University of Southern California Dissertations and Theses

Therapeutic potential of rhesus theta defensin-1 in the treatment of inflammatory lung diseases

(USC Thesis Other)

Therapeutic potential of rhesus theta defensin-1 in the treatment of inflammatory lung diseases

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1
Therapeutic Potential of Rhesus Theta Defensin-1 in the
Treatment of Inflammatory Lung Diseases

By
Jordanna Grace Jayne

A Dissertation Presented to the Faculty of The University of Southern California Graduate
School in Partial Satisfaction of the Requirements for the Degree
Doctor of Philosophy
August, 2019

Clinical and Experimental Therapeutics
USC School of Pharmacy

Dissertation Committee:
Advisor: Professor Paul Beringer, Chair
Dr Annie Wong-Beringer
Dr. Andre Ouellette

2
Table of Contents
CHAPTER 1: Introduction 5
Cystic Fibrosis (CF) Background 5
Cystic Fibrosis Transmembrane Conductance Regulator (CFTR). 6
Obstruction 7
Infection 8
Inflammation in the CF lung 11
Airway Neutrophils in CF 11
Airway Macrophages in CF 13
Intracellular Signaling Abnormalities in the CF Macrophage 14
The Inflammasome in CF 19
Host Defense Peptides (HDP) 21
a, b,and q-Defensins 22
Defensin Antimicrobial Mechanisms of Action 24
Rhesus q-Defensin-1 25
An Unmet Need 26
References 28
CHAPTER 2: Rhesus Theta (θ)-Defensin-1 Attenuates Endotoxin-Induced Acute Lung
Injury by Inhibiting Proinflammatory Cytokines and Neutrophil Recruitment 45
Abstract 46
Introduction 47
Materials and Methods 49
Human and murine cell cultures 49
In vitro chemotaxis 49
In vitro adhesion 50
In vitro airway leukocyte inflammation 50
Animals and husbandry 51
Experimental procedures 51
Pharmacokinetic studies in mice 52
LC/MS analysis of RTD-1 52
Total and differential cell counts and evaluation of lung edema 53
BALF and cell culture cytokines 54
RT-PCR and expression analysis 54
BALF MMP and peroxidase activities 55
Lung histopathology 55
Data and statistical analysis 56
Endotoxin, RTD-1, and general reagents. 57
Data and statistical analysis 57
Results 58
RTD-1 inhibits neutrophil migration and adhesion 58
RTD-1 dampens LPS-induced alveolar macrophage inflammation but has little effect
on epithelial cells in vitro 59
RTD-1 pharmacokinetics in plasma 61
RTD-1 reduces airway neutrophil burden and pulmonary edema 62
RTD-1 inhibits LPS-induced inflammatory cytokines/chemokines 64
RTD-1 dampens early inflammatory responses in the lung 66
RTD-1 exhibits anti-inflammatory effects up to 12 hours post LPS insufflation 69
RTD-1 protects against LPS induced acute lung injury 71
3
Discussion 73
Acknowledgements 77
References 78
CHAPTER 3: Rhesus Theta Defensin-1 exhibits anti-inflammatory activity through
inhibition of NFκB and inflammasome formation. 86
Abstract 87
Introduction 88
Materials and Methods 90
In vivo studies 90
Animals 90
Chronic Murine Infection Model 91
Ex vivo studies 93
Human subjects 93
CF sputum leukocyte culture. 94
In vitro studies 94
Cell Culture 94
NF-κB Assay 95
Gene Expression Analysis 95
ELISA 96
Inflammasome Activation Assay 96
Data and statistical analysis 97
Results 97
In vivo Efficacy of Aerosolized RTD-1 in Mice with Chronic P. aeruginosa Lung
Infection. 97
Biological targets for the anti-inflammatory activity of RTD-1 during chronic
Pseudomonas aeruginosa infection. 100
RTD-1 reduces spontaneous inflammatory cytokine secretion in CF sputum
leukocytes. 104
RTD-1 exhibits anti-inflammatory activity through inhibition of NF-κB in THP-1
reporter cells 106
RTD-1 driven NF-κB inhibition reduces IL-1β and TNFα gene transcripts 107
RTD-1 treatment reduces THP-1 IL-1β and TNFα cytokine production in LPS
stimulated cells 108
Inflammasome associated gene expression in RTD-1 treated THP-1 macrophages is
largely dampened 109
RTD-1 downregulates NLRP3 gene expression but does not destabilize the gene
transcript. 110
RTD-1 inhibits inflammasome activity, likely through NF-κB inhibition 110
Discussion 112
Conclusions 116
References 116
CHAPTER 4: Research Summary 124
General Aims and Conclusions 124
Anti-inflammatory Activity 124
Antibacterial Activity 125
Future Directions 126
4
Dose Optimization and Long-Term Toxicology 126
Mechanism of Action Studies 127
References 127

5
CHAPTER 1: Introduction
Cystic Fibrosis (CF) Background
CF is an autosomal recessive hereditary multisystem lethal disease with the primary cause of
death being pulmonary failure. CF predominantly affects Caucasians and thus is most prevalent
in the US, Europe and Australia (Elborn 2016) affecting around 70,000 people worldwide (Rafeeq
and Murad 2017). Once considered to be a pediatric disease, the median predicted survival age
between 2013 and 2017 was 43.6 years (95% confidence interval: 42.2 - 44.8 years) (Foundation
2017). This dramatic increase in survival rates is mostly in thanks to neonatal screening,
pancreatic enzyme replacement, respiratory physiotherapy, mucolytics and aggressive antibiotic
treatment (Castellani and Assael 2017). The disease is caused by a mutation in the Cystic Fibrosis
Transmembrane Conductance Regulator (CFTR) gene which encodes a transmembrane channel
responsible for transporting chloride and bicarbonate ions. Abnormal CFTR production results in
abnormal fluid and electrolyte transport across epithelia, airway surface dehydration and
acidification of the airways. Defective ion transport effects both absorptive and secretory
processes resulting in dysregulated secretions from the pancreas, lung, liver, gastrointestinal
tract, sweat glands, and reproductive tract (Reddy and Stutts 2013). CF is characterized by thick
mucosal secretions, bronchiectasis, airways obstruction, chronic infections and subsequent
inflammation leading to tissue damage and pulmonary function decline. Aggressive antibiotic and
airway therapies have been associated with increased life expectancy. Although pulmonary failure
is the primary cause of patient mortality and morbidity other comorbidities include pancreatic
insufficiencies (malabsorption), bile duct obstruction (biliary cirrhosis), sweat gland obstruction
(heat shock), and vas deferens obstruction (male infertility) (Elborn 2016).

6
Cystic Fibrosis Transmembrane Conductance Regulator (CFTR).
The CFTR gene was identified in 1989 and is located on chromosome 7, location 7q31.2., and
spans approximately 250,000 base pairs (Rommens et al. 1989). Since then, over 2,000 different
mutations have been identified, the most common being DF508 of which 85.8% of patients on the
Cystic Fibrosis Foundation 2017 Registry having at least one copy (Sosnay et al. 2013) and 50%
have two copies (Chaudary 2018). The DF508 mutation results in a deletion of three nucleotides
causing a loss of a codon for the amino acid phenylalanine (Chaudary 2018). This mutation leads
to abnormal CFTR protein folding and gating. All other CFTR mutations prevail in 5% or less of
CF patients (Foundation 2017). Mutations are grouped into classes bases upon their production,
trafficking, functionality, and membrane stability (Figure 1-1).

Figure 1-1. Classification of CFTR mutations. Image from (Elborn 2016).

Diminished CFTR activity at the cell surface membrane causes a multitude of negative adverse
biological effects including reduced chloride and bicarbonate ion secretion, enhanced sodium
7
absorption and mucin secretion, which leads to acidic microenvironments resulting in
compromised host defense peptide activity, dysregulated phagocytic activity, and dehydrated
airway surface liquid. Several therapies targeting the primary defect have been approved in recent
years; these include Kalydeco, Orkambi, and Symdeko. These drugs target DF508 CFTR
mutations and address the dysfunctional molecular basis helping to slow the progression of the
disease. Around ~ 50% of CF patients are prescribed CFTR modulators. Although much research
is going into the clinical development of next-generation correctors few are available for the
treatment of individuals with rare mutations. Furthermore, reported drug interactions between
potentiators and correctors demonstrate that there is significant work to be done before a cure is
found (Cholon et al. 2014).

Obstruction
CFTR has a well-defined function as a cyclic adenosine 3’,5’-monophosphate (cAMP)-dependent
chloride channel, that in conjunction with the calcium–activated chloride channel (CaCC),
secretes Cl
-
allowing for normal hydration of mucins that form airway mucus (Stutts et al. 1995;
Quinton 2007). Additionally, normal CFTR limits sodium and fluid absorption through epithelial
Na+ channels (ENaC) (Stutts et al. 1995; Rubenstein et al. 2011). Importantly, NaCl plays a
pivotal role in fluid balance, and critically, in CF, airway surface liquid (ASL) hydration. ASL
dehydration is commonly observed in CF patients due to the dysregulated Cl
-
and Na
+
absorption
(Rubenstein et al. 2011). Further exacerbating the biological situation is the CFTR dependent
luminal bicarbonate insufficiency which hinders mucin maturation resulting in mucin
accumulation, poor mucin solubility and increased mucin immobility (Quinton 2008). Secretory
mucins provide a barrier to ward off invading pathogens whilst cell surface mucins provide a
barrier to inhibit pathogen adhesion. Diminished epithelial ciliary beating and mucus transport
within the CF lung supports mucus adhesion, immobility, airway obstruction, chronic bacterial
8
colonization and inflammation resulting in pulmonary function decline and ultimately respiratory
failure (Figure 1-2).
Figure 1-2. Pathophysiological cascade in the CF lung. The vicious cycle of airway obstruction,
inflammation and infection causes tissue damage, lung tissue remodeling and ultimately
pulmonary failure. Image from (Lopes-Pacheco 2016).
**ENaC, epithelial Na
+
channel; Aqp, aquaporin.

Infection
Chronic pulmonary infections and intermittent acute exacerbations are hallmarks of CF. Abnormal
CFTR causes functional impairments of the innate host defense system. Dysfunctional CFTR
leads to ASL acidification due to diminished bicarbonate secretion. Acidic conditions in the CF
airways impairs host defense peptide antimicrobial activity providing the opportunity for bacteria
to establish acute and chronic infections in humans and animal models (Pezzulo et al. 2012; Shah
et al. 2016). Host defenses are further diminished by the elevated proteases levels observed in
CF. Proteases such as, neutrophil elastase, metalloproteases, and cathepsins are produced in
large amounts by neutrophils, the predominant immune cell type invading the CF lungs. The
unbalanced protease: anti-protease activity in the CF airways results in the degradation of
9
antimicrobial peptides such as lactoferrin, elafin, b defensin-2 and LL-37, secretory leukocyte
protease inhibitor (SLPI), and surfactant protein A (Voynow, Fischer, and Zheng 2008; Small et
al. 2019; Lecaille, Lalmanach, and Andrault 2016). Diminished host defense activity results in
Staphylococcus aureus and Haemophilus influenzae infections in infancy which become
persistent by childhood (Lyczak, Cannon, and Pier 2002). Opportunistic pathogens, particularly
P. aeruginosa, begin to colonize CF patients in children and early adulthood. Colonization of P.
aeruginosa and Burkholderia cepacia complex (Bcc) are proven perpetrators of lung function
decline and premature death (Henry, Mellis, and Petrovic 1992; Muhdi et al. 1996). Persistent
infections commonly result in the acquisition of virulence and antibiotic resistance. The
development of biofilm growth offers a physical defense mechanism to antibiotic and host defense
peptide exposure (Bjarnsholt et al. 2009; Hoiby, Ciofu, and Bjarnsholt 2010). Bacteria growing as
a biofilm exhibit a 100- to 1000-fold increase in antimicrobial agent tolerance compared to
planktonic bacteria (Mah and O'Toole 2001; Sriramulu et al. 2005). Due to the chronic nature of
these infections and acute exacerbations patients are repeatedly exposed to antibiotics which
induces antibiotic resistance through various mechanisms such as b-lactamase, topoisomerase,
drug efflux pumps, mucoid phenotype, porins, and modified membrane architecture (McCaughey
et al. 2013; Stefani et al. 2017). By adulthood, >70% of CF patients have chronically established
P. aeruginosa infections, around 20% of individuals are positive for multidrug resistant P.
aeruginosa (Figure 1-3A-B). S. aureus infections peak in patients in their teenage years and
slowly decline as P. aeruginosa increase. Roughly 40% of adult CF patients are colonized with
MSSA and ~20% with MRSA (Figure 1-3C). Note: Multidrug resistance is defined as resistance
to all antibiotics tested in two or more classes in a single culture.
10
A.
B.
C.

Figure 1-3. Prevalence of pulmonary bacterial colonization sorted by age in CF patients. A) Age
groups and corresponding incidence of bacteria colonizing the airways. B) Rates of multi-drug
11
resistant P. aeruginosa. C) Rates of multi-drug resistant S. aureus (MRSA). Reproduced from
(Foundation 2017).

Inflammation in the CF lung
Exuberant non-resolving neutrophil dominated inflammation is a hallmark of CF lung disease and
is recognized as a key contributing factor to pulmonary tissue destruction. In vitro and ex vivo
studies have demonstrated the dysregulated and hyperinflammatory state of CF neutrophils and
macrophages (Guan et al. 2016; Bruscia and Bonfield 2016a; Laval, Ralhan, and Hartl 2016).
The dysfunctional immune response in CF is driven my inherited and environmental factors
(Bruscia and Bonfield 2016b). Despite the hyperinflammatory response CF patients are often
unable to clear bacterial infections. Vicious cycles of infection and inflammation continually
damage lung structure causing bronchiectasis in infancy which continues to progress into
adulthood resulting in pulmonary function decline and reduced FEV1 in patients.

Airway Neutrophils in CF
Neutrophils are specialized phagocytes and account for >90% of immune cells recovered from
expectorated sputum and bronchoalveolar lavage fluid in studies. Large amounts of
chemoattractants in the CF lung such as IL-8, LTB4, C5a, High-mobility group box 1 (HMGB1),
IL-17, and bacterial products such as N-formyl-methionyl-leucyl-phenylalanine (fMLP) and LPS
draw troves of neutrophils to the site (Nichols and Chmiel 2015). Importantly, IL-8 concentrations
in BAL fluid tend to correlate with neutrophil concentration and thus neutrophil proteases (Nichols
and Chmiel 2015).

While neutrophilia is desirable when fighting an acute infection, chronic lung neutrophilia causes
pulmonary destruction through the release of granulocytes which are rich in cathepsins, ROS,
12
neutrophil elastase, serine- and metalloproteases. Clinical studies have shown that neutrophil
elastase is negatively associated with lung function in CF patients (Tirouvanziam et al. 2006;
Mayer-Hamblett et al. 2007). Proteases can be released from neutrophils through passive and
active mechanisms. The passive release of proteases comes from necrotic cells with leaky
membranes which release proteases in an uncontrolled fashion. The active release of protease
from neutrophils is through degranulation, this is a highly regulated process which, in healthy
individuals, prevents excessive degranulation and protease exposure. Due to the enormity of the
protease release in the CF lung, there is a pathophysiological protease to anti-protease imbalance
which causes: a1-antitrypsin inactivation through MMP (Vissers et al. 1988), proMMP-9 is
cleavage into its active form, neutrophil elastase and cysteine cathepsins cleave and inactivate
serine leukocyte protease inhibitor (SLPI), elafin and the tissue inhibitor of metalloproteinases-1
(TIMP-1) (Weldon et al. 2009). The uncontrolled protease release results in a number of adverse
biological outcomes such as reduced bacterial killing (Hartl et al. 2007) and impaired phagocytic
killing (Ng et al. 2014). Together, the literature suggests these defective CFTR defaults
collaboratively promote a self-perpetuating cycle of neutrophil influx, activation, inflammation,
proteolysis, and bronchiectasis (Figure 1-4).
13

Figure 1-4. The CF neutrophil in the airways. Neutrophils are present in massive quantities and
are key propagators of inflammation in the CF airway. (Abbreviations: a1-PI, alpha-1 proteinase
inhibitor; fMLP, N-formyl-methionyl-leucyl-phenylalanine; ECM, extracellular matrix; ENaC,
epithelial sodium channel; MMP, matrix metalloproteinase; PGP, proline–glycine–proline). Image
from (Nichols and Chmiel 2015).

Airway Macrophages in CF
Macrophages are diverse in nature and possess incredible immune plasticity and rapidly adapt to
changing environmental cues and local milieu (Bruscia and Bonfield 2016a). Macrophages are
specialized phagocytosing cells which engulf cellular debris, invading microorganisms, and their
associated products. In addition, macrophages play an important role in directing a pro-
14
inflammatory response or alternatively, orchestrating the resolution of inflammation and tissue
repair. The macrophage phenotype is directed by its environmental cues, these typically come
from the host although microbial products also play a role. The different macrophage phenotypes
are defined as classically activated (M1) and alternatively activated (M2) of which there are
several, all of which display variable cell surface receptors, pathogen recognition receptors and
inflammatory/anti-inflammatory profiles (Hussell and Bell 2014). M1-macrophages rapidly engulf
microbes and secrete large quantities of pro-inflammatory cytokines (e.g. TNF-α, IL-1β, IL-8). On
the contrary, M2-macrophages are recruited to contain and resolve inflammation and secret anti-
inflammatory cytokines (e.g. IL-4, IL-13, and IL-10).

Intracellular Signaling Abnormalities in the CF Macrophage
Macrophages detect microbial pathogen associated molecular patters (PAMPs) through pattern
recognition receptors (PRRs). PRRs are poised on immune cells and epithelium ready to detect
PAMPs such as lipopolysaccharide (LPS), fMLP, dsRNA and flagellin. PRRs are comprised of 4
major families: Toll-like receptors (TLRs), nucleotide oligomerization (NOD) receptors, retinoic
acid-inducible gene 1 (RIG-I) receptors, and c-type lectin receptors (Bruscia and Bonfield 2016a).
Each family recognizes specific PAMPs and transduce the appropriate signaling cascade to elicit
an immune response. PRRs are also important for the recognition of cellular and tissue damage
and detect ‘damage-associated molecular patterns’ (DAMPs).

Unfortunately, CF macrophages display a dysregulated and hyperinflammatory phenotype in CF.
Alveolar macrophages (AMs) reside in the airway lumen and interstitial fluid and are the airway
sentinels. Once activated they precipitously amplify the host immune response producing copious
amounts of proinflammatory and antimicrobial molecules. These “call-to-action” signals recruit
15
neutrophils to the site, this signaling is coordinated with alveolar epithelial cells for a rapid
response (Hussell and Bell 2014).

CF macrophages have an intrinsically hyperinflammatory phenotype. Numerous studies have
demonstrated that peripheral blood monocyte derived macrophages display heightened
proinflammatory cytokine profiles compared to non-CF healthy controls (Kopp et al. 2012; Tarique
et al. 2017; Zhang et al. 2015). This dysregulated behavior is thought to be a result of intrinsic
and environmental factors (e.g., mucus, proteases, ROS, and bacterial burden), present in the
CF airways. In sputum there is an increase in the number of apoptotic cells, these dead and dying
cells are removed by phagocytic cells in a process called efferocytosis (Vandivier et al. 2002). In
CF, efferocytosis is impaired as proteases released from neutrophils cleave phosphatidylserine
receptors from macrophages diminishing their ability to effectively recognize and phagocytose
apoptotic cells. The clearing of apoptotic cells is imperative for minimizing the liberation of
neutrophil proinflammatory cytokines and proteases (Bruscia and Bonfield 2016b). Additionally,
CF macrophages exhibit an impaired ability to phagocytose and to kill phagocytosed bacteria.
This is thought to be due to downregulated TLR5 expression at the cell surface membrane,
meaning the macrophages are not able to properly recognize P. aeruginosa for phagocytosis
(Simonin-Le Jeune et al. 2013). Furthermore, the improper acidification of the macrophage
phagolysosomes as a result of defective CFTR makes bacterial killing ineffectual (Del Porto et al.
2011; Di et al. 2006; Deriy et al. 2009). This is thought to be, at least in part, due to abnormal
CFTR functions as inhibition of CFTR in non-CF healthy macrophages induces altered
phagocytosis (Simonin-Le Jeune et al. 2013).

Compounding the defective efferocytosis and bacterial killing, CF macrophage also displays
abnormal signaling through key inflammatory pathways including NF-κB, MAPK and
PI3K/AKT (Leveque et al. 2017). The hyperinflammatory signaling through NF-κB, MAPK and
16
PI3K/AKT pathways is thought be to partially caused by abnormal cell surface receptor
abundance. In particular, CF macrophages have been reported to have significantly increased
TLR4 through which LPS, DAMPS and HMGB1 signal (Sturges et al. 2010; Bruscia et al. 2011).
Evidence suggests that continual uncontrolled signaling through TLR4 is a result of reduce
caveolin-1 (Zhang et al. 2013). Cavolin-1 is an important structural protein for the negative
regulation of signaling membrane receptors. Diminished caveolin-1 facilitates cholesterol
transport at the cell surface membrane and thus plays an important role in lipid rafts, cell
membrane regions rich in cholesterol and ceramide. Caveolin-1 is the main structural component
in the formation of caveolae which form small membrane invaginations and initiate non clathrin-
dependent endocytosis (Leveque et al. 2017). The reduction of caveolin-1 and heme-oxygenase,
a co-localizing stress response protein, at the cell surface means TLR4 is not correctly
internalized for degradation once bound to its ligand. The Bruscia group suggest this is a result
of high microRNA-199a-5p which, in healthy macrophages, is inhibited by phosphorylated AKT.
However, in CF macrophages PI3K/AKT signaling is dysregulated and microRNA-199a-5p
increases to pathological levels. This in turn inhibits caveolin-1 and heme-oxygen creating a
vicious cycle where TLR4 is a continually signaling further inducing NF-κB, MAPK and
PI3K/AKT pathways (Zhang et al. 2015). Other studies have suggested ineffectual trafficking of
TLRs may also be caused by diminished Rab protein expression (Kelly et al. 2013) and
microtubule formation (Rymut et al. 2015), both key elements in vesicle trafficking.

Ceramide, a sphingolipid, plays an important role in CF pathogenesis. Studies have discovered
that in epithelial cells and alveolar macrophages isolated from CF patients explanted lung
specimens and cftr-/- mice there is a significant accumulation of ceramide (Teichgraber et al.
2008; Zhang et al. 2010; Brodlie et al. 2010). Ceramide accumulation is brought about by
dysfunctional CFTR causing alkalinization of cellular vesicles and imbalanced acid
sphingomyelinase and acid ceramidase (Teichgraber et al. 2008). CFTR is localized into lipid
17
rafts upon P. aeruginosa infection and is important of signal transduction. Defective CFTR fails to
activate NADPH oxidase and diminishes the cells ability to induce ROS mediated P. aeruginosa
killing (Zhang et al. 2010).

The mechanisms that contribute to the dysregulated hyperinflammatory phenotype of CF
macrophages is complex and numerous, a summary of CF macrophage behaviors is provided
below (Figure 1-5).

18

Figure 1-5. A summary of abnormal CF macrophage functions that lead to their characteristic
proinflammatory phenotype (a) and diminished phagocytosis and bacterial killing (b). Image from
(Bruscia and Bonfield 2016a).
19
The Inflammasome in CF
The inflammasome is a key innate immune system proinflammatory mediator responsible for the
activation of proinflammatory cytokines, IL-1β, IL-1a and IL-18. Nucleotide-binding domain,
leucine-rich repeat containing proteins (NOD-like receptors, NLRs) and the absent in melanoma
2 (AIM)-like receptors (ALRs) are 2 families of PRRs responsible for the sensing of particular
stimuli in response to which they assemble a caspase-1 activating scaffold (Takeuchi and Akira
2010). Currently, there are five PRRs (AIM2, Pyrin, NLRC4, NLRP1, and NLRP3) known to form
inflammasomes (Lamkanfi and Dixit 2014). The NLRP3 inflammasome is a crucial component in
the immune response to a number of cellular stressors. The NRLP3 inflammasome is thought to
detect disruptions to cellular homeostasis, this includes potassium efflux, calcium signaling,
mitochondrial imbalances and lysosomal rupture (He, Hara, and Nunez 2016). The inflammasome
is a multimeric protein complex comprised of NLRP3 (NALP3), the adapter molecule apoptosis-
associated speck (ASC), and pro-caspase-1 (Guo, Callaway, and Ting 2015) (Figure 1-6).
Figure 1-6. NLRP3
inflammasome activation.
Image from (Guo,
Callaway, and Ting
2015).

PAMP signaling through NF-κB is essential for the priming of key inflammasome related genes
and subsequent inflammasome activation (Sun 2011; Sutterwala, Haasken, and Cassel 2014).
20
Both pro-IL-1B and NLRP3 promoter regions contains NF-κB-binding sites and are targets of NF-
κB pathogen associated molecular pattern (PAMP) induced transcription (Qiao et al. 2012).
Inflammasome activation induces the proteolytic cleavage of procaspase-1 into active caspase-
1. Active caspase-1 is liberated to cleave precursor cytokines proIL-1β, pro-IL-1a and pro-IL-18
to release their biologically active forms which are then secreted to propagate proinflammatory
signal transduction (Howard et al. 1991; Gu et al. 1997). Caspase-1 is also important in the
mediation of pyroptosis, a type of inflammatory programmed cell death that typically occurs in
response to intracellular pathogens.

A number of clinical studies have demonstrated increased IL-1β concentrations in CF patient
sputum (Osika et al. 1999), plasma (Wilmott et al. 1994) and BAL samples (Wilmott et al. 1990;
Bonfield et al. 1995). Additionally, IL-1β levels are elevated in CF patients chronically colonized
with P. aeruginosa when compared to non-colonized individuals (Bonfield et al. 1995). In
agreement with this, IL-1β levels are decreased after the clearance of P. aeruginosa in BAL
samples from CF children (Douglas et al. 2009). Furthermore, various clinical studies have
identified IL-1β gene polymorphisms to be associated with lung disease severity in CF patients
(Levy et al. 2009; de Vries et al. 2014). Additionally, it has been shown that ΔF508 mutant murine
bone marrow derived macrophages produce exuberant quantities of IL-1β (Kotrange et al. 2011).
This could be due to the increased number of TLR4 receptors present in CF macrophages.
Conversely, a study by Tang et al. showed there were no significant differences in caspase-1
activation and IL-1β production between CF patient and healthy volunteer peripheral blood
mononuclear cell (PBMC) samples (Tang et al. 2012). Interestingly, that study also showed that
IL-1β is produced in negligible amounts by bronchial epithelial cells upon stimulation. Other
studies have demonstrated that the inflammasome is a potential target for the treatment of CF
lung disease through the negative regulation of IL-1Ra to mitigate the damaging effects caused
by chronic microbial infection (Iannitti et al. 2016; Veliz Rodriguez et al. 2012).
21

Host Defense Peptides (HDP)
HDP activity is diminished in the CF lung due to defective CFTR HCO3- transportation, this results
in the improper maintenance of the ASL causing acidification. In the CF ASL the pH can drop to
as low as 5.3 (Rogan et al. 2004), yet even reductions from 8.0 to 6.8 can have devastating effects
for host defense peptide activity. pH 6.8 was found to be sufficiently low to prevent the bactericidal
activities of β-defensin-3 (hBD-3), and the cathelicidin, LL-37 against S. aureus (Abou Alaiwa et
al. 2014). Low pH also inhibited LL-37 P. aeruginosa killing (Abou Alaiwa et al. 2014). Airway
HDPs, such as lysozyme and lactoferrin, act synergistically to defend the host from invading
pathogens, in acidic conditions this synergism is often negated (Abou Alaiwa et al. 2014; Pezzulo
et al. 2012). The decimation of the innate host defense armamentarium causes CF patients to be
highly susceptible to chronic bacterial colonization.

Host defense peptides (HPDs), historically known as antimicrobial peptides, are short, cationic
amphipathic peptides synthesized by all complex living organisms. HDPs typically possess
modest broad-spectrum antimicrobial activity and substantial immunomodulatory
properties (Hancock, Haney, and Gill 2016) (Figure 1-7). Currently, there are >3,000 HDPs
identified (Wang, Li, and Wang 2016). HDPs exert their antimicrobial activity on gram positive
and negative bacteria, viruses, fungi and protozoa (Mansour, Pena, and Hancock 2014). As our
understanding of HDPs evolves the field is increasingly thinking of HDPs more as complex
multifaceted immunomodulatory mediators who, under certain circumstances, act as antimicrobial
peptides.
22

Figure 1-7. Host defense peptides exhibit both antimicrobial activity and immune modulating
potential. Different peptides may have more potent activity for one or the other activity. Image
from (Hancock and Sahl 2006).

Human defensins are comprised of two families, α-defensins and β-defensins. In the lung,
defensins phospholipase A2, lysozyme, lactoferrin, and the Cathelicidin, LL-37 are secreted in
abundance. Human α-defensins are produced by neutrophils while β-defensins are typically
produced by epithelium. HDP synthesis can be constitutive and inducible depending on
inflammatory stimuli such as tissue damage or infection (Hancock, Haney, and Gill 2016).

a, b,and q-Defensins
Mature defensins share several characteristics which include, 18-45 amino acids sequences,
three disulfide bonds, cation charge (+1 to +11), and β-strands dominated tertiary structures
(Selsted and Ouellette 2005). Defensins are ubiquitously expressed in all vertebrates, though to
varying degrees between species. The linear spacing and disulfide bonds are what structurally
23
distinguish the α- and β-defensins (Fig. 1-8) (Selsted and Ouellette 2005). θ-defensins have a
cyclized backbone making them structurally divergent from the α- and β-defensins.

Figure 1-8. Defensin
genes (left) and their
peptides (right). Numbers
above diagrams denote
disulfide bonds. The 3D
structures are: rabbit α-
defensin RK-1 (top),
human β-defensin-1
(middle) and θ-defensin
RTD-1 (bottom). Image
from (Selsted and
Ouellette, 2005).

a, b,and q-Defensins are synthesized as ‘prepropeptides’, these are rapidly cleaved into ‘pro-
defensins’. Pro-α-defensins exhibit little to no anti-microbial effects in vitro (Valore and Ganz 1992;
Wu et al. 2003). Proteolytic cleavage of the anionic ‘propiece’ is required for activation and charge
balancing which is thought to minimize cytotoxicity (Selsted and Ouellette 2005). Conversely, β-
defensins have short amino acid sequences dividing the signal and mature peptide regions.
Hence, the structural basis for synthesis and intracellular trafficking of α- and β-defensins are
fundamentally distinctive. Human α-defensins (1 thorough 4) are synthesized and packaged in
leukocyte granulocytes, whilst human α-defensins (5 and 6) are produced in Paneth cells located
24
in the base of crypts in the gastrointestinal tract (Ouellette 2006). Human β-defensins (1 thorough
4) are broadly synthesized in epithelial cells and leukocytes constitutively and, dependent on the
conditions and site, inducibly (Selsted and Ouellette 2005).

The θ-defensins are unique in the fact that they are the only fully cyclized peptides expressed in
mammals. θ-defensins are 18 amino acid peptides conferring immense structural stability thanks
to their macrocyclic tri-disulfide structure (Selsted and Ouellette 2005). These peptides are
produced through the ligation of two precursor alpha defensin paralogs cleaved into 9 amino acid
fragments from 12 amino acid pro-pieces (Selsted and Ouellette 2005). Although θ-defensins are
not expressed in humans due to a premature stop codon in the mRNA sequence preventing
translation, they are widely expressed in Old World Monkeys (e.g. rhesus macaques monkeys
and baboons) and orangutans (Selsted and Ouellette 2005). The evolutionary reasons for the
introduction of the premature stop codon in humans is not understood.

Defensin Antimicrobial Mechanisms of Action
Recognition of differences in cell membrane architecture between mammals and bacteria is
imperative for effective HDP antimicrobial action. Mammalian membranes have a net neutral
charge opposed to bacterial cell membranes who carry a net negative charge, because the
defensins are highly cationic they bind strongly to bacterial membranes (Melo, Ferre, and
Castanho 2009). The net charge difference is likely crucial for HDPs to form van der Waals
interactions with bacterial membranes. Additionally, bacterial transmembrane potential
differences support defensin membrane insertions and translocation (Melo, Ferre, and Castanho
2009). Anionic bacterial components such as LPS, lipoteichoic acid and peptidoglycan also
promote peptide binding allowing for membrane disturbances through electrostatic interactions
(Melo, Ferre, and Castanho 2009).

25
Additionally, defensins initiate bacterial cell killing through intracellular mechanisms. This can
occur through cell wall inhibition, nucleic acid synthesis inhibition and protein synthesis inhibition,
altered cytoplasmic membrane septum formation and inhibition of enzymatic activity (Brogden
2005). Host defense peptides also possess anti-viral and anti-fungal activity. The mechanisms of
these actions include cell permeabilization, fusion inhibition, receptor blocking, reverse
transcriptase blocking, replication inhibition and neutralization (Basso et al. 2018; Quinones-
Mateu et al. 2003; Wilson, Wiens, and Smith 2013).

The clinical development of a host defense peptide which is stable in protease rich and acidified
conditions, such as those present in the CF airways, is a novel approach to the treatment of CF
airway infection and inflammation.

Rhesus q-Defensin-1
Antimicrobial Activity
Rhesus q-defensin-1 (RTD-1) is a macrocyclic peptide endogenously expressed in Old World
monkeys but is absent from other monkeys and hominids (Lehrer, Cole, and Selsted 2012). Our
lab demonstrated RTD-1 exhibits broad-spectrum antibacterial activity against multidrug-resistant
bacteria including mucoid Pseudomonal strains isolated from CF patients (Beringer et al. 2016;
Tai et al. 2015). Furthermore, RTD-1 is active against fungi (Candida albicans and Cryptococcus
neoformans) (Basso et al. 2018), methicillin-resistant S. aureus (MRSA) (Tai et al. 2015), and HIV
(Seidel et al. 2010). Unlike the a and b-defensins which typically exert their bactericidal activity
through inhibition of peptidoglycan synthesis, RTD-1 interrupts the bacterial cell membrane
through membrane potential based mechanisms (Wilmes et al. 2014).

26
Anti-inflammatory Activity
In addition to above described RTD-1 antimicrobial activity, the peptide also exhibits potent
immunomodulatory activity. RTD-1 has demonstrated potent immunomodulatory properties in
murine models of acute lung injury (Jayne et al. 2018), chronic lung infection (Bensman et al.
2017), bacteremia sepsis (Schaal et al. 2012), systemic candidiasis (Basso et al. 2018), and
rheumatoid arthritis (Schaal et al. 2017). In vitro work has demonstrated that the RTD-1 anti-
inflammatory mechanism of action is in part due to inhibition of NFkB activation mediated through
the phosphorylation of AKT (Tongaonkar et al. 2015). Additionally, RTD-1 inhibits soluble tumor
necrosis factor alpha (TNFa) release through the inhibition of TNFa converting enzyme
(TACE/ADAM17) (Schaal et al. 2018). Studies in differentiated THP-1 macrophage-like cells and
healthy volunteer blood leukocytes have shown RTD-1 significantly mitigates inflammation
induced by TLR agonists independent of direct agonist neutralization (Schaal et al. 2012).
Elucidation of other mechanism of immunomodulatory actions are discussed further throughout
this thesis.

Safety
RTD-1 has been shown to be non-immunogenic and non-toxic in mice, rats and chimpanzees
(Schaal et al. 2012; Kopp et al. 2012). Furthermore, pre-clinical toxicology studies have been
performed and RTD-1 is now entering into phase 1 clinical studies for rheumatoid arthritis
demonstrating an excellent safety profile and clinical promise for this dual-acting peptide.

An Unmet Need
Although HDPs have been shown to be elevated in the CF airway chronic infection persists
(Hiemstra et al. 2016). The decreased pH of the epithelial lining fluid in CF, sometimes dropping
as low as 5.3, offers optimal conditions for cathepsin to cleave and inactivate HDPs and anti-
27
proteases (Rogan et al. 2004). These pathological conditions in CF continually diminish the host
defense armamentarium.

Several pediatric clinical trials have demonstrated that glucocorticosteroids and high dose
ibuprofen decrease the rate of pulmonary function decline indicating that inflammation in the CF
lung is an important target (Konstan et al. 1995; Konstan et al. 2007; Eigen et al. 1995).
Unfortunately, serious adverse effects limit their clinical use. Currently, long-term low-dose
azithromycin is the most commonly prescribed anti-inflammatory for CF lung inflammation (63.8%
utilization) (Foundation 2017). However, Azithromycin provides modest effects. Studies have
shown a mere 4% increase in lung function (FEV1) over 6 months which, disappointingly, is not
maintained past a year (Fleet et al. 2013). Thus, there is a clear unmet clinical need for safe and
efficacious anti-inflammatory therapies to mitigate the persistent hyper-inflammatory state in the
CF lung.

The RTD-1 macrocyclic structure and tridisulfide bonds offer the peptide superior structural
stability necessary to withstand the acidified and protease rich environment present in the CF
lung. Taken together with its broad-spectrum antimicrobial properties and immune modulating
capabilities we believe RTD-1 is a promising therapeutic for CF lung disease. The subsequent
chapters of this thesis delve into the drugs therapeutic potential and its immunomodulatory
mechanism of action.

Aims and Summary of Chapters
CF lung disease is characterized by pulmonary obstructions, chronic lung infections, and
inflammation, leading to pulmonary function decline and ultimately respiratory failure.
Dysfunctional CFTR leads to an acidified airway environment rich in proteases. The defective
CFTR and hostile cytokine milieu in the CF airways results in neutrophils and macrophages
28
displaying a dysregulated and hyperinflammatory phenotype. RTD-1 is a macrocyclic dual-acting
broad-spectrum antimicrobial peptide with immunomodulatory properties. This thesis aims to
further understand efficacy and immunomodulatory mechanism of action for RTD-1 in
experimental models of CF lung disease.

In chapter 2, we will describe the anti-inflammatory effects of RTD-1 in a murine model of acute
lung injury. This model recapitulates the neutrophilic nature of the CF lung. Furthermore, we
discuss the RTD-1 effect on proinflammatory cytokines, neutrophil migration and adhesion in vitro.

In chapter 3, we explore the RTD-1 effect in a murine model of chronic lung infection and
investigate the transcriptional changes induced. Additionally, we explore the RTD-1 effects on the
inflammasome pathway.

References
Abou Alaiwa, M. H., L. R. Reznikov, N. D. Gansemer, K. A. Sheets, A. R. Horswill, D. A. Stoltz, J.
Zabner, and M. J. Welsh. 2014. 'pH modulates the activity and synergism of the airway surface
liquid antimicrobials beta-defensin-3 and LL-37', Proc Natl Acad Sci U S A, 111: 18703-8.

Basso, V., A. Garcia, D. Q. Tran, J. B. Schaal, P. Tran, D. Ngole, Y. Aqeel, P. Tongaonkar, A. J.
Ouellette, and M. E. Selsted. 2018. 'Fungicidal Potency and Mechanisms of theta-Defensins
against Multidrug-Resistant Candida Species', Antimicrob Agents Chemother, 62.

Bensman, T. J., J. G. Jayne, M. Sun, E. Kimura, J. Meinert, J. C. Wang, J. B. Schaal, D. Tran, A.
P. Rao, O. Akbari, M. E. Selsted, and P. M. Beringer. 2017. 'Efficacy of Rhesus Theta-Defensin-
1 in Experimental Models of Pseudomonas aeruginosa Lung Infection and Inflammation',
Antimicrob Agents Chemother, 61.
29

Beringer, P. M., T. J. Bensman, H. Ho, M. Agnello, N. Denovel, A. Nguyen, A. Wong-Beringer, R.
She, D. Q. Tran, S. M. Moskowitz, and M. E. Selsted. 2016. 'Rhesus theta-defensin-1 (RTD-1)
exhibits in vitro and in vivo activity against cystic fibrosis strains of Pseudomonas aeruginosa', J
Antimicrob Chemother, 71: 181-8.

Bjarnsholt, T., P. O. Jensen, M. J. Fiandaca, J. Pedersen, C. R. Hansen, C. B. Andersen, T.
Pressler, M. Givskov, and N. Hoiby. 2009. 'Pseudomonas aeruginosa biofilms in the respiratory
tract of cystic fibrosis patients', Pediatr Pulmonol, 44: 547-58.

Bonfield, T. L., J. R. Panuska, M. W. Konstan, K. A. Hilliard, J. B. Hilliard, H. Ghnaim, and M.
Berger. 1995. 'Inflammatory cytokines in cystic fibrosis lungs', Am J Respir Crit Care Med, 152:
2111-8.

Brodlie, M., M. C. McKean, G. E. Johnson, J. Gray, A. J. Fisher, P. A. Corris, J. L. Lordan, and C.
Ward. 2010. 'Ceramide is increased in the lower airway epithelium of people with advanced cystic
fibrosis lung disease', Am J Respir Crit Care Med, 182: 369-75.

Brogden, K. A. 2005. 'Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria?',
Nat Rev Microbiol, 3: 238-50.

Bruscia, E. M., and T. L. Bonfield. 2016a. 'Cystic Fibrosis Lung Immunity: The Role of the
Macrophage', J Innate Immun, 8: 550-63.
Bruscia, E. M. 2016b. 'Innate and Adaptive Immunity in Cystic Fibrosis', Clin Chest Med, 37: 17-
29.

30
Bruscia, E. M., P. X. Zhang, A. Satoh, C. Caputo, R. Medzhitov, A. Shenoy, M. E. Egan, and D.
S. Krause. 2011. 'Abnormal trafficking and degradation of TLR4 underlie the elevated
inflammatory response in cystic fibrosis', J Immunol, 186: 6990-8.

Castellani, C., and B. M. Assael. 2017. 'Cystic fibrosis: a clinical view', Cell Mol Life Sci, 74: 129-
40.

Chaudary, N. 2018. 'Triplet CFTR modulators: future prospects for treatment of cystic fibrosis',
Ther Clin Risk Manag, 14: 2375-83.

Cholon, D. M., N. L. Quinney, M. L. Fulcher, C. R. Esther, Jr., J. Das, N. V. Dokholyan, S. H.
Randell, R. C. Boucher, and M. Gentzsch. 2014. 'Potentiator ivacaftor abrogates pharmacological
correction of DeltaF508 CFTR in cystic fibrosis', Sci Transl Med, 6: 246ra96.

de Vries, L., A. Griffiths, D. Armstrong, and P. J. Robinson. 2014. 'Cytokine gene polymorphisms
and severity of CF lung disease', J Cyst Fibros, 13: 699-705.

Del Porto, P., N. Cifani, S. Guarnieri, E. G. Di Domenico, M. A. Mariggio, F. Spadaro, S. Guglietta,
M. Anile, F. Venuta, S. Quattrucci, and F. Ascenzioni. 2011. 'Dysfunctional CFTR alters the
bactericidal activity of human macrophages against Pseudomonas aeruginosa', PLoS One, 6:
e19970.

Deriy, L. V., E. A. Gomez, G. Zhang, D. W. Beacham, J. A. Hopson, A. J. Gallan, P. D.
Shevchenko, V. P. Bindokas, and D. J. Nelson. 2009. 'Disease-causing mutations in the cystic
fibrosis transmembrane conductance regulator determine the functional responses of alveolar
macrophages', J Biol Chem, 284: 35926-38.
31

Di, A., M. E. Brown, L. V. Deriy, C. Li, F. L. Szeto, Y. Chen, P. Huang, J. Tong, A. P. Naren, V.
Bindokas, H. C. Palfrey, and D. J. Nelson. 2006. 'CFTR regulates phagosome acidification in
macrophages and alters bactericidal activity', Nat Cell Biol, 8: 933-44.

Douglas, T. A., S. Brennan, S. Gard, L. Berry, C. Gangell, S. M. Stick, B. S. Clements, and P. D.
Sly. 2009. 'Acquisition and eradication of P. aeruginosa in young children with cystic fibrosis', Eur
Respir J, 33: 305-11.

Eigen, H., B. J. Rosenstein, S. FitzSimmons, and D. V. Schidlow. 1995. 'A multicenter study of
alternate-day prednisone therapy in patients with cystic fibrosis. Cystic Fibrosis Foundation
Prednisone Trial Group', J Pediatr, 126: 515-23.

Elborn, J. S. 2016. 'Cystic fibrosis', Lancet, 388: 2519-31.

Fleet, J. E., K. Guha, S. Piper, W. Banya, D. Bilton, and M. E. Hodson. 2013. 'A retrospective
analysis of the impact of azithromycin maintenance therapy on adults attending a UK cystic
fibrosis clinic', J Cyst Fibros, 12: 49-53.

Foundation, CF. 2017. "Cystic Fibrosis Foundation Patient Registry." In.

Gu, Y., K. Kuida, H. Tsutsui, G. Ku, K. Hsiao, M. A. Fleming, N. Hayashi, K. Higashino, H.
Okamura, K. Nakanishi, M. Kurimoto, T. Tanimoto, R. A. Flavell, V. Sato, M. W. Harding, D. J.
Livingston, and M. S. Su. 1997. 'Activation of interferon-gamma inducing factor mediated by
interleukin-1beta converting enzyme', Science, 275: 206-9.

32
Guan, X., Y. Hou, F. Sun, Z. Yang, and C. Li. 2016. 'Dysregulated Chemokine Signaling in Cystic
Fibrosis Lung Disease: A Potential Therapeutic Target', Curr Drug Targets, 17: 1535-44.
Guo, H., J. B. Callaway, and J. P. Ting. 2015. 'Inflammasomes: mechanism of action, role in
disease, and therapeutics', Nat Med, 21: 677-87.

Hancock, R. E., E. F. Haney, and E. E. Gill. 2016. 'The immunology of host defence peptides:
beyond antimicrobial activity', Nat Rev Immunol, 16: 321-34.

Hancock, R. E., and H. G. Sahl. 2006. 'Antimicrobial and host-defense peptides as new anti-
infective therapeutic strategies', Nat Biotechnol, 24: 1551-7.

Hartl, D., P. Latzin, P. Hordijk, V. Marcos, C. Rudolph, M. Woischnik, S. Krauss-Etschmann, B.
Koller, D. Reinhardt, A. A. Roscher, D. Roos, and M. Griese. 2007. 'Cleavage of CXCR1 on
neutrophils disables bacterial killing in cystic fibrosis lung disease', Nat Med, 13: 1423-30.

He, Y., H. Hara, and G. Nunez. 2016. 'Mechanism and Regulation of NLRP3 Inflammasome
Activation', Trends Biochem Sci, 41: 1012-21.

Henry, R. L., C. M. Mellis, and L. Petrovic. 1992. 'Mucoid Pseudomonas aeruginosa is a marker
of poor survival in cystic fibrosis', Pediatr Pulmonol, 12: 158-61.

Hiemstra, P. S., G. D. Amatngalim, A. M. van der Does, and C. Taube. 2016. 'Antimicrobial
Peptides and Innate Lung Defenses: Role in Infectious and Noninfectious Lung Diseases and
Therapeutic Applications', Chest, 149: 545-51.

33
Hoiby, N., O. Ciofu, and T. Bjarnsholt. 2010. 'Pseudomonas aeruginosa biofilms in cystic fibrosis',
Future Microbiol, 5: 1663-74.

Howard, A. D., M. J. Kostura, N. Thornberry, G. J. Ding, G. Limjuco, J. Weidner, J. P. Salley, K.
A. Hogquist, D. D. Chaplin, R. A. Mumford, and et al. 1991. 'IL-1-converting enzyme requires
aspartic acid residues for processing of the IL-1 beta precursor at two distinct sites and does not
cleave 31-kDa IL-1 alpha', J Immunol, 147: 2964-9.

Hussell, T., and T. J. Bell. 2014. 'Alveolar macrophages: plasticity in a tissue-specific context',
Nat Rev Immunol, 14: 81-93.

Iannitti, R. G., V. Napolioni, V. Oikonomou, A. De Luca, C. Galosi, M. Pariano, C. Massi-Benedetti,
M. Borghi, M. Puccetti, V. Lucidi, C. Colombo, E. Fiscarelli, C. Lass-Florl, F. Majo, L. Cariani, M.
Russo, L. Porcaro, G. Ricciotti, H. Ellemunter, L. Ratclif, F. M. De Benedictis, V. N. Talesa, C. A.
Dinarello, F. L. van de Veerdonk, and L. Romani. 2016. 'IL-1 receptor antagonist ameliorates
inflammasome-dependent inflammation in murine and human cystic fibrosis', Nat Commun, 7:
10791.

Jayne, J. G., T. J. Bensman, J. B. Schaal, A. Y. J. Park, E. Kimura, D. Tran, M. E. Selsted, and
P. M. Beringer. 2018. 'Rhesus theta-Defensin-1 Attenuates Endotoxin-induced Acute Lung Injury
by Inhibiting Proinflammatory Cytokines and Neutrophil Recruitment', Am J Respir Cell Mol Biol,
58: 310-19.

Kelly, C., P. Canning, P. J. Buchanan, M. T. Williams, V. Brown, D. C. Gruenert, J. S. Elborn, M.
Ennis, and B. C. Schock. 2013. 'Toll-like receptor 4 is not targeted to the lysosome in cystic fibrosis
airway epithelial cells', Am J Physiol Lung Cell Mol Physiol, 304: L371-82.
34

Konstan, M. W., P. J. Byard, C. L. Hoppel, and P. B. Davis. 1995. 'Effect of high-dose ibuprofen
in patients with cystic fibrosis', N Engl J Med, 332: 848-54.

Konstan, M. W., M. D. Schluchter, W. Xue, and P. B. Davis. 2007. 'Clinical use of Ibuprofen is
associated with slower FEV1 decline in children with cystic fibrosis', Am J Respir Crit Care Med,
176: 1084-9.

Kopp, B. T., B. A. Abdulrahman, A. A. Khweek, S. B. Kumar, A. Akhter, R. Montione, M. F. Tazi,
K. Caution, K. McCoy, and A. O. Amer. 2012. 'Exaggerated inflammatory responses mediated by
Burkholderia cenocepacia in human macrophages derived from Cystic fibrosis patients', Biochem
Biophys Res Commun, 424: 221-7.

Kotrange, S., B. Kopp, A. Akhter, D. Abdelaziz, A. Abu Khweek, K. Caution, B. Abdulrahman, M.
D. Wewers, K. McCoy, C. Marsh, S. A. Loutet, X. Ortega, M. A. Valvano, and A. O. Amer. 2011.
'Burkholderia cenocepacia O polysaccharide chain contributes to caspase-1-dependent IL-1beta
production in macrophages', J Leukoc Biol, 89: 481-8.

Lamkanfi, M., and V. M. Dixit. 2014. 'Mechanisms and functions of inflammasomes', Cell, 157:
1013-22.

Laval, J., A. Ralhan, and D. Hartl. 2016. 'Neutrophils in cystic fibrosis', Biol Chem, 397: 485-96.

Lecaille, F., G. Lalmanach, and P. M. Andrault. 2016. 'Antimicrobial proteins and peptides in
human lung diseases: A friend and foe partnership with host proteases', Biochimie, 122: 151-68.

35
Lehrer, R. I., A. M. Cole, and M. E. Selsted. 2012. 'theta-Defensins: cyclic peptides with endless
potential', J Biol Chem, 287: 27014-9.

Leveque, M., S. Le Trionnaire, P. Del Porto, and C. Martin-Chouly. 2017. 'The impact of impaired
macrophage functions in cystic fibrosis disease progression', J Cyst Fibros, 16: 443-53.

Levy, H., A. Murphy, F. Zou, C. Gerard, B. Klanderman, B. Schuemann, R. Lazarus, K. C. Garcia,
J. C. Celedon, M. Drumm, M. Dahmer, M. Quasney, K. Schneck, M. Reske, M. R. Knowles, G. B.
Pier, C. Lange, and S. T. Weiss. 2009. 'IL1B polymorphisms modulate cystic fibrosis lung
disease', Pediatr Pulmonol, 44: 580-93.

Lopes-Pacheco, M. 2016. 'CFTR Modulators: Shedding Light on Precision Medicine for Cystic
Fibrosis', Front Pharmacol, 7: 275.

Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2002. 'Lung infections associated with cystic fibrosis',
Clin Microbiol Rev, 15: 194-222.

Mah, T. F., and G. A. O'Toole. 2001. 'Mechanisms of biofilm resistance to antimicrobial agents',
Trends Microbiol, 9: 34-9.

Mansour, S. C., O. M. Pena, and R. E. Hancock. 2014. 'Host defense peptides: front-line
immunomodulators', Trends Immunol, 35: 443-50.

Mayer-Hamblett, N., M. L. Aitken, F. J. Accurso, R. A. Kronmal, M. W. Konstan, J. L. Burns, S. D.
Sagel, and B. W. Ramsey. 2007. 'Association between pulmonary function and sputum
biomarkers in cystic fibrosis', Am J Respir Crit Care Med, 175: 822-8.
36

McCaughey, G., D. Gilpin, J. Elborn, and M. M. Tunney. 2013. 'The future of antimicrobial therapy
in the era of antibiotic resistance in cystic fibrosis pulmonary infection', Expert Rev Respir Med,
7: 385-96.

Melo, M. N., R. Ferre, and M. A. Castanho. 2009. 'Antimicrobial peptides: linking partition, activity
and high membrane-bound concentrations', Nat Rev Microbiol, 7: 245-50.

Muhdi, K., F. P. Edenborough, L. Gumery, S. O'Hickey, E. G. Smith, D. L. Smith, and D. E.
Stableforth. 1996. 'Outcome for patients colonised with Burkholderia cepacia in a Birmingham
adult cystic fibrosis clinic and the end of an epidemic', Thorax, 51: 374-7.

Ng, H. P., Y. Zhou, K. Song, C. A. Hodges, M. L. Drumm, and G. Wang. 2014. 'Neutrophil-
mediated phagocytic host defense defect in myeloid Cftr-inactivated mice', PLoS One, 9:
e106813.

Nichols, D. P., and J. F. Chmiel. 2015. 'Inflammation and its genesis in cystic fibrosis', Pediatr
Pulmonol, 50 Suppl 40: S39-56.

Osika, E., J. M. Cavaillon, K. Chadelat, M. Boule, C. Fitting, G. Tournier, and A. Clement. 1999.
'Distinct sputum cytokine profiles in cystic fibrosis and other chronic inflammatory airway disease',
Eur Respir J, 14: 339-46.

Ouellette, A. J. 2006. 'Paneth cell alpha-defensin synthesis and function', Curr Top Microbiol
Immunol, 306: 1-25.

37
Pezzulo, A. A., X. X. Tang, M. J. Hoegger, M. H. Abou Alaiwa, S. Ramachandran, T. O. Moninger,
P. H. Karp, C. L. Wohlford-Lenane, H. P. Haagsman, M. van Eijk, B. Banfi, A. R. Horswill, D. A.
Stoltz, P. B. McCray, Jr., M. J. Welsh, and J. Zabner. 2012. 'Reduced airway surface pH impairs
bacterial killing in the porcine cystic fibrosis lung', Nature, 487: 109-13.

Qiao, Y., P. Wang, J. Qi, L. Zhang, and C. Gao. 2012. 'TLR-induced NF-kappaB activation
regulates NLRP3 expression in murine macrophages', FEBS Lett, 586: 1022-6.

Quinones-Mateu, M. E., M. M. Lederman, Z. Feng, B. Chakraborty, J. Weber, H. R. Rangel, M.
L. Marotta, M. Mirza, B. Jiang, P. Kiser, K. Medvik, S. F. Sieg, and A. Weinberg. 2003. 'Human
epithelial beta-defensins 2 and 3 inhibit HIV-1 replication', Aids, 17: F39-48.

Quinton, P. M. 2007. 'Cystic fibrosis: lessons from the sweat gland', Physiology (Bethesda), 22:
212-25.

Quinton, P. M. 2008. 'Cystic fibrosis: impaired bicarbonate secretion and mucoviscidosis', Lancet,
372: 415-7.

Rafeeq, M. M., and H. A. S. Murad. 2017. 'Cystic fibrosis: current therapeutic targets and future
approaches', J Transl Med, 15: 84.

Reddy, M. M., and M. J. Stutts. 2013. 'Status of fluid and electrolyte absorption in cystic fibrosis',
Cold Spring Harb Perspect Med, 3: a009555.

38
Rogan, M. P., C. C. Taggart, C. M. Greene, P. G. Murphy, S. J. O'Neill, and N. G. McElvaney.
2004. 'Loss of microbicidal activity and increased formation of biofilm due to decreased lactoferrin
activity in patients with cystic fibrosis', J Infect Dis, 190: 1245-53.

Rommens, J. M., M. C. Iannuzzi, B. Kerem, M. L. Drumm, G. Melmer, M. Dean, R. Rozmahel, J.
L. Cole, D. Kennedy, N. Hidaka, and et al. 1989. 'Identification of the cystic fibrosis gene:
chromosome walking and jumping', Science, 245: 1059-65.

Rubenstein, R. C., S. R. Lockwood, E. Lide, R. Bauer, L. Suaud, and Y. Grumbach. 2011.
'Regulation of endogenous ENaC functional expression by CFTR and DeltaF508-CFTR in airway
epithelial cells', Am J Physiol Lung Cell Mol Physiol, 300: L88-l101.

Rymut, S. M., T. Ivy, D. A. Corey, C. U. Cotton, J. D. Burgess, and T. J. Kelley. 2015. 'Role of
Exchange Protein Activated by cAMP 1 in Regulating Rates of Microtubule Formation in Cystic
Fibrosis Epithelial Cells', Am J Respir Cell Mol Biol, 53: 853-62.

Schaal, J. B., T. Maretzky, D. Q. Tran, P. A. Tran, P. Tongaonkar, C. P. Blobel, A. J. Ouellette,
and M. E. Selsted. 2018. 'Macrocyclic theta-defensins suppress tumor necrosis factor-alpha
(TNF-alpha) shedding by inhibition of TNF-alpha-converting enzyme', J Biol Chem, 293: 2725-34.

Schaal, J. B., D. Q. Tran, A. Subramanian, R. Patel, T. Laragione, K. D. Roberts, K. Trinh, P.
Tongaonkar, P. A. Tran, D. Minond, G. B. Fields, P. Beringer, A. J. Ouellette, P. S. Gulko, and M.
E. Selsted. 2017. 'Suppression and resolution of autoimmune arthritis by rhesus theta-defensin-
1, an immunomodulatory macrocyclic peptide', PLoS One, 12: e0187868.

39
Schaal, J. B., D. Tran, P. Tran, G. Osapay, K. Trinh, K. D. Roberts, K. M. Brasky, P. Tongaonkar,
A. J. Ouellette, and M. E. Selsted. 2012. 'Rhesus macaque theta defensins suppress inflammatory
cytokines and enhance survival in mouse models of bacteremic sepsis', PLoS One, 7: e51337.

Seidel, A., Y. Ye, L. R. de Armas, M. Soto, W. Yarosh, R. A. Marcsisin, D. Tran, M. E. Selsted,
and D. Camerini. 2010. 'Cyclic and acyclic defensins inhibit human immunodeficiency virus type-
1 replication by different mechanisms', PLoS One, 5: e9737.

Selsted, M. E., and A. J. Ouellette. 2005. 'Mammalian defensins in the antimicrobial immune
response', Nat Immunol, 6: 551-7.

Shah, V. S., D. K. Meyerholz, X. X. Tang, L. Reznikov, M. Abou Alaiwa, S. E. Ernst, P. H. Karp,
C. L. Wohlford-Lenane, K. P. Heilmann, M. R. Leidinger, P. D. Allen, J. Zabner, P. B. McCray, Jr.,
L. S. Ostedgaard, D. A. Stoltz, C. O. Randak, and M. J. Welsh. 2016. 'Airway acidification initiates
host defense abnormalities in cystic fibrosis mice', Science, 351: 503-7.

Simonin-Le Jeune, K., A. Le Jeune, S. Jouneau, C. Belleguic, P. F. Roux, M. Jaguin, M. T.
Dimanche-Boitre, V. Lecureur, C. Leclercq, B. Desrues, G. Brinchault, J. P. Gangneux, and C.
Martin-Chouly. 2013. 'Impaired functions of macrophage from cystic fibrosis patients: CD11b,
TLR-5 decrease and sCD14, inflammatory cytokines increase', PLoS One, 8: e75667.

Small, D. M., R. R. Brown, D. F. Doherty, A. Abladey, Z. Zhou-Suckow, R. J. Delaney, L. Kerrigan,
C. M. Dougan, K. S. Borensztajn, L. Holsinger, R. Booth, C. J. Scott, G. Lopez-Campos, J. S.
Elborn, M. A. Mall, S. Weldon, and C. C. Taggart. 2019. 'Targeting of Cathepsin S Reduces Cystic
Fibrosis-like Lung Disease', Eur Respir J.

40
Sosnay, P. R., K. R. Siklosi, F. Van Goor, K. Kaniecki, H. Yu, N. Sharma, A. S. Ramalho, M. D.
Amaral, R. Dorfman, J. Zielenski, D. L. Masica, R. Karchin, L. Millen, P. J. Thomas, G. P. Patrinos,
M. Corey, M. H. Lewis, J. M. Rommens, C. Castellani, C. M. Penland, and G. R. Cutting. 2013.
'Defining the disease liability of variants in the cystic fibrosis transmembrane conductance
regulator gene', Nat Genet, 45: 1160-7.

Sriramulu, D. D., H. Lunsdorf, J. S. Lam, and U. Romling. 2005. 'Microcolony formation: a novel
biofilm model of Pseudomonas aeruginosa for the cystic fibrosis lung', J Med Microbiol, 54: 667-
76.

Stefani, S., S. Campana, L. Cariani, V. Carnovale, C. Colombo, M. M. Lleo, V. D. Iula, L. Minicucci,
P. Morelli, G. Pizzamiglio, and G. Taccetti. 2017. 'Relevance of multidrug-resistant Pseudomonas
aeruginosa infections in cystic fibrosis', Int J Med Microbiol, 307: 353-62.

Sturges, N. C., M. E. Wikstrom, K. R. Winfield, S. E. Gard, S. Brennan, P. D. Sly, and J. W.
Upham. 2010. 'Monocytes from children with clinically stable cystic fibrosis show enhanced
expression of Toll-like receptor 4', Pediatr Pulmonol, 45: 883-9.

Stutts, M. J., C. M. Canessa, J. C. Olsen, M. Hamrick, J. A. Cohn, B. C. Rossier, and R. C.
Boucher. 1995. 'CFTR as a cAMP-dependent regulator of sodium channels', Science, 269: 847-
50.

Sun, S. C. 2011. 'Non-canonical NF-kappaB signaling pathway', Cell Res, 21: 71-85.
Sutterwala, F. S., S. Haasken, and S. L. Cassel. 2014. 'Mechanism of NLRP3 inflammasome
activation', Ann N Y Acad Sci, 1319: 82-95.

41
Tai, K. P., K. Kamdar, J. Yamaki, V. V. Le, D. Tran, P. Tran, M. E. Selsted, A. J. Ouellette, and A.
Wong-Beringer. 2015. 'Microbicidal effects of alpha- and theta-defensins against antibiotic-
resistant Staphylococcus aureus and Pseudomonas aeruginosa', Innate Immun, 21: 17-29.

Takeuchi, O., and S. Akira. 2010. 'Pattern recognition receptors and inflammation', Cell, 140: 805-
20.

Tang, A., A. Sharma, R. Jen, A. F. Hirschfeld, M. A. Chilvers, P. M. Lavoie, and S. E. Turvey.
2012. 'Inflammasome-mediated IL-1beta production in humans with cystic fibrosis', PLoS One, 7:
e37689.

Tarique, A. A., P. D. Sly, P. G. Holt, A. Bosco, R. S. Ware, J. Logan, S. C. Bell, C. E. Wainwright,
and E. Fantino. 2017. 'CFTR-dependent defect in alternatively-activated macrophages in cystic
fibrosis', J Cyst Fibros, 16: 475-82.

Teichgraber, V., M. Ulrich, N. Endlich, J. Riethmuller, B. Wilker, C. C. De Oliveira-Munding, A. M.
van Heeckeren, M. L. Barr, G. von Kurthy, K. W. Schmid, M. Weller, B. Tummler, F. Lang, H.
Grassme, G. Doring, and E. Gulbins. 2008. 'Ceramide accumulation mediates inflammation, cell
death and infection susceptibility in cystic fibrosis', Nat Med, 14: 382-91.

Tirouvanziam, R., C. K. Conrad, T. Bottiglieri, L. A. Herzenberg, R. B. Moss, and L. A. Herzenberg.
2006. 'High-dose oral N-acetylcysteine, a glutathione prodrug, modulates inflammation in cystic
fibrosis', Proc Natl Acad Sci U S A, 103: 4628-33.

Tongaonkar, P., K. K. Trinh, J. B. Schaal, D. Tran, P. S. Gulko, A. J. Ouellette, and M. E. Selsted.
2015. 'Rhesus macaque theta-defensin RTD-1 inhibits proinflammatory cytokine secretion and
42
gene expression by inhibiting the activation of NF-kappaB and MAPK pathways', J Leukoc Biol,
98: 1061-70.

Valore, E. V., and T. Ganz. 1992. 'Posttranslational processing of defensins in immature human
myeloid cells', Blood, 79: 1538-44.

Vandivier, R. W., V. A. Fadok, P. R. Hoffmann, D. L. Bratton, C. Penvari, K. K. Brown, J. D. Brain,
F. J. Accurso, and P. M. Henson. 2002. 'Elastase-mediated phosphatidylserine receptor cleavage
impairs apoptotic cell clearance in cystic fibrosis and bronchiectasis', J Clin Invest, 109: 661-70.

Veliz Rodriguez, T., F. Moalli, N. Polentarutti, M. Paroni, E. Bonavita, A. Anselmo, M. Nebuloni,
S. Mantero, S. Jaillon, A. Bragonzi, A. Mantovani, F. Riva, and C. Garlanda. 2012. 'Role of Toll
interleukin-1 receptor (IL-1R) 8, a negative regulator of IL-1R/Toll-like receptor signaling, in
resistance to acute Pseudomonas aeruginosa lung infection', Infect Immun, 80: 100-9.

Vissers, M. C., P. M. George, I. C. Bathurst, S. O. Brennan, and C. C. Winterbourn. 1988.
'Cleavage and inactivation of alpha 1-antitrypsin by metalloproteinases released from neutrophils',
J Clin Invest, 82: 706-11.

Voynow, J. A., B. M. Fischer, and S. Zheng. 2008. 'Proteases and cystic fibrosis', Int J Biochem
Cell Biol, 40: 1238-45.

Wang, G., X. Li, and Z. Wang. 2016. 'APD3: the antimicrobial peptide database as a tool for
research and education', Nucleic Acids Res, 44: D1087-93.

43
Weldon, S., P. McNally, N. G. McElvaney, J. S. Elborn, D. F. McAuley, J. Wartelle, A. Belaaouaj,
R. L. Levine, and C. C. Taggart. 2009. 'Decreased levels of secretory leucoprotease inhibitor in
the Pseudomonas-infected cystic fibrosis lung are due to neutrophil elastase degradation', J
Immunol, 183: 8148-56.

Wilmes, M., M. Stockem, G. Bierbaum, M. Schlag, F. Gotz, D. Q. Tran, J. B. Schaal, A. J.
Ouellette, M. E. Selsted, and H. G. Sahl. 2014. 'Killing of staphylococci by theta-defensins
involves membrane impairment and activation of autolytic enzymes', Antibiotics (Basel), 3: 617-
31.

Wilmott, R. W., M. Frenzke, V. Kociela, and L. Peng. 1994. 'Plasma interleukin-1 alpha and beta,
tumor necrosis factor-alpha, and lipopolysaccharide concentrations during pulmonary
exacerbations of cystic fibrosis', Pediatr Pulmonol, 18: 21-7.

Wilmott, R. W., J. T. Kassab, P. L. Kilian, W. R. Benjamin, S. D. Douglas, and R. E. Wood. 1990.
'Increased levels of interleukin-1 in bronchoalveolar washings from children with bacterial
pulmonary infections', Am Rev Respir Dis, 142: 365-8.

Wilson, S. S., M. E. Wiens, and J. G. Smith. 2013. 'Antiviral mechanisms of human defensins', J
Mol Biol, 425: 4965-80.

Wu, Z., A. Prahl, R. Powell, B. Ericksen, J. Lubkowski, and W. Lu. 2003. 'From pro defensins to
defensins: synthesis and characterization of human neutrophil pro alpha-defensin-1 and its
mature domain', J Pept Res, 62: 53-62.

44
Zhang, P. X., J. Cheng, S. Zou, A. D. D'Souza, J. L. Koff, J. Lu, P. J. Lee, D. S. Krause, M. E.
Egan, and E. M. Bruscia. 2015. 'Pharmacological modulation of the AKT/microRNA-199a-
5p/CAV1 pathway ameliorates cystic fibrosis lung hyper-inflammation', Nat Commun, 6: 6221.

Zhang, P. X., T. S. Murray, V. R. Villella, E. Ferrari, S. Esposito, A. D'Souza, V. Raia, L. Maiuri,
D. S. Krause, M. E. Egan, and E. M. Bruscia. 2013. 'Reduced caveolin-1 promotes
hyperinflammation due to abnormal heme oxygenase-1 localization in lipopolysaccharide-
challenged macrophages with dysfunctional cystic fibrosis transmembrane conductance
regulator', J Immunol, 190: 5196-206.

Zhang, Y., X. Li, H. Grassme, G. Doring, and E. Gulbins. 2010. 'Alterations in ceramide
concentration and pH determine the release of reactive oxygen species by Cftr-deficient
macrophages on infection', J Immunol, 184: 5104-11.

45
CHAPTER 2: Rhesus Theta (θ)-Defensin-1 Attenuates Endotoxin-Induced Acute Lung
Injury by Inhibiting Proinflammatory Cytokines and Neutrophil Recruitment

Jordanna G. Jayne
1#
,

Timothy J. Bensman
1#
, Justin B. Schaal
2
, A young J. Park
1
, Elza Kimura
3
,
Dat Tran
2
, Michael E. Selsted
2*
, Paul M. Beringer
1*

1
University of Southern California, School of Pharmacy, 1985 Zonal Avenue, Los Angeles, CA
90033
2
University of Southern California, Keck

School of Medicine, 2011 Zonal Avenue, Los Angeles,
CA 90033.
3
State University of Maringá, Maringá, Paraná, Brazil
Short Title: Anti-inflammatory effect of RTD-1 in ALI

** Please note, this chapter is taken from the aforementioned publication.

46
Abstract
Acute lung injury (ALI) is a clinical syndrome characterized by acute respiratory failure and is
associated with substantial morbidity and mortality. Rhesus theta defensin-1 (RTD-1) is an
antimicrobial peptide with immunomodulatory activity. As airway inflammation and neutrophil
recruitment and activation are hallmarks of ALI, we evaluated the therapeutic efficacy of RTD-1
in pre-clinical models of the disease. We investigated the effect of RTD-1 on neutrophil
chemotaxis and macrophage-driven pulmonary inflammation with isolated human blood
neutrophils and LPS-stimulated murine alveolar macrophage (MH-S) cells. Treatment and
prophylactic single escalating doses were administered subcutaneously in a well-established
murine model of direct endotoxin induced ALI. We assessed lung injury by histopathology,
pulmonary edema, inflammatory cell recruitment, and inflammatory cytokines/chemokines in the
bronchoalveolar lavage fluid. In vitro studies demonstrated that RTD-1 suppressed CXCL8
induced chemotaxis of isolated human blood neutrophils, TNF mediated neutrophil-endothelial
cell adhesion and pro-inflammatory cytokine release in activated murine alveolar macrophages
(MH-S cells). Treatment with RTD-1 significantly inhibited in vivo LPS-induced ALI by reducing
pulmonary edema and histopathological changes. Treatment was associated with dose- and time-
dependent inhibition of proinflammatory cytokines (TNF, IL-1b, and IL-6), peroxidase activity, and
neutrophil recruitment into the airways. Anti-inflammatory effects were demonstrated in animals
receiving the peptide up to 12 hours after LPS challenge. Notably, subcutaneously administered
RTD-1 demonstrates good peptide stability as demonstrated by the long in vivo half-life. Taken
together, these studies demonstrate that RTD-1 is efficacious in an experimental model of ALI
through inhibition of neutrophil chemotaxis and adhesion, and the attenuation of proinflammatory
cytokines and gene expression from resident alveolar macrophages.

47
Introduction
Acute lung injury (ALI) is a clinical syndrome characterized by lung edema, impaired gas
exchange, and respiratory failure (Matthay and Zimmerman 2005). The principal cause of ALI is
the excessive and prolonged activation of neutrophils in response to infection or aspiration, which
cause damage to the pulmonary parenchyma and microvasculature (Johnson and Matthay 2010).
Proinflammatory cytokines are associated with the severity of ALI, underscoring the importance
of inflammation as a therapeutic target (Park et al. 2001). Despite improvements in the
understanding of the pathophysiology of ALI, outcomes remain poor with significant morbidity and
mortality at 40% (Johnson and Matthay 2010). Some have proposed a paradigm shift toward
prevention or early treatment of ALI with the goal of improving outcomes (Levitt and Matthay
2012).

Defensins are cationic antimicrobial peptides that promote key innate and adaptive immune
responses within the lungs. In humans, a-defensins are primarily expressed in neutrophils while
the b- defensins are expressed in many tissues including the epithelial cells lining the respiratory
tract. While first studied for their broad-spectrum activity against bacteria, fungi, and viruses;
defensins also contribute to recruitment of inflammatory cells and activation of adaptive immune
responses (Oppenheim et al. 2003). While a- and b- defensins are critical to mounting an effective
immune response to a pathogen, a-defensins have been shown to contribute to the pathogenesis
of ALI by disrupting the capillary-epithelial barrier (Bdeir et al. 2010).

Theta (θ) defensins are macrocyclic antimicrobial peptides found in leukocytes of Old World
Monkeys, but lost to man through the evolutionary acquisition of a premature stop codon that
aborts translation (Selsted 2004; Lehrer, Cole, and Selsted 2012). They are 18 amino acids long
and are formed by the dimeric head-to-tail ligation of two precursors and further stabilized with
48
three disulfide bonds. Similar to the human α-defensins, Rhesus Theta Defensin 1 (RTD-1)
exhibits broad spectrum microbicidal activity against viruses, bacteria, and fungi (Beringer et al.
2015; Tran et al. 2008; Tran et al. 2002; Tai et al. 2015). In contrast to the a-defensins which are
pro-inflammatory, theta defensins have been shown to exhibit anti-inflammatory activity in vitro
(Schaal et al. 2012; Tongaonkar et al. 2015). Data shows RTD-1 diminishes cytokine production
in leukocytes stimulated with a number of TLR agonists including; heat-killed L. monocytogenes
(TLR2), flagellin (TLR5), LPS (TLR4) and live E. coli (13). In murine models of polymicrobial
sepsis and severe acute respiratory syndrome (SARS), RTD-1 treatment significantly reduced
inflammatory cytokines (Schaal et al. 2012; Wohlford-Lenane et al. 2009). Importantly, early pre-
clinical investigations in mice, rats, and chimpanzee suggest RTD-1 to be safe and non-
immunogenic (Schaal et al. 2012).

The antimicrobial and anti-inflammatory properties of RTD-1 may provide a unique approach to
treating both infection and inflammation associated with ALI. In this study, we sought to
investigate whether the immunomodulatory potential of RTD-1 mitigates ALI cellular airway influx
and leukocyte-induced lung injury (Proudfoot et al. 2011). To determine the effect of RTD-1 on
ALI, mice received RTD-1 30 minutes before initiation of pulmonary inflammation, at the time of
insult and 12 hours after initiation of inflammation using the well-established murine model of
intranasal LPS-induced acute lung neutrophilia (Matute-Bello, Downey, Moore, Groshong,
Matthay, Slutsky, Kuebler, et al. 2011; Proudfoot et al. 2011). We evaluated RTD-1 intervention
by quantifying airway neutrophil burden and activation, cytokine release, gene expression,
pulmonary vascular leakage, and extent of lung injury. Additionally, in vitro assays investigating
neutrophil chemotaxis and adhesion, as well as LPS-induced alveolar macrophage, and human
lung epithelial inflammation provide supportive details on RTD-1 responsive cell populations. We
provide evidence that RTD-1 reduces LPS-induced lung injury by inhibiting neutrophil recruitment
and alveolar macrophage pro-inflammatory cytokine production.
49
Materials and Methods
Human and murine cell cultures
Peripheral blood neutrophils were isolated by density gradient centrifugation using One-Step
Polymorph as previously described for use in experiments determining RTD-1 effect on
chemotaxis (Accurate Chemical and Scientific Corp, Westbury, NY) (Ha et al. 2014). Healthy
volunteer peripheral blood neutrophils were isolated using EasySep™ Human Neutrophil
Enrichment Kit for use in experiments assessing cell adhesion (STEMCELL Technologies,
Vancouver, Canada). Neutrophil purity and viability was > 95%, as assessed by Quick-Diff
staining and trypan blue dye exclusion, respectively. The murine (BALB/c) alveolar macrophage
cells (MH-S) and human alveolar epithelial cells (A549) were purchased from the American Type
Culture Collection (Manassas, VA, USA). MH-S cells were maintained in RPMI 1640 (Sigma-
Aldrich, St. Louis, MO) containing 10% FBS (Sigma-Aldrich), 1% Penicillin-Streptomycin
(Amresco, Dallas, TX), and 0.05 mM 2-Mercaptoethanol (Amresco). A549 cells were maintained
in DMEM-F12 (Sigma-Aldrich, St. Louis, MO) containing 10% FBS (Sigma-Aldrich), 1% Penicillin-
Streptomycin (Amresco, Dallas, TX). Human Lung Microvascular Endothelial Cells (HMVEC-L)
(Lonza, Walkersville, MD) were maintained in EGM™-2MV BulletKit™ (Lonza, Walkersville, MD)
according to Lonza guidelines. Cell lines were confirmed to be mycoplasma negative using
MycoAlert (Lonza, Walkersville, MD). MH-S and A549 experiment used cells with 14-18
passages, HMVEC-L cells ranged from 4-8 passages.

In vitro chemotaxis
Neutrophil migration was assessed using human peripheral blood neutrophils (4 × 10
5
in 200 µL
RPMI) in a 3 μm pore size Thincert transwell system (Greiner-Bio-one, Monroe, NC) under a
CXCL8 chemotactic gradient. Neutrophils pre-incubated in triplicate with or without RTD-1 at a
range of concentrations for 15 to 20 min. Inserts were then placed in media containing 400 μL of
50
RPMI, 0.2% BSA, and 15 ng mL
-1
CXCL8 in a 24 well plate and allowed to migrate for 2 h at 37
°C and 5% CO2. To detach adherent migrated cells, the Thincerts were placed in a fresh 24 well
plate containing 0.5% Trypsin and 0.025% EDTA at 37 °C for 5 minutes. The plate was gently
tapped and the loose cells combined with the migrated cells in the original plate. Migrated cells
were quantified by manual counting. The percentage of maximal chemotaxis was calculated by
setting the number of migrated cells in the presence of chemoattractant alone to 100% after
subtracting the number of cells undergoing random migration (chemokinesis) as previously
described (Ha et al. 2014). The response of treated cells under chemoattractant was normalized
to the positive control.

In vitro adhesion
The adhesion assay was performed as previously described (Wilhelmsen, Farrar, and Hellman
2013). Briefly, confluent Human microvascular endothelial lung cells (HMVEC-L) were stimulated
with 100 ng mL
-1
TNF for 3 hours in a 24 well plate. Calcein-AM (Life Technologies, Carlsbad,
California) (3µM) labelled neutrophils were pre-treated with RTD-1 for 15 minutes. A specific cell
adhesion inhibitor (100µM) was used as a comparator (Sigma, SCP0111-1MG). Subsequently,
HMVEC-L cells were washed and labelled neutrophils added. Neutrophils, (6x10
5
cells suspended
in 300µl per well), could adhere for 20 minutes before washing and fluorescence read at 485nm
excitation and 520nm emission. Fluorescent and light microscopy images were take using a Zeiss
AxioObserver.A1 Wide-field inverted microscope, images were prepared using Zeiss Zen 2 Blue
(2011) Edition Software. Experiments were performed in triplicate.

In vitro airway leukocyte inflammation
Alveolar macrophage inflammation was assessed using MH-S cells (1.25× 10
5
in 250 µL) in a 48
well plate. The cells were incubated at 37 °C and 5% CO2 for 24 hours, followed by a media
51
change and the addition of 100 µg mL
-1
RTD-1 and 100 ng mL
-1
LPS. After 24 hours of incubation,
the supernatant was collected for cytokine analysis. Based on prior published data demonstrating
RTD-1 reduces TNF protein expression in THP-1 cells, we performed a dose response
experiment (Schaal et al. 2012). MHS cells were prepared as described above, but with
increasing concentrations of RTD-1 in a 96 well plate experiment.

Animals and husbandry
All animal experiments were reviewed and approved by the Institutional Animal Care and Use
Committee at the University of Southern California (Protocols 11676 and 11956). Male, 8-10 week
old BALB/c mice (Charles River Laboratories, CA) weighing 20-25 g, were housed under specific
pathogen-free conditions with a temperature of 22-24 °C and humidity of 60-65%, with 12 h
light/dark cycles. The animals were provided standard laboratory chow and water ad libitum.

Experimental procedures
Bacterial LPS instilled intranasally induces acute neutrophilic airway inflammation and lung injury
in mice. The route, time, BALB/c mouse strain, Pseudomonas aeruginosa bacterial endotoxin
type and 1 µg endotoxin amount was based on literature modeling the acute lung injury condition
(Matute-Bello, Downey, Moore, Groshong, Matthay, Slutsky, and Kuebler 2011; Proudfoot et al.
2011) and therapeutic investigations (Balloy et al. 2014; Szarka et al. 1997; Wieland et al. 2002).
Mice were sedated with a single intraperitoneal injection of 100 µL of ketamine 80 mg·kg
−1

(Hospira, Lake Forest, IL, USA) and xylazine 10 mg·kg
−1
(Lloyd, Shenandoah, IA, USA). Acute
lung inflammation was induced by intranasal administration of 1 µg of LPS in 50 μL of PBS. In the
dose ranging study, mice were randomly assigned to subcutaneous RTD-1 at 0, 0.2, 1, 5, or 25
mg kg
-1
body weight 0.5 h before LPS challenge (n=6/ group). 24 h after LPS administration, mice
were euthanized.
52

In an intervention study RTD-1 was administered post induction of inflammation subcutaneously
at 25 mg kg
-1
at the time of LPS insufflation (T0) and in a separate group of mice 12 hours post
LPS insufflation (T12). Dexamethasone was administered subcutaneously at 2 mg kg
-1
at T0. 48
h after LPS administration mice were euthanized (n=9/group). Separately, 3h after LPS
administration another group of mice were euthanized for gene expression (n=6/group).

In an exploratory time course study, RTD-1 was administered at 5 and 25 mg kg
-1
0.5 h before
LPS challenge. Mice (n=3/ group) were euthanized after 0.5, 1, 3, 7, 24, 48, and 72 h.

Pharmacokinetic studies in mice
Plasma concentrations of RTD-1 at 0.25, 0.5, 1, 7, 24, 48, and 72 h were measured by an LC/MS
assay in LPS challenged mice receiving a single dose of 5 or 25 mg kg
-1
RTD-1 subcutaneously.
Data were expressed as ng mL
-1
and plasma concentration-time profiles were subjected to a non-
compartmental analysis (NCA) with parallel sampling. The area under the curve (AUC) was
calculated with the linear trapezoidal rule.

LC/MS analysis of RTD-1
Approximately 400 µL of blood or 2.6 mL Bronchoalveolar lavage fluid (BALF) was collected at
0.25, 0.5, 1, 7, 24, 48, and 72 h after RTD- 1 administration. Blood was collected by cardiac
puncture into EDTA-tubes and plasma and BALF prepared by a two-step centrifugation (200 x g
for 10 min followed by 23,000 x g for 15 min). Samples were transferred to siliconized tubes and
stored at -80 °C. Concentrations of RTD-1 were determined after solid phase extraction (SPE)
and quantitation by C18 RP-HPLC, photodiode array (PDA) detection, with tandem electrospray-
ionization mass spectroscopy (ESI-MS). BALF quantification used exact methods previously
53
described (Beringer et al. 2015). The plasma quantification method was as follows:100 μL of
plasma was diluted 1:10 with 4% H3PO4, 10% ACN containing 50 ng of RTD-2 as internal
standard. This was loaded on a 3cc Oasis WCX cartridge (Waters, Milford, MA, USA) equilibrated
in water. Two mL each of 5% NH4OH, 20% ACN, 1% TFA, and 10% ACN + 1% TFA washed the
cartridge. Elution was performed with 2 mL 1% TFA + 40% ACN. Eluents were lyophilized,
suspended in 100 μL of 10% HOAc, 5% ACN, and chromatographed at 0.3 mL/min on a Waters
C18 X-Bridge BEH C18 2.5 μm 2.1 x 150mm XP column fitted with a VanGuard Pre-Column BEC
C18 (1.7 µm; Waters) using a linear 5 to 55% water-acetonitrile gradient containing 0.1% formic
acid. Chromatography was performed on an Acquity H-class UPLC with an analytical PDA
detector using Empower 3 software (Waters, Milford, MA, USA). Quantitative mass spectrometry
was performed on post PDA eluent using a Micromass Quattro Ultima mass spectrometer with
Mass Lynx 4.1 (Waters, Milford, MA, USA). The assay proved to be linear and acceptable with an
r >0.98 for the two standard curves. Accuracy and precision were 99.3% and 0.23% for a middle
quality control sample, respectively.

Total and differential cell counts and evaluation of lung edema
BALF was collected by flushing the lungs three times (1, 0.8 and 0.8 mL) with PBS (w/o Ca
+2
and
Mg
+2
) and cOmplete protease inhibitor cocktail (Roche, IN) as suggested by the manufacturer.
Mean recovery of BALF via syringe aspiration was 86%. Collected BALF samples were kept on
ice until clarified by centrifugation at 360 ×g for 10 min at 4 °C; supernatant was stored at -80 °C.
Airway total cell counts were determined for each BALF sample using Turk blood diluting fluid
and a haemocytometer. Approximately 5 x 10
5

cells were added to a slide chamber, spun in a
cytocentrifuge (Shandon, Thermo Scientific, Waltham, MA), and stained using the Diff Quick Stain
kit per commercial protocol (Polysciences, Warrington, PA). Differential cell counts were
conducted on 200 cells per slide. Lung edema was assessed by measurement of total protein
54
concentration in supernatants of BALF using the Bradford assay (Bio-Rad, Hercules, CA)(Matute-
Bello, Downey, Moore, Groshong, Matthay, Slutsky, Kuebler, et al. 2011).

BALF and cell culture cytokines
Multiple analyte levels were determined using Milliplex MAP multiplex kits (EMD Millipore,
Billerica, MA) with bead fluorescence readings analyzed on a Bioplex 200 with HTF (BioRad,
Hercules, CA). Frozen samples were thawed on ice and processed per the overnight protocol
according to the manufacturer’s instructions. All plates met reasonable precision (CV ≤ 20%) and
samples below the lower detection limit were extrapolated in order to avoid statistical analysis of
zero values. No values were found above the upper limit of detection.

RT-PCR and expression analysis
Lung tissue was homogenized in RLT buffer (Qiagen, Düsseldorf, Germany) plus 143mM 2-
Mercaptoethanol (Amresco). Total RNA was isolated using Qiagen RNA Mini Kits
™
(Qiagen), as
per manufacturer instructions. cDNA was transcribed using iScript™ Reverse Transcription
Supermix for RT-qPCR (Bio-Rad Laboratories, Hercules, CA). Real Time quantitative PCRs were
performed using SsoAdvanced™ Universal SYBR® Green Supermix (BioRad) following the
manufacturer’s specifications. Primers used are listed below (Sigma-Aldrich, St. Louis, MO).
These data are representative of three mice per group each plated in technical triplicates. RT-
PCR analysis was performed with a Bio-Rad CFX96. Copy number were normalized to the
housekeeping gene, HPRT, by ΔΔCt method and expression calculated by relative fold change.
Gene Forward Primer Reverse Primer
IL-6 AAGAAATGATGGATGCTACC GAGTTTCTGTATCTCTCTGAAG
MCP-1 CAAGATGATCCCAATGAGTAG TTGGTGACAAAAACTACAGC
IL-1β GGATGATGATGATAACCTGC CATGGAGAATATCACTTGTTGG
55
TNFa CTATGTCTCAGCCTCTTCTC CATTTGGGAACTTCTCATCC
MIP-2 GGGTTGACTTCAAGAACATC CCTTGCCTTTGTTCAGTATC
KC AAAGATGCTAAAAGGTGTCC GTATAGTGTTGTCAGAAGCC
HPRT CACAGGACTAGAACACCTGC GCTGGTGAAAAGGACCTCT

BALF MMP and peroxidase activities
BALF obtained from 24 h LPS alone, RTD-1 treated, or PBS untreated mice was assayed for total
MMP activity using a fluorogenic peptide substrate BML-P128 [Dnp-Pro-ß-cyclohexyl-Ala-Gly-
Cys(Me)-His-Ala-Lys(Nma)-NH2] (Enzo life sciences, Farmingdale, NY). A 100 μL reaction
mixture containing 50 μL BALF plus 10 μM substrate was read kinetically over 2 h. Enzymatic
reactivity was determined at 340 nm excitation and 440 nm emission on a Synergy H1 Hybrid
plate reader (Biotek, Winooski, VT). BALF peroxidase activity was measured as previously
described (Abdel-Latif et al. 2004). Briefly, 150 μL TMB substrate solution was added to 50 μL of
BALF and incubated at room temperature for 30 minutes prior to termination with 50 μL 1M H2SO4.
Plates were read spectrophotometrically at 450 nm (Tecan, CA, USA).

Lung histopathology
In a separate study mice were treated with LPS + Saline, LPS + 25 mg kg
-1
RTD-1, or PBS +
Saline for 24 h (n=3 per treatment group). Murine lungs were infused with 10% formalin buffered
solution (Thermo Fisher Scientific, Waltham, MA) and inflated at 25 cm as recommended by an
official ATS workshop report (Matute-Bello, Downey, Moore, Groshong, Matthay, Slutsky,
Kuebler, et al. 2011). Staining was conducted by the USC Pathology lab for hematoxylin-eosin
(H&E) on 5 μm slices. Photomicrographs were captured at 10X magnification using a Nikon
Microphot-FXA microscope and images captured using SPOT insight 4.0 MP CCD color digital
camera and software under 10X objective lens. Scientific software was used to construct figure
56
and scale bar (Aigouy and Mirouse 2013). Lung injury scores were evaluated by an investigator
who was blinded to the identity of the slides following a previously described lung injury scoring
system (Matute-Bello, Downey, Moore, Groshong, Matthay, Slutsky, Kuebler, et al. 2011; Matute-
Bello et al. 2001).

Data and statistical analysis
Preclinical animal investigations were designed as a pilot study to characterize the
pharmacokinetics and preliminary efficacy of RTD-1 in an experimental model of ALI. Treatment
groups were not blinded, nor sample size/power analysis performed. For statistical analyses, raw
data was used except in the case for the POD and migration assays which have been normalized
to untreated controls to minimize the variance. Statistical and graphical analysis were carried out
using STATA 13 (StataCorp, College Station, TX) and GraphPad Prism version 6.0 (GraphPad
Software, San Diego, CA). Residual errors of univariate data were inspected for near normal
shape distribution (skewness and kurtosis ±2, histogram) and central tendency (mean, median)
(Westfall P 2013). Non-normal data was subsequently log-transformed and evaluated as
described above. The parametric unpaired two-sample t-test or ANOVA with post-hoc analysis P-
values were calculated with the Bonferonni corrections between LPS treated and untreated
groups and reported as either mean ± SD or geometric mean ± 95% confidence interval. A
normalized response sigmoidal Emax model was applied to the chemotaxis data to estimate IC50
defined as the concentration associated with a 50% inhibition of the maximal chemotactic
response. A variable Hill slope model was selected based on the F-test criteria. Strength and
direction of association between total neutrophils and POD activity or MMP activity were
quantified by Pearson correlation. The time course of inflammatory markers modulated by RTD-
1 were evaluated by computing the area under the concentration-time curves (AUCs) from 0.5 to
48 h and their standard deviation using the sparse sampling method in Kinetica 5.1
(ThermoScientific, Waltham, MA) using the Bailer-Satterhwaite method to estimate the mean
57
AUC and its variance. Non-compartmental analysis of RTD-1 pharmacokinetics was computed
using the sparse AUC method in Kinetica 5.1.

Endotoxin, RTD-1, and general reagents.
Pseudomonas aeruginosa lipopolysaccharide was purchased from Sigma (Pa-LPS, MO, USA,
Serotype 10, ATCC strain 27316, Phenol extracted). The hydrochloride salt of RTD-1 (>98%) was
synthesized using Fmoc chemistry as described previously (Garcia et al. 2008; Tang et al. 1999;
Tran et al. 2002). A stock solution was prepared in sterile water and 0.22 μm filter-sterilized and
concentration/purity determined by LC-MS. Working solutions were further prepared in 0.9%
Sodium Chloride for injection, USP (Hospira, Lake Forest, IL) for administration to animals. Turks
blood diluting fluid for leukocyte counts was obtained from Ricca Chemical Co (Arlington, Tx).
PBS w/o Ca
+2
, Mg
+2
was purchased from Lonza (Walkersville, MD). Otherwise, unless specified,
materials were purchased from VWR (Radnor, PA).

Data and statistical analysis
Statistical and graphical analysis were carried out using STATA version 13 and GraphPad Prism
version 6.0. A significance level of p<0.05 was determined a priori.

58
Results
RTD-1 inhibits neutrophil migration and adhesion
Given the importance of airway neutrophilia in the pathogenesis of ALI we began by testing RTD-
1’s activity using in vitro methods. First, we investigated the effect of RTD-1 on cell migration
using human blood neutrophils in a transwell migration assay. RTD-1 treatment significantly
reduced CXCL8 stimulated chemotaxis when compared to control with > 50% inhibition at 5 µg
mL
-1
(Fig. 1a). Since one possible mechanism is modification of neutrophil adhesion, we then
investigated the effect of RTD-1 on neutrophils in an endothelial adhesion assay. Importantly,
RTD-1 reduced neutrophil adhesion to HMVEC-L by > 50% at 5 µg mL
-1
compared to untreated
cells (p<0.01) (Fig. 2-1b), Representative images can be found in figure 1c. The potent specific
Cell Adhesion Inhibitor Cyclic Peptide (Sigma) inhibited adhesion by >85% at 100µM (p<0.001).

Figure 2-1. Dose dependent effects of RTD-1 on neutrophil migration in vitro. To assess
RTD-1 effects, peripheral blood neutrophils were isolated and (A) 4 x 10
5
cells in RPMI were pre-
treated with RTD-1 or PBS for 15 min and placed in the apical chamber of their respective
59
transwells. Inserts were then placed in the presence of 15 ng mL
-1
CXCL8 to induce chemotaxis.
Cells in the basolateral chamber are expressed as percent normalized migrated cells. n=3 per
group; mean ± SD. Horizontal dashed line indicates 50% migration. Treatment compared to
control by one-way ANOVA. Neutrophil-endothelial cell adhesion was assessed by exposing
endothelial cells to 100ng ml
-1
TNF before incubation with drug treated neutrophil. Adhesion was
assessed by measuring fluorescence from the Calcein-AM-labelled neutrophils (B and C). n=3
per group (technical replicates) taken from two experiments; mean ± SD. Representative images
from a third experiment (C). Treatment compared to control by unpaired two samples t-test. (**)
p<0.01, (***) p<0.001.

RTD-1 dampens LPS-induced alveolar macrophage inflammation but has little effect on
epithelial cells in vitro
To determine the effect of RTD-1 on LPS-induced alveolar macrophage inflammation, we utilized
an in vitro model using MH-S cells and profiled the macrophage relevant cytokines MIP-2, KC,
MCP-1, IL-6, and TNF. Treatment with RTD-1 resulted in ~ 5-, 3-, 154-, and 4-fold reductions in
MIP-2 (p<0.0001), MCP-1 (p<0.01), TNF (p<0.001), and IL-6 (p<0.001) respectively when
compared with LPS stimulated MH-S cells alone (Fig. 2-2a-e). There was no difference in KC
levels between groups (p>0.05) (Fig. 2-2b). Given the attenuation of TNF at 100 µg mL
-1
RTD-1,
we performed a dose response experiment. These data were best described by a sigmoidal Emax
model with an IC50 of 4.5 µg mL
-1
(95% CI: 3.99 to 5.13; R
2
= 0.99) (Fig. 2-2f).

60

Figure 2-2. Dose dependent effects of RTD-1 in LPS-induced alveolar macrophage
inflammation in vitro. To assess RTD-1’s effects, cell culture supernatant from 24 h 100 ng mL
-
1
LPS induced MH-S alveolar macrophage cells (1.25 x 10
5
) in the presence or absence of 100
µg mL
-1
RTD- 1 were analyzed for soluble cytokines MIP-2 (A) KC (B) MCP-1 (C) IL-6 (D) and
TNF (E). n=3 per group; Mean ± SD. Treatment compared to control by unpaired two-sample t-
test (**) p<0.01, (***) p<0.001, (****) p<0.0001. In a separate investigation supernatant from 24 h
stimulated cells in the presence of 0, 0.1, 1, 10, 100 µg mL
-1
RTD-1 were analyzed for TNF dose-
response (F). n=5 per group; mean ± SD.

To evaluate the effect of RTD-1 on epithelial inflammation, we analyzed cytokine concentrations
from LPS stimulated A549 cells. Overall, basal and LPS-stimulated cytokine expression was
significantly reduced in the A549 (pg mL
-1
) when compared with the MH-S cells (ng/mL). RTD-1
did not significantly affect IL-8, MIP-2, IFN-γ, TNF, IL-12 or IL-1β expression (Table 2-1).
Unexpectedly, RTD-1 induced a doubling (1.07-fold increase) of IL-6 in LPS stimulated A549
cells. No cytotoxicity was observed by alamar blue method (data not shown) which is in agreement
61
with published in vitro data demonstrating limited observed erythrocyte hemolysis or fibroblast
cytotoxicity under similar conditions (i.e. 10% serum and 100 µg mL
-1
RTD-1 (Tran et al. 2008).

Analyte No Treatment RTD-1 Alone
*
LPS
#
LPS
#
+ RTD-1
*

IL-8 185.2 (5.19) 147.5 (14.64) 342.3 (28.24) 377.9 (27.24)
MIP-2 2566 (311.5) 2007 (278.5) 3052 (227.2) 4030 (898.7)
IFN-γ 0.22 (0.05) 0.29 (0.03) 0.32 (0.07) 0.28 (0.05)
TNF 0.13 (0.02) 0.21 (0.08) 0.52 (0.14) 0.29 (0.11)
IL-12 0.07 (0.03) 0.11 (0.04) 0.17 (0.06) 0.14 (0.06)
IL-1β 0.14 (0.00) 0.20 (0.10) 0.14 (0.14) 0.14 (0.04)
IL-6 0.11 (0.00) 0.35 (0.13) 0.81 (0.20) 1.68 (0.09) **
Table 2-1: A549 cytokine 24 h post treatment and LPS challenge
#
100 ng/mL LPS,
*
100 µg/mL

RTD-1,
a
n=3 per treatment group,
b
Values in pg/mL Mean ± SD,
c
Samples less than detectable were set to minimal detectable value of assay otherwise
extrapolated values were used for analysis,
d
Unpaired Two-sample T-test. (**) p<0.01.

RTD-1 pharmacokinetics in plasma
The mean plasma concentration versus time plot following single subcutaneous RTD-1 doses at
5 or 25 mg kg
-1
in diseased mice are depicted in Figure 3a. The observed mean maximum RTD-
1 concentrations of 342.5 and 1169.9 ng mL
-1
were achieved at 1 h indicating rapid absorption.
The disposition of RTD-1 appears to be biphasic with a short distribution phase followed by a
prolonged elimination phase with an apparent terminal half-life of around 30 hours. A less than
proportional increases in the Cmax (3.4-fold) and AUC (2.3-fold) was observed when comparing
the disposition between the 5 and 25 mg kg
-1
doses (Fig. 2-3b). Airway concentrations were
detectable but not quantifiable by our assay methods.
62

Figure 2-3. Plasma RTD-1 concentration vs time profile. (A) RTD-1 disposition in plasma after
a single subcutaneous injection at 5 and 25 mg kg
-1
. Plasma was collected at 0.25-, 0.5-, 1-, 7-,
24-, 48-, and 72- h and quantified by LC/MS. Data is represented as median and IQR. N= 3-7 per
group. (B) Sparse NCA methods using the Bailer-Satterhwaite approach were performed to
evaluate the AUC.

RTD-1 reduces airway neutrophil burden and pulmonary edema
Following LPS exposure at 24 h, total inflammatory cell counts in BALF were increased
approximately 32-fold (p<0.0001) in LPS untreated control mice compared to sham mice. Cellular
differentials confirmed that neutrophils were the main infiltrative leukocyte (>90% of total cells)
(Figs. 2-4a,b). No mortality was observed in the disease model. RTD-1 treatment resulted in a
significant decrease in neutrophils in RTD-1 treated mice at doses of 5 mg kg
-1
(p<0.01) and 25
mg kg
-1
(p<0.001). Treatment with RTD-1 was not associated with any increases in airway
macrophages when compared to LPS untreated mice (p>0.05) (Fig. 2-4b).
63

Figure 2-4. Dose effects of RTD-1 on airway neutrophilia, neutrophil activation, and
microvascular disruption. To assess RTD-1’s dose response, mice received subcutaneous
pre-treatment with 0, 0.2, 1, 5 or 25 mg kg
-1
RTD-1 0.5 h prior to 1 µg intranasal LPS instillation.
BALF was evaluated for (A) Total, (B) Differential, (C) Peroxidase activity, (D) Global MMP activity
and (E) Total protein. n= 6 mice per group; mean ± 95% CI; Treatment compared to control by
one-way ANOVA with the Bonferroni’s post-test (*) p<0.05, (**) p<0.01, (***) p<0.001, (****)
p<0.0001. Abbreviations: White blood cells (WBCs), Peroxidase (POD).

Airway neutrophil activation status was measured by cell free BALF peroxidase (POD) activity
and global MMP activity. RTD-1 diminished airway peroxidase (Fig. 2-4c) and MMP9 activity (Fig.
2-4d) in a dose-dependent manner in the 5 mg kg
-1
and 25 mg kg
-1
treatment groups when
compared with LPS control mice (p<0.01). A strong positive association was observed between
the total neutrophil count and POD activity (r = 0.87; p<0.05) (Fig. 2-5a), or total neutrophil count
and global MMP activity (r = 0.78; p<0.05) (Fig. 2-5b). Total protein concentrations in BALF were
64
quantified to assess disease severity and more specifically, alveolar-capillary barrier leakage
induced by LPS. BALF protein levels were increased 3.8-fold (p<0.001) after LPS challenge in
untreated mice compared to sham mice. Compared with LPS untreated mice, RTD-1 treatment
resulted in significant reductions in protein levels in the 1 mg kg
-1
(p<0.05), 5 mg kg
-1
(p<0.05),
and 25 mg kg
-1
(p<0.001) RTD-1 groups (Fig. 2-4e).

Figure 2-5. Strength and direction of relationship between neutrophils and airway
enzymes. 1 µg intranasal LPS treated mice received subcutaneous pretreatment with 0, 0.2, 1,
5 or 25 mg kg
-1
RTD-1. BALF was obtained and relationships between total neutrophils and (A)
POD activity or (B) MMP activity were quantified by pearson correlation. Note for MMP-9 only 0,
5 and 25 mg kg
-1
RTD-1 treatment groups were available for analysis.

RTD-1 inhibits LPS-induced inflammatory cytokines/chemokines
Given the observed effects of RTD-1 on lung neutrophilia, 24 h airway levels of pro-inflammatory
cytokines were measured from BALF to further evaluate immunomodulatory activity (Fig. 6a-c).
TNF, IL-1a, IL-1b, IL-6, MCP-1, KC, MIP1a, MIP1b, were elevated in response to LPS challenge
in mice compared to sham controls (p<0.0001) (Table 2-2). RTD-1 treatment at doses of 5 mg kg
-
1
and 25 mg kg
-1
achieved significant reductions in IL-1β (p<0.05) and TNF (p<0.01) when
0 200 400 600
0
200
400
600
800
1000
Global MMP Activity
Neutrophils (x10
4
)
r

= 0.87
p<0.05
0 50 100 150
0
200
400
600
800
1000
POD Activity
Neutrophils (x10
4
)
r

= 0.78
p<0.05
A.
B.
0 200 400 600
0
200
400
600
800
1000
Global MMP Activity
Neutrophils (x10
4
)
r

= 0.87
p<0.05
0 50 100 150
0
200
400
600
800
1000
POD Activity
Neutrophils (x10
4
)
r

= 0.78
p<0.05
A.
B.
65
compared with LPS untreated mice respectively (Fig. 2-6a,b). In addition, RTD-1 at the highest
treatment dose resulted in significant reductions in IL-6 (p<0.05) (Fig. 2-4c). No treatment
differences were observed in the levels of IL-1a, KC, MCP-1, MIP1a, MIP1b, when compared to
LPS untreated controls (Table 2-2).

Figure 2-6. Dose effects of RTD-1 on airway cytokines and chemokines. To assess RTD-1’s
dose response, mice received pre-treatment with 0, 0.2, 1, 5 or 25 mg kg
-1
RTD-1 0.5 h prior to 1
µg intranasal LPS instillation. BALF was obtained at 24 hours. Effect of RTD-1 on cytokines: (A)
IL-1b, (B) TNF, and (C) IL-6 are shown. n= 6 mice per group; geometric mean ± 95% CI;
Treatment compared to control by one-way ANOVA with the Bonferroni’s post-test (*) p<0.05, (**)
p<0.01, (***) p<0.001.

66
Table 2-2: BALF cytokine 24 h post intranasal LPS challenge
Analyte LPS
#
Sham
*

TNF 393 (135.6) **** 0.7 (0.2)
IL-1a 94.8 (49.2)**** 8.5 (5.5)
IL-1b 46.7 (14.2)**** 1.6 (1.0)
IL-6 2622 (1034)**** 2.0 (0)
MCP-1 23 (4.3)**** 2.5 (0)
KC 1002 (296.3)**** 14.63 (4.2)
MIP1a 393.2 (152.5)**** 8.6 (3.7)
MIP1b 601 (216.6)**** 6.0 (0

#
insufflation of 1 µg LPS in 50 µL PBS,
*
insufflation of 50 µL PBS,
a
n=6 BALB/C mice per
treatment group,
b
Values in pg/mL Mean ± SD,
c
Two-sample T-test. (****) p<0.0001,
d
Samples
less than detectable were set to minimal detectable value of assay otherwise extrapolated values
were used for analysis.

RTD-1 dampens early inflammatory responses in the lung
Given the promising in vivo treatment effect described above, we performed an exploratory study
in LPS challenged mice to evaluate the time course of the anti-inflammatory activity of RTD-1.
Led by in vitro findings, we evaluated TNF, IL-1b, IL-6, KC and endogenous anti-inflammatory
soluble receptors. Additionally, MIP-2 was evaluated due to its primary production in the resident
macrophage and role in neutrophil migration to the lung space (Amano et al. 2000; De Filippo et
al. 2008). Comparison of cytokine concentration-time profiles demonstrated RTD-1 dose-
dependently reduced cumulative airway cytokine exposure of MIP-2 (p<0.01), KC (p<0.001), TNF
(p<0.001), and IL-1b (p<0.01) compared to LPS untreated controls (Fig. 2-7a-d) (Table 2-3). This
67
reduction in cumulative exposure was largely attributed to an early (3 h) attenuation of these
markers. No treatment effects were observed for IL-6, or the soluble receptor antagonists profiled
(Table 2-3).

Next we evaluated inflammatory cell infiltration into the airspace. Treatment with RTD-1 resulted
in a significant dose dependent decrease in airway leukocytes in response to LPS starting as
early as 3 h. The cumulative exposure of neutrophils to the airways was significantly reduced
following RTD-1 treatment at doses of 5- and 25 mg kg
-1
compared with LPS untreated mice
(p<0.0001) (Fig. 2-7e) (Table 2-3).

To investigate whether the above actions could be explained by RTD-1 regulated gene
expression, we performed a study (n= 6/group), to asses mRNA levels between treated (RTD-1
25 mg kg
-1
) and untreated groups 3 h post endotoxin challenge. RTD-1 significantly reduced
mRNA levels of TNF (-1.560 FC; p<0.01), IL1b (-1.386 FC; p<0.0001), IL-6 (-1.393 FC; p<0.01),
MCP-1 (-3.396 FC; p<0.0001), MIP-2 (-1.496 FC; p<0.001) and KC (-1.277 FC; p<0.01) in mouse
whole lung homogenate compared to untreated controls (Figure 2-7f).
68

Figure 2-7. Dose- and time-dependent effects of RTD-1 on airway neutrophilia, cytokine
proteins and gene expression. A time course study was conducted to assess RTD-1’s direct
effects on airway neutrophils and immune mediators. RTD-1 at 0, 5 or 25 mg kg-1 was
administered 0.5 h prior to 1 µg intranasal LPS. BALF was obtained at the times noted for MIP-2
(A), KC (B), TNF (C), and IL-1b (D) and total cell counts (F) (n = 3 mice per group; mean ± SD ).
In a separate set of mice, changes in 3 h lung homogenate cytokine mRNA levels were evaluated
(F) (n = 6 mice per group; mean ± SD ). Treatment compared to control by two-way ANOVA with
the Bonferroni’s post-test (*) p<0.05, (**) p<0.01, (***) p<0.001, (****) p<0.0001.

69
Table 2-3: Total Exposure of inflammatory markers in mice with LPS induced lung injury
treated with RTD-1.
RTD-1 [mg/kg]
MARKER 0 5 25
WBC 2,571,220.0 (62,570.9) 1,267,870.0 (121,595.0) **** 814,981.0 (59,138.8) ****
MIP-2 48,972.2 (5,274.1) 30,368.0 (6,506.6) ** 28,412.9 (818.6) **
KC 57,789.1 (3,398.9) 51,719.6 (8,313.2) 46,748.4 (1,502.1)
TNF 27,549.5 (1,453.8) 22,543.7 (1,062.9) *** 18,627.2 (769.9) ***
IL-1b 761.5 (51.5) 516.4
$
(48.8) *** 395.6
#
(18.8) ****
sIL-6R 20,980.3 (634.6) 25,119.5 (2,924.4) 22,338.0 (2,420.6)
sTNFRI 20,872.4 (671.6) 25,511.8 (3,549.9) 23,974.6 (2,849.9)
sTNFRII 192,113.0 (8,930.2) 198,590.0 (14942.0) 152,459.0 (9117.3)
sIl-1RII 15,942.8 (1645.9) 16,327.7 (1298.2) 14,067.9 (668.9)
a
Insufflation of 1 µg LPS in 50 µL PBS and subcutaneous injection of either 0, 5, or 25 mg kg
-1

RTD-1 in xx mL normal saline,
b
n=3 BALB/c mice per treatment group,
c
AUC analysis using
Bailer-Satterhwaite method to estimate samples Mean ± SD from sparse sampling
(Nedelman, Gibiansky, and Lau 1995; Tse and Nedelman 1996),
d
Unpaired two-sample t-test.
(**) p<0.01, (***) p<0.001, (****) p<0.0001.

RTD-1 exhibits anti-inflammatory effects up to 12 hours post LPS insufflation
Following the encouraging prophylactic in vivo data we tested the interventional effects of 25 mg
kg
-1
RTD-1 administered subcutaneously at 0 and 12 h post LPS insufflation. For comparison, we
tested 2 mg kg
-1
Dexamethasone. One death occurred in the RTD-1 T0 group 12 hours post LPS
insufflation which was likely a surgical complication. RTD-1 treatment showed a trend towards
reducing neutrophil lung infiltration at T0 and significantly reduced lung neutrophilia at T12
70
(p<0.01) (Fig. 2-8a). Dexamethasone also significantly reduced lung neutrophilia (p<0.05). There
was no statistically significant difference between the T0 and T12 cohorts (unpaired two samples
t-test p=0.1360). In addition, RTD-1 significantly reduced TNF (-0.32 FC; p<0.05), IL-6 (-0.66 FC;
p<0.001) and IP-10 (-0.34 FC; p<0.001) at T0 and TNF (-0.40 FC; p<0.01), IL-1β (-0.43 FC; 0.01),
IL-6 (-0.66 FC; 0.001) and IP-10 (-0.67 FC; p<0.001) at T12 (Fig. 8b-f). MIP-2 and KC were not
significantly changed by RTD-1 treatment (data not shown). Dexamethasone reduced IL-1β (-
0.40 FC; p<0.05), KC (-0.27 FC; p<0.05 data not shown) and IP-10 (-0.50 FC; p<0.001). These
data show that RTD-1 treatment retains a protective effect when administered 12 hours post LPS
insufflation.

Figure 2-8. Time-dependent effect of RTD-1 on airway neutrophilia and cytokines. To
assess timing of drug administration, 25 mg kg
-1
RTD-1 was administered at 0- or 12 h after 1 µg
LPS instillation. As a comparator agent, 2 mg kg
-1
dexamethasone was given at 0 h. LPS mice
administered saline served as control. (A) BALF WBCs were quantified by manual counting. BALF
concentrations of TNF (B), IL-1b (C), IL-6 (D), IP-10 (E), IFNγ (F) were quantified by multiplex
71
ELISA. n=9 mice per group (except n=8 for RTD-1 at 0 h); mean ± SD; Treatment compared to
control by unpaired two sided t-test (*) p<0.05, (**) p<0.01, (***) p<0.001.

RTD-1 protects against LPS induced acute lung injury
Considering the maximal immunomodulatory effects observed at the higher dose, we selected
the 25 mg kg
-1
RTD-1 dose to evaluate disease severity at 24 h as measured by histology and
lung pathology scoring. We compared the presence of congestion, interstitial and alveolar
leukocytes, and alveolar hyaline membranes between RTD-1 treated, LPS untreated and sham
mice (Fig. 2-9). RTD-1 exhibited a protective effect against LPS-induced lung injury as evidenced
by the lack of alveolar leukocyte infiltrates, absence of hyaline membranes and normal alveolar
wall thickness (Fig. 2-9a-i). A comparison of standardized lung injury scores demonstrated a
significant reduction in lung injury in RTD-1 treated animals when compared with controls.
(p<0.01)(Fig 2-9j).
72

Figure 2-9. RTD-1 effects on severity of acute lung injury. To assess treatment effects on lung
injury, mice received pre-treatment with 0- or 25 mg kg
-1
RTD-1 0.5 h prior to 1 µg LPS insufflation.
Lungs were formalin inflated and H&E stained. Representative photomicrographs of each mouse
and their respective treatment groups (A-C) LPS alone, (D-F) LPS +25 mg kg
-1
RTD-1, or (G-I)
PBS sham are shown. (J) Pathological scoring of slides for lung injury and inflammation.
Parameters included the presence of congestion, interstitial and alveolar leukocytes, and alveolar
hyaline membranes. n=3 mice per group; Mean ± SD; Treatment compared to control by unpaired
two-sample t-test (**) p<0.01.

73
Discussion
ALI is a disorder of acute inflammation characterized by loss of alveolar-capillary membrane
integrity, excessive neutrophil infiltration, release of pro-inflammatory mediators, and pulmonary
edema (Johnson and Matthay 2010). Lung infections and/or sepsis are frequently the underlying
cause of ALI. While antibiotics remain the primary treatment, limited therapies are currently
available for directly targeting the inflammatory response in ALI. Cationic antimicrobial peptides
participate in bacterial killing, as well as initiation and resolution of acute inflammatory responses
(Tecle, Tripathi, and Hartshorn 2010; Hancock and Sahl 2006). Several cationic antimicrobial
peptides have demonstrated efficacy in murine models of sepsis induced ALI (Tasaka et al. 1996;
Simpson et al. 2001; Vandermeer et al. 1994; Bals et al. 1999). The dual antimicrobial and
immunomodulatory actions of cationic antimicrobial peptides make them attractive drug
candidates for treatment of ALI. However, host toxicity profiles and pharmacokinetic challenges
have hampered the clinical development of earlier cationic antimicrobial peptides (Hancock and
Sahl 2006).

Theta defensins are macrocyclic cationic peptides with antimicrobial and immunomodulatory
activities. While initially studied for their antimicrobial action, recent investigations indicate
attenuation of the inflammatory response plays a significant role in the therapeutic benefit in
murine models of severe acute respiratory syndrome (SARS) and sepsis (Schaal et al. 2012;
Wohlford-Lenane et al. 2009). However, the effects of RTD-1 in a model of “sterile inflammation”
and direct lung injury has not previously been investigated. In the current investigation, we present
the first evidence that the q-defensin, RTD-1, yields protective effects in mitigating ALI by reducing
pro-inflammatory cytokines, neutrophil infiltration, alveolar-capillary membrane leakage, and lung
injury.

74
Following a direct insult (i.e. infection or trauma), cell-mediated amplification of proinflammatory
cytokines occur in response to pathogens and/or ongoing cellular injury. Here we used the well-
established bacterial endotoxin model to simulate the host lung immune response and acute lung
injury pathology. Upon intranasal LPS challenge, we found that RTD-1 treatment reduced the total
airway exposure of several monocyte/macrophage related cytokines (i.e. MIP-2, TNF, IL-1b) in a
dose-dependent manner. In particular, we observed a distinct and early reduction (3 h) in soluble
TNF, and MIP-2. To see if these early observations could be explained by resident macrophage
responses and/or lung epithelium, we conducted in vitro investigations with LPS-stimulated cells.
These experiments revealed that RTD-1 treatment inhibited the release of soluble TNF, MIP-2,
MCP-1, and IL-6 in alveolar but not epithelial cells. These data are consistent with published
reports highlighting the importance of resident alveolar macrophages in mediating early
inflammatory responses to LPS-induced acute lung injury and suggests the
monocyte/macrophage as a primary cellular target of RTD-1 (Koay et al. 2002; Maus et al. 2003;
Reutershan et al. 2005).

A fundamental feature of ALI is the vascular emigration and interstitial migration of neutrophils
into the lung compartment. Following intranasal LPS challenge in mice, we found that RTD-1
dose-dependently reduced 24 h airway neutrophil recruitment in vivo. The early treatment
differences of airway neutrophils (3 to 7 h) compared to LPS control mice suggest that RTD-1
may directly inhibit neutrophil emigration from the vasculature. Supporting this direct neutrophil
blockade hypothesis is in vitro data demonstrating RTD-1 inhibited human CXCL8 dependent
neutrophil chemotaxis. Additional in vitro data indicates the effect of RTD-1 on neutrophil
chemotaxis may be due to inhibition of neutrophil cell adhesion. RTD-1 reduced neutrophil-
endothelial cell adhesion by >50% compared to the specific Cell Adhesion Inhibitor Cyclic Peptide
which reduced adhesion by >85%. This new finding of antagonism of chemotaxis runs counter
the general observation of HDPs known to induce migration (Mansour, Pena, and Hancock 2014).
75
This is important, as KC and MIP-2 (murine homologs of human CXCL8), are pivotal in regulating
migration and activation of neutrophils in murine LPS-induced pulmonary inflammation
(Jeyaseelan et al. 2004; Huang et al. 1992). Consistent with these findings is the improved lung
inflammation scores in vivo that was driven by reduced airway neutrophilia. Therefore, data
suggest that the peripheral blood neutrophils may be another target of RTD-1 as systemic action
on this cell population would reduce airway neutrophil burden.

Excessive and prolonged neutrophilia and the associated inflammatory products contribute to
basement membrane destruction and increased permeability of the alveolar-capillary barrier. One
measure of membrane permeability and pulmonary edema is the total protein concentration in
BALF. RTD-1 treatment was associated with reduced pulmonary edema in vivo. While active
migration of neutrophils contribute to a “leaky” barrier, the release of proteolytic enzymes (NE,
MMP-9) and reactive oxygen species further increase the permeability of the alveolar-capillary
membrane and thus pulmonary edema (Grommes and Soehnlein 2011). RTD-1 treatment
reduced POD and MMP-9 activity in a dose-dependent manner in vivo. Given the observed strong
positive association between neutrophil counts and their released products (POD or MMP activity)
these dose-dependent effects are likely the result of reduced neutrophil recruitment. However, we
have previously demonstrated that RTD-1 is an inhibitor of MMP-9 activity in vitro (Bensman et
al. 2017). The anti-inflammatory and ALI protective effects were observed when RTD-1 was
administered 12 hours post LPS insufflation supporting its potential as a treatment for ALI.

From investigations disclosed here, we postulate that RTD-1’s multifunctional actions on i) early
alveolar macrophage driven inflammatory reactions and ii) blood neutrophil emigration and
adhesion underlie the in vivo observation of reduced neutrophil lung recruitment from LPS
challenge. The immunoregulatory action of RTD-1 is relatively unique in comparison with other
cationic host defense peptides in which the anti-inflammatory action is an indirect effect mediated
76
by their endotoxin neutralizing effects (Schaal et al. 2012; Tongaonkar et al. 2015). Recent work
has elucidated several modes by which RTD-1 may exert these effects. Work in
macrophage/monocyte cells demonstrate inhibition of NF-kB translocation and proinflammatory
effects through PI3K/AKT pathway activation (Tongaonkar et al. 2015). RTD-1 was recently
shown to inhibit NF-kB translocation through induction of phosphorylated Akt, which acts as a
negative regulator of NF-kB and MAPK (14). Additionally, RTD-1 inhibits IκBα degradation and
p38 MAPK phosphorylation in macrophage/monocyte cells (14). This is consistent with our in vivo
gene expression data suggesting that RTD-1 modulates TLR signaling activity and subsequently
mRNA levels and soluble cytokines. Published data demonstrating fast temporal inhibition (4 h)
of soluble TNF in macrophages suggest that RTD-1 is likely multi-regulatory (Schaal et al. 2012;
Tongaonkar et al. 2015). Ongoing mechanistic studies in our labs are underway to understand
the multi-regulatory actions of this peptide at the molecular level.

Pharmacokinetic studies designed to characterize the time course of drug concentrations in blood
are key to identifying the optimal dose to maximize efficacy and safety of the compound.
Examination of the plasma concentration time curves revealed several observations. First, the
peak in vivo concentrations following single dose subcutaneous administration were below the in
vitro IC50s (e.g. neutrophil chemotaxis and inflammatory cytokines from MHS cells) indicating the
potential for greater anti-inflammatory activity with improved drug delivery. Second, the area
under the plasma concentration curve (AUC) did not increase in proportion to the dose when
comparing between the 5- and 25 mg kg
-1
doses suggesting saturable absorption from the
injection site. This observation explains the less than proportional increase in anti-inflammatory
activity at the higher dose and is consistent with unpublished data from our group demonstrating
low absolute bioavailability of RTD-1 in rodents. Lastly, taking into account the relatively long
77
plasma half-life observed here, as well as previously disclosed in vitro plasma stability, a
prolonged treatment effect is possible (Schaal et al. 2012).

There are several areas worthy of future exploration. Firstly, although LPS-induced ALI is a
recommended model for testing potential therapeutics, we did not explore the utility of RTD-1 in
treatment of ALI induced by other causes (e.g. acid aspiration). Secondly, we have investigated
part of the potential mechanism of action through which RTD-1 is effecting neutrophil chemotaxis.
Future studies evaluating the RTD-1 effect on specific adhesion molecules and cytoskeleton
components would be informative. Lastly, pharmacokinetic observations suggest additional work
on drug formulation are warranted to optimize treatment effects.

In conclusion, data described here demonstrates that the q-defensin RTD-1 exhibited anti-
inflammatory effects comparable to 2 mg/kg dexamethasone in a murine model of LPS-induced
ALI and retains its protective effects 12 hours post LPS administration. In vitro findings suggest
that RTD-1 reduced in vivo lung injury and airway neutrophilia by directly inhibiting neutrophil
migration and attenuating keystone responses of the resident alveolar macrophages.
Observations disclosed here suggest that this dual anti-inflammatory and antimicrobial peptide
may provide a potentially new therapeutic approach to the treatment of ALI; especially given its
promising early pre-clinical safety profile (Schaal et al. 2012).

Acknowledgements
We would like to thank Dr. Diane Da Silva, Mr. Joseph Skeate and Ms. Elena Chavez Juan from
the Beckman Center for Immune Monitoring for running the multiple analyte panels. In addition,
this work was presented in part at the North American Cystic Fibrosis Conference, 8-11 October
2012.
78
References
Abdel-Latif, D., M. Steward, D. L. Macdonald, G. A. Francis, M. C. Dinauer, and P. Lacy. 2004.
'Rac2 is critical for neutrophil primary granule exocytosis', Blood, 104: 832-9.

Aigouy, B., and V. Mirouse. 2013. 'ScientiFig: a tool to build publication-ready scientific figures',
Nat Methods, 10: 1048.

Amano, H., H. Yamamoto, M. Senba, K. Oishi, S. Suzuki, K. Fukushima, N. Mukaida, K.
Matsushima, K. Eguchi, and T. Nagatake. 2000. 'Impairment of endotoxin-induced macrophage
inflammatory protein 2 gene expression in alveolar macrophages in streptozotocin-induced
diabetes in mice', Infect Immun, 68: 2925-9.

Balloy, V., A. Deveaux, D. Lebeaux, O. Tabary, P. le Rouzic, J. M. Ghigo, P. F. Busson, P. Y.
Boelle, J. G. Guez, U. Hahn, A. Clement, M. Chignard, H. Corvol, M. Burnet, and L. Guillot. 2014.
'Azithromycin analogue CSY0073 attenuates lung inflammation induced by LPS challenge', Br J
Pharmacol, 171: 1783-94.

Bals, R., D. J. Weiner, A. D. Moscioni, R. L. Meegalla, and J. M. Wilson. 1999. 'Augmentation of
innate host defense by expression of a cathelicidin antimicrobial peptide', Infect Immun, 67: 6084-
9.

Bdeir, K., A. A. Higazi, I. Kulikovskaya, M. Christofidou-Solomidou, S. A. Vinogradov, T. C. Allen,
S. Idell, R. Linzmeier, T. Ganz, and D. B. Cines. 2010. 'Neutrophil alpha-defensins cause lung
injury by disrupting the capillary-epithelial barrier', Am J Respir Crit Care Med, 181: 935-46.

79
Bensman, T. J., J. G. Jayne, M. Sun, E. Kimura, J. Meinert, J. C. Wang, J. B. Schaal, D. Tran, A.
P. Rao, O. Akbari, M. E. Selsted, and P. M. Beringer. 2017. 'Efficacy of Rhesus Theta-Defensin-
1 in Experimental Models of Pseudomonas aeruginosa Lung Infection and Inflammation',
Antimicrob Agents Chemother, 61.

Beringer, P. M., T. J. Bensman, H. Ho, M. Agnello, N. Denovel, A. Nguyen, A. Wong-Beringer, R.
She, D. Q. Tran, S. M. Moskowitz, and M. E. Selsted. 2015. 'Rhesus theta-defensin-1 (RTD-1)
exhibits in vitro and in vivo activity against cystic fibrosis strains of Pseudomonas aeruginosa', J
Antimicrob Chemother.

De Filippo, K., R. B. Henderson, M. Laschinger, and N. Hogg. 2008. 'Neutrophil chemokines KC
and macrophage-inflammatory protein-2 are newly synthesized by tissue macrophages using
distinct TLR signaling pathways', J Immunol, 180: 4308-15.

Garcia, A. E., G. Osapay, P. A. Tran, J. Yuan, and M. E. Selsted. 2008. 'Isolation, synthesis, and
antimicrobial activities of naturally occurring theta-defensin isoforms from baboon leukocytes',
Infect Immun, 76: 5883-91.

Grommes, J., and O. Soehnlein. 2011. 'Contribution of neutrophils to acute lung injury', Mol Med,
17: 293-307.

Ha, H., T. Bensman, H. Ho, P. M. Beringer, and N. Neamati. 2014. 'A novel phenylcyclohex-1-
enecarbothioamide derivative inhibits CXCL8-mediated chemotaxis through selective regulation
of CXCR2-mediated signalling', Br J Pharmacol, 171: 1551-65.

80
Hancock, R. E., and H. G. Sahl. 2006. 'Antimicrobial and host-defense peptides as new anti-
infective therapeutic strategies', Nat Biotechnol, 24: 1551-7.

Huang, S., J. D. Paulauskis, J. J. Godleski, and L. Kobzik. 1992. 'Expression of macrophage
inflammatory protein-2 and KC mRNA in pulmonary inflammation', Am J Pathol, 141: 981-8.

Jeyaseelan, S., H. W. Chu, S. K. Young, and G. S. Worthen. 2004. 'Transcriptional profiling of
lipopolysaccharide-induced acute lung injury', Infect Immun, 72: 7247-56.

Johnson, E. R., and M. A. Matthay. 2010. 'Acute lung injury: epidemiology, pathogenesis, and
treatment', J Aerosol Med Pulm Drug Deliv, 23: 243-52.

Koay, M. A., X. Gao, M. K. Washington, K. S. Parman, R. T. Sadikot, T. S. Blackwell, and J. W.
Christman. 2002. 'Macrophages are necessary for maximal nuclear factor-kappa B activation in
response to endotoxin', Am J Respir Cell Mol Biol, 26: 572-8.

Lehrer, R. I., A. M. Cole, and M. E. Selsted. 2012. 'theta-Defensins: cyclic peptides with endless
potential', J Biol Chem, 287: 27014-9.

Levitt, J. E., and M. A. Matthay. 2012. 'Clinical review: Early treatment of acute lung injury--
paradigm shift toward prevention and treatment prior to respiratory failure', Crit Care, 16: 223.
Mansour, S. C., O. M. Pena, and R. E. Hancock. 2014. 'Host defense peptides: front-line
immunomodulators', Trends Immunol, 35: 443-50.

81
Matthay, M. A., and G. A. Zimmerman. 2005. 'Acute lung injury and the acute respiratory distress
syndrome: four decades of inquiry into pathogenesis and rational management', Am J Respir Cell
Mol Biol, 33: 319-27.

Matute-Bello, G., G. Downey, B. B. Moore, S. D. Groshong, M. A. Matthay, A. S. Slutsky, and W.
M. Kuebler. 2011. 'An official American Thoracic Society workshop report: features and
measurements of experimental acute lung injury in animals', Am J Respir Cell Mol Biol, 44: 725-
38.

Matute-Bello, G., G. Downey, B. B. Moore, S. D. Groshong, M. A. Matthay, A. S. Slutsky, W. M.
Kuebler, and Group Acute Lung Injury in Animals Study. 2011. 'An official American Thoracic
Society workshop report: features and measurements of experimental acute lung injury in
animals', Am J Respir Cell Mol Biol, 44: 725-38.

Matute-Bello, G., R. K. Winn, M. Jonas, E. Y. Chi, T. R. Martin, and W. C. Liles. 2001. 'Fas (CD95)
induces alveolar epithelial cell apoptosis in vivo: implications for acute pulmonary inflammation',
Am J Pathol, 158: 153-61.

Maus, U. A., K. Waelsch, W. A. Kuziel, T. Delbeck, M. Mack, T. S. Blackwell, J. W. Christman, D.
Schlondorff, W. Seeger, and J. Lohmeyer. 2003. 'Monocytes are potent facilitators of alveolar
neutrophil emigration during lung inflammation: role of the CCL2-CCR2 axis', J Immunol, 170:
3273-8.

Nedelman, J. R., E. Gibiansky, and D. T. Lau. 1995. 'Applying Bailer's method for AUC confidence
intervals to sparse sampling', Pharm Res, 12: 124-8.

82
Oppenheim, J. J., A. Biragyn, L. W. Kwak, and D. Yang. 2003. 'Roles of antimicrobial peptides
such as defensins in innate and adaptive immunity', Ann Rheum Dis, 62 Suppl 2: ii17-21.

Park, W. Y., R. B. Goodman, K. P. Steinberg, J. T. Ruzinski, F. Radella, 2nd, D. R. Park, J. Pugin,
S. J. Skerrett, L. D. Hudson, and T. R. Martin. 2001. 'Cytokine balance in the lungs of patients
with acute respiratory distress syndrome', Am J Respir Crit Care Med, 164: 1896-903.

Proudfoot, A. G., D. F. McAuley, M. J. Griffiths, and M. Hind. 2011. 'Human models of acute lung
injury', Dis Model Mech, 4: 145-53.

Reutershan, J., A. Basit, E. V. Galkina, and K. Ley. 2005. 'Sequential recruitment of neutrophils
into lung and bronchoalveolar lavage fluid in LPS-induced acute lung injury', Am J Physiol Lung
Cell Mol Physiol, 289: L807-15.

Schaal, J. B., D. Tran, P. Tran, G. Osapay, K. Trinh, K. D. Roberts, K. M. Brasky, P. Tongaonkar,
A. J. Ouellette, and M. E. Selsted. 2012. 'Rhesus macaque theta defensins suppress inflammatory
cytokines and enhance survival in mouse models of bacteremic sepsis', PLoS One, 7: e51337.

Selsted, M. E. 2004. 'Theta-defensins: cyclic antimicrobial peptides produced by binary ligation of
truncated alpha-defensins', Curr Protein Pept Sci, 5: 365-71.

Simpson, A. J., W. A. Wallace, M. E. Marsden, J. R. Govan, D. J. Porteous, C. Haslett, and J. M.
Sallenave. 2001. 'Adenoviral augmentation of elafin protects the lung against acute injury
mediated by activated neutrophils and bacterial infection', J Immunol, 167: 1778-86.

83
Szarka, R. J., N. Wang, L. Gordon, P. N. Nation, and R. H. Smith. 1997. 'A murine model of
pulmonary damage induced by lipopolysaccharide via intranasal instillation', J Immunol Methods,
202: 49-57.

Tai, K. P., K. Kamdar, J. Yamaki, V. V. Le, D. Tran, P. Tran, M. E. Selsted, A. J. Ouellette, and A.
Wong-Beringer. 2015. 'Microbicidal effects of alpha- and theta-defensins against antibiotic-
resistant Staphylococcus aureus and Pseudomonas aeruginosa', Innate Immun, 21: 17-29.

Tang, Y. Q., J. Yuan, G. Osapay, K. Osapay, D. Tran, C. J. Miller, A. J. Ouellette, and M. E.
Selsted. 1999. 'A cyclic antimicrobial peptide produced in primate leukocytes by the ligation of
two truncated alpha-defensins', Science, 286: 498-502.

Tasaka, S., A. Ishizaka, T. Urano, K. Sayama, F. Sakamaki, H. Nakamura, T. Terashima, Y. Waki,
K. Soejima, M. Nakamura, H. Matsubara, S. Fujishima, M. Kanazawa, and J. W. Larrick. 1996. 'A
derivative of cationic antimicrobial protein attenuates lung injury by suppressing cell adhesion',
Am J Respir Cell Mol Biol, 15: 738-44.

Tecle, T., S. Tripathi, and K. L. Hartshorn. 2010. 'Review: Defensins and cathelicidins in lung
immunity', Innate Immun, 16: 151-9.

Tongaonkar, P., K. K. Trinh, J. B. Schaal, D. Tran, P. S. Gulko, A. J. Ouellette, and M. E. Selsted.
2015. 'Rhesus macaque theta-defensin RTD-1 inhibits proinflammatory cytokine secretion and
gene expression by inhibiting the activation of NF-kappaB and MAPK pathways', J Leukoc Biol.

84
Tran, D., P. A. Tran, Y. Q. Tang, J. Yuan, T. Cole, and M. E. Selsted. 2002. 'Homodimeric theta-
defensins from rhesus macaque leukocytes: isolation, synthesis, antimicrobial activities, and
bacterial binding properties of the cyclic peptides', J Biol Chem, 277: 3079-84.

Tran, D., P. Tran, K. Roberts, G. Osapay, J. Schaal, A. Ouellette, and M. E. Selsted. 2008.
'Microbicidal properties and cytocidal selectivity of rhesus macaque theta defensins', Antimicrob
Agents Chemother, 52: 944-53.

Tse, F. L., and J. R. Nedelman. 1996. 'Serial versus sparse sampling in toxicokinetic studies',
Pharm Res, 13: 1105-8.

Vandermeer, T. J., M. J. Menconi, B. P. O'Sullivan, V. A. Larkin, H. Wang, R. L. Kradin, and M.
P. Fink. 1994. 'Bactericidal/permeability-increasing protein ameliorates acute lung injury in
porcine endotoxemia', J Appl Physiol (1985), 76: 2006-14.

Westfall P, Henning K. 2013. Functions of Random Variables: Their Distributions and Expected
Values (CRC Press).

Wieland, C. W., B. Siegmund, G. Senaldi, M. L. Vasil, C. A. Dinarello, and G. Fantuzzi. 2002.
'Pulmonary inflammation induced by Pseudomonas aeruginosa lipopolysaccharide,
phospholipase C, and exotoxin A: role of interferon regulatory factor 1', Infect Immun, 70: 1352-
8.

Wilhelmsen, K., K. Farrar, and J. Hellman. 2013. 'Quantitative in vitro assay to measure neutrophil
adhesion to activated primary human microvascular endothelial cells under static conditions', J
Vis Exp: e50677.
85

Wohlford-Lenane, C. L., D. K. Meyerholz, S. Perlman, H. Zhou, D. Tran, M. E. Selsted, and P. B.
McCray, Jr. 2009. 'Rhesus theta-defensin prevents death in a mouse model of severe acute
respiratory syndrome coronavirus pulmonary disease', J Virol, 83: 11385-90.

86
CHAPTER 3: Rhesus Theta Defensin-1 exhibits anti-inflammatory activity through
inhibition of NFκB and inflammasome formation.

Jordanna G. Jayne
1
,

Mansour Dughbaj
1
, A young J. Park
1
, Timothy J. Bensman
2
, Marquerita
Algorri
1
, Michael E. Selsted
3
, Paul M. Beringer
1*

1
University of Southern California, School of Pharmacy, 1985 Zonal Avenue, Los Angeles, CA
90033

2
Food and Drug Administration, 1717 Pennsylvania Ave NW #1025, Washington, DC 20006
3
University of Southern California, Keck

School of Medicine, 2011 Zonal Avenue, Los Angeles,
CA 90033.

*
Corresponding author. Tel: 323-442-1402, Fax: 626-628-3024, Email: beringer@usc.edu

** Please note, parts of this chapter are taken from the publication: “Experimental Therapeutics
Efficacy of Rhesus Theta-Defensin-1 in Experimental Models of Pseudomonas aeruginosa Lung
Infection and Inflammation” Timothy J. Bensman, Jordanna G. Jayne, Meiling Sun, Elza Kimura,
Joshua Meinert, Joshua C. Wang, Justin B. Schaal, Dat Tran, Adupa P. Rao, Omid Akbari,
Michael E. Selsted, Paul M. Beringer. DOI: 10.1128/AAC.00154-17

87
Abstract
Background: Cystic fibrosis (CF) is characterized by vicious cycles of chronic airway obstruction,
inflection and inflammation which leads to pulmonary function decline and ultimately respiratory
failure and premature death. Rhesus Theta Defensin-1 (RTD-1) is a macrocyclic peptide with
immunomodulatory properties which has previously been shown to inhibit inflammasome related
cytokines. The studies in this chapter describe the in vivo RTD-1 effects in a chronic murine lung
infection model and in vitro studies which aim to further elucidate the peptides inflammasome
related activities.

Methods: For these studies we utilized a chronic mouse infection model using Pseudomonas
aeruginosa embedded agar beads instilled intra-tracheally. The mice received RTD-1 or saline
via nebulization starting 24 hours after inoculation, with dosing continued daily for 6 days. Lung
immune cell infiltration, bacterial burden, cytokine concentration, and gene expression were
assessed (one-way ANOVA, t-test and Benjamini-Hochberg tests were used respectively).
Additionally, in vitro RTD-1 inflammasome specific effects were assessed through qRT-PCR,
ELISA and confocal microscopy. Inflammasome activation was induced by LPS priming of THP-
1 cells exposed to an additional ATP inflammasome activation step with or without RTD-1
treatment; Azithromycin was tested as a comparator. The RTD-1 effect on NF-κB activation was
assessed using the THP-1 Lucia™ cell line which contains a stable NF-κB-inducible Luc reporter
construct.

Results: Aerosolized RTD-1 (167μg/kg; n = 8) significantly reduced lung WBC counts in C57BL/6
mice with chronically established P. aeruginosa infections on days 3 and 7. Microarray analysis
of lung tissue homogenate and BAL immune cells revealed that RTD-1 down regulated
inflammasome related gene expression. Additional in vitro studies confirmed RTD-1 directed NF-
κB activity inhibition in THP-1 monocytic and macrophage-like cells by ~ 2-fold. In LPS stimulated
88
THP-1 monocytes RTD-1 significantly inhibited IL-1β and TNFα at a gene and protein level.
Furthermore, RTD-1 downregulates a key inflammasome component, NLRP3, at a transcriptional
level (FC -2.17; p = <0.0001). A FLICA-FAM antibody based inflammasome activation assay
confirmed that RTD-1 inhibited inflammasome formation (FC -1.79; p = 0.0052).

Conclusions: These data demonstrate that RTD-1 downregulates P. aeruginosa chronic lung
infection associated inflammation and targets inflammasome related genes. We hypothesize that
these effects may be downstream effects of NF-κB inhibition. These findings support this cationic
dual acting anti-microbial and immunomodulatory peptide as a promising candidate for the
treatment of CF lung disease.

Introduction
CF is an autosomal recessive disorder caused by a mutation in the cystic fibrosis transmembrane
conductance regulator (CFTR). Over 1,900 different potential mutations can lead to abnormal
mucus production primarily in the respiratory and gastrointestinal systems (De Boeck et al. 2014).
CF lung disease is characterized by vicious cycles of airway mucus obstruction, infection, are
inflammation. The high levels of chronic inflammation in the CF lung results in bronchiectasis, and
ultimately pulmonary failure. Clinical studies have assessed the therapeutic potential of high dose
ibuprofen and corticosteroids however, their clinical use is limited due to concerns regarding
potential adverse effects (Lai et al. 2000; Konstan et al. 2007; Lands and Dauletbaev 2010).
Currently, azithromycin is prescribed to mitigate pulmonary inflammation; however, its effects are
modest and are not sustained (Samson et al. 2016; Zhuo et al. 2014). Despite efforts to develop
efficacious anti-inflammatory therapies to treat CF lung disease there is still a clear unmet need.

The inflammasome is a key proinflammatory mediator responsible for the activation of
proinflammatory cytokines, IL-1β, IL-1a and IL-18. Importantly, CF patient sputum (Osika et al.
89
1999), plasma (Wilmott et al. 1994) and BAL samples (Wilmott et al. 1990; Bonfield et al. 1995)
are known to contain elevated IL-1β secretions compared to non-CF controls. Furthermore,
various clinical studies have identified IL-1β gene polymorphisms to be associated with lung
disease severity in CF patients (Levy et al. 2009; de Vries et al. 2014). The inflammasome has
demonstrated to be an appropriate target for the treatment of CF lung disease in vivo and in vitro
through the negative regulation of IL-1Ra to mitigate the damaging effects caused by chronic
bacterial colonization (Iannitti et al. 2016; Veliz Rodriguez et al. 2012).

The inflammasome is a multimeric protein complex comprised of NLRP3 (NALP3), the adapter
molecule apoptosis-associated speck (ASC), and pro-caspase-1 (Guo, Callaway, and Ting 2015).
PAMP signaling through NF-κB is essential for the priming of key inflammasome related genes
and subsequent inflammasome activation (Sun 2011; Sutterwala, Haasken, and Cassel 2014).
Both pro-IL-1B and NLRP3 promoter regions contains NF-κB-binding sites and are targets of NF-
κB pathogen associated molecular pattern (PAMP) induced transcription (Qiao et al. 2012).
Inflammasome activation induces the proteolytic cleavage of procaspase-1 into active caspase-
1. Active caspase-1 then cleaves proIL-1β, pro-IL-1a and pro-IL-18 to release their biologically
active forms which are secreted to propagate proinflammatory signal transduction processes
(Lopez-Castejon and Brough 2011).

RTD-1 is a macrocyclic peptide endogenously expressed in leukocytes of Old World Monkeys.
This macrocyclic peptide exhibits broad-spectrum antibacterial activity against multidrug-resistant
bacteria including mucoid P. aeruginosa strains isolated from CF patients (Beringer et al. 2016;
Tai et al. 2015). Additionally, RTD-1 has demonstrated potent immunomodulatory properties in
murine models of acute lung injury (Jayne et al. 2018), chronic lung infection (Bensman et al.
2017), bacteremia sepsis (Schaal et al. 2012), systemic candidiasis (Basso et al. 2018), and
rheumatoid arthritis (Schaal et al. 2017). The RTD-1 anti-inflammatory mechanism of action is in
90
part due to inhibition of NF-κB activation mediated through the phosphorylation of AKT
(Tongaonkar et al. 2015). Additionally, RTD-1 inhibits soluble tumor necrosis factor alpha (TNFa)
release through the inhibition of TNFa converting enzyme (TACE/ADAM17) (Schaal et al. 2018).
The RTD-1 macrocyclic structure and triple disulfide bonds offer the peptide superior structural
stability necessary to withstand the acidified and protease rich environment present in the CF
lung.

To determine the effect of nebulized RTD-1 in a chronic lung infection murine model, mice
received RTD-1 following challenge with P. aeruginosa embedded in agarose beads using an
established protocol (Bragonzi et al. 2006; Facchini et al. 2014). We assessed the in vivo anti-
inflammatory effect by quantifying white blood cell (WBC) lung infiltration, bacterial burden,
bronchoalveolar lavage fluid (BALF) cytokine concentration and gene expression. In addition, in
vitro studies investigated the effect of RTD-1 on cytokine production, inflammasome activation,
gene expression and transcript stability to further our understanding of its anti-inflammatory
mechanism of action (MoA). These studies support RTD-1 as a potentially efficacious therapy for
chronic lung infections as seen in CF patients. Furthermore, these studies suggest RTD-1 is
dampening inflammasome activation and associated cytokines through modulation of NF-κB
pathways. The dual anti-inflammatory and antimicrobial properties of RTD-1 demonstrate its
potential to provide a unique therapeutic approach to treating CF pulmonary inflammation.

Materials and Methods
In vivo studies
Animals
All animal experiments were reviewed and approved by the Institutional Animal Care and Use
Committee (IACUC) at the University of Southern California (protocol 20252). Male 10- to 12-
91
week-old C57BL/6N mice (Charles River Laboratories, CA) weighing 23 to 29 g were housed in
pathogen-free conditions at 22 - 24°C and 60 - 65% humidity with 12-h dark/light periods. The
mice were given water and standard laboratory chow available at will.

Chronic Murine Infection Model
Chronic infection was established by intratracheal instillation of 5 x 10
5

CFUs of P. aeruginosa
(RP73, mucoid CF isolate) embedded in agarose beads to establish a chronic pulmonary
infection. Beads were made fresh the day before the experiment and stored overnight at 4ºC. The
instilled volume was 50 µl of P. aeruginosa beads suspended in sterile PBS. After 24 hours of
infection, the animals received a 1-hour daily treatment with either aerosolized saline (n = 8) or
RTD-1 (167μg/kg; n = 8) for 3 or 7 days. Figure 3-1 depicts the drug delivery system.

RTD-1 was aerosolized at a dose of 167 µg/kg starting 24 hours after infection and continued for
6 days. The dose was chosen based on a previous single dose pharmacokinetic study of
aerosolized doses of 6.8, 49, and 167µg/kg (data not shown); the latter achieved levels in the
epithelial lining fluid well above the targeted levels necessary to achieve antibacterial (MIC = 4
µg/mL) and anti-inflammatory effects (ADAM-17/TACE ~ 1 µg/mL) based on in vitro studies.

92

Figure 3-1. Aerosolized properties of RTD-1. (A) Nose only inhalation exposure system
equipment schematic. (B) Mean mass median aerodynamic diameter (MMAD) and geometric
standard deviation (GSD) for delivered doses of RTD-1.

Mice were euthanized on days 3 and 7. The lungs were washed twice with 0.8 ml PBS containing
mini protease inhibitors (c0mplete™, Millipore Sigma). Bronchoalveolar lavage fluid (BALF) cells
were diluted in Turks blood diluting fluid (Ricca Chemical Company) and quantified using a
hemocytometer. BALF cells were then pelleted for RNA extraction at 300 rcf for 10 min at 4°C
and supernatants were stored at -80°C. Cytokines were quantified from the BALF using the
Luminex Bead Array (Luminex). Cell differential counts were performed using Diff-Quick staining.
Lungs were removed and immediately homogenized, the samples were split for bacterial burden
quantification and RNA extraction. Lung bacterial burden was quantified by plating serially diluted
BALF and lung homogenate samples onto pseudomonas inhibitory agar (PIA). Colony counts
were determined after a 24 hour incubation at 37°C. The total lung bacterial burden was
93
calculated from the sum of the colony counts in the BAL fluid and lung homogenate. Samples for
RNA extraction were stored in RLT lysis buffer (Qiagen) containing 1% β-Mercaptoethanol
(Millipore Sigma) and isolated using RNeasy Mini kit (Qiagen) on-column extraction with DNase-
1 digestion (Qiagen). Gene expression was determined on the Mouse ref 8 v2.0 Expression
BeadChip (Illumina). The statistical analysis of differentially expressed genes (DEG) in the
different tissue samples was carried out using the gene expression workflow in Partek GS. To
identify the most significant DEG, lists were generated with the following criteria: a false discovery
rate (FDR) corrected p<0.05 using the Benjamini-Hochberg step-up procedure to account for
multiple testing and the difference in mean gene transcript level were at least 1.5-fold in either
direction.

Ex vivo studies
Human subjects
Adult CF patients from the University of Southern California CF clinic were invited to enroll in a
cross-sectional study investigating lung inflammatory biomarkers in CF. Inclusion criteria: adult
CF patients (>18 years old) able to spontaneously expectorate sputum. Six patients admitted for
acute pulmonary exacerbation (APE) treatment participated in the study. Age, BMI, ppFEV1, and
anti-inflammatory therapy at the time of sampling were recorded (Tables 3-1 and 3-2). Leukocyte
populations from spontaneously expectorated sputum samples were isolated for cell culture
experiments. This clinical study received institutional review board (IRB) approval (HS-12-00320)
from the at the University of Southern California. All enrolled patients provided written informed
consent.

94
CF sputum leukocyte culture.
Expectorated CF sputum samples (n = 6) were obtained from inpatients within 48 hours of starting
intravenous (i.v.) antibiotics and were processed as previously described (Marjanovic et al. 2011).
Cellular viability after processing was >82% for all samples, which is consistent with published
data (Profita et al. 2003; Marjanovic et al. 2011). Differential cell counts were determined by
placing approximately 5 × 10
5
cells onto a slide chamber, spinning in a cytocentrifuge (Shandon,
Thermo Scientific, Waltham, MA), and staining using a Diff Quick (Polysciences, Warrington, PA)
stain kit according to the commercial protocol. Differential cell counts were conducted on 200 cells
per slide. The cells were suspended in RPMI medium plus L-glutamine and 10% fetal bovine
serum (FBS) (Sigma-Aldrich, St. Louis, MO) at 2 × 10
6
/ml. A 0.5 ml aliquot of the cell suspension
was placed in a 48 well plate (Greiner-Bio One, Monroe, NC). The wells were spiked with 100
μg/ml RTD-1 or cell culture medium and incubated for 24 h. This increase in dose relative to the
THP-1 cell line was based on in-house data suggesting significant protein binding in the presence
of serum and previously published safety data demonstrating no hemolytic or cytotoxicity
concerns at this dose (Tran et al. 2008). The clarified cell supernatants were aliquoted and stored
at −80°C until analysis. No cytotoxicity was observed over 24 hours with or without RTD-1, as
determined by trypan blue exclusion and LDH release (the biologically relevant threshold was
defined as 20%). The sampling of lower airways is supported by <20% squamous epithelial cell
contamination (Table 2).

In vitro studies
Cell Culture
THP-1 monocytes (ATCC, Manassas, VA) were cultured in RPMI 1640, 2 mM L-glutamine, 25
mM HEPES (Corning Inc. New York, NY) + 10% HI-FBS (Genesee Scientific, San Diego, CA).
THP-1 macrophage-like cell differentiation was induced by treatment of cells with 100 nM PMA
95
(Millipore Sigma) and cultured for 48 hours. Cells were cultured at 37°C in 5% CO2. Cell lines
were confirmed to be mycoplasma negative using MycoAlert (Lonza, Walkersville, MD).
Experiments were performed using THP-1 cells cultured between 8-18 passages. Inflammation
was induced using 100 ng/ml Pseudomonas aeruginosa LPS (InvivoGen). Cells were dosed with
RTD-1 (10 μg/ml), Azithromycin (50 μg/ml) or MCC950 (10 μM) at time 0. At the initiation of
experiments cells were cultured in cell cultured media containing 1% FBS. Cells were harvested
for RNA at 4 hours and for protein analysis at 24 hours.

NF-κB Assay
To assess the effect of RTD-1 on NF-κB activation we utilized the THP1-Lucia™ NF-κB reporter
cell line (Invivogen). For these experiments the cells were starved for 4 hours in RPMI 25mM
HEPES 1% FBS before an overnight (16 hour) treatment period. NF-κB induced luciferase
expression is secreted into the cell culture supernatant and quantified using the luciferase
detection reagent QUANTI-Luc™. Luminosity was measures using a kinetic plate reader.

Gene Expression Analysis
Cells were lysed in PureLink (Thermo Fisher, Waltham, MA) spin column–based kit lysis buffer
containing 1% β-Mercaptoethanol and total RNA isolated according to PureLink manufacturer's
protocol. cDNA was transcribed using iScript™ Reverse Transcription Supermix for RT-qPCR
(Bio-Rad Laboratories, Hercules, CA). Real Time quantitative PCRs were performed using
SsoAdvanced™ Universal SYBR® Green Supermix (BioRad) per manufacturer’s instructions on
the CFX96™ Real-Time PCR Detection System (BioRad). Primers used are listed below
(Millipore Sigma) (Table 1). These data are representative of three independent experiments each
plated in technical triplicates. Transcript copy number were normalized to the housekeeping
genes, GAPDH and RPL27, by ΔΔCt method and expression calculated by relative fold change.
96

Primer Forward Reverse
GAPDH ACAGTTGCCATGTAGACC TTGAGCACAGGGTACTTTA
RPL27 CGTCAATAAGGATGTATTCAG GTTCTTGCCTGTCTTGTATC
NLRP3 AGGTGTTGGAATTAGACAAC AATACATTTCAGACAACCCC
IL1β CTAAACAGATGAAGTGCTCC GGTCATTCTCCTGGAAGG
TNFα CTATGTCTCAGCCTCTTCTC CATTTGGGAACTTCTCATCC

Table 3-1. Forward and reverse primer sequences used in qRT-PCR experiments.

Inflammasome gene expression profiles were analyzed by RT-Profiler Human Inflammasome
plates (Qiagen). These data were analyzed using the Qiagen Data Analysis Center by DDCt
method.

ELISA
Cell culture supernatants were collected at 24 hours. Cytokines were quantified by V-Plex ELISA
(Meso Scale Diagnostics, Rockville, MD) according to manufacturer's protocol.

Inflammasome Activation Assay
THP-1 cells were seeded into 96 well plates at 40,000 cells in 100 μl of complete media.
Inflammasome activation was quantified by a fluorescent plate reader (BioTek, Synergy H1).
Additionally, cells were seeded onto 12 mm glass coverslips (Neuvitro Corporation, Vancouver,
WA) in a 24 well plate at 2 x 10
5
in 0.5 ml of complete media for confocal imaging. Cells were
97
differentiated in the wells for 48 hours in 100 nM PMA. The complete media was aspirated and
replaced with RPMI +1% HI-FBS before the addition of LPS 100 ng/ml, RTD-1 10 μg/ml or
Azithromycin 50 μg/ml for 6 hours. ATP 5mM (Milipore Sigma) was added for 45 minutes before
labelling of the cells with FAM-FLICA® Caspase-1 Assay Kit (ImmunoChemistry Technologies,
Bloomington, IN) according to manufacturer’s instruction. Inflammasome activity was measured
using a kinetic fluorescent microplate reader (Synergy H1, Bio-Tek). Cells seeded onto the
coverslips were fixed and mounted using Fluoroshield Mounting Medium (Abcam, Cambridge,
UK). Representative confocal images were taken using the ZEISS LSM 880 with Airyscan (ZEISS,
Oberkochen, Germany) and analyzed using ZEN Blue Microscope software (ZEISS).

Data and statistical analysis
Statistical and graphical analysis were carried out using GraphPad Prism version 8.0.1. A
statistical significance level of p<0.05 was determined prior to analysis.

Results
In vivo Efficacy of Aerosolized RTD-1 in Mice with Chronic P. aeruginosa Lung Infection.
We hypothesized that aerosolized RTD-1 would modulate inflammation and resultant lung injury
in vivo. We initiated an aerosolized RTD-1 study to characterize its efficacy by determining its
effect on 1) immune cell infiltration into the lungs, 2) cytokines/chemokines in bronchoalveolar
lavage fluid (BALF) and 3) total lung bacterial burden. Aerosolized RTD-1 efficacy was assessed
by comparing the antibacterial and anti-inflammatory effects between RTD-1 treated and control
mice (Figure 3-2). No difference in antibacterial effect was noted when comparing treated vs.
control groups on days 3 or 7 (Figure 3-2a). Mice treated with RTD-1 appeared to have less weight
loss when compared with controls on day 3, whereas no apparent difference was noted on day 7
(Figure 3-2c). Despite the lack of antibacterial effects, RTD-1 treatment was associated with a
98
significant reduction in total white blood cell count in the BAL on days 3 (-50%; p=0.0003) and 7
(-33%; p=0.0097) (Figure 3-2d). Differentials showed predominantly neutrophils on day 3 and an
increase in the proportion of macrophages by day 7 however, there were no significant differences
between treatment groups (Figure 3-2d).

Figure 3-2. Chronic infection was established by intratracheal instillation of 5 X 10
5
CFUs of P.
aeruginosa (RP73, mucoid CF isolate). Aerosolized RTD-1 at a dose of 167mg/kg commenced
24 hours after infection and continued for 6 days. Effect of treatment on a) lung bacterial burden,
b) total immune cell counts and c) weight changes and d) differential cell counts were measured.
Consistent with the anti-inflammatory effects of RTD-1, treatment was associated with significant
reductions in IL-6, MCP-1, TNFa, IL-17, IL-1b, and TIMP-1 on day 3 (Figure 3-3a). No significant
Control RTD-1 Control RTD-1
10
2
10
3
10
4
10
5
10
6
Total CFUs/lung
Day 3 Day 7
Control RTD-1 Control RTD-1
10
5
10
6
10
7
Total BALF WBCs (log)
***
Day 3
**
Day 7
0 1 2 3 4 5 6 7
-20
-15
-10
-5
0
% Weight Loss
3 Day RTD-1
3 Day Control
7 Day RTD-1
7 Day Control
Days
0
20
40
60
80
100
120
140
% Differential BALF WBCs
Macrophages
PMNs
Control Control RTD-1 RTD-1
C
D
A B
99
differences were noted between treatment and control groups for the majority of the inflammatory
biomarkers on day 7 which could reflect resolution of inflammation (Figure 3-3b).

Figure 3-3. Cytokines were quantified from the BALF of C57BL/6 mice chronically infected with
P. aeruginosa (RP73). The mice were treated with either aerosolized saline or RTD-1 (167mg/kg)
A
B
100
for 1 hour for 6 days 24 hours after bacterial instillation. Cytokines were evaluated on day 3 (a)
and on day 7 (b).

Biological targets for the anti-inflammatory activity of RTD-1 during chronic Pseudomonas
aeruginosa infection.
We performed microarray analysis of lung tissue homogenate and BAL cell pellet RNA isolated
from RTD-1 treated and control mice to help delineate the anti-inflammatory mechanism of RTD-
1 in vivo. Results of the gene expression analyses following a 3-day course of aerosolized RTD-
1 or saline in C57BL/6 mice chronically infected with P. aeruginosa showed downregulation of
several key inflammasome related genes within the lung tissue homogenate and BAL cell pellet
(Table 3-2, Figures 3-(3-4)).
Figure 3-3. Microarray gene expression analysis after 3 days
of treatment with aerosolized RTD-1 for 60 mins (167μg/kg).
The Venn diagram shows expression of 109 and 58 genes
was altered by RTD-1 treatment in BAL cells and lung
homogenate respectively. Twenty-six of the genes were
commonly downregulated by RTD-1 in both tissue groups.

Ingenuity Pathway Analysis (IPA) revealed that several networks were commonly affected by
RTD-1 between the tissues. The IPA generated biological functions and disease heat maps show
that RTD-1 reduced Cell-To-Cell Signaling and Interaction, Hematological System Development
and Function and Inflammatory Response (Figure 3-4). In the lung tissue the highest scoring
networks was clustered around Tumor Necrosis Factor-α (TNFα). The CF airways are known to
contain elevated levels of the proinflammatory cytokine TNFα contributing to chronic
inflammation. These data show significant down-regulation of TNFα in this chronic infection
mouse model. There was also a large reduction in the expression of the proinflammatory
101
cytokines CXCL10 (Lung -4.4; BALF -3.45), CXCL9 (Lung -2.78; BALF -2.33), CXCL2 (Lung -
2.81; BALF -3.22), IL1β (Lung -2.61; BALF -3.27), IL1α (Lung -2.60; BALF -3.03), and IFNγ (Lung
-2.45; BALF -2.00). Overall, inflammation associated genes were significantly reduced including
a number of genes known to be over-expressed in CF airways (e.g. TNFα and IL1β).
Figure 3-4. Ingenuity Pathway Analysis derived network analysis shows RTD-1s predicted effects
based on the literature.

Interestingly, these data showed that a number of inflammasome related genes were highly
downregulated in both tissues (Table 3-2). The downregulation of inflammasome genes is
consistent with the observed treatment effect of RTD-1 on reducing airway neutrophils and begins
to identify a pathway through which RTD-1 may be working. These data are promising and
suggest RTD-1 has therapeutic potential for CF and may be exerting its anti-inflammatory activity
through inhibition of the inflammasome signaling pathway (figure 3-4.).
Inflammasome Genes: Hom FC p value BAL FC p value
AIM2 -1.129 1.47E-06 1.009 0.846
CASP1 (ICE) -1.641 1.44E-06 -1.141 0.048
PYCARD (TMS1, ASC) -1.163 0.0041 -1.068 0.248
NAIP (BIRC1) -1.001 0.9766 1.116 0.015
NLRP1a -1.017 0.3553 1.076 0.0721
102
NLRP3 -1.204 0.0001 -2.212 0.0002
PYCARD (TMS1, ASC) -1.163 0.0042 -1.068 0.248
Negative Regulation of Inflammasomes: Hom FC p value BAL FC p value
BCL2 -1.047 0.3354 -1.015 0.7873
BCL2L1 (BCLXL) -1.074 0.0042 -1.355 0.0405
CD40LG (TNFSF5) -1.019 0.3303 1.051 0.1602
CTSB -1.074 0.3528 -1.061 0.1893
HSP90AA1 1.011 0.632 1.022 0.4343
HSP90AB1 (HSPCB) 1.122 0.0086 1.143 0.0037
HSP90B1 (TRA1) -1.029 0.7481 1.158 0.0436
MEFV -2.097 0.0003 -2.272 0.0014
PSTPIP1 -1.473 0.0003 -1.519 0.0009
PYDC1 (POP1) -1.023 0.2233 1.016 0.6624
SUGT1 -1.008 0.7363 1.003 0.9298
TNF -2.772 0.0001 -2.700 0.0015
TNFSF11 (RANKL) -1.003 0.9143 -1.051 0.22
TNFSF14 -1.137 0.0496 -1.358 0.0164
TNFSF4 (OX40L) -1.018 0.4356 -1.032 0.2648
Signaling Downstream of Inflammasomes: Hom FC p value BAL FC p value
IFNG -2.454 <0.0001 -2.003 <0.0001
IL12A -1.599 <0.0001 -2.701 0.0001
IL12B -1.055 0.0249 -1.012 0.6891
IL18 1.112 0.2412 1.389 0.005
IL1A -2.604 0.0005 -3.033 0.0005
IL1B -2.613 0.0002 -2.273 0.0004
103
IL33 1.081 0.4021 1.082 0.6368
IRAK1 1.036 0.2777 -1.024 0.6509
IRF1 -1.822 <0.0001 -1.886 0.0003
MYD88 -1.360 0.0001 -1.239 0.0001
P2RX7 -1.038 0.0049 -1.036 0.5641
PANX1 -1.254 0.0018 1.106 0.2339
PTGS2 (COX2) -1.014 0.2189 -1.097 0.0119
RIPK2 -1.183 <0.0001 -1.364 <0.0001
TIRAP -1.063 0.1828 -1.014 0.7116
TXNIP 1.476 <0.0001 1.352 0.0001
NOD-Like Receptors Hom FC p value BAL FC p value
CIITA -1.678 <0.0001 -1.073 0.4876
NAIP1 (BIRC1) -1.001 0.9766 1.116 0.0153
NLRP1a -1.017 0.3553 1.116 0.0153
NLRP3 -1.204 0.0001 -2.212 0.0002
NLRP5 1.013 0.3332 1.028 0.0421
NLRP6 -1.004 0.8525 1.027 0.5759
NLRX1 -1.042 0.2505 1.327 0.0019
NOD1 (CARD4) -1.309 0.0033 -1.291 <0.0001
NOD2 -1.146 <0.0001 -1.462 <0.0001

Table 3-2. Gene expression changes of lung homogenate and BAL cells from mice chronically
infected with P. aeruginosa. Gene expression was quantified using Microarray Mouse ref 8 v2.0
Expression Bead Chip. Data was analyzed in Partek Genomics Suite. Blue highlights indicate
genes where RTD-1 induced a greater than 1.5 fold change in either direction.
104

RTD-1 reduces spontaneous inflammatory cytokine secretion in CF sputum leukocytes.
In order to determine the translational potential of RTD-1 we performed complementary studies
to evaluate the anti-inflammatory effect of RTD- 1 in CF sputum immune cells. Six patients with
CF who were hospitalized for treatment of an acute pulmonary exacerbation (APE) participated
in the sputum inflammation study. The median admission demographics were as follows: 28 years
of age, normal weight (body mass index [BMI], 23.4), and moderate lung disease (percent
predicted forced expiratory volume in 1 s [ppFEV1], 39%) (Table 3-3). All of the patients enrolled
had chronic P. aeruginosa-positive respiratory cultures and were receiving treatment with
azithromycin. Total and differential cell counts in sputum demonstrated neutrophil predominance
(Table 3-3). RTD-1 at 100 μg/ml for 24
hours significantly reduced spontaneous
secretion of IL-1β (P < 0.001), TNF (P <
0.05), and IL-8 (P < 0.01), on average by
approximately 2.5-, 2-, and 1.3-fold,
respectively (Figure 3-5). Although IL-6
showed a trend towards being reduced,
variability was large and thus it did not
reach significance (P = 0.14).

Table 3-3. Patient demographics and sputum analysis from enrolled CF patients with acute
pulmonary exacerbation.

105

Figure 3-5. RTD-1 reduces spontaneous inflammatory cytokines in airway leukocytes. Isolated
CF airway leukocytes were cultured in the presence or absence of 100 μg/ml RTD-1 for 24 h.
Release of cytokines IL-1β, TNF, IL-8, and IL-6 was quantified by ELISA. Geometric means and
95% CIs (n = 6/group) are shown. Treatment differences (log2) were analyzed by a paired t test
after baseline correction (RTD-1/baseline); *, P < 0.05; **, P < 0.01; ***, P < 0.001 versus CF
leukocytes alone.

Although the detrimental effects of CF lung disease are predominantly an effect of chronic
neutrophilia the recruitment of immune cells into the lung and the chronic inflammation in these
patients is orchestrated by a number of cell types. There is a great deal of cross talk between
different cell types such as lung epithelia, macrophages, monocytes and other immune cells which
help to orchestrate the airway inflammation. The effect of RTD-1 on these cells is of interest as,
although they may be a minority in the sputum cell population, they are key modulators of
inflammation and cell recruitment. To assess the RTD-1 effect on these cells the following studies
evaluated the RTD-1 immunomodulatory effect on A549 (lung epithelial cell line) and THP-1
(monocytic cell line) monocytes and THP-1 PMA differentiated macrophages.
-2.0 -1.5 -1.0 -0.5 0.0 0.5
IL-6
IL-8
TNF
IL-1β
Fold Change (Log 2)
***
*
**
E
Control RTD-1
0
200
400
600
800
1000
IL-1β [pg/mL]
Control RTD-1
0
200
400
600
800
TNF [pg/mL]
Control RTD-1
0
20000
40000
60000
80000
IL-8 [pg/mL]
Control RTD-1
0
1000
2000
3000
4000
IL-6 [pg/mL]
A B
D C
106
RTD-1 exhibits anti-inflammatory activity through inhibition of NF-κB in THP-1 reporter
cells
Previous studies by Tongaonkar et al. demonstrated that RTD-1 inhibited TLR induced NF-κB
activation by inducing the phosphorylating of AKT, an upstream regulator of NF-κB, in THP-1
macrophages. We conducted similar studies in THP-1 monocytes and macrophages. In both
THP-1 monocytes and macrophages there is a 2 fold inhibition of NF-κB activity when treated
with RTD-1 (Figure 3-6a-b). Azithromycin inhibited NF-κB similarly to RTD-1 and there were no
statistically significant differences between RTD-1 and azithromycin treatment in the THP-1
macrophages although there is a trend towards azithromycin being more potent (figure 3-6b), this
trend was not seen in the THP-1 monocytes (figure 3-6a).

Figure 3-6. THP-1 Lucia NF-κB monocytes (a) and macrophages (b) were treated for 16 h with LPS
(100 ng/ml). Luminescence signal intensity was measured by the Lucia NF-κB reporter gene assay
and calculated as the percent of treated cells over control cells. Results are normalized to LPS
stimulated cells (mean ± SD). Statistical significances between LPS challenged and RTD-1 (10µg/ml)
and Azithromycin (50µg/ml) treated were evaluated with a two-sample t test (****p, < 0.0001, ***p,
<0.001).

0
20
40
60
80
100
120
% NFkB Activation
LPS
RTD-1
AZM
-
-
-
-
- - -
- -
+ + +
+ +
+
***
****
0
20
40
60
80
100
120
% NFkB Activation
LPS
RTD-1
AZM
-
-
-
-
- - -
- -
+ + +
+ +
+
****
***
B A
0
20
40
60
80
100
120
% NFkB Activation
LPS
RTD-1
AZM
-
-
-
-
- - -
- -
+ + +
+ +
+
***
****
0
20
40
60
80
100
120
% NFkB Activation
LPS
RTD-1
AZM
-
-
-
-
- - -
- -
+ + +
+ +
+
****
***
B A
107
RTD-1 driven NF-κB inhibition reduces IL-1β and TNFα gene transcripts
To evaluate the downstream effect of NFKB inhibition, we conducted in vitro experiments with
RTD-1 in LPS stimulated THP-1 monocytes. RTD-1 drastically inhibited IL-1β gene transcription
at a comparable level to azithromycin 3 hours after treatment (Figure. 3-7a). The RTD-1 effect on
TNFα gene expression was considerably lesser than the RTD-1 effect on soluble TNFα protein
secretion as seen in figure 3-8b and as previously reported (Jayne et al. 2018; Tongaonkar et al.
2015; Schaal et al. 2012; Schaal et al. 2018) (Figure 3-7b). The significantly more dramatic effect
of RTD-1 on TNFα protein levels compared to gene levels is likely due to the peptides direct TACE
inhibitory activities.

Figure 3-7. RTD-1 (10 μg/ml) reduces IL-1β and TNFα gene transcription in THP-1 monocytes
stimulated with 100 ng/ml LPS for 3 hours. Gene expression was quantified by qRT-PCR (n = 3).
Treatment differences were analyzed by a t test after correction (LPS stimulated response
normalize to 100%) (****p, < 0.0001).
NT
RTD-1
LPS
LPS + RTD-1
LPS + AZM
LPS + RTD-1 + AZM
0
25
50
75
100
125
% IL1β mRNA induction
****
****
****
NT
RTD-1
LPS
LPS + RTD-1
LPS + AZM
LPS + RTD-1 + AZM
0
25
50
75
100
125
% TNFα mRNA induction
****
****
****
A B
108
RTD-1 treatment reduces THP-1 IL-1β and TNFα cytokine production in LPS stimulated
cells
RTD-1 treatment reduced IL-1β protein production by around 10-fold, this is comparable to the
RTD-1 effect on the IL-1β gene transcript (figure 3-8a). Azithromycin treatment exhibited similar
potency compared to RTD-1 24 hours after treatment (figure 3-8a). Additionally, RTD-1 potently
inhibits TNFα secretion, however interestingly it appears that when dosed in combination there is
a trend towards an increase in TNFα inhibition (figure 3-8b) suggesting that RTD-1 and
Azithromycin may be inhibiting TNFα protein concentrations through different mechanisms of
action.

Figure 3-8. RTD-1 (10 μg/ml) inhibits IL-1β and TNFα protein secretion in THP-1 monocytes
stimulated with 100 ng/ml LPS after 24 hours. Cytokines were quantified by ELISA (n = 3).
Treatment differences were analyzed by a t test after correction (****p, < 0.0001).

NT
RTD-1
Stim
Stim + RTD-1
Stim + AZM
Stim + RTD-1 + AZM
0
5
10
15
IL-1β pg/ml
****
***
***
NT
RTD-1
Stim
Stim + RTD-1
Stim + AZM
Stim + RTD-1 + AZM
0
100
200
300
400
500
TNFα pg/ml
****
**
***
A B
109
Inflammasome associated gene expression in RTD-1 treated THP-1 macrophages is largely
dampened
Microarray expression data from the chronic P. aeruginosa model eluded to RTD-1 potentially
having a targeted effect on the NLRP3 inflammasome. Preliminary experiments in THP-1
monocytes demonstrated they express minimal NLRP3 gene transcripts in comparison to THP-1
differentiated macrophages. Therefore, to investigate the RTD-1 associated inflammasome
effects we used THP-1 macrophages. We assessed THP-1 macrophage gene transcription
changes in LPS and RTD-1 treated cells. Exposure of THP-1 macrophages to 10 μg/mL RTD-1
resulted in significantly decreased expression of downstream inflammasome molecules including,
IL-1β (-8.72), IL18 (-2.125), CXCL1 (-7.225), CXCL2 (-7.925), CCL5 (-2.000) and IFNβ1 (-1.665)
(Figure 3-9).

Figure 3-9. THP-1 macrophages experience inhibition of inflammasome associated genes when
exposed to RTD-1 (10 µg/mL) and LPS (100ng/ml) over 3 hours. RTD-1 down regulated
expression of downstream inflammasome molecules, statistically significant gene expression
changes are plotted above the dotted horizontal line (p = <0.05). The mRNA transcription profiles
by qRT-PCR profiler array were plotted according to the log2 fold change and a -log adjusted p-
value. Treatment differences were analyzed using the multiple t-test function in Prism 8.0.
-10 -5 0 5 10
0
1
2
3
4
Log 2 (FC RTD-1/Control)
-log(Adjusted P Value)
BIRC3
CCL5
CFLAR
CXCL1
CXCL2
HSP90B1
IFNB1
IL18
IL1B
MAP3K7
MAPK9
NFKB1
NFKBIA
NLRP9
RIPK2
TAB2
TNFSF14
RPLP0
110
RTD-1 downregulates NLRP3 gene expression but does not destabilize the gene transcript.
Similar to RTD-1, azithromycin is known to phosphorylate AKT and modulate the AKT/PI3K
pathway (Lendermon et al. 2017). We hypothesized that RTD-1 may be destabilizing the NLRP3
transcript as reported in THP-1 cells treated with Azithromycin (Lendermon et al. 2017). For this
study we utilized actinomycin-D, a transcriptional inhibitor. Cells were treated with LPS (100
ng/ml) and RTD-1 (10 μg/ml) for 3 hours before collection, actinomycin-D was added to half of
the wells and collected after an additional 45 mins. These data show that although RTD-1 is
reducing NLRP3 mRNA transcripts (-2.17 FC; p <0.0001) it is not doing so through transcript
destabilization. There were no statistically significant differences when transcripts were incubated
with RTD-1 and actinomycin-D (figure 3-10).

Figure 3-10. THP-1 Macrophages were stimulated with LPS (100 ng/ml) and RTD-1 (10 μg/ml)
3 hours, an additional set of cells were also exposed to Actinomycin-D (5 μg/ml) for an additional
45 minutes.

RTD-1 inhibits inflammasome activity, likely through NF-κB inhibition
To confirm the downregulation of inflammasome associated genes was translating into a
dampening of inflammasome activity we performed an inflammasome activation assay. These
data showed that LPS and ATP alone are not sufficient to induce significant inflammasome activity
0
1
2
3
4
5
6
Fold Change ΔΔCt
****
LPS + ATP
RTD-1
Actinomycin-D
-
-
-
-
- - -
+
-
+ + +
+ +
+
NS
111
yet have a synergistic effect when combined (figure 3-11a). RTD-1, Azithromycin and the two
treatments combined yielded fold reductions of -1.79 (p = 0.0052), -2.55 (p = 0.0022) and -2.38
(p = 0.0003) respectively (figure 3-11a). Notably, the combined treatment of RTD-1 and
azithromycin did not display any synergistic effect on inflammasome activity.

Figure 3-11. Macrophage-like THP-1 cells were stimulated with 100 ng/ml LPS, 10 μg/ml RTD-1
or 50 μg/ml Azithromycin for 6 hours, 5 mM ATP was added for an additional 45 minutes. a) cells
NT
RTD-1
ATP
LPS
LPS + ATP
LPS + ATP + RTD-1
LPS + ATP + AZM
LPS + ATP + RTD-1 + AZM
0
20
40
60
80
100
120
% Inflammasome Induction
**
**
***
A
B
112
were labelled with FLICA antibody and fluorescence measured. b) representative confocal images
are shown.

Discussion
CF is an autosomal multisystem hereditary disease; the most common cause of death is
premature pulmonary failure. Defective CFTR results in a thick sticky mucus accumulating in the
lungs making these patients highly susceptible to chronic infections (Elborn 2016). The vicious
cycles of infection, inflammation and bronchiectasis contribute to patients declining pulmonary
function. While the outlook for those born with CF has improved significantly as it is no longer
considered a pediatric disease, patients are still dying prematurely with the median predicted
survival age being ~43.6 years (Foundation 2017). Azithromycin is the most commonly prescribed
drug to treat CF pulmonary inflammation (63.8% utilization) (Foundation 2017). Disappointingly,
azithromycin offers modest effects at best. Clinical studies have demonstrated a modest 4%
improvement in FEV1 over a 6-month period which was not maintained past 1 year (Fleet et al.
2013). Therefore, there is an obvious clinical need for safe therapeutics with improved efficacy
profiles to mitigate the persistent and superfluous inflammatory state within the CF lungs.

Cationic peptides exhibit antimicrobial activity in addition to their immunomodulatory properties
(Hancock and Sahl 2006; Hancock, Haney, and Gill 2016). Previous literature from our lab has
demonstrated that the cationic peptide, RTD-1, demonstrated efficacy in a sterile murine model
of acute lung injury (Jayne et al. 2018) and in a CF murine model of chronic lung infection
(Bensman et al. 2017). Furthermore, several other cationic peptides have also displayed efficacy
in murine models of endotoxemia lung injury (Wang et al. 2018) and in a P. aeruginosa alginate
chronic murine model (Wuerth, Falsafi, and Hancock 2017). Our lab has previously demonstrated
that RTD-1 exhibits antimicrobial activity against multidrug resistant P. aeruginosa isolates from
CF patients (Beringer et al. 2016). The dual antimicrobial and immunomodulatory properties of
113
RTD-1 make it a desirable candidate for the treatment of CF lung disease. Moreover, RTD-1 is
non-immunogenic and non-toxic in mice, rats and chimpanzees (Schaal et al. 2012). In addition,
pre-clinical toxicology studies for RTD-1 have demonstrated its excellent safety profile in
preparation for entry into phase 1 clinical studies for rheumatoid arthritis. In this third chapter, we
present evidence that RTD-1 attenuates neutrophil infiltration into the lung of chronically infected
mice, we explore potential mechanisms of action and assess the RTD-1 effect on the
inflammasome.

In this study we utilized the “gold standard” model for murine chronic lung infections to mimic the
highly inflammatory, neutrophil rich CF lung environment. Upon bacterial inoculation, RTD-1
aerosolization reduced total lung WBC counts and significantly reduced the proinflammatory
cytokines IL-6, MCP-1, TNFa, IL-17, IL-1b, and TIMP-1 on day 3. However, no significant changes
were observed at 7 day, this is believed to be due to resolution of inflammation. Due to the more
dramatic effects seen at day 3 we performed microarray analysis on the lung homogenate and
BAL cell pellets from day 3. The gene expression data from this analysis revealed RTD-1 is
downregulating a number of inflammasome associated genes. These findings guided the direction
of the latter experiments in this chapter and the rationale for investigating the inflammasome as
a potential cellular target of RTD-1.

RTD-1 has been shown to have dramatic effects on the cytokine production in monocyte and
macrophage cell lines (Tongaonkar et al. 2015; Schaal et al. 2018; Jayne et al. 2018). The
importance of alveolar macrophages and lung epithelia cross talk in orchestrating and recruiting
neutrophils to the site of inflammation cannot be understated (Hussell and Bell 2014; Bruscia and
Bonfield 2016). However, isolating patient alveolar macrophage or lung epithelia presents
significant logistical challenges. As an alternative, to assess the RTD-1 effect on patient samples,
we isolated immune cells (90% neutrophilic) from CF sputum samples donated by patients
114
experiencing acute lung exacerbations. RTD-1 significantly reduced IL-1β, IL-8 and TNFα in
isolated sputum immune cells, there was a trend towards reduction for IL-6 but due to significant
interpatient variability it did not reach significance (p<0.05). These data further bolster the promise
of RTD-1 as a potential therapeutic for CF lung disease and demonstrate its translational
potential.

The RTD-1 anti-inflammatory mechanism of action is only partially understood within the context
of CF lung inflammation. Published data shows that RTD-1 inhibits NF-κB nuclear translocation
through the phosphorylation of AKT (Tongaonkar et al. 2015). Another study demonstrated that
RTD-1 is a potent TNFα converting enzyme (TACE / ADAM17) inhibitor, TACE is the primary pro-
TNFα sheddase (Schaal et al. 2018). Data presented in this chapter show RTD-1 significantly
reduces gene and protein expression of the proinflammatory cytokines IL-1β, and TNFα.
Interestingly, there appeared to be synergistic effects on TNFα protein inhibition when RTD-1 and
Azithromycin were dosed in combination. This would suggest that the two drugs are working
through alternative mechanisms. The literature suggests that, in addition to its NF-κB inhibitory
effects, Azithromycin also inhibits DNA binding of the transcriptional factor specificity protein 1
(SP1) (Cigana, Assael, and Melotti 2007). Additionally, we observed that RTD-1 inhibited
inflammasome activation and downregulated the transcription of a key inflammasome
component, NLRP3. Azithromycin has been shown to rapidly destabilize the NLRP3 transcript
(Lendermon et al. 2017). We hypothesized that RTD-1 might be working to downregulate NLRP3
through a similar mechanism. To answer this question, we utilized actinomycin-D, a transcription
inhibitor, to assess the direct effect of RTD-1 on the NLRP3 transcript. These data showed RTD-
1 does not destabilized the transcript and thus the NLRP3 downregulation is likely due to
dampening of NF-κB activity at the NLRP3 promoter region.

115
Upon liberation by the inflammasome, IL-1β is free to induce the production of several
chemotactic agents including, but not limited to, LL-33, Muc5ac, CXCL1, CXCL2, and MMP9
which in turn call neutrophils to the site in a “call-to-action” signal (Mahmutovic Persson et al.
2018; Lappalainen et al. 2005; Calkins et al. 2002; Patton et al. 1995). Anakinra, an IL-1Ra
agonist, has been shown to ameliorate inflammasome associated inflammation in infected Cftr–
/– and C57BL/6 mice and in human CF bronchial epithelial cells through negative regulation of
pathogenic NLRP3 activity (Iannitti et al. 2016). In November 2018, a Phase IIa randomized,
placebo-controlled, double-blind, cross-over clinical trial investigating the efficacy and safety of
the, Anakinra, in CF patients was approved by the German Competent Authority. Like Anakinra,
RTD-1 is capable of inhibiting the NLRP3 inflammasome and decreasing IL-1β secretion. Based
upon RTD-1 targeting this key CF pro-inflammatory player and its anti-pseudomonal activity we
hypothesize that RTD-1 would be beneficial in the treatment of CF lung disease.

From these data, we hypothesize that RTD-1’s multi-pronged mechanism of action inhibits the
inflammasome and subsequent mature IL-1β production primarily through NF-κB based activities.
These activities, in combination with the peptide’s inhibition of TNFα liberation, contributes to the
dampened cytokine signaling in the lung. Previous studies have also demonstrated that RTD-1
inhibits neutrophil chemotaxis and adhesion (Jayne et al. 2018), this multi-mechanistic approach
has proved effective in multiple lung infection and lung injury models (Bensman et al. 2017; Jayne
et al. 2018; Beringer et al. 2016). The immunomodulatory mechanism of action of RTD-1 is
somewhat unique in comparison to other cationic host defense peptides where the
immunomodulatory action is an indirect effect of endotoxin neutralization (Tongaonkar et al. 2015;
Schaal et al. 2012). Ongoing mechanistic experiments within our lab are underway to better
understand the multi-mechanistic actions of RTD-1 at the molecular level.

116
Conclusions
To conclude, these data demonstrate that RTD-1 reduces lung neutrophil infiltration in a murine
chronic infection model and reduces cytokine production in the lung. From this mouse study we
found that RTD-1 is significantly downregulating a number of inflammasome related genes. This
led us to conduct several in vitro experiments to better understand how RTD-1 is affecting the
NLRP3 inflammasome. Our data suggests that RTD-1 downregulates inflammasome
components possibly as a downstream result of NF-κB inhibition. The findings support this dual
acting anti-microbial and immunomodulatory peptide as a promising potential therapeutic for the
treatment of CF lung disease.

References

Basso, V., A. Garcia, D. Q. Tran, J. B. Schaal, P. Tran, D. Ngole, Y. Aqeel, P. Tongaonkar, A. J.
Ouellette, and M. E. Selsted. 2018. 'Fungicidal Potency and Mechanisms of theta-Defensins
against Multidrug-Resistant Candida Species', Antimicrob Agents Chemother, 62.

Bensman, T. J., J. G. Jayne, M. Sun, E. Kimura, J. Meinert, J. C. Wang, J. B. Schaal, D. Tran, A.
P. Rao, O. Akbari, M. E. Selsted, and P. M. Beringer. 2017. 'Efficacy of Rhesus Theta-Defensin-
1 in Experimental Models of Pseudomonas aeruginosa Lung Infection and Inflammation',
Antimicrob Agents Chemother, 61.

Beringer, P. M., T. J. Bensman, H. Ho, M. Agnello, N. Denovel, A. Nguyen, A. Wong-Beringer, R.
She, D. Q. Tran, S. M. Moskowitz, and M. E. Selsted. 2016. 'Rhesus theta-defensin-1 (RTD-1)
exhibits in vitro and in vivo activity against cystic fibrosis strains of Pseudomonas aeruginosa', J
Antimicrob Chemother, 71: 181-8.

117
Bonfield, T. L., J. R. Panuska, M. W. Konstan, K. A. Hilliard, J. B. Hilliard, H. Ghnaim, and M.
Berger. 1995. 'Inflammatory cytokines in cystic fibrosis lungs', Am J Respir Crit Care Med, 152:
2111-8.

Bragonzi, A., L. Wiehlmann, J. Klockgether, N. Cramer, D. Worlitzsch, G. Doring, and B. Tummler.
2006. 'Sequence diversity of the mucABD locus in Pseudomonas aeruginosa isolates from
patients with cystic fibrosis', Microbiology, 152: 3261-9.

Bruscia, E. M., and T. L. Bonfield. 2016. 'Cystic Fibrosis Lung Immunity: The Role of the
Macrophage', J Innate Immun, 8: 550-63.

Calkins, C. M., D. D. Bensard, B. D. Shames, E. J. Pulido, E. Abraham, N. Fernandez, X. Meng,
C. A. Dinarello, and R. C. McIntyre, Jr. 2002. 'IL-1 regulates in vivo C-X-C chemokine induction
and neutrophil sequestration following endotoxemia', J Endotoxin Res, 8: 59-67.

Cigana, C., B. M. Assael, and P. Melotti. 2007. 'Azithromycin selectively reduces tumor necrosis
factor alpha levels in cystic fibrosis airway epithelial cells', Antimicrob Agents Chemother, 51: 975-
81.

De Boeck, K., A. Zolin, H. Cuppens, H. V. Olesen, and L. Viviani. 2014. 'The relative frequency
of CFTR mutation classes in European patients with cystic fibrosis', J Cyst Fibros, 13: 403-9.

de Vries, L., A. Griffiths, D. Armstrong, and P. J. Robinson. 2014. 'Cytokine gene polymorphisms
and severity of CF lung disease', J Cyst Fibros, 13: 699-705.

Elborn, J. S. 2016. 'Cystic fibrosis', Lancet, 388: 2519-31.
118

Facchini, M., I. De Fino, C. Riva, and A. Bragonzi. 2014. 'Long term chronic Pseudomonas
aeruginosa airway infection in mice', J Vis Exp.

Fleet, J. E., K. Guha, S. Piper, W. Banya, D. Bilton, and M. E. Hodson. 2013. 'A retrospective
analysis of the impact of azithromycin maintenance therapy on adults attending a UK cystic
fibrosis clinic', J Cyst Fibros, 12: 49-53.

Foundation, CF. 2017. "Cystic Fibrosis Foundation Patient Registry." In.

Guo, H., J. B. Callaway, and J. P. Ting. 2015. 'Inflammasomes: mechanism of action, role in
disease, and therapeutics', Nat Med, 21: 677-87.

Hancock, R. E., E. F. Haney, and E. E. Gill. 2016. 'The immunology of host defence peptides:
beyond antimicrobial activity', Nat Rev Immunol, 16: 321-34.

Hancock, R. E., and H. G. Sahl. 2006. 'Antimicrobial and host-defense peptides as new anti-
infective therapeutic strategies', Nat Biotechnol, 24: 1551-7.

Hussell, T., and T. J. Bell. 2014. 'Alveolar macrophages: plasticity in a tissue-specific context',
Nat Rev Immunol, 14: 81-93.

Iannitti, R. G., V. Napolioni, V. Oikonomou, A. De Luca, C. Galosi, M. Pariano, C. Massi-Benedetti,
M. Borghi, M. Puccetti, V. Lucidi, C. Colombo, E. Fiscarelli, C. Lass-Florl, F. Majo, L. Cariani, M.
Russo, L. Porcaro, G. Ricciotti, H. Ellemunter, L. Ratclif, F. M. De Benedictis, V. N. Talesa, C. A.
Dinarello, F. L. van de Veerdonk, and L. Romani. 2016. 'IL-1 receptor antagonist ameliorates
119
inflammasome-dependent inflammation in murine and human cystic fibrosis', Nat Commun, 7:
10791.

Jayne, J. G., T. J. Bensman, J. B. Schaal, A. Y. J. Park, E. Kimura, D. Tran, M. E. Selsted, and
P. M. Beringer. 2018. 'Rhesus theta-Defensin-1 Attenuates Endotoxin-induced Acute Lung Injury
by Inhibiting Proinflammatory Cytokines and Neutrophil Recruitment', Am J Respir Cell Mol Biol,
58: 310-19.

Konstan, M. W., M. D. Schluchter, W. Xue, and P. B. Davis. 2007. 'Clinical use of Ibuprofen is
associated with slower FEV1 decline in children with cystic fibrosis', Am J Respir Crit Care Med,
176: 1084-9.

Lai, H. C., S. C. FitzSimmons, D. B. Allen, M. R. Kosorok, B. J. Rosenstein, P. W. Campbell, and
P. M. Farrell. 2000. 'Risk of persistent growth impairment after alternate-day prednisone treatment
in children with cystic fibrosis', N Engl J Med, 342: 851-9.

Lands, L. C., and N. Dauletbaev. 2010. 'High-Dose Ibuprofen in Cystic Fibrosis', Pharmaceuticals
(Basel), 3: 2213-24.

Lappalainen, U., J. A. Whitsett, S. E. Wert, J. W. Tichelaar, and K. Bry. 2005. 'Interleukin-1beta
causes pulmonary inflammation, emphysema, and airway remodeling in the adult murine lung',
Am J Respir Cell Mol Biol, 32: 311-8.

Lendermon, E. A., T. A. Coon, J. S. Bednash, N. M. Weathington, J. F. McDyer, and R. K.
Mallampalli. 2017. 'Azithromycin decreases NALP3 mRNA stability in monocytes to limit
inflammasome-dependent inflammation', Respir Res, 18: 131.
120

Levy, H., A. Murphy, F. Zou, C. Gerard, B. Klanderman, B. Schuemann, R. Lazarus, K. C. Garcia,
J. C. Celedon, M. Drumm, M. Dahmer, M. Quasney, K. Schneck, M. Reske, M. R. Knowles, G. B.
Pier, C. Lange, and S. T. Weiss. 2009. 'IL1B polymorphisms modulate cystic fibrosis lung
disease', Pediatr Pulmonol, 44: 580-93.

Lopez-Castejon, G., and D. Brough. 2011. 'Understanding the mechanism of IL-1beta secretion',
Cytokine Growth Factor Rev, 22: 189-95.

Mahmutovic Persson, I., M. Menzel, S. Ramu, S. Cerps, H. Akbarshahi, and L. Uller. 2018. 'IL-
1beta mediates lung neutrophilia and IL-33 expression in a mouse model of viral-induced asthma
exacerbation', Respir Res, 19: 16.

Marjanovic, N., M. Bosnar, F. Michielin, D. R. Wille, T. Anic-Milic, O. Culic, S. Popovic-Grle, M.
Bogdan, M. J. Parnham, and V. Erakovic Haber. 2011. 'Macrolide antibiotics broadly and
distinctively inhibit cytokine and chemokine production by COPD sputum cells in vitro', Pharmacol
Res, 63: 389-97.

Osika, E., J. M. Cavaillon, K. Chadelat, M. Boule, C. Fitting, G. Tournier, and A. Clement. 1999.
'Distinct sputum cytokine profiles in cystic fibrosis and other chronic inflammatory airway disease',
Eur Respir J, 14: 339-46.

Patton, L. M., B. S. Saggart, N. K. Ahmed, J. A. Leff, and J. E. Repine. 1995. 'Interleukin-1 beta-
induced neutrophil recruitment and acute lung injury in hamsters', Inflammation, 19: 23-9.

121
Profita, M., G. Chiappara, F. Mirabella, R. Di Giorgi, L. Chimenti, G. Costanzo, L. Riccobono, V.
Bellia, J. Bousquet, and A. M. Vignola. 2003. 'Effect of cilomilast (Ariflo) on TNF-alpha, IL-8, and
GM-CSF release by airway cells of patients with COPD', Thorax, 58: 573-9.

Qiao, Y., P. Wang, J. Qi, L. Zhang, and C. Gao. 2012. 'TLR-induced NF-kappaB activation
regulates NLRP3 expression in murine macrophages', FEBS Lett, 586: 1022-6.

Samson, C., A. Tamalet, H. V. Thien, J. Taytard, C. Perisson, N. Nathan, A. Clement, P. Y. Boelle,
and H. Corvol. 2016. 'Long-term effects of azithromycin in patients with cystic fibrosis', Respir
Med, 117: 1-6.

Schaal, J. B., T. Maretzky, D. Q. Tran, P. A. Tran, P. Tongaonkar, C. P. Blobel, A. J. Ouellette,
and M. E. Selsted. 2018. 'Macrocyclic theta-defensins suppress tumor necrosis factor-alpha
(TNF-alpha) shedding by inhibition of TNF-alpha-converting enzyme', J Biol Chem, 293: 2725-34.

Schaal, J. B., D. Q. Tran, A. Subramanian, R. Patel, T. Laragione, K. D. Roberts, K. Trinh, P.
Tongaonkar, P. A. Tran, D. Minond, G. B. Fields, P. Beringer, A. J. Ouellette, P. S. Gulko, and M.
E. Selsted. 2017. 'Suppression and resolution of autoimmune arthritis by rhesus theta-defensin-
1, an immunomodulatory macrocyclic peptide', PLoS One, 12: e0187868.

Schaal, J. B., D. Tran, P. Tran, G. Osapay, K. Trinh, K. D. Roberts, K. M. Brasky, P. Tongaonkar,
A. J. Ouellette, and M. E. Selsted. 2012. 'Rhesus macaque theta defensins suppress inflammatory
cytokines and enhance survival in mouse models of bacteremic sepsis', PLoS One, 7: e51337.

Sun, S. C. 2011. 'Non-canonical NF-kappaB signaling pathway', Cell Res, 21: 71-85.
122
Sutterwala, F. S., S. Haasken, and S. L. Cassel. 2014. 'Mechanism of NLRP3 inflammasome
activation', Ann N Y Acad Sci, 1319: 82-95.

Tai, K. P., K. Kamdar, J. Yamaki, V. V. Le, D. Tran, P. Tran, M. E. Selsted, A. J. Ouellette, and A.
Wong-Beringer. 2015. 'Microbicidal effects of alpha- and theta-defensins against antibiotic-
resistant Staphylococcus aureus and Pseudomonas aeruginosa', Innate Immun, 21: 17-29.

Tongaonkar, P., K. K. Trinh, J. B. Schaal, D. Tran, P. S. Gulko, A. J. Ouellette, and M. E. Selsted.
2015. 'Rhesus macaque theta-defensin RTD-1 inhibits proinflammatory cytokine secretion and
gene expression by inhibiting the activation of NF-kappaB and MAPK pathways', J Leukoc Biol,
98: 1061-70.

Tran, D., P. Tran, K. Roberts, G. Osapay, J. Schaal, A. Ouellette, and M. E. Selsted. 2008.
'Microbicidal properties and cytocidal selectivity of rhesus macaque theta defensins', Antimicrob
Agents Chemother, 52: 944-53.

Veliz Rodriguez, T., F. Moalli, N. Polentarutti, M. Paroni, E. Bonavita, A. Anselmo, M. Nebuloni,
S. Mantero, S. Jaillon, A. Bragonzi, A. Mantovani, F. Riva, and C. Garlanda. 2012. 'Role of Toll
interleukin-1 receptor (IL-1R) 8, a negative regulator of IL-1R/Toll-like receptor signaling, in
resistance to acute Pseudomonas aeruginosa lung infection', Infect Immun, 80: 100-9.

Wang, Q., L. Jin, H. Wang, S. Tai, H. Liu, and D. Zhang. 2018. 'AWRK6, A Synthetic Cationic
Peptide Derived from Antimicrobial Peptide Dybowskin-2CDYa, Inhibits Lipopolysaccharide-
Induced Inflammatory Response', Int J Mol Sci, 19.

123
Wilmott, R. W., M. Frenzke, V. Kociela, and L. Peng. 1994. 'Plasma interleukin-1 alpha and beta,
tumor necrosis factor-alpha, and lipopolysaccharide concentrations during pulmonary
exacerbations of cystic fibrosis', Pediatr Pulmonol, 18: 21-7.

Wilmott, R. W., J. T. Kassab, P. L. Kilian, W. R. Benjamin, S. D. Douglas, and R. E. Wood. 1990.
'Increased levels of interleukin-1 in bronchoalveolar washings from children with bacterial
pulmonary infections', Am Rev Respir Dis, 142: 365-8.

Wuerth, K. C., R. Falsafi, and R. E. W. Hancock. 2017. 'Synthetic host defense peptide IDR-1002
reduces inflammation in Pseudomonas aeruginosa lung infection', PLoS One, 12: e0187565.

Zhuo, G. Y., Q. He, L. Xiang-Lian, Y. Ya-Nan, and F. Si-Te. 2014. 'Prolonged treatment with
macrolides in adult patients with non-cystic fibrosis bronchiectasis: meta-analysis of randomized
controlled trials', Pulm Pharmacol Ther, 29: 80-8.

124
CHAPTER 4: Research Summary
General Aims and Conclusions
The aim of this project was to better understand the anti-inflammatory mechanism of action of
RTD-1 within the context of CF lung disease using several preclinical models of CF and in vitro
assays. The key objective of this thesis was to better understand how RTD-1 is exerting its anti-
inflammatory action to better facilitate its clinical development. Through the utilization of chronic
and acute neutrophilic murine models and in vitro assays we investigated the mechanistic
activities of RTD-1. These data disclosed in this thesis furthers our understanding of the RTD-1
anti-inflammatory mechanism of action and helps to promote the future development of this novel
host defense peptide for the treatment of CF lung disease. Future studies are required to
completely understand the multimodal mechanism of action of RTD-1 due to its complex nature.

Anti-inflammatory Activity
Although the infiltration of immune cells into the CF lung is a necessary component in the fight
against invading pathogens, the chronic mass neutrophilia and dysregulated hyperinflammatory
response seen in CF patients contributes to pulmonary function decline. Therefore, targeting this
chronic and hyperinflammatory state is critical to prevent bronchiectasis and preserve lung
function. We used an LPS-induced acute lung injury mouse model, and a chronic P. aeruginosa
lung infection model to assess the RTD-1 in vivo anti-inflammatory properties. The murine model
of acute lung injury shows that subcutaneous RTD-1 dose dependently reduced neutrophil lung
infiltration, alveolar-capillary barrier leakage, and proinflammatory cytokine response including IL-
1β, TNFα and IL-6. From these data we wanted to gain a better understanding of how RTD-1 is
reducing lung neutrophilia. Is this a secondary result of cytokine inhibition from its NF-κB and
TACE inhibitory activity reducing the “call-to-action” signal in the lung? Or is a direct effect on
immune cell migration? To answer this, we tested the RTD-1 ability to inhibit neutrophil
125
chemotaxis. RTD-1 reduced healthy volunteer neutrophil chemotaxis by half, subsequent studies
suggest that RTD-1 exerts this ability through inhibition of neutrophil adhesion. This is a somewhat
unusual behavior for an HDP as several are known to act as chemoattractant signals (Yount and
Yeaman 2006; Patel and Akhtar 2017).

Aerosolized RTD-1 decreased lung neutrophilia in a murine chronic P. aeruginosa infection model
whilst preventing bacterial outgrowth. Gene expression analysis of lung homogenate and BALF
immune cells identified an RTD-1 dampening of inflammasome associated genes. Additionally,
we see RTD-1 potently inhibiting inflammasome regulated cytokines, such as IL-1β, in THP-1
monocytes. Importantly, dysregulated NLRP3 inflammasome activity is reported in CF patients
(Iannitti et al. 2016). Furthermore, several clinical studies have shown that IL-1β is elevated in CF
patient sputum (Osika et al. 1999), plasma (Wilmott et al. 1994) and BAL samples (Wilmott et al.
1990; Bonfield et al. 1995). While IL-1β gene polymorphisms have been correlated with lung
disease severity in CF (Levy et al. 2009; de Vries et al. 2014). Studies have demonstrated that
targeting inflammasome activity can mitigate the damaging effects that chronic bacterial
colonization has on the lungs of CF patients (Iannitti et al. 2016; Veliz Rodriguez et al. 2012).
Thus, RTD-1 is a promising therapeutic with appropriate targets for the treatment of CF lung
disease

Antibacterial Activity
P. aeruginosa colonization in the CF lung has been linked to increased morbidity and mortality,
while those colonized with mucoid strains display even graver outcomes (Emerson et al. 2002;
Henry, Mellis, and Petrovic 1992). The prevention of bacterial outgrowth in the RTD-1 treated
chronically infected mice is an important point to acknowledge. Numerous clinical trials
investigating anti-inflammatory therapies such as ibuprofen and corticosteroids have been
terminated prematurely due to serious adverse events (SAE) which included increase acute
126
exacerbations in the treated groups (Konstan et al. 2007; Konstan et al. 1995; Eigen et al. 1995).
Another clinical study investigating the LTB4 antagonist (BIIL 284 BS) was terminated early due
to an increase in infection related respiratory SAEs in the treatment cohort (Konstan et al. 2014).
The SAEs were associated with pulmonary exacerbation and subsequently led to hospitalisation
and IV antibiotic treatment. After the conclusion of the clinical trial, the Brogonzi lab tested BIIL
284 BS in the murine chronic model of P. aeruginosa lung infection used in our studies. The model
was able to recapitulate the results of the clinical trial and showed that in mice treated with BIIL
284 BS there was an increase in bacterial lung burden (Doring et al. 2014). This study served to
highlight the importance of thorough pre-clinical safety studies and the clinical predictability of this
model. In contrast, RTD-1 effectively prevented bacterial outgrowth in the chronically infected
mice. Notably, RTD-1 has previously been shown to be efficacious against multidrug resistant CF
strains of P. aeruginosa.

Future Directions
Although these data presented in this thesis shows promise for RTD-1 there are several
limitations to this work. Additional experiments are needed to for dose optimization, long-term
aerosolized toxicology and additional anti-inflammatory mechanism of action studies.

Dose Optimization and Long-Term Toxicology
Additional experiments should be carried out to assess dose dependent adverse effects and
determine the maximum tolerated dose by means of single dose escalation studies. Once this
has been determined, the dosing regimen should be optimized through a multiple-dose escalation
study. Once dosing is determined, long-term toxicology studies should be performed. RTD-1 has
been demonstrated to be non-immunogenic and non-toxic in mice rats and chimpanzees.
Additionally, RTD-1 has entered into Phase 1 clinical trials for rheumatoid arthritis and
127
demonstrated an excellent safety profile in pre-clinical testing (information from personal
correspondence). Dosing for the aforementioned clinical trial is subcutaneous and safety and
efficacy for an alternative route of administration, such as nebulized, needs to be assessed. These
data would be critical before clinical testing.

Mechanism of Action Studies
The CF macrophage displays a hyper-inflammatory phenotype (Kopp et al. 2012; Tarique et al.
2017) and superfluous TLR4 expression at the cell surface (Bruscia et al. 2011). The increased
TLR4 is suggested to be a result of diminished caveolin-1, a key structural protein for caveolae
formation and subsequent receptor internalization (Zhang et al. 2013). This abnormal TLR4
regulation is thought to be a result of dysregulated microRNA-199a-5p which, under normal
conditions, is inhibited by phosphorylated AKT (Zhang et al. 2015). Unfortunately, in the CF
macrophage the PI3K/AKT pathway is dysregulated to pathological levels creating a system
where TLR4 is allowed to continuously signal through pro-inflammatory pathways. Interestingly,
it has been shown that Celecoxib (an FDA approved nonsteroidal anti-inflammatory drug) corrects
this dysregulated pathway and hyper-inflammatory response in CF macrophages through the
phosphorylation of AKT (Zhang et al. 2015). Since it has been demonstrated that RTD-1 also
induces AKT phosphorylation (Tongaonkar et al. 2015) we hypothesize that RTD-1 may also be
able to correct this faulty pathway in CF macrophages. Promisingly, preliminary data from our lab
indicate that RTD-1 downregulates TLR4 and its co-receptor CD14 at a gene transcription level.
Additional work is warranted to further investigate the RTD-1 effect on dysregulated CF
macrophage phenotypes such as those mentioned above.

References

128
Bonfield, T. L., J. R. Panuska, M. W. Konstan, K. A. Hilliard, J. B. Hilliard, H. Ghnaim, and M.
Berger. 1995. 'Inflammatory cytokines in cystic fibrosis lungs', Am J Respir Crit Care Med, 152:
2111-8.

Bruscia, E. M., P. X. Zhang, A. Satoh, C. Caputo, R. Medzhitov, A. Shenoy, M. E. Egan, and D.
S. Krause. 2011. 'Abnormal trafficking and degradation of TLR4 underlie the elevated
inflammatory response in cystic fibrosis', J Immunol, 186: 6990-8.

de Vries, L., A. Griffiths, D. Armstrong, and P. J. Robinson. 2014. 'Cytokine gene polymorphisms
and severity of CF lung disease', J Cyst Fibros, 13: 699-705.

Doring, G., A. Bragonzi, M. Paroni, F. F. Akturk, C. Cigana, A. Schmidt, D. Gilpin, S. Heyder, T.
Born, C. Smaczny, M. Kohlhaufl, T. O. Wagner, M. R. Loebinger, D. Bilton, M. M. Tunney, J. S.
Elborn, G. B. Pier, M. W. Konstan, and M. Ulrich. 2014. 'BIIL 284 reduces neutrophil numbers but
increases P. aeruginosa bacteremia and inflammation in mouse lungs', J Cyst Fibros, 13: 156-
63.

Eigen, H., B. J. Rosenstein, S. FitzSimmons, and D. V. Schidlow. 1995. 'A multicenter study of
alternate-day prednisone therapy in patients with cystic fibrosis. Cystic Fibrosis Foundation
Prednisone Trial Group', J Pediatr, 126: 515-23.

Emerson, J., M. Rosenfeld, S. McNamara, B. Ramsey, and R. L. Gibson. 2002. 'Pseudomonas
aeruginosa and other predictors of mortality and morbidity in young children with cystic fibrosis',
Pediatr Pulmonol, 34: 91-100.

129
Henry, R. L., C. M. Mellis, and L. Petrovic. 1992. 'Mucoid Pseudomonas aeruginosa is a marker
of poor survival in cystic fibrosis', Pediatr Pulmonol, 12: 158-61.

Iannitti, R. G., V. Napolioni, V. Oikonomou, A. De Luca, C. Galosi, M. Pariano, C. Massi-Benedetti,
M. Borghi, M. Puccetti, V. Lucidi, C. Colombo, E. Fiscarelli, C. Lass-Florl, F. Majo, L. Cariani, M.
Russo, L. Porcaro, G. Ricciotti, H. Ellemunter, L. Ratclif, F. M. De Benedictis, V. N. Talesa, C. A.
Dinarello, F. L. van de Veerdonk, and L. Romani. 2016. 'IL-1 receptor antagonist ameliorates
inflammasome-dependent inflammation in murine and human cystic fibrosis', Nat Commun, 7:
10791.

Konstan, M. W., P. J. Byard, C. L. Hoppel, and P. B. Davis. 1995. 'Effect of high-dose ibuprofen
in patients with cystic fibrosis', N Engl J Med, 332: 848-54.

Konstan, M. W., G. Doring, S. L. Heltshe, L. C. Lands, K. A. Hilliard, P. Koker, S. Bhattacharya,
A. Staab, and A. Hamilton. 2014. 'A randomized double blind, placebo controlled phase 2 trial of
BIIL 284 BS (an LTB4 receptor antagonist) for the treatment of lung disease in children and adults
with cystic fibrosis', J Cyst Fibros, 13: 148-55.

Konstan, M. W., M. D. Schluchter, W. Xue, and P. B. Davis. 2007. 'Clinical use of Ibuprofen is
associated with slower FEV1 decline in children with cystic fibrosis', Am J Respir Crit Care Med,
176: 1084-9.

Kopp, B. T., B. A. Abdulrahman, A. A. Khweek, S. B. Kumar, A. Akhter, R. Montione, M. F. Tazi,
K. Caution, K. McCoy, and A. O. Amer. 2012. 'Exaggerated inflammatory responses mediated by
Burkholderia cenocepacia in human macrophages derived from Cystic fibrosis patients', Biochem
Biophys Res Commun, 424: 221-7.
130

Levy, H., A. Murphy, F. Zou, C. Gerard, B. Klanderman, B. Schuemann, R. Lazarus, K. C. Garcia,
J. C. Celedon, M. Drumm, M. Dahmer, M. Quasney, K. Schneck, M. Reske, M. R. Knowles, G. B.
Pier, C. Lange, and S. T. Weiss. 2009. 'IL1B polymorphisms modulate cystic fibrosis lung
disease', Pediatr Pulmonol, 44: 580-93.

Osika, E., J. M. Cavaillon, K. Chadelat, M. Boule, C. Fitting, G. Tournier, and A. Clement. 1999.
'Distinct sputum cytokine profiles in cystic fibrosis and other chronic inflammatory airway disease',
Eur Respir J, 14: 339-46.

Patel, S., and N. Akhtar. 2017. 'Antimicrobial peptides (AMPs): The quintessential 'offense and
defense' molecules are more than antimicrobials', Biomed Pharmacother, 95: 1276-83.

Tarique, A. A., P. D. Sly, P. G. Holt, A. Bosco, R. S. Ware, J. Logan, S. C. Bell, C. E. Wainwright,
and E. Fantino. 2017. 'CFTR-dependent defect in alternatively-activated macrophages in cystic
fibrosis', J Cyst Fibros, 16: 475-82.

Tongaonkar, P., K. K. Trinh, J. B. Schaal, D. Tran, P. S. Gulko, A. J. Ouellette, and M. E. Selsted.
2015. 'Rhesus macaque theta-defensin RTD-1 inhibits proinflammatory cytokine secretion and
gene expression by inhibiting the activation of NF-kappaB and MAPK pathways', J Leukoc Biol,
98: 1061-70.

Veliz Rodriguez, T., F. Moalli, N. Polentarutti, M. Paroni, E. Bonavita, A. Anselmo, M. Nebuloni,
S. Mantero, S. Jaillon, A. Bragonzi, A. Mantovani, F. Riva, and C. Garlanda. 2012. 'Role of Toll
interleukin-1 receptor (IL-1R) 8, a negative regulator of IL-1R/Toll-like receptor signaling, in
resistance to acute Pseudomonas aeruginosa lung infection', Infect Immun, 80: 100-9.
131

Wilmott, R. W., M. Frenzke, V. Kociela, and L. Peng. 1994. 'Plasma interleukin-1 alpha and beta,
tumor necrosis factor-alpha, and lipopolysaccharide concentrations during pulmonary
exacerbations of cystic fibrosis', Pediatr Pulmonol, 18: 21-7.

Wilmott, R. W., J. T. Kassab, P. L. Kilian, W. R. Benjamin, S. D. Douglas, and R. E. Wood. 1990.
'Increased levels of interleukin-1 in bronchoalveolar washings from children with bacterial
pulmonary infections', Am Rev Respir Dis, 142: 365-8.

Yount, N. Y., and M. R. Yeaman. 2006. 'Structural congruence among membrane-active host
defense polypeptides of diverse phylogeny', Biochim Biophys Acta, 1758: 1373-86.

Zhang, P. X., J. Cheng, S. Zou, A. D. D'Souza, J. L. Koff, J. Lu, P. J. Lee, D. S. Krause, M. E.
Egan, and E. M. Bruscia. 2015. 'Pharmacological modulation of the AKT/microRNA-199a-
5p/CAV1 pathway ameliorates cystic fibrosis lung hyper-inflammation', Nat Commun, 6: 6221.

Zhang, P. X., T. S. Murray, V. R. Villella, E. Ferrari, S. Esposito, A. D'Souza, V. Raia, L. Maiuri,
D. S. Krause, M. E. Egan, and E. M. Bruscia. 2013. 'Reduced caveolin-1 promotes
hyperinflammation due to abnormal heme oxygenase-1 localization in lipopolysaccharide-
challenged macrophages with dysfunctional cystic fibrosis transmembrane conductance
regulator', J Immunol, 190: 5196-206.

Abstract (if available)

Abstract Chapter 2 Abstract. Acute lung injury (ALI) is a clinical syndrome characterized by acute respiratory failure and is associated with substantial morbidity and mortality. Rhesus theta defensin-1 (RTD-1) is an antimicrobial peptide with immunomodulatory activity. As airway inflammation and neutrophil recruitment and activation are hallmarks of ALI, we evaluated the therapeutic efficacy of RTD-1 in pre-clinical models of the disease. We investigated the effect of RTD-1 on neutrophil chemotaxis and macrophage-driven pulmonary inflammation with isolated human blood neutrophils and LPS-stimulated murine alveolar macrophage (MH-S) cells. Treatment and prophylactic single escalating doses were administered subcutaneously in a well-established murine model of direct endotoxin induced ALI. We assessed lung injury by histopathology, pulmonary edema, inflammatory cell recruitment, and inflammatory cytokines/chemokines in the bronchoalveolar lavage fluid. In vitro studies demonstrated that RTD-1 suppressed CXCL8 induced chemotaxis of isolated human blood neutrophils, TNF mediated neutrophil-endothelial cell adhesion and pro-inflammatory cytokine release in activated murine alveolar macrophages (MH-S cells). Treatment with RTD-1 significantly inhibited in vivo LPS-induced ALI by reducing pulmonary edema and histopathological changes. Treatment was associated with dose- and time-dependent inhibition of proinflammatory cytokines (TNF, IL-1β, and IL-6), peroxidase activity, and neutrophil recruitment into the airways. Anti-inflammatory effects were demonstrated in animals receiving the peptide up to 12 hours after LPS challenge. Notably, subcutaneously administered RTD-1 demonstrates good peptide stability as demonstrated by the long in vivo half-life. Taken together, these studies demonstrate that RTD-1 is efficacious in an experimental model of ALI through inhibition of neutrophil chemotaxis and adhesion, and the attenuation of proinflammatory cytokines and gene expression from resident alveolar macrophages. ❧ Chapter 3 Abstract. Background: Cystic fibrosis (CF) is characterized by vicious cycles of chronic airway obstruction, inflection and inflammation which leads to pulmonary function decline and ultimately respiratory failure and premature death. Rhesus Theta Defensin-1 (RTD-1) is a macrocyclic peptide with immunomodulatory properties which has previously been shown to inhibit inflammasome related cytokines. The studies in this chapter describe the in vivo RTD-1 effects in a chronic murine lung infection model and in vitro studies which aim to further elucidate the peptides inflammasome related activities. ❧ Methods: For these studies we utilized a chronic mouse infection model using Pseudomonas aeruginosa embedded agar beads instilled intra-tracheally. The mice received RTD-1 or saline via nebulization starting 24 hours after inoculation, with dosing continued daily for 6 days. Lung immune cell infiltration, bacterial burden, cytokine concentration, and gene expression were assessed (one-way ANOVA, t-test and Benjamini-Hochberg tests were used respectively). Additionally, in vitro RTD-1 inflammasome specific effects were assessed through qRT-PCR, ELISA and confocal microscopy. Inflammasome activation was induced by LPS priming of THP-1 cells exposed to an additional ATP inflammasome activation step with or without RTD-1 treatment

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Therapeutic potential of host defense peptides for the treatment of cystic fibrosis lung disease

PDF

Therapeutic potential of Rhesus theta defensin-1 for the treatment of COVID-19 pneumonia

PDF

Therapeutic potential of rhesus theta (θ) defensin-1 in cystic fibrosis airway infection and inflammation

PDF

Immunomodulatory properties, mechanisms, and therapeutic potential of macrocyclic theta defensins

PDF

Identification and characterization of the primary Theta Defensin Cycloconvertase

PDF

Immunomodulatory and regenerative potential of amniotic fluid stem cells as a treatment strategy for pulmonary fibrosis

PDF

Modulation of the renin-angiotensin system (RAS) for the treatment of COVID-19

PDF

Investigating the modulatory mechanisms of ILC2s as a therapeutic strategy in the context of health and disease

PDF

Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

PDF

Clinical, functional and therapeutic analysis of CD99 in acute myeloid leukemia

PDF

Increased cathepsin S plays an important role in ocular surface manifestations in Sjögren’s syndrome

PDF

Identification of small-molecules targeting CXCR2 function and signaling

PDF

Role of purinergic P2X7 receptors in inflammatory responses in the brain and liver: a study using a mouse model of chronic ethanol and high-fat diet exposure

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

The role of endogenous neuregulin-4 during immune-mediated intestinal injury

Asset Metadata

Creator Jayne, Jordanna Grace (author)

Core Title Therapeutic potential of rhesus theta defensin-1 in the treatment of inflammatory lung diseases

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Clinical and Experimental Therapeutics

Publication Date 06/17/2019

Defense Date 03/07/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag acute lung injury,anti-inflammatory,cyclic peptide,cystic fibrosis,Inflammation,OAI-PMH Harvest,rhesus theta defensin-1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Beringer, Paul (committee chair), Ouellette, Andre (committee member), Wong-Beringer, Annie (committee member)

Creator Email jayne@usc.edu,jgjayne2@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-174428

Unique identifier UC11660107

Identifier etd-JayneJorda-7488.pdf (filename),usctheses-c89-174428 (legacy record id)

Legacy Identifier etd-JayneJorda-7488.pdf

Dmrecord 174428

Document Type Dissertation

Format application/pdf (imt)

Rights Jayne, Jordanna Grace

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA