing .......... 18
3.5 UBM Increases Angiogenesis in Chronic Irradiated Wound Healing ...................... 20
3.6 TGF-β1 Level is Lower in UBM Treated Group on Day 28 .................................... 22
3.7 Phospho-Smad3 is Less Concentrated in the UBM-treated Group on Day 28 ........ 24
4. Discussion ............................................................................................................26
5. Future Experiments ..............................................................................................30
References ................................................................................................................31

v

List of Tables
Table 1. Primer sequence for RT-PCR .............................................................................. 11

List of Figures
Figure 1. Accelerated wound healing in UBM-treated group ............................................... 13
Figure 2. Histological analysis of UBM-treated and control wounds ..................................... 15
Figure 3. Sirius Red staining of UBM-treated and control wounds ....................................... 17
Figure 4. Immunohistochemical staining of α-SMA of UBM-treated and control wounds ........ 19
Figure 5. Immunohistochemical staining of CD31 of UBM-treated and control wounds .......... 21
Figure 6. RT-PCR and qPCR of TGF-β1 on day 28. ........................................................... 23
Figure 7. Immunohistochemical staining of phospho-SMAD3 ............................................. 25

vi

Abstract

Radiation therapy is currently a major modality in cancer treatment and is part of the treatment
regimen of half of all patients diagnosed with cancer. In addition to radiation therapy, cancer
patients often undergo surgical procedures. The resulting soft tissue injury post-radiation can
result in fibrosis and necrosis, which leads to delayed wound healing. Current strategies in
treating such chronic wounds are very limited. Thus, our focus is on finding novel treatments to
improve the outcome of chronic wounds generated from irradiation. Previous studies have shown
that applying extracellular matrix (ECM) derivatives stimulates wound closure and cell growth in
many clinical cases and in animal models. In light of this promising preceding work, the aim of
my study is to investigate whether Urinary Bladder Matrix (UBM), an extracellular matrix
derived from porcine urinary bladder, can be beneficial in shortening the healing time of chronic
wounds post-radiation as well as in improving the quality of wound healing. In this study, we
found that porcine-derived urinary bladder matrix accelerates chronic wound healing after
radiation exposure. It can improve the quality of chronic irradiated wound healing by increasing
collagen deposition, presence of myofibroblasts, and stimulating angiogenesis. In addition, UBM
may reduce fibrosis through the TGF-β1/ Smad3 signaling pathway. Therefore, UBM may be a
cost-effective and easily applicable treatment option for irradiated chronic wound healing.
1

1. Introduction
1.1 Radiation Therapy and its side effects

Radiation therapy (also known as radiotherapy) is currently a major modality in cancer treatment
and is administered to half of all patients diagnosed with cancer. It uses a high dose of ionizing
radiation produced by special equipment to irradiate cancerous tumors, damage genetic materials
(DNA) in cancer cells, block their ability of proliferation, differentiation and diffusion, and
further leads to cellular death. However, the complicated responses in cells caused by radiation
also cause side effects and patients suffer for months to years after radiation treatment. More
than 90% cancer patients undergoing radiation therapy will have a negative skin reaction
following treatment [1].

Radiation-induced skin injuries are usually divided into two categories, acute injuries and
chronic injuries. Acute injuries, occurring from the first several days after the treatment, include
erythema, dry desquamation, hyperpigmentation, hair loss, and moist desquamation [2,3]. These
injuries are usually reversible and patients can recover by themselves within three months. In
contrast, chronic injuries that happen months to years after treatment are usually irreversible and
could leave patients life-long suffering. Chronic injuries involve vascular damage, nonstandard
wound healing, tissue atrophy, fibrosis, skin necrosis, and ulcers [2-4].

2

In addition to radiation therapy, cancer patients often undergo surgical procedures. The resulting
soft tissue injury post-radiation can result in delayed wound healing in the wound area. Cancer
patients often undergo expensive surgical procedures in attempts to fix these injuries. While local
free flap reconstruction, hyperbaric oxygen therapy and negative-pressure wound therapies have
been used to improve chronic irradiated wound healing [5-7] they are limited by their potential
disturbance to recipient vessels. Thus, there is a need for minimally invasive non-surgical
techniques to act upon the numerous cellular changes as well as decrease costs of treating
chronic irradiated wounds.

1.2 Extracellular Matrix Biomaterials

The extracellular matrix (ECM) is a complex network composed of macromolecular substances
secreted by cells that provides both physical support and biochemical regulation to surrounding
tissues [8]. The main components of ECM are proteins such as collagen, elastin, proteoglycans,
and glycoproteins. Current non-invasive therapies have explored the use of extracellular matrix
(ECM) biomaterials in stimulating wound closure and cell growth and have shown success in
numerous case studies and animal models [7]. As an acellular dermal matrix, ECM biomaterials
are obtained via decellularization from various organs of numerous species, and ECM products
from human skin, porcine small intestine and porcine urinary bladder have gained broad clinical
acceptance [9]. Obtained ECM generally retains functional molecules and native tissue structure
3

that aids the healing process in each stage of wound healing [9, 10].

Urinary Bladder Matrix (UBM) is a porcine derived ECM that be found as the only material that
retains the integrity of basement membrane as well as other components such as collagen, lamini,
fibronectin, and growth factors to aid in directed wound healing [9]. When topically applied to
wound areas, UBM can act as a scaffold for tissue reconstruction. Its retained epithelial basement
membrane could help direct tissue regeneration and organization of new growth [11]. UBM
xenografts have shown positive results in the reduction of pain and an increase in new epidermal
growth in multiple case studies in wounds which failed to heal following traditional therapies
[12]. These studies offer a hopeful new treatment for non-healing irradiated chronic wounds.

1.3 Four stages of wound healing

When the skin is injured, it begins to repair itself through a complicated process involving a
sequence of signaling pathway changes and cell activation [13-16]. The wound healing process
usually undergoes four stages: hemostasis, inflammation, proliferation and remodeling. These
stages are not completely independent but overlap each other.

The first phase for skin self-repair after injury is hemostasis, which starts immediately after
injury happens and is usually complete within a few hours. During this stage, platelets gather at
the damaged site and activate collagen to help form a platelet plug. This leads to the formation of
4

fibrin which acts as “glue” to bind the platelet plugs together [13-15]. The resulting clot over the
wound area retains the integrity of blood vessels and prevents further bleeding.

The second phase, known as inflammation phase, happens within a few hours. At this time, the
bleeding has been controlled and the protective barrier has been formed, so the main objective of
this phase is to clean out necrotic tissues and to prevent infection. During this phase, neutrophils
are first recruited to the wound area to kill bacteria as well as to degrade platelets and remove
debris. About three days after, macrophages differentiated from monocytes appear to support the
phagocytosis of pathogens and debris. Besides, they secrete numerous growth factors such as
TGF- β, VEGF, FGF and PDGF, which moves the healing process into the next phase [13-16].
Proliferation phase takes place after the wound area has been cleaned out. In this stage, the main
purpose is to form a new blood vessel network, close the open wound area by contraction and re-
epithelialization, and fill the injury zone with granulation tissue. In the normal healing process,
the edge of the wound usually rapidly shrank to finish the wound closure, and the degree of
wound reduction varies with animal species, wound site, wound size and shape [12]. Healthy
granulation tissue is essential for the proliferation phase, since it can provide nutrients and
secrete growth factors that are needed during this process.

When the wound is completely covered by regenerated epithelial cells, the healing process enters
the last stage of the wound, remodeling phase. In this phase, most cells’ metabolic activity slows
5

down, surplus cells are removed through apoptosis, and collagen fibers undergo reorganization to
increase the tensile strength of new tissues in wound area. Subepidermal appendages slowly
grow back and finally restore to normal skin structure [13-16].

1.4 Chronic irradiated wound healing

Ionizing radiation can damage the normal skin, which leads to profound side-effects on
postoperative wound healing and leaves a tough problem to clinical treating. Previous study
reported that the rate of developing wound complications after radiation is about 37% [17]. The
physiological process of wound healing involves a complicated coordinated sequence of
signaling pathways that is regulated by a network of growth factors and cytokines. Radiation-
induced tissue damages attribute to the changes of parenchymal cells and blood vessels, which
further lead to a delayed wound healing.

Cellular depletion is considered as one of the main reasons of delayed wound healing [4].
Reduction of stem cells has been found in irradiated skins [18], which lead to a decreased
differentiation of functional cells. Additionally, the impairment of proliferation in epidermal stem
cells was discovered three days after irradiation, and it could last up to 96 days or longer [19].
Moreover, Rudolph et al demonstrated that irradiation can cause long-lasting damages to the
proliferation and differentiation of fibroblasts [20] that further diminished the healing capacity.
6

Loss of normal tissue structure results from irradiation has also been shown [21]. Microvascular
impairment and decreased angiogenesis have been observed in irradiated skin [4, 21]. This
damage can lead to local poor nutrition support and local tissue hypoxia, which blocks the
granulation tissue formation and delays the wound healing process.

In addition, irradiation changes the interaction among growth factors, cytokines and chemokines,
resulting in dysregulation of tissue regeneration [1]. Overexpression of cytokines transforming
growth factor beta (TGFb), vascular endothelial growth factor (VEGF), tumor necrosis factor-a
(TNF-a), interferon-y (IFN-y) and proinflammatory cytokines (interleukin-1, interleukin-8) has
been reported., which leading to an accumulation of matrix and fibrosis [22]. Excessive activity
of Metalloproteases (MMPs), enzymes that degrade the extracellular matrix, is also responsible
for healing impairment [23]. Evidence shows that MMP is overexpressed in irradiated wounds,
which may delay tissue granulation by over degrading ECM proteins that are necessary for the
healing process.

2. Materials and Methods

2.1 Animals

All animal experiments were performed according to protocol #11464 approved by the Animal
Core Facility of the University of Southern California (USC). FVB male (23-25 g) and female
7

(19-22 g) mice aged 10-12 weeks were used for this project. Mice were single housed and
maintained under specific pathogen–free conditions and given standard laboratory chow food
and water ad libitum during experiments.

2.2 Radiation Procedure

To investigate irradiated chronic wound healing, a radiation procedure was performed to model
clinical radiation therapy. A 1.5 x 1.5 cm area dorsal side skin was exposed to external beam
radiation using the XRAD 320 irradiator. Before radiation, mice were injected intraperitoneally
with ketamine 100mg/kg and xylazine 10mg/kg for anesthesia. All mice received a 5.5 Gray
(Gy) dose of radiation every day, and this step was repeated for five consecutive days. During
this process, the radiation went to a maximum depth of 1mm and injured only the skin. After
radiation, mice were kept on a heating pad until consciousness was restored. The mice were
given six weeks recovery period to mimic chronic irradiated human skin models.

2.3 Surgical Procedure and Treatment Application

At six-weeks post-recovery, mice were placed on a heating pad to keep their body temperature
and were anesthetized with 2.5% isoflurane through inhalation. Each mouse was weighed by an
electronic scale and was given buprenorphine SR 1.0mg/kg (subcutaneous injection) to avoid
pain or distress before surgery. Mouse dorsal hair was removed using an electronic hair remover
8

and the exposed skin was sterilized using 10% povidone iodine solution. The dorsal back skin
was picked up at the midline and punched by an 8-mm sterile punch biopsy (McKesson, Irving,
TX) through two layers of skin to create full-thickness wound within previous irradiated area.
Twenty-one mice were randomly divided into UBM-treated group (n=11) and control group
(n=10). In UBM-treated group, a drop of saline was applied over wound area to keep moisture,
2.5mg UBM powder (MicroMatrix powder, ACell, Inc) was topically applied to wound area,
followed with an 8-mm UBM sheet (Wound Matrix sheet, ACell, Inc) and wrapped with a non-
adherent bandage (Nexcare) and cloth tape. In control group, mice only received a drop of saline.
Mice were returned to standard housing and checked twice every day. Mice were weighed every
seven days and the body weight changes were calculated to estimate the adverse effects. Wound
dressings were changed every seven days under the same procedure. The buprenorphine SR
injection was repeated every 72 hours.

2.4 Measurement of Wound Healing

Wound healing was observed over the course of 28 days postoperatively. Wound photographs
were taken on days 0, 7, 14, 21 and 28 after injury with a Canon EOS Rebel T4i DSLR camera
from a fixed distance. A ruler was placed next to each mouse as an object of reference for
measurement. Wound area for one mouse on each day (At) were measured using ImageJ (NIH,
version 1.52a) and compared to its original size (A0) on day 0. The percentage of wound present
was used to assess the degree of wound closure.
9

Percentage Wound Present = (At / A0) * 100%
Average percentage of wound present was calculated for UBM-treated group and control group
in Microsoft Excel and wound healing curves were created using the same software.

2.5 Histological Analysis

Mice in UBM-treated group and control group were euthanized on day 14 (n=3, n=3) and day 28
(n=8, n=7) serve as middle and end timepoints of wound healing process. Wounds together with
surrounding healthy skin were removed from each mouse. Tissues were cut along the middle line
and fixed with 10% formalin at 4℃. After overnight, wound samples were transferred to 70%
ethanol for three hours, dehydrated with the different concentration ethanol and xylene, and
finally embedded in paraffin block with the wounding side down. The paraffin blocks were
sectioned into 4 μm thick slides for further staining.

Hematoxylin-Eosin (H&E) staining was performed to investigate the irradiated wound structure.
Solutions were prepared according to the standard protocol. Sirius Red staining was performed to
assess the collagen structure and deposition. In summary, after deparaffinized with xylene 100%,
95% and 70% ethanol, wound sections were stained with Weigert’s hematoxylin for 8 min for
nuclei staining. After washing with tap water for 10 minutes, slides were stained with picro-sirius
red for 1 hour and washed in acidified water twice. Completed slides were dehydrated and
mounted for analysis. Photos were taken using KEYENCE BZ-X700 microscope (Itasca, IL)
10

under 4x magnification to view the overall structure of wounds. Three high powered field (HPF)
views were also randomly chosen under 40x magnification for further semiquantitative analysis
using ImageJ (NIH, version 1.52a). Color threshold function was used to determine the range of
red color (hue 200-255, saturation 105-255, brightness 135-255) and analyze the percentage of
positive pixel (PPP) of collagen in each HPF.

2.6 Immunohistochemical Analysis

4 μm thick slides were deparaffinized using the same method, then underwent antigen retrieval
process in sodium citrate buffer (pH=6) using a pressure cooker. Slides were blocked with horse
serum for one hour, then washed with 1%TBS and stained with anti-CD31 antibody at 1:200
dilution (Abcam; catalog #ab28364), anti-alpha smooth muscle actin (α-SMA) antibody at 1:100
dilution (Abcam; catalog #ab5694), or anti-SMAD3 (phospho S423 + S425) antibody at 1:100
dilution (Abcam; catalog #ab52903) overnight at 4 °C. Slides were washed and treated with
horse anti-rabbit secondary antibody and incubated at room temperature for 1 hour. After
washing, slides were stained with IMMPact DAB substrate IMMPact DAB substrate (Vector
Laboratories, Burlingame, CA) according to the manufacturer’s instruction and 20%
hematoxylin solution for 45 seconds. Photos were taken using the same method as with Picro-
Sirius Red staining evaluation. For CD31 and phospho-SMAD3 staining, analysis was performed
to each group and the number of positive cells in each HPF were averaged. For α-SMA staining,
analysis was performed using the same function in ImageJ and the color range is hue 0-60,
11

saturation 35-255, brightness 0-255.

2.7 Total RNA Isolation and Quantitative Real-Time PCR

Total RNA was isolated from wound samples using TRIzol plus RNA purification kit (Thermo
Fisher Scientific, Waltham, MA) according to manufacturer instructions, then cDNA was
prepared using a QuantiTect Reverse Transcription Kit (QIAGEN, Hilden, Germany). Real-time
PCR was performed using PerfeCTa SYBR Green SuperMix Kit (Quantabio, Beverly, MA) with
the Applied Biosystems ABI 7900HT Real-Time System (Thermo Fisher Scientific, Waltham,
MA). Housekeeping gene β-actin was chosen as an internal control and 2
-ΔΔCq
Livak Method was
used to calculate the relative expression level of TGF-β1. Primers were purchased from
Integrated DNA Technologies (Coralville, IA), and the sequences are listed in Table 1.

Table 1. Primer sequence for RT-PCR
Gene name Forward sequence Reverse sequence
Murine Actb GTACGACCAGAGGCATACAG CTGAACCCTAAGGCCAACC
Murine Tgfb1 CCGAATGTCTGACGTATTGAAGA GCGGACTACTATGCTAAAGAGG

2.8 Statistical Analysis

The results are presented as means ± SEM. Statistical significance was calculated using unpaired
Student’s t test. A p value <0.05 was identified as statistical significance.

12

3. Results

3.1 UBM Group Shows Accelerated Wounds Healing Compared with Controls

To investigate the effect of UBM biomaterial on chronic irradiated wound healing, the healing
process was tracked to 28 days. Wound photos were taken on days 0, 7, 14, 21 and 28 changing
dressing (Fig. 1B). Measurement of remaining wound size was performed and the percent of
wound present was calculated. The percent of wound areas present on days 7, 14, 21 and 28 were
65.39%±13.62%, 46.38%±8.63%, 12.61%±9.16% and 1.80%±3.81% in control group. However,
in UBM-treated group, the percent of wounds present on days 7, 14, 21 and 28 were
52.14%±10.59%, 34.28%±11.49%, 4.35%±2.31% and 0.00%±0.00%. Statistical analysis showed
at day 7 (p=0.0216), day 14 (p=0.0140) and day 21 (p=0.0393), the wound closure was
significantly accelerated in UBM-treated groups compared to controls (Fig. 1C).

13

(A)

(B)

(C)

Figure 1. Accelerated wound healing in UBM-treated group
(A) Full-thickness wounds were created on irradiated dorsal back skin. (B) Representative wound
photographs of UBM-treated group and control group on day 0, day 7, day 14, day 21 and day 28.
(C) Computerized measurements of the open wound area were performed using ImageJ and the
percent of wound present was calculated. All results represented as mean ± SEM. *P < 0.05.
14

3.2 UBM-treated Group Shows Thicker and Healthier Epidermis

In order to evaluate the effect of UBM on the quality of chronic irradiated wound healing,
Hematoxylin-Eosin (H&E) staining was performed on wound tissue harvested on days 14 and
28. H&E staining showed irradiated wounds were reorganized and re-epithelialized by day 28
(Fig 2A), which is much later than normal mouse skin wound healing. Even though both groups
finished re-epithelialization on day 28, the epidermal thickness was significantly different
(p=0.0154) in UBM-treated and control groups (Fig. 2C).

15

(A)

(B)

(C)

Figure 2. Histological analysis of UBM-treated and control wounds
(A) Representative Hematoxylin-Eosin (H&E) staining photographs of wounds of UBM-treated
group and control group on day 14 and day 28 under ×4 and ×40 magnification. (B) Zoom in view
of epidermis of two groups on day 28. (C) Epidermal thickness was measured by ImageJ, average
thickness was calculated and represented as mean ± SEM. *P < 0.05.
16

3.3 UBM Application Increased Collagen Deposition by Day 14

Collagen plays an essential role during the process of wound healing. Therefore, Sirius Red
staining was performed on wound tissues at days 14 and 28 to evaluate the deposition and
structural recovery of collagen. Collagen was stained with red. The staining showed apparent
collagen fibers (black arrows) in the UBM-treated group on day 14 (Fig 3A). On the contrary,
collagen fibers are barely visible in control group tissue samples on day 14. The semi-
quantitative analysis revealed that the UBM-treated group (5.56% ± 0.57%) displayed
significantly increased (p<0.0001) collagen deposition compared to control mice (0.78% ±
1.62%) at day 14 (Fig 3B). However, two groups showed no significant difference on day 28
(UBM-treated group 83.76% ± 7.42%; control group 82.86% ± 10.85%).

17

(A)

(B)

Figure 3. Sirius Red staining of UBM-treated and control wounds
(A) Representative Sirius Red staining of UBM-treated group and control group on day 14 and
day 28 under ×40 magnification. (B) Collagen deposition was assessed by calculating the percent
area of collagen in wound tissue. Values were represented as mean ± SEM. **P < 0.01.

18

3.4 UBM Increases Contraction Activity in Chronic Irradiated Wound Healing

It has been reported that Myofibroblasts are required for wound contraction. Alpha-smooth
muscle actin (α-SMA) expressed in mature myofibroblasts acts as stress fiber that helps the
wound contraction. Immunohistochemical (IHC) staining revealed significantly (p=0.0004)
increased α-SMA density in UBM- treated group (42.16% ± 5.24%) on day 14 compared to
control group (30.20% ± 3.91%) (Fig 4B). This finding indicated UBM may stimulate wound
healing by mediating the proliferation of fibroblasts or the differentiation of myofibroblasts. For
day 28, the wound closure was completely finished and the healing process had entered the late
stage, which is the remodeling stage. The semi-quantitative analysis showed no significant
difference between UBM-treated group (28.89% ± 4.63%) and control group (27.13% ± 1.25%)
at day 28 (Fig 4B).

19

(A)

(B)

Figure 4. Immunohistochemical staining of α-SMA of UBM-treated and control wounds
(A) Representative IHC staining of UBM-treated group and control group on day 14 and day 28
under ×40 magnification. (B) The density of α-SMA was assessed by calculating the percent of α-
SMA positive pixel in wound tissue. Data were represented as mean ± SEM. **P < 0.01.

20

3.5 UBM Increases Angiogenesis in Chronic Irradiated Wound Healing

During wound closure, a new network of blood vessels is needed in granulation tissue as it can
deliver oxygen and nutrition to newborn tissue. CD31, also known as platelet endothelial cell
adhesion molecule (PECAM-1), can be used as a biomarker to determine the presence of
endothelial cells and evaluate the degree of angiogenesis. CD31 IHC staining displayed that
wounds of UBM-treated group had a higher micro-vessel density on both day 14 (p<0.0065) and
day 28 (p=0.0166) (Fig 5B). On day 14, the blood vessels were clear in UBM-treated wounds.
However, it was difficult to find the newly formed micro-vessels in controls. On day 28, UBM-
treated wounds exhibited enhanced and well-structured blood vessels (Fig 5A). This result
indicates that UBM may improve the chronic irradiated wound healing by promoting
angiogenesis.

21

(A)

(B)

Figure 5. Immunohistochemical staining of CD31 of UBM-treated and control wounds
(A) IHC staining of wounds of UBM-treated group and control group on day 14 and day 28
under ×40 magnification. (B) Number of blood vessels under each HFP was counted and average
results were represented as mean ± SEM. *P < 0.05, **P < 0.01.
22

3.6 TGF-β1 Level is Lower in UBM Treated Group on Day 28

In the remodeling stage, the dysregulation of growth factors and cytokines resulting in radiation-
induced fibrosis. As a key factor involved in fibrotic diseases, TGF-β1 has also been reported as
a potential marker to predict the extent of radiation injury. The overexpression of TGF-β1 after
irradiation exposure causes fibrosis in the late phase of wound healing. Reverse transcription
polymerase chain reaction (RT-PCR) was performed to detect the expression level of TGF-β1 in
the two groups on day 28. The results demonstrated an extensive lower TGF-β1 expression in
UBM-treated wounds (Fig 6A). This result was further confirmed with quantitative real-time
PCR (qPCR). Statistical analysis illuminated that the relative expression level was significantly
different (p=0.0049) in two groups (Fig 6B). The UBM-treated group showed lower expression
level on day 28.

23

(A)

(B)

Figure 6. RT-PCR and qPCR of TGF-β1 on day 28.
(A) RT-PCR results of TGF-β1 (target) and β-actin (control) of UBM-treated and control wounds.
(B) Statistical analysis of qPCR results to assess the relative expression level of TGF-β1. Data
were represented as mean ± SEM. **P < 0.01.

24

3.7 Phospho-Smad3 is Less Concentrated in the UBM-treated Group on Day 28

To investigate the activity of TGFβ signaling pathway, IHC staining of phospho-Smad3 was
performed to wound samples (Fig 7A). The percent of phospho-SMAD3 positive cells of day28
were 81.25% ± 7.26% in UBM-treated group and 57.90% ± 1.59% in control group (Fig 7B).
Statistic analysis demonstrated a significant difference (p<0.0001) between two groups. The
percent of phospho-SMAD3 positive cells was lower in UBM-treated wounds, which follows the
same pattern as TGF-β1. These results implied UBM may help with the regulation of TGFβ-
1/Smad3 pathway resulting in decreased fibrosis and higher quality of wound healing in chronic
irradiated wounds.

25

(A)

(B)

Figure 7. Immunohistochemical staining of phospho-SMAD3
(A) Phospho-SMAD 3 IHC staining of wounds of UBM-treated and control groups on day 14 and
day 28 under ×40 magnification. (B) Percent of phospho-SMAD3 positive cells represented as
mean ± SEM. **P < 0.01.

26

4. Discussion

Radiation therapy is an approved treatment for many types of cancers but may lead to long-term
skin injuries to patients. Effects of radiation can be divided into two types: acute injury and
chronic injury. Early changes, including erythema, dry and wet desquamation and hair loss,
usually occur right after treatment and can self-recover within four weeks [2,3]. However, long-
term side effects could result in permanent injury that suffers patients. Chronic irradiated wounds
that resist healing has been a common clinical problem. Existing treatments to this type of
wounds are expensive and limited. Previous studies have shown that applying extracellular
matrix (ECM) stimulates wound closure and cell growth in many clinical cases and in animal
models [7-10]. In light of this promising preceding work, we developed a mouse chronic
irradiated wound model to investigate whether Urinary Bladder Matrix (UBM), an extracellular
matrix derived from porcine urinary bladder, can be beneficial in shortening the healing time of
chronic wounds post-radiation as well as in improving the quality of wound healing.

Over 28 days observation, our data shows that topical application of the UBM biomaterial can
increase the speed of chronic irradiated wound healing. The histological staining result suggests
that mice in UBM-treated group form a thicker and complete epidermis on day 28, which is the
remodeling phase. This epidermal thickness difference in UBM-treated and control groups may
be caused by the different expression level of three keratin pairs: KRT16/17-KRT6, KRT10-
27

KRT1 and KRT14-KRT5 [24-26]. In the healing process, KRT16/17-KRT6 are induced at the
suprabasal layers of the epidermis and enhance epithelialization. This induction occurs at the
expense of KRT10-KRT1 [24]. However, in irradiated mouse skin tissue, KRT10 expression was
deficient. There might be a shift from KRT10 to KRT14 in irradiated keratinocytes, which seems
to be an impairment of wound healing [25,26]. Further studies are needed to verify this
hypothesis.

In addition, infection has been proved as one of the side effects of radiation therapy which brings
great suffering to patients [27]. In our mouse model, on day 7, control group had 4 out of 10
mice got infection; in contrast, UBM-treated group only had 1 out of 11 got infection. This lower
infection rate suggests that UBM may have the ability to build a physical barrier to reduce the
opportunity for bacteria to infect wounds.

In the process of wound healing, extracellular matrix (ECM) alternation resulting from
irradiation decreases the healing ability of irradiated chronic wounds. As a main component of
ECM, collagen, created by fibroblasts, plays a key role in each stage of wound healing. It acts as
a scaffold in dermis to support and mediate cell proliferation, migration and differentiation
[28,29]. Previous study observed the destruction and disruption in the structure of collagen fibrils
24 hours after irradiation treatment in mouse skin [30]. Additionally, the strength of collagen
decreases significantly as well [4, 31]. In this study, we found that the UBM-treated group shows
28

an increased collagen deposition by day 14, which suggests UBM may assist in irradiated wound
healing by mediating collagen formation. However, species specific IHC staining is needed to
confirm that the collagen fibers are self-synthesized rather than degraded from the UBM
material.

Wound healing during the proliferation stage can be divided into two categories based on the
direction of wound closure: granulation and contraction. These two actions happen
simultaneously. The wound healing process in mice is dominated by myofibroblast-mediated
contraction. However, in human skin, wounds close mainly through granulation and re-
epithelization [32]. Wound contraction takes place horizontally and is mainly mediated by
myofibroblasts differentiated from fibroblast [33]. The α-smooth muscle actin (α-SMA) in
myofibroblasts creates a force to contract the edge of wounds, thus closing the open wound. This
process is impacted by irradiation as seen in permanent damage to fibroblasts as well as a
decrease of the abundance and contractility of myofibroblasts [33]. Our data demonstrates that
the UBM-treated group shows an increased α-SMA density during early stage (day 14) of wound
healing. This suggests that UBM may accelerate wound healing by promoting the proliferation of
fibroblasts and regulating the differentiation of myofibroblasts. Granulation involves healing
along the vertical wound axis. With the nutrient and oxygen support from the blood vessel
network, the granulation tissue grows from the base of the wound and slowly fills the wound
bed. However, this process is also impacted by irradiation, which causes microvascular damage
29

[34]. The destruction of nutrients delivering blood vessels and local tissue hypoxia results in
delayed wound healing in irradiated skin [4, 34]. Our IHC staining displays an increased
angiogenesis in UBM-treated groups, which suggests UBM may improve wound healing by
promoting vascularization and local nutrition and oxygen supply in granulation tissue.
Among the chronic injuries, radiation-induced fibrosis has shown as prevailing in clinic [35,36].
Radiation-induced fibrosis is a compound process that involves many cellular and molecular
dysregulations that are also seen in other fibrotic diseases [37]. TGF β-1 has shown a key role in
fibroproliferative diseases as well as a potential marker to predict the extent of radiation-induced
fibrosis [31, 39]. TGFβ-1 acts as a mediator to regulate the extracellular matrix remodeling in the
late phase of wound healing. Overexpression of TGFβ-1 and its transducer Smad3 after
irradiation have been previously detected [31], which leads to keloid and fibrosis. Our results
demonstrate that the expression levels of TGFβ-1 and phospho-Smad3 are significantly lower in
UBM-treated groups. This indicates UBM may help with the regulation of TGFβ-1/Smad3
pathway resulting in decreased fibrosis in chronic irradiated wounds.

In conclusion, this short-term mouse study highlights UBM as a more cost-effective and easily
applicable treatment option for irradiated chronic wound healing. It can improve the quality of
chronic irradiated wound healing by increasing collagen deposition, presence of myofibroblasts,
and stimulating angiogenesis. In addition, UBM may reduce fibrosis through the TGF-β1/ Smad3
signaling pathway.

30

5. Future Experiments

On day 7 we noted different infection rates between two groups. However, due to the mouse
quantity limitation, we were not able to get skin samples on day 7. IHC staining for neutrophils,
macrophages, T cells and B cells on day 14 showed no significant difference between two groups
(data not shown). Therefore, repeat animal experiments to get earlier time points of wound
samples may be necessary to assess the effect of UBM to the inflammation phase. Additionally,
we focused solely on the use of UBM as a treatment. Exploration of other ECM materials in
chronic irradiated wounds may be useful for future comparisons.

31

References

1. Gieringer M, Gosepath J, Naim R. Radiotherapy and wound healing: Principles, management
and prospects (review). Oncol Rep. 2011;26(2):299.

2. Brown KR, M.D., Rzucidlo E, M.D. Acute and chronic radiation injury. J Vasc Surg.
2011;53(1):15S-21S.

3. Berkey FJ, D.O. Managing the adverse effects of radiation therapy. Am Fam Physician.
2010;82(4):381-388.

4. Jacobson LK, Johnson MB, Dedhia RD, Niknam-Bienia S, Wong AK. Impaired wound healing
after radiation therapy: A systematic review of pathogenesis and treatment. JPRAS Open.
2017;13:92-105.

5. Singh D, Chopra K, Sabino J, Brown E. Practical things you should know about wound healing
and vacuum-assisted closure management. Plast Reconstr Surg. 2020;145(4):839e-854e.

6. Haubner F, Ohmann E, Pohl F, Strutz J, Gassner HG. Wound healing after radiation therapy:
Review of the literature. Radiation oncology (London, England); Radiat Oncol. 2012;7(1):162.

7. Rommer EA, Peric M, Wong A. Urinary bladder matrix for the treatment of recalcitrant
nonhealing radiation wounds. Adv Skin Wound Care. 2013;26(10):450-455.

8. Yue B. Biology of the extracellular matrix: An overview. J Glaucoma. 2014;23 Proceedings of
the 20th Annual Think Tank: “Exfoliation Syndrome: What We Know and Where We Need To Go”
September 19-21, 2013 New York, NY Sponsored by The Glaucoma Foundation (TGF)(8):S20-
S23.

9. Kimmel H, D.P.M., Rahn M, D.P.M., Gilbert TW, PhD. The clinical effectiveness in wound
healing with extracellular matrix derived from porcine urinary bladder matrix: A case series on
severe chronic wounds. Journal of the American College of Certified Wound Specialists, The; J
Am Col Certif Wound Spec. 2010;2(3):55-59.

10. Londono R, Gorantla VS, Badylak SF. Emerging implications for extracellular matrix-based
technologies in vascularized composite allotransplantation. Stem Cells International; Stem Cells
Int. 2015;2016:1541823-16.

11. Kruper GJ, VandeGriend ZP, Lin H, Zuliani GF. Salvage of failed local and regional flaps with
porcine urinary bladder extracellular matrix aided tissue regeneration. Case Reports in
32

Otolaryngology; Case Rep Otolaryngol. 2013;2013:917183-5.

12. Puckett Y , Pham T, McReynolds S, Ronaghan CA. Porcine urinary bladder matrix for
management of infected radiation mastectomy wound. Cureus; Cureus. 2017;9(7):e1451.

13. Reinke JM, Sorg H. Wound repair and regeneration. Eur Surg Res. 2012;49(1):35-43.

14. Olczyk P, Mencner Ł, Komosinska-Vassev K. The role of the extracellular matrix components
in cutaneous wound healing. BioMed Research International; Biomed Res Int. 2014;2014:747584-
8.

15. Werner S, Barrandon Y , Longaker MT, Gurtner GC. Wound repair and regeneration. Nature.
2008;453(7193):314-321.

16. Greenhalgh DG. Wound healing. In: Greenhalgh DG, ed. Burn care for general surgeons and
general practitioners. Cham: Springer International Publishing; 2016:95-116.

17. Tsumano T, Kawai K, Ishise H, et al. A new mouse model of impaired wound healing after
irradiation. Journal of Plastic Surgery and Hand Surgery; J Plast Surg Hand Surg. 2013;47(2):83-
88.

18. Kim JH, Kolozsvary AJJ, Jenrow KA, Brown SL. Mechanisms of radiation-induced skin injury
and implications for future clinical trials. Int J Radiat Biol. 2013;89(5):311-318.

19. Ahmed EA, Agay D, Schrock G, Drouet M, Meineke V , Scherthan H. Persistent DNA damage
after high dose in vivo gamma exposure of minipig skin. PloS one; PLoS One. 2012;7(6):e39521.

20. Rudolph R, Vande Berg J, Schneider JA, Fisher JC, Poolman WL. Slowed growth of cultured
fibroblasts from human radiation wounds. Plast Reconstr Surg. 1988;82(4):669-675.

21. Iyer S, Balasubramanian D. Management of radiation wounds. Indian Journal of Plastic
Surgery; Indian J Plast Surg. 2012;45(2):325-331.

22. Herskind C, Bamberg M, Rodemann HP. The role of cytokines in the development of normal-
tissue reactions after radiotherapy. Strahlenther Onkol. 1998;174 Suppl 3:12.

23. Falanga V . The chronic wound: Impaired healing and solutions in the context of wound bed
preparation. Blood Cells Mol Dis. 2004;32(1):88-94.

24. Zhang X, Yin M, Zhang L. Keratin 6, 16 and 17-critical barrier alarmin molecules in skin
wounds and psoriasis. Cells; Cells. 2019;8(8):807.
33

25. Lee J, Jang H, Park S, et al. Platelet-rich plasma activates AKT signaling to promote wound
healing in a mouse model of radiation-induced skin injury. Journal of translational medicine; J
Transl Med. 2019;17(1):295.

26. Miyake T, Shimada M, Matsumoto Y , Okino A. DNA damage response after ionizing radiation
exposure in skin keratinocytes derived from human-induced pluripotent stem cells. Int J Radiat
Oncol Biol Phys. 2019;105(1):193-205.

27. Micallef CJ, Johnson JN, Johnson RM. A value analysis of microsurgical lower extremity
reconstruction vs. acellular urinary bladder matrix (UBM) for radiation wounds of the lower
extremity. Journal of Surgical Case Reports; J Surg Case Rep. 2019;2019(3):rjz051.

28. Chattopadhyay S, Raines RT, Glick GD. Review collagen‐based biomaterials for wound
healing. Biopolymers. 2014;101(8):821-833.

29. Brett D. A review of collagen and collagen-based wound dressings. Wounds : a compendium
of clinical research and practice; Wounds. 2008;20(12):347.

30. Maslennikova A, Kochueva M, Ignatieva N, et al. Effects of gamma irradiation on collagen
damage and remodeling. Int J Radiat Biol. 2015;91(3):240-247.

31. Johnson MB, Pang B, Gardner DJ, et al. Topical fibronectin improves wound healing of
irradiated skin. Scientific reports; Sci Rep. 2017;7(1):3876-10.

32. Grada A, Mervis J, Falanga V . Research techniques made simple: Animal models of wound
healing. J Invest Dermatol. 2018;138(10):2095-2105.e1.

33. Darby IA, Laverdet B, Bonté F, Desmoulière A. Fibroblasts and myofibroblasts in wound
healing. Clinical, cosmetic and investigational dermatology; Clin Cosmet Investig Dermatol.
2014;7:301-311.

34. Nivet A, Schlienger M, Clavère P, Huguet F. Effects of high-dose irradiation on vascularization:
Physiopathology and clinical consequences. Cancer Radiother. 2019;23(2):161.

35. Bentzen SM. Preventing or reducing late side effects of radiation therapy: Radiobiology meets
molecular pathology. Nature Reviews Cancer; Nat Rev Cancer. 2006;6(9):702-713.

36. Stone HB, Coleman CN, Anscher MS, McBride WH. Effects of radiation on normal tissue:
Consequences and mechanisms. The Lancet Oncology; Lancet Oncol. 2003;4(9):529-536.

34

37. Ejaz A, Greenberger JS, Rubin PJ. Understanding the mechanism of radiation induced fibrosis
and therapy options. Pharmacol Ther. 2019;204:107399.

38. Fleckenstein K, M.D., Gauter-Fleckenstein B, Jackson IL, B.S., Rabbani Z, M.D., Anscher M,
M.D., Vujaskovic, Zeljko,M.D., PhD. Using biological markers to predict risk of radiation injury.
Semin Radiat Oncol. 2007;17(2):89-98.

Abstract (if available)

Abstract Radiation therapy is currently a major modality in cancer treatment and is part of the treatment regimen of half of all patients diagnosed with cancer. In addition to radiation therapy, cancer patients often undergo surgical procedures. The resulting soft tissue injury post-radiation can result in fibrosis and necrosis, which leads to delayed wound healing. Current strategies in treating such chronic wounds are very limited. Thus, our focus is on finding novel treatments to improve the outcome of chronic wounds generated from irradiation. Previous studies have shown that applying extracellular matrix (ECM) derivatives stimulates wound closure and cell growth in many clinical cases and in animal models. In light of this promising preceding work, the aim of my study is to investigate whether Urinary Bladder Matrix (UBM), an extracellular matrix derived from porcine urinary bladder, can be beneficial in shortening the healing time of chronic wounds post-radiation as well as in improving the quality of wound healing. In this study, we found that porcine-derived urinary bladder matrix accelerates chronic wound healing after radiation exposure. It can improve the quality of chronic irradiated wound healing by increasing collagen deposition, presence of myofibroblasts, and stimulating angiogenesis. In addition, UBM may reduce fibrosis through the TGF-β1/ Smad3 signaling pathway. Therefore, UBM may be a cost-effective and easily applicable treatment option for irradiated chronic wound healing.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Extracellular Hsp90α in diabetic wound healing: structure, function, and mechanism of action

PDF

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

PDF

Mechanisms of human skin cell migration and wound healing

PDF

Regulation of matrix metalloproteinase-9 in cutaneous wound healing

PDF

Characterization of a fragment in secreted Hsp90α with potential therapeutic benefits in wound healing and cancer

PDF

Topical adipose-derived stem cell therapy ameliorates radiation-induced delayed wound healing

PDF

The role of secreted Hsp90α in tissue repair and cancer

PDF

The roles of type VII collagen in wound healing and scar reduction

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

Examination of the effect of the ecPlexin-B1 on MDA-MB-231 cells

PDF

Investigating the role of cardiac fibroblasts in modulating angiogenesis during heart injury

PDF

The role of Hedgehog signaling in Sox9 expressing progenitors during large scale bone repair

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Effects of chromatin regulators during carcinogenesis

PDF

Examination of the effect of oleandrin on head and neck cancer cells

PDF

Expression of recombinant hepatitis B virus e antigen and analysis of its effect on macrophages

PDF

The effect of cytomegalovirus on gene expression of pediatric acute lymphoblastic leukemia

PDF

Targeting glioma cancer stem cells for the treatment of glioblastoma multiforme

PDF

The differential effects of selective COX-2 inhibitors on cell proliferation and induced ER stress in glioblastoma and pancreatic carcinoma cell lines

PDF

Cytotoxic effect of NEO212, a novel perillyl alcohol-temozolomide conjugate, on canine lymphoma

Asset Metadata

Creator Yao, Jingxin (author)

Core Title The effect of urinary bladder matrix on irradiated wound healing

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 08/02/2020

Defense Date 05/19/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag animal model,Mice,OAI-PMH Harvest,Radiation,urinary bladder matrix,wound healing

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Wong, Alex K. (committee chair), Frenkel, Baruch (committee member), Hong, Young-Kwon (committee member), Li, Wei (committee member)

Creator Email jingxinyao77@gmail.com,yaojingx@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-354442

Unique identifier UC11666504

Identifier etd-YaoJingxin-8859.pdf (filename),usctheses-c89-354442 (legacy record id)

Legacy Identifier etd-YaoJingxin-8859.pdf

Dmrecord 354442

Document Type Thesis

Rights Yao, Jingxin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA