University of Southern California Dissertations and Theses

Functional study of C9ORF72 and its implication in the pathogenesis of amyotrophic lateral sclerosis

(USC Thesis Other)

Functional study of C9ORF72 and its implication in the pathogenesis of amyotrophic lateral sclerosis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Functional study of C9ORF72
and its implication in the
pathogenesis of amyotrophic
lateral sclerosis
by
Shaoyu Lin
A Dissertation Presented to
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
Doctor of Philosophy
Developmental Biology, Stem Cell Biology and Regenerative Medicine
August 2019
Acknowledgement
I see my past years’ PhD training not only courses, experiments and publications, but more
importantly, also a journey where I kept pushing the envelop to achieve next level of personal
development. Therefore the first person I want to say thank you to is my PhD supervisor Prof.
Justin Ichida, who has been the most influential person during my graduate study in USC. Not
only dose Justin always encourage me to try new ideas while keeping me focusing on the right
direction, but he also sets himself as a good model for me to learn the mentality overcoming
difficulties in the scientific career, which is lifelong wealth for me. I still remember one day at
the end of 2015, while I was working on the very technically challenging GEF assay for the
manuscript submission, to enable me to have more time to try new experimental conditions,
Justin rushed to the neighboring building himself to borrow ultracentrifuge tubes for me and then
drove my car to the bodyshop for oil change. Although eventually that batch of experiment
failed, I was motivated by his determination to see through experiments. He was also very
generous supporting my traveling to conferences and helped me a lot during my postdoc
application. Next I want to say thank you with my full respect to Yingxiao Shi, whose pioneering
work really lay the foundation for this project, and also to Wen-Hsuan Chang and Shu-Ting
Hung, as both showed great dedication to helping with this project, far beyond that can be
represented in the authorship. Moreover, I want to thank all the other members of Ichida lab,
especially Kim Staats, Eric Hendricks, Mickey Huang, Louise Menendez, and Kimberley
Wunder, no matter whether we collaborate or not, they are always willing to help, both in and
I
outside lab. I wan to Thank Prof. Junjie Hu, my supervisor during my master study in Nankai
University, as solid training in cell biology and biochemistry from his lab really helped me a lot
during my PhD study in USC. I also want to thank Jiao Luo and Brent Wilkinson from USC for
generous supports of lab facilities and reagents; USC stem cell core, USC imaging core, Sha Sun
and Xian Bian from Yale U, and Bo Xiong from UT Southwestern for their technical supports for
my experiments; and my thesis committee members Prof. Gage Crump, Prof. Dion Dickman,
Prof. Chien-Ping Ko, and Prof. Berislav Zlokovic for their guidance during these years. Last, I
want to thank my girl friend Ching-Ju Hsu for tolerating my extremely long working hours in the
lab, and apologize to my parents for not being with them for most of time since I came to LA. It
is very difficult for they to understand the scientific questions I am pursuing, but they did
everything they can to support their only child.
Grown up in a very introverted Chinese family, I am somehow still struggling learning to express
my appreciation in this direct way, although I have been in LA for more than 6 year. Therefore, I
believe there are far more people than those were mentioned above to whom I want to say thank
you, without your warmhearted support, I can not reach that far. Thank you to all.
II
Abstract
An intronic GGGGCC repeat expansion in C9ORF72 is the most common cause of amyotrophic
lateral sclerosis (ALS) and frontotemporal dementia (FTD), but the pathogenic mechanism of
this repeat remains unclear. Using human induced motor neurons (iMNs), we found that repeat-
expanded C9ORF72 was haploinsufficient in ALS. We found that C9ORF72 interacted with
endosomes and was required for normal vesicle trafficking and lysosomal biogenesis in motor
neurons. Repeat expansion reduced C9ORF72 expression, triggering neurodegeneration through
accumulation of glutamate receptors, leading to excitotoxicity. Restoring C9ORF72 levels or
augmenting its function with constitutively active RAB5 or chemical modulators of RAB5
effectors rescued patient neuron survival and ameliorated neurodegenerative processes in loss-of-
function C9orf72 mouse models. Thus, modulating vesicle trafficking was able to rescue
neurodegeneration caused by the C9ORF72 repeat expansion. Coupled with rare mutations in
ALS2, FIG4, CHMP2B, OPTN and SQSTM1, our results reveal mechanistic convergence on
vesicle trafficking in ALS and FTD. III
Table of Contents
Acknowledgement I ............................................................
Abstract III ...........................................................................
Table of Contents IV ............................................................
List of figures VI ..................................................................
List of tables VII ...................................................................
Chapter 1-Introduction of amyotrophic lateral
sclerosis and C9ORF72 mutation 1 ...................................
Amyotrophic lateral sclerosis 2
........................................................................
Pathological features of C9ORF72 ALS/FTD 4
...............................................
Pathogenic mechanisms of C9ORF72 ALS/FTD 6
..........................................
Chapter 2-Mechanistic study of C9ORF72
haploinsufficiency in the pathogenesis of ALS/FTD 13 ...
Introduction 14
................................................................................................
Result 14
..........................................................................................................
Discussion 29
..................................................................................................
Chapter 3-Study of PIKFYVE's role in exosomal
secretion 31 .........................................................................
Introduction 32
................................................................................................
Result 32
..........................................................................................................
Discussion 34
..................................................................................................
Chapter 4-Study of GEF activity of C9ORF72 36 ..............
Introduction 37
................................................................................................
Result 37
..........................................................................................................
IV
Discussion 42
..................................................................................................
Chapter 5-Conclusion 44 ...................................................
Methods 46 ..........................................................................
References 60 ......................................................................
V
List of figures
Fig. 1.1 | C9ROF72 structure, transcript variants and protein isoforms. 3

Fig. 1.2 | C9ORF72 ALS/FTD neuropathology. 4
.......................................
Fig. 2.1 | C9ORF72 patient iMNs degenerate upon glutamate stress. 15
.
Fig. 2.2 | C9ORF72 haploinsufficiency leads to motor neuron
degeneration. 16
...........................................................................
Fig. 2.3 | C9ORF72 is localized on early endosomes in iMNs. 19
.............
Fig. 2.4 | Low C9ORF72 activity leads to defective lysosomal
biogenesis. 22
...............................................................................
Fig. 2.5 | Low C9ORF72 activity sensitizes iMNs to glutamate stress. 23
.
Fig. 2.6 | Small molecule and genetic regulators of endosomal
trafficking rescue patient iMNs survival. 27
...................................
Fig. 3 | Functions of PIKFYVE in exosomal secretion. 33
..........................
Fig. 4.1| C9ORF72 interactome. 38
...........................................................
Fig. 4.2 | GEF activity of C9ORF72. 40 ......................................................
VI
List of tables
Table 1| List of GTPases cloned 41
VII
Chapter 1-Introduction of
amyotrophic lateral sclerosis and
C9ORF72 mutation
1
Amyotrophic lateral sclerosis
Amyotrophic lateral sclerosis (ALS) is a fatal, progressive neurodegenerative disease that is
characterized by the irreversible degeneration of motor neurons in the brain and spinal cord and
consequent muscle denervation and wasting
1
. The age of clinical onset of ALS is highly variable
but is almost always after the fourth decade of life, rare juvenile ALS cases have been reported
2
.
Death in ALS occurs typically 3–5 years after diagnosis, with the vast majority of deaths due to
respiratory failure. In the United States and United Kingdom, ALS causes more than 1 in 500
deaths in adults, a statistic that suggests that more than 15 million people who are alive at present
will succumb to the disease
3
. Importantly, ALS shares clinical and pathological features with
several other adult-onset degenerative disorders, including, most frequently, frontotemporal
dementia (FTD), which is characterized pathologically by focal degeneration of prefrontal and/or
temporal cortex and clinically by changes in behavior, language, and executive functions
4
. The
convergence of these two diseases on several dysfunctional molecular pathways as well as many
disease-causing genetic mutations suggest that they may constitute a clinical spectrum
5
.
ALS is traditionally classified into two categories: familiar ALS (~10% of all ALS cases) and
sporadic ALS (~90%), and they are largely indistinguishable clinically. Familiar ALS is
predominantly hereditary, almost always as a dominant trait and frequently with high penetrance.
In 1993, SOD1 was discovered as the first disease associated gene
6,
thereafter, greater than 50
ALS-linked genes have been identified, which can be grouped into loose categories based on the
involved molecular and/or cellular pathways: genes that alter proteostasis and protein quality
control; genes that perturb RNA stability, function and metabolism; and genes that disturb
2
Fig. 1.1 | C9ROF72 structure, transcript variants and protein isoforms.
The C9ORF72 gene consists of 11 exons, has three main alternatively spliced transcript variants and produces two protein
isoforms. In the figure, coding exons are indicated in grey and non-coding exons in blue (not to scale). The GGGGCC
hexanucleotide repeat expansion mutation is located in the first intron of variants 1 and 3 and within the promoter region of
variant 2. Variant 1 encodes C9ORF72 isoform B (short), a 222-amino acid protein of 24 kDa, and variants 2 and 3 encode
C9ORF72 isoform A (long), a 481-amino acid protein of 54 kDa. Adapted from Ref.63.

cytoskeletal dynamics in the motor neuron axon and distal terminal
3
. Many of these disease-
linked genes are shared in both familiar and sporadic ALSs cases. In 2011, groundbreaking
progress has been made with the discovery that a hexanucleotide GGGGCC (G4C2) repeat
expansion in the C9ORF72 gene (Fig. 1.1) is the most frequent genetic cause of both ALS and
FTD in Europe and North America (up to 40% in familiar ALS cases in Finland)
7,8
. This G4C2
repeat expansion has also been detected in 5-20% of patients with sporadic ALS
9
. While the vast
majority (>95%) of neurologically healthy individuals have ≤11 hexanucleotide repeats in the
C9ORF72 gene
10,11
, the actual size of the G4C2 repeats varies dramatically among patients with
ALS or FTD carrying the mutation (here termed C9ORF72 ALS/FTD). An arbitrary threshold of
30 repeats is used in most studies, but larger expansions ranging from hundreds to thousands of
repeats are most commonly observed in patients with C9ORF72 ALS/FTD
12–14
. To date, the size
3
Fig. 1.2 | C9ORF72 ALS/FTD neuropathology.
Sense and antisense RNA foci are a common feature in the brains of patients with C9ORF72-associated frontotemporal
dementia and/or amyotrophic lateral sclerosis (C9ORF72 ALS/FTD). (a,b) Representative images show neurons from the
frontal cortex of a patient with C9FTD/ALS, containing multiple sense (red; part a) and antisense (green; part b) foci in
nuclei (stained blue with DAPI). (c) TAR DNA-binding protein 43 (TDP-43) pathology in a patient with C9ORF72 ALS/FTD.
Arrow indicates a neuronal cytoplasmic TDP-43 inclusion in the frontal cortex, with concomitant depletion of nuclear
TDP-43. (d) Dipeptide repeat protein (DPR) pathology in a patient with C9ORF72 ALS/FTD. Inclusions consisting of sense
and antisense DPRs are produced by repeat associated non-ATG translation (RAN). Arrows indicate neuronal cytoplasmic
inclusions of ploy-GA protein. Adapted from Ref.63.

of the G4C2 repeat expansion does not appear to correlate with any disease parameter, such as
disease severity or age of disease onset.
Pathological features of C9ORF72 ALS/FTD
TDP-43 inclusions
The overwhelming majority of ALS cases and approximately 50% of FTD cases develop
pathological inclusion of TDP-43 (TAR DNA-binding protein 43) in neurons and glia, with
abnormal phosphorylation and ubiquintination on both full length protein and truncated C-
terminal fragments
15,16
. Cells with cytoplasmic TDP-43 aggregates typically have concomitant
4
Fig. 1.3 | Dipeptide repeat proteins. The figure shows the dipeptide repeat proteins that are generated by RAN translation.
The sense strand generates poly-GA, poly-GP and poly-GR, and the antisense strand generates poly-GP , poly-PA and
poly-PR. Adapted from Ref.63.

loss of TDP-43 signal from nuclei.
RNA foci
The expanded G4C2 repeats in the C9ORF72 intron are bidirectionally transcribed into repetitive
RNA, which forms sense and antisense RNA foci
17–19
. These foci are found predominantly
within neuronal nuclei in the frontal and motor cortices, hippocampus, cerebellum and spinal
cord (in motor neurons and occasionally in interneurons) (Fig. 1.2 a, b). Nuclear localized RNA
foci are also found in motor and cortical neurons generated from induced pluripotent stem cells
(iPSCs) derived from patients with C9ORF72 ALS/FTD
17,18,20,21
. 30–60% of (G4C2) or (C4G2)
RNA foci-containing cells in the frontal cortex and hippocampus showed TDP-43
mislocalization. However, only less than 20% of these cells stained positive for P62 (also known
as SQSTM1) aggregation, calling into question the correlation between RNA foci and
pathological inclusions
22
.
5
Dipeptide repeat proteins pathology
The G4C2 RNA repeats can be translated in all possible reading frames to form five different
dipeptide repeat proteins (DPRs) via a non-canonical mechanism known as repeat-associated
non-ATG (RAN) translation
19
. The sense (G4C2) RNA repeats encode three DPRs, glycine–
proline (poly-GP), glycine–alanine (poly-GA) and glycine–arginine (poly-GR), whereas the
antisense (C4G2) RNA encodes proline–glycine (poly-PG), proline–arginine (poly-PR) and
proline–alanine (poly-PA) (Fig. 1.3). DPRs most commonly form neuronal cytoplasmic
inclusions, but intranuclear inclusions are also observed with some arginine rich species (poly-
GR and poly-PR)
23–26
(Fig. 1.2 c, d). Sense-derived DPRs are more prevalent than antisense-
derived DPRs in C9ORF72 ALS/ FTD patients, but poly-PA, poly-PR and poly-PG have been
found in the hippocampus, cerebellum, amygdala, medulla, thalamus, frontal cortex, spinal cord
and motor cortex of patients with C9ORF72 ALS/ FTD
19,23
, with the hippocampus and
cerebellum (granule cells) showing the highest levels of DPRs, and C9ORF72 ALS/ FTD spinal
cord and brainstem tissue containing the lowest DPR levels
19,27
. Notably, (GP), (GA) and (GR)
DPRs co-localized with P62, but were TDP-43 negative, suggesting that their precipitation may
precede the development of TDP-43 inclusion.
Pathogenic mechanisms of C9ORF72 ALS/FTD
Based on studies with human postmortem tissue, in vitro cultured neuronal systems, and in vivo
animal models, three competing but nonexclusive mechanisms have been proposed for the
pathogenesis of C9ORF72 ALS/FTD: 1) loss of C9ORF72 function due to haploinsufficient
6
C9ORF72 protein level, toxic gain of function from 2) expanded G4C2 RNA repeats, and/or 3)
aggregated dipeptide repeat proteins generated from RAN translation.
Loss of function mechanisms
The human C9ORF72 gene consists of 11 exons, has three main alternatively spliced transcript
variants, and produces two protein isoforms. In transcript variants 1 and 3, the repeats are within
intron 1 and therefore included in the respective pre-mRNAs, while in variant 2, the repeats are
located within the promoter region and thus are not incorporated into variant 2 pre-mRNA (Fig
1.1). Studies have demonstrated reduced levels of one or more of the C9ORF72 transcript
variants in frontal cortex
8,28–32
, cerebellum
14,17,24,31
, motor cortex
17
, cervical spinal cord
17
, and
also in iPSC-derived neurons
17,20,33
from C9ORF72 G4C2 repeat expansion carriers compared
with controls. The findings are particularly robust for variants 1 and 2
14
. C9ORF72 protein levels
might be correspondingly reduced in the frontal cortex
32
.
Two mechanisms may explain the downregulation of C9ORF72: 1) epigenetic silencing and 2)
transcriptional instability
31,34,35
. 1) The presence of the G4C2 repeat expansion leads to local
epigenetic modifications that reduce available transcriptional start sites located in a promoter
region located upstream of and distal to the expansion (responsible for driving the production of
the transcript variants 1 and 3)
21
. 2) The structurally polymorphic nature of the G4C2 repeat
expansion also directly impairs polymerase processivity, thus causes RNA polymerases to stall,
slip or release during transcriptional initiation or elongation, which consequently leads to
reduced transcript levels and/or aborted or truncated transcripts
34,36–38
.
7
Knockdown of C9ORF72 in human cell lines and primary neuronal cultures inhibit autophagy
induction
39,40
, leading to accumulation of P62
39,40
and cytoplasmic aggregation of TDP-43
40
.
Neurons from C9ORF72 ALS/FTD patients have impaired basal autophagy
39,40
and increased
sensitivity to autophagy inhibition
20
, suggesting linkage of C9ORF72 function to cellular stress.
The mechanism underlying has been speculated to involve RAB GTPases as C9ORF72 interacts
with RAB guanine nucleotide exchange factors (GEF) Smith-Magenis syndrome Chromosome
Region candidate 8 (SMCR8) and WD Repeat containing protein 41 (WDR41)
40–45
. Different
RAB proteins mediate distinct steps of endosomal trafficking, including endocytosis, lysosomal
biogenesis, recycling, exocytosis, and autophagy. Multiple RABs including RAB1A, RAB8A
and RAB39B have been proposed involved in C9ORF72 pathway
39,40,42,43
, while no consensus
has been reached yet on which particular RAB is more important.
In zebrafish, c9orf72 knockdown resulted in severe axonal degeneration and behavioral deficits
that were rescued by the expression of exogenous human C9ORF72
28
. Similarly, deletion of the
Caenorhabditis elegans C9orf72 orthologue alfa-1 resulted in age-dependent motility deficits
47
.
However, in mouse, where the C9orf72 orthologue shares 98% homology with human
C9ORF72, ubiquitous knockouts of C9orf72 throughout development led to immune system
dysregulation in homozygous mice, but no general motor neuron dysfunction, pathology or
survival deficit
48–50
were observed.
Critically, none of the mouse C9orf72 knockouts recapitulate ALS or FTD, suggesting that
C9ORF72 loss of function may be insufficient to precipitate disease. However, given the role of
8
C9ORF72 in pathways previously implicated in FTD and ALS
51
, haploinsufficiency might
contribute to the disease process in combination with gain-of-function mechanisms.
Gain of function mechanisms
It remains unclear whether the G4C2 RNA repeats expansion or the translated DPRs are the true
neurotoxic species, though a considerable body of approaches have been developed trying to
dissect these gain-of-function cellular mechanisms. Each of the model systems come with its
own limitation. Postmortem studies generally do not capture the earliest pathogenic events. In
vitro and in vivo models often do not feature the long repeats found in patients, owing to
methodological difficulties in cloning GC-rich repeats of this length. Overexpression models do
not necessarily reflect endogenous expression level in patients, thus bring in extra layer of
complexity.
The evidence of repeated RNA toxicity comes from studies using a Drosophila model that
expresses 30 G4C2 repeats with a 6 bp (CTCGAG) interruption in the middle of the repeats
52,53
.
Ubiquitous expression of transgene was developmental lethal, while specific expression of
(G4C2)30 in eyes or motor neurons led to neurodegeneration. DPRs were not detected in the eyes
or neurons unless the repeats were strongly induced in all tissues
52
. Another study found when
primary cultured cortical or motor neurons were transfected with expanded G4C2 repeats in an
artificial intronic backbone mimicking the intronic context of C9ORF72 expansions, these
neurons demonstrated nuclear RNA foci and reduced survival. Dot blots and
immunocytochemistry revealed no DPRs in these cells
54
. However, it needs to be noted that
inability to detect DPRs is not sufficient to exclude a toxic role for these proteins.
9
In vitro, G4C2 repeat RNA forms secondary structures, including hairpins
34,55
and highly stable G
quadruplexes
30,34,55–57
. In vivo, such secondary structures are likely to mediate the sequestration
— and, as a consequence, depletion — of RNA-binding proteins (RBPs)
30,34
. RBPs have diverse
roles in splicing, translational regulation and RNA transport and degradation. Through an
unbiased proteomic strategy using human tissue
17,34,53,58
, cell models
34,53,59–61
, iPSC-derived
neurons
17,21,34
and in vivo models
20,53,59,62
, many unique C9ORF72 RNA repeats•RBP
interactomes have been identified. The most frequently identified RBPs that interact with
C9ORF72 repeat RNA were the heterogeneous nuclear ribonucleoproteins (hnRNPs), in
particular, hnRNP H, although hnRNP A1 and hnRNP A3 were also detected. Other RBPs
included double-stranded RNAspecificeditase B2 (ADARB2), THO complex subunit 4
(ALYREF), serine/arginine- rich splicing factor 1 (SRSF1), nucleolin, and Pur-α
63
. To date,
however, direct evidence regarding the effects of RBP sequestration in C9ORF72 ALS/FTD
patients is limited.
The neurotoxicity of DPRs has been also investigated in Drosophila models
22,33
. In one study,
overexpression of expanded G4C2 repeats in Drosophila eyes or adult neurons led to
neurodegeneration
22
. This effect was inhibited when the repeats were interrupted by stop codons
in each reading frame that prevented translation of the repeats into DPRs. In another study, 160
G4C2 repeats flanked by human C9ORF72 intronic sequence were ubiquitously overexpressed
33
.
RNA foci, but not DPRs were detected in neurons and glia. This model showed no evidence of
neurodegeneration or reduced survival, unless transgene expression was further upregulated to a
level when DPR started to accumulate, while RNA foci level remained grossly unchanged
33
,
supporting the idea that DPRs rather than RNA foci mediate neurodegeneration. Among the DPR
10
species, the arginine rich ones (poly-GR and poly-PR) showed greatest toxicity to primary
neuronal cultures
54,64,65
and Drosophila models
22,54,66–68
. In mouse with virus-mediated 66 G4C2
repeats overexpression in central nervous system, motor and behavioral phenotypes can be
detected by 6 months, with RNA foci, DPRs, phospho-TDP-43 inclusions and neuronal loss all
being observed
69
. However, when other gain-of-function mouse models were made with bacterial
artificial chromosome (BAC) transgenic expression of human C9ORF72 G4C2 repeat expansion
with surrounding regulatory regions and flanking sequences to achieve a more physiologically
relevant level of transgene expression, neither was TDP-43 inclusion pathology, no were
neuronal loss or reduced survival observed
70–72
.
A few DPR toxicity mechanisms in C9ORF72 ALS/FTD have been validated across multiple
human and non-human model systems, of which, dysfunctional nucleocytoplasmic transport
(NCT) is a prominent one. Poly-PR and poly-GR have been shown to interact with proteins that
contain low-complexity domains (LCDs), which include many RBPs
62,73
. LCD proteins can
undergo liquid-liquid phase separation (LLPS) to form droplets. Through this process, the
proteins become compartmentalized in the cell, forming membrane less organelles, such as
nucleoli and stress granules. These organelles facilitate the assembly of RNA and RBPs into
ribonucleoproteins and also aid subsequent RNA metabolism
63
. Poly-PR and poly-GR interact
with LCD proteins in nucleoli and stress granules, thereby impairing LLPS, disrupting the
dynamics of assembly of these organelles and affecting mRNA translation and NCT
62,67,74

Moreover, poly-GR and poly-PR can also induced stress granule assembly and localization of
NCT factors into these stress granules, thereby mediating NCT dysfunction
67
. Inhibition of stress
11
granule assembly abrogated NCT dysfunction and neurodegeneration in patient-derived neurons
and in vivo
67
.
Overall, many cellular pathways have been implicated in gain-of-function toxicity, given the
highly toxic nature of these DPRs. One issue remains to be addressed is whether different DPRs
or repeat RNA and DPRs act synergistically, potentially in conjunction with loss of function of
C9ORF72, to elicit downstream effects. Crossing of models that express different DPR species
should help to address this question. A further priority is to develop physiologically relevant
models to reflect endogenous levels of C9ORF72 repeat RNA and DPRs, and human iPSC-
derived neuronal models will be a key tool in this regard.
12
Chapter 2-Mechanistic study of
C9ORF72 haploinsufficiency in the
pathogenesis of ALS/FTD
13
Introduction
As reviewed above, neither have the gain of RNA/DPR toxicity mouse models fully
recapitulated C9ORF72 ALS/FTD phenotypes, nor did loss of C9orf72 function mouse models
develop any motor neuron degeneration. These suggest the necessity to develop a human iPSCs
based disease modeling system, which can precisely retain pathophysiologically relevant G4C2
repeats size and other disease associated genomic and epigenomic backgrounds. Although it has
been shown that human C9ORF72 protein was involved in regulation of autolysosomal
trafficking, most of these experiments were done in cell culture system irrelevant to motor
neuron degeneration
39,75
, no studies have provided direct evidence identifying a cellular pathway
through which C9ORF72 activity modulates neuronal survival in the scenario of ALS/FTD. The
effect of C9ORF72 haploinsufficiency in C9ORF72 ALS/FTD disease pathogenesis remains
unclear.
Result
C9ORF72 patient iMNs degenerate upon glutamate stress
To study the pathogenic mechanism of the C9ORF72 repeat expansion in human motor neurons,
we employed a previously developed method to convert human control and C9ORF72 ALS/FTD
patient iPSCs into induced motor neurons (iMNs) by overexpression of a cocktail of seven
transcriptional factors (Ngn2, Isl1, Lhx3, NeuroD1, Brn2, Ascl1 and Myt1l)
76
. Cells were co-
infected with Hb9 promotor driven GFP or RFP to label the generated neurons. Converted motor
14
Fig. 2.1 | C9ORF72 patient iMNs degenerate upon glutamate stress.
(a, b) Survival of control (CTRL) and C9ORF72 patient (C9ORF72-ALS) iMNs in basal neuronal culture (a) or in excess
glutamate (b). (c) Survival of control and C9ORF72-ALS iMNs in excess glutamate with glutamate receptor antagonists. (d)
Survival of iDAs in excess glutamate. n = 50 iMNs or iDAs per line for two control and two C9ORF72-ALS lines, iMNs
quantified from three biologically independent iMN conversions per line.

neurons have been well characterized by immunofluorescent and electrophysiological
approaches as functional motor neurons and can form neuromuscular junction with co-cultured
primary chick muscle, and actuated muscle contraction.
To determine whether C9ORF72 iMNs recapitulate neurodegenerative ALS processes, we
examined their survival by performing longitudinal tracking of Hb9::RFP+ iMNs. This approach
enabled us to distinguish differences in neurogenesis from differences in survival, which could
not be addressed using previously reported cross-sectional analyses
17,21,54,77
. In basal neuronal
medium supplemented with neurotrophic factors, control and C9ORF72 patient iMNs survived
equally well (Fig. 2.1a).Given that human C9ORF72 ALS patients have elevated glutamate
levels in their cerebrospinal fluid (possibly triggered by DPR-mediated aberrant splicing of the
15
a
c d
b
Fig. 2.2 | C9ORF72 haploinsufficiency leads to motor neuron degeneration.
(a) The levels of C9ORF72 variant 2 mRNA transcript (encoding isoform A). Data are presented as mean ± s.e.m., two-tailed
t-test with Welch’s correction. t value: 5.347, degrees of freedom: 11.08. n = 9 biologically independent iMN conversions
from 3 control lines and 12 biologically independent iMN conversions from 5 C9-ALS lines. (b) Immunoblotting and
quantification of C9ORF72 isoform A levels in control (n=2) and patient (n=3) motor neurons. Mean +/- s.d. (c, d) iMN
survival in excess glutamate following introduction of C9ORF72 (C9 isoform A or B) into C9ORF72 patient iMNs (c) or
SOD1-ALS iMNs (d). (e) qRT-PCR analysis of the levels of C9ORF72 variant 2 in control, C9ORF72+/-, and C9ORF72-/-
flow-sorted iMNs. n=3 biologically independent iMN conversions per line. Mean +/- s.d. One-way ANOVA with Tukey
correction. F-value (DFn, DFd): (2, 6) = 97.97. (e) Immunoblotting and quantification of C9ORF72 isoform A levels in motor
neurons derived from control (CTRL2), C9ORF72+/-, and C9ORF72-/- iPSCs. Quantification performed on n=3 biologically
independent motor neuron differentiations for each genotype in the western blot, one-way ANOVA with Tukey correction for
all comparisons. F-value (DFn, DFd): (1.528, 3.055) = 67.78. Mean +/- s.e.m. (f) qRT-PCR analysis of the levels of C9ORF72
variant 2 in control, C9ORF72+/-, and C9ORF72-/- flow-sorted iMNs. The diagram depicts the qRT-PCR primer binding
sites and the coding sequence for C9ORF72 isoform A. n=3 biologically independent iMN conversions per line. Mean +/-
s.d. One-way ANOVA with Tukey correction. F-value (DFn, DFd): (2, 6) = 97.97. n=3 biologically independent motor neuron
differentiations per line. (g) Survival of control (CTRL2) iMNs, the isogenic heterozygous (C9+/−) and homozygous (C9−/−)
iMNs and C9ORF72 patient (C9-ALS) iMNs in excess glutamate. n = 50 biologically independent iMNs per line per
condition for one control and two C9-ALS lines, iMNs quantified from three biologically independent iMN conversions. (h)
Control iMN survival in excess glutamate with scrambled or C9ORF72 ASOs. Each trace includes control iMNs from two
donors. n = 50 biologically independent iMNs per line per condition for two control lines, iMNs quantified from three
biologically independent iMN conversions. All iMN survival experiments were analyzed by two-sided log-rank test, and
statistical significance was calculated using the entire survival time course.

16
C9ORF72

TUJ1
d e
h
i
f
C9ORF72

TUJ1
c
a b
astrocytic excitatory amino acid transporter 2 EAAT2)
7,78
, we stimulated iMN cultures with a
high-glutamate pulse (12-h treatment, 10 μM glutamate). Only the C9ORF72 iMNs, but the not
controls developed a robust degenerative response upon glutamate administration (Fig. 2.1b).
This was consistent across lines from multiple patients (n = 6 patients) and controls (n = 4
controls). Treatment with glutamate receptor antagonists during glutamate administration
prevented patient iMN degeneration (Fig. 2.1c), confirming the specificity of glutamate induced
neurotoxicity.
To determine whether patient iMN degeneration results from bona fide ALS disease processes
specific for motor neurons, we measured the survival of induced dopaminergic neurons (iDAs)
generated by expression of FoxA2, Lmx1a, Brn2, Ascl1 and Myt1l29. These neurons expressed
high levels of tyrosine hydroxylase, indicating that they had established a key aspect of the
dopamine synthesis pathway and were distinct from iMNs, which do not express this enzyme
76
.
Unlike iMN cultures, the neuronal survival was indistinguishable between iDAs from C9ORF72
patients (n = 2 patients) and controls (n = 2 controls) upon glutamate treatment (Fig. 2.1d),
indicating that the in vitro neurodegenerative phenotype elicited by the C9ORF72 mutation is
selective for motor neurons.
C9ORF72 haploinsufficiency leads to motor neuron degeneration
Consistent with previous studies
7,8,17,18,21
, we have found that patient iMNs (n = 5 patients)
showed reduced C9ORF72 expression compared with controls (n= 3; Fig. 2.2a, b). To examine
whether the loss of C9ORF72 protein directly contributes to degeneration, we re-expressed
human C9ORF72 isoform A or B in iMNs and found that both isoforms rescued the glutamate
17
induced survival phenotype in C9ORF72 patient iMNs (n = 3 patients; Fig. 2.2c). This effect was
specific for C9ORF72 iMNs, as same C9ORF72 overexpression did not rescue SOD1A4V iMN
survival (Fig. 2.2d) or improve the survival of control iMNs (n = 2 controls)
79
.
To confirm that reduced C9ORF72 protein levels are sufficient to cause neurodegeneration, we
used CRISPR/Cas9-mediated genome editing to introduce a frameshift mutation into one or both
alleles of C9ORF72 in control iPSCs. Quantitative PCR (qPCR) and immunoblotting revealed
that targeting one or both alleles resulted in nonsense-mediated RNA decay, which proportionally
reduced both C9ORF72 mRNA and protein levels (Fig. 2.2e, f).sequencing of flow-purified
Hb9::RFP+ iMNs revealed that targeting C9ORF72 did not substantially alter the expression of
the top ten genes with predicted off-target sites for the CRISPR guide RNA
79
. In addition,
expression levels of the 20 genes nearest C9ORF72 on chromosome 9 were largely unperturbed
in either the C9ORF72+/− and C9ORF72−/− iMNs, indicating that this approach specifically
inactivated C9ORF72
79
.
Eliminating C9ORF72 protein expression from one or both alleles reduced iMN survival to
levels comparable to those of patient iMNs (Fig. 2.2g). Antisense oligonucleotide (ASO)-
mediated suppression of C9ORF72 expression levels also reduced control iMN survival (Fig.
2.2h), suggesting that reduced iMN survival was not a result of an off-target effect of the
CRISPR/Cas9 genome editing. Exogenously restoring C9ORF72 expression in C9ORF72+/−
and C9ORF72−/− iMNs rescued survival
79
, verifying that depletion of C9ORF72 caused the
observed neurodegeneration.
18
Fig. 2.3 | C9ORF72 is localized on early endosomes in iMNs.
(a) Immunofluorescent microscopy images showing colocalization of (arrows) of C9ORF72 (green) with early endosome
markers EEA1 and RAB5 (red), but not with lysosome marker LAMP1 (red). Scale bar: 10 μm for the top and 5 μm for the
middle and bottom. This experiment was repeated three times with similar results. (b) Immunoblotting against C9ORF72,
EEA1 and LAMP2 on lysates from iPSC-derived motor neurons separated into light (endosomal) and heavy (lysosomal)
membrane fractions using ercoll gradient centrifugation. This experiment was repeated twice with similar results. (c)
Immunoblotting against FLAG to examine the potentials of C9ORF72 isoform A and B to bind to an immobilized N-terminal
fragment of EEA1. This experiment was repeated twice with similar results.

19
b c
LAMP1 C9ORF72 LAMP1/C9ORF72 Hb9::ChR-YFP/Hoechst
RAB5 C9ORF72 RAB5/C9ORF72 Hb9::ChR-YFP/Hoechst
EEA1 C9ORF72 EEA1/C9ORF72/Hoechst Hb9::ChR-YFP
a
C9ORF72 is localized on early endosomes in iMNs
To study C9ORF72 function, we examined its localization in iMNs using immunofluorescent
approach with validated antibody
79
. In iMNs, C9ORF72 appeared as cytoplasmic puncta, about
80% of the C9ORF72-positive vesicles also expressed the early endosomal proteins RAB5 and
EEA1
79
(Fig. 2.3a). Only a very small portion of C9ROF72 colocalized with the lysosomal
marker LAMP1 (20%
79
; Fig. 2.3a). We performed density gradient centrifugation on lysates
from iPSC-derived motor neurons to separate light (endosomal) and heavy (lysosomal)
membrane fractions. C9ORF72 co-segregated with EEA1 and not LAMP2, supporting the notion
that C9ORF72 localizes predominantly in early endosomes (Fig. 2.3b). In addition, we found
that in in vitro binding assay, immobilized N-terminal fragment of EEA1 has a very strong
binding preference toward C9ORF72 isoform B than isoform A (Fig. 2.3c), which may be able to
explain the observation that not all EEA1+ vesicles contained high levels of C9ORF72, as
isoform A is the predominant C9ORF72 specie in human, and also raise an interesting possibility
that C9ORF72 isoform B may be a constitutively active truncation of isoform A, though
expressed at a much lower level.
Low C9ORF72 activity leads to lysosomal biogenesis deficit
To determine whether a deletion of C9ORF72 or the C9ORF72 repeat expansion caused changes
in endosomal trafficking in motor neurons, we examined the number of early endosomes
(RAB5+, EEA1+), late endosomes (RAB7+) and lysosomes (LAMP1+, LAMP2+, LAMP3+) in
control, C9ORF72 patient, C9ORF72+/− and C9ORF72−/− iMNs. We observed the most
20
21
Control +
eGFP
LAMP1
eGFP/Hoechst
C9ORF72+/- +
eGFP
C9ORF72-/- +
eGFP
C9ORF72-ALS +
eGFP
C9ORF72-ALS +
C9isoB-eGFP
Control +
eGFP
M6PR
eGFP/Hoechst
C9ORF72+/- +
eGFP
C9ORF72-/- +
eGFP
C9ORF72-ALS +
eGFP
C9ORF72-ALS +
C9isoB-eGFP
a
b c d
e
f
Fig. 2.4 | Low C9ORF72 activity leads to defective lysosomal biogenesis.
(a) Confocal microscopy images showing lysosome phenotypes in iMNs of specified genotypes expressing eGFP or
C9ORF72 (isoform A or B)-eGFP . Scale bars: 10 μm. This experiment was repeated three times with similar results. (b-d)
Number of LAMP1+ vesicles in control (b–d), patient (b), C9ORF72+/− (c), and C9ORF72−/− (d) iMNs overexpressing eGFP or
C9ORF72 (isoform A or B)-eGFP . Each gray open circle represents a single iMN, Data are presented as mean ± s.d. For b, n
= 80 (CTRL + GFP), 80 (C9ORF72-ALS + GFP), 64 (C9ORF72-ALS + isoA) and 61 (C9ORF72-ALS + isoB) iMNs quantified
from two biologically independent iMN conversions of three CTRL or four C9ORF72-ALS lines. For c, n = 20 (Control +
GFP), 15 (C9ORF72+/− +GFP), 12 (C9ORF72+/− + isoA) and 13 (C9ORF72+/− + isoB) iMNs quantified from two biologically
independent iMN conversions per condition. For d, n = 20 iMNs quantified from two biologically independent iMN
conversions per condition. One-way ANOVA with Tukey correction between CTRL2 and C9ORF72+/− and C9ORF72−/− (c, d),
one-way ANOVA with Tukey correction between controls and patient conditions (b). F value (DFn, DFd): (3, 273) = 12.12 (b),
(3, 57) = 5.64 (c) and (3, 77) = 6.091 (d). (e) Confocal microscopy images showing M6PR vesicle phenotypes in iMNs of
specified genotypes expressing eGFP or C9ORF72 (isoform A or B)-eGFP . Scale bars: 10 μm. This experiment was
repeated twice with similar results. (f) Fraction of iMNs containing large (>6 vesicles) clusters of M6PR+ vesicles in control,
patient, C9ORF72+/-, and C9ORF72-/- iMNs overexpressing eGFP (grey open cricle)or C9ORF72 isoform B-eGFP (grey
solid circle). Mean ± s.d. n=2 biologically independent iMN conversions per condition, n=15 cells per conversion.

significant difference in the lysosomal population, with C9ORF72 patient iMNs (n = 4 patients)
having fewer LAMP1+, LAMP2+ and LAMP3+ vesicles than control iMNs
79
(n = 4 controls;
Fig. 2.4a, b). C9ORF72+/− and C9ORF72−/− iMNs also harbored fewer LAMP1+, LAMP2+
and LAMP3+ vesicles than isogenic control iMNs, indicating that reduced C9ORF72 levels
alone leads to a loss of lysosomes (Fig. 2.4a, c, d). ASO-mediated knockdown of C9ORF72
expression also decreased lysosome numbers in iMNs
79
. Forced expression of either C9ORF72
isoform restored the number of LAMP1+, LAMP2+ and LAMP3+ lysosomes in patient (n = 4
patients) and C9ORF72-deficient iMNs (Fig. 2.4a-d).
During lysosomal biogenesis, lysosomal proteins (mainly precursors of proteases, lipases and
glycosidases) are transported in mannose-6-phosphate receptor (M6PR)+ vesicles from the
trans-Golgi network to early and late endosomes for eventual incorporation into lysosomes
80
.
Disruption of M6PR+ vesicle trafficking can lead to a reduction in lysosome numbers
81
and
altered localization of M6PR+ vesicles
82
. In control iMNs (n = 3 controls), M6PR+ vesicles were
distributed evenly in the cytoplasm (Fig. 2.4e). In contrast, C9ORF72 patient (n = 4 patients),
C9ORF72+/− and C9ORF72−/− iMNs frequently harbored densely packed clusters of M6PR+
vesicles, usually around the perinuclear region, suggesting potential deficit in post-Golgi
22
Fig. 2.5 | Low C9ORF72 activity sensitizes iMNs to glutamate stress.
(a) Super-resolution microscopy images showing NR1+ puncta on neurites of iMNs overexpressing eGFP or C9ORF72
isoform B-eGFP . Scale bar: 5 μm. This experiment was repeated three times with similar results. (b–d) Number of NR1+
puncta per unit area in control (b–d), C9ORF72+/− (b), C9ORF72+/− (c) and patient (d) iMNs. Data are presented as mean ±
s.d. Each gray open circle represents the number of NR1+ puncta per area unit on a single neurite (one neurite quantified
per iMN). For b, n = 75 (CTRL + GFP), 84 (C9ORF72-ALS + GFP), 95 (C9ORF72-ALS + isoA) and 111 (C9ORF72-ALS +
isoB) iMNs quantified from two biologically independent iMN conversions of three CTRL or four C9-ALS lines. For c, n = 37
(Control + GFP), 37 (C9ORF72+/− + GFP), 25 (C9ORF72+/− + isoA) and 27 (C9ORF72+/− + isoB) iMNs quantified from two
biologically independent iMN conversions per condition. For d, n = 37 (Control + GFP), 37 (C9ORF72−/− + GFP), 38
(C9ORF72−/− + isoA) and 23 (C9ORF72−/− + isoB) iMNs quantified from two biologically independent iMN conversions per

(To be continued in next page)

23
C9ORF72-ALS + eGFP
C9ORF72-ALS + C9isoB-
eGFP
Control +eGFP C9ORF72+/- + eGFP C9ORF72-/- + eGFP
NR1
NR1/GFP
Surface NR1

Surface TFR

Total TFR

Total TUJ1
Surface Nr1/Glur1

(Mouse postmorten PSDs)
GLUR1
GLUR1

(short exposure)
ACTIN
TUJ1
NR1
NR1(short exposure)
ACTIN
a
b c d
e f
g
h
i
j
k
Surface NR1

(Human NIL-iMNs)
(continued)

condition. One-way ANOVA with Tukey correction for all comparisons. F value (DFn, DFd): (3, 360) = 56.63 (b), (3, 122) =
13.42 (c), (3, 131) = 17.11 (d). (e, f)Immunoblotting analysis of surface NR1 after biotinylation purification in control and
C9ORF72-ALS patient NIL-iMNs. n = 11 biologically independent motor neuron cultures from 11 independent control lines
and 4 biologically independent motor neuron cultures from 4 independent C9ORF72-ALS patient lines. Experiments were
repeated twice with similar results. Data are presented as mean ± s.e.m. (g, h) Immunoblotting analysis of surface Nr1 and
Glur1 in postsynaptic densities (PSDs) from C9orf72 control and knockout mice, two-tailed t test. t value: 4.424 (Nr1), 4.632
(Glur1), degrees of freedom: 4 (Nr1), 4 (Glur1). n = 3 control PSD preparations isolated from 3 control mice and 3 C9orf72−/−
PSD preparations isolated from 3 C9orf72−/− mice. This experiment was repeated twice with similar results. Data are
presented as mean ± s.e.m.

transportation (Fig. 2.4e). This was not a result of a reduced number of M6PR+ vesicles in
patient and C9ORF72-deficient iMNs
79
. Forced expression of C9ORF72 isoform B restored
normal M6PR+ vesicle localization in patient (n = 4 patients) and C9ORF72-deficient iMNs,
confirming that a lack of C9ORF72 activity induced this phenotype (Fig. 2.4f).
Low C9ORF72 activity sensitizes iMNs to glutamate stress
In cortical neurons, homeostatic synaptic plasticity is maintained through endocytosis and
subsequent lysosomal degradation of glutamate receptors in response to chronic glutamate
signaling
83,84
. Defects in this process lead to the accumulation of glutamate receptors on the cell
surface
84,85
.
To explore the potential link between lysosomal deficit and sensitization to glutamate stress, we
examine glutamate receptors in iMNs. Immunofluorescence revealed that C9ORF72+/− and
C9ORF72−/− iMNs contained elevated levels of NMDA (NR1) and AMPA (GLUR1) receptors
on neurites and dendritic spines compared with control iMNs under basal conditions
79
(Fig. 2.5a,
b). In addition, control iMNs treated with C9ORF72-specific ASOs displayed increased numbers
of NMDA and AMPA receptors in their neurites
79
. C9ORF72 patient iMNs (n = 3 patients) also
showed elevated NR1 and GLUR1 levels as compared with controls (n = 3 controls), and ectopic
expression of C9ORF72 isoform B reduced glutamate receptor levels in patient iMNs (n = 3
24
patients) compared with controls (n = 3 controls) conditions (Fig. 2.5a, c). mRNA levels of NR1
(GRIN1) and GLUR1 (GRIA1) were not elevated in flow-purified C9ORF72+/− iMNs,
indicating that increased transcription could not explain the increased glutamate receptor levels
79
.
To confirm that glutamate receptor levels were increased on the surface of C9ORF72+/− and
C9ORF72 patient iMNs, we employed biotinylating without permealization approach to label
and purify the plasma membrane localized proteome from the neuronal culture, then quantified
the surface bound glutamate receptors level using immunoblotting. To enable generation of large
scale of neurons for this biochemical experiment, we used CRISPR/Cas9 editing to introduce a
Dox-inducible polycistronic cassette containing NGN2, ISL1 and LHX3 into the AA VS1 safe-
harbor locus of control, C9ORF72+/− and C9ORF72 patient iPSCs
79
. Motor neurons generated
this way (NIL-iMNs) expressed motor neuron markers and had transcriptional profiles similar to
iMNs made using our full set of seven transcription factors
79
. We found that surface NR1 levels
were higher on C9ORF72+/− and C9ORF72 patient iMNs (n = 2 patients) than controls (n = 3
controls) (Fig. 2.5e, g). To determine whether reduced C9ORF72 levels leads to glutamate
receptor accumulation in vivo, we isolated postsynaptic densities fractions through serial
centrifugation from Nestin-Cre-Stop-Flox-C9orf72 mice, in which C9orf72 was deleted
85
.
Postsynaptic density fractions contained glutamate receptors and PSD-95, but not P53 or
Synaptophysin, indicating that they were enriched for postsynaptic density proteins
79
.
Immunoblotting revealed that postsynaptic densities in C9orf72 knockout mice contained
significantly higher levels of NR1 and GLUR1 than control mice (Fig. 2.5f, h),Which is
consistent with immunofluorescent study using same animals
79
.To determine whether glutamate
receptor accumulation occurs on C9ORF72 patient motor neurons in vivo, we isolated
25
postsynaptic densities fractions from motor cortices of C9ORF72 patients and found that
C9ORF72 patients had higher levels of NR1 and GLUR1 than controls (Fig. 2.5i, j).
To determine whether the extra glutamate receptors were functional, we used Calcium indicator
GCaMP6
86
to measure calcium influx into iMNs in response to glutamate. Glutamate triggered
more frequent calcium influxes in C9ORF72 patient (n = 3 patients) and C9ORF72+/− iMNs
than controls (n = 3 controls) (Fig. 2.5k). Given that glutamate receptor activation and neuronal
firing both induce calcium influx, we determined their relative contributions to the increased
GCaMP6 activation by using the ion channel inhibitors TTX and TEA to block neuronal firing.
C9ORF72+/− iMNs still displayed more frequent GCaMP6 activation than C9ORF72+/+ iMNs,
indicating that part of the hyperexcitability is a result of increased glutamate receptor
activation
79
. To determine which receptors were responsible for the increased glutamate
response, we tested small-molecule agonists of specific glutamate receptor subtypes. Activation
of NMDA, AMPA and kainite receptors was higher in C9ORF72+/− iMNs than in controls
79
.
Small molecule and genetic regulators of endosomal trafficking
rescue patient iMNs survival
To identify chemicals that can rescue C9ORF72 patient iMN survival, performed a phenotypic
screen with 800 bioannotated compounds targeting diverse cellular processes, including vesicle
trafficking. Among four reproducible hit compounds, we identified a PIKFYVE kinase inhibitor
(YM201636) that significantly increased C9ORF72 patient iMN survival (n = 2 patients) (Fig.
2.6a, b). PIKFYVE is a lipid kinase that converts phosphatidylinositol 3-phosphate (PI3P) into
26
Fig. 2.6 | Small molecule and genetic regulators of endosomal trafficking rescue patient iMNs survival.
(a) Live cell images of iMNs at day 7 of treatment with DMSO or YM201636. Scale bar: 1 mm. This experiment was
performed three times with similar results. (b) Survival of iMNs in excess glutamate from two independent C9ORF72

ALS-iMNs with DMSO or YM201636 treatment. (c) Survival of iMNs in excess glutamate from four independent C9ORF72

ALS-iMNs with DMSO or Apilimod treatment. (d) Survival effect of Apilimod and the reduced-activity analog on C9ORF72

ALS-iMNs with neurotrophic factor withdrawal. n = 50 iMNs per condition, iMNs quantified from three biologically
independent iMN conversions per condition. (e) Survival effect of scrambled or PIFKVYE ASOs on C9ORF72-ALS iMNs in
excess glutamate. n = 50 iMNs per condition, iMNs quantified from three biologically independent iMN conversions per
condition. All iMN survival experiments in d and e were analyzed by two-sided log-rank test, and statistical significance
was calculated using the entire survival time course. (f) Survival of iMNs in excess glutamate from two independent control
lines lines with GFP or constitutively-active RAB5 (RAB5CA-T2A-GFP) overexpression. (g) Survival of iMNs in excess
glutamate from three independent C9ORF72 ALS-iMNs with GFP or wild-type RAB5 (RAB5-T2A-GFP) overexpression. (h)
Survival of iMNs in excess glutamate from two independent C9ORF72 ALS-iMNs with GFP or RAB5CA-T2A-GFP
overexpression. (i) Survival of iMNs in excess glutamate from three independent C9ORF72 patient lines with GFP or wild-
type RAB5 (RAB5-T2A-GFP) overexpression.

27
a b
c d
e
f
h i
g
phosphtidylinositol (3,5)-bisphosphate (PI(3,5)P2)
87
. PI3P is primarily found
in endosomes, multivesicular bodies and phagosomes. In early endosomes, PI3P anchors EEA1
to early endosomes to drive endosomal maturation
88
, which is disfavored if PI3P is
phosphorylated to PI(3,5)P2. Thus, inhibition of PIKFYVE increases endo-lysosomal biogenesis
and may compensate for reduced C9ORF72 activity and other disease processes by increasing
PI3P levels to facilitate the removal of supernumerous glutamate receptors. Notably, FIG4 is a
phosphatase that opposes PIKFYVE kinase by converting PI(3,5)P2 to PI3P and loss-of-function
mutations in FIG4 cause ALS
89
. Thus, genetic evidence suggests that PIKFYVE inhibition may
be capable of modulating ALS disease processes in humans.
Consistent with this, we found that Apilimod, a structurally distinct PIKFYVE inhibitor, can also
rescue patient iMN but nor control survival

(Fig. 2.6c). In addition, we synthesized a structural
analog of Apilimod with a reduced ability to inhibit PIKFYVE kinase activity in a biochemical
assay using purified PIKFYVE protein
79
. The reduced activity analog was significantly less
effective at rescuing C9ORF72 patient iMN survival (Fig. 2.6d). To verify target engagement by
Apilimod in iPSC-derived motor neurons, we administered Apilimod to neuronal culture for 3 h
and observed Apilimod treatment increased EEA1+ endosome size in a dose-dependent
manner
79
, consistent with increased recruitment of EEA1 and upregulated endosomal fusion
upon PI3P enrichment
90
. As further confirmation that PIKFYVE was the active target, ASO-
mediated suppression of PIKFYVE also rescued C9ORF72 patient iMN survival (Fig. 2.6e).
To verify that PIKFYVE-dependent modulation of vesicle trafficking was responsible for
rescuing C9ORF72 patient iMN survival, we tested the ability of a constitutively active RAB5
28
mutant (Q79L) to block C9ORF72 patient iMN degeneration. Active RAB5 recruits PI3-kinase
to synthesize PI3P from PI and, similar to PIKFYVE inhibition, increases PI3P levels
91
.
Constitutively active RAB5 did not improve control iMN survival (n = 2 controls), but
successfully rescued C9ORF72 patient iMN survival (n = 3 patients; Fig. 2.6f. h). In contrast,
dominant negative RAB5 (S34N), wild-type did not rescue C9ORF72 patient iMN survival (n =
1, 3 patients, respectively; Fig. 2.6g, i). To determine whether PIKFYVE inhibition rescued
patient iMN survival by reversing phenotypic changes caused by C9ORF72 haploinsufficiency,
we measured glutamate receptor levels withand without PIKFYVE inhibitor treatment.
PIKFYVE inhibition significantly lowered NR1 (NMDA receptor) and GLUR1 (AMPA
receptor) levels in patient (n = 4 patients) and C9ORF72+/− iMNs
79
.
Discussion
Our results indicate that haploinsufficiency for C9ORF72 activity triggers neurodegeneration in
C9ORF72 ALS. Reduced C9ORF72 activity causes the accumulation of glutamate receptors and
excitotoxicity in response to glutamate. Although C9orf72 knockout mice do not display overt
neurodegeneration
70,72,85
, these mice may be protected from excitotoxicity because they lack
gain-of-function disease processes such as DPRs, which induce aberrant splicing and dysfunction
of the EAAT2 glutamate transporter in astrocytes in vitro
92
and in C9ORF72 ALS patients
7,78
.
EAAT2 dysfunction causes glutamate accumulation in the cerebrospinal fluid of ALS patients
78
;
consistent with this notion, we found that poly-PR in human astrocytes reduced their rate of
glutamate uptake
79
. By using human iMNs, mice and human postmortem tissue, we found, to the
best of our knowledge for the first time, that reduced C9ORF72 activity modulates the
29
vulnerability of human motor neurons to degenerative stimuli and our results establish a
mechanistic link between the C9ORF72 repeat expansion and glutamate-induced excitotoxicity.
our results show for the first time that chemical or genetic modulators of vesicle trafficking can
fully rescue iMN degeneration caused by the C9ORF72 repeat expansion. Previous studies have
implicated several rare ALS or FTD mutations linked to these vesicle trafficking pathways, but
by showing that C9ORF72 is haploinsufficient in ALS and FTD and demonstrating that
perturbation of vesicle trafficking rescues C9ORF72 neurodegeneration our findings highlight
mechanistic convergence in a large portion of ALS.
30
Chapter 3-Study of PIKFYVE's role
in exosomal secretion
31
Introduction
Given that both PI(3)P and PI(3,5)P2 are important signaling lipid molecules, PIKFYVE has been
implicated, potentially in a cell and/or tissue specific manner, in multiple cellular processes like
endosomal fusion
79
, recovery of terminal lysosome from prefused endolysosome
93
, and
biogenesis of autophagosome
94
and melanosome
95
. Recently, it has been also shown that
PIKFYVE inhibition by Apilimod can stimulate exosome secretion
96
. Exosomes are the
intraluminal vesicles residing in a specialized subpopulation of late endosomes named
multivesicular bodies (MVB), and released to the extracellular environment upon fusion of MVB
with plasma membrane
97–99
. Exosomes contain cytosolic and membrane proteins, RNA, lipids, as
well as other cell metabolites
98,100
, thus are generally thought as vesicular carriers for
intercellular communication. Neurodegenerative disease-associated protein aggregates,
particularly the DPRs in C9ORF72-ALS/FTD have also been found released to the extracellular
environment through both exosome-dependent and-independent mechanisms
101,102
. However, it
remains elusive whether the diseased neurons can actively switch from intracellular degradative
machineries like lysosome and proteasome to exosome secretion via a PIKFYVE mediated
pathway to remove excessive toxic DPRs, as these aggregates may already severely compromise
the formers.
Result
To examine whether PIKFYVE inhibition rescued the survival deficit of C9ORF72-ALS/FTD
motor neurons also through stimulating exosome secretion, we treated the C9ORF72-ALS/FTD
32
Fig. 3 | Functions of PIKFYVE in exosomal secretion.
(a) Immunoblotting analysis of exosomal TSG101 and intracellular TSG101 after Apilimod treatment in control and
C9ORF72-ALS patient iPSC-MNs. n = 3 biologically independent motor neuron cultures from 1 control line and 1
C9ORF72-ALS patient line. (b) Sequencing result of PIKFYVE targeting in C9ORF72-ALS patient lines. Protospacer
adjacent motif (PAM) is highlighted in light blue.

iPSC derived motor neurons with Apilimod for 24 h, harvested the medium, and purified the
secreted exosome fraction through ultracentrifugation. Preliminary immunoblotting revealed that
compared with DMSO control, treatment with Apilimod dramatically increased the secreted
exosome pool in both control (n = 1 control) and C9ORF72-ALS/FTD neurons (n = 1 patient)
but not the intracellular pool(Fig. 3a).
To further confirm the rescuing effect of pharmaceutical inhibition of PIKFYVE, we used
CRISPR/Cas9 -mediated genome editing to introduce a frameshift mutation into one or both
alleles of PIKFYVE in three C9ORF72-ALS/FTD iPSCs lines and one control line to generation
PIKFYVE knock out lines. Three gRNAs targeting different coding regions of PIKFYVE were
used to rule out influence from off-target genomic editing on future experiments. Preliminary
sequencing of two targeted C9ORF72-ALS/FTD iPSCs lines indicated successful guided editing
in at least one allele in both lines (Fig. 3b).
33
b
a
Discussion
The effect of PIKFYVE inhibition in exosome secretion needs to be confirmed in more
C9ORF72-ALS/FTD lines, and potentially with motor neurons generated using different
approaches (like NIL-iMNs). More exosome markers (like ALIX
96
) need to be used, also in
combination with other approaches (like electronic microscopy) to further validate the exosomal
nature of pellet from ultracentrifugation. The indistinguishable upregulation of exosomal
secretion in both control line and C9ORF72-ALS/FTD line by Apilimod treatment suggested
Apilimod may hit a very general cellular pathway in exosomal secretion, which may not be
directly linked to motor neurodegenration. Therefore, it is very crucial to examine whether any
of the DPR species is enriched in the secreted exosome fraction, which may help explain the
survival rescuing effect of Apilimod selectively on C9ORF72-ALS/FTD neurons but not on
control ones. Development of sensitive methods to quantify different DPR species in the purified
exosome fraction or even unpurified culture medium is of great importance.
PIKFYVE+/- iPSC line has a ~50% reduction of PIKFYVE activity, thus can best mimic the
effect of pharmaceutical inhibition of PIKFYVE. PIKFYVE+/- motor neurons in C9ORF72-
ALS/FTD background will be used to confirm the survival rescuing effect of Apilimod, and
further validate the potential to develop Apilimod and other endolysosomal pathway modulators
to cure ALS/FTD. Therefore, further purifications of those promising clones are needed to select
the heterozygous iPSC line, as preliminary sequencing results were from clones grown up right
after antibiotic selection, which are most likely mixed population of wide type cells and
34
genomically edited ones, because the Cas9 cutting can occur either before or after the first cell
division post nucleofection. 35
Chapter 4-Study of GEF activity of
C9ORF72
36
Introduction
Bioinformatics analysis predicted that human C9ORF72 may be distantly related to
Differentially Expressed in Normal and Neoplastic cells (DENN) domain containing family,
most of whose members are GEF for RAB GTPases
103,104
. GEF catalyzes GDP dissociation from
its interacting RAB(s), thus favors reloading of GTP and consequent activation of RAB(s).
Results of immunoprecipitation (IP) and/or mass spectrometry (MS) studies trying to identify
C9ORF72 targeting RAB(s), however, were contradictory: one study suggested RAB1, RAB7
and RAB11 as the C9ORF72 binding partner
105
, while the second, through a more stringent
screening, showed C9ORF72’s GEF activity in protein complex with SMCR8 and WDR41,
against RAB8A and RAB39B
40
. Other studies uncovered function of C9ORF72 as an effector
down stream of activated GTPases (RAB1
39
and ARF6
106
, respectively), instead of a GEF
activating these GTPases. It is of note that nearly all of the C9ORF72 interatomic studies were
done with overexpressed C9ORF72 isoform A in mouse neuronal cell lines, and only found hits
minimally overlapping across different studies
40,106
, which raised the concern about potential
artifacts in these experiments due to superaphysiological expression of transgene in often non-
disease-specific cellular environments. Whether C9ORF72 functions as a GEF still remains
unclear, nor has whether isoform B has similar GEF function been investigated either.
Result
C9ORF72 interactome
To identify more physiologically relevant C9ORF72 binding partners, we used CRISPR/Cas9 -
37
Fig. 4.1| C9ORF72 interactome.
(a) Immunofluorescent microscopy images showing motor neuron differentiation from control and C9ORF72-3FLAG line.
ISLET1 is spinal cord motor neuron marker, CHX10 is V2a interneuronal marker, TUJ1 is pan-neuronal marker. Scale bar: 40
μm. Experiments were repeated twice with similar results. (b) Immunoblotting analysis of C9ORF72 expression during
motor neuron differentiation in both wild type (wt) and C9ORF72-3FLAG (FLAG) line. (b) Immunoblotting analysis of
C9ORF72 interaction with SMCR8 in C9ORF72-3FLAG line at D7 of motor neuron differentiation. I: Input. P: FLAG IP . (d)
Sequencing result of SMCR8 targeting in C9ORF72-ALS patient lines. Protospacer adjacent motif (PAM) is highlighted in
light blue.

mediated genome editing to introduce a 3XFLAG tag right before the stop codon of C9ORF72
isoform A in genome of one control iPSC line (C9ORF72-3FLAG), which enabled C9ORF72
isoA-3FLAG to be expressed at the endogenous level. We differentiated this C9ORF72-3FLAG
iPSC line into motor neurons via published protocol
107
, and immunofluorescence result indicated
knock in of 3XFLAG tag did not affect neuronal differentiation (Fig. 4.1a). Immunoblotting
revealed that C9ORF72 expression has been turned on as early as D7, when the iPSCs were
38
c
d
a
C9ORF72-3FLAG
ISLET1 CHX10 Hoechst TUJ1
Control
FLAG
55
55
130
I
C9ORF72
COFILIN
SMCR8
C9ORF72
-3FLAG
Control
15
P P I
55
WT
D13 D30
b
FLAG
C9ORF72
TUBULIN
D7
55
55
FLAG WT FLAG WT FLAG
differentiated into neuroepithelial cells
107
, and has been kept on till D30, when functional motor
neurons were made (Fig. 4.1b). Interestingly, immunoblotting of FLAG pulled-down sample at
D7 of differentiation showed robust SMCR8 signal, consistent with previously reported
C9ORF72-SMCR8 interaction in other cell types
40,45
(Fig. 4.1c). However, we did not detect
another reported C9ORF72 binding partner COFILIN in the same pulled-down sample
106
,
suggesting the cell type specificity of C9ORF72 interactome.
To investigate whether the rescuing effect of overexpressed C9ORF72 is dependent on
C9ORF72-SMCR8 interaction, we used CRISPR/Cas9-mediated genome editing to introduce a
frameshift mutation into one or both alleles of SMCR8 in three C9ORF72-ALS/FTD iPSCs lines
and two control lines to generation SMCR8 knock out lines. Three gRNAs targeting different
coding regions of SMCR8 were used to rule out effects of off-target CRISPR editing. Preliminary
sequencing of two targeted C9ORF72-ALS/FTD iPSCs lines indicated successful guided editing
in at least one allele in both lines (Fig. 4.1d). Promising clones are currently under further clone
purification.
GEF activity of C9ORF72
To identify potential RAB substrate(s) for C9ORF72, we developed a GEF activity screening
assay using BODIPY-GDP. The fluorescent BODIPY group will self-quench once the GDP is
dissociated from bound RAB, thus the decrease in fluorescence reading will indicate the rate of
GDP dissociation
108
. We chose to clone a panel of ~ 50 small GTPases based on their expression
level in human iMNs for the screening
79
, which consisted of ~30 RABs and ~15 ARFs,
39
Fig. 4.2 | GEF activity of C9ORF72.
(a) Purification of GTPases.(b) BODIPY-GDP assay showing effect of EDTA treatment on different GTPases. (c) BODIPY-
GDP assay showing effect of RABEX5 containing cell lysate on RAB5A.

two families of GTPases mostly involved in vesicle trafficking
109,110
(Table 1). Based on the
capacity of in-house protein chemistry facility and the induced protein expression level in
bacteria, ~30 GTPases were purified from bacteria and used in the screening (Fig 4.2a). We
chose to express both C9ORF72 isoforms and other GEFs in HEK cells to retain potential post
translational modifications which may affect GEF activity. Purified GTPases were loaded with
BODIPY-GDP, and then incubated with HEK cell lysate containing overexpressed GEFs.
40
Fluorescence change normalized with DsRED
-600
-400
-200
0
200
RAB1A
RAB2A
RAB3A
RAB4A
RAB5A
RAB6A
RAB7A
RAB11A
RAB18
RAB21
RAB31
RAB39B
ARF1
ARF3
ARF4
ARF5
ARF6
ARL2
ARL4
ARL5
SAR1A
RAC1
RAC3
RHOA
RHOB
CDC42
RAN
Fluorescence change of RAB5A
-700
-525
-350
-175
0
175
Time 2:00:00
RABEX5 DsRED EDTA+DsRED
a
b
c
Table 1| List of GTPases cloned
Fluorescence decrease of BODIPY-GDP was measured to determine the GEF activity. Given that
magnesium ion is required for stability of RAB/GDP complex, we reasoned that addition of
chelators like EDTA will release GDP from pre-bound GTPases
108
, thus EDTA can serve as a
positive control in our screening. Compared with cell lysate containing overexpressed RFP,
further addition of EDTA did lower fluorescence of most tested GTPases to varied levels (Fig
4.2b). However, many of the fluorescence changes were very marginal compared with
background signal fluctuation, making interpretation very challenging. Replacing BODIPY-GDP
with another fluorescently labelled guanine nucleotide mant-GDP did not improve the result
111
,
suggesting that for many of these less active GTPases, the intrinsic GDP releasing rate may be
41
GTPases cloned into pET28a
backbone for bacteria
expression (6XHis tag)
GTPases cloned into pHAGE
or pMX backbone for
mammalian cell expression
(2XHA tag)
RABs RAB1A, RAB1B, RAB2A,
RAB3A, RAB4A, RAB5A,
RAB6A, RAB7A, RAB8A,
RAB8A, RAB9A, RAb10,
RAB11A, RAB12, RAB13,
RAB14, RAB15, RAB18,
RAB21, RAB22, RAB24,
RAB25, RAB27, RAB28,
RAB30, RAB31, RAB32,
RAB34, RAB35, RAB38,
RAB39B, RAB40C, RABL3,
RABL5
RAB1A, RAB2A, RAB3A,
RAB4A, RAB5A, RAB7A,
RAB8A, RAB8A, RAB9A,
RAb10, RAB11A, RAB13,
RAB18, RAB21, RAB22,
RAB31, RAB32, RAB35,
ARFs SAR1A, ARF1, ARF3, ARF4,
ARF5, ARF6, ARL1, ARL2,
ARL3, ARL4, ARL5, ARL6,
ARL8A, ARL10
SAR1A, ARF1, ARF3, ARF4,
ARF5, ARF6, ARL1, ARL2,
ARL3, ARL8A
RASs RAP1B, RAP2A, RASL10
RHOs RHOA, RHOB, RHOC, CDC42,
RAC1, RAC3
RAN RAN
too slow to capture in a two-hours’ measurement. Another confounding factor was that some
GTPases were prone to precipitate during the GDP loading reaction, which led to a dramatic
reduction of soluble proteins available for downstream GDP releasing reaction, thus caused
much smaller fluorescence decreases. RABEX5, a well-documented GEF specific for the
RAB5A
112
(Fig 4.2c), elicited a consistent decrease in fluorescence when incubated with
BODIPY-GDP-bound RAB5A (50%-150% of EDTA induced fluorescence decrease, subject to
expression level in HEK cells), but did not induce fluorescence decrease from other GTPases
tested. However, Incubation of either overexpressed C9ORF72 isoform A or B containing lysate
with the same panel of GTPases led to severely fluctuating readings, with most of the hits not
reproducible. Moreover, DENND2D, a DENN family member and GEF specific for RAB9
112
,
did not change fluorescence of its cognate BODIPY-GDP/RAB9A during our measurement
either, raising the concern about the reliability of this assay.
Discussion
One advantage of morphogen mediated motor neuron differentiation is that neuroprogenitors are
generated as intermediates during the porcess, thus this approach enables study of C9ORF72
interactome during early period of neural development. Although C9ORF72-ALS/FTD is
thought traditionally as a late-onset disease, given the importance of C9ORF72 in modulating
vesicle trafficking, investigation of dynamic changes of C9ORF72 interactome at different times
during motor neuron differentiation by IP/MS may help our understanding of disease in the early
asymptomatic stage.
42
Astrocytes and microglia have also played crucial roles in ALS and FTD
3
, potentially through
neuroinflammatory and/or phagocytic pathways
113
. C9ORF72 has been found highly expressed
in glial cells particularly microglia, suggesting loss of C9ORF72 function in glia may contribute
through some non-cell-autonomous mechanisms to motor neuron degeneration. Therefore, it will
be equally important to determine glia specific C9ORF72 interactive through IP/MS in
C9ORF72-3FLAG iPSC derived astrocytes
114
and microglia
115
.
As shown above, the low sensitivity of fluorescence-based readout and the destabilizing reaction
temperature made BODIPY-GDP not ideal for GEF activity detection. Alternatively, a Co-IP
based screening can also be performed with both C9ORF72 and screened RABs/ARFs
overexpressed in cell lines
40.
Optimizations may include adding excess GDP to the reaction, or
using dominantly negative mutations of RABs/ARFs instead of the wildtype proteins, both of
which will enrich GDP locked RABs/ARFs and thus increase the selectivity of pulling-down.
Crucially, all the in vitro GEF activity assays so far, including ours, were done with protein
complex consists of not only C9ORF72, but also other potential GEFs like SMCR8 and
WDR41
40,42–46
. It is not clear whether C9ORF72 itself has the suggested GEF function, or it just
contributes as a regulatory component. Experiments with purified C9ORF72, preferentially from
eukaryotic cells need to be done to further address this question. 43
Chapter 5-Conclusion 44
Our results highlight the importance of C9ORF72 protein function, RAB5 activity, PI3P levels
and lysosomal function as key therapeutic targets for C9ORF72 ALS/FTD. By generating PI3P,
RAB5 drives early endosomal maturation and the initial stages of lysosomal biogenesis
116
. Loss
of function mutations in two other genes whose proteins function to increase PI3P levels, ALS2
and FIG4, also cause ALS
117
. ALS2 encodes the RAB5 guanine exchange factor ALSIN
118
,
whereas FIG4 converts PI(3,5)P2 into PI3P
89
. In addition, proteins encoded by several other ALS
genes have key roles in lysosomal biogenesis, including CHMP2B, OPTN and SQSTM1
117
. The
fact that FIG4 and ALS2 loss-of-function mutations can cause ALS suggests that PIKFYVE
inhibition or RAB5 activation may be capable of modulating ALS disease processes in humans.
Identification of targets that effectively modulate vesicle trafficking will hold tremendous
therapeutic value for development of therapeutic strategies for C9ORF72-ALS/FTD.
45
Methods
iPSC reprogramming
Human lymphocytes from healthy subjects and ALS patients were obtained from the NINDS
Biorepository at the Coriell Institute for Medical Research and reprogrammed into iPSCs as
previously described using episomal vectors
119
. Briefly, mammalian expression vectors
containing Oct4, Sox2, Klf4, L-Myc, Lin28, and a p53 shRNA were introduced into the
lymphocytes using the Adult Dermal Fibroblast Nucleofector Kit and Nucleofector 2b Device
(Lonza) according to the manufacturer’s protocol. The cells were then cultured on mouse feeders
until iPSC colonies appeared. The colonies were then expanded and maintained on Matrigel
(BD) in mTeSR1 medium (Stem Cell Technologies).
Molecular cloning and viral production
Complementary DNAs (cDNAs) for the iMN factors (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Myt1l
and Brn2) and iDA neuron factors (Ascl1, Brn2, Myt1l, Lmx1a and Foxa2), human RAB5,
RAB5 Q79L, RAB5 S34N, and GCaMP6 were purchased from Addgene. cDNA for human
C9ORF72 was purchased from Thermo Scientific. cDNA for human RABEX5, DENND2D,
RAB3, RAB10, RAB12, RAB14, RAB15, RAB25, and RAB35 were purchased from GE
Dharmarcon. Neuronal reprogramming factors and transgenes for survival experiments were
cloned into the pMXs retroviral expression vector using Gateway cloning technology
(Invitrogen). For overexpression in mammalian cell lines for biochemical experiments, cDNAs
46
were cloned into pHAGE lentiviral expression vector with FLAG or HA tag using Gateway
cloning technology. For bacterial expression and protein purification, Human EEA1 (1-209) was
inserted into pGEX-6P-1 vector with an N-terminal GST tag using restrictive enzymes. Human
ARFs were inserted into pET28 with C-terminal His tag using restrictive enzymes, other small
GTPases were cloned into the same vector using same strategy, but with His tag at the N-
terminal. The Hb9::RFP lentiviral vector was also purchased from Addgene (ID: 37081).
Viruses were produced as follows: HEK293 cells were transfected at 80–90% confluency with
viral vectors containing genes of interest and viral packaging plasmids (PIK-MLV-gp and pHDM
for retrovirus; pPAX2 and VSVG for lentivirus) using polyethylenimine (PEI)(Sigma-Aldrich).
The medium was changed 24 h after transfection. Viruses were harvested at 48 h and 72 h after
transfection. Viral supernatants were filtered with 0.45 μm filters, incubated with Lenti-X
concentrator (Clontech) for 24 h at 4℃, and centrifuged at 1,500 g at 4℃ for 45 min. The pellets
were resuspended in 300 μl DMEM +10% FBS and stored at −80 ℃.
Conversion of iPSCs into induced motor neurons and dopaminergic
neurons
Reprogramming was performed in 96-well plates (8 x 10
3
cells/well) or 13mm plastic coverslips
(3.2 x 10
4
cells/coverslip) that were sequentially coated with gelatin (0.1%, 1 h) and laminin (2–4
h) at 23 ℃. To enable efficient expression of the transgenic reprogramming factors, iPSCs were
cultured in fibroblast medium (DMEM + 10% FBS) for at least 48 h and either used directly for
retroviral transduction 4or passaged before transduction for each experiment. Seven iMN or five
47
iDA factors were added in 100~200 μl fibroblast medium per 96-well well with 5 μg/ml
polybrene. For iMNs, cultures were transduced with lentivirus encoding the Hb9::RFP reporter
48 h after transduction with transcription factor-encoding retroviruses. On day 5, primary mouse
cortical glial cells from P1 ICR pups (male and female) were added to the transduced cultures in
glia medium containing MEM (Life Technologies), 10% donor equine serum (HyClone), 20%
glucose (Sigma-Aldrich), and 1% penicillin/streptomycin. On day 6, cultures were switched to
N3 medium containing DMEM/F12 (Life Technologies), 2% FBS, 1% penicillin/streptomycin,
N2 and B27 supplements (Life Technologies), 7.5 μM RepSox (Selleck), and 10 ng/ml each of
GDNF, BDNF, and CNTF (R&D). The iMN and iDA neuron cultures were maintained in N3
medium, changed every other day, unless specified otherwise.
Morphogen mediated iPSC motor neuron differentiation
For immunoblotting of C9ORF72 protein level in control, C9ORF72+/−, C9ORF72−/−,
C9ORF72-3FLAG and C9ORF72-ALS patient derived neurons, Percoll density gradient
centrifugation, IP of C9ORF72 for interactome study, and exosome purification. Motor neurons
were generated from iPSC using morphogen-based protocol as described previously with slight
modification
107
. On day 0, iPSCs were dissociated with Accutase (Life Technologies) and
300,000 iPSCs were seeded into one Matrigel (Corning)- coated well of a six-well plate in
mTeSR medium (Stem Cell Technologies) with 10 μM Rock Inhibitor (Selleck). On day 1, the
medium was changed to Neural Differentiation Medium (NDM) consisting of a 1:1 ratio of
DMEM/F12 (Genesee Scientific) and Neurobasal medium (Life Technologies), 0.5X N2 (Life
Technologies), 0.5X B27 (Life Technologies), 0.1 mM ascorbic acid (Sigma), 1X Glutamax (Life
48
Technologies). 3 μM CHIR99021 (Cayman), 2 μM DMH1 (Selleck) and 2 μM SB431542
(Cayman) were also added. On day 7, cells were dissociated with Accutase and 4.5 million cells
were seeded into Matrigel coated 10-cm dishes in NDM plus 1 μM CHIR99021, 2 μM DMH1, 2
μM SB431542, 0.1 μM RA (Sigma), 0.5 μM Purmorphamine (Cayman) and 10 μM Rock
Inhibitor. Rock inhibitor was removed on day 9. On day 13, cells were dissociated with Accutase
and seeded at a density of 40 million cells per well in a non-adhesive six-well plate (Corning) in
NDM plus 0.5 μM RA, 0.1 μM Purmorphamine, and 10 μM Rock Inhibitor. On day 19, the
media was changed to NDM plus 1 μM RA, 1 μM Purmorphamine, 0.1 μM Compound E
(Cayman), and 5 ng/ml each of BDNF, GDNF and CNTF (R&D Systems). Medium change was
done every other day unless specified otherwise. Plates were put onto shaker from D13 till the
end of differentiation Cells were used for experiments between days 25~35 of differentiation.
Immunocytochemistry

iMNs were fixed in 4% paraformaldehyde (PFA) for 1 h at 4 C, permeabilized with 0.5% PBS-T
overnight at 4 C, blocked with 10% FBS or donkey serum in 0.1% PBS-T at 23 ℃ for 2 h, and
incubated with primary antibodies at 4 ℃ overnight. Cells were then washed with 0.1% PBS-T
and incubated with Alexa Fluor secondary antibodies (Life Technologies) in blocking buffer for
2 h at 23 ℃. To visualize nuclei, cells were stained with Hoechst (Life Technologies) then
mounted on slides with Vectashield (Vector Labs). Images were acquired on Zeiss LSM800
microcopy with 63X 1.4NA objective or Zeiss LSM780 microcopy with 40X 1.1NA objective.
Structured illumination microscopy (SIM) images were acquired using a Zeiss Elyra PS.1 system
49
equipped with a 100X 1.46 NA or 63X 1.4NA objective. Acquisition was performed with PCO
edge sCMOS camera and image reconstruction was done with built-in structured illumination
model. Further image process and fluorescence intensity quantification were done with Fiji.
The following primary antibodies were used:
chicken anti-TUJ1 (EMD Millipore/ab9354, 1:1,000); mouse anti-ISLET1 (DSHB/39.4D5,
1:50); sheep anti-CHX10 (Abcam/ab16141, 1:500); rabbit anti-C9ORF72 (Sigma-Aldrich/
HPA023873, 1:50); mouse anti-EEA1 (BD Biosciences/610457, 1:100); mouse anti-RAB5 (BD
Biosciences/610724, 1:100); mouse anti-LAMP1 (Abcam/ab25630, 1:10); mouse anti-M6PR
(Abcam/ab2733, 1:80); mouse anti-NR1 (EMD Millipore/MAB363, 1:10); chicken anti-GFP
(GeneTex, 1:500/GTX13970).
Immunoblotting
Cells were lysed in RIPA buffer with protease inhibitor cocktail (Roche) unless specified
otherwise. Protein concentration was normalized using the BCA kit (Pierce) and samples were
run on SDS-PAGE gels at 80~150 V for 60~90 min. After transferring to nitrocellulose or PVDF
membrane, the membrane was blocked with 5% milk in 0.1% PBS-Tween 20 (PBS-T)(Sigma-
Aldrich), incubated with primary antibodies overnight at 4℃, washed three times with 0.1%
PBS-T, then incubated with horseradish peroxidase (HRP)-conjugated seconday antibodies(Santa
Cruz). Blots were visualized using an Amersham ECL Western Blotting Detection Kit (GE) or
the SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and
developed on X-ray film (Genesee).
50
The following primary antibodies were used:
rabbit anti-C9ORF72 (Proteintech/22637-1-AP, 1:500); mouse anti-FLAG (Sigma/F1804,
1:1,000); rabbit anti-GLUR1 (Millipore/AB1504, 1:1,000), mouse anti-NR1 (NovusNB300118,
1:2,000); mouse anti-Transferrin receptor (TFR) (Thermo Fisher Scientific /136800, 1:1,000);
mouse anti-LAMP2 (DSHB/H4B4, 1:4,000); mouse anti-EEA1 (BD Biosciences/610457,
1:1,000); mouse anti-TUJ1 (Biolegend/MMS-435P,1:5,000); mouse anti-TSG101 (BD
Biosciences/612696, 1:300); rabbit anti-SMCR8 (Bethyl Laboratories/A304-694, 1:800); mouse
anti-COFILIN (Proteintech/66057, 1:2,000); anti-mouse HRP (Cell Signaling/7076S, 1:5,000);
anti-rabbit HRP (Cell Signaling/7074S, 1:5,000).
Induced neuron survival assay

Hb9::RFP+ iMNs appeared between days 13–16 after retroviral transduction. RepSox was
removed at day 17 and the survival assay was initiated. For the glutamate treatment condition, 10
μM glutamate was added to the culture medium on day 17 and removed after 12 h. Cells were
then maintained in N3 medium with neurotrophic factors without RepSox. For the glutamate
treatment condition with glutamate receptor antagonists, cultures were co-treated with 10 μM
MK801 and CNQX, and 2 μM Nimodipine during the 12 h glutamate treatment. The antagonists
were maintained till the end of experiment. Longitudinal tracking was performed by imaging
neuronal cultures in a Nikon Biostation CT or Molecular Devices ImageExpress once every 24–
72 h starting at day 17. Tracking of neuronal survival was performed using SVcell 3.0 (DRVision
Technologies). Neuron was scored as dead when its soma was no longer detectable by RFP
fluorescence. All neuron survival assays were performed at least twice, with equal numbers of
51
neurons from three individual replicates from one of the trials being used for the quantification
shown. All trials quantified were representative of other trials of the same experiment. When
iMNs from multiple independent donors are combined into one survival trace in the Kaplan-
Meier plots for visual clarity.
CRISPR/Cas9 genome editing of iPSCs

CRISPR/Cas9-mediated genome editing was performed in human iPSCs as previously
described
120
.Colonies were picked 5-10 days after and genotyped by PCR amplification and
sequencing of targeted region. Colonies containing a frameshift mutation were clonally purified
on MEF feeders and the resulting clones were re-sequenced to verify the editing. gRNAs used in
this study are:
C9ORF72 KO-3: 5’- UUAACACAUAUAAUCCGGAA
C9ORF72 KO-4: 5’- CACCACUCUCUGCAUUUCGA
AA VS1: 5’- GGGGCCACUAGGGACAGGAUUGG
SMCR8 KO-1: 5’- CUGACGUAGUGGCCUUCACC
SMCR8 KO-2: 5’- UGACGUAGUGGCCUUCACCA
SMCR8 KO-3: 5’- GAUCAGCGCCCCUGACGUAG
PIKFYVE KO-10: 5’- UGAUAAGACGUCCCCAACAC
PIKFYVER KO-80: 5’-UCGAGGACACAGUCUGUUAG
52
PIKFYVE KO-122: 5’-UCGUACAGCUGUUCAGCUUC
C9ORF72-3FLAG: 5’-GAUCAUGAUUGUGAUGGAAU
Generation of NIL-iMNs and biotinylation of surface-bound glutamate
receptors
Dox-NIL iMNs were generated by plating at ~25% confluency on matrigel coated plates and
adding 1 μg/ml of doxycylin in N3 media +7.5 μMRepSox 1 day after plating. Mouse primary
mixed glia were added to the cultures at day 6, and doxycyline was maintained throughout
conversion. iMN cultures were harvested at day 17. Biotinylation of plasma membrane localized
glutamate receptors was performed using the Piece Cell Surface Protein Isolation Kit (Thermo
Fisher Scientific) following the manufacturer’s instructions. Briefly, Dox-NIL iMNs were
incubated with 0.25mg/ml Sulfo-NHS-SS-Biotin in cold room for 1~2 h with end-to-end
shaking. After quenching, cells were harvested by scraping and lysed with lysis buffer from the
Piece Cell Surface Protein Isolation Kit or the M-PER mammalian protein extraction buffer
(Thermo Fisher Scientific). Cell lysate was incubated with High Capacity NeutrAvidin agorase
beads (Thermo Fisher Scientific), and the bound protein was eluted in 2X SDS-PAGE sample
buffer supplemented with 50 mM DTT for 1 h at 23 ℃ with end-to-end rotation, and further
analyzed by immunoblotting.
53
GST pull-down
GST-EEA1 or GST only was expressed in E. Coli BL21 (DE3) cells (Thermo Fisher Scientific)
for 12 h at 18 ℃. Harvested cells were lysed by sonication in cold GST Purification Buffer (50
mM Tris pH 8.0, 200 mM NaCl, 2 mM DTT, 0.5 mg/ml Lysozyme, 0.2% Triton X-100 and
protease inhibitor cocktail). After centrifugation at 15,000 g for 30 min at 4 ℃, clarified lysate
was incubated with glutathione sepharose 4B beads (GE Healthcare Life Science) for 3 h to
purify GST-EEA1 or GST. HEK cells were transfected with C-terminal 3XFLAG tagged
C9ORF72 isoform A or B, or eGFP constructs and harvested 36~48 h post-transfection in cold
Lysis Buffer (25 mM HEPES pH 7.4, 100 mM NACl, 5 mM MgCl2, 1 mM DTT, 10% Glycerol,
0.1% Triton X-100 and protease inhibitor cocktail). After centrifugation at 8,000 g for 10 min at
4 ℃, the clarified supernatant was incubated with washed GST-EEA1 or GST beads for 2 h at 4
℃ with end-to-end rotation. Beads were then boiled in 2X SDS-PAGE sample buffer and pulled-
down protein was analyzed by Immunoblotting.
Percoll density gradient centrifugation
iPSC-MNs at differentiation D35 were harvested in cold Hypotonic buffer (20 mM HEPES pH
7.4, 10 mM KCl, 2 mM MgCl2, 1 mM EDTA, 1mM EGTA, 1 mM DTT and protease inhibitor
cocktail) and lysed by passing through G25 needles 25 times and then spun down at 700 g for 10
min at 4 ℃. The Supernatant was loaded onto pre-made 30% Percoll solution and re-centrifuged
at 33,000 r.p.m. using Beckman rotor SWI55 for 50min at 4 ℃. 300 μl aliquots were taken from
54
top to bottom as fractions and all the collected samples were boiled with SDS-PAGE sample
buffer and analyzed by immunoblotting.
Postsynaptic density extraction
Postsynaptic density extraction was done following a protocol published previously
121
. Briefly,
mouse spinal cord tissue or human cortical tissue was homogenized in cold Sucrose Buffer (320
mM Sucrose, 10 mM HEPES pH 7.4, 2 mM EDTA, 30 mM NaF, 40 mM β-Glycerophosphate,
10 mM Na3VO4, and protease inhibitor cocktail) using a tissue grinder and then spun down at
500 g for 6 min at 4 ℃. The supernatant was re-centrifuged at 10,000 g for 10 min at 4 ℃. The
supernatant was collected as the ‘Total’fraction, and the pellet was resuspended in cold Triton
buffer (50 mM HEPES pH 7.4, 2 mM EDTA, 50 mM NaF, 40 mM β-Glycerophosphate, 10 mM
Na3VO4, 1% Triton X-100 and protease inhibitor cocktail (Roche)) and then spun down at
30,000 RPM using a Beckman rotor MLA-130 for 40 min at 4 ℃. The supernantant was
collected as the ‘Triton’ fraction and the pellet was resuspended in DOC buffer (50 mM HEPES
pH 9.0, 50 mM NaF, 40 mM β-Glycerophosphate, 10 mM Na3VO4, 20 μM ZnCl2, 1% sodium
deoxycholate and protease inhibitor cocktail) and collected as the “DOC” fraction, PSD-enriched
fraction. Collected samples were boiled with SDS-PAGE sample buffer and analyzed by
immunoblotting.
GEF assay
All GTPases were expressed in BL21(DE3) cells at 18 ºC for 12 to 14 h . Cells were pelleted,
lysed on ice for 20 min in IMAC5 buffer (20 mM Tris-HCl, pH 8.0, 300 mM NaCl, 5 mM
55
imidazole, 0.2% Triton X-100) supplemented with 0.5 mg/ml lysozyme (Sigma-Aldrich) and a
protease inhibitor cocktail, then sonicated at 70% power four times for 30 s with intervening rest
periods of 30 s. After centrifugation at 16,500 x g for 30 min, lysates were incubated with nickel-
charged NTA-agarose (Qiagen) for 3 h, washed with 15 volumes of IMAC20 buffer (IMAC5
buffer with 20mM imidazole), and eluted with 7.5 volumes MAC 200 buffer (IMAC5 buffer
with 200mM imidazole). Purified proteins were concentrated into GEF reaction buffer (10 mM
NaCl, 50 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.8 mM DTT, 0.005% Triton X-100) using
ultracentrifugal tubes. The GEF assay was performed as follows: 30 µM purified RAB proteins
were incubated with 50 µM BODIPY® FL GDP (Life Technologies) for 1.5 h at 30 ºC in GEF
reaction buffer and quenched with 10 mM MgCl2. HEK cell lysates were prepared by
transfecting HEK cells with 2X HA-tagged C9ORF72 isoform B, DENND2D, or BABEX5, or
with a pMXs vector containing DsRED, then harvesting 48 h post-transfection in cell lysis buffer
(10 mM NaCl, 50 mM Tris-HCl pH8.0, 12 mM MgCl2, 0.8 mM DTT, 1% CA-630)
supplemented with a protease inhibitor cocktail. After centrifugation at 15,000 x g for 15min at 4
ºC, the lysates was mixed with 1.5 µM preloaded RABs and 2 mM GDP, and the fluorescence
intensity recorded using SpectroMAX M2 plate reader (Molecular Device) every 30 s over a 2-h
period.
Exosome isolation
Exosome was isolated as described previsouly
96
. Briefly, iPSC derived motor neurons were
treated with 3uM Apilimod for 24hrs. Then all the medium was collected, centrifuged at
1,000×g for 10 min, and thereafter at 10,000×g for 30 min to remove dead cells and cell debris.
56
The supernatant was then ultracentrifuged at 35,000 r.p.m. using Beckman rotor SWI55 for 90
min at 4 ℃. The exosome pellet was resuspended in cold PBS, and re-centrifuged at 35,000
r.p.m. for the same time. The pellet was resuspended with PBS and boiled with SDS-PAGE
sample buffer and analyzed by immunoblotting.
Quantitative real time PCR
Total RNA was extracted from sorted iMNs at day 21 post-transduction with Trizol RNA
Extraction Kit (Life Technologies) and reverse transcribed with an Oligo dT primer using
ProtoScript II First Strand Synthesis Kit (NEB). RNA integrity was checked using the Experion
system (Bio-3Rad). Real-time PCR was performed with iTaq Universal SYBR Green Supermix
(Bio-Rad) using primers listed in Ref. 79.
GCaMP6 calcium influx assay
GCaMP6 was transduced into reprogramming cultures concurrently with the motor neuron
factors. To assess GCaMP6 activity, 1.5 μm glutamate was added to iMN cultures and cells were
imaged continuously for 2 min at 24 frames per s. GFP flashes were scored manually using the
video recording. At least three different fields of view from three independent cultures, totaling
50~100 iMNs, were scored per condition.
Small molecule screen and PIKFYVE inhibitor assay
Hb9::RFP+ C9ORF72 ALS/FTD iMNs were generated in 96-well plates. On day 15 post
transduction, neurotrophic factors and RepSox were withdrawn and the small molecule library
57
was added (EMD Millipore kinase collection and Stemselect library, 3.3 μM final concentration)
and added fresh every other day till the end of experiment. Identification of neuroprotective
compounds was identified using SVcell 3.0 (DRVision Technologies) and further verification by
manual iMN tracking.
Synthesis and activity assays of Apilimod and the reduced activity
analog
For experiments other than the comparison of Apilimod and the reduced-activity analog,
Apilimod was purchased from Axon Medchem (cat. no. 1369). For the reduced-activity analog
assays, Apilimod and the reduced activity analog were synthesized at Icagen, Inc. PIKFYVE
kinase inhibition was measured using the ADP-Glo kinase assay from SignalChem according to
the manufacturer’s instructions, using purified PIKFYVE kinase (SignalChem cat. no.
P17-11BG-05).
Animal
Mice were housed in standard conditions with food and water ad libitum in the conventional
cvivarium at the University of Southern California. All animal use and care were in accordance
with local institution guidelines of the University of Southern California and the IACUC board
of the University of Southern California with the protocol numbers 20546 and 11938.
58
Statistical analysis
Analysis was performed with the statistical software package Prism Origin (GraphPad Software).
Statistical analysis of iMN survival experiments was performed using a two-sided log-rank test
to account for events that did not occur (that is, iMNs that did not degenerate before the end of
the experiment). For each line, the survival data from 50 iMNs were selected randomly using
Microsoft Excel, and these data were used to generate the survival curve. If all iMNs
degenerated in a given experiment, statistical significance was calculated using a two-tailed
Student’s t test. For all other experiments, differences between two groups were analyzed using a
two-tailed Student’s t test, unless the data was non-normally distributed for which two-sided
Mann-Whitney testing was used. Differences between more than two groups were analyzed by
one way-ANOV A with Tukey correction for multiple testing. Significance was assumed at P <
0.05. Error bars represent the s.d. unless specified otherwise.
For iMN survival assays, assays were repeated at least twice, with each round containing 3
biologically independent iMN conversions. iMNs from the 3 biologically independent iMN
conversions in one representative round was used to generate the Kaplan-Meier plot shown. iMN
survival times were confirmed by manual longitudinal tracking by an individual who was
blinded to the identity of the genotype and condition of each sample. To select 50 iMNs per
condition for analysis, >50 neurons were selected for tracking randomly at day 1 of the assay.
Subsequently, the survival values for 50 cells were selected at random using the RAND function
in Microsoft Excel. For quantification of immunofluorescence, samples were quantified by an
individual who was blinded to the identity of the genotype of each sample. 59
References
1. Hardiman, O. et al. Amyotrophic lateral sclerosis. Nat. Rev. Dis. Prim. 3, 17071 (2017).
2. Turner, M. R., Barnwell, J., Al-Chalabi, A. & Eisen, A. Young-onset amyotrophic lateral
sclerosis: historical and other observations. Brain 135, 2883–2891 (2012).
3. Taylor, J. P., Brown, R. H. & Cleveland, D. W. Decoding ALS: from genes to mechanism.
Nature 539, 197–206 (2016).
4. Olney, N. T., Spina, S. & Miller, B. L. Frontotemporal Dementia. Neurol. Clin. 35, 339–
374 (2017).
5. Gao, F.-B., Almeida, S. & Lopez-Gonzalez, R. Dysregulated molecular pathways in
amyotrophic lateral sclerosis-frontotemporal dementia spectrum disorder. EMBO J. 36,
2931–2950 (2017).
6. Rosen, D. R. et al. Mutations in Cu/Zn superoxide dismutase gene are associated with
familial amyotrophic lateral sclerosis. Nature 362, 59–62 (1993).
7. Renton, A. E. et al. A Hexanucleotide Repeat Expansion in C9ORF72 Is the Cause of
Chromosome 9p21-Linked ALS-FTD. Neuron 72, 257–268 (2011).
8. DeJesus-Hernandez, M. et al. Expanded GGGGCC Hexanucleotide Repeat in Noncoding
Region of C9ORF72 Causes Chromosome 9p-Linked FTD and ALS. Neuron 72, 245–256
(2011).
9. Majounie, E. et al. Frequency of the C9orf72 hexanucleotide repeat expansion in patients
with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study.
Lancet. Neurol. 11, 323–30 (2012).
10. Rutherford, N. J. et al. Length of normal alleles of C9ORF72 GGGGCC repeat do not
influence disease phenotype. Neurobiol. Aging 33, 2950.e5-7 (2012).
11. van der Zee, J. et al. A pan-European study of the C9orf72 repeat associated with FTLD:
geographic prevalence, genomic instability, and intermediate repeats. Hum. Mutat. 34,
363–73 (2013).
12. Beck, J. et al. Large C9orf72 hexanucleotide repeat expansions are seen in multiple
neurodegenerative syndromes and are more frequent than expected in the UK population.
Am. J. Hum. Genet. 92, 345–53 (2013).
13. Suh, E. et al. Semi-automated quantification of C9orf72 expansion size reveals inverse
correlation between hexanucleotide repeat number and disease duration in frontotemporal
degeneration. Acta Neuropathol. 130, 363–372 (2015).
14. van Blitterswijk, M. et al. Association between repeat sizes and clinical and pathological
characteristics in carriers of C9ORF72 repeat expansions (Xpansize-72): a cross-sectional
cohort study. Lancet. Neurol. 12, 978–88 (2013).
15. Arai, T. et al. TDP-43 is a component of ubiquitin-positive tau-negative inclusions in
frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem. Biophys.
Res. Commun. 351, 602–611 (2006).
60
16. Neumann, M. et al. Ubiquitinated TDP-43 in Frontotemporal Lobar Degeneration and
Amyotrophic Lateral Sclerosis. Science (80-. ). 314, 130–133 (2006).
17. Donnelly, C. J. et al. RNA toxicity from the ALS/FTD C9ORF72 expansion is mitigated
by antisense intervention. Neuron 80, 415–28 (2013).
18. Lagier-Tourenne, C. et al. Targeted degradation of sense and antisense C9orf72 RNA foci
as therapy for ALS and frontotemporal degeneration. Proc. Natl. Acad. Sci. U. S. A. 110,
E4530-9 (2013).
19. Zu, T. et al. RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and
frontotemporal dementia. Proc. Natl. Acad. Sci. 110, E4968–E4977 (2013).
20. Almeida, S. et al. Modeling key pathological features of frontotemporal dementia with
C9ORF72 repeat expansion in iPSC-derived human neurons. Acta Neuropathol. 126, 385–
99 (2013).
21. Sareen, D. et al. Targeting RNA foci in iPSC-derived motor neurons from ALS patients
with a C9ORF72 repeat expansion. Sci. Transl. Med. 5, 208ra149 (2013).
22. Mizielinska, S. et al. C9orf72 frontotemporal lobar degeneration is characterised by
frequent neuronal sense and antisense RNA foci. Acta Neuropathol. 126, 845–857 (2013).
23. Gendron, T. F. et al. Antisense transcripts of the expanded C9ORF72 hexanucleotide
repeat form nuclear RNA foci and undergo repeat-associated non-ATG translation in
c9FTD/ALS. Acta Neuropathol. 126, 829–44 (2013).
24. Mori, K. et al. The C9orf72 GGGGCC Repeat Is Translated into Aggregating Dipeptide-
Repeat Proteins in FTLD/ALS. Science (80-. ). 339, 1335–1338 (2013).
25. Ash, P. E. A. et al. Unconventional translation of C9ORF72 GGGGCC expansion
generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77, 639–46 (2013).
26. Amoroso, M. W. et al. Accelerated High-Yield Generation of Limb-Innervating Motor
Neurons from Human Stem Cells. 33, 574–586 (2013).
27. Gomez-Deza, J. et al. Dipeptide repeat protein inclusions are rare in the spinal cord and
almost absent from motor neurons in C9ORF72 mutant amyotrophic lateral sclerosis and
are unlikely to cause their degeneration. Acta Neuropathol. Commun. 3, 38 (2015).
28. Ciura, S. et al. Loss of function of C9orf72 causes motor deficits in a zebrafish model of
amyotrophic lateral sclerosis. Ann. Neurol. 74, 180–7 (2013).
29. Gijselinck, I. et al. A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort
with disorders of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis
spectrum: a gene identification study. Lancet. Neurol. 11, 54–65 (2012).
30. Fratta, P. et al. Homozygosity for the C9orf72 GGGGCC repeat expansion in
frontotemporal dementia. Acta Neuropathol. 126, 401–9 (2013).
31. Belzil, V . V et al. Reduced C9orf72 gene expression in c9FTD/ALS is caused by histone
trimethylation, an epigenetic event detectable in blood. Acta Neuropathol. 126, 895–905
(2013).
32. Waite, A. J. et al. Reduced C9orf72 protein levels in frontal cortex of amyotrophic lateral
sclerosis and frontotemporal degeneration brain with the C9ORF72 hexanucleotide repeat
expansion. Neurobiol. Aging 35, 1779.e5-1779.e13 (2014).
33. Tran, H. et al. Differential Toxicity of Nuclear RNA Foci versus Dipeptide Repeat
Proteins in a Drosophila Model of C9ORF72 FTD/ALS. Neuron 87, 1207–1214 (2015).
61
34. Haeusler, A. R. et al. C9orf72 nucleotide repeat structures initiate molecular cascades of
disease. Nature 507, 195–200 (2014).
35. Xi, Z. et al. Hypermethylation of the CpG Island Near the G4C2 Repeat in ALS with a
C9orf72 Expansion. Am. J. Hum. Genet. 92, 981–989 (2013).
36. van Blitterswijk, M. et al. Novel clinical associations with specific C9ORF72 transcripts
in patients with repeat expansions in C9ORF72. Acta Neuropathol. 130, 863–76 (2015).
37. Grabczyk, E. & Usdin, K. The GAA*TTC triplet repeat expanded in Friedreich’s ataxia
impedes transcription elongation by T7 RNA polymerase in a length and supercoil
dependent manner. Nucleic Acids Res. 28, 2815–22 (2000).
38. Li, Y . et al. Expanded GAA repeats impede transcription elongation through the FXN gene
and induce transcriptional silencing that is restricted to the FXN locus. Hum. Mol. Genet.
24, 6932–43 (2015).
39. Webster, C. P. et al. The C9orf72 protein interacts with Rab1a and the ULK1 complex to
regulate initiation of autophagy. EMBO J. 35, 1656–76 (2016).
40. Sellier, C. et al. Loss of C9ORF72 impairs autophagy and synergizes with polyQ Ataxin-2
to induce motor neuron dysfunction and cell death. EMBO J. 35, 1276–97 (2016).
41. Sullivan, P. M. et al. The ALS/FTLD associated protein C9orf72 associates with SMCR8
and WDR41 to regulate the autophagy-lysosome pathway. Acta Neuropathol. Commun. 4,
51 (2016).
42. Yang, M. et al. A C9ORF72/SMCR8-containing complex regulates ULK1 and plays a
dual role in autophagy. Sci. Adv. 2, e1601167 (2016).
43. Ugolino, J. et al. Loss of C9orf72 Enhances Autophagic Activity via Deregulated mTOR
and TFEB Signaling. PLOS Genet. 12, e1006443 (2016).
44. Amick, J., Roczniak-Ferguson, A. & Ferguson, S. M. C9orf72 binds SMCR8, localizes to
lysosomes and regulates mTORC1 signaling. Mol. Biol. Cell 72, 3040–3051 (2016).
45. Blokhuis, A. M. et al. Comparative interactomics analysis of different ALS-associated
proteins identifies converging molecular pathways. Acta Neuropathol. 132, 175–96
(2016).
46. Sellier, C. et al. Loss of C 9 ORF 72 impairs autophagy and synergizes with polyQ
Ataxin- 2 to induce motor neuron dysfunction and cell death. 35, 1276–1297 (2016).
47. Therrien, M., Rouleau, G. A., Dion, P. A. & Parker, J. A. Deletion of C9ORF72 results in
motor neuron degeneration and stress sensitivity in C. elegans. PLoS One 8, e83450
(2013).
48. Atanasio, A. et al. C9orf72 ablation causes immune dysregulation characterized by
leukocyte expansion, autoantibody production, and glomerulonephropathy in mice. Sci.
Rep. 6, 23204 (2016).
49. Sudria-Lopez, E. et al. Full ablation of C9orf72 in mice causes immune system-related
pathology and neoplastic events but no motor neuron defects. Acta Neuropathol. 132,
145–7 (2016).
50. Burberry, A. et al. Loss-of-function mutations in the C9ORF72 mouse ortholog cause fatal
autoimmune disease. Sci. Transl. Med. 8, 347ra93 (2016).
51. Robberecht, W. & Philips, T. The changing scene of amyotrophic lateral sclerosis. Nat.
Rev. Neurosci. 14, 248–64 (2013).
62
52. Zhang, K. et al. The C9orf72 repeat expansion disrupts nucleocytoplasmic transport.
Nature 525, 56–61 (2015).
53. Xu, Z. et al. Expanded GGGGCC repeat RNA associated with amyotrophic lateral
sclerosis and frontotemporal dementia causes neurodegeneration. Proc. Natl. Acad. Sci.
110, 7778–7783 (2013).
54. Wen, X. et al. Antisense proline-arginine RAN dipeptides linked to C9ORF72-ALS/FTD
form toxic nuclear aggregates that initiate invitro and invivo neuronal death. Neuron 84,
(2014).
55. Su, Z. et al. Discovery of a Biomarker and Lead Small Molecules to Target r(GGGGCC)-
Associated Defects in c9FTD/ALS. Neuron 83, 1043–1050 (2014).
56. Reddy, K., Zamiri, B., Stanley, S. Y . R., Macgregor, R. B. & Pearson, C. E. The disease-
associated r(GGGGCC)n repeat from the C9orf72 gene forms tract length-dependent uni-
and multimolecular RNA G-quadruplex structures. J. Biol. Chem. 288, 9860–6 (2013).
57. Zhou, B. et al. Characterizations of distinct parallel and antiparallel G-quadruplexes
formed by two-repeat ALS and FTD related GGGGCC sequence. Sci. Rep. 8, 2366
(2018).
58. Hautbergue, G. M. et al. SRSF1-dependent nuclear export inhibition of C9ORF72 repeat
transcripts prevents neurodegeneration and associated motor deficits. Nat. Commun. 8,
16063 (2017).
59. Rossi, S. et al. Nuclear accumulation of mRNAs underlies G4C2-repeat-induced
translational repression in a cellular model of C9orf72 ALS. J. Cell Sci. 128, 1787–99
(2015).
60. Lee, Y .-B. et al. Hexanucleotide repeats in ALS/FTD form length-dependent RNA foci,
sequester RNA binding proteins, and are neurotoxic. Cell Rep. 5, 1178–86 (2013).
61. Cooper-Knock, J. et al. Sequestration of multiple RNA recognition motif-containing
proteins by C9orf72 repeat expansions. Brain 137, 2040–51 (2014).
62. Lee, K. H. K.-H. et al. C9orf72 Dipeptide Repeats Impair the Assembly, Dynamics, and
Function of Membrane-Less Organelles. Cell 167, 774–788.e17 (2016).
63. Balendra, R. & Isaacs, A. M. C9orf72-mediated ALS and FTD: multiple pathways to
disease. Nat. Rev. Neurol. 14, 544–558 (2018).
64. Yamakawa, M. et al. Characterization of the dipeptide repeat protein in the molecular
pathogenesis of c9FTD/ALS. Hum. Mol. Genet. 24, 1630–45 (2015).
65. Tao, Z. et al. Nucleolar stress and impaired stress granule formation contribute to C9orf72
RAN translation-induced cytotoxicity. Hum. Mol. Genet. 24, 2426–41 (2015).
66. Freibaum, B. D. et al. GGGGCC repeat expansion in C9orf72 compromises
nucleocytoplasmic transport. Nature 525, 129–33 (2015).
67. Zhang, K. et al. Stress Granule Assembly Disrupts Nucleocytoplasmic Transport. Cell
173, 958–971.e17 (2018).
68. Yang, D. et al. FTD/ALS-associated poly(GR) protein impairs the Notch pathway and is
recruited by poly(GA) into cytoplasmic inclusions. Acta Neuropathol. 130, 525–35
(2015).
69. Chew, J. et al. Neurodegeneration. C9ORF72 repeat expansions in mice cause TDP-43
pathology, neuronal loss, and behavioral deficits. Science 348, 1151–4 (2015).
63
70. Jiang, J. et al. Gain of Toxicity from ALS/FTD-Linked Repeat Expansions in C9ORF72 Is
Alleviated by Antisense Oligonucleotides Targeting GGGGCC-Containing RNAs. Neuron
90, 535–50 (2016).
71. Peters, O. M. et al. Human C9ORF72 Hexanucleotide Expansion Reproduces RNA Foci
and Dipeptide Repeat Proteins but Not Neurodegeneration in BAC Transgenic Mice.
Neuron 88, 902–909 (2015).
72. O’Rourke, J. G. et al. C9orf72 BAC Transgenic Mice Display Typical Pathologic Features
of ALS/FTD. Neuron 88, 892–901 (2015).
73. Lin, Y . et al. Toxic PR Poly-Dipeptides Encoded by the C9orf72 Repeat Expansion Target
LC Domain Polymers. Cell 167, 789–802.e12 (2016).
74. Boeynaems, S. et al. Phase Separation of C9orf72 Dipeptide Repeats Perturbs Stress
Granule Dynamics. Mol. Cell 65, 1044–1055.e5 (2017).
75. Aoki, Y . et al. C9orf72 and RAB7L1 regulate vesicle trafficking in amyotrophic lateral
sclerosis and frontotemporal dementia. Brain 140, 887–897 (2017).
76. Son, E. Y . et al. Conversion of Mouse and Human Fibroblasts into Functional Spinal
Motor Neurons. Cell Stem Cell 9, 205–218 (2011).
77. Kiskinis, E. et al. Pathways disrupted in human ALS motor neurons identified through
genetic correction of mutant SOD1. Cell Stem Cell 14, 781–95 (2014).
78. Lin, C. L. et al. Aberrant RNA processing in a neurodegenerative disease: the cause for
absent EAAT2, a glutamate transporter, in amyotrophic lateral sclerosis. Neuron 20, 589–
602 (1998).
79. Shi, Y . et al. Haploinsufficiency leads to neurodegeneration in C9ORF72 ALS / FTD
human induced motor neurons. (2018). doi:10.1038/nm.4490
80. Saftig, P. & Klumperman, J. Lysosome biogenesis and lysosomal membrane proteins:
trafficking meets function. Nat. Rev. Mol. Cell Biol. 10, 623–35 (2009).
81. Ganley, I. G., Carroll, K., Bittova, L. & Pfeffer, S. Rab9 GTPase regulates late endosome
size and requires effector interaction for its stability. Mol. Biol. Cell 15, 5420–30 (2004).
82. Rodriguez-Gabin, A. G., Yin, X., Si, Q. & Larocca, J. N. Transport of mannose-6-
phosphate receptors from the trans-Golgi network to endosomes requires Rab31. Exp. Cell
Res. 315, 2215–30 (2009).
83. Wang, G., Moffitt, J. R. & Zhuang, X. Multiplexed imaging of high-density libraries of
RNAs with MERFISH and expansion microscopy. Sci. Rep. 1–13 (2018). doi:10.1038/
s41598-018-22297-7
84. Chen, P., Gu, Z., Liu, W. & Yan, Z. Glycogen synthase kinase 3 regulates N-methyl-D-
aspartate receptor channel trafficking and function in cortical neurons. Mol. Pharmacol.
72, 40–51 (2007).
85. Koppers, M. et al. C9orf72 ablation in mice does not cause motor neuron degeneration or
motor deficits. Ann. Neurol. 78, 426–38 (2015).
86. Chen, T.-W. et al. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature
499, 295–300 (2013).
87. Cai, X. et al. PIKfyve, a class III PI kinase, is the target of the small molecular IL-12/
IL-23 inhibitor apilimod and a player in Toll-like receptor signaling. Chem. Biol. 20, 912–
21 (2013).
64
88. Lemmon, M. A. Membrane recognition by phospholipid-binding domains. Nat. Rev. Mol.
Cell Biol. 9, 99–111 (2008).
89. Chow, C. Y . et al. Deleterious variants of FIG4, a phosphoinositide phosphatase, in
patients with ALS. Am. J. Hum. Genet. 84, 85–8 (2009).
90. Ikonomov, O. C., Sbrissa, D. & Shisheva, A. Localized PtdIns 3,5-P2 synthesis to regulate
early endosome dynamics and fusion. Am. J. Physiol. Cell Physiol. 291, C393-404 (2006).
91. Lodhi, I. J. et al. Insulin stimulates phosphatidylinositol 3-phosphate production via the
activation of Rab5. Mol. Biol. Cell 19, 2718–28 (2008).
92. Kwon, I. et al. Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede
RNA biogenesis, and kill cells. Science 345, 1139–45 (2014).
93. Bissig, C., Hurbain, I., Raposo, G. & van Niel, G. PIKfyve activity regulates reformation
of terminal storage lysosomes from endolysosomes. Traffic 18, 747–757 (2017).
94. Vicinanza, M. et al. PI(5)P Regulates Autophagosome Biogenesis. Mol. Cell 57, 219–234
(2015).
95. Liggins, M. C. et al. PIKfyve regulates melanosome biogenesis. PLOS Genet. 14,
e1007290 (2018).
96. Hessvik, N. P. et al. PIKfyve inhibition increases exosome release and induces secretory
autophagy. Cell. Mol. Life Sci. 73, 4717–4737 (2016).
97. Johnstone, R. M., Adam, M., Hammond, J. R., Orr, L. & Turbide, C. Vesicle formation
during reticulocyte maturation. Association of plasma membrane activities with released
vesicles (exosomes). J. Biol. Chem. 262, 9412–20 (1987).
98. Vlassov, A. V , Magdaleno, S., Setterquist, R. & Conrad, R. Exosomes: current knowledge
of their composition, biological functions, and diagnostic and therapeutic potentials.
Biochim. Biophys. Acta 1820, 940–8 (2012).
99. Raposo, G. & Stoorvogel, W. Extracellular vesicles: Exosomes, microvesicles, and
friends. J. Cell Biol. 200, 373–383 (2013).
100. Budnik, V ., Ruiz-Cañada, C. & Wendler, F. Extracellular vesicles round off
communication in the nervous system. Nat. Rev. Neurosci. 17, 160–172 (2016).
101. Grad, L. I. et al. Intercellular propagated misfolding of wild-type Cu/Zn superoxide
dismutase occurs via exosome-dependent and -independent mechanisms. Proc. Natl.
Acad. Sci. 111, 3620–3625 (2014).
102. Westergard, T. et al. Cell-to-Cell Transmission of Dipeptide Repeat Proteins Linked to
C9orf72 -ALS/FTD. Cell Rep. 17, 645–652 (2016).
103. Zhang, D., Iyer, L. M., He, F. & Aravind, L. Discovery of Novel DENN Proteins:
Implications for the Evolution of Eukaryotic Intracellular Membrane Structures and
Human Disease. Front. Genet. 3, 283 (2012).
104. Levine, T. P., Daniels, R. D., Gatta, A. T., Wong, L. H. & Hayes, M. J. The product of
C9orf72, a gene strongly implicated in neurodegeneration, is structurally related to DENN
Rab-GEFs. Bioinformatics 29, 499–503 (2013).
105. Farg, M. A. et al. C9ORF72, implicated in amytrophic lateral sclerosis and frontotemporal
dementia, regulates endosomal trafficking. Hum. Mol. Genet. 23, 3579–95 (2014).
106. Sivadasan, R. et al. C9ORF72 interaction with cofilin modulates actin dynamics in motor
neurons. Nat. Neurosci. 19, 1610–1618 (2016).
65
107. Du, Z.-W. et al. Generation and expansion of highly pure motor neuron progenitors from
human pluripotent stem cells. Nat. Commun. 6, 6626 (2015).
108. Xiong, B. et al. Crag is a GEF for Rab11 required for rhodopsin trafficking and
maintenance of adult photoreceptor cells. PLoS Biol. 10, e1001438 (2012).
109. Jean, S. & Kiger, A. A. Coordination between RAB GTPase and phosphoinositide
regulation and functions. Nat. Rev. Mol. Cell Biol. 13, 463–470 (2012).
110. Donaldson, J. G. & Jackson, C. L. ARF family G proteins and their regulators: roles in
membrane transport, development and disease. Nat. Rev. Mol. Cell Biol. 12, 362–375
(2011).
111. Eberth, A. & Ahmadian, M. R. In vitro GEF and GAP assays. Curr. Protoc. cell Biol.
Chapter 14, Unit 14.9 (2009).
112. Yoshimura, S., Gerondopoulos, A., Linford, A., Rigden, D. J. & Barr, F. A. Family-wide
characterization of the DENN domain Rab GDP-GTP exchange factors. J. Cell Biol. 191,
367–81 (2010).
113. Radford, R. A. et al. The established and emerging roles of astrocytes and microglia in
amyotrophic lateral sclerosis and frontotemporal dementia. Front. Cell. Neurosci. 9, 414
(2015).
114. TCW, J. et al. An Efficient Platform for Astrocyte Differentiation from Human Induced
Pluripotent Stem Cells. Stem Cell Reports 9, 600–614 (2017).
115. Douvaras, P. et al. Directed Differentiation of Human Pluripotent Stem Cells to Microglia.
Stem Cell Reports 8, 1516–1524 (2017).
116. Zeigerer, A. et al. Rab5 is necessary for the biogenesis of the endolysosomal system in
vivo. Nature 485, 465–70 (2012).
117. Renton, A. E., Chiò, A. & Traynor, B. J. State of play in amyotrophic lateral sclerosis
genetics. Nat. Neurosci. 17, 17–23 (2014).
118. Topp, J. D., Gray, N. W., Gerard, R. D. & Horazdovsky, B. F. Alsin Is a Rab5 and Rac1
Guanine Nucleotide Exchange Factor. J. Biol. Chem. 279, 24612–24623 (2004).
119. Okita, K. et al. A more efficient method to generate integration-free human iPS cells. Nat.
Methods 8, 409–412 (2011).
120. Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8,
2281–2308 (2013).
121. Li, J. et al. Long-term potentiation modulates synaptic phosphorylation networks and
reshapes the structure of the postsynaptic interactome. Sci. Signal. 9, rs8-rs8 (2016).
66

Abstract (if available)

Abstract An intronic GGGGCC repeat expansion in C9ORF72 is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), but the pathogenic mechanism of this repeat remains unclear. Using human induced motor neurons (iMNs), we found that repeat-expanded C9ORF72 was haploinsufficient in ALS. We found that C9ORF72 interacted with endosomes and was required for normal vesicle trafficking and lysosomal biogenesis in motor neurons. Repeat expansion reduced C9ORF72 expression, triggering neurodegeneration through accumulation of glutamate receptors, leading to excitotoxicity. Restoring C9ORF72 levels or augmenting its function with constitutively active RAB5 or chemical modulators of RAB5 effectors rescued patient neuron survival and ameliorated neurodegenerative processes in loss-of-function C9orf72 mouse models. Thus, modulating vesicle trafficking was able to rescue neurodegeneration caused by the C9ORF72 repeat expansion. Coupled with rare mutations in ALS2, FIG4, CHMP2B, OPTN and SQSTM1, our results reveal mechanistic convergence on vesicle trafficking in ALS and FTD.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The C9ORF72 repeat expansion impairs neurodevelopment

PDF

Identification of therapeutic targets for neurons and microglia in amyotrophic lateral sclerosis

PDF

C9orf72 deficiency exacerbates motor deficits in C9ALS/FTD mouse models

PDF

Neural crest-derived cranial pericytes and their dysfunction in disease

PDF

Functional compensation between hematopoietic stem cell clones in vivo

PDF

Identification of therapeutic targets in human cerebral brain organoid models of neurodegeneration

PDF

Characterization of metabolically distinct muscle resident fibro-adipogenic subpopulations reveals a potentially exploitable mechanism of skeletal muscle aging and disease

PDF

Signaling networks in complex brain disorders

PDF

Transcriptomic maturation of developing human cone precursors in fetal and 3D hESC-derived tissues

PDF

Genetics and the environment: evaluating the role of noncoding RNA in autism spectrum disorder

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

Asset Metadata

Creator Lin, Shaoyu (author)

Core Title Functional study of C9ORF72 and its implication in the pathogenesis of amyotrophic lateral sclerosis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development, Stem Cells and Regenerative Medicine

Publication Date 07/04/2019

Defense Date 01/10/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag ALS,C9ORF72,iMN,OAI-PMH Harvest,vesicle trafficking

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Crump, Gage (committee chair), Dickman, Dion K (committee member), Ichida, Justin K (committee member), Ko, Chien-Ping (committee member), Zlokovic, Berislav V (committee member)

Creator Email shaoyu@mit.edu,shaoyuli@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-179954

Unique identifier UC11660316

Identifier etd-LinShaoyu-7533.pdf (filename),usctheses-c89-179954 (legacy record id)

Legacy Identifier etd-LinShaoyu-7533.pdf

Dmrecord 179954

Document Type Dissertation

Format application/pdf (imt)

Rights Lin, Shaoyu

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA