University of Southern California Dissertations and Theses

A small molecule protease inhibitor induces senescence phenotypes that are reversible upon drug removal

(USC Thesis Other)

A small molecule protease inhibitor induces senescence phenotypes that are reversible upon drug removal

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i

A SMALL MOLECULE PROTEASE INHIBITOR INDUCES SENESCENCE PHENOTYPES
THAT ARE REVERSIBLE UPON DRUG REMOVAL

by
Chisaka Kuehnemann

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
BIOLOGY OF AGING

December 2020

Copyright 2020 Chisaka Kuehnemann

ii

ACKNOWLEDGEMENTS

It is an honor to be among the early intakes for the USC-Buck Biology of Aging PhD
program. Working at Buck before the PhD, I immediately saw value in combining such a
premier research university with a prominent center studying age-related diseases. I jumped at
the opportunity.
My expectations were exceeded. Since my first semester in downtown LA I have
experienced the collaborative nature of the program and benefits of this partnership. I was
welcomed by Dr. Pinchas Cohen and brought into his lab for my first rotation. Hassy was ever
inquisitive and optimistic; he showed me a mindset and approach for a durable career in the
sciences. During that time, I was lucky enough to be paired with a senior postdoctoral fellow in
his lab, Su-Jeong Kim; her insight and work ethic modeled good behavior and showed me the
elevated quality that I’d need to produce. All the while during this time, being on back on
campus strengthened my theoretical foundations in research methods and ensured a strong
platform to complete the program.
Upon returning to Northern California, I settled back home into the Campisi Lab and the
camaraderie that has been cultivated in the lab. Dr. Pierre Yves Desprez was ever and always
keeping me focused on the goal: I’d like to thank him for the tireless editorial reviews and
research checkpoints. As a scientist and sommelier, he delivered the most memorable adage of
the program, “Sometimes when you stress the vine; it delivers the best fruit.” Dr. Chris Wiley
was a mentor whose jovial partnership usually helped relieve some of that stress. His passion for
senescence, and science, is overflowing – even from his desk! He was probably my most trusted
and frequent collaborator.
iii

My other mentors have been similarly giving with their time and advice. Dr. Birgit
Schilling introduced me to new research methods and tools I wouldn’t have known otherwise;
she was always supportive and precise in her dedication to breakthrough science. Dr. Gordon
Lithgow has acted as the program’s and student’s primary champion as he helped me navigate
the sometimes-overwhelming experience of being a PhD student.
It’s noteworthy that I’ve benefited from and contributed to work which had generated
four papers – from four labs, one each from my four mentors across the USC-Buck partnership.
This illustrates the collaborative spirit and sense of purpose felt between the labs, the students,
and the locations, to jointly address the diseases of aging.
As per the respect given in our tradition of last authorship, this space is reserved for Dr.
Judith Campisi. My six years in Judy’s lab is a stroke of good fortune I couldn’t have imagined.
Judy nourished my potential since before the PhD, encouraging me to apply, and acting as a
brilliant, energetic, tireless guide. I learned from her through observation, osmosis, discussion
and direction. There are reasons that Judy's name is on the family tree of senescence, and I hope
to make her proud with my work over the years.

iv

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ............................................................................................................ ii
LIST OF TABLES .......................................................................................................................... v
LIST OF FIGURES ....................................................................................................................... vi
ABBREVIATIONS ...................................................................................................................... vii
ABSTRACT ................................................................................................................................. viii
CHAPTER 1: INTRODUCTION ................................................................................................... 1
1.1. Long term HIV-infection is associated with premature aging ............................................. 1
1.2. Antiretroviral therapy (ART) and premature aging ............................................................. 3
1.3. HIV protease inhibitors appear to drive premature aging phenotypes ................................. 5
1.4. Cellular Senescence.............................................................................................................. 8
1.5. Cellular senescence as a driver of HIV PI-induced premature aging phenotypes ............. 13
1.6. HIV PIs induce a senescent phenotype that is reversible upon cessation of treatment ...... 15
CHAPTER 2: RESULTS .............................................................................................................. 17
2.1. Nucleotide reverse transcriptase inhibitors induce senescence phenotypes ....................... 17
2.2. The Protease Inhibitor Atazanavir induces cellular senescence in cultured cells .............. 21
2.3. The Atazanavir-induced SASP contains aging and disease biomarkers ............................ 26
2.4. ATV/r treated cells undergo a p53-dependent growth arrest ............................................. 32
2.5. Eliminating senescent cells could improve senescence phenotypes .................................. 35
2.6. Mice administered Atazanavir boosted with Ritonavir (ATV/r) show accelerated aging
phenotypes ................................................................................................................................. 36
2.7. Senescent cells appear at sites of atazanavir-induced pathology ....................................... 39
2.8. Cessation of ATV/r treatment reverses senescence phenotypes ........................................ 42
CHAPTER 3: DISCUSSION ........................................................................................................ 49
CHAPTER 4: MATERIALS AND METHODS .......................................................................... 55
BIBLIOGRAPHY ......................................................................................................................... 62

v

LIST OF TABLES

Table 1. ART drug classes implicated in the accelerated aging phenotypes seen with HIV-
infection. ............................................................................................................................ 5
Table 2. Gene Ontology Enrichment. ........................................................................................... 30
Table 3. Top Pathways. ................................................................................................................. 31
Table 4. Human Oligonucleotides ................................................................................................ 56
Table 5. Mouse Oligonucleotides ................................................................................................. 57

vi

LIST OF FIGURES

Figure 1. Epidemiology of aging in people living with HIV .......................................................... 3
Figure 2. Characteristics of a Senescent cell. ............................................................................... 10
Figure 3. The senescence growth arrest is established and maintained by two major pathways:
the p53/p21 pathway, and the p16/pRB pathway. ......................................................... 11
Figure 4. The damaging effects of HIV protease inhibitors occur through the accumulation of
senescent cells. ............................................................................................................... 13
Figure 5.Nucleotide reverse transcriptase inhibitors induce senescence. ..................................... 19
Figure 6. NRTI treatments induce senescence in tissues that show premature aging phenotypes.
........................................................................................................................................ 20
Figure 7. The senolytic ABT-263 selectively eliminates NRTI-induced senescent cells............. 35
Figure 8. The HIV PI Atazanavir induces senescence in cultured cells. ...................................... 23
Figure 9. The HIV PI Darunavir does not induce senescence in cultured cells. ........................... 25
Figure 10. Summary of changes in SASP factors between ATV/r-induced senescent cells
compared to non-senescent control cells. ................................................................... 28
Figure 11. Pathways and core networks. ...................................................................................... 32
Figure 12. ATV/r treated cells undergo a p53-dependent growth arrest. ..................................... 34
Figure 13. ATV/r treatment accelerates aging phenotypes. .......................................................... 38
Figure 14. ATV/r-treated mice accumulate senescent cells at sites of age-related pathologies. .. 41
Figure 15. Removal of ATV/r from cells in culture reverses senescence phenotypes. ................ 43
Figure 16. Removal of ATV/r from cells in culture reverses senescence phenotypes. ................ 44
Figure 17. Cessation of treatment improves age-related phenotypes and pathology in mice. ...... 48

vii

ABBREVIATIONS

3MR, trimodal reporter; ART, antiretroviral therapy; ATV/r, atazanavir/ritonavir; AZT,
Zidovudine; CDKI, cyclin-dependent kinase inhibitor; CXCL, chemokine C-X-C motif ligand;
d4T, Stavudine; DAMP, damage-associated molecular pattern; DDA, data-dependent
acquisition; DDR, DNA damage response; DIA, data-independent acquisition; DRN/r,
darunavir/ritonavir; ECG, echocardiography; ECM, extracellular matrix; FACS, fluorescence-
assisted cell sorting; FBS, fetal bovine serum; FTC, Emtricitabine; GCV, ganciclovir; GDF15,
Growth/differentiation factor 15; GSE22, Genetic Selector Element 22; HAART, highly active
antiretroviral therapy; HIV, human immunodeficiency virus; HMGB1, high mobility group box
1; HSV, herpes simplex virus; IGFBP, insulin-like growth factor binding protein; IL,
interleukin; IL-1R, IL-1 receptor; IL-6, interleukin 6; IR, X-irradiation; LAMB1, laminin
subunit beta-1; LMNB1, lamin B1; LUC, luciferase; microCT, micro-computed tomography;
MiDAS, mitochondrial dysfunction-associated senescence; MMP, matrix metalloproteinase;
MS2, tandem mass spectrometry; mtDNA, mitochondrial DNA; NRTI, nucleotide reverse
transcriptase inhibitor; p16, p16
INK4A
; p21, p21
WAF1/Cip1
; PI, protease inhibitor; POLG,
polymerase γ; qRT-PCR, quantitative real-time PCR; mRFP, monomeric red fluorescent
protein; RAS, RAS oncogene overexpression; ROS, reactive oxygen species; SA-β-Gal,
senescence-associated β-galactosidase; SASP, senescence-associated secretory phenotype;
SERPIN, serine protease inhibitors; SERPINE1, plasminogen activator inhibitor 1; STC1,
stanniocalcin 1; TDF, Tenofovir disoproxil fumarate TIMP, tissue inhibitor of metallopeptidase;
TK, thymidine kinase; TP53, tumor protein p53; VEGF, vascular endothelial growth factor

viii

ABSTRACT

Aging generates a myriad of phenotypes and pathologies that impair tissue homeostasis
and function. Despite progress in understanding the genetic and molecular processes that drive
aging, there remain large gaps in our knowledge. One approach to gaining deeper insights into
the causes and consequences of aging is to study genetic and environmental conditions that
accelerate the process.
Antiretroviral drugs have dramatically improved the prognosis of HIV-infected patients,
with strikingly reduced morbidity and mortality. However, long-term use is now associated with
multiple signs of premature aging, including lipodystrophy, osteoporosis, type 2 diabetes,
cardiovascular disease and cancer. Highly active antiretroviral therapy (HAART) generally
comprises two nucleoside reverse transcriptase inhibitors (NRTIs) with one of three additional
antiretroviral drug classes, which include protease inhibitors (PIs). These two component drug
classes are implicated in the premature aging effects seen in patients. The NRTIs can inhibit the
mammalian mitochondrial DNA polymerase (polymerase gamma; POLG) and thereby deplete
mitochondrial DNA, resulting in mitochondrial dysfunction, and the PIs have been shown to
impair maturation of the major nuclear protein lamin A (LMNA) by inhibiting activity of the
mammalian protease ZMPSTE24. ZMPSTE24 processes the major nuclear protein prelamin A
into lamin A (LMNA), defects in which cause the human premature aging disorder Hutchinson-
Gilford progeria syndrome (HGPS). Children with HGPS accumulate a mutant form of LMNA
termed progerin. They die in the second decade of life, primarily of cardiovascular disease, but
also suffer from lipodystrophy, type 2 diabetes and bone and skin fragility.
One commonality between mitochondrial dysfunction (NRTIs) and LMNA defects (PIs)
is that they can cause or accelerate cellular senescence. Senescent cells irreversibly lose their
ix

ability to proliferate and adopt a senescence-associated secretory phenotype (SASP) that includes
numerous pro-inflammatory molecules. Senescent cells accumulate with age and contribute to a
multitude of aging phenotypes. This can happen in two ways. First, the cellular arrest can prevent
senescent progenitor cells from repopulating a tissue. Second, the senescence-associated
secretory phenotype (SASP) can have potent effects on local tissues. Importantly, eliminating
senescent cells in adult mice alleviates several aging phenotypes and pathologies including
sarcopenia, osteoporosis, age-related losses of skin integrity, and loss of cardiovascular function.
Although highly correlated, it has not been determined that senescent cells promote age-related
conditions associated with ART.
Here, I hypothesize that senescent cells increase following treatment with certain HIV
therapies, which in turn drives age-related phenotypes and pathologies in patients. I compare the
effects of two chemically distinct HIV PIs; ritonavir-boosted atazanavir/ritonavir (ATV/r) and
darunavir/ritonavir (DRNr), used in combination treatments for HIV infection in adults and
children. In parallel, I examine the NRTIs emtricitabine/tenofovir disoproxil fumarate
(FTC/TDF), used as pre-exposure prophylaxis (PrEP) to reduce the risk of contracting HIV in
HIV-negative individuals. I characterize the senescent phenotypes and the SASPs that result
from inhibition of ZMPSTE24 function by PIs, and from inhibition of POLG by NRTIs,
comparing the responses of several relevant human and mouse cell types in culture, and mice in
vivo.
With FTC/TDF and ATV/r, but not DRN/r, cells arrested growth and displayed multiple
features of senescence, i.e., cells exhibited a flat morphology, upregulated senescence associated
β-galactosidase (SA-β-gal) activity, showed an increase in the expression of the tumor
suppressors p16INK4a/p21waf1, and a decrease in LMNB1. Cells also exhibited a loss of
x

nuclear high mobility group B1 (HMGB1) and expressed significantly upregulated levels of the
SASP factors known to promote inflammation. To characterize novel SASP factors associated
with PI-induced senescence, unbiased mass spectrometry and data-independent acquisitions was
performed for a comprehensive analysis of the resultant SASP. GDF15, MMP1, SERPINE1, and
other known SASP factors and biomarkers of aging, cardiovascular and neurodegenerative
diseases were elevated in the PI-induced SASP.
Unique to ATV/r, removing treatment reversed all the senescent phenotypes. Despite
initially expressing classical markers of senescence, cells resumed proliferation and lost markers
of senescence. This suggests that ATV/r induces a growth arrest, with many features of
senescence, that is reversible upon the removal of the drug. This was further observed in studies
using mice to identify the phenotypes and pathologies driven specifically by ATV/r. Mice
receiving sustained ATV/r treatment duly showed increased senescence phenotypes and deficits
in functional assays, including decreased heart function. When ATR/r was removed, there was a
reversal of aging features. The mice regained heart function and more closely resembled
phenotypes of vehicle-treated control mice.
The disappearance of aging phenotypes after the removal of ATV/r is a significant
finding that has direct applications to HIV patients, and broad applications to aging in general.
For patients suffering the toxic side effects of PI drugs like ATV/r, intermittent treatment
regimens designed to cycle between periods of drug usage and cessation might provide a novel
strategy for reducing atazanavir induced premature aging phenotypes. The link between HIV PIs,
LMNA defects and cellular senescence also offers an intriguing line of inquiry. Might
senescence reversion also restore functional properties of cells? Is there the possibility of
restoring a healthy nuclear lamina? For progeria patients, this might result in potentially
xi

promising clinical interventions. Overall, this changes the paradigm on the irreversibility of
senescence without persistent DNA damage, and has implications for the biology of aging in that
it hints at the potential reversibility of some aspects of aging in humans.
1

CHAPTER 1: INTRODUCTION

Aging is a major risk factor for the development of many chronic diseases. It is
characterized by a loss of physical integrity, leading to a progressive decline in cellular and
tissue function over time. This results in dysfunction to organs of various systems including the
circulatory, muscular, renal, skeletal, and nervous systems, and an increased risk for the
development of several diseases associated with these systems, such as atherosclerosis and heart
failure, sarcopenia, renal failure, osteoporosis, and neurodegenerative diseases such as
Alzheimer’s and Parkinson’s diseases (Campisi, 2013). The multiplicity of these diseases, and
their co-morbidity over time, suggests that some basic biological processes might underlie age-
related pathologies. One way to identify these processes is to study conditions that accelerate
aging phenotypes and pathologies. In humans, this approach is afforded by the unexpected side
effects of treatments for two life threatening diseases: genotoxic anti-cancer therapies and anti-
retroviral therapies (ART) to treat HIV-AIDS. The latter is understudied, despite its rising
clinical importance and potential for uncovering new mechanisms of aging. Here, I examine a
causal connection between ART and premature aging phenotypes seen with patients, driven by a
common hallmark of aging – cellular senescence.

1.1. Long term HIV-infection is associated with premature aging
Treatment for HIV has resulted in HIV RNA decreases and CD4 T lymphocyte (CD4)
cell increases in most patients (Office of AIDS Research Advisory Council, 2019). This has
significantly improved the prognosis of infected patients and successfully reduced the morbidity
and mortality associated with HIV infection. Even so, many individuals infected with HIV now
appear in the clinic with conditions that collectively resemble aging. Conditions associated with
2

treated HIV patients include lipodystrophy, osteoporosis, type 2 diabetes, cardiovascular disease,
neurodegenerative disease and cancer (Smith, de Boer, Brul, Budovskaya, & van Spek, 2013).
A key feature of long term HIV-infection is immune activation with low-grade chronic
and systemic inflammation, termed inflammaging (Franceschi & Campisi, 2014). Patients
express increased levels of the inflammatory biomarkers including interleukin-6 (IL-6) and C-
reactive protein, characteristic of more elderly people (Fitch, Feldpausch, & Looby, 2017). In
addition to inflammatory biomarkers, other age-related biological mechanisms increased in
patients have included type I interferon responses, monocyte activation and coagulation (Hunt,
2012) (Zicari, et al., 2019). These increased immune responses can contribute to the
pathogenesis of age-related diseases.
Clinical studies also show that HIV-infected patients have a 10-year shorter life
expectancy relative to those without infection (Lohse, et al., 2007) (The Antiretroviral Therapy
Cohort Collaboration, 2008), and an 8-year shorter life expectancy with access to healthcare and
timely initiation of ART (Marcus, et al., 2016).
Several factors in HIV patients might influence their lifespan and susceptibility to chronic
diseases. Low level viral replication, toxic side effects of ART medications and/or chronic
immune activation, have all been implicated as contributing factors to the observed aging
pathologies (Pathai, Bajillan, Landay, & High, 2014). The individual influence of ART on
disease susceptibility has been difficult to parse out given that these drugs are essential to
improve patients’ survival in the long term, and uninfected individuals have not taken ART
drugs until recently (with the introduction of pre-exposure prophylaxis (PrEP)). However, data
from mouse and cell culture models of ART treatment suggest that these drugs might accelerate
the aging process.
3

1.2. Antiretroviral therapy (ART) and premature aging
Increased access to antiretroviral medication around the world has increased survival in
HIV-infected patients, with a 39% decline in AIDS-related deaths since 2010. In 2019, 38.0
million people worldwide were living with HIV. Of these, 67% were accessing treatment, and
most had undetectable levels of the virus (UNAIDS, 2020). In a paradox, long term antiretroviral
use has been associated with serious side effects resembling premature and accelerated aging,
resulting in reduced lifespans for HIV-infected patients receiving ART when compared to
uninfected individuals (Lohse, et al., 2007).

Figure 1. Epidemiology of aging in people living with HIV
Source data: HIV Surveillance Report, 2018 (Updated); vol. 31. It is estimated that 51% of those
on ART medication are over the age 50 (Centers for Disease Control and Prevention, 2020).
With the advancing age of the HIV infected population, and increased risk for chronic diseases,
the adverse effects of ART are poised to become a greater public health issue (Guaraldi, et al.,
2013).

4

Antiretroviral guidelines set by the U.S. Department of Health and Human Services for
the treatment of HIV infection in adults and adolescents recommend highly active antiretroviral
therapy (HAART) for the treatment of HIV infection. A HAART regimen is generally a
combination of two nucleoside reverse transcriptase inhibitors (NRTIs) with a third inhibitor
from one of three antiretroviral drug classes including an integrase strand transfer inhibitor, a
nonnucleoside reverse transcriptase inhibitor (NNRTI), or a protease inhibitor (PI) (Schafer &
Vuitton, 1999 Mar). This clinical approach suppresses HIV and prevents the development and
transmission of AIDS. Accumulating evidence from cell culture and mouse models of ART
treatment implicate two ART drug classes in the pro-aging side effects of ART; the NRTIs and
the PIs.
Nucleotide reverse transcriptase inhibitors (NRTIs), can inhibit the mammalian
mitochondrial DNA polymerase gamma (POLG) responsible for mitochondrial DNA (mtDNA)
synthesis and thus lead to a depletion of mitochondrial DNA, resulting in mitochondrial
dysfunction (Apostolova, Blas-Garcia, & Esplugues, 2011). NRTIs such as zidovudine,
stavudine and tenofovir may accelerate aging by inducing a state of mitochondrial dysfunction in
otherwise healthy cells (Caron, Auclairt, Vissian, Vigouroux, & Capeau, 2008). Less studied in
the context of accelerating aging, and the major focus of my dissertation, are PIs.
Protease inhibitors (PIs), such as lopinavir, atazanavir and ritonavir, can inhibit the
activity of the mammalian protease ZMPSTE24 (Coffinier, et al., 2007) (Coffinier, et al., 2008).
ZMPSTE24 processes the major nuclear protein lamin A (LMNA), defects in which cause the
rare human premature aging disorder Hutchinson-Gilford progeria syndrome (HGPS/Progeria).
Children with Progeria accumulate a mutant form of LMNA termed progerin, and die in the
second decade of life, primarily of cardiovascular disease, but also suffer from lipodystrophy,
5

type 2 diabetes and bone and skin fragility (Caron, et al., 2007) (Maraldi, Capanni, Cenni, Fini,
& Lattanzi, 2011) (Olive, et al., 2010) (Scaffidi & Misteli, 2006). It is notable that normal non-
HGPS individuals also produce progerin, which increases in multiple tissues throughout life
albeit at a much slower rate (Olive, et al., 2010) (Scaffidi & Misteli, 2006). This has relevance in
that one or more basic pro-aging processes may be accelerated by PIs possibly acting on similar
molecular pathways as in natural aging processes.

Table 1. ART drug classes implicated in the accelerated aging phenotypes seen with HIV-
infection.
NRTI mediated mitochondrial DNA depletion and PI inhibition of ZMPSTE24 may underlie
some of the toxicities that result in the pro-aging effects of ART drugs.

1.3. HIV protease inhibitors appear to drive premature aging phenotypes
HIV PIs were among the earliest classes of antiretroviral drugs developed. They work to
suppress the HIV virus by targeting the protease of HIV responsible for proteolytic cleavage of
viral proteins into their mature form, thereby blocking protein precursors that are necessary for
viral packaging (Nolan, 2003). There are currently 11 PI drugs approved for use in the treatment
6

of HIV and they are typically administered in combination with other HIV medications (U.S.
Food and Drug Administration, 2020). The PI pair, Atazanavir and Ritonavir are among those
reported to accelerate aging phenotypes (Auclair, Afonso, Cape, Caron-Debarle, & Capeau,
2014). Despite this, and due to their necessity for survival, they are recommended for the
treatment of HIV infection in children, as early as 3 months of age, and in adults including as an
antiretroviral prophylaxis during pregnancy (Chougrani, Luton, Matheron, Mandelbrot, & Azria,
2013) (Ripamonti, et al., 2007).
Many HIV protease inhibitors (PIs) are implicated in the pro-aging effects of ART
through their inhibition of proper lamin A maturation (Caron, Auclair, Sterlingot, Kornprobst, &
Capeau, 2003). More specifically, they block the activity of ZMPSTE24, a metalloprotease that
converts farnesyl-prelamin A to mature lamin A (Young, Fong, & Michaelis, 2005). Normally,
lamin A is generated after several maturation steps, beginning with C-terminal farnesylation and
its subsequent cleavage by ZMPSTE24. Inhibition of ZMPSTE24 therefore causes the
accumulation of farnesyl-prelamin A. Farnesyl Prelamin A gets anchored into the nuclear rim
where it interferes with the structural integrity of the nuclear lamina and causes changes to the
nuclear architecture (Young, Fong, & Michaelis, 2005). The resulting misshapen nuclei cause
genomic instability and cellular dysfunction leading to abnormalities and premature aging
diseases collectively called laminopathies, the most well characterized being HGPS/ Progeria
(Worman & Foisner, 2010). Progeria patients accumulate a truncated form of farnesyl prelamin
A, termed progerin, which causes severe nuclear envelope deformations including blebbing, and
leads to premature aging phenotypes (Young, Fong, & Michaelis, 2005). The net effect of this is
a greatly reduced quality of life and shortened lifespan in patients. In vivo studies have
7

additionally shown that ZMPSTE24-deficient mice show an accelerated aging phenotype (Bergo,
et al., 2002) (Pendas, et al., 2002) (Osorio, et al., 2011) (Gordon, et al., 2014).
It has been reported that patients who have been taking HIV PI medication for about a
decade or so frequently develop lipodystrophy syndromes, specifically lipoatrophy, where there
is a pathological loss of subcutaneous fat tissue (Caron, et al., 2007) (Afonso, et al., 2016)
(Mattout, Dechat, Adam, Goldman, & Gruenbaum, 2006)
A cell culture study of human skin fibroblasts, isolated from patients with lipodystrophy
and bearing LMNA mutations expectedly showed an accumulation of farnesyl-prelamin A.
When control non-lipodystrophic fibroblasts were treated with the HIV PIs indinavir or
nelfinavir, they too accumulated farnesyl-prelamin A (Caron, et al., 2007). Patients exhibiting
lipodystrophy syndromes are also at an elevated risk of developing cardiovascular related
pathology as is seen with HIV and Progeria patients. A study associating cardiovascular disease
with HIV PI treatment showed that vascular smooth muscle cells (VSMCs), after being treated
with the HIV PIs lopinavir, atazanavir and ritonavir, not only accumulated farnesyl prelamin A
as expected, but also had increased calcification which is a contributing factor to atherosclerosis
(Afonso, et al., 2016). Progeria patients exhibit severe premature atherosclerosis and myocardial
infarction is a common cause of death in their early teen years (McClintock, Gordon, & Djabali,
2006). Also on cardiovascular effects, human coronary artery endothelial cells (HCAECs)
treated with lopinavir and ritonavir accumulated farnesyl-prelamin A, but were protected from
age-related phenotypes when additionally treated with a farnesylation inhibitor (Lefevre, et al.,
2010). This study went on to show, that PBMCs from HIV patients taking Ritonavir displayed
increased markers of aging but were similarly protected from aging phenotypes when patients
took statins in addition. Statins have been shown to have an inhibitory effect on farnesylation
8

(Lefevre, et al., 2010). Osteoporosis is another documented premature aging symptom seen in
HIV patients on treatment regimens including PIs. A comparison of different HIV drug classes
found that PIs caused greater losses to bone mineral density (Duvivier, et al., 2009). Although
the mechanism is not well known, another study found that bone marrow mesenchymal stem
cells (MSCs) treated with clinically relevant combinations of atazanavir with ritonavir, or
lopinavir with ritonavir, accumulated farnesyl-prelamin A (Hernandez-Vallejo, Beaupere,
Larghero, Capeau, & Lagathu, 2013). Cellular dysfunction to precursor cells might therefore
have contributed to the observed loss in bone density. These studies and more suggest that
treatment with HIV PIs and the ensuing accumulation of farnesyl-prelamin A has implications in
accelerating age-related phenotypes and pathologies. In many cases, the observed cellular
dysfunction which is increased with farnesyl-lamin A accumulation can be explained by
accumulating evidence from mouse and cell culture models of HIV PI treatment, which suggest
that this drug class activates a pro-aging biological process known as cellular senescence.

1.4. Cellular Senescence
Cellular senescence is a complex stress response featuring an essentially irreversible
growth arrest coupled to a resistance to apoptosis and a multifaceted secretory phenotype, termed
senescence-associated secretory phenotype (SASP) (Campisi, 2005) (Campisi, 2011) (Rodier &
Campisi, Four faces of cellular senescence., 2011). The SASP includes numerous pro-
inflammatory cytokines, proteases and growth factors (Coppé, et al., Senescence-associated
secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor
suppressor , 2008) (Coppé, et al., 2010) (Acosta, et al., 2013).
9

Cellular senescence was formally described following the observation that normal human
fibroblasts had a finite proliferative capacity after prolonged passaging in cell culture (Hayflick
& Moorhead, The serial cultivation of human diploid cell strains , 1961) (Hayflick, 1965). This
was, even at the time, hypothesized to be the underlying factor for aging. Later studies confirmed
this phenomenon to be the progressive loss of telomeres with each cell division, to a point where
they become critically shortened as to elicit a telomeric/ genomic damage stress response
(Bodnar, et al., 1998). Thereafter cellular senescence was, and still is, recognized as the
irreversible growth arrest of cells at risk for malignant tumorigenesis (Campisi, 2013).
Accumulating evidence now indicates that senescence also plays a role in mediating multiple
physiological and pathological process including in embryonic development (Rajagopalan &
Long, 2012) (Muñoz-Espín, et al., 2013) (Storer, et al., 2013), wound healing (Demaria, et al.,
An essential role for senescent cells in optimal wound healing through secretion of PDGF-AA,
2014) (Jun & Lau, 2010), tissue repair (Krizhanovsky, et al., 2008) and in aging (Baker, et al.,
2008) (Baker, et al., 2011).
Several stressors cause senescence, most prominent of which include persistent
telomeric/ genomic damage, oncogenes/ strong mitogenic signals, epigenetic perturbations,
tumor suppressor gene activation, mitochondrial dysfunction and oxidative stress (Campisi &
d'Adda di Fagagna, 2007) (Muñoz-Espín & Serrano, 2014) (Wiley, et al., 2016) (Van Deursen,
2014). Although the different stressors signal through different pathways, they
converge on the activation of the cyclin-dependent kinase (CDK) inhibitors, mainly p16
INK4A

(p16) and p21
WAF1/Cip1
(p21) which implement the senescence growth arrest by preventing the
inactivation of the tumor suppressor protein pRB (Figure 3).

10

Figure 2. Characteristics of a Senescent cell.
Upon growth arrest, senescent cells increase in size and exhibit a flat morphology in cell culture
conditions. Key biomarkers of senescence include histochemical staining for senescence-
associated β-galactosidase (SA-βgal) at pH 6.0 based on the increased lysosomal activity of
senescent cells (Kurz, Decary, Hong, & Erusalimsk, 2000) (Dimri, et al., 1995), expression of
the tumor suppressor proteins p16 and p21 (Campisi, 2013) (Muñoz-Espín & Serrano, 2014)
(Campisi & d'Adda di Fagagna, 2007), DNA damage foci; DNA segments with chromatin
alterations reinforcing senescence (DNA-SCARS) (Rodier, et al., 2011) or more specifically
telomere dysfunction-induced foci (TIF) when present at telomeres (Takai, Smogorzewska, & de
Lange, 2003), senescence-associated heterochromatin foci (SAHF) (Narita, et al., 2003), and a
loss of the nuclear lamina protein – lamin B1 (LMNB1) expression (Freund, Laberge, Demaria,
& Campisi, 2012). It is important to note, however, that there is no single senescence specific
marker and therefore to evaluate the presence of senescence cells, one must examine multiple
markers of the senescent phenotype. Additionally, expressed markers of senescence might vary
depending on cell type and senescence-inducing stimuli.

11

Figure 3. The senescence growth arrest is established and maintained by two major
pathways: the p53/p21 pathway, and the p16/pRB pathway.
Adapted from (Campisi, Aging, cellular senescence and cancer, 2013). The senescence growth
arrest is established and maintained by two major pathways: the p53/p21 pathway, and the
p16/pRB pathway. DNA damage activates a DNA damage response (DDR) which activates the
master transcriptional regulator p53. Phosphorylated p53 activates the expression of its
downstream effector, p21, which inhibits CDK2 preventing the inactivation of pRb establishing
growth arrest. Stressors that do not directly cause genomic damage can induce p16 as well as
indirectly trigger a DDR. p16 activates pRB to establish a growth arrest, through its inhibition of
CDK4 and CDK6. If damage is severe, persistent DDR signaling can also lead to increased
reactive oxygen species (ROS) and an activation of p16 mediated by p38-MAPK. The SASP,
also induced by persistent DDR signaling can reinforce the senescence growth arrest.

12

Senescent cells accumulate with age and can contribute to a multitude of phenotypes and
pathologies associated with aging (Campisi, 2005) (Campisi, Andersen, Kapahi, & Melov, 2011)
(Jeyapalan & Sedivy, 2008) (Karrasch, Holz, & Jörres, 2008) (Kozlowski, 2012). Senescent cells
can contribute to aging phenotypes in a cell autonomous (through the growth arrest) or non-
autonomous (through the SASP) manner. In a cell autonomous manner, it was demonstrated in
BubR1 progeroid mice that the senescent growth arrest of skeletal muscle and fat tissue
progenitor cells disrupts the stem cell niche and depletes the pool of cycling cells available for
tissue regeneration (Baker, Weaver, & van Deursen, 2013). In a cell non-autonomous manner,
the SASP, which includes pro-inflammatory molecules, can disrupt the activities of healthy
neighboring cells through paracrine signaling contributing to an inflammatory phenotype
(Acosta, et al., 2013). A mouse model of chronic inflammation accumulates senescent cells and
exhibits accelerated aging phenotypes (Jurk, et al., 2014). Chronic inflammation plays a
causative role in age-related diseases (Freund, Orjalo, Desprez, & Campisi, 2010), including
some that have been associated with HIV-infection and/or ART drugs.

13

1.5. Cellular senescence as a driver of HIV PI-induced premature aging phenotypes
HIV PI treatment impairs maturation of the major nuclear protein lamin A (LMNA) by
inhibiting activity of the mammalian protease ZMPSTE24. LMNA mutations lead to the
accumulation of farnesyl-prelamin A which causes or accelerates cellular senescence. It would
follow that in promoting cellular senescence, PIs may be contributing to premature aging in HIV
patients (Figure 4).

Figure 4. The damaging effects of HIV protease inhibitors occur through the accumulation
of senescent cells.
HIV PIs are implicated in the pro-aging effects of ART through their inhibition of proper lamin
A maturation. PIs inhibit the specific activity of the mammalian protease ZMPSTE24.
ZMPSTE24 processes the major nuclear protein prelamin A into lamin A (LMNA), defects in
which have been shown to accelerate senescent phenotypes.

Patients who have been taking HIV PI medication develop lipodystrophy syndromes,
specifically lipoatrophy, characterized by a pathological loss of subcutaneous fat tissue (Caron,
et al., 2007) (Afonso, et al., 2016) (Mattout, Dechat, Adam, Goldman, & Gruenbaum, 2006). The
identification of senescent cells in adipose tissue of HIV patients that receive certain PIs
(McComsey, et al., 2016), supports a role for them in PI-induced lipodystrophy syndrome, and
14

possibly in other age-related phenotypes. Senescent cells have also been identified in
preadipocytes in obesity – a condition associated with aging (Tchkonia, et al., 2010).
Patients exhibiting lipodystrophy syndromes are also at an elevated risk of developing
cardiovascular related pathology as is seen with HIV and Progeria patients (Afonso, et al., 2016).
Progeria patients exhibit severe premature atherosclerosis and myocardial infarction is a
common cause of death in their early teen years (McClintock, Gordon, & Djabali, 2006).
Senescent cells have been shown to promote atherosclerosis (Childs, et al., 2016) and
cardiovascular pathology in aged mice (Baker, et al., 2016).
Osteoporosis is another documented premature aging symptom seen in HIV patients on
treatment regimens including PIs. A comparison of different HIV drug classes found that PIs
caused greater losses to bone mineral density (Duvivier, et al., 2009). Senescent cells are known
to drive age-associated bone loss in mice (Farr, et al., 2017).
Other incidences of senescent cells being present at sites of aging pathologies associated
with PI-treatment include in neurodegenerative conditions like Alzheimer’s and Parkinson’s
diseases (Jabbari Azad, et al., 2014) (Yan, et al., 2014). A recent study suggested that HIV PI’s
may be promoting neurodegeneration in HIV-associated neurocognitive disorders (HAND)
(Gannon, et al., 2017).
HIV-infected individuals are at a higher risk for developing cancer (Shiels, et al., 2011),
and senescent cells, through their SASP, can drive malignant phenotypes (Krtolica, Parrinello,
Lockett, Desprez, & Campisi, 2001) (Parrinello, Coppe, Krtolica, & Campisi, 2005).
Ultimately, senescent cells are persistently present at sites of many age-related
pathologies also associated with PI-treatment. Although not fully determined yet, it is reasonable
that senescent phenotypes might underlie some of the toxic effects of the drug class specific
15

effects of HIV PIs. Since senescent cells drive conditions associated with either HIV infection or
ART, they are a strong candidate for mediating the pro-aging effects of ART, and a potentially
powerful target for intervention. A study using a transgenic mouse model, INK-ATTAC, to
induce apoptosis in p16
INK4A
-expressing senescent cells, decisively connected cellular
senescence to age-related phenotypes and pathologies (Baker, et al., 2016). A similar approach
can be used to resolve the mechanistic relationship between PI treatment and age-related
pathologies, and offer possibilities for therapeutic interventions aimed at eliminating senescent
cells.

1.6. HIV PIs induce a senescent phenotype that is reversible upon cessation of treatment
Stressful stimuli, including genomic damage, oncogenic mutations, metabolic imbalances
and organelle stress, cause cellular senescence which has 3 unique characteristics – a multi-
faceted secretory phenotype, resistance to apoptosis, and a growth arrest (Campisi, 2013). It is
generally accepted that this growth arrest is essentially irreversible.
In my studies, the HIV PI atazanavir boosted with ritonavir (ATV/r), induces senescence,
that is p53-dependent, exhibiting several features of senescence (Figure 2), but is reversible upon
removal of the drug. Mice receiving sustained ATV/r treatment showed increased senescent
phenotypes and deficits in functional assays, including decreased heart function. When ATR/r
was removed, the mice lost the senescence phenotypes, and regained physiological function in
the heart. So does this represent senescence truly? There are few examples where senescence has
been found to be reversible without the addition of external mitogens. An example that may
come close was demonstrated with replicative senescence; it could be reversed depending on the
differential expression of p16 at senescence induction (Beauséjour, et al., 2003). Cells expressing
16

low levels of p16 at senescence induction re-entered the cell cycle when p53 was inactivated. In
another example of apparent reversal, irradiated melanoma cells that were growth arrested and
exhibiting canonical markers of senescence, were are able to resume growth and colonize distant
metastatic sites (Webster, et al., 2015).
These results change the paradigm on the irreversibility of senescence without persistent
DNA damage. There are positive implications of this in that senescence induced by HIV PIs and
the consequent premature aging conditions seen with patients, may be reversed by simply
stopping administration, or rather, switching therapy to those not seen to cause senescence – like
DRN/r. Beyond ART, the phenomenon of a reversible senescence phenotype has the potential
for uncovering new mechanisms of aging.

17

CHAPTER 2: RESULTS

2.1. Nucleotide reverse transcriptase inhibitors induce senescence phenotypes
Antiretroviral therapy (ART) has been associated with long term adverse events
collectively resembling accelerated aging. NRTIs in particular, exert an inhibitory effect on the
DNA polymerase γ (POLG) which is responsible for mitochondrial DNA (mtDNA) synthesis
thus leading to a depletion of mtDNA and consequently mitochondrial dysfunction. (Caron,
Auclairt, Vissian, Vigouroux, & Capeau, 2008) (Apostolova, Blas-Garcıa, & Esplugues, 2011).
Previous work demonstrated that cells undergo senescence in response to mitochondrial
dysfunction termed mitochondrial dysfunction-associated senescence (MiDAS) (Wiley, et al.,
2016). MiDAS occurred in POLG mutant mice, a mouse model of mitochondrial dysfunction-
induced premature aging, which display profound lipoatrophy and accumulate senescent cells at
a rapid rate. Lipoatrophy is also a common consequence of ART, and senescent cells appear in
adipose tissue of patients that receive some NRTIs (Kennedy, et al., 2014). Thus, senescent cells
could be causing or contributing to the development of ART-induced lipoatrophy and possibly
other age-related phenotypes and pathologies.
Since NRTIs can deplete mtDNA through their inhibition of POLG causing senescence
phenotypes, I first tested the hypothesis that NRTIs induce cellular senescence in cultured human
cells. I cultured human fibroblasts in the presence of zidovudine (AZT), stavudine (d4T) – some
of the earliest NRTIs, and tenofovir + emtricitabine (TDF/FTC), a combination used today to
treat HIV-negative groups that are at risk for contracting HIV as part of pre-exposure
prophylaxis (PrEP), and therefore relevant even in the absence of HIV infection. All the NRTIs
tested induced senescence as determined by SA-β-gal positivity (Fig. 5A) expression of p16
INK4a

18

and p21
WAF1
(Fig. 5B) and a senescence-associated secretory phenotype (SASP) (Fig. 5C) upon
treatment with TDF/FTC.
To determine if NRTIs promote aging phenotypes in mice, young adult mice were treated with
TDF/FTC for 8 weeks after which functional assays were performed, and tissue collected for
senescence analyses. TDF/FTC-treated mice exhibited premature aging phenotypes including a
graying coat, a loss in subcutaneous fat (Fig. 6A). Pathology in the treated mice was associated
with an accumulation of senescent cells in affected tissues as determined by positive SA-β-gal
staining in subcutaneous fat tissue (Fig. 6B) with increased expression of p21
WAF1
(Fig. 6C), and
deficits in parameters of heart health; loss of cardiac output and stroke volume (Fig. 6D & E),
with increased expression of of p21
WAF1
in heart tissue (Fig. 6F). Senescent cells are therefore a
strong candidate for mediating the pro-aging effects of NRTIs. They also represent a potentially
powerful target for intervention.

19

Figure 5.Nucleotide reverse transcriptase inhibitors induce senescence.
IMR-90 fibroblasts were treated with the labeled NRTIs 14 days prior to analysis. A. Example
images of SA-B-gal positivity in cells induced to senesce by labeled NRTIs. B. RNA from
TDF+FTC-treated cells was analyzed for p16
INK4a
and p21
WAF1
expression by qPCR. C. Cells
from (B) were analyzed for SASP gene expression by qPCR.

20

Figure 6. NRTI treatments induce senescence in tissues that show premature aging
phenotypes.
5 mo old mice were treated for 8 weeks with TDF/FTC before analysis. A. Examples of
vehicle and TDF/FTC treated mice. B. Subcutaneous fat from mice was stained for SA-B-gal.
C. RNA from (B) was analyzed for p21
waf1
(p21) expression by quantitative PCR. D-E.
Echocardiography reveals loss of cardiac output and stroke volume in treated mice. F. p21
expression in hearts from (D-E).

21

2.2. The Protease Inhibitor Atazanavir induces cellular senescence in cultured cells
Several PIs are implicated in the pro-aging effects of ART through inhibition of the
activity of ZMPSTE24, a metalloprotease that converts farnesyl-prelamin A to mature LMNA
(Young, Fong, & Michaelis, 2005). LMNA requires several maturation steps, including C-
terminal farnesylation and subsequent removal by ZMPSTE24-mediated cleavage of the C-
terminus. ZMPSTE24 inhibition therefore causes an accumulation of farnesyl-prelamin A,
which remains anchored to the nuclear membrane where it interferes with the structure of the
nuclear lamina. The resulting fragile nuclei show blebbing and DNA damage signaling, a feature
of several diseases collectively called laminopathies, the most well characterized being HGPS/
Progeria (Worman & Foisner, 2010).
To examine the drug class specific effects of HIV PIs on senescent phenotypes, I treated
human cells in culture with Atazanavir, boosted with Ritonavir as is administered in patients.
Ritonavir, although itself a protease inhibitor, is generally used as a pharmacokinetic enhancer in
combination therapies to increase the effectiveness of HIV medicines. As fibrosis associated
genes were found to be elevated in HIV patients taking ART (Kusko, et al., 2012), I treated
human fibroblasts with clinically relevant doses, 10-20µM (Auclair, Afonso, Cape, Caron-
Debarle, & Capeau, 2014), of the combination; Atazanavir + Ritonavir (ATV/r). Treated cells
arrested growth and displayed multiple features of senescence. ATV/r treatment caused an
increase in the expression of the tumor suppressors p16INK4a / p21waf1, and a decrease in
LMNB1(Fig. 7A & B). Cells exhibited a flat morphology, upregulated senescence associated β-
galactosidase (SA-β-gal) activity (Fig. 7C). Immunofluorescence staining for senescence
markers showed a loss of nuclear high mobility group B1 (HMGB1), an alarmin that initiates an
inflammatory response in nearby leukocytes (Davalos, et al., 2013), and reduced EdU
22

incorporation indicative of a cease in cell proliferation. Nuclear staining showed abnormalities in
the nuclear architecture of ATV/r-induced senescent cells characteristic of laminopathies. Some
IMR-90 fibroblasts cultured in the presence of ATV/r showed dysmorphic blebbing nuclei (Fig.
7D). Western blot analyses showed increased protein expression of Prelamin A, and growth
arrest markers phospho-p53 and p21
WAF1
(Fig. 7E). ATV/r-treated cells expressed significantly
upregulated levels of the SASP factors AREG, IL-6, CXCL10, IL-1α and IL-1β, MMP1 and 3
(Fig. 7F). MMPs are known to promote inflammation by processing cytokines such as IL-1β, and
stimulating leukocyte infiltration (Parks, Wilson, & López-Boado, 2004).

23

Figure 7. The HIV PI Atazanavir induces senescence in cultured cells.
IMR-90 human fibroblasts were cultured in the presence of ATV/r for 14 days. A. RNA was
isolated from untreated (DMSO) and ATV/r-treated cell cultures. p16/p21 mRNA levels were
measured by qPCR. B. mRNA levels of LMNB1 in treated cells. C. Example images of SA-β-
gal positivity in cells induced to senesce by ATV/r. D. Cells were analyzed for HMGB1 release
from the nucleus, proliferation (EdU), and nuclei morphology E. Intracellular Prelamin A, P-p53,
p21, and HMGB1 protein expression. F. SASP mRNA levels were measured by qPCR.

24

I next compared the effects on senescence phenotypes of Darunavir boosted with
ritonavir (DRV/r), another commonly prescribed HIV PI. Whereas ATV/r has been found to lead
to the accumulation of farnesyl-prelamin A through its inhibition of ZMPSTE24 activity,
darunavir does not inhibit ZMPSTE24, or lead to the accumulation of prelamin A (Coffinier, et
al., 2008). Importantly, DRN/r has not been associated with age-related phenotypes and
pathologies associated with ART, and has a more favorable safety profile when compared to
ATV/r (Menzaghi, et al., 2013) (Arathoon, et al., 2013) (Orkin, et al., 2013). Mouse dermal
fibroblasts treated with DRN/r did not arrest growth or exhibit features of senescence. DRN/r-,
unlike ATV/r-treated cells, did not show increased expression of the tumor suppressors
p16INK4a / p21waf1 and retained LMNB1expression similar to the vehicle treated controls (Fig.
8A & B). DRN/r treated cells did not stain positively for SA-β-gal activity (Fig. 8C & D),
continued to proliferate as determined by CellTrace™ Violet dye dilution (Fig. 8E), and did not
express a SASP (Fig. 8F).

25

Figure 8. The HIV PI Darunavir does not induce senescence in cultured cells.
Mouse dermal fibroblasts were treated with ATV/r or DRN for 14 d prior to analyses. A. mRNA
levels of p16/p21 in treated cells. B. mRNA levels of LMNB1 in treated cells. C. Example
images of SA-β-gal positivity in untreated (DMSO), DRN/r and ATV/r-treated cells D.
quantification of (C). E. Overlay of 3MR dermal fibroblast cultures of untreated (DMSO),
DRN/r and ATV/r-treated cells, monitored for cell proliferation. Cell proliferation was followed
for 5 days using the CellTrace™ Violet reagent. A shift of histograms to the left since day 0
represents successive generations of cells. F. SASP mRNA levels were measured by qPCR.

26

2.3. The Atazanavir-induced SASP contains aging and disease biomarkers
The accumulation of senescent cells, and the resulting proinflammatory SASP in
particular, can have potent effects on local tissues that could drive tissue dysfunction and aging
(Campisi, 2013). The composition of the SASP is known to vary with the inducer of senescence,
as well as cell and tissue type. Until recently, the composition of the SASP had not been studied
in the context of ART-induced senescence. In conjunction with collaborators, we sought to
understand what factors may be released from HIV PI-induced senescent cells, which of those
may be universally present, among different inducers of senescence, and which may be specific
to PI-induced senescence (Basisty, et al., 2020). We tested the hypothesis that the SASP
following senescence induction from PI treatment may contribute to premature aging
phenotypes, such as those seen in patients.
Secretome profiling was performed using targeted mass spectrometry on conditioned
media (proteins secreted into cell culture over 24 hours) from human fibroblast cell cultures
induced to senesce with ATV/r or vehicle (DMSO) (Fig. 9A & B). The secretion of previously
identified SASP factors; CXCLs, high mobility group box 1 protein (HMGB1), insulin-like
growth factor binding proteins (IGFBPs), matrix metalloproteinases (MMPs), laminin subunit
beta-1 (LAMB1), and tissue inhibitors of metallopeptidase (TIMPs), was validated to be elevated
in the SASP of ATV/r senescent cells (Fig. 9C). Mass Spectrometry was performed on the
TripleTOF 5600 using data-independent acquisition (DIA) (Fig. 9D). This unbiased proteomic
profiling identified between 441 proteins secreted by ATV/r induced senescent cells with 376
significantly up- or down-regulated in the secretome (Figure 9E). As expected, most of the
significantly changed proteins were markedly up-regulated in the SASP from ATV/r-senescent
27

cells compared with control cells. GDF15, among the most highly secreted proteins, has a
significant association with aging (Tanaka, et al., 2018) (Figure 9F).
A recent biomarker study identified 217 proteins that are significantly associated with age
in human plasma (Tanaka, et al., 2018). Between the originally defined SASP (Coppé, et al.,
2008) and unique SASP proteins common to X-irradiation (IR), RAS oncogene overexpression
(RAS) and atazanavir (ATV/r), 39 proteins identified with the age-associated plasma proteins
(Basisty, et al., 2020) (Fig. 9G). GDF15, STC1, SERPINE1, and MMP1 among others – known
SASP factors and biomarkers of aging, cardiovascular and neurodegenerative diseases – were
elevated in the ATV/r-induced SASP (Fig. 9H). Thus, plasma biomarkers of aging are highly
enriched in the SASP following ATV/r treatment, and this might contribute to premature aging
phenotypes in patients.
It has been described how different senescence-inducing stimuli drive largely distinct
secretory phenotypes (Coppé, et al., 2008) (Coppé, et al., 2011) (Davalos, et al., 2013) (Wiley, et
al., 2016). However, there are some core proteins found to be present regardless of the
senescence inducer. To determine the core pathways associated with the SASP of different
senescence inducers, we performed pathway and network analyses on overlapping proteins in the
SASP of human fibroblasts induced to senesce by IR, RAS, and ATV/r. The largest pathways
associated with all inducers related to tissue and cell structure, including extracellular matrix
organization, actin cytoskeleton, integrin interactions, and peptidase regulation (Fig. 10).
Complement and coagulation cascade proteins, particularly protease inhibitors such as
SERPINs, are prominent plasma biomarkers of aging (Tanaka, et al., 2018). These proteins and
their pathway networks were robustly altered in the SASPs of cells induced to senesce by ATV/r.
Among the top pathways of proteins increased in the SASP of human fibroblasts treated with
28

ATV/r was ‘platelet activation, signaling and aggregation’ (Table 3). This finding is in agreement
with additional collaborative work, where we found that chemotherapy treatment-induced
senescent cells release factors that promote blood clotting, including PAI-1 (SERPINE1), uPAR
(PLAUR), and THBS1. Importantly, eliminating senescent cells prevented increases in platelet
counts and activation in mice treated with chemotherapy (Wiley, et al., 2019). HIV patients
taking ART are at a higher risk of recurrent blood clots (Rokx, et al., 2020). The enrichment of
such aging and disease biomarkers in the secretomes of ATV/r-induced senescent cells supports
HIV PIs’ link to a wide spectrum of age-related diseases.

Figure 9. Summary of changes in SASP factors between ATV/r-induced senescent cells
compared to non-senescent control cells.
IMR-90 fibroblasts were treated with ATV/r or vehicle (CTL) for 14 days prior to collecting
conditioned media for analyses. A. Induction of senescence was verified by SA-β-Gal positivity,
B. increased levels of p16INK4a and IL-6 mRNAs determined by qPCR and expressed as fold
change of senescent over control (red line) cells, and C. increased expression of secreted factors.
D. Proteomic workflow for isolation and analysis of secreted proteins. Senescence was induced
in cultured primary human lung fibroblasts ATV/r. Soluble proteins were then isolated from
conditioned media. Samples were digested and subjected to mass spectrometric analysis (DIA),
followed by protein identification and quantification using Spectronaut Pulsar and by
bioinformatic, pathway, and network analyses in R and Cytoscape E. Top; Heatmap of changes
in the SASP following treatment with ATV/r. Bottom; Summary of proteins with significantly
altered (q-value 1.5-fold change) secretion by senescent compared with quiescent cells following
ATV treatment in senescent human lung fibroblasts F. Top gene expression fold changes between
non-senescent controls and ATV/r-induced senescent cells. G. A Venn diagram showing the
overlap between the originally defined SASP (known SASP) with SASP proteins common to
ATV/r-, IR- and RAS oncogene overexpression-induced senescence (core SASP), and plasma
aging markers. H. Western blot confirmation of top core SASP factors, GDF15, STC1,
SERPINE1, and MMP1, in ATV/r-induced senescent cells compared to non-senescent controls.
29

30

Table 2. Gene Ontology Enrichment.
IMR90 fibroblasts were treated with ATV/r or vehicle (CTL) for 14 d prior to collecting
conditioned media for analyses. Biological functions occurring more frequently in ATV/r-
induced senescent cells are shown here.

31

Table 3. Top Pathways.
IMR90 fibroblasts were treated with ATV/r or vehicle (CTL) for 14 d prior to collecting
conditioned media for analyses. Analysis of top pathways and functions unique to the SASP of
ATV-induced senescent IMR90 cells are shown here.

32

Figure 10. Pathways and core networks.
Analysis of top pathways and functions unique to the SASP of ATV-induced senescent IMR90
cells. Pathway enrichment and network analyses of overlapping SASPs resulting from senescent
cells of different inducers including X-irradiation (IR), RAS oncogene overexpression (RAS)
and atazanavir treatment (ATV/r).

2.4. ATV/r treated cells undergo a p53-dependent growth arrest
As p53 initiates the senescence growth arrest, I assessed the p53 dependence of ATV/r-
induced senescence. I used human IMR-90 fibroblasts expressing genetic suppressor element 22
(GSE22), a peptide that prevents p53 tetramerization and causes inactive monomeric p53 to
accumulate (Gudkov, et al., 1993) (Ossovskaya, et al., 1996).
IMR-90 fibroblasts were transduced with lentiviral vectors expressing GSE22, or no
insert (vector), and cultured in the presence of ATV/r or DRN/r for 14 days. Indeed, GSE22
suppressed the induction of senescence in ATV/r treated cells as was determined by the
unchanged levels of senescence markers p21
WAF1
and LMNB1, when compared to the empty
33

vector control and/or cells treated with DRN/r, an HIV PI that does not induce senescence (Fig.
11A). While empty vector control cells stained positively for SA-β-gal activity following
treatment with ATV/r, GSE22 infected cells did not (Fig. 11B). Western blotting confirmed
GSE22 but not empty vector markedly reduced p21 levels, as was expected for loss of p53
activity, and caused retention of HMGB1 following ATV/r treatment (Fig. 11C). Cell
proliferation was followed for 5 days using the CellTrace™ Violet reagent, a dye enabling the
visualization of proliferating cells by flow cytometry. GSE22 transduced cells treated with
ATV/r continued to proliferate similarly to control cells and/or cells treated with DRN/r (Fig.
11D). Thus, p53 activity is necessary for the ATV/r senescence growth arrest.

34

Figure 11. ATV/r treated cells undergo a p53-dependent growth arrest.
IMR-90 fibroblasts were transduced with lentiviral vectors expressing GSE-22, a peptide that
inactivates p53, or no insert (vector), and cultured in the presence of ATV/r or DRN/r for 14
days. A. p21 and LMNB1 mRNA levels were measured by qPCR B. Example images of SA-β-
gal positivity in control (vector) or GSE-22 transduced cells treated with ATV/r C. Western blot
confirming p53 inactivation in GSE-22 transduced cells by absence of p21expression and
retained nuclear HMGB1. D. Overly of DMSO / ATV/r / DRN-treated, lenti-GSE22-transduced
IMR-90 cells analyzed for proliferation. Cell proliferation was followed for 5 days using the
CellTrace™ Violet reagent. A shift of histograms to the left since day 0 represents successive
generations of cells.

35

2.5. Eliminating senescent cells could improve senescence phenotypes
As has been determined in my experiments and in those of others, senescent cells appear
in cell culture and at sites of age-related pathology in mice treated with NRTIs. A correlation can
be drawn between the accumulation of senescent cells and premature aging phenotypes in NRTI-
treated mice. It has been shown that eliminating senescent cells in prematurely- or
chronologically-aged mice improves several age-related phenotypes that also appear in NRTI-
treated patients (Baker, et al., 2016) (Baar, et al., 2017). Therefore, use of a senolytic (a drug that
kill senescent cells) such as ABT-263, would critically test the idea that senescent cells promote
NRTI-associated premature aging pathologies. Indeed, cell cultures of mouse dermal fibroblasts
induced to senesce with TDF+FTC as determined by increased p21
WAF1
expression

(Fig. 12A),
and decreased levels of LMNB1 (Fig. 12B), were selectively killed by treatment with ABT-263
(Fig. 12C). This finding suggests that senolytic drugs could prevent the accumulation of
senescent cells in NRTI-treated mice and protect against the development of aging phenotypes,
providing a rationale for therapeutic intervention in NRTI-treated patients.

Figure 12. The senolytic ABT-263 selectively eliminates NRTI-induced senescent cells.
Mouse dermal fibroblasts were treated with TDF+FTC for 14 d prior to analyses. A. mRNA
levels of p21 in treated cells. B. mRNA levels of LMNB1 in treated cells. C. Cells were treated
for 14 hrs with the indicated concentrations of the senolytic drug, ABT-263, and survival was
determined by automated cell count.
36

2.6. Mice administered Atazanavir boosted with Ritonavir (ATV/r) show accelerated aging
phenotypes
To determine if some PIs promote aging phenotypes in mice, I analyzed p16-3MR mice
in which the tumor suppressor p16
INK4a
is used as a senescence-sensitive promoter that is used to
track senescent cells (Demaria, et al., 2014). The 3MR (trimodality reporter) fusion protein
contains functional domains of a synthetic Renilla luciferase (LUC), monomeric red fluorescent
protein (mRFP), and truncated herpes simplex virus 1 (HSV-1) thymidine kinase(HSV-TK)
(Wang, Lu, Chen, Li, & Zhang, 2004). LUC allows the detection of 3MR-expressing cells by
luminescence, mRFP permits sorting of these cells from tissues, and HSV-TK allows their
killing by ganciclovir (GCV), a nucleoside analog that has a high affinity for HSV-TK but low
affinity for the cellular TK. HSV-TK converts GCV into a toxic DNA chain terminator; in
nonproliferating senescent cells, GCV fragments mitochondrial DNA, causing death by
apoptosis (Laberge, et al., 2013).
Young adult p16-3MR mice, were administered ATV/r at the clinically relevant doses of
62mg/kg atazanavir with 21mg/kg ritonavir (human daily dose normalized for mouse body
surface area) for 8 weeks (Fig. 13A), after which functional assays were performed, and tissue
collected for senescence analyses. Mice treated with ATV/r exhibited an aged appearance
including a graying coat, hair loss and localized loss of fat tissue / lipodystrophy (Fig. 13B).
These aging phenotypes have been reported for patients on long-term ART, as well as for genetic
conditions of compromised LMNA. Tissues collected from the heart, subcutaneous fat, visceral
fat, kidney, bone, skin and liver tissues, showed significantly increased expression of the cyclin-
dependent kinase inhibitor p21
WAF1
(Fig. 13C-H),whereas p16
INK4a
was only modestly increased
in some tissues (Figure 13I-N). This was consistent with measurements of luminescence. ATV/r
37

treatment caused a small increase in whole-body bioluminescence (Fig. O & P) comparable to
the small increase in p16
INK4a
mRNA in different tissues. These results suggest that ATV/r
induces cellular senescence in mice.

38

Figure 13. ATV/r treatment accelerates aging phenotypes.
Young adult mice at age 5 months were treated with 62mg/kg atazanavir with 21mg/kg ritonavir
in their drinking water for 8 weeks. A. Schematic of the experimental setup. B. Representative
phenotypic differences between ATV/r-treated mice (right) vs. age-matched controls (left) are
shown. C-H. p21
WAF1
mRNA expression levels were measured by qPCR. I-N. p16
INK4a
mRNA
expression levels were measured by qPCR. O. Representative images of p16-3MR male mice,
treated with ATV/r (left) vs. vehicle (right), injected with coelenterazine and measured for
luminescence using the Xenogen imaging system. P. Quantification of (I).

39

2.7. Senescent cells appear at sites of atazanavir-induced pathology
Mice treated with ATV/r exhibited localized loss of fat tissue / lipodystrophy, reduced
bone density (not shown here) and reduced cardiac activity. Histochemical analysis of
subcutaneous fat following ATV/r administration revealed more SA-β-gal-positive staining
compared to vehicle-treated animals (Fig. 14A). Mice also showed increased p21
WAF1
expression
(Fig. 14B) and exhibited core features of the SASP including MMP3, IL-1a, GMCSF and IL-10
(Fig. 14C-F). The pro-inflammatory SASP has been shown to occur in humans after genotoxic
chemotherapy (Coppé, et al., 2008) (Sun, et al., 2012), and chronic inflammation is a
contributing factor to age-related pathologies (Vasto, et al., 2007) (Chung, et al., 2009)
(Franceschi & Campisi, 2014).
Skin isolated from the dorsal area of mice following treatment with ATV/r similarly
stained positive for SA-β-gal in the stratum corneum (Fig. 14G) and showed significantly
increased p21
WAF1
and p16
INK4A
expression compared to vehicle treated mice (Fig. 14H). Further,
expression of the SASP factors; IL-10, MMP3 and TIMP1were higher compared to vehicle
treated mice (Fig. 14I-K).
Echocardiography recordings revealed functional deficits in cardiac output, stroke
volume and ejection fraction (Fig. 14L) in the ATV/r-treated mice. This reduced cardiac activity
was associated with an accumulation of senescent cells as determined by increased expression of
p21
WAF1
and p16
INK4A
in heart tissue (Fig. 14M).

40

41

Figure 14. ATV/r-treated mice accumulate senescent cells at sites of age-related
pathologies.
Young adult mice at age 5 months were treated with 62mg/Kg Atazanavir with 21mg/Kg
Ritonavir in their drinking water for 8 weeks. A. Representative images of SA-β-gal in
subcutaneous fat from vehicle (left) and ATV/r-treated (right) mice. B. p21 mRNA expression
levels in tissue from (A) were measured by qPCR. C-F. SASP factors; MMP3, IL-1a, GMCSF
and IL-10, mRNA expression levels were measured by qPCR and normalized to actin. G.
Representative images of sectioned dorsal skin stained for SA-β-gal activity. H. qPCR analysis
for senescence markers p16/p21 mRNAs in skin tissue from (A). I-K. Markers of the SASP
including IL-10, MMP3 and TIMP1 mRNA expression levels were measured by qPCR and
normalized to actin. L. Cardiac activity was measured by echocardiography. M. qPCR analysis
for senescence markers p16/p21 mRNAs in heart tissue from (A).

42

2.8. Cessation of ATV/r treatment reverses senescence phenotypes
To assess the persistence of ATV/r-induced senescence, I cultured human fibroblasts in
the presence of ATV/r for 14 days, assessed senescence markers – then removed the drug from
the culture medium and maintained the cell cultures for another 14 days before collecting for
analyses. IMR-90 fibroblasts cultured in the presence of ATV/r for 14 days expectedly arrested
growth and showed increased expression of p16
INK4a
and p21
WAF1
, with the accompanying loss in
LMNB1, compared to vehicle (DMSO) and DRN/r – a PI known not to induce senescence
phenotypes (Fig. 15A). When ATV/r was removed, and the cell culture maintained for another 14
days, this surprisingly reversed the senescent phenotypes that occurred from the treatment. SA-β-
gal positivity in cells 14 day-released from treatment went down to ~1% compared to ~87% SA-
β-gal positivity after the initial 14 days with treatment (Fig. 15B).
One way in which senescent cells contribute to a multitude of aging phenotypes is
through the senescence growth arrest. This loss of proliferative capacity can prevent senescent
progenitor cells from repopulating a tissue leading to a loss in tissue function (Zhou, et al.,
2008). Therefore, I also assessed proliferation in ATV/r-treated cells, alongside vehicle (DMSO)-
and DRN/r-treated cells as proliferating controls. Cell proliferation was followed during the last
5 days of drug treatment using the CellTrace™ Violet reagent – a dye enabling the labeling of
cells in culture to trace multiple generations using dye dilution by flow cytometry. CellTrace™
labeled cells were defined at the beginning of the experiment (day 0) by marking the range of
CellTrace™ fluorescence output of each cell type being assayed. The same gates were used at
day 4 and day 18 to ascertain the frequency of undivided cells. 17.1% of ATV/r-treated cells
were found to be growth-arrested (Fig. 15C) and expressed p16
INK4a
and p21
WAF1
, with an
accompanying loss in LMNB1 (Fig. 15A). This cell population was sorted out and returned to
43

culture for 2 weeks without ATV/r treatment, after which they were re-analyzed for proliferation.
Cells were found to have undergone multiple cell divisions by day 18, with no cells falling
within the gate defined at day 0 suggesting that all of the cells, once growth arrested, had re-
entered the mitotic cell cycle (Fig. 15D). Thus, ATV/r induces a growth arrest, that is p53-
dependent, and with many features of senescence, but is reversible upon the removal of the drug.

Figure 15. Removal of ATV/r from cells in culture reverses senescence phenotypes.
IMR-90 fibroblasts were treated with ATV/r or DRN for 14 d prior to analyses. A. Confirmation
of mRNA levels of p16/p21/LMNB1 in treated cells. B. Example images of SA-β-gal positivity
in untreated (DMSO), ATV/r-treated and ATV/r-released cells C. Overlay of untreated (DMSO),
DRN/r and ATV/r-treated cells monitored for proliferation. Cell proliferation was followed for
5 days using the CellTrace™ Violet reagent. The shift in the histograms to the left since day 0
represents successive generations of cells. D. The 17.1% non-divided ATV/r-treated cells from
(C), were put back in culture for 2 weeks without ATV/r treatment, and then re-analyzed for
proliferation.

44

That senescence phenotypes do not persist after drug removal, was observed in studies
using mice to identify the phenotypes and pathologies driven specifically by PIs. I examined
whether removal of ATV/r treatment can reverse the premature aging phenotypes and
pathologies associated with its administration in mice. Mice were administered ATV/r or vehicle
(DMSO) for 8 weeks and then taken off treatment for 10 weeks after which time physiological
function was assessed, and tissue collected for senescence analyses (Fig. 16A). Mice receiving
sustained ATV/r treatment for 8 weeks duly showed increased senescence phenotypes as
determined by the increased expression of p16
INK4a
and p21
WAF1
at sites of ATV/r-induced
pathology, such as the heart and subcutaneous fat. 10 weeks post-treatment, there was no
difference in p16
INK4a
and p21
WAF1
expression in ATV/r-treated mice and vehicle-treated mice
(Fig. 16B-E). Further, expression of the SASP factors; MMP3 and TIMP1, initially elevated after
8 weeks of treatment, was reversed after 10 weeks without treatment (Fig. 16F-I). Whole body
luminescence moderately increased with ATV/r drug treatment and was decreased upon drug
removal (Fig. 16J) suggesting an accumulation in p16 driven senescent cells with treatment that
are lost with drug removal.

Figure 16. Removal of ATV/r administration in mice reverses senescence phenotypes.
Young adult mice at age 5 months were treated with 62mg/Kg Atazanavir with 21mg/Kg
Ritonavir in their drinking water for 8 weeks. A. Schematic of the experimental setup. B - C. p21
mRNA expression levels in tissue from the heart and subcutaneous fat were measured by qPCR.
D – E. p16 mRNA expression levels in tissue from the heart and subcutaneous fat were measured
by qPCR. F - G. SASP factor MMP3 mRNA expression levels in the heart and subcutaneous fat
tissue were measured by qPCR and normalized to actin. H - I. SASP factor TIMP1 mRNA
expression levels in the heart and subcutaneous fat tissue were measured by qPCR and
normalized to actin. J. p16-3MR male mice injected with coelentarazine, and measured for
luminescence at Baseline, at 8 weeks on treatment and at 10 weeks post treatment.
45

46

J
47

Follow up experiments included young adult mice at age 5 months, administered
62mg/Kg Atazanavir with 21mg/Kg Ritonavir in their drinking water for 8 weeks and then
released from drug treatment for 8 weeks (Fig. 17A). Mice assayed at the 8-week timepoint
exhibited deficits in parameters of heart function, including cardiac output and stroke volume,
which were reversed after ATR/r treatment was removed for 8 weeks (Fig. 17B). p21
WAF1
expression in heart tissue was similarly increased with treatment and decreased 8 weeks post
removal (Fig. 17C). The mice regained heart function and more closely resembled phenotypes of
vehicle-treated mice that were never administered any drug. Further, p16
INK4a
and p21
WAF1
expression in the skin was elevated with treatment and reversed post drug removal (Fig. 17D &
E). Thus, removal of ATV/r treatment from mice reverses aging phenotypes and pathologies.

48

Figure 17. Cessation of treatment improves age-related phenotypes and pathology in mice.
Young adult mice at age 5 months were treated with 62mg/Kg Atazanavir with 21mg/Kg
Ritonavir in their drinking water for 8 weeks and then released from drug treatment for 8 weeks.
A. Schematic of the experimental setup. B. Cardiac activity was measured by echocardiography.
C. qPCR analysis for p21 mRNA levels in heart tissue from (B). D. qPCR analysis for p16
mRNA levels in skin tissue. E. qPCR analysis for p21 mRNA levels in skin tissue.
49

CHAPTER 3: DISCUSSION
Long term antiretroviral therapy use has been related to adverse events that can
compromise patients’ health with consistent evidence for a central role of senescence in
mediating the toxic side effects of two ART drug classes; the nucleotide reverse transcriptase
inhibitor (NRTIs), which can inhibit mtDNA POLG resulting in mitochondrial dysfunction, and
the protease inhibitors (PIs) which inhibit the activity of the mammalian protease ZMPSTE24,
impairing the maturation of the major nuclear protein lamin A (LMNA).
I show that (1) The NRTI combination Tenofovir/emtricitabine (TDF/FTC) as well as the
PI combination, atazanavir boosted with ritonavir (ATV/r), induce senescence phenotypes
including arrested growth and a SASP; (2) the SASP following ATV/r-induced senescence
includes known biomarkers of aging including GDF15, STC1, SERPINE1, and MMP1; (3)
ATV/r treated cells undergo a p53-dependent growth arrest; (4) mice administered ATV/r show
accelerated aging phenotypes; (5) senescent cells appear at sites of atazanavir-induced pathology
and (6) cessation of ATV/r treatment reverses senescence phenotypes.
My studies of the NRTIs dovetailed with those of a senior postdoctoral fellow, who
showed that mitochondrial dysfunction induces a senescence response with a characteristic
SASP (Wiley, et al., 2016). NRTI’s are linked to both mitochondrial DNA depletion/damage via
inhibition of POLG, and to a myriad of age-related disorders such as lipodystrophy, osteopenia,
diabetes, and cardiomyopathy (Caron, Auclairt, Vissian, Vigouroux, & Capeau, 2008). Older
NRTIs such as zidovudine (AZT) and stavudine (d4T), as well as more recent ones, such as
tenofovir with emtricitabine (TDF/FTC) have been implicated in non-viral off target effects
including inhibition of POLG, depletion of mtDNA, reduction of mtDNA and direct inhibition of
ETC complexes (I, IV) leading to mitochondrial dysfunction (Apostolova, Blas-Garcıa, &
50

Esplugues, 2011). Less, however, is understood about the role of HIV PI-induced senescent cells.
Is their presence only detrimental or might they have a beneficial role? Importantly, what are the
key pathways through which senescence is mediated? Knowing the pathways contributing most
to the PI-induced senescence arrest could help to maximize the therapeutic potential of
interventions in the senescence program. For this, I compared the responses of human fibroblasts
in culture to atazanavir boosted with ritonavir (ATV/r) and to a second protease inhibitor,
darunavir boosted with ritonavir (DRN/r), that has not been associated with elevating senescence
phenotypes.
Examining the effects of the PIs, comprised the major part of my dissertation. Several
studies from cell culture experiments, rodent models, and human studies have linked senescence
to antiretroviral therapies. I conducted experiments expanding on this foundational knowledge of
the important mechanisms under consideration for ART-associated premature aging pathologies
and understanding how ART might drive senescence, and what factors are released from these
senescent cells. I characterized the senescent phenotypes, including the SASPs, resulting from
inhibition of ZMPSTE24 function by atazanavir, comparing the responses of several relevant
human and mouse cell types in culture. The SASP contained potential aging and disease
biomarkers. By profiling the secreted proteins of treatment-induced senescent cells, we
investigated the side effects of ATV/r and identified biomarker candidates that may indicate
signs of premature aging in patients. The enrichment of aging and disease biomarkers in the
secretome of ATV/r-induced senescent cells supports its link to a wide spectrum of age-related
diseases.
The protease inhibitor combinations, atazanavir/ritonavir and darunavir/ritonavir are
commonly prescribed for the treatment of patients with HIV. Studies comparing the efficacy of
51

ritonavir-boosted atazanavir and darunavir treatment found them to be of similar effectiveness in
the treatment patients initiating ART, but of differing tolerability with DRV/r being generally
preferred over ATV/r (Lennox, et al., 2014). Higher rates of toxicity have been associated with
atazanavir/ritonavir treatment over darunavir/ritonavir that the United States Department of
Health and Human Services’ (HHS) HIV treatment guidelines now recommend
darunavir/ritonavir as the preferred option for initiation of combination antiretroviral therapy,
and has reclassified atazanavir/ritonavir as an alternative regimen / second-line therapy (Office
of AIDS Research Advisory Council, 2019). If patients had been on HIV medication prior, those
switching treatment to regimens with DRV/r were less likely to experience drug toxicity and/or
drug resistance, and better adhered to their treatment regimens compared to people changing to
combinations with atazanavir/ritonavir (ATV/r) or lopinavir/ritonavir (LPV/r), another important
treatment option for HIV patients (Antoniou, et al., 2017).
Given also the differential effects of atazanavir and darunavir on senescence phenotypes;
with ATV/r inducing senescence whereas DRN/r does not, I am conducting final studies in mice,
testing the effects on senescent phenotypes of switching from atazanavir to darunavir. What I
expect is that mice first administered ATV/r for a period and then switched to DRN/r will show
reduced senescence phenotypes compared to those administered ATV/r the entire time. Seeing as
these drugs are already in the clinic as anti-HIV agents, insights learned from these experiments
could add to a growing body of research which could inform recommendations for safer drug
administration.
The underlying mechanisms governing the senescence response with atazanavir vs
darunavir are not known. Data from cell culture studies show that while darunavir
phosphorylates p53 at ser-37, p21 expression is not increased simultaneously, suggesting that
52

p21 is somehow suppressed by DRN/r treatment. Unveiling the molecular mechanisms
regulating HIV PI senescence induction provides a deeper understanding of the role of PI-
induced senescence in premature aging phenotypes and pathologies.
Unique to ATV/r, removing treatment reversed all the senescent phenotypes. These data
suggest that ATV/r induces a stress response that is senescent-like, given the many features of
senescence, but is reversible upon the removal of the drug. This was first observed in studies
using mice to identify the phenotypes and pathologies that are driven specifically by ATV/r. I
first attributed this phenomenon to immune-mediated clearance (immune surveillance). Immune
cells attracted by the SASP can remove nearby damaged cells (Krizhanovsky et al. 2008). Also,
premalignant senescent hepatocytes in mice have been reported to induce a T-cell-mediated
adaptive immune response (Kang, et al., 2011). The chemokines and cytokines that the cells
secrete promote immune-mediated clearance. However, Similar results were reproduced in cell
culture with primary human fibroblasts. Despite initially expressing classical markers of
senescence, cells resumed proliferation and lost markers of senescence within a week of the drug
being removed from the treatment media. Because the reversal was also observed in homogenous
cultures of human fibroblasts, it could not be completely attributable to Immune surveillance.
I found that human and mouse cells grown in the presence of the PI combination ATV/r,
and/or the NRTI combination TDF/FTC, exhibit senescent phenotypes, and that senescent cells
appear at sites of ageing pathology in vivo. If eliminating senescent cells that accumulate with PI
treatment could alleviate phenotypes associated with premature aging, this would prove causality
for age-related conditions associated with ART.
To decisively link NRTIs and mitochondrial dysfunction, and PIs and LMNA defects, to
specific age-related pathologies driven by the accumulation of senescent cells, I initially made
53

use of the p16-3MR mouse earlier described (Demaria, et al., 2014). However, unlike aged mice
which accumulate high levels of p16
INK4a
-positive cells, I found that the senescent cells that
accumulate with PI-treatment significantly express p21
WAF1
, whereas p16
INK4a
is expressed quite
modestly. Transgenic mice like the p16-3MR or INK-ATTAC (Baker, et al., 2016) selectively
eliminate p16
INK4a
-positive senescent cells. This limits the application of the p16-3MR to
diseases in which p16INK4a-positive cells are the major drivers of senescence related pathology.
Senolytic therapies that clear senescent cells are emerging as a promising category of
aging therapies. The senolytic drug ABT263 induces apoptosis in senescent cells expressing
either p16
INK4a
or p21
WAF1
-positive cells. As such, it has been demonstrated that progressive
illness such as pulmonary fibrosis can be reversed by senolytic drugs such as ABT-263 (Pan, et
al., 2017), and multiple clinical trials are underway for the use of senolytics in treating other
diseases (Kirkland & Tchkonia, 2020). In my studies using mouse dermal fibroblasts induced to
senesce by treatment with the NRTI combination TDF/FTC, ABT-263 selectively eliminated the
senescent cells over vehicle treated, proliferating controls. ABT-263 is therefore a viable option
for future research directions that are necessary to link ART drugs to specific age-related
diseases driven by the accumulation of senescent cells.
Still, other approaches might achieve similar results – I found that senescence phenotypes
were reversed in cell culture and mouse models after removal of treatment in conjunction with
the associated pathologies. In addition to supporting the idea that senescent cells promote HIV-
associated premature aging pathologies, this finding opens up new possibilities for clinical
interventions for patients suffering the toxic side effects of PI drugs like ATV/r. For example,
treatment regimens designed to cycle between periods of drug usage and cessation might provide
54

a novel strategy for reducing atazanavir induced premature aging phenotypes and restore
functional properties of cells.
Overall, this changes the paradigm on the irreversibility of senescence without persistent
DNA damage, and has implications for the biology of aging in that it hints at the potential
reversibility of some aspects of aging in humans.

55

CHAPTER 4: MATERIALS AND METHODS

4.1 Cell culture and treatment
IMR-90 primary human lung fibroblasts (ATCC, Manassas, VA; #CCL-186) were cultured in
Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher Scientific, Waltham, MA;
#12430–054) supplemented with penicillin and streptomycin (5,000 U/mL and 5,000 μg/mL;
Thermo Fisher Scientific, Waltham, MA; #15070063) and 10% fetal bovine serum (FBS;
Thermo Fisher Scientific, Waltham, MA; #2614079). Mouse dermal fibroblasts were isolated
from the dorsal skin of 3-month-old mice, as described (Demaria, et al., 2014). Primary mouse
cells were expanded for no more than 10 doublings. Human fibroblasts (HCA2) were obtained
from O. Pereira-Smith (The University of Texas Health Science Center, San Antonio). All cell
types were maintained at 37˚C, 10% CO2, and 3% O2.

4.2. Induction of senescence
Atazanavir, Ritonavir and Darunavir were purchased from Medchem Express (Princeton, NJ,
USA). Cells were cultured in appropriate media for 14 days, with DMSO (control) or with the
drugs dissolved in DMSO at 10 – 20µM / Cmax plasma concentrations according to the literature
(Auclair, Afonso, Cape, Caron-Debarle, & Capeau, 2014). Subsequently, cells were washed with
PBS and placed in serum–free DMEM. Cells and conditioned media were collected after 24
hours for further analyses

4.3. Vectors.
Lentiviral vectors containing the genetic suppressor element GSE22 were used for p53
inactivation (Gudkov, et al., 1993) (Ossovskaya, et al., 1996). IMR-90 fibroblasts were
56

transduced with lentiviral vectors expressing GSE22, or no insert (vector) as described
(Beauséjour, et al., 2003).

4.4. RT-PCR
Cells were incubated with drugs for 14 days. RNA was isolated from cultured cells using the
Bioline Isolate II RNA Mini Kit (Taunton). RNA was isolated from homogenized tissues using
TRizol reagent (Thermo Fisher Scientific) with the Direct-zol RNA MiniPrep Kit (Genesee
Scientific) as recommended by the supplier. Total mRNA was extracted followed by reverse
transcription (capacity cDNA reverse transcription kit, #4368814, Life Technologies). cDNA
synthesis and qRT-PCR were performed as described previously (Demaria, et al., 2017)
qRT-PCR was performed with LightCycler 480. See tables below for the primers and probes
used.

Table 4. Human Oligonucleotides

Human
Primers
UPL
Probe Forward Primer Reverse Primer
Actin-1 64 ccaaccgcgagaagatga tccatcacgatgccagtg
p16 67 gagcagcatggagccttc cgtaactattcggtgcgttg
P21 3 gtgctgcgagcaggagac ccattaagatcagattccttcttagc
LMNB1 3 gtgctgcgagcaggagac ccattaagatcagattccttcttagc
IL-6 45 gcccagctatgaactccttct gaaggcagcaggcaacac
IL-8 72 agacagcagagcacacaagc atggttccttccggtggt
IL-1α 6 ggttgagtttaagccaatcca tgctgacctaggcttgatga
IL-1β 78 tacctgtcctgcgtgttgaa tctttgggtaatttttgggatct
CXCL1 52 tcctgcatcccccatagtta cttcaggaacagccaccagt
CXCL10 34 gaaagcagttagcaaggaaaggt gacatatactccatgtagggaagtga
MMP9 6 gaaccaatctcaccgacagg gccacccgagtgtaaccata
MMP3 36 caaaacatatttctttgtagaggacaa ttcagctatttgcttgggaaa
AREG 73 tgatcctcacagctgttgct tccattctcttgtcgaagtttct

57

Table 5. Mouse Oligonucleotides

Mouse
Primers UPL Probe Forward Primer Reverse Primer
Actin-1 64 ctaaggccaaccgtgaaaag accagaggcatacagggaca
LMNB1 15 gggaagtttattcgcttgaaga atctcccagcctcccatt
IL-6 6 gctaccaaactggatataatcagga ccaggtagctatggtactccagaa
CXCL1 75 ttttgtatgtattagggtgaggaca gcgtgttgaccatacaatatgaa
CXCL10 3 gctgccgtcattttctgc tctcactggcccgtcatc
MMP3 76 aagggtcttccggtcctg atgcaatgggtaggatgagc
IL-1b 78 tgtaatgaaagacggcacacc tcttctttgggtattgcttgg
P21 9 ttgccagcagaataaaaggtg tttgctcctgtgcggaac
GM-CSF 58 cccaaatgaatggggtcat atactggctgcaccaatgc
TIMP1 76 gcaaagagctttctcaaagacc agggatagataaacagggaaacact
P16 5'/56-FAM/AGG TGA
TGA /ZEN/TGA TGG
GCA ACG TTC
AC/3IABkFQ/ -3'
aactctttcggtcgtacccc tcctcgcagttcgaatctg

4.5. Mice
p16-3MR mice were maintained in the AALAC-accredited Buck Institute for Research on Aging
animal facility. All procedures were approved by the Institutional Animal Care and Use
Committee. p16-3MR mice were bred in house. For ATV/r-induced senescence, 4-5-month old
p16-3MR mice were administered 62mg/Kg atazanavir with 21mg/kg ritonavir in their drinking
water for 8 weeks. TDF/FTC mice were administered 41mg/kg and 62mg/kg respectively for the
same period.

4.6. Bioluminescence
Mice were injected intraperitoneally (IP) with 25 ug of Xenolight RediJect Coelentarazine h
(Calipers/Perkin Elmer), a substrate for Renilla Luciferase to produce luminescence. 20 min after
IP injection, the mice were anesthetized with isoflurane and whole body luminescence measured
58

with a Xenogen IVIS-200 Optical in vivo imaging System (Caliper Life Sciences; 5 min medium
binning).

4.7. Western blotting
Cells were washed with cold PBS, lysed, and subjected to SDS-PAGE using 4%–12% Bis-Tris
gels; separated proteins were transferred to polyvinylidene fluoride membranes. Membranes
were blocked and incubated overnight at 4°C with antirabbit primary antibodies (p21, Cell
Signaling #2947 dil 1:1000; P-p53, Cell Signaling #9289 dil 1:1000; HMGB1, abcam# ab18256
dil 1:2000; Prelamin A, Millipore Sigma #mabt858 dil 1:500; β-actin Sigma-Aldrich #A2228
1:10000). Membranes were washed and incubated with horseradish peroxidase-conjugated
(1:5,000; Cell Signaling) secondary antibodies for 45 min at room temperature and washed
again. Signals were detected by enhanced chemiluminescence.

4.8. Senescence-associated β-galactosidase (SA- β-gal) staining
SA-β-gal activity was determined using the BioVision Senescence Detection Kit (Milpitas, CA;
#K320-250). For each condition and replicate, cells were counted and 20,000 cells were seeded
into TC-treated, 12-well cell culture plates (Genessee Scientific, Cat #: 25-106). After 24 hr, the
SA-β-gal staining assay was performed as per the manufacturer’s protocol. For each experiment,
approximately 100–150 cells were counted.

4.9. Cell proliferation assays
CellTrace™ Violet Cell Proliferation Kit was used according to the manufacturers protocol
(ThermoFisher Scientific Catalog number # C34557), for the labeling of cells in culture to trace
59

multiple generations using dye dilution by flow cytometry. Cells were harvested and stained with
1 μM CellTrace™ Violet dye per million cells and monitored for proliferation.

5.0. Flow Cytometry analysis
Cell proliferation analyses by FACS were performed as described (Tario, Conway, Muirhead, &
Wallace, 2018). Cells were analyzed using a BD FACS Aria (Becton Dickinson). CellTrace™
Violet was excited with the 405 nm laser and detected with the 450/50 band pass filter. The
detector voltage was established using unlabeled controls fully on-scale in the first decade and
then labeled cells were run to confirm that they were fully on-scale. The data was analyzed using
FlowJo_v10.6.2. The stained samples were gated at day 0 to encompass >95% of events and the
same gates were used at day 4 to ascertain the frequency of undivided cells.

5.1. Echocardiography
Two-dimensional transthoracic echocardiography was performed as described (Demaria, et al.,
2017). Mice were anesthetized using 1% isofluorane mixed with 100% oxygen while being
imaged. Echocardiography was performed using a LZ 550 series, 55-MHz MicroScan transducer
probe and a Vevo 2100 Imaging System (Flynn, et al., 2013). Left ventricular fractional
shortening and ejection fraction were determined from the M-mode of the parasternal short-axis
view. All parameters were averaged from at least 3 consecutive high-resolution cardiac cycles
for analysis.

60

5.2. Mass spectrometry analysis
Mass spectrometry was performed as described (Basisty, et al., 2020). Samples were analyzed by
reverse-phase HPLC-ESI-MS/MS using the Eksigent Ultra Plus nano-LC 2D HPLC system
(Dublin, CA) combined with a cHiPLC system directly connected to an orthogonal quadrupole
time-of-flight SCIEX TripleTOF 6600 or a TripleTOF 5600 mass spectrometer (SCIEX,
Redwood City, CA). All samples were analyzed by DIA, specifically using variable window
DIA acquisitions. In these DIA acquisitions, windows of variable width (5 to 90 m/z) are passed
in incremental steps over the full mass range (m/z 400–1,250). All collected data were processed
in Spectronaut using a panhuman library that provides quantitative DIA assays for approximately
10,000 human proteins.

5.3. Pathway and network analysis
Pathway and networks were analyzed as described (Basisty, et al., 2020). Gene ontology,
pathway, and network analysis was performed using the GlueGO package, version 2.5.3, in
Cytoscape (https://cytoscape.org/), version 3.7.1. Curated pathways for enrichment analysis were
referenced from the databases; GO Biological Function, GO Cellular Compartment, Kegg
pathways, WikiPathways, and Reactome Pathways. For gene ontology data, testing was
restricted to pathways with experimental evidence (EXP, IDA, IPI, IMP, IGI, IEP). The
statistical cutoff for enriched pathways was Bonferroni-adjusted p-values <0.01 by right-sided
hypergeometric testing. Pathway-connecting edges were drawn for kappa scores >40%.

61

5.4. Statistical analysis
Statistics were assessed using GraphPad Prism Software. For experiments with multiple
comparisons, one-way ANOVA and Dunnett’s multiple comparisons test were used. For
pairwise comparisons, data were analyzed using a two-way ANOVA or an unpaired two-tailed
Student t test. Data are presented as mean values +/- SD for in vivo and cell culture experiments.
Differences between means were considered significant when values were *p < 0.05, **p < 0.01,
and ***p < 0.001. ns denotes nonsignificant.

62

BIBLIOGRAPHY

Acosta, J. C., Banito, A., Wuestefeld, T., Georgilis, A., Janich, P., Morton, J. P., . . . Gill, J.
(2013). A complex secretory program orchestrated by the inflammasome controls
paracrine senescence. Nat. Cell Biol, 15, 978–990.

Afonso, P., Auclair, M., Boccara, F., Vantyghem, M. C., Katlama, C., Capeau, J., . . . Caron-
Debarle, M. (2016). LMNA mutations resulting in lipodystrophy and HIV protease
inhibitors trigger vascular smooth muscle cell senescence and calcification: Role of
ZMPSTE24 downregulation. Atherosclerosis, 245:200-211.

Antoniou, T., Szadkowski, L., Walmsley, S., Cooper, C., Burchell, A. N., Bayoumi, A. M., . . .
Raboud, J. (2017). Comparison of atazanavir/ritonavir and darunavir/ritonavir based
antiretroviral therapy for antiretroviral naïve patients. . BMC infectious diseases, , 17(1),
266.

Apostolova, N., Blas-Garcia, A., & Esplugues, J. V. (2011). Mitochondrial interference by anti-
HIV drugs: mechanisms beyond Pol-γ inhibition. Trends Pharmacol Sci, 32:715-725.

Apostolova, N., Blas-Garcıa, A., & Esplugues, J. V. (2011). Mitochondrial interference by
antiHIV drugs: mechanisms beyond Pol-γ inhibition. Trends in Pharmacological
Sciences, 32(12), 715–725.

Arathoon, E., Schneider, S., Baraldi, E., Lim, P. L., Opravil, M., Van De Casteele, T., &
Lavreys, L. (2013). Effects of once- daily darunavir/ritonavir versus lopinavir/ritonavir
on metabolic parameters in treatment-naive HIV-1-infected patients at week 96:
ARTEMIS. Int J STD AIDS , 24:12–17.

Auclair, M., Afonso, P., Cape, l. E., Caron-Debarle, M., & Capeau, J. (2014). Impact of
darunavir, atazanavir and lopinavir boosted with ritonavir on cultured human endothelial
cells: beneficial effect of pravastatin. Antiviral Therapy. , 19:773–782.

Baar, M. P., Brandt, R., Putavet, D. A., Klein, J., Derks, K., Bourgeois, B., . . . de Keizer, P.
(2017). Targeted Apoptosis of Senescent Cells Restores Tissue Homeostasis in Response
to Chemotoxicity and Aging. Cell, 169(1):132-147 e116.

Baker, D. .., Weaver, R. L., & van Deursen, J. M. (2013). p21 Both attenuates and drives
senescence and aging in BubR1 progeroid mice. . Cell Rep, 3, 1164–1174.

Baker, D. J., Childs, B. G., Durik, M., Wijers, M. E., Sieben, C. J., Zhong, J., . . . van Deursen, J.
M. (2016). Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan.
Nature, 530(7589):184-189.

Baker, D. J., Perez-Terzic, C., Jin, F., Pitel, K., Niederländer, N. J., Jeganathan, K., . . . van
Deursen, J. M. (2008). Opposing roles for p16Ink4a and p19Arf in senescence and ageing
caused by BubR1 insufficiency . Nature Cell Biology, 10(7), 825–836.
63

Baker, D. J., Wijshake, T., Tchkonia, T., LeBrasseur, N. K., Childs, B. G., van de Sluis, B., . . .
van Deursen, J. M. (2011). Clearance of p16Ink4a-positive senescent cells delays ageing-
associated disorders . Nature, 479(7372), 232–236.

Basisty, N., Kale, A., Jeon, O. H., Kuehnemann, C., Payne, T., Rao, C., . . . Schilling, B. (2020).
A proteomic atlas of senescence-associated secretomes for aging biomarker development.
PLoS biology, 16;18(1):e3000599.

Beauséjour, C. M., Krtolica, A., Galimi, F., Narita, M., Lowe, S. W., Yaswen, P., & Campisi, J.
(2003). Reversal of human cellular senescence: roles of the p53 and p16 pathways. The
EMBO journal, 22(16), 4212–4222.

Bergo, M. O., Gavino, B., Ross, J., Schmidt, W. K., Hong, C., Kendall, L. V., . . . Young, S. G.
(2002). Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle
weakness, and a prelamin A processing defect. Proc Natl Acad Sci, 99: 13049-13054.

Bhat, R., Crowe, E. P., Bitto, A., Moh, M., Katsetos, C. D., Garcia, F. U., . . . Torres, C. (2012).
Astrocyte senescence as a component of Alzheimer's disease. PloS one, 7(9), e45069.

Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B., . . . Wright, W.
E. (1998). Extension of life-span by introduction of telomerase into normal human cells .
Science, 279, 349–352.

Campisi, J. (2005). Aging, tumor suppression and cancer: high wire-act! Mech Ageing Dev,
126:5158.

Campisi, J. (2005). Senescent cells, tumor suppression and organismal aging: Good citizens, bad
neighbors. . Cell , 120:513-522.

Campisi, J. (2011). Cellular senescence: putting the paradoxes in perspective. . Curr Opin Genet
Dev, 21:107-112.

Campisi, J. (2013). Aging, cellular senescence and cancer. Annu Rev Physiol, 75:685-705.

Campisi, J., & d'Adda di Fagagna, F. (2007). Cellular senescence: when bad things happen to
good cells. . Nature Rev Molec Cell Biol, 8, 729-740.

Campisi, J., Andersen, J. K., Kapahi, P., & Melov, S. (2011). Cellular senescence: A link
between cancer and age-related degenerative disease? Semin Cancer Biol , 21:354-359.

Caron, M., Auclair, M., Donadille, B., Bereziat, V., Guerci, B., Laville, M., . . . Vigouroux, C.
(2007). Human lipodystrophies linked to mutations in A-type lamins and to HIV protease
inhibitor therapy are both associated with prelamin A accumulation, oxidative stress and
premature cellular senescence. Cell Death Differ, 14:1759-67.
64

Caron, M., Auclair, M., Sterlingot, H., Kornprobst, M., & Capeau, J. (2003). Some HIV protease
inhibitors alter lamin A/C maturation and stability, SREBP-1 nuclear localization and
adipocyte differentiation. AIDS, 17, 2437–2444.

Caron, M., Auclairt, M., Vissian, A., Vigouroux, C., & Capeau, J. (2008). Contribution of
mitochondrial dysfunction and oxidative stress to cellular premature senescence induced
by antiretroviral thymidine analogues. Antivir Ther., 13(1):27-38.

Centers for Disease Control and Prevention. (2020). Diagnoses of HIV Infection in the(Updated).
HIV Surveillance Report, 2018 (Updated); vol. 31.

Chang, A. C., Doherty, J., Huschtscha, L. I., Redvers, R., Restall, C., Reddel, R. R., & Anderson,
R. L. (2015). STC1 expression is associated with tumor growth and metastasis in breast
cancer. Clinical & experimental metastasis, 32(1), 15–27.

Childs, B. G., Baker, D. J., Wijshake, T., Conover, C. A., Campisi, J., & van Deursen, J. M.
(2016). Senescent intimal foam cells are deleterious at all stages of atherosclerosis.
Science (New York, N.Y.) , 354(6311), 472–477.

Chougrani, I., Luton, D., Matheron, S., Mandelbrot, L., & Azria, E. (2013). Safety of protease
inhibitors in HIV-infected pregnant women. HIV/AIDS (Auckland, N.Z.), 5:253–262.

Chung, H. Y., Cesari, M., Anton, S., Marzetti, E., Giovannini, S., Seo, A. Y., . . . Leeuwenburgh,
C. (2009). Molecular inflammation: underpinnings of aging and age-related diseases.
Ageing research reviews, 8(1), 18–30.

Coffinier, C., Hudon, S. E., Farber, E. A., Chang, S. Y., Hrycyna, C. A., Young, S. G., & Fong,
L. G. (2007). HIV protease inhibitors block the zinc metalloproteinase ZMPSTE24 and
lead to an accumulation of prelamin A in cells. Proc Natl Acad Sci U S A,
104(33):13432-13437.

Coffinier, C., Hudon, S. E., Lee, R., Farber, E. A., Nobumori, C., Miner, J. H., . . . Young, S. G.
(2008). A Potent HIV Protease Inhibitor, Darunavir, Does Not Inhibit ZMPSTE24 or
Lead to an Accumulation of Farnesyl-prelamin A in Cells. The Journal of Biological
Chemistry, 283(15), 9797-9804.

Cohen, J., & Torres, C. (2017). HIV-associated cellular senescence: A contributor to accelerated
aging. Ageing Res Rev., 36:117-124.

Coppe, J. P., Kauser, K., Campisi, J., & Beausejour, C. M. (2006). Secretion of vascular
endothelial growth factor by primary human fibroblasts at senescence. . J Biol Chem,
281: 29568–29574.

Coppé, J. P., Patil, C. K., Rodier, F., Krtolica, A., Beauséjour, C. M., Parrinello, S., . . . Campisi,
J. (2010). A Human-Like Senescence-Associated Secretory Phenotype Is Conserved in
Mouse Cells Dependent on Physiological Oxygen. PLoS ONE, 5(2), e9188.
65

Coppé, J. P., Patil, C. K., Rodier, F., Sun, Y., Muñoz, D. P., Goldstein, J., . . . Campisi, J. (2008).
Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of
oncogenic RAS and the p53 tumor suppressor . PLoS Biol, 6:2853-68.

Coppé, J. P., Rodier, F., Patil, C. K., Freund, A., Desprez, P. Y., & Campisi, J. (2011). Tumor
suppressor and aging biomarker p16(INK4a) induces cellular senescence without the
associated inflammatory secretory phenotype. The Journal of biological chemistry,
286(42), 36396–36403.

Daniels, L. B., Clopton, P., Laughlin, G. A., Maisel, A. S., & Barrett-Connor, E. (2011). Growth-
differentiation factor-15 is a robust, independent predictor of 11-year mortality risk in
community-dwelling older adults: the Rancho Bernardo Study. Circulation, 123(19),
2101–2110.

Davalos, A. R., Kawahara, M., Malhotra, G. K., Schaum, N., Huang, J., Ved, U., . . . J, C.
(2013). p53-dependent release of Alarmin HMGB1 is a central mediator of senescent
phenotypes. J Cell Biol, 201(4):613-29.

Demaria, M., Ohtani, N., Youssef, S. A., Rodier, F., Toussaint, W., Mitchell, J. R., . . . Campisi,
J. (2014). An essential role for senescent cells in optimal wound healing through
secretion of PDGF-AA. Dev Cell, 31(6), 722-733.

Demaria, M., Ohtani, N., Youssef, S. A., Rodier, F., Toussaint, W., Mitchell, J. R., . . . Campisi,
J. (2014). An essential role for senescent cells in optimal wound healing through
secretion of PDGF-AA. Developmental cell, 31(6), 722–733.

Demaria, M., O'Leary, M. N., Chang, J., Shao, L., Liu, S., Alimirah, F., . . . Campisi, J. (2017).
Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse. .
Cancer discovery, 7(2), 165–176.

Dimri, G. P., Lee, X., Basile, G., Acosta, M., Scott, G., Roskelley, C., . . . Pereira-Smith, O.
(1995). A biomarker that identifies senescent human cells in culture and in aging skin in
vivo. Proceedings of the National Academy of Sciences, 92 (20) 9363-9367.

Duvivier, C., Kolta, S., Assoumou, L., Ghosn, J., Rozenberg, S., Murphy, R. L., . . . Costagliola,
D. (2009). Greater decrease in bone mineral density with protease inhibitor regimens
compared with nonnucleoside reverse transcriptase inhibitor regimens in HIV-1 infected
naive patients. AIDS (London, England), 23(7), 817–824.

Farr, J. N., Xu, M., Weivoda, M. M., Monroe, D. G., Fraser, D. G., Onken, J. L., . . . Khosla, S.
(2017). Targeting cellular senescence prevents age-related bone loss in mice. Nat Med. ,
23(9):1072-1079.

Feldman, N., Rotter-Maskowitz, A., & Okun, E. (2015). DAMPs as mediators of sterile
inflammation in aging-related pathologies. Ageing Res Rev. , 24: 29–39.
66

Fitch, K. V., Feldpausch, M. N., & Looby, S. E. (2017). Biomarkers and Clinical Indices of
Aging with HIV. Interdiscip Top Gerontol Geriatr, 42:47-58.

Flynn, J. M., O'Leary, M. N., Zambataro, C. A., Academia, E. C., Presley, M. P., Garrett, B. J., .
. . Melov, S. (2013). Late-life rapamycin treatment reverses age-related heart dysfunction.
Aging cell, 12(5), 851–862.

Franceschi, C., & Campisi, J. (2014). Chronic inflammation (inflammaging) and its potential
contribution to age-associated diseases. J Gerontol A Biol Sci Med Sci, 69 Suppl 1, S4-9.

Freund, A., Laberge, R. M., Demaria, M., & Campisi, J. (2012). Lamin B1 loss is a senescence-
associated biomarker. . Molecular Biology of the Cell, 23(11):2066–2075.

Freund, A., Orjalo, A. V., Desprez, P. Y., & Campisi, J. (2010). Inflammatory networks during
cellular senescence: causes and consequences. . Trends in molecular medicine, 16(5),
238–246.

Fucikova, J., Moserova, I., Urbanova, L., Bezu, L., Kepp, O., Cremer, I., . . . Spisek, R. (2015).
Prognostic and Predictive Value of DAMPs and DAMP-Associated Processes in Cancer.
. Frontiers in immunology, 6, 402.

Gannon, P. J., Akay-Espinoza, C., Yee, A. C., Briand, L. A., Erickson, M. A., Gelman, B. B., . . .
Sciutto, K. L. (2017). HIV Protease Inhibitors Alter Amyloid Precursor Protein
Processing via β-Site Amyloid Precursor Protein Cleaving Enzyme-1 Translational Up-
Regulation. . The American journal of pathology, 187(1), 91–109.

Garg, A. D., Galluzzi, L., Apetoh, L., Baert, T., Birge, R. B., Bravo-San Pedro, J. M., . . .
Agostinis, P. (2015). Molecular and Translational Classifications of DAMPs in
Immunogenic Cell Death. Frontiers in immunology, , 6, 588.

Gordon, L. B., Massaro, J., D’Agostino, R. B., Campbell, S. E., Brazier, J., Brown, W. T., . . .
Kieran, M. W. (2014). Impact of Farnesylation Inhibitors on Survival in Hutchinson-
Gilford Progeria Syndrome. . Circulation, 130:27-34.

Guaraldi, G., Zona, S., Menozzi, M., Carli, F., Bagni, P., Berti, A., . . . Palella, F. (2013). Cost of
noninfectious comorbidities in patients with HIV. ClinicoEconomics and outcomes
research : CEOR, 5, 481–488.

Gudkov, A. V., R, Z. C., Kazarov, A. R., Thimmapaya, R., Suttle, D. P., Beck, W. T., & B, R. I.
(1993). Isolation of genetic suppressor elements, inducing resistance to topoisomerase II-
interactive cytotoxic drugs, from human topoisomerase II cDNA. Proc. Natl. Acad. Sci.
USA, 90:3231– 3235.

Guo, Y., Ayers, J. L., Carter, K. T., Wang, T., Maden, S. K., Edmond, D., . . . Grady, W. M.
(2019). Senescence-associated tissue microenvironment promotes colon cancer formation
through the secretory factor GDF15. Aging cell, 18(6), e13013.
67

Hayflick, L. (1965). The limited in vitro lifetime of human diploid cell strains. . Exp Cell Res,
37, 614-636.

Hayflick, L., & Moorhead, P. S. (1961). The serial cultivation of human diploid cell strains . Exp
Cell Res, 25, 585-621.

Hernandez-Vallejo, S. .., Beaupere, C., Larghero, J., Capeau, J., & Lagathu, C. (2013). HIV
protease inhibitors induce senescence and alter osteoblastic potential of human bone
marrow mesenchymal stem cells: beneficial effect of pravastatin. Aging cell , 12, 955-
965.

Ho, J. E., Hwang, S. J., Wollert, K. C., Larson, M. G., Cheng, S., Kempf, T., . . . Fox, C. S.
(2013). Biomarkers of cardiovascular stress and incident chronic kidney disease. Clinical
chemistry, 59(11), 1613–1620.

Hodes, R. J., Sierra, F., Austad, S. N., Epel, E., Neigh, G. N., Erlandson, K. M., . . . Hunt, P. W.
(2016). Disease drivers of aging. Annals of the New York Academy of Sciences, 1386(1),
45–68.

Huang, J., Xie, Y., Sun, X., Zeh, H. J., Kang, R., Lotze, M. T., & Tang, D. (2015). DAMPs,
ageing, and cancer: The 'DAMP Hypothesis'. Ageing research reviews, , 24(Pt A), 3–16.

Hudson, M. M., Ness, K. K., Gurney, J. G., Mulrooney, D. A., Chemaitilly, W., Krull, K. R., . . .
Robinson, L. L. (2013). Clinical ascertainment of health outcomes amoung adults treated
for childhood cancer. JAMA, 309(22), 2371-2381.

Hunt, P. W. (2012). HIV and inflammation: mechanisms and consequences. Current HIV/AIDS
reports, 9(2), 139–147.

Jabbari Azad, F., Talaei, A., Rafatpanah, H., Yousefzadeh, H., Jafari, R., Talaei, A., & Farid
Hosseini, R. (2014). Association between cytokine production and disease severity in
Alzheimer’s disease. . Iran. J. Allergy Asthma Immunol., 13, 433–439.

Jeyapalan, J. C., & Sedivy, J. M. (2008). Cellular senescence and organismal aging. Mech
Ageing Dev, 129:467-474.

Jun, J. I., & Lau, L. F. (2010). The Matricellular Protein CCN1/CYR61 Induces Fibroblast
Senescence and Restricts Fibrosis in Cutaneous Wound Healing. Nature Cell Biology,
12(7), 676–685.

Jurk, D., Wilson, C., Passos, J. F., Oakley, F., Correia-Melo, C., Greaves, L., . . . von Zglinicki,
T. (2014). Chronic inflammation induces telomere dysfunction and accelerates ageing in
mice. Nat. Commun. , 2, 4172.

68

Kang, T. W., Yevsa, T., Woller, N., Hoenicke, L., Wuestefeld, T., Dauch, D., . . . Zender, L.
(2011). Senescence surveillance of pre-malignant hepatocytes limits liver cancer
development. Nature, 479(7374), 547–551.

Karrasch, S., Holz, O., & Jörres, R. A. (2008). Aging and induced senescence as factors in the
pathogenesis of lung emphysema. . Respir Med, 102:1215-1230.

Kennedy, B. K., Berger, S. L., Brunet, A., Campisi, J., Cuervo, A. M., Epel, E. S., . . . Sierra, F.
(2014). Geroscience: linking aging to chronic disease. Cell, 159(4), 709-713.

Kim, S. H., Beausejour, C., Davalos, A. R., Kaminker, P., & Heo, S. J. (2004). TIN2 mediates
the functions of TRF2 at telomeres. J Biol Chem , 279: 43799– 43804.

Kirkland, J. L., & Tchkonia, T. (2020). Senolytic drugs: from discovery to translation. Journal of
internal medicine, 10.1111/joim.13141. Advance online publication.

Kozlowski, M. R. (2012). RPE cell senescence: A key contributor to age-related macular
degeneration. Med Hypotheses, 78:505-510.

Krizhanovsky, V., Yon, M., Dickins, R. A., Hearn, S., Simon, J., Miething, C., . . . Lowe, S. W.
(2008). Senescence of activated stellate cells limits liver fibrosis. Cell, 134(4), 657–667.

Krtolica, A., Parrinello, S., Lockett, S., Desprez, P. Y., & Campisi, J. (2001). Senescent
fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and
aging. Proceedings of the National Academy of Sciences of the United States of America,
98(21), 12072–12077.

Kurz, D. J., Decary, S., Hong, Y., & Erusalimsk, J. D. ( 2000). Senescence-associated β-
galactosidase reflects an increase in lysosomal mass during replicative ageing of human
endothelial cells. J. Cell Sci, 113:3613–22.

Kusko, R. L., Banerjee, C., Long, K. K., Darcy, A., Otis, J., Sebastiani, P., . . . Montano, M.
(2012). Premature expression of a muscle fibrosis axis in chronic HIV infection. Skeletal
muscle, 2(1), 10.

Laberge, R. M., Adler, D., DeMaria, M., Mechtouf, N., Teachenor, R., Cardin, G. B., . . . Rodier,
F. (2013). Mitochondrial DNA damage induces apoptosis in senescent cells. Cell death &
disease, 4(7), e727.

Laberge, R. M., Awad, P., Campisi, J., & Desprez, P. (2012). Epithelial-mesenchymal transition
induced by senescent fibroblasts . Cancer Microenviron., 5, 39–44.

Lefevre, C., Auclair, M., Boccara, F., Bastard, J. P., Capeau, J., Vigouroux, C., & Caron-
Debarle, M. (2010). Premature senescence of vascular cells is induced by HIV protease
inhibitors: implication of prelamin A and reversion by statin. Arterioscler Thromb Vasc
Biol, 30(12):2611-20.
69

Lennox, J. L., Landovitz, R. J., Ribaudo, H. J., Ofotokun, I., Na, L. H., Godfrey, C., . . . Team,
A. A. (2014). Efficacy and tolerability of 3 nonnucleoside reverse transcriptase inhibitor-
sparing antiretroviral regimens for treatment-naive volunteers infected with HIV-1: a
randomized, controlled equivalence trial. . Annals of internal medicine, 161(7), 461–471.

Libby, P. (2006). Inflammation and cardiovascular disease mechanisms. . Am. J. Clin. Nutr, 83,
456S–460S.

Lohse, N., Hansen, A. E., Pedersen, G., Kronborg, G., Gerstoft, J., Sorensen, H. T., . . . Obel, N.
(2007). Survival of Persons with and without HIV Infection in Denmark, 1995–2005 .
Ann Intern Med, 146:87-95.

Maraldi, N. M., Capanni, C., Cenni, V., Fini, M., & Lattanzi, G. (2011). Laminopathies and
lamin- associated signaling pathways. J Cell Biochem, 112:979-92.

Marcus, J. L., Chao, C. R., Leyden, W. A., Xu, L., Quesenberry, C. P., Klein, D. B., . . .
Silverberg, M. J. (2016). Narrowing the Gap in Life Expectancy Between HIV-Infected
and HIV-Uninfected Individuals With Access to Care. J Acquir Immune Defic Syndr,
73(1): 39-46.

Mattout, A., Dechat, T., Adam, S. A., Goldman, R. D., & Gruenbaum, Y. (2006). Nuclear
lamins, diseases and aging. . Curr. Opin. Cell Biol, 18, 335–341.

McClintock, D., Gordon, L. B., & Djabali, K. (2006). Hutchinson-Gilford progeria mutant lamin
A primarily targets human vascular cells as detected by an anti-lamin A G608G antibody.
Proc. Natl. Acad. Sci. U. S. A, 103, 2154–2159.

McComsey, G. A., Moser, C., Currier, J., Ribaudo, H. J., Paczuski, P., Dubé, M. P., . . . Brown,
T. T. (2016). Body Composition Changes After Initiation of Raltegravir or Protease
Inhibitors: ACTG A5260s. Clinical infectious diseases : an official publication of the
Infectious Diseases Society of America, 62(7), 853–862.

Menzaghi, B., Ricci, E., Carenzi, L., Parruti, G., Orofino, G., Guastavigna, M., . . . T, Q. (2013).
Safety and durability in a cohort of HIV-1 positive patients treated with once and twice
daily darunavir-based therapy (SCOLTA Project). Biomed Pharmacother , 67:293–298.

Muñoz-Espín, D., & Serrano, M. (2014). Cellular senescence: from physiology to pathology. Nat
Rev Mol Cell Biol, 15(7):482-96.

Muñoz-Espín, D., Cañamero, M., Maraver, A., Gómez-López, G., Contreras, J., Murillo-Cuesta,
S., . . . Serrano, M. (2013). Programmed cell senescence during mammalian embryonic
development . Cell, 155, 1104–1118.

Nacarelli, T. A., & Sell, C. (2016). Mitochondrial stress induces cellular senescence in an
mTORC1-dependent manner. . Free radical biology & medicine, , 95, 133–154.
70

Narita, M., Nunez, S., Heard, E., Narita, M., Lin, A. W., Hearn, S. A., . . . Lowe, S. W. (2003).
Rb-Mediated Heterochromatin Formation and Silencing of E2F Target Genes during
Cellular Senescence. Cell, 113:703–716.

Nolan, D. (2003). Metabolic complications associated with HIV protease inhibitor therapy. .
Drugs, 63(23):2555-74.

Office of AIDS Research Advisory Council. (2019). What to Start: Initial Combination
Regimens for the Antiretroviral-Naive Patient | Adult and Adolescent ARV |. Rockville,
MD: ClinicalInfo. Retrieved October 05, 2020, from
https://clinicalinfo.hiv.gov/en/guidelines/adult-and-adolescent-arv/what-start-initial-
combination-regimens-antiretroviral-naive?view=full

Ohkouchi, S., Ono, M., Kobayashi, M., Hirano, T., Tojo, Y., Hisata, S., . . . Kurosawa, H.
(2015). Myriad Functions of Stanniocalcin-1 (STC1) Cover Multiple Therapeutic Targets
in the Complicated Pathogenesis of Idiopathic Pulmonary Fibrosis (IPF). Clinical
medicine insights. Circulatory, respiratory and pulmonary medicine, 9(Suppl 1), 91–96.

Olive, M., Harten, I., Mitchell, R., Beers, J. K., Djabali, K., Cao, K., . . . Gordon, L. B. (2010).
Cardiovascular pathology in Hutchinson-Gilford progeria: correlation with the vascular
pathology of aging. Arterioscler Thromb Vasc Biol , 30:2301-9.

Orkin, C., DeJesus, E., Khanlou, H., Stoehr, A., Supparatpinyo, K., Lathouwers, E., . . . Tomaka,
F. (2013). 192-week efficacy and safety of once-daily darunavir/ritonavir compared with
lopinavir/ritonavir in HIV-1-infected treatment-naive patients in the ARTEMIS trial. .
HIV Med , 14:49–59.

Osorio, F. G., Ugalde, A. P., Marino, G., Puente, X. S., Freije, J. M., & Lopez-Otin, C. (2011).
Cell autonomous and systemic factors in progeria development. Biochem Soc Trans, 39:
1710–1714.

Ossovskaya, V. S., Mazo, .. A., Chernov, M. V., Chernova, O. B., Strezoska, Z., Kondratov, R., .
. . Gudkov, A. V. (1996). Use of genetic suppressor elements to dissect distinct biological
effects of separate p53 domains. Proc Natl Acad Sci U S A, 93: 10309–10314.

Pan, J., Li, D., Xu, Y., Zhang, J., Wang, Y., Chen, M., . . . Meng, A. (2017). Inhibition of Bcl-
2/xl With ABT-263 Selectively Kills Senescent Type II Pneumocytes and Reverses
Persistent Pulmonary Fibrosis Induced by Ionizing Radiation in Mice. International
journal of radiation oncology, biology, physics, 99(2), 353–361.

Parks, W. C., Wilson, C. L., & López-Boado, Y. S. (2004). Matrix metalloproteinases as
modulators of inflammation and innate immunity. Nature Rev Immunol , 4:817-629.

Parrinello, S., Coppe, J. P., Krtolica, A., & Campisi, J. (2005). Stromal-epithelial interactions in
aging and cancer: senescent fibroblasts alter epithelial cell differentiation. Journal of cell
science, 118(Pt 3), 485–496.
71

Pathai, S., Bajillan, H., Landay, A. L., & High, K. P. (2014). Is HIV a model of accelerated or
accentuated aging?. The journals of gerontology. Series A, Biological sciences and
medical sciences, 69(7), 833–842.

Pendas, A. M., Zhou, Z., Cadinanos, J., Freije, J. M., Wang, J., Hultenby, K., . . . López-Otín, C.
(2002). Defective prelamin A processing and muscular and adipocyte alterations in
Zmpste24 metalloproteinasedeficient mice . Nature genetics, 31(1), 94–99.

Rajagopalan, S., & Long, E. O. ( 2012). Cellular senescence induced by CD158d reprograms
natural killer cells to promote vascular remodeling. Proceedings of the National Academy
of Sciences of the United States of America,, 109(50), 20596–20601.

Ripamonti, D., Cattaneo, D., Maggiolo, F., Airoldi, M., Frigerio, L., Bertuletti, P., . . . Suter, F.
(2007). Atazanavir plus low-dose ritonavir in pregnancy: pharmacokinetics and placental
transfer. . AIDS, 21(18):2409-15.

Rodier, F., & Campisi, J. (2011). Four faces of cellular senescence. J Cell Biol , 192:547-556.

Rodier, F., Muñoz, D. P., Teachenor, R., Chu, V., Le, O., Bhaumik, D., . . . Campisi, J. (2011).
DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth
arrest and inflammatory cytokine secretion. Journal of Cell Science, 124(Pt 1), 68–81.
doi:https://doi.org/10.1242/jcs.071340

Rokx, C., Borjas Howard, J. F., Smit, C., Wit, F. W., Pieterman, E., Reiss, P., . . . Rijnders, B.
(2020). Risk of recurrent venous thromboembolism in patients with HIV infection: A
nationwide cohort study. . PLoS medicine, 17(5), e1003101.

Rosas, I. O., Richards, T. J., Konishi, K., Zhang, Y., Gibson, K., Lokshin, A. E., . . . Kaminski,
N. (2008). MMP1 and MMP7 as potential peripheral blood biomarkers in idiopathic
pulmonary fibrosis. . PLoS medicine, 5(4), e93.

Roy, R., Yang, J., & Moses, M. A. (2009). Matrix Metalloproteinases As Novel Biomarkers and
Potential Therapeutic. J Clin Oncol., 27: 5287–5297.

Scaffidi, P., & Misteli, T. (2006). Lamin A-dependent nuclear defects in human aging. Science ,
312:1059-1063.

Schafer, R. W., & Vuitton, D. A. (1999 Mar). Highly active antiretroviral therapy (HAART) for
the treatment of infection with human immunodeficiency virus type 1. Biomed.
Pharmacother., 53(2):73-86.

Shahim, P., Blennow, K., Johansson, P., Svensson, J., Lista, S., Hampel, H., . . . Zetterberg, H.
(2017). Cerebrospinal Fluid Stanniocalcin-1 as a Biomarker for Alzheimer's Disease and
Other Neurodegenerative Disorders. Neuromolecular medicine, 19(1), 154–160.
72

Shiels, M. S., Pfeiffer, R. M., Gail, M. H., Hall, H. I., Li, J., Chaturvedi, A. K., . . . Engels, E. A.
(2011). Cancer burden in the HIV-infected population in the United States. . Journal of
the National Cancer Institute, 103(9), 753–762.

Smith, R. L., de Boer, R., Brul, S., Budovskaya, Y., & van Spek, H. (2013). Premature and
accelerated aging: HIV or HAART? Frontiers in genetics, 3, 328.

Storer, M., Mas, A., Robert-Moreno, A., Pecoraro, M., Ortells, M. C., Di Giacomo, V., . . . WM,
K. (2013). Senescence is a developmental mechanism that contributes to embryonic
growth and patterning. Cell, 21;155(5):1119-30.

Su, J., Guo, B., Zhang, T., Wang, K., Li, X., & Liang, G. (2015). Stanniocalcin-1, a new
biomarker of glioma progression, is associated with prognosis of patients. Tumour
biology : the journal of the International Society for Oncodevelopmental Biology and
Medicine, 36(8), 6333–6339.

Sun, Y., Campisi, J., Higano, C., Beer, T. M., Porter, P., Coleman, I., . . . Nelson, P. S. (2012).
Treatment-induced damage to the tumor microenvironment promotes prostate cancer
therapy resistance through WNT16B. Nature medicine, 18(9), 1359–1368.

Takai, H., Smogorzewska, A., & de Lange, T. (2003). DNA damage foci at dysfunctional
telomeres. . Curr. Biol, 13:1549–56.

Tanaka, T., Biancotto, A., Moaddel, R., Moore, A. Z., Gonzalez-Freire, M., Aon, M. A., . . .
Ferrucci, L. (2018). Plasma proteomic signature of age in healthy humans. Aging Cell,
Oct;17(5):e12799.

Tario, J. D., Conway, A. N., Muirhead, K. A., & Wallace, P. K. (2018). Monitoring Cell
Proliferation by Dye Dilution: Considerations for Probe Selection. Methods in molecular
biology (Clifton, N.J.), 1678, 249–299.

Tchkonia, T., Morbeck, D. E., Von Zglinicki, T., Van Deursen, J., Lustgarten, J., Scrable, H., . . .
Kirkland, J. L. (2010). Fat tissue, aging, and cellular senescence. Aging cell, 9(5), 667–
684.

The Antiretroviral Therapy Cohort Collaboration. (2008). Life expectancy of individuals on
combination antiretroviral therapy in high-income countries: a collaborative analysis of
14 cohort studies. Lancet, 372: 293–99.

Torres, R. A., & Lewis, W. (2014.). Aging and HIV/AIDS: pathogenetic role of therapeutic side
effects. Lab Invest, 94:120-128.

U.S. Food and Drug Administration. (2020). HIV and AIDS: Medicines to Help You.
https://www.fda.gov/consumers/free-publications-women/hiv-and-aids-medicines-help-
you.
73

UNAIDS. (2020). Global HIV & AIDS statistics - 2020 fact sheet. UNAIDS.
https://www.unaids.org/en/resources/fact-sheet.

Van Deursen, J. M. (2014). The role of senescent cells in ageing. Nature, 509(7501), 439–446.

Vasto, S., Candore, G., Balistreri, C. R., Caruso, M., Colonna-Romano, G., Grimaldi, M. P., . . .
Caruso, C. (2007). Inflammatory networks in ageing, age-related diseases and longevity.
Mechanisms of ageing and development, 128(1), 83–91.

Wang, J., Lu, X. X., Chen, D. Z., Li, S. F., & Zhang, L. S. (2004). Herpes simplex virus
thymidine kinase and ganciclovir suicide gene therapy for human pancreatic cancer.
World journal of gastroenterology, 10(3), 400–403.

Webster, M. R., Xu, M., Kinzler, K. A., Kaur, A., Appleton, J., O'Connell, M. P., . . .
Weeraratna, A. T. (2015). Wnt5A promotes an adaptive, senescent-like stress response,
while continuing to drive invasion in melanoma cells. . Pigment cell & melanoma
research, 28(2), 184–195.

Wiley, C. D., Liu, S., Limbad, C., Zawadzka, A. M., Beck, J., Demaria, M., . . . Kapahi, P.
(2019). SILAC Analysis Reveals Increased Secretion of Hemostasis-Related Factors by
Senescent Cells. . Cell reports, 28(13), 3329–3337.e5.

Wiley, C. D., Velarde, M. C., Lecot, P., Liu, S., Sarnoski, E. A., Freund, A., . . . Campisi, J.
(2016). Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory
Phenotype. Cell Metab, 23:303-14.

Wing, E. J. (2016). HIV and aging. International journal of infectious diseases : IJID : official
publication of the International Society for Infectious Diseases, 53, 61–68.

Wollert, K. C., Kempf, T., & Wallentin, L. (2017). Growth Differentiation Factor 15 as a
Biomarker in Cardiovascular Disease. Clinical chemistry, 63(1), 140–151.

Worman, H. J., & Foisner, R. (2010). The nuclear envelope from basic biology to therapy. .
Biochem Soc Trans., 38(Pt 1):253-6.

Yan, J., Fu, Q., Cheng, L., Zhai, M., Wu, W., Huang, L., & Du, G. (2014). Inflammatory
response in parkinson’s disease (review). Mol. Med. Rep., 10, 2223–2233.

Young, S. G., Fong, L. G., & Michaelis, S. (2005). Prelamin A, Zmpste24, misshapen cell
nuclei, and progeria–new evidence suggesting that protein farnesylation could be
important for disease pathogenesis. J. Lipid Res., 46, 2531–2558.

Zhou, S., Greenberger, J. S., Epperly, M. W., Goff, J. P., Adler, C., Leboff, M. S., & Glowacki,
J. (2008). Age-related intrinsic changes in human bone-marrow-derived mesenchymal
stem cells and their differentiation to osteoblasts. Aging cell, 7(3), 335–343.
74

Zicari, S., Sessa, L., Cotugno, N., Ruggiero, A., Morrocchi, E., Concato, C., . . . Palma, P.
(2019). Immune Activation, Inflammation, and Non-AIDS Co-Morbidities in HIV-
Infected Patients under Long-Term ART. Viruses, 11(3), 200.

Abstract (if available)

Abstract Aging generates a myriad of phenotypes and pathologies that impair tissue homeostasis and function. Despite progress in understanding the genetic and molecular processes that drive aging, there remain large gaps in our knowledge. One approach to gaining deeper insights into the causes and consequences of aging is to study genetic and environmental conditions that accelerate the process. ❧ Antiretroviral drugs have dramatically improved the prognosis of HIV-infected patients, with strikingly reduced morbidity and mortality. However, long-term use is now associated with multiple signs of premature aging, including lipodystrophy, osteoporosis, type 2 diabetes, cardiovascular disease and cancer. Highly active antiretroviral therapy (HAART) generally comprises two nucleoside reverse transcriptase inhibitors (NRTIs) with one of three additional antiretroviral drug classes, which include protease inhibitors (PIs). These two component drug classes are implicated in the premature aging effects seen in patients. The NRTIs can inhibit the mammalian mitochondrial DNA polymerase (polymerase gamma

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Alpha-ketoglutarate, an endogenous metabolite, extends lifespan and compresses morbidity in aging mice

PDF

Characterization of senescent cell heterogeneity using cell culture models

PDF

Natural divergence of traits in species of mice reveals novel molecular mechanisms of cellular senescence

PDF

The overlap between mTOR signaling, rapamycin and cellular senescence

PDF

The regulation, roles, and mechanism of action of mitochondrial-derived-peptides (MDPs) in aging

PDF

Computational approaches to identify genetic regulators of aging and late-life mortality

PDF

Longitudinal assessment of neural stem-cell aging

PDF

Investigating brain aging and neurodegenerative diseases through omics data

PDF

Investigating the effects of polycomb repressive complex inhibitors on cancer cell phenotypic plasticity

PDF

Factors that may impact drug disposition and metabolism

PDF

Mediating the homeostatic response during light & cytotoxic induced retinal damage

PDF

Treatment of HPV driven tumors with SH5-07, a small molecule inhibitor targeting STAT3

PDF

Synthetic small molecules and protein secondary structure mimetics as modulators of hypoxia-inducible transcription and integrin receptors function

Asset Metadata

Creator Kuehnemann, Chisaka (author)

Core Title A small molecule protease inhibitor induces senescence phenotypes that are reversible upon drug removal

School Leonard Davis School of Gerontology

Degree Doctor of Philosophy

Degree Program Biology of Aging

Publication Date 12/11/2020

Defense Date 10/13/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aging,ART, antiretroviral therapy,ATV/r, atazanavir/ritonavir,cellular senescence,HAART, highly active antiretroviral therapy,OAI-PMH Harvest,PI, protease inhibitor,SASP, senescence-associated secretory phenotype

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lithgow, Gordon (committee chair), Campisi, Judith (committee member), Cohen, Pinchas (committee member), Schilling, Birgit (committee member)

Creator Email chisaka@gmail.com,kuehnema@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-413388

Unique identifier UC11667174

Identifier etd-Kuehnemann-9193.pdf (filename),usctheses-c89-413388 (legacy record id)

Legacy Identifier etd-Kuehnemann-9193.pdf

Dmrecord 413388

Document Type Dissertation

Rights Kuehnemann, Chisaka

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA