University of Southern California Dissertations and Theses

Macrophage-specific Stat3 deletion in a mouse model of Alzheimer’s disease

(USC Thesis Other)

Macrophage-specific Stat3 deletion in a mouse model of Alzheimer’s disease

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

Macrophage-specific Stat3 deletion in a
mouse model of Alzheimer’s disease

By

Rachel Oseas

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA

In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(Medical Physiology)
May 2019

2
Acknowledgements

First, I want to thank Dr. Terrence Town for welcoming me into his lab. I would also like
to extend a heartfelt thank you to Dr. Harvey Kaslow for never failing to make himself
available to me to talk about academics, life, and how to give a great presentation. If you
hadn’t taken a chance on me it’s unlikely I would be successfully transitioning into my
studies to become a physician assistant. Finally, I’d like to thank Dr. Austin Mircheff for
taking time to listen to my thesis defense.

I’d also like to thank the entire Town lab. I feel so fortunate to have found such an
incredible family. I can honestly say the last two years have been some of the best of my
life because of you. Alex, thank you for teaching me how to pipette, for never getting
frustrated with me when I repeatedly asked for help with dilution calculations, and for your
invaluable advice editing and preparing my thesis manuscript. Alicia, thank you for being
such a supportive and positive influence in the lab. Your constant optimism was welcome
when it seemed like all my experiments were going wrong and your memes made it
impossible to feel dejected for too long. Cole, thank you for always offering to help when
I felt overwhelmed with work and for your comradery during our application struggles.
Chris, thank you for always being excited for me, even when my results seemed weird,
and for your pep-talks when I felt down. Brian, thank you for introducing me to the world
of science and how it “vibed” with the Town lab. Thank you for staying late with me when
my experiments ran over and always making yourself available for my questions. Anakha,
thank you for always believing in me and being so supportive whenever I struggled with
something. Also, thank you for your hugs and for always being excited to eat chocolate
with me. And Nima, thank you for suffering through stereology with me and being a
positive light even when our Zeiss cave seemed to encompass the darkest of times.

More than anyone, I need to thank Mariana Figueiredo Uchoa. The words “thank you”
can never be enough to describe how truly grateful I am for all your mentorship and help
over the last two years. This thesis would not have been possible without you. You taught
me to think like a scientist, but more importantly, you taught me what it means to be truly
selfless for others. You are the best role model I could have ever hoped for and an
incredible friend. I only hope that one day I can inspire someone else as much as you
have inspired me.

Lastly, I want to thank my entire family for all their encouragement and understanding
over the last two years. Mom, thank you for your emotional support during this program.
Thank you for all the hours you listened to me vent about my experiments and for your
enthusiasm, whether they were successful or not. Aunt Marti and Uncle Lou, thank you
for always accommodating my schedule when we made plans, and for all your love and
support in my daily life. Nana and Papa, thank you for your love and for making it possible
for me to attend USC. Finally, I’d like to thank my boyfriend Zachary for his unyielding
faith that I will succeed at whatever I do. Your belief in me is a solid foundation for the
times I feel overwhelmed and forget to believe in myself.

3
Abbreviations
Early-onset Alzheimer’s disease (EOAD)
Late-onset Alzheimer’s disease (LOAD)
Amyloid precursor protein (APP)
Presenilin 1 and 2 (PSEN1 and PSEN2)
Amyloid-beta (Ab)
Apolipoprotein E4 (APOE4)
Triggering receptor on myeloid cells 2 (TREM2)
Genome wide association studies (GWAS)
Signal transducer and activator of transcription 3 (STAT3)
Neurofibrillary tangles (NFTs)
Interleukin 1b (IL1b), interleukin 10 (IL10), interleukin 6 (IL6)
Interferon gamma (IFNg)
Tumor necrosis factor alpha (TNFa)
Monocyte chemoattract protein 1 (MCP-1)
Toll-like receptors (TLRs)
G protein-coupled receptors (GPCRs)
C-C chemokine receptor type 2 (CCR2)
Suppressor of Cytokine Signaling 3 (SOCS3)
Bone marrow derived monocytes (BMDM)
Colony stimulating factor 1 receptor (Csf1r)

4
Table of Contents

Acknowledgements……………………………………………………………………..………2
Abbreviations………………...………………………………………………………….………3
Table of Contents…………...……………………………………………………………..……4
Introduction………………………………………………………………………….……….…..5
Alzheimer’s Disease Pathological Hallmarks…………………………….……….….7
Innate Immune System…………………………………………………………………9
Stat3, Immunity, and AD……………………………………………………..……….12
Materials and Methods……………………………………………………..……………..…..14
Animals ……………………………………………………..……..…………………...14
Bone Marrow Derived Monocyte (BMDM) Isolation and Differentiation..………..15
Flow Cytometry …..…………………………………..……..…………………...…....16
Electrochemical ELISA (MSD) ...………..……..…………………….………….......17
Immunohistochemistry………………………………..……..…………...…………...18
Image Acquisition and Quantification…………..…..……..…………...……………19
mRNA isolation and Quantitative Polymerase Chain Reaction (qPCR)…...........20
Western Blot………………………………..……..…………...……………………....20
Statistical Analysis……………….… …..…..…………...……………………….......21
Results ………………………………..……..………………………...……………………....21
Brain and peripheral macrophages are targeted in Csf1r-cre
+
mice……….........21
Stat3 deletion in macrophages shows sex-specific increase in cerebral Ab……22
Stat3 deletion in macrophages alters innate immunity profile ….…..........……...23
Stat3 inhibition decreases macrophage differentiation in vitro……………..........25
Discussion…………………………………………………………..……..…………………..25
Conclusion…………………………………………………………..……..……………..…....29
Figures………………………………………………………..……..……..……………..…....30
References…………………………………………………………..……..……………….....41

5
Introduction
Alzheimer’s disease (AD) is the most common form of dementia, affecting 5.7
million people in the United States. This progressive neurodegenerative disorder is
considered the sixth leading cause of death in America
1
. Of those affected, 5.5 million are
over the age of 65 and nearly two-thirds of them are women. The risk for AD increases
with age, and the population over the age of 65 in the United States is expected to grow
from 53 million to 88 million by 2050
1,2
. As a result, the prevalence, i.e. the number of
individuals affected at a current point in time, is expected to nearly triple, from 5.7 million
to 13.2 million, by 2050
1,2
.
Early-onset Alzheimer’s Disease (EOAD) or ‘familial AD’ is a form of AD that affects
less than 5% of all patients
1,2
. EOAD is determined by genetic factors and is inherited in
an autosomal-dominant fashion. Three genetic mutations have been identified as
deterministic in causing the disease: amyloid precursor protein (APP), presenilin 1
(PSEN1), and presenilin 2 (PSEN2). The mutations that cause EOAD occur either in the
substrate (APP) or the protease (PSEN1 and 2) of the enzymatic reaction that generates
a 39-42 amino acid amyloid-b (Ab) peptide
2-5
. In the non-amyloidogenic pathway, APP is
cleaved by a-secretase and forms APPa, a soluble amyloid fragment that is associated
with neuronal development and protection
3,4
. In the amyloidogenic pathway, APP is
cleaved by b-secretase and g-secretase to form Ab, a peptide that leads to synaptic
damage and neurodegeneration. In AD, the predominant Ab species are 40 or 42 amino
acids in length. Ab1-40 is prone for vasculature deposition, while the hydrophobicity of the
final two amino acids in Ab1-42 makes it highly susceptible to aggregate and form senile
plaques
4–6
.
6
Patients with late-onset Alzheimer’s disease (LOAD), also known as ‘sporadic’ AD,
account for more than 95% of all cases
1,2,7
. Rather than a strong underlying genetic factor
driving the disease, LOAD results from a combination of environmental and genetic risk
factors. For instance, human and animal studies have shown that air pollution, obesity,
and diabetes all increase the risk for AD
2-4,8-13
. Studies have also shown that having the
Apolipoprotein E4 (APOE4) allele (odds ratio: 14.9) or variants in the Triggering receptor
on myeloid cells 2 (TREM2) gene (odds ratio: 2.7) are genetic indicators for disease
development
8,9
. APOE4 plays a role in lipid metabolism while TREM2 is an immune-
related gene that facilitates phagocytosis
4,10
. Despite the variety of risk factors, they share
similar mechanisms that contribute to significantly increased levels of neuroinflammation,
oxidative stress, Ab accumulation, and decreased blood-brain barrier integrity
2-4,8-13
.
As genomic sequencing and bioinformatics continue to advance, there is
increasing evidence that dysregulation of genes involved in APP processing,
inflammation, lipid metabolism and Ab clearance increase susceptibility to the disease
2,7
.
Genome wide association studies (GWAS), large-scale studies that scan complete sets
of DNA (genomes) to find genetic variations associated with a particular disease, have
identified a large proportion of immune-related genes that act as risk factors for
AD
7,11,12,13
. Having a single variant of these genes only confers a low risk, but when there
are multiple hits on immune-related genes they become increasingly detrimental
2
. These
findings, in conjunction with others, have highlighted the fact that impairments in immune
system pathways can influence AD pathogenesis and progression. For example,
integrated genomic approaches have identified STAT3 (signal transducer and activator
of transcription 3) pathways to be differentially activated in LOAD, which was further
7
biologically confirmed
13,14
. STAT3 dysregulation, similar to having the APOE4 allele or
TREM2 mutation, leads to decreased Ab clearance
15
. This further emphasizes the need
to better understand how Ab affects immunity and how better treatment methods can be
developed to target this relationship.
Alzheimer’s Disease Pathological Hallmarks
The “amyloid cascade hypothesis”, first proposed by John Hardy and Gerald
Higgins in 1992, is the most well-established theory to describe the development of AD
3
.
It states that the accumulation of Ab is the primary cause of AD pathogenesis and acts
as a trigger for neuronal injury, the formation of neurofibrillary tangles (NFTs), and
neuronal death. It explains that cleavage of APP by b-secretase and g-secretase leads to
excessive production of Ab1-40 and Ab1-42, and the subsequent formation of Ab
oligomers
3,10
. Ab oligomers then promote the formation of Ab plaques, activate glial cells
to release pro-inflammatory cytokines, alter the phosphorylation state of tau proteins, and
ultimately lead to neuronal death
3,6
.
The original amyloid cascade hypothesis was developed after studying EOAD and
Down Syndrome. Down Syndrome (DS) is characterized by patients having a third copy
of chromosome 21, which is the location for the APP gene. There is a high prevalence of
AD among DS patients, with 60-75% of them over the age of 50 being diagnosed
16–18
.
The excess APP in DS patients, and the subsequent discovery of Ab pathology in their
brains, further supports the hypothesis that Ab is the driving factor in AD disease
pathogenesis.
In 2016, the amyloid cascade hypothesis was revised to account for amyloid
accumulation in LOAD
10
. Evidence shows that rather than inherited mutations driving
8
Ab overproduction, there is an imbalance between homeostatic production and
clearance, leading to excess Ab accumulation
5,10,15
. The innate immune system is the
body’s first line of defense against increasing Ab accumulation, resulting in the activation
of glial cells (microglia and astrocytes) and their secretion of pro-inflammatory
cytokines
12,15,19–21
. Failure to clear Ab and the persistent inflammation surrounding
Ab plaques creates a toxic milieu for the immediate brain tissue and synaptic
environment. Multiple studies have shown that soluble Ab oligomers decrease the density
of dendritic spines and long-term potentiation (LTP), an activity-dependent process that
that takes place at dendritic spines and is necessary for learning and memory to occur
10,22-
26
. The Ab induced synaptic damage explains many of the clinical hallmarks of AD,
including declined cognition, weakened associative learning, and increased memory
impairment
3,10,11
.
In addition to synaptic injury, Ab further damages neurons through its effects on
tau protein
12
. Tau is a cytoplasmic protein that binds to tubulin, stabilizing microtubules
for better transport within an axon
25
. Experiments with transgenic mouse models have
shown Ab fibrils can induce tau hyperphosphorylation and reduce their capacity to bind
to microtubules
11,26
. When tau is hyperphosphorylated it causes the tau protein to
dislodge from the microtubules and increases their affinity for other tau monomers,
leading to the assembly of intermediate tau oligomers. These oligomers can then combine
and form NFTs which accumulate within neurons, preventing synaptic communication
and inducing neurodegeneration
11,25
.
The final stage of AD pathology is neuronal death. The accumulation of
Ab promotes cytotoxic effects that can either directly or indirectly cause
9
neurodegeneration, such as oxidative stress, dysregulation of calcium homeostasis, and
Ab induced apoptosis
27,28,29
. In addition to Ab’s toxic effects, NFTs (worsened by the
presence of Ab) interfere with neuronal maturation and potentiate neuronal loss
10,30
.
Lastly, the mediators and products of the body’s chronic inflammatory response promote
neuronal degeneration in AD
31
. The overall result is AD patients show marked neuronal
atrophy, specifically in regions associated with learning and memory such as the
hippocampus and entorhinal cortex
27
.
The amyloid hypothesis explains this cascade of events as solely stemming from
Ab accumulation. Increasing evidence now shows that Ab-induced inflammation plays a
significant role in disease pathogenesis
12,32,33
. At homeostatic levels, increased
inflammation is beneficial and necessary to ameliorate an insult to the body. However, in
AD, the chronic nature of the disease shifts the immune system towards a pathological
state. Shockingly, Ab deposition and inflammation begins 10-20 years before clinical
symptoms manifest
34
. The prodromal nature of Ab deposition emphasizes the critical
need to understand the events prior to clinical onset, including the role of inflammation in
disease pathogenesis. Several studies have shown that clearing Ab can improve
cognition in animal models of AD
13,15,23
. Understanding how to improve clearance by
rebalancing innate immunity is vital to future therapies aimed at halting the progression
of AD.
Innate Immune System
The innate immune system is the body’s simplest form of immune defense. It is
responsible for sensing stimuli throughout the body to maintain homeostasis, inducing
inflammation in response to danger signals, and activating the body’s adaptive immune
10
system
35
. Unlike adaptive immunity, innate immune cells require no prior exposure to a
pathogen to be activated
35
. These cells include natural killer cells, mast cells,
granulocytes, and macrophages. Their “non-specific” activation allows them to respond
almost immediately to an insult. In contrast, the adaptive immune response is highly
specific, but the consequence of improved specificity is a delay in response timing
35,36
.
Macrophages play a significant role in the inflammatory response. They
phagocytize unwanted particles, serve as antigen-presenting cells (APC), and
immunomodulate their environment through the secretion of cytokines and growth
factors
21
. Monocytes differentiate into unique types of macrophages based on the
surrounding tissue, at which point they are typically classified as having pro-inflammatory
(M1) or anti-inflammatory (M2) phenotypes. These two primary classifications are still
generally applied when describing how the immune system works, although there is a
wide spectrum of potential responses
21,37
.
Macrophages in the central nervous system (CNS) can arise from two
ontogenetically distinct populations: brain-resident microglia or infiltrating peripheral
monocytes. Microglia make up 10-15% of all cells in the brain and are characterized by
their prenatal development in that they primarily derive their progenitors from the
ectoderm of the yolk sac. In contrast to other myeloid cells, microglia are unique with a
long life and ability to self-renew
21,38
. During neuroinflammation, there is increased
microgliosis as well as increased peripheral macrophage recruitment to sites of
injury
21,32,38
. Peripheral macrophages and resident microglia have their own functional
roles, but do appear to interact with each other
21,39
. At a glance they are phenotypically
different and have been previously distinguished by the expression level of surface
11
markers such as CD45, CD11b, and Tmem119. However, recent research has made it
increasingly clear that peripheral macrophages can adopt a microglia-like phenotype
once activated in the CNS, which makes identification difficult
39
. With differentiation
challenging, microglia and peripheral macrophages in the CNS are often collectively
referred to as brain macrophages. Once activated, brain macrophages withdraw their
processes to become amoeboid in shape, migrate toward the inflammatory trigger, and
release the cytokines IL1b, IL6, and TNFa to propagate an inflammatory response
20
.
Although brain macrophages are needed for a variety of purposes, they are heavily relied
upon for the phagocytosis of pathogens and clearance of toxic molecules, cellular debris,
and protein deposits (such as Ab or tau)
12,21,30,39
.
Ab activates macrophages through direct receptor binding, which triggers
opsonization, or chaperone molecules like apolipoproteins to initiate engulfment
39
. In a
healthy brain, Ab is engulfed via phagocytosis, trafficked to lysosomes, and degraded by
digestive enzymes. However, research has shown that persistent Ab burden in AD leads
to the chronic activation of macrophages, creating a cytotoxic milieu where they
upregulate their secretion of pro-inflammatory cytokines, propagate Ab production, and
decrease clearance and phagocytosis
12,21,30,32,39
. This has led some researchers to
believe that preventing brain macrophage activation may be beneficial to overall disease
pathology. However, research has also shown that harnessing the innate immune
system, and thus the brain macrophages, may instead be a useful tool to halt disease
onset by preventing the negative effects of chronic gliosis
15,33
.

12
Stat3, Immunity, and AD
Integrative genomic studies have identified immune pathways that are upregulated
in AD. One of the pathways that has been identified is the Stat3 pathway, which has been
shown to be at supraphysiological levels in patient brains and sera
14,38
. Stat3 is a
transcription factor involved in a variety of cellular functions, including the regulation of
macrophage survival, proliferation and differentiation
20,38,40
. It can be activated by
different cytokines, growth factors, TLRs and GPCRs
39–41
. Stat3 exists in an inactive form
in the cytoplasm until it is phosphorylated by Janus kinase (JAK), resulting in dimerization,
and translocation to the nucleus. Once in the nucleus, it binds DNA and controls
downstream gene activation
15,41
.
The role Stat3 plays is determined by which molecule activates its signaling
cascade. For example, IL6, a cardinal pro-inflammatory cytokine, initiates the IL6/Stat3
pathway promoting the secretion of IL6, TNFa, and IL1b from macrophages. These
cytokines are important for initiating an inflammatory response, however their chronic
secretion in AD can drive synaptic damage and neuronal loss
20,43
. Research has shown
that overexpression of IL1b can impair macrophages’ ability to clear Ab and worsens tau
phosphorylation
12
. Furthermore, IL1b drives peripheral leukocyte recruitment to the CNS
via CCR2/Stat3 signaling
44,12
. Although an increase in peripheral macrophages could
theoretically be helpful for ameliorating Ab deposits, the increased gliosis has not been
associated with an increase in Ab phagocytosis
21,39
.
In contrast, IL10, a cardinal anti-inflammatory cytokine, initiates the IL10/Stat3
pathway. This results in activation of Suppressor of Cytokine Signaling 3 (SOCS3), a
feedback inhibitor that suppresses the inflammatory activity of macrophages
37,45,46
.
13
Although IL10 is important to prevent chronic inflammation, its overexpression in AD has
been shown to restrain brain macrophages from performing their phagocytic function
15,47
.
Using a mouse model of AD, our group has confirmed that deleting IL10 reduced
Ab pathology, increased phagocytosis, and improved cognitive behavior
15
.
Mounting evidence suggests dysregulated immunity drives the pathological
increase in amyloidosis. Previous attempts to limit Ab production by interfering with APP
processing have been unsuccessful, and thus attention has shifted toward immunity to
therapeutically activate homeostatic mechanisms to increase clearance. Stat3 is at the
intersection of innate immunity through its involvement in both pro-inflammatory and anti-
inflammatory pathways—including macrophage survival, activation and phagocytosis.
Stat3 is dysregulated in AD with increased phosphorylation, yet its role with regard to
cerebral Ab remains unknown. To assess Stat3 role in macrophages within the context
of AD, we generated a mouse model to inducibly delete macrophage-specific Stat3 and
analyze cerebral amyloidosis and macrophage phenotypes.

14
Materials and Methods
Animals
All mice were obtained from Jackson Laboratory and were housed under standard
conditions with free access to food and water. Experiments were performed according to
the Guidelines for Use of Animals in Research and the protocol was approved by The
University of Southern California (USC) Institutional Animal Care and Use Committee.
To delete Stat3 in macrophages we used the inducible cre/lox system. Cre-lox
recombination is a technology that carries out site-specific deletions in DNA cells. It
consists of a single enzyme, cre recombinase, that recombines a pair of target sequences
with a lox-P site. In the inducible system, cre recombinase can only translocate to the
nucleus after being activated by tamoxifen. Cre is introduced under the control of the
Csfr1 promoter, a gene transcriptionally active only in macrophages. This allows for an
inducible deletion of Stat3 exclusively in macrophages (Figure 1) and to control the time
of recombination. This model avoids the embryonic lethality that results from germline
deletion of Stat3 while also enabling traditional development of amyloid-related pathology
in APP/PS1 mice up to the point of intervention. Thus, we used three mouse strains: 1)
Tg(APPswe,PSEN1ΔE9) transgenic mice (referred to as APP/PS1 in this report; B6.Cg
Tg(APPswe,PSEN1dE9)85Dbo/Mmjax, stock #034832, Jackson Laboratory) 2) Csf1r-
cre
ESR
mice (FVB-Tg(Csf1rcre/Esr1*)1Jwp/J, stock #019098, Jackson Laboratory) and
3) Stat3
Fl/Fl
(B6.129S1-Stat3tm1Xyfu/J, stock #016923). To obtain the experimental
animals, APP/PS1
+
Csf1r-cre
ESR
Stat3
Fl/Fl
,

we crossed the APP/PS1
+
Stat3
Fl/Fl
mice to
Csf1r-cre
ESR+
Stat3
Fl/Fl
mice. These animals will be referenced as APP/PS1
+
Csf1r-
cre
+
Stat3
Fl/Fl
or APP/PS1
+
Csf1r-cre
-
Stat3
Fl/Fl
in subsequent sections. We induced cre
15
activation with subcutaneous (s.c.) injections of tamoxifen (daily for 5 days; 100μl of
20mg/mL tamoxifen or PBS vehicle) at 6 and 7½ months of age. Male and female mice
were used to account for sex as a biological variable. At 12 months of age, animals were
euthanized in a CO2 chamber, perfused with ice-cold PBS, and the anterior quarters of
the brain were snap-frozen and randomly assigned to protein or mRNA analyses while
the posterior quarters were fixed in 4% paraformaldehyde (PFA) overnight and randomly
assigned to paraffin or agarose embedding.
To test rate of recombination, a fourth mouse strain was bred by crossing Csf1r-
cre
ESR
mice with Rosa mice (B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J, stock
#008463, Jackson Laboratory) to create Rosa
+
Csf1r-cre
+
mice. The Rosa
+
Csf1r-cre
+

mice were used as a surrogate to measure cre recombination efficiency by inducing
tdTomato expression. Animals received tamoxifen (s.c. injections daily for 5 days; 100μl
of 20mg/mL) at two months of age. Two or four weeks after treatment, the animals were
euthanized and perfused with ice-cold PBS. The brains and spleens were isolated and
analyzed for tdTomato expression and CD45
+
cells by flow cytometry.
Bone Marrow Derived Monocyte (BMDM) Isolation and Differentiation
To prepare BMDM, bone marrow from the femur and tibia were flushed with RPMI
(Life Technology-Invitrogen) using a 21 gauge needle. Cells were dissociated and
centrifuged at 200g for 5 min at 4°C. The pellet was resuspended in red cell lysis buffer
(1x) (0.15M NH4Cl, 23mM NaHCO3, 1μM EDTA, pH 7.3) and incubated for 15 min on ice.
Samples were centrifuged and the pellet was resuspended in media and seeded at the
concentration of 5 10
4
cells/well. Cells were incubated for 5 days in media (RPMI w/o
phenol red, 1% GlutaMAX, 1% Pyruvate, Gibco) containing 10% endotoxin-free charcoal
16
striped fetal bovine serum (Gibco), 15ng/ml M-CSF (Peprotech), 1% penicillin and
streptomycin) with vehicle or STAT3 inhibitor VII, 5,15-DPP (Stat3 inhibitor, Calbiochem).
Cells were collected at the end of each day and processed for flow cytometry. Media was
changed and replaced on day 3.
Flow Cytometry
For the experiments on Rosa
+
Csf1r-cre
+
mice splenocytes, spleens were
mechanically dissociated, centrifuged, resuspended in red cell lysis buffer (1x) and
incubated for 15 min on ice. Afterwards, cells were centrifuged, resuspended in PBS and
filtered using .7μm filters. Cells were fixed and permeabilized (BD Cytofix/Cytoperm
TM

Plus, BD Biosceinces) for 20 min on ice. Cells were washed with FACS wash buffer (1%
bovine serum albumin, 0.1% saponin, 0.1% azide in PBS) and incubated with primary
antibody against CD45 (1:200. Biolegend) for 30 min on ice. Samples were washed with
FACS wash buffer, followed by two washes with PBS and analyzed using BD LSR II Flow
Cytometer (BD Biosciences).
For the experiments on BMDM, cells were collected, centrifuged, resuspended in
PBS and filtered using .7μm filters. Cells were fixed and permeabilized for 20 min on ice.
Cells were washed with FACS Buffer and incubated with primary antibody conjugated
with specific fluorophores (CD11b, F4/80, CD45, CD14, 1:200, Biolegend) for 30 min on
ice. Samples were washed with FACS buffer, followed by two washes with PBS and
analyzed using GUAVA® easyCyte. Data were analyzed with FlowJo software
(TreeStar).

17
Electrochemical ELISA (MSD)
Anterior brain quarters were weighed and homogenized (using a mechanical cell
disperser) with 5 volumes of ice-cold 1X tissue lysis buffer (2mM Tris-HCl, 15mM NaCl,
0.1mM Na2EDTA, 0.1mM EGTA, 0.25mM sodium pyrophosphate, 0.1mM beta-
glycerophosphate, 0.1mM Na3VO4, 0.1μg/ml leupeptin, pH7.5, Cell Signaling
Technology) supplemented with 1X phosphatase inhibitor cocktail 2 (Sigma Aldrich) and
protease inhibitor cocktail (104μM AEBSF, 80nM aprotinin, 4μM bestatin, 1.4μM E-64,
2μM leupeptin, 1.5μM pepstatin, Sigma-Aldrich). After 15 min incubation on ice,
homogenates were centrifuged at 14,000 g for 15 min at 4°C; the supernatant contains
triton-soluble Aβ peptides and soluble proteins (including cytokines and chemokines).
Evaluation of MCP-1, IL1b, IFNg, IL6, TNFa levels was performed using a Multi V-PLEX
assay (mouse pro-inflammatory panel 1 and mouse cytokine panel 1 Meso Scale
Discovery). Samples were run according to the manufacturer's instructions.
The triton-insoluble pellets were extracted using 5M guanidine-HCl (diluted in 50
mM tris-HCl, pH 8.0). Pellets were re-homogenized and shaken overnight at room
temperature to promote extraction of insoluble Ab. Homogenates were centrifuged for 5
min at 8,000 g. The triton-soluble and guanidine-HCl-soluble fractions were used as input
for ELISA detection of Ab1-40 and Ab1-42 peptides (V-PLEX Plus Ab Peptide Panel 1
(6E10) Kit, Meso Scale Discovery) according to the manufacturer’s recommendations. Ab
oligomers were quantified from the triton-soluble fraction using enzyme immunoassay for
determination of Ab bound to 82E1 antibody in sandwich ELISA (IBL International).
Samples were run according to the manufacturer's instructions. BCA protein assay
18
(Biorad) was used to determine total protein concentrations in each fraction and values
were used for normalization.
Immunohistochemistry
For paraffin-embedded brains, 10 μm sections were deparaffinized and
rehydrated, boiled at 95°C for 30 min in a modified citrate buffer (pH 6.1, Dako) to retrieve
antigens. Prior to immunoperoxidase labeling, sections were treated with 0.6% H2O2 in
PBS for 30 min to remove endogenous peroxidase activity. Sections were then rinsed in
PBS and blocked for 1h with a 10% NDS diluted in PBS 0.2% Triton X-100. Thereafter,
sections were incubated in Iba1 (Wako) overnight at 4°C. Following incubation with the
primary antibody, immunoreactivity was visualized in single labeling experiments with
biotinylated goat anti-rabbit IgG (1:200, Vector Laboratory) followed by
diaminobenzidine/diaminobenzidine (Vector Laboratory) resulting in a brown reaction
precipitate.
In immunofluorescence experiments, after antigen retrieval paraffin sections were
permeabilized for 10 min (.5% Triton X-100 in PBS) and blocked in 10% NDS (diluted in
PBS with .2% Triton X-100). Primary antibodies were directed against Iba1 (rabbit
polyclonal; 1:200, Wako; goat polyclonal; 1:200, LifeSpan Biosciences), CD45 (rat
polyclonal; 1:100, AbD Serotec) and glial fibrillary acidic protein (GFAP, rat polyclonal;
1:2000, Invitrogen). Amyloid plaques were also detected using a 1% solution of
thioflavinS (ThioS) diluted in H2O for 10 min at room temperature, and then washed 3x in
70% ethanol for 5 min.
For brains embedded in agarose, 50 μm sections were permeabilized for 10 min
(.5% Triton X-100 in PBS) and blocked in 10% NDS or BSA 5% (diluted in PBS with .2%
19
Triton X-100). Primary antibodies were directed against CD68 (rat polyclonal; 1:100,
Abcam), Ki67 (rabbit polyclonal; 1:200, Cell Signaling Technology), 6E10 (mouse
monoclonal; 1:400, BioLegend) and Iba1. Alexa
488/594/647
-coupled secondary antibodies
were used for immunofluorescence experiments (1:200, Life Technologies). Afterwards,
sections were mounted with Prolong anti-fade reagent with DAPI (Molecular Probes).
Imaging Acquisition and Quantification
Staining coverage
Brain sections stained for ThioS, 6E10, Iba1, CD45, and GFAP were imaged using
Zeiss Axioplan 2 light microscope including a Sony DXC-930P color video camera
system. Four sections were stained per animal, with 1 image taken per section of the
entorhinal cortex (EC) and hippocampus (HC) at 10x. Plaque size were determined by
labeling with ThioS and 6E10, and assigning plaques to three mutually exclusive size
categories based on maximum diameter: small <25μm, medium 25-50μm, and large
>50μm.
Ab phagocytosis and macrophage proliferation
Brain sections were stained for Iba1, 6E10, and CD68 (phagocytosis) or Iba1 and
Ki67 (proliferation). Confocal image stacks of the EC and HC were taken at 60x
magnification. Four sections were stained per animal, with 3 images taken per region.
The images were converted to 3D images using the surface-rendering feature of Imaris
Bitplane software (version 7.6.1). For Ab phagocytosis, the volume of Ab inside the
Iba1
+
CD68
+
brain macrophage phagolysosomes was quantified. To measure
proliferation, the percent of Iba1
+
cells colocalized with Ki67 was quantified.

20
Stereology
For stereological quantification of Iba1
+
brain macrophages, a brightfield
microscope fitted with a motorized stage was used along with computer-assisted
stereological toolbox version 11.10.2 64-bit (Stereo Investigator, MF Biosciences). Slides
were first viewed with a x1.5 objective to identify the anterior-most section in each series
containing hippocampus and entorhinal cortex for analysis and following three posterior
sections for a total of four slices. Entorhinal cortex and hippocampus were then outlined
for analysis. In total, 25% of the total area of these regions was counted using a .04mm
2

frame size via stereological random sampling.
mRNA Isolation and quantitative Polymerase Chain Reaction (qPCR)
RNA was extracted with Trizol (Life Technologies) from snap-frozen quarter brains.
The extracted mRNA was cleaned using the RNAeasy Mini Kit (Qiagen) and dissolved in
water, then reverse-transcribed using the SuperScript III first strand synthesis system
(Life Technologies). We performed relative mRNA quantification using DDC threshold
cycle method. Expression levels were determined using primers for APP (F:
CACCACAGAGTCTGTGGAAG; R:AGGTGTCTCGAGATACTTGT), PS1 (F:
AGACGGGTCAGCTCATCTACAC; R:GATAGAACTACCAGGGCCATGAG) and Actin
(F: AGAGGGAAATCGTGCGTGAC; R:CAATAGTGATGACCTGGCCGT).
Western Blot
Mouse brain tissue was homogenized using a mechanical cell disperser with 5
volumes of ice-cold 1X tissue lysis buffer (Cell Signaling Technology) supplemented with
protease inhibitor cocktail (Sigma-Aldrich) and phosphatase inhibitor cocktails 2 (Sigma-
Aldrich). After 15 min of incubation on ice, homogenates were centrifuged at 14,000 g for
21
15 min at 4°C. Protein concentration in the supernatants was determined using the BCA
protein assay (Biorad). Samples were heated for 10 min in sample buffer containing
reducing agent (Bolt, Thermo Fisher), then resolved on Bolt precast gels (Thermo Fisher).
Gels were then transferred to methanol-activated PVDF membrane (0.45μm pore, Merck
Millipore) using the Trans-Blot(R) TurboTM transfer system (Biorad). Primary antibodies
were directed against: APP C-terminal fragments (rabbit polyclonal; 1:1000, Millipore and
clone 369, gifted by Prof. Sam Gandy), PS1 (mouse monoclonal, 1:1000, Covance), and
β-actin (mouse monoclonal; 1:1000, Merck Millipore). Densitometric analyses were
performed using Biorad Image Lab Software, and band densities were normalized to b-
actin for all experiments.
Statistical Analysis
Graphpad Prism (version 7.0) Software (La Jolla, CA) was used for all statistical
analysis. Multiple group comparisons were performed by one-way analysis of variance
(ANOVA) followed by Dunnett’s post hoc tests. Two-way ANOVA followed by Sidak’s post
hoc tests was used when sex was considered a relevant variable. Else, Student’s t-test
was performed. In all cases, p ≤ 0.05 was considered to be statistically significant and p
≤ 0.10 was considered trending. All data are presented as means ± SEM.
Results
Brain and peripheral macrophages are targeted in Csf1r-cre
+
mice

To determine how macrophage-specific Stat3 deletion affects Ab, we used
APP/PS1 mice expressing tamoxifen-inducible Cre recombinase (Cre
ERT
) under the
macrophage-specific colony stimulating factor 1 receptor (Csf1r) promoter. In addition to
specificity, this model was chosen because it allows for temporal deletion of Stat3 at 6
22
months of age, when deposition of Ab peptides begins in the APP/PS1 model. To validate
the efficiency of the APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
model, we first created Rosa
+
Csf1r-cre
+

mice and analyzed for tdTomato expression. To assess recombination efficiency in the
brain, we used histological quantification to examine colocalization of tdTomato and
macrophage (Iba1) staining. We found that there was ~50% recombination in Iba1
+
cells
two weeks post-injection and ~80% four weeks post-injection (Figure 2A-B). To test
recombination in the periphery, splenocytes were isolated and FACS analysis revealed
that approximately 23% of the CD45
+
cells in Rosa
+
Csf1r-cre
+
expressed tdTomato, while
this population was absent in the Rosa
+
Csf1r-cre
-
mice. Macrophages account for
approximately ¼ of the splenocyte population, indicating a high rate of recombination
(Figure 2C-D). This confirms that strong, Stat3 recombination in macrophages occurred
in both the periphery and the brain.

Stat3 deletion in macrophages shows sex-specific increase in cerebral Ab
If Stat3 plays a significant role in the macrophage response to Ab, then Stat3
deficiency should alter the degree of cerebral amyloidosis. We performed a quantitative
histological analysis of Ab plaques using two commonly employed staining methods,
thioflavin S (ThioS) and a 6E10 antibody, to examine the effect of Stat3 deletion on
amyloid plaque deposition in APP/PS1 mice (Figure 3). In the entorhinal cortex and
hippocampus, APP/PS1
+
Csf1r-cre
-
Stat3
Fl/Fl
females had significantly higher deposition of
plaques by both stains than males (Figure 3A-D). Interestingly, we found that these
differences were not due an increase in plaque size (Figure 4), suggesting a potential
increase in plaque number. Notably, when we performed a more sensitive biochemical
analysis of Ab species in the brain, there was a significant increase in triton-soluble
23
(Figure 5B-C) and insoluble (Figure 5E-F) Ab1-40 and Ab1-42 levels in APP/PS1
+
Csf1r-
cre
+
Stat3
Fl/Fl
female mice. Notably, the triton-soluble oligomeric analysis only showed a
sex-specific effect with no genotype difference (Figure 5D).
Amyloid accumulation is a result of either an increase in Ab production or a decrease
in Ab clearance. To determine if our genetic manipulation affected APP processing in the
model, we assessed APP and PS1 mRNA levels by qPCR. The expression of APP and
PS1 were unchanged (Figure 6A-B). To further validate this finding, we found no
significant differences when we looked at protein levels of APP and PS1 using Western
blot (Figure 6C-D), suggesting that the effects of macrophage Stat3 signaling was not
modified by APP or PS1 expression or processing.
Stat3 deletion in macrophages alters innate immunity profile
We then examined innate immune cells in the brains of APP/PS1 mice to observe
the effect of Stat3 deletion on their profile, as microgliosis and astrocytosis are direct
responses to amyloidosis. Thus, we performed a quantitative histological analysis of area
covered by immunostaining in the entorhinal cortex (EC) and hippocampus. We first
stained for GFAP to assess astrocyte reactivity. There was a significant increase in the
entorhinal cortex for APP/PS1 female mice compared to males, but no genotype
difference (Figure 7A-B). Interestingly, there was a significant sex-specific decrease in
brain macrophage (Iba1) immunostaining for the APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
females in
the entorhinal cortex (Figure 7C-D) but no change in pan-leukocyte (CD45) load (Figure
7E-F).
Decreased Iba1 immunostaining in the APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
female mice
could be a result of changes in brain macrophage proliferation, infiltration or activation.
24
To investigate the effect of Stat3 on proliferation, we first performed immunohistological
analysis of the presence of Ki67, a proliferative marker, in brain macrophages (Iba1
+
) in
the entorhinal cortex and hippocampus. There was no difference between genotypes,
however data revealed a sex-specific increase in proliferating brain macrophages for the
female APP/PS1

mice in the EC (Figure 8A-B). This indicates that the decrease in brain
macrophage load for females is not a result of decreased proliferation. Further, we used
stereological analysis to count total brain macrophages in the entorhinal cortex and the
hippocampus. There was no significant difference in numbers between any of the
experimental groups (Figure 8C-D). This data demonstrates that Stat3 manipulation did
not affect proliferation, yet we cannot exclude changes in infiltration or activation as
explanations for the decrease in Iba1 staining in APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
females.
To further investigate the effect of Stat3 deletion in macrophage activation, we
measured the levels of several cytokines known to be involved in the Ab-related
inflammatory response. An electrochemical-ELISA of brain homogenates revealed a
decrease in the levels of IL1b and IFNg in APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
female mice
compared to APP/PS1
+
Csf1r-cre
-
Stat3
Fl/Fl
female mice (Figure 9A-B). Neither male nor
female mice showed any significant difference in IL6, MCP-1, or TNFa cytokine levels.
(Figure 9C-E).
We next analyzed the functional consequence of Stat3 deletion in brain
macrophages by assessing Ab phagocytosis. To accomplish this, we analyzed
phagocytosis in three ways: volume of Ab uptake within phagolysosomes (via CD68
immunostainning), percent brain macrophage volume occupied by phagolysosomes, and
percent phagolysosomes occupied by Ab, using our novel methodology for 3D
25
reconstruction of confocal images (q3Dism). Both male and female APP/PS1
+
Csf1r-
cre
+
Stat3
Fl/Fl
mice had brain macrophages (Iba1
+
) with decreased Ab uptake compared
to APP/PS1
+
Csf1r-cre
-
Stat3
Fl/Fl
mice (Figure 10A). Specifically, the brain macrophages
had less phagolysosomes (Figure 10B) and their phagolysosomes contained less
Ab than their APP/PS1
+
Csf1r-cre
-
Stat3
Fl/Fl
counterparts (Figure 10C).
Stat3 inhibition decreases macrophage differentiation in vitro
Stat3 has previously been shown to play a role in macrophage differentiation. Our
Rosa
+
Csf1r-cre
+
data showed that Stat3 recombination was successful in the periphery,
and thus could have impacted peripheral monocyte differentiation into macrophages.
Importantly, peripheral macrophages have been shown to directly and indirectly affect
brain immunity
21,39
. Hence, we isolated bone marrow derived monocytes (BMDM) from
male and female wild-type mice and cultured them in M-CSF enriched media to induce
differentiation for five days with VII, 5,15-DPP (a Stat3 inhibitor) or vehicle. In both male
and female BMDM cultures, our Stat3 inhibitor significantly decreased macrophage
differentiation (identified as CD11b
+
, CD45
+
, F4/80
+
, CD14
+
) when compared to control
(Figure 11).
Discussion
Dysregulation of the innate immune response to Ab is thought to play a central role in
AD progression. For EOAD patients, multiple in vivo and in vitro studies have
demonstrated that mutations in APP, PSEN1 and PSEN2 are responsible for
Ab overproduction
48,49
. To examine if overproduction was also a driving cause in LOAD,
in 2010, NIH researchers performed an in vivo study comparing Ab1-40 and Ab1-42
production and clearance rates in patients with LOAD versus patients deemed cognitively
26
normal. They found there was no difference in Ab production between groups, but the
clearance rates for Ab1-40 and Ab1-42 were impaired in AD patients
50
. This helped establish
that insufficient Ab clearance, rather than overproduction, is a leading cause of excessive
aggregation in LOAD patients
5,33,50
.
Although the ‘failure to clear’ concept has become more widely accepted, the specific
role of Stat3 in this process is still unknown. Research has provided conflicting evidence
with regard to Stat3 signaling and AD pathology. For example, our lab has previously
shown that deleting IL10, a cytokine that signals through Stat3, in APP/PS1 mice resulted
in improved phagocytosis, decreased cerebral amyloidosis and partially restored
cognitive function
15
. Similarly, another study found that Stat3 deletion in astrocytes of
APP/PS1 mice decreased Ab deposition, upregulated clearance pathways, and
decreased astrogliosis. However, a third study showed that increasing IL1b synthesis, a
cytokine upregulated by Stat3, enhanced microglia activation and recruited macrophages
from the periphery to reduce Ab levels
44
.
These varying results highlight the complex interplay of Stat3 and its modulation of
the inflammatory response to Ab. The present study aimed to shed light on this issue by
assessing how Stat3 signaling affects brain macrophages in a mouse model of
amyloidosis. Our results indicate that deleting Stat3 in macrophages is detrimental to
overall Ab burden, especially in the female APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
mice. Despite a
decrease in phagocytosis for both sexes, only APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
females
displayed a decrease in the load of brain macrophages and pro-inflammatory cytokines.
Research suggests Stat3 pathways are regulated differently in males and females,
27
potentially because of the interaction between the female sex hormone estradiol and
Stat3
50-53
.
Given the sex-specific increase in amyloid load and plaque deposition, it was
surprising to discover that Stat3 deletion reduced phagocytosis in both male and female
APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
mice. This finding contradicts previous studies by our lab
and others that showed Stat3 inhibition improved phagocytosis in vitro
15,51
. Our present
study demonstrates that Stat3 signaling in brain macrophages is important for their
successful activation and Ab internalization, and that the loss of Stat3 negatively impacts
this process.
Recent studies have provided evidence that Ab clearance can be performed by
peripheral macrophages that infiltrate the CNS during AD and ameliorate Ab plaques
21,39
.
Importantly, Stat3 phosphorylation has previously been shown to influence macrophage
infiltration, differentiation and proliferation
37,52,53
. Previous reports have presented
conflicting findings on the role of Stat3 in peripheral macrophage infiltration. Multiple
studies have demonstrated that CCL2-CCR2 signaling uses Stat3 to upregulate IL1b and
induce peripheral entry
40,52
. However, another study showed that deleting Stat3 increased
leukocyte infiltration with increased levels of TNFa and MCP-1
54
. We showed that Stat3
is being recombined in peripheral macrophages, raising the possibility that Stat3 deletion
is preventing peripheral macrophage infiltration into the CNS. As peripheral macrophages
often adopt a microglial-like phenotype upon entry in the brain, it is extremely difficult to
distinguish between the two cell types. Accordingly, we have chosen to be conservative
and refer to the Iba1
+
cell population as “brain macrophages”. Therefore, a decrease in
the Iba1
+
load seen in female APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
mice could be a result of fewer
28
brain macrophages stemming from decreased peripheral infiltration. Although we saw a
decrease in IL1b levels, there was no corresponding change in MCP-1 or TNFa levels.
Further, we used stereology to assess macrophage numbers and found no significant
difference in the number of brain macrophages between our APP/PS1

mice, regardless
of sex or genotype. As such, there is little evidence that the decrease in Iba1
+
load is
representative of a decrease in peripheral macrophage infiltration.
To assess Stat3’s impact on macrophage differentiation in the periphery, we treated
primary monocytes in vitro with Stat3 inhibitor or vehicle for 5 days. Strikingly, Stat3
inhibition decreased monocyte-to-macrophage differentiation by nearly 80%. Since Csf1r
signals through Stat3, as well as cardinal polarizing cytokines such as IL10, IL6 and IFNg,
further studies are needed to examine how macrophage-specific Stat3 deletion impacts
differentiation in vivo.
In addition to macrophage differentiation and infiltration, Stat3 activation is also
involved in macrophage proliferation
55
. We stained brain sections with Iba1

and Ki67, a
common marker of proliferation, and looked at colocalization. Surprisingly, we found the
APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
females showed an increase in proliferation compared to
APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
males, eliminating failure to proliferate as the cause of
decreased Iba1

load. While females showed increased proliferation, the lack of difference
in cell count suggests that Stat3 deletion might be affecting other processes, such as
survival. Another possibility is that brain macrophages proliferate yet fail to activate, thus
resulting in failed Iba1 upregulation. Activated brain macrophages adopt an ameboid
shape, exhibit phagocytic activity, and secrete pro-inflammatory cytokines like IL1b, IFNg,
and TNFa
20,56
. We found that our APP/PS1
+
Csf1r-cre
+
Stat3
Fl/Fl
females had decreased
29
Iba1 load, phagocytic markers, and levels of IL1b and IFNg. This provides further
evidence that Stat3 deletion in macrophages reduces their capacity to respond to Ab.
Our study is the first of its kind to selectively delete Stat3 in macrophages and points
to a cell-type specific effect of Stat3 inhibition in the context of AD. The cell-type specific
nature of Stat3 signaling is further validated by the recent study showing astrocyte-
specific Stat3 deletion proved beneficial
57
. Our study also deleted Stat3 temporally,
beginning at 6 months after the onset of AD pathology. This time point may represent a
period in which brain macrophages have already reached an irreversible state.
Conclusion
This work is the first of its kind to cell-specifically and temporally delete Stat3 in the
context of AD. Strikingly, Stat3 deletion reduced brain macrophages’ activation in
response to Ab, resulting in increased amyloidosis in female APP/PS1
+
mice. As Stat3
lies at the intersection of several innate immune pathways, future work needs to be done
to establish which specific Stat3 pathways positively affect clearance of Ab, and how this
transcription factor can be manipulated to help rebalance the innate immune response in
AD. Furthermore, our sex-specific findings mirror those seen in humans where females
have an increased prevalence of AD than males. This highlights the need to better assess
why our female mice are more susceptible to Ab plaque deposition in the face of
macrophage-specific Stat3 deletion. This present study has reinforced the importance of
Stat3 as a signaling molecule in AD and demonstrates the need for a detailed
understanding of innate immune signaling in AD to unlock future therapies.

30
Figures

Figure 1. Inducible cre/lox system used for the creation of macrophage-specific
APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice. We crossed APP/PS1
+
Stat3
Fl/Fl
mice with
APP/PS1
+
Csf1r-cre mice to create our experimental animals, APP/PS1
+
Csf1r-
cre
+
Stat3
Fl/Fl
. The cre recombinase enzyme is under the control of the Csf1r promoter, a
gene transcriptionally active only in macrophages. At 6 months, cre activation was
induced with subcutaneous (s.c.) injections of tamoxifen and Stat3 was deleted only in
macrophage cells.

31

Figure 2. Validation of the model using Rosa
+
Csf1r-cre

mice. Representative cortical
confocal images from Rosa
+
Csf1r-cre mouse brains stained with Iba1 (green) and Dapi
(A), and further quantitation of Iba1
+
cells expressing dtTomato (red) 2 or 4 weeks after
tamoxifen treatment; (n = 5 mice per group) (B). Flow cytometric dot-plots showing CD45
and tdTomato expressing splenocytes from Rosa+Csf1r-cre
+
or Rosa+Csf1r-cre
-
mice
(C), and further quantitation of CD45
+
cells expressing dtTomato 2 weeks after tamoxifen
treatment (D). Data are presented as mean ± SEM.

A
C
B
D
- + +
2 2 4
32

Figure 3. Aβ deposition in APP/PS1
+
Csf1r-cre Stat3
Fl/Fl
mice. Quantification of
aggregated Aβ protein labeling was done in male and female APP/PS1
+
Csf1r-cre
Stat3
Fl/Fl
mice in the hippocampus (HC) (A and C) and entorhinal cortex (EC) (B and D)
via Thioflavine S (ThioS) and 6E10 labeling. Data are presented as mean ± SEM. In all
cases, p<0.05 (*) was considered to be statistically significant. n=3-8 per group.
Representative microphotographs of 6E10 labeling in EC in male and female
APP/PS1
+
Csf1r-cre
-
Stat3
Fl/Fl
mice (E).

A
C
B
D
0.0
0.5
1.0
1.5
2.0
2.5
APP/PS1
Csfr1-cre Stat3
Fl/Fl
+ - + -
†
Aβ oligomers (nmol/mg)
Male
Female
6E10 (EC)
E
33

Figure 4. Morphometric analysis of amyloid plaques in APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl

mice. Brain sections were labeled with Thioflavin S (ThioS) (A) or 6E10 (B) and Aβ
plaques were counted and assigned to three mutually exclusive categories based on
maximum diameter. Data are presented as mean ± SEM of plaques in the entorhinal
cortex (EC). n=3-5 per group.

34

Figure 5. Biochemical analysis of Aβ levels in APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice.
Schematic representation of different Aβ states found in the brain parenchyma of
APP/PS1 mice, demonstrating the most likely states found in the triton-soluble and
guanidine-soluble compartments (A). ELISA analysis of triton-soluble Aβ1-40 (B) and Aβ1-
42 (C) in male and female APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice. Analysis of Aβ oligomers (D)
and guanidine-soluble Aβ1-40 (E) and Aβ1-42 (F) of mice with indicated genotypes. Data
are presented as mean ± SEM. In all cases, p<0.05 (*) or lower (p<0.01 ** or p<0.001 ***)
was considered to be statistically significant. Trending results with p<0.1 (†) are also
displayed. n=4-10 per group.

35

Figure 6. APP and PS1 expression levels in APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice.
Quantification of APP (A) or PS1 (B) mRNA levels in frontal cortex homogenates from
APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice. Expression levels are normalized to β-actin.
Quantification of western blots normalized to actin of APP (C) and PS1 (D) in brain
homogenates of APP/PS1 mice with indicated genotypes. Data are presented as mean
± SEM. n=4-5 per group.

36

Figure 7. Innate immunity cell profile. Quantification of reactive astrocytes was done
by GFAP labeling in the entorhinal cortex (EC) (A) and hippocampus (HC) (B) of male
and female APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice. Further quantification of brain
macrophages was done by Iba1 labeling in the EC (C) and HC (D), and pan-leukocytes
was done by CD45 labeling in the EC (E) and HC (F). Data are shown as mean ± SEM.
In all cases, p<0.05 (*) was considered to be statistically significant. n=4-8 per group.

37

Figure 8. Proliferation and numbers of brain macrophage cells in APP/PS1
+
Csf1r-
cre

Stat3
Fl/Fl
mice. Number of Iba1
+
cells colocalized with Ki67
+
in the entorhinal cortex
(EC) (A) and hippocampus (HC) (B) of male and female APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl

mice. Number of DAB stained brain macrophages in the HC (C) and EC (D) of indicated
genotypes. Data are presented as mean ± SEM. In all cases, p<0.01 (**) was considered
to be statistically significant. n=3-5 per group.

38

Figure 9. Inflammatory cytokine profile in APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice. ELISA
analysis of IL1β (A), IFN𝛾 (B), IL6 (C), MCP-1 (D), and TNFα (E) levels in brain
homogenate of male and female APP
+
Csf1r-cre

Stat3
Fl/Fl
mice. Data are presented as
mean ± SEM. In all cases, p<0.05 (*) was considered to be statistically significant. n=7-
10 per group.

A
B
C D
E
39

Figure 10. Aβ encapsulated within phagolysosomes of APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl

mice brain sections. Quantitation of Aβ (6E10) volume uptake within CD68
+

phagolysosomes inside Iba1
+
cells (A), percent Iba1
+
brain macrophage volume occupied
by phagolysosomes (B), or volume of phagolysosome occupied by Aβ (C) in the cortex
of APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice. Data are presented as mean ± SEM. 3D
reconstruction from confocal image stacks showing 6E10
+
(red) Aβ encapsulated within
CD68
+
(green) phagolysosome structures in Iba1
+
(white) brain macrophages present in
brains of APP/PS1
+
Csf1r-cre

Stat3
Fl/Fl
mice (D). In all cases, p<0.05 (*) or lower (p<0.01
** or p<0.001 ***) was considered to be statistically significant. Trending results with p<0.1
(†) are also displayed. n=3-8 per group.

A
B
Cre- Cre+
Confocal Image 3D Reconstruction
D
0.0
0.5
1.0
1.5
2.0
2.5
APP/PS1
Csfr1-cre Stat3
Fl/Fl
+ - + -
†
Aβ oligomers (nmol/mg)
Male
Female
C
40

Figure 11. Effect of Stat3 on bone marrow derived macrophage (BMDM)
differentiation in vitro. Monocytes from wild-type mice cultured in the presence of M-
CSF were analyzed with flow cytometry for successful differentiation from monocytes
(CD11b
+
, CD45
+
, F4/80
-
, and CD14
-
) to macrophages (CD11b
+
, CD45
+
, F4/80
+
, and
CD14
+
) (A). Co-culture of monocytes with Stat3 inhibitor VII, 5,15-DPP (Stat3i+) or vehicle
(Stat3i-) prevented macrophage differentiation, analyzed on day 5 (B). Data are
presented as mean ± SEM. n= 7-8 per group.

A
B
41
References

1. Alzheimer’s Association (2018). Alzheimer’s disease facts and figures [E Book}.
2. Reitz, C. & Mayeux, R. Alzheimer disease: Epidemiology, Diagnostic Criteria, Risk Factors
and Biomarkers. Biochem. Pharmacol. 88, 640–651 (2014).
3. Hardy, J. A. & Higgins, G. A. Alzheimer’s disease: the amyloid cascade hypothesis. Science
256, 184–185 (1992).
4. Barage, S. H. & Sonawane, K. D. Amyloid cascade hypothesis: Pathogenesis and therapeutic
strategies in Alzheimer’s disease. Neuropeptides 52, 1–18 (2015).
5. Tarasoff-Conway, J. M. et al. Clearance systems in the brain—implications for Alzheimer
disease. Nat. Rev. Neurol. 11, 457–470 (2015).
6. Masters, C. L. & Selkoe, D. J. Biochemistry of Amyloid β-Protein and Amyloid Deposits in
Alzheimer Disease. Cold Spring Harb. Perspect. Med. 2, (2012).
7. Robinson, M., Lee, B. Y. & Hane, F. T. Recent Progress in Alzheimer’s Disease Research, Part
2: Genetics and Epidemiology. J. Alzheimers Dis. 57, 317–330
8. Lu, Y., Liu, W. & Wang, X. TREM2 variants and risk of Alzheimer’s disease: a meta-analysis.
Neurol. Sci. 36, 1881–1888 (2015).
9. Secko, D. Alzheimer’s disease: genetic variables and risk. CMAJ Can. Med. Assoc. J. 172, 627
(2005).
10. Selkoe, D. J. & Hardy, J. The amyloid hypothesis of Alzheimer’s disease at 25 years. EMBO
Mol. Med. 8, 595–608 (2016).
11. Reitz, C. Alzheimer’s disease and the amyloid cascade hypothesis: a critical review. Int. J.
Alzheimers Dis. 2012, 369808 (2012).
42
12. Wang, W.-Y., Tan, M.-S., Yu, J.-T. & Tan, L. Role of pro-inflammatory cytokines released
from microglia in Alzheimer’s disease. Ann. Transl. Med. 3, (2015).
13. Li, X., Long, J., He, T., Belshaw, R. & Scott, J. Integrated genomic approaches identify major
pathways and upstream regulators in late onset Alzheimer’s disease. Sci. Rep. 5, (2015).
14. Annese, A. et al. Whole transcriptome profiling of Late-Onset Alzheimer’s Disease patients
provides insights into the molecular changes involved in the disease. Sci. Rep. 8, (2018).
15. Guillot-Sestier, M.-V. et al. Il10 deficiency rebalances innate immunity to mitigate
Alzheimer-like pathology. Neuron 85, 534–548 (2015).
16. Bakkar, R. M., Luo, G., Webb, T. A., Crutcher, K. A. & de Courten-Myers, G. M. Down’s
Syndrome with Alzheimer’s Disease-Like Pathology: What Can It Teach Us about the
Amyloid Cascade Hypothesis? International Journal of Alzheimer’s Disease (2010).
doi:10.4061/2010/175818
17. Head, E., Powell, D., Gold, B. T. & Schmitt, F. A. Alzheimer’s Disease in Down Syndrome. Eur.
J. Neurodegener. Dis. 1, 353–364 (2012).
18. Holland, A. J., Hon, J., Huppert, F. A., Stevens, F. & Watson, P. Population-based study of the
prevalence and presentation of dementia in adults with Down’s syndrome. Br. J. Psychiatry
J. Ment. Sci. 172, 493–498 (1998).
19. Olmos-Alonso, A. et al. Pharmacological targeting of CSF1R inhibits microglial proliferation
and prevents the progression of Alzheimer’s-like pathology. Brain J. Neurol. 139, 891–907
(2016).
43
20. Przanowski, P. et al. The signal transducers Stat1 and Stat3 and their novel target Jmjd3
drive the expression of inflammatory genes in microglia. J. Mol. Med. Berl. Ger. 92, 239–254
(2014).
21. London, A., Cohen, M. & Schwartz, M. Microglia and monocyte-derived macrophages:
functionally distinct populations that act in concert in CNS plasticity and repair. Front. Cell.
Neurosci. 7, (2013).
22. Shankar, G. M. et al. Amyloid β-Protein Dimers Isolated Directly from Alzheimer Brains
Impair Synaptic Plasticity and Memory. Nat. Med. 14, 837–842 (2008).
23. Ma, T. & Klann, E. Amyloid β: Linking Synaptic Plasticity Failure to Memory Disruption in
Alzheimer’s Disease. J. Neurochem. 120, 140–148 (2012).
24. Dorostkar, M. M., Zou, C., Blazquez-Llorca, L. & Herms, J. Analyzing dendritic spine
pathology in Alzheimer’s disease: problems and opportunities. Acta Neuropathol. (Berl.)
130, 1–19 (2015).
25. Šimić, G. et al. Tau Protein Hyperphosphorylation and Aggregation in Alzheimer’s Disease
and Other Tauopathies, and Possible Neuroprotective Strategies. Biomolecules 6, (2016).
26. Busciglio, J., Lorenzo, A., Yeh, J. & Yankner, B. A. beta-amyloid fibrils induce tau
phosphorylation and loss of microtubule binding. Neuron 14, 879–888 (1995).
27. Mukhin, V. N., Pavlov, K. I. & Klimenko, V. M. Mechanisms of Neuron Loss in Alzheimer’s
Disease. Neurosci. Behav. Physiol. 47, 508–516 (2017).
28. Niikura, T., Tajima, H. & Kita, Y. Neuronal Cell Death in Alzheimer’s Disease and a
Neuroprotective Factor, Humanin. Curr. Neuropharmacol. 4, 139–147 (2006).
44
29. Morishima, Y. et al. Beta-amyloid induces neuronal apoptosis via a mechanism that involves
the c-Jun N-terminal kinase pathway and the induction of Fas ligand. J. Neurosci. Off. J. Soc.
Neurosci. 21, 7551–7560 (2001).
30. Streit, W. J., Braak, H., Xue, Q.-S. & Bechmann, I. Dystrophic (senescent) rather than
activated microglial cells are associated with tau pathology and likely precede
neurodegeneration in Alzheimer’s disease. Acta Neuropathol. (Berl.) 118, 475–485 (2009).
31. Donev, R., Kolev, M., Millet, B. & Thome, J. Neuronal death in Alzheimer’s disease and
therapeutic opportunities. J. Cell. Mol. Med. 13, 4329–4348 (2009).
32. Fiala, M., Cribbs, D. H., Rosenthal, M. & Bernard, G. Phagocytosis of amyloid-beta and
inflammation: two faces of innate immunity in Alzheimer’s disease. J. Alzheimers Dis. JAD
11, 457–463 (2007).
33. Guillot-Sestier, M.-V., Doty, K. R. & Town, T. Innate Immunity Fights Alzheimer’s Disease.
Trends Neurosci. 38, 674–681 (2015).
34. Beason-Held, L. L. et al. Changes in Brain Function Occur Years before the Onset of
Cognitive Impairment. J. Neurosci. 33, 18008–18014 (2013).
35. Hato, T. & Dagher, P. C. How the Innate Immune System Senses Trouble and Causes
Trouble. Clin. J. Am. Soc. Nephrol. CJASN 10, 1459–1469 (2015).
36. Elliott, D. E., Siddique, S. S. & Weinstock, J. V. Innate Immunity in Disease. Clin.
Gastroenterol. Hepatol. Off. Clin. Pract. J. Am. Gastroenterol. Assoc. 12, 749–755 (2014).
37. Hillmer, E. J., Zhang, H., Li, H. S. & Watowich, S. S. STAT3 signaling in immunity. Cytokine
Growth Factor Rev. 31, 1–15 (2016).
45
38. Li, H. S. & Watowich, S. S. Innate Immune Regulation by STAT-mediated Transcriptional
Mechanisms. Immunol. Rev. 261, 84–101 (2014).
39. Sokolowski, J. D. & Mandell, J. W. Phagocytic clearance in neurodegeneration. Am. J. Pathol.
178, 1416–1428 (2011).
40. Izumi, K. et al. Targeting the androgen receptor with siRNA promotes prostate cancer
metastasis through enhanced macrophage recruitment via CCL2/CCR2-induced STAT3
activation. EMBO Mol. Med. 5, 1383–1401 (2013).
41. Grivennikov, S. I. & Karin, M. Dangerous liaisons: STAT3 and NF-kappaB collaboration and
crosstalk in cancer. Cytokine Growth Factor Rev. 21, 11–19 (2010).
42. Akira, S. Roles of STAT3 defined by tissue-specific gene targeting. Oncogene 19, 2607–2611
(2000).
43. Walker, D. G., Lue, L. F. & Beach, T. G. Gene expression profiling of amyloid beta peptide-
stimulated human post-mortem brain microglia. Neurobiol. Aging 22, 957–966 (2001).
44. Shaftel, S. S., Griffin, W. S. T. & O’Banion, M. K. The role of interleukin-1 in
neuroinflammation and Alzheimer disease: an evolving perspective. J. Neuroinflammation
5, 7 (2008).
45. Ben Haim, L. et al. The JAK/STAT3 pathway is a common inducer of astrocyte reactivity in
Alzheimer’s and Huntington’s diseases. J. Neurosci. Off. J. Soc. Neurosci. 35, 2817–2829
(2015).
46. Gordon, P., Okai, B., Hoare, J. I., Erwig, L. P. & Wilson, H. M. SOCS3 is a modulator of human
macrophage phagocytosis. J. Leukoc. Biol. 100, 771–780 (2016).
46
47. Chakrabarty, P. et al. IL-10 alters immunoproteostasis in APP mice, increasing plaque
burden and worsening cognitive behavior. Neuron 85, 519–533 (2015).
48. Scheuner, D. et al. Secreted amyloid beta-protein similar to that in the senile plaques of
Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked
to familial Alzheimer’s disease. Nat. Med. 2, 864–870 (1996).
49. Potter, R. et al. Increased in vivo Amyloid-β42 production, exchange, and irreversible loss in
Presenilin Mutations Carriers. Sci. Transl. Med. 5, (2013).
50. Mawuenyega, K. G. et al. Decreased Clearance of CNS Amyloid-β in Alzheimer’s Disease.
Science 330, 1774 (2010).
51. He, G.-L. et al. Inhibition of STAT3- and MAPK-dependent PGE2 synthesis ameliorates
phagocytosis of fibrillar β-amyloid peptide (1-42) via EP2 receptor in EMF-stimulated N9
microglial cells. J. Neuroinflammation 13, (2016).
52. Tian, D.-S. et al. Chemokine CCL2-CCR2 Signaling Induces Neuronal Cell Death via STAT3
Activation and IL-1β Production after Status Epilepticus. J. Neurosci. Off. J. Soc. Neurosci. 37,
7878–7892 (2017).
53. Vasamsetti, S. B. et al. Metformin Inhibits Monocyte-to-Macrophage Differentiation via
AMPK-Mediated Inhibition of STAT3 Activation: Potential Role in Atherosclerosis. Diabetes
64, 2028–2041 (2015).
54. Matsukawa, A. et al. Stat3 in resident macrophages as a repressor protein of inflammatory
response. J. Immunol. Baltim. Md 1950 175, 3354–3359 (2005).
55. Hong, L. et al. STAT3 signaling pathway regulates glioma stem cells induced host
macrophage malignance. Transl. Cancer Res. 5, 805-816–816 (2016).
47
56. Michelucci, A., Heurtaux, T., Grandbarbe, L., Morga, E. & Heuschling, P. Characterization of
the microglial phenotype under specific pro-inflammatory and anti-inflammatory
conditions: Effects of oligomeric and fibrillar amyloid-beta. J. Neuroimmunol. 210, 3–12
(2009).
57. Reichenbach, N. et al. Inhibition of Stat3-mediated astrogliosis ameliorates pathology in an
Alzheimer’s disease model. EMBO Mol. Med. e9665 (2019).
doi:10.15252/emmm.201809665

Abstract (if available)

Abstract Alzheimer’s disease (AD) is the most common form of dementia and is the sixth leading cause of death in the United States. AD is pathologically defined by neuroinflammation, neurodegeneration, and the deposition of amyloid-beta (Aβ) peptides as senile plaques. The role of the innate immune system in AD has recently taken center stage on the heels of multiple top hits in genome-wide association studies. Stat3, an important mediator of inflammation, is at supraphysiological levels in AD. Stat3 regulates a variety of brain macrophage functions and its dysregulation in AD has been associated with decreased Aβ clearance. To assess Stat3’s role in macrophages within the context of AD, we generated an inducible cre/lox mouse able to delete Stat3 in Csf1r⁺ macrophages within the APP/PS1 model of amyloidosis. Female cre⁺ mice displayed decreased levels of IFNγ and IL1β while showing an increase in Aβ40 and Aβ42 levels. Along with decreased pro-inflammatory cytokines, female cre⁺ mice exhibited reduced Iba1 immunostaining in the cortex, suggesting decreased macrophage activation. Strikingly, Stat3 deletion decreased Aβ phagocytosis in both male and female cre⁺ mice compared to cre⁻. These results indicate that Stat3 signaling in brain macrophages is important for their successful activation and their ability to internalize Aβ, and that the loss of Stat3 negatively impacts this process.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

A transgenic mouse model with overexpression of human RAGE in endothelial cells presents enhanced amyloid-beta transport into the brain

PDF

TREM2 and C1q signaling regulates immunoproteostasis in Alzheimer's disease

PDF

Role of oxidative stress in age-associated mild cognitive impairment and Alzheimer's disease

PDF

A virtual reality exergaming system to enhance brain health in older adults at risk for Alzheimer’s disease

PDF

Experience-dependent neuroplasticity of the dorsal striatum and prefrontal cortex in the MPTP-lesioned mouse model of Parkinson’s disease

PDF

Inhibition of NR3B1 attenuates the progression of NAFLD and NASH in liver-specific Pten knockout mice

Asset Metadata

Creator Oseas, Rachel (author)

Core Title Macrophage-specific Stat3 deletion in a mouse model of Alzheimer’s disease

School Keck School of Medicine

Degree Master of Science

Degree Program Medical Physiology

Publication Date 05/08/2019

Defense Date 03/04/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Alzheimer’s disease,amyloid-beta,amyloidosis,APP/PS1,brain,Csf1r-cre,innate immunity,microglia,neuroinflammation,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Town, Terrence (committee chair), Kaslow, Harvey (committee member), Mircheff, Austin (committee member)

Creator Email oseas@usc.edu,racheloseas@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-169057

Unique identifier UC11660515

Identifier etd-OseasRache-7427.pdf (filename),usctheses-c89-169057 (legacy record id)

Legacy Identifier etd-OseasRache-7427.pdf

Dmrecord 169057

Document Type Thesis

Format application/pdf (imt)

Rights Oseas, Rachel

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA