University of Southern California Dissertations and Theses

Engineered exosomes for immunotherapy

(USC Thesis Other)

Engineered exosomes for immunotherapy

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Engineered Exosomes for Immunotherapy

by

Xinping Duan
——————————————————————————————————————
A Thesis Presented to the
FACULTY OF THE USC SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(PHARMACEUTICAL SCIENCES)
May 2020

ii
Acknowledgements
I would like to thank Dr. Yong (Tiger) Zhang as my principal investigator for the past two year
academic journeys. He supports my thoughts, research and any decisions at all time, and he is
always ready and happy to answer questions from us. It was with his direction and help that I
was able to complete my thesis.
I would like to thank Dr. Curtis T. Okamoto and Dr. Angel P. Tabancay for reviewing my thesis
and kindly providing ideas and revisions to make it better.
I would like to thank all my lab members, Qinqin Cheng, Xiao-Nan Zhang, Xiaojing Shi, Jeff
Dai, Albert Lam, Tianling Hou and Jiawei Li for assisting me to involve in the lab surroundings
and teaching me more essential skills for greater improvement.
Finally, I have to express my sincere gratitude to my parents. It will be impossible for me to
study in the School of Pharmacy at USC and finish my thesis in the last semester without their
support and understanding. They are always my strongest backing.

iii
Table of Contents
Acknowledgements........................................................................................................................ii
List of Tables .................................................................................................................................v
List of Figures ...............................................................................................................................vi
Abbreviations ..............................................................................................................................vii
Chapter 1 Introduction ..................................................................................................................1
1.1 Epidermal Growth Factor (EGFR) in Cancer.....................................................................1
1.2 CD16...................................................................................................................................5
1.3 Monoclonal 3G8 Antibody.................................................................................................6
1.4 Exosomes............................................................................................................................6
1.5 EGFR and 3G8 Engineered Exosomes...............................................................................8

Chapter 2 Experimental Procedures ...........................................................................................11
2.1 Molecular Cloning and Fusion Protein Expression..........................................................11
2.2 Purification of Exosomes..................................................................................................16
2.3 Immunoblot Analysis........................................................................................................20
2.4 Flow Cytometry Analysis.................................................................................................22

Chapter 3 Results and Conclusion...............................................................................................23
3.1 Molecular Cloning of Anti-CD16 and Anti-EGFR Fusion Protein..................................23
3.2 The Expression of Engineered Exosomes.........................................................................26
3.3 Expression of CD16 in MDA-MB-453 Cancer Cell Line................................................30
3.4 Binding Affinity of Engineered Exosomes.......................................................................34
3.5 Conclusion........................................................................................................................38

iv
Chapter 4 Discussion and Future Directions..............................................................................38
References ....................................................................................................................................43

v
List of Tables
Table 1: Primers were used in PCR..............................................................................................11
Table 2: Cycling parameters set for the PCR reaction..................................................................12

vi
List of Figures
Figure 1: Utilization of anti-EGFR monoclonal antibodies (mAb) in EGFR signaling
pathways..........................................................................................................................................4
Figure 2: Schematic representation of engineered exosomes.......................................................10
Figure 3: Schematic representation of four steps of centrifugation for exosome purification.....19
Figure 4: PCR products of designed fragments of the combination of anti-CD16 and anti-
EGFR.............................................................................................................................................25
Figure 5: Western blot analysis of the engineered exosomes by the fusion proteins...................29
Figure 6: Analysis of CD16 expression in transfected MDA-MB-453 CD16
!
cell line............33
Figure 7: Flow cytometry analysis of anti-CD16 and anti-EGFR engineered exosomes.............37

vii
Abbreviations
ADCC Antibody-Dependent Cell Mediated Cytotoxicity
CR1 Cysteine-Rich 1
ddH2O Double-distilled Water
DPBS Dulbecco’s Phosphate-buffered Saline
EGF Epidermal Growth Factor
EGFR Epidermal Growth Factor Receptor
Fc region Fragment Crystallizable Region
FITC Fluorescein Isothiocyanate
HC Heavy Chain
IgG Immunoglobulin G
Lamp2 Lysosome-associated membrane protein 2
mAb Monoclonal Antibody
MVB Multivesicular Body
NK Cell Natural Killer Cell
PBS Phosphate-buffered Saline
PBST Phosphate-buffered saline with Tween 20
PCR Polymerase Chain Reaction
PDGFR Platelet-Derived Growth Factor Receptors
PEI Polyethyleneimine Transfection Reagent
RTK Receptor Tyrosine Kinase

viii
scFv Single-Chain Variable Fragment
UV light Ultraviolet light

1
Chapter 1 Introduction

1.1 Epidermal Growth Factor Receptor (EGFR) in Cancer
The epidermal growth factor receptor (EGFR), which is known as regulating and modulating
the cell signaling, migration and proliferation, is a member of the receptor tyrosine kinase (RTK)
family and functions as a transmembrane protein. It is divided into five sections totally and
located in both intracellular and extracellular space. Therefore, EGFR owns an extracellular
domain to be ready for binding to the ligands of epidermal growth factor family (EGF family).
There is a cysteine-rich 1 (CR1) subdomain that includes a beta-hairpin loop to maintain the
receptor’s function. Under a ligand-free condition, the beta-hairpin loop interacts with CR2 to
keep a closed form and reject receptor-receptor interaction (Wieduwilt and Moasser, 2008). Once
the receptor is bound to ligands, the receptor undergoes conformational change, and the
activation leads to the conversion of the inactive monomeric form of receptor into an active
homo- or hetero-dimer. The dimerization then causes further conformational change of
intracellular tyrosine kinase domain to be stimulated by autophosphorylations of tyrosine at the
c-terminus of EGFR (Normanno et al., 2005). After that, the waiting signaling components will
be “awakened” by phosphorylation or other mechanisms to promote downstream signaling
pathways including RAS, STAT, Akt and etc. Most of these signaling pathways play essential
roles for cell proliferation, growth and survival.

2
Since at the beginning, most cancer cells were proposed to yield a number of peptide growth
factors to bind to the receptors, the contribution of growth factor receptors in dependently
promoting cell signaling and further pathogenesis of human cancer was verified. Later, several
pieces of evidences and research studies demonstrated that not only raised levels of growth
factors, high level expression of growth factor receptors and intracellular signal transduction
proteins also can lead to tumor progression. Based on these facts, numerous studies started to
focus on sub-species under each category. Among these, EGFR and its ligand received higher
attention in the development of human carcinoma. EGFR is known to be involved in the renewal
of stem cells, so most mutations in genes that expressed by receptors cause defects in organ’s
development, such as liver, lung and even central nervous system (Normanno et al., 2005).
Overview of 200 relevant references show that more than 10 types of cancers have been shown
to be linked to the overexpression of EGFR; therefore, the relationship between EGFR and
cancer progression can be served as a prognosis indicator, and therapies used to treat the severe
carcinoma due to EGFR triggering cell proliferation are established and developed (Nicholson et
al., 2001).
At the same time, the first molecular target illustrating the ability to be targeted by
monoclonal antibody is EGFR, and later this property was developed and used for cancer
therapies (Martinelli et al., 2009). The major pathway is treating the extracellular domain of
EGFR with anti-EGFR monoclonal antibodies, and thus the binding between antibody and
inactive EGFR will interfere the ligand-receptor binding to further inhibit the activation of

3
EGFR-mediated signaling. Our study utilizes this kind of monoclonal antibodies (mAb) for
display on exosomes to target EGFR-overexpressing tumor cells.

4

Figure 1: Utilization of anti-EGFR monoclonal antibodies (mAb) in EGFR signaling
pathways. Binding between EGFR-ligands and EGFR leads to dimerization and activation,
which contribute to downstream signaling pathways, like RAS and PI3K. The utilization of anti-
EGFR monoclonal antibodies (mAb) inhibits the dimerization and further shuts down signaling
pathways.

5
1.2 CD16
The presence of cellular receptors demonstrates a critical pathway in innate immunity, which
recognize the constant regions of immunoglobulins to stimulate immune responses through
natural killer (NK) cell, neutrophils and etc. (Meghan et al., 2011).
Natural killer cells are one of the members of innate lymphocytes, and its capacity is majorly
exhibiting anti-tumor responses without antigen exposure. In a normal human body, these cells
occupy 5-20% of circulating lymphocytes. However, NK cells migrate at early stages and
primarily perform cytolytic activities for immune responses in tissues and secondary lymphoid
organs. CD56 and CD16 are the most common markers on NK cells (Abel et al., 2018).
According to the surface density of CD56, the NK cells are divided into two functional groups,
𝐶𝐷56
"#$%&'
and 𝐶𝐷56
($)
. The 𝐶𝐷56
"#$%&'
population is typically present in tissues with little
expression of CD16 and shows higher production of cytokine, but 𝐶𝐷56
($)
population, which
predominates in peripheral blood, has higher levels of CD16 expression and is cytotoxic even
without the stimulation of interleukins (Romee et al., 2013). The existence of two subsets
illustrates that an efficient dense relies on both cytotoxic activity for cancer cell death and
cytokine and chemokine’s production for triggering inflammatory responses.
CD16, also named as FcγRIII, is a Fc receptor and locates on the surface of peripheral blood
NK cells, macrophages, monocytes and neutrophils. It owns the ability of directly killing of
target cells. It also has two isoforms, CD16a which is the signaling form of receptor, and CD16b
without the transmembrane domain that can only anchor to the membrane through

6
glycosylphosphatidylinositol (Meghan et al., 2011). Downregulation of CD16 could result in
defect of NK cell’s cytotoxic functions. As its functions, it can bind to the Fc domain of IgG
antibodies, and then the antibody-dependent cell mediated cytotoxicity (ADCC) is operating to
kill malignant cancer cells or virally infected cells. On the other hand, anti-CD16 monoclonal
antibodies (mAb) could also interact with CD16, which mediate ADCC-independent cell lysis.
This property makes CD16 receptor on NK cells be a great candidate for targeting cancer
immunotherapy.

1.3 Monoclonal 3G8 Antibody
Monoclonal 3G8 antibody initially was reported to inhibit IgG complexes but later studies
figured out it was ideal to work as an anti-CD16 antibody. Studies shown that anti-CD16 mAb or
other large immune complexes not only have higher affinity for CD16 on NK cells than IgG Fc,
but also the signals transmitted to stimulate NK are maximized by receptor-ligand interaction
(Bowles et al., 2005).
In this study, we genetically displayed the monoclonal 3G8 antibody on the exosomal surface
by fusing to known transmembrane proteins, to target exosomes to CD16 receptor on NK cells.

1.4 Exosomes
For forty years ago, extracellular vesicles are separated into three groups: exosomes, micro-
vesicles or ectosomes, and apoptotic bodies, based on the size and cell of origin (Bunggulawa et

7
al., 2018). At the beginning of discovery of exosomes, it was regarded as extracellular wastes
due to cell apoptosis or damages. However, with increasing number of research results, exosome
recently was discovered as a new type of lipid cellular vesicle to encapsulate proteins and genetic
materials to transport among cells as a “communication carrier.” When exosomes are directly
derived from stem cells, they can be used as regenerative medicine. Compared to other types of
extracellular vesicles, exosomes own a much smaller diameter which only has 30-150 nm
(Gomez et al., 2018). Benefitting from the property of size, exosome is taken into account as the
most promising way in mediating cell-cell communications because of simpler fusion machinery.
Nowadays, the exosomes become a novel drug delivery carrier to induce cellular processes, such
as immune responses. They can be selectively packed with genetic materials, like microRNA,
messenger RNA and proteins. And they also can be modified to be delivered to target organelles.
Therefore, many studies focus on modifying the exosomes to enhance not only its delivery
ability but also certain conjugate’s function.
However, many aspects of exosomes still remain mysterious and needs more investigations,
for now, the properties, like intrinsic long-term circulatory capability, natural vesicles for
transportation, and high rate of encapsulation, reinforces the possibility of exosome as a cancer
therapy to control tumor cell progression (Liu and Su., 2019).

8
1.5 EGFR and 3G8 Engineered Exosomes
There are several types of engineered exosomes, the most representative ones are modifying
surface proteins on exosome for targeting and encapsulating the genetic cargos for better
delivery. As a result, the loading and targeting are tricky but essential problems for leveraging
therapeutic potentials of exosomes (Liu and Su., 2019). The encapsulating form of exosomes not
only could carry the macromolecules, like miRNA, inside of the exosome from bone marrow
stroma to breast cancer cells, but also could be loaded with chemotherapeutic agents to lower the
deleterious effects caused by drug toxicity (Bellavia et al., 2018). In our study, we tried to use
the first representative method to engineering exosomal surface and try to recruit NK cells and
tumor cells at the same time in order to trigger immune responses from immune effector cells to
suppress and even “kill” the malignant cancer cells.
As a result, we genetically displayed two monoclonal antibodies, which are anti-CD16 and
anti-EGFR antibodies, on the surface of exosome membrane. To facilitate the anchoring of two
antibodies on the surface, one transmembrane protein, lysosome-associated membrane protein 2b
(Lamp2b), is respectively fused with two antibodies. Lamp2b belongs to a family of membrane
glycoproteins and is a spliced form which functions as a membrane protein on exosome to
localize monoclonal antibodies extracellularly. Compared to other membrane protein, Lamp2b
was widely investigated to stably facilitate the display of other proteins for exosome targeting
(Vakhshiteh et al., 2019), and it has an extracellular N-terminus and an intracellular C-terminus
associated by a transmembrane domain.

9
Under monoclonal anti-CD16 antibody coated exosomes, the NK cells are recruited for
targeted cell lysis (Romee et al., 2013). Simultaneously, the anti-EGFR antibody would detect
the tumor cells which have abundant of EGFR receptor expression. Therefore, the modified
exosomes target directly to these tumor cells and redirect the NK cells for anti-cancer immunity.

10

Figure 2: Schematic representation of engineered exosome. The exosomes are modified by
presenting anti-EGFR and anti-CD16 antibodies extracellularly. These two fragments are fused
to Lamp2b which locates on the membrane. The engineered exosomes gain abilities to target
cancer cells and recruits NK cells simultaneously.

11
Chapter 2 Experimental Procedures

2.1 Molecular Cloning and Fusion Protein Expression
Polymerase Chain Reaction (PCR)
In order to modify the surface protein on exosomes, cloning of new fusion proteins and
making them expressed in cells are essential. Synthetic genes encoding the anti-CD16 (3G8
antibody) and anti-EGFR were inserted into pDisplay vector fused with Lamp2b membrane
protein and this whole set of sequence was used as a template in designing primers and for
further PCR reactions. In our study, both anti-human CD16 scFv and anti-mouse CD16 scFv
were chosen to fuse with EGFR-Lamp2b. For convenience of future detection, a HA-tag
(YPYDVPDTA) was placed at the N-terminus of anti-CD16 (3G8) scFv.

Table 1: Primers were used in PCR.
Human
H3G8 forward
primer (35 bps)
5’- GGCCAGATCTGACATCGTGACCCAATCTCCAGACT -
3’
EGFR-H3G8 reverse
primer (50 bps)
5’- GTTCGTCGACACTTCCTCCACCACCCTTCAGTTCCAG
CTTGGTGCCAGCG -3’

12
Mouse
M3G8 forward primer
(45 bps)
5’- GCGGTCTTATGCATATCCATATGATGTTCCAGAT
TATGCTGGGGC -3’
EGFR-M3G8 reverse
primer (50 bps)
5’- GTTCGTCGACACTTCCTCCACCACCCTTCAGTTC
CAGCTTGGTGCCAGCG -3’

The primers were ordered from Integrated DNA Technologies IDT (IDT, Coralville, IA),
and dissolved by ddH2O and diluted to 100 𝜇𝑀 prepared as stock primers. The following
components: 3 𝜇𝐿 of 10 𝜇𝑀 forward primer, 3 𝜇𝐿 of 10 𝜇𝑀 reverse primer, 1 𝜇𝐿 of 200
ng/𝜇L DNA template of inserted sequence, 10 𝜇𝐿 of 10X 𝐴𝑐𝑐𝑢𝑃𝑟𝑖𝑚𝑒
*+
Pfx reaction mix
(Invitrogen, Carlsbad, CA), 0.8 𝜇𝐿 of 𝐴𝑐𝑐𝑢𝑃𝑟𝑖𝑚𝑒
*+
Pfx DNA polymerase (Invitrogen,
Carlsbad, CA), and finally 82.2 𝜇𝐿 of ddH20 (total volume is 100 𝜇𝐿), were added together and
pipetted inside of the PCR tubes several times to make sure they were mixed well. Then these
tubes were placed into PCR machine to run 30 cycles of gene amplification.
Table 2: Cycling parameters set for the PCR reaction.
Step Time Temperature
1. Initialization 5 minutes 95 ℃
2. Denaturation 15 Seconds 95 ℃
3. Annealing 90 Seconds 63 ℃ (*)
4. Extension 2 minutes 68 ℃

13
*Notes: Temperature was determined according to melting temperature of assigned primers
and length of amplified fragment
5. Repeat step 2-4 for 30 times
6. Cool down mixture and store at 4℃
The products after 30 cycles of PCR reactions were analyzed by agarose gel electrophoresis
to confirm its size and completeness. The gel contained 1.0% TBE agarose gel and Quick-Load
Purple 1 kb Plus DNA Ladder (New England BioLabs, Ipswich, MA) was used as the marker.
The gel bands in correct size were cut under UV imaging and were extracted back to DNA
fragments by ZymoClean DNA Recovery Kit (Genesee Scientific, San Diego, CA).

Molecular Cloning
Through the PCR reaction, the inserted DNA was amplified and was ready to be put into the
backbones. We placed same restriction sites on both inserted DNA fragments and vectors, so
they can be digested by same restriction enzymes in order to stick the ends perfectly. The
following components: 2 𝜇𝐿 of 10,000 units/mL SalI-HF restriction enzyme (New England
BioLabs, Ipswich, MA), 2 𝜇𝐿 of 10,000 units/ml BglII restriction enzyme (New England
BioLabs, Ipswich, MA), 2 ng of DNA fragments, 5 𝜇𝐿 of 10X NEBuffer 3.1 (restriction
enzymes reaching 100% activity in 10X NEBuffer 3.1) were mixed well and the final volume is
made up to 50 𝜇𝐿. The double digestion happened under 37℃ for 3 hours. The digestion

14
products were analyzed by gel electrophoresis and regained by ZymoClean DNA Recovery Kit
(Genesee Scientific, San Diego, CA).
After the double digestion, the separate fragments were required to ligate together to get a
complete gene sequence. Due to the sticky ends created by last digestion step, the inserted
fragments and vector fragments could be paired with each other easily. By establishing the
ligation, the following components: 4 𝜇𝐿 of 10X T4 ligase buffer (New England BioLabs,
Ipswich, MA), 2 𝜇𝐿 of standard T4 DNA ligase (New England BioLabs, Ipswich, MA), 400ng
of vector fragments, 485 ng of inserted DNA fragments (calculated by the ratio of length of each
fragment), and ddH20 to total volume of 40 𝜇𝐿 were put together for reaction under 16 ℃ and
overnight. Instead of DNA recovery, the ligation products only needed to be cleaned,
concentrated and eliminate any contaminations, so ZymoClean DNA Clean & Concentrator Kit
(Genesee Scientific, San Diego, CA) was used.
Totally 10 𝜇𝐿 ligation products were eluted at the end of purification, and directly taking 1
𝜇𝐿 pipetted into 50 𝜇𝐿 DH10B electrocompetent cells. Then the cells went through the process
of electroporation with the voltage at 1.3 kV. 400 𝜇𝐿 Luria Broth (LB) was added in and
incubation of the mixture was under 37 ℃ for 50 minutes. The final products were put on LB
plates, and these plates were incubated at 37 ℃ for overnight.
The colonies were picked up after overnight growing, and in order to confirm if they are the
correct colonies, we performed the colony PCR to reduce unnecessary losses. 25 𝜇𝐿 of 2X
GoTaq Green Master Mix (Promega Corporation, Madison, WI), 1.0 𝜇𝑀 of forward primer, 1.0

15
𝜇𝑀 of reverse primer, and ddH20 (final volume is 45 𝜇𝐿) were mixed in one autoclaved tube
and this mixture was drawn evenly into 5 small PCR tubes. The individual colonies were used as
templates and pipetted into each PCR tube. Further PCR machine automatically ran 30 cycles as
same as the first PCR step. The correct colony displayed correct length on ethidium bromide
staining agarose gel, and it could be incubated with LB again to further isolate the plasmid. The
resulting expression constructs were sent to GENEWIZ to verify its sequence for next-step
expression.

Cell Expression of Fusion Proteins
The large volume and concentration of plasmid was extracted by ZymoPURE II Plasmid
Maxiprep Kit (Genesee Scientific, San Diego, CA), because the cell expression needed such
amount of plasmid. The expression of the construct of anti-CD16 and anti-EGFR fused to
Lamp2b was achieved by the transfection into Expi293 cells due to the Expi293 cells could give
a higher production of exosomes. Before the transfection, the cells were maintained in BalanCD
HEK293 Medium (Irvine Scientific, Irvine, CA) under 37 ℃ and had already reached the
density of 4.0×10
,
𝑐𝑒𝑙𝑙𝑠/𝑚𝐿. Among the transfection:
1. Maintained cells was suspended down and the supernatant was siphoned.
2. Diluting remaining cells and counting them under microscope.
3. Drawing enough cells and 2.5×10
,
𝑐𝑒𝑙𝑙𝑠/𝑚𝐿 was the final transfection density with
250 mL of final volume.

16
4. Preparing 𝐸𝑥𝑝𝑖𝐹𝑒𝑐𝑡𝑎𝑚𝑖𝑛𝑒
*+
293/ plasmid DNA complexes.
• Adding 1,000 𝜇𝐿 polyethylenimine transfection reagent (PEI) (Polysciences,
Warrington, PA) to 250 𝜇𝑔 of plasmid, and vortexing the tube gently for 5 seconds.
• Notes*: PEI prepared through suspending 0.1 g of PEI 25K (Polysciences,
Warrington, PA) into 90 mL of ddH2O, stirring to fully dissolved at pH<2.0, then
adjusting pH back to 6.9-7.1, and adding more water until the volume is 100 mL.
• Adding the mixture from last step into 12.5 mL of 𝑂𝑝𝑡𝑖−𝑀𝐸𝑀
*+
I Reduced
Serum Medium (Thermo Fisher Scientific, Houston, TX), and vortexing the larger
tube gently for 5 seconds.
• Let the prepared solution stand in hooded environment for 20 minutes.
5. After standing 20 minutes at room temperature, the 𝐸𝑥𝑝𝑖𝐹𝑒𝑐𝑡𝑎𝑚𝑖𝑛𝑒
*+
293/ plasmid
DNA complexes were poured into the shaker flask which had the prepared Expi293 cells.

2.2 Purification of Exosomes
The media were collected at Day 3 and Day 6 for isolating exosome. Once the Day 3 media
were taken out, fresh and warm media were added in the shaker flask again to continue the
production process of exosomes. After the collecting, three steps of centrifugation, which could
separate different contents based on their size, density and shape, were required for the exosome
isolation.

17
First, the collected media were centrifuged at 4,000 ×g for 30 mins in order to remove few
remaining dead cells. The supernatant media were poured into new tubes and stored at 4 ℃.
The second step required a high-speed centrifuging machine which could perform 14,000
×g for 50 minutes. This procedure pulled cellular debris and large particles out of the media, so
these pellets were discarded, and remaining solution were stored at 4 ℃ for the next
centrifugation.
The purified media were transferred to polycarbonate bottles (Beckman Coulter Life
Sciences, Indianapolis, IN) for ultracentrifugation. The ultracentrifugation-based isolation
technique was operated under 4 °C due to production requirements of purity and high-
performance of exosome. The extracellular vesicles, like exosome, could be separated based on
their physical property and density through applying external centrifuging force (Li et al., 2017).
The polycarbonate bottles containing media received 60,000 ×g ultracentrifugation in a
Type 70 Ti rotor (Beckman Instruments, IN, USA) lasted for 2 hours, and the environment
should be under vacuum. After 2 hours, the exosomes accumulated at the bottom of bottles as a
transparent pellet. All left media were pour-out, and fresh 1X Dulbecco’s Phosphate-buffered
Saline (DPBS) (Corning, Manassas, VA) was added into the bottles slowly and gently to wash
the pellet one more time. The waste of pellet would be washed off, so the remaining supernatant
was dumped out. Purer pellet then was resuspended by 400 𝜇𝐿 of DPBS, and we pipetted several
times to make sure that the whole pellet was scratched off from the bottles. In order to let the
debris of pellet dissolve in the DPBS, the tube containing resuspended pellet was vortexed 20

18
minutes. Another round of 15,000 ×g high-speed centrifugation performed 15 minutes to move
the impurities and only supernatant exosomes were saved.

19

Figure 3: Schematic representation of four steps of centrifugation for exosome purification.
500 rpm 10 minutes could get cells in pellet. 4,000 ×g 30 minutes could get dead cells in pellet.
14,000 ×g 50 minutes could get cell debris and large particles in pellet. 60,000 ×g 2 hours
could get exosomes.

20
2.3 Immunoblot Analysis
The concentration of exosomes was measured using Bradford assays. To detect the
expression of fusion protein on exosomes, the immunoblot analysis is a great way to show. 4 𝜇𝑔
exosome samples were put into PCR tubes with 2 𝜇𝐿 of 100 mM dithiothreitol (DTT) and 4X
NuPAGE LSD sample buffer (Thermo Fisher Scientific, Houston, TX). Positive control and
negative control were also included and taken same amount as our exosome sample. These
samples were boiled 10 minutes at 98 ℃ to lyse the exosomes. Once the samples were ready,
the following procedures conducted:
1. Assemble the SDS-PAGE gel (GenScript, Piscataway, NJ) into the tank with the full
filling of Tris-MOPS-SDS running buffer (GenScript, Piscataway, NJ).
2. Load boiled samples into the wells of SDS-PAGE gel, and the Blue Prestained Protein
Standard (BioLand Scientific LLC, Paramount, CA) with broad range 11-190kDa, was
loaded along with to visualize the sizes of proteins.
3. Run the SDS-PAGE gel at 150 V for 50 minutes.
4. Sink the PVDF membrane with methanol. Then rinse and keep the membrane and fiber
pads with 1X transfer buffer. 1X transfer buffer was got from direct dilution of 10X
transfer buffer with 20% methanol, and the 10X transfer buffer was made according to
the standard formulation (15.2g of Tris base, 72.1g of Glycine, 5.0g of SDS, and ddH
-
O
up to 500 mL).

21
5. After the running of gel was completed, the gel was disassembled from the tank and also
rinsed with 1X transfer buffer.
6. The protein transferring from the gel to the PVDF membrane required a “sandwich” form
stack with the following order: bottom pad àPVDF membrane àSDS-PAGE gel àtop
pad. The process of transfer was at 15 V for 35 minutes.
7. Block the transferred membrane with 5% BSA in 0.5% PBST for 1 hour.
8. Briefly wash the membrane with 0.5% PBST and incubate the membrane with 1:2,000
dilution of anti-HA mouse primary antibody (Invitrogen, Carlsbad, CA) at room
temperature. The incubation costed 1 hour.
9. Wash the membrane with 0.5% PBST three times, totally cost 30 minutes.
10. Incubate the membrane with 1:3,000 dilution of goat anti-mouse IgG horseradish
peroxidase conjugate (HRP) (Invitrogen, Carlsbad, CA) at room temperature for 1 hour.
11. Wash the membrane with 0.5% PBST three times, totally cost 30 minutes.
12. Prepare 1,000 𝜇𝐿 chemiluminescent substrate in 1:1 ratio applied to 𝑆𝑢𝑝𝑒𝑟𝑆𝑖𝑔𝑛𝑎𝑙
*+

West Pico PLUS Stable Peroxide Solution and 𝑆𝑢𝑝𝑒𝑟𝑆𝑖𝑔𝑛𝑎𝑙
*+
West Pico PLUS
Lumino/Enhancer Solution (Thermo Fisher Scientific, Houston, TX).
13. Treat the membrane with the substrate and image the membrane by the
chemiluminescence and colorimetric function from the ChemiDoc Touch Gel Imager
(Bio-Rad, Hercules, CA).

22
2.4 Flow Cytometry Analysis
Flow cytometer contains two major detection apparatus, light scatter and fluorescence
intensity. In this experiment, the cells were fluorescently labelled, so the intensity of
fluorescence represented the amount of cell binding to special samples (Flow Cytometry
Fundamental Principle. n.d.). The preparation and procedures were as described.
1. Three breast cancer cell lines, MDA-MB-453 CD16 negative, MDA-MB-453 CD16
positive, MDA-MB-468 EGFR positive, were chosen and maintained with 10% FBS
adding into RPMI 1640 media (Corning, Manassas, VA) in T-75 suspension flasks before
the flow cytometry analysis.
2. Cells were separately digested by Gibco 0.05% trypsin-EDTA (Thermo Fisher Scientific,
Houston, TX) into signal cells and suspended down.
3. The cell-free media were aspirated. Count the cell quantity under microscope to ensure
50,000 cells seeded in each flow tube.
4. Exosome samples (treatment group, positive control and negative control) were added
into the prepared cells in 0.1 mg/mL, and final culture volume was 100 𝜇𝑙. The cells
used as blank did not receive any exosome sample treatments. This incubation lasted 30
minutes at 4 ℃.
5. 2% FBS in PBS was regarded as the washing buffer. 4 mL washing buffer was draw into
every flow tube, and place tubes to centrifuge at 400 ×g for 5 minutes. This washing
step repeated three times.

23
6. Treat the cells with anti-HA primary antibody (Invitrogen, Carlsbad, CA) at 4℃ for
another 30 minutes.
7. Repeat washing step described at step 4.
8. Then treat the cells with Alexa Flour 488-conjugated anti-mouse IgG (H+L) secondary
antibody (Thermo Fisher Scientific, Houston, TX) at 4 ℃ for 30 minutes.
9. Repeat washing step described at 4.
10. Place the final cell samples on ice and analyze them by LSRFortessa X20 Cell Analyzer
(BD, San Jose, CA).

Chapter 3 Results and Conclusion

3.1 Molecular Cloning of Anti-CD16 and Anti-EGFR Fusion Protein
CD16 is the protein receptor on NK cells, and EGFR can activate cell signaling and further
cell proliferation by dimerization of mono-receptor in breast cancer cells, so the aim of this study
is trying to use the engineered exosomes to trigger the immune responses from the NK cells to
attack tumor cells which have EGFR receptor overexpressed on the surface. In order to display
these functional antibodies on the membrane of the exosome, anti-CD16 and anti-EGFR
antibodies are fused to the Lamp2b served as transmembrane proteins to ensure the antibodies
are engineered at the extracellular space to proceed their function.

24
As the designing of primers, we aimed to insert anti-CD16, which is monoclonal 3G8
antibody in this case, and anti-EGFR antibodies at the N-terminus of Lamp2b which is outside of
the exosome. Lamp2b is a typical transmembrane protein which is abundantly existed on the
exosomal surface, and it is a great candidate for exosome engineering because of succeed from
plenty of studies for drug delivery by using Lamp2b (Liu et al., 2018). We also place a signal
peptide region of Lamp2b at the N-terminus of two fusion antibodies, exactly in the front of the
HA-epitope tag. To avoid the steric hindrance may occurred between the scaffolds of two
antibodies and promote them expressing on the surface of the same exosome, only the single-
chain variable fragment (scFv) again CD16 and heavy chain (HC) against EGFR are encoded in
our designing (Shi et al., 2019).
The PCR products were run by agarose gel electrophoresis, and the gel was stained by
ethidium bromide so the bands could be cut exactly along the edges under UV lights. According
to the gel, both mouse-based PCR fragments and human-based PCR fragments display the
brightest bands around 1.5 kb, which following the gene map of the designing of fusion
fragments (1535 bps).

25

Figure 4: PCR products of designed fragments of the combination of anti-CD16 and anti-
EGFR. The agarose gel was stained by ethidium bromide, so it showed the bands under UV
light. Lane 1: PCR products of human-based anti-CD16 linked to anti-EGFR (1535 bps); Lane 2:
PCR products of mouse-based anti-CD16 linked to anti-EGFR (1535 bps); Lane 3: Quick-Load
Purple 1 kb Plus DNA Ladder (New England BioLabs, Ipswich, MA).

26
3.2 The Expression of Engineered Exosomes
Based on the correct sequencing results, we assumed that the transfection of modified
plasmid into Expi293cells was performed successful since the Expi293 supposedly could give
high production of exosomes and we followed the transfection protocol strictly. The cell-free
media were collected twice, at day 3 and day 6. Once the media were drawn out, four steps of
centrifugation were performed immediately at the same day. After the final exosome products
dissolving completely in DPBS, the concentration was measured by Pierce Coomassie Plus
(Bradford) Assay kit (Thermo Fisher Scientific, Houston, TX) at room temperature. In a 96-wells
plate, 250 𝜇𝐿 of tube containing reagent was mixed with 5 𝜇𝐿 exosome samples, which lead
blue color of mixture, and then test it at 595 nm (Pierce™ Coomassie Plus (Bradford) Assay Kit,
n.d.). The Bradford assay is a great way to quantify the concentrations of nanoparticles, such as
exosomes, by simple lysis of the exosomes, and the unit giving to the number is always 𝜇𝑔/𝜇𝐿.
The expression of engineered exosomes was demonstrated by western blot analysis which
gave ability to clear figure out whether or not the anti-CD16, anti-EGFR antibodies and Lamp2b
fusion proteins presented on the exosome. To better illustrating the intensity of
chemiluminescence signals, the positive controls were set up. We used the engineered exosomes
with the fusion of anti-CD16, anti-EGFR antibodies and platelet-derived growth factor receptors
(PDGFR). PDGFR is a single-chain transmembrane protein with extracellular N-terminus and
intracellular C-terminus. In addition, compare with other transmembrane protein, PDGFR owns
ability to relatively easier express fusion protein on transfected cell surface because of its small

27
molecular weight (Shim et al., 2010). Therefore, PDGFR works in the same way as Lamp2b. The
control construct was tested before this experiment showing high expression and almost one
clear band; this property made it satisfy the requirements as a positive control.
We loaded 5 different exosome samples in 5 lanes, and in each lane, 4 𝜇𝑔 samples were
mixed with loading dye and DTT, except the last one which was diluted 10 times. In addition,
day 6 samples may have more impurities, so the final exosome samples directly extracted from
day 3 and day 6 cell-free media were combined together as one sample. Following the protocol
of western blotting, results are shown in Figure 4. The molecular weights of each fusion protein
are calculated; both mouse and human anti-CD16, anti-EGFR and PDGFR fusion proteins have
61.8 kDa, and both mouse and human anti-CD16-anti-EGFR and Lamp2b fusion proteins have
102.2 kDa. The most intense bands for two positive controls exactly locate in the middle of the
range 58-75 kDa, which correspond to the calculated numbers. However, there are multiple
bands from our designed fusion proteins, and the major one locates between 135 kDa and 190
kDa. We reasoned that the larger molecular weight than expected is due to glycosylation of
Lamp2b.
In the structure of Lamp2b, there are asparagine residues and serine or threonine residues,
and they are much easily glycosylated through N-linked and O-linked glycosylation (Li et al.,
2015). When designing the fusion protein, the glycosylation motifs were included at several sites
on Lamp2b to prevent the degradation of linkage and protein itself and improve the expression
level of Lamp2b on exosome surface. Respectively, previous studies shown that such

28
glycosylation-stabilized peptides, instead of interfering the targeting function of engineered
exosomes, they are more likely to help direct the route of delivery (Hung and Leonard., 2015). In
addition, the great amount of glycosylation on Lamp2b would result in bigger molecular weight,
just at present, it is still ambiguous and nearly no studies demonstrate how much the
glycosylation exactly happened during the cell expression.
According to the fact of Lamp2b’s glycosylation, both mouse and human anti-CD16, anti-
EGFR and Lamp2b fusion proteins express well on the exosomes. They display much more
intense bands than positive controls (mouse and human anti-CD16, anti-EGFR and PDGFR
fusion proteins) under the same process of immunoblotting and same chemiluminescence
exposures.

29

Figure 5: Western blot analysis of the engineered exosomes by the fusion proteins. Lane 1:
Blue Pre-stained Protein Standard with broad range 11-190 kDa (BioLand Scientific LLC,
Paramount, CA); Lane 2: Exosome samples were modified by anti-CD16 mouse based, anti-
EGFR and PDGFR fusion proteins with 61.8 kDa; Lane 3: Exosome samples were modified by
anti-CD16 human based, anti-EGFR and PDGFR fusion proteins with 61.8 kDa; Lane 4:
Exosome samples were modified by anti-CD16 mouse based, anti-EGFR and Lamp2b fusion
protein with 102.2 kDa; Lane 5: Exosome samples were modified by anti-CD16 human based,
anti-EGFR and Lamp2b fusion proteins with 102.2 kDa; Lane 6: Directly dissolve lane 5’s
exosome sample in 0.1X.

30
3.3 Expression of CD16 on MDA-MB-453 cancer cell line
For further investigating the expression of anti-CD16 and anti-EGFR on exosomes and their
relative binding affinity to certain cell lines, the flow cytometry analysis was performed by
separately study the binding capacity of anti-CD16-anti-EGFR exosomes. Since we do not have
available CD16 positive cell lines, like NK cells, we transfected CD16 encoding genes into
MDA-MB-453 cancer cell line which is CD16 negative originally.
The FCGR3A genes encode the receptor III-A on NK cells to interact with the fragment
crystallizable (Fc) portion of immunoglobulin G as an integral membrane glycoprotein
(FCGR3A Gene: Protein Coding); in other words, it functions almost same as CD16a protein
receptors. Therefore, the encoding genes were ordered directly from IDT (Coralville, IA) with
complete gene map, and then the FCGR3A genes were moved to pcDNA vector. The primers
were designed based on the sequences of pcDNA-FCGR3A, following molecular cloning to
produce sufficient amounts for transfection. At the same time, the normal MDA-MB-453 human
breast cancer cells were maintained with 1X RPMI 1640 (Corning, Manassas, VA) containing
10% FBS in a T-75 flask under 37 ℃. These cells are CD16 negative and EGFR negative, which
will not interfere the later analysis, and served as good candidate for pcDNA-FCGR3A
transfection.
The transfection system for MDA-MB-453 cancer cell line is different from the Expi293’s
workflow. The Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA) was
purchased for the transfection of pcDNA-FCGR3A. On the day before transfection, MDA-MB-

31
453 cells were digested and centrifuged down for precisely counting cell number and
concentration under microscope, and 8.1×10
.
cells were seeded in one well of a 24-well plate
and supplement media were added until the final volume was 500 𝜇𝐿. On the day of
transfection, first, 50𝜇𝑙 of 𝑂𝑝𝑡𝑖−𝑀𝐸𝑀
*+
I Reduced Serum Medium (Thermo Fisher
Scientific, Houston, TX), 2.5 𝜇𝐿 of Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA),
and 500 ng DNA were mixed together, and the complex was incubated under room temperature
for 15 minutes. After the incubation, each well of the plate which was seeded with MDA-MB-
453 cells was treated by 50 𝜇𝐿 of complex. The whole plate was returned to the incubator
which kept at 37 ℃ and 5% 𝐶𝑂
-
(Transfecting Plasmid DNA Into MDA-MB-453 Cells Using
Lipofectamine 3000 Reagent. n.d.).
After 48 hours of transfection, we assumed that the MDA-MB-453 cancer cell line had
already exhibited CD16a on its surface, so the cells were prepared for flow cytometry for further
confirmation. The transfected cells were suspended down to aspirate the supernatant media,
instead of culture media, 250 𝜇𝐿 of the mixture of TrypLE reagent and 1X DPBS (Corning,
Manassas, VA) in 7:3 ratio was used to ensure single cells presented for flow cytometry, not
cluster of cells. From this point, rest of procedures were same as the previously described
protocol of flow cytometry. However, for detecting the expression of CD16a protein on cell
surface, CD16
/
MDA-MB-453 cell line also readied as negative control, and anti-CD16
monoclonal primary antibody (Thermo Fisher Scientific, Houston, TX) treated both cell samples.

32
Same Alexa Flour 488-conjugated anti-mouse IgG (H+L) secondary antibody (Thermo Fisher
Scientific, Houston, TX) was available for labelling.
As the results from flow cytometry analysis shown, the transfected MDA-MB-453 cancer
cells obtain a broader range and higher mean of fluorescence intensity, which means the binding
affinity of transfected cells to anti-CD16 antibody is greater than non-transfected cells.
Successful molecular cloning of pcDNA-FCGR3A (CD16a) and efficient transfection give
MDA-MB-453 cell line an opportunity to function as CD16
!
cells to support our studies of anti-
CD16 and anti-EGFR engineered exosomes.

33

Figure 6: Analysis of CD16 expression in transfected MDA-MB-453 CD𝟏𝟔
!
cell line. (a)
Flow cytometry analysis by using MDA-MB-453 CD16
!
cell line and CD16
/
cell line under
treating same primary and secondary antibodies. (b) The comparison of mean of fluorescence
intensity in FITC channel illustrates that CD16
!
cell line has higher bindings.

34
3.4 Binding Affinity of Engineered Exosomes
Recently, flow cytometry analysis gives insights on quantitatively examining and
characterizing exosomes via staining exosomes with fluorochrome-conjugated antibodies.
Therefore, we further investigated the cell binding affinity of engineered exosomes by flow
cytometry analysis to monitor exosome’s function.
In the design of flow cytometry experiment, MDA-MB-453 CD16
!
, MDA-MB-453
CD16
/
, and MDA-MB-468 EGFR
!
cell lines were used because of simultaneous expression of
anti-CD16 and anti-EGFR antibodies on exosomes. MDA-MB-453 CD16
!
cells could display
high cell binding if treatment groups have anti-CD16 antibodies accumulated, so both positive
control and negative control are essential for the comparison. We directly set the flow tubes
which receive anti-CD16 monoclonal primary antibody as the positive control due to the
certainty of binding capability between CD16 and anti-CD16 antibody; the exosome samples,
anti-CD16-anti-EGFR-PDGFR, that had been used as control group in western blot were still
tested in flow cytometry. Negative controls basically were no treatment for cells but got same
amount of primary and secondary antibodies.
On the other hand, if sufficient anti-EGFR antibodies present, MDA-MB-468 EGFR
!
cells
would give high fluorescence intensity. Treatment of anti-EGFR monoclonal primary antibody to
MDA-MB-468 cell line leads to high cell bindings, functionalizing as positive control group.
Another exosome sample, anti-CD16-anti-EGFR-Lamp2b, which had been verified previously in

35
significant shift of fluorescence intensity, incubated the cells under same experimental
procedures to help to estimate how well the anti-EGFR performed on our engineered exosome.
As for MDA-MB-453 CD16
/
cells, they received same treatments as CD16
!
groups but
the presence of this cell line was used to provide a more-refined analyses of mean values. These
cells were regularly maintained in T-75 flasks and experienced several passages before
conducting cell’s seed, with no performed transfection. What is more, MDA-MB-453 CD16
/

cells did not have EGFR expressed, they also could be regarded as a comparison for MDA-MB-
468 EGFR
!
cells.
The investigation of fluorescence intensity was visualized by anti-HA primary antibody and
its Alexa Flour 488-conjugated anti-mouse IgG (H+L) secondary antibody which has absorption
at 495 nm and emission at 519 nm. This range property makes it be the ideal candidate to do
fluorescent cell staining because fluorescein isothiocyanate (FITC) owns comparable spectrum
range (Alexa Fluor® 488-conjugated antibodies, 2020). In addition, this Alexa Flour 488
staining allows longer capturing time, greater sensitivity and less background disturbance. The
HA tag was placed at the N-terminus of anti-CD16 at the beginning of designing encoding genes,
so it is much reliable to have HA epitope tag primary antibody to conjugate the exosome
samples.
After all experimental procedures finished and followed according to protocol, cell samples
were characterized through LSRFortessa X20 Cell Analyzer (BD, San Jose, CA), and all data
were processed and the figures were drawn by FlowJo_V10 software (Tree Star, OR). The

36
results point out that anti-CD16-anti-EGFR-Lamp2b engineered exosome gives high binding to
EGFR overexpressed cell line, but relatively low binding or even no binding to CD16 transfected
cell line. Compared to the positive controls which is treated with anti-EGFR monoclonal
antibody and which is fused to PDGFR transmembrane proteins, the binding affinity of our anti-
CD16-anti-EGFR-Lamp2b engineered exosome is not as great as them, but the detection of
fluorescence intensity is relatively significant. Since, the usage of anti-CD16 monoclonal
antibodies in both MDA-MB-453 CD16
!
and CD16
/
cells gives much difference in the mean
of fluorescence intensity, we could conclude that the CD16a is successfully transfected and some
of MDA-MB-453 cells have already formed CD16 receptors on its surface. Thus, the lack of cell
binding of anti-CD16-anti-EGFR-Lamp2b engineered exosome could exclude the incapability of
transfected CD16
!
cells.

37

Figure 7: Flow cytometry analysis of anti-CD16 and anti-EGFR engineered exosomes. (a)
Usage of MDA-MB-453 CD16
!
cell line. Positive group shows significant shift of binding; (b)
Usage of MDA-MB-453 CD16
/
cell line. Positive group does not show significant shift of
binding; (c) Usage of MDA-MB-468 EGFR
!
cell line. Both positive group and treatment group
show significant shift of binding.

38
3.5 Conclusion
In this study, we explored a new concept to create a novel class of exosomes, from initially
designing, generating to characterizing, which is considered to be a promising
immunotherapeutic. We successfully placed two monoclonal antibodies, anti-CD16 and anti-
EGFR, together to fuse with exosomal transmembrane protein, Lamp2b, to target the CD16
receptor on NK cells, and EGFR on EGFR overexpressed tumor cells, and isolated exosome
samples from Expi293 transfected cells. Four steps of centrifugation were particularly proceeded
among the generation of engineered exosomes, including high-speed and ultra-centrifugation.
Furthermore, the significant expression of desired antibodies on the engineered exosomes
confirmed the availability to display two antibodies, which may trigger different responses but
through one nanoparticle. However, the flow cytometry analysis demonstrated a failure of
recruiting and activating the NK cell surface CD16 receptors, it still gave expectations on surface
modified exosomes.

Chapter 4 Discussion and Future Directions

Through past 30 years, the studies focusing on exosome received significant attention, and
the function and utilization of exosomes were investigated at increased rates. It is undeniable that
the progression of exosomal science is remarkable, and their way into clinical therapies are
promising. Among these, several studies illustrate the possibility of exosome’s

39
immunomodulating to activate immune responses from antigen-specific cells. Thus, exosomes
are identified to mediate the immune system through four pathways, which are presenting
presentation of antigens, stimulation of complement system, activation or suppression of immune
system (Milane et al., 2015). Since the immunomodulating property of exosomes are well
documented, but engineering surface protein on exosome for direct targeting immune cells is
rarely conducted. Based on the biogenesis of exosome is from early endosomes through outward
budding, the cellular and membrane contents of exosomes exactly depend on their parent cell’s
status and functions (Zhao et al., 2019). Thus, the opportunity to modify the surface proteins
placed on exosomes becomes available, which represents a novel way to develop new generation
of exosomes for immunotherapy.
In our study, we aimed to create a bispecific exosome which could stimulate the natural
killer cells to kill breast cancer cells which are trapped by surface proteins on exosomes.
Therefore, we transfected anti-CD16-anti-EGFR-Lamp2b fusion proteins into Expi293 cells
which are derived from HEK293 cell line and can efficiently product sufficient amounts of
exosomes. We hypothesized that these modified proteins could finally be placed on the surface
of exosomes by multivesicular body (MVB) secretion pathways. Fortunately, as the western blot
shown, the desired fusion protein expressed on the exosomes in correct molecular weight, and
even the signals are comparable with the previous tested anti-CD16-anti-EGFR-PDGFR
construct.

40
Later work on cell binding met some difficulties in the interaction between CD16 and
engineered exosomes. To confirm the originally MDA-MB-453 CD16
/
exhibiting the CD16a
receptor protein through pcDNA- FCGR3A transfection, the flow cytometry analysis was
conducted. Although the shift of fluorescence intensity is not so obvious, the data demonstrates
that the MDA-MB-453 CD16
/
cell line gain the ability to bind to anti-CD16 monoclonal
antibody as a “NK cell”. For further testing cell binding of engineered exosomes, the
performance of anti-EGFR region fulfills our hypothesis, but anti-CD16 region targets worse
than expected. There are several possible reasons for this failure, such as no sufficient CD16
receptor display on the surface of MDA-MB-453 to proceed significant binding, low efficiency
of binding interaction happens between engineered exosome and transfected cells, or flow
cytometry is not the best choice for testing CD16 receptor binding.
Thus, in order to solve the problems, multiple attempts need be tried. First, if the cell line
transfected with CD16 encoding genes is unable to obtain high levels of expression or some of
expressed receptors are folded or blocked to respond to its ligands, the best solution would be
directly using a cell line which secretes its owns CD16 receptor on its surface. This kind of cell
line will promise at least the sufficient expression of CD16 to promote the receptor-antibody’s
interaction. For low efficiency of binding, two essential conditions for reach binding equilibrium
is the concentration of exosome samples and the strength of the binding reaction (Hunter and
Cochran., 2016). Some of inefficient binding may require longer incubation to reach the
equilibrium; however, for flow cytometry analysis, it is impossible to extend the incubation time

41
much longer. The critical method would be raising the concentration of either treatment samples
or primary antibodies.
Furthermore, the aim of this study is to direct NK cells to kill tumor cells, an assay to
perform in vitro cytotoxicity could help us better understand whether or not the engineered
exosomes exhibit the expected function. If under the treatment of exosome samples, there is
cytotoxicity occurred especially to EGFR overexpressed cell line, such as MDA-MB-468
EGFR
!
cell line, but do not affect other kinds of cells, we could conclude that the engineered
exosomes did target correct cells and induce significant cytotoxicity.
The anti-CD16-anti-EGFR-Lamp2b engineered exosomes gives us a broad idea on
modifying the surface protein of exosome to create a strategy in stimulating immune response
and targeting malignant tumor cells. Even though, this design of construct does not bring a
critical result to us, it helps us to better understand the exosome’s and fusion protein’s function
and based on this project, lots of derived studies can be conducted. For example, the Lamp2b
fuses to anti-CD16-anti-EGFR can be exchanged into other well-known transmembrane proteins,
like CD9. CD9 is a tetraspanin protein, which has highly functional and biochemical
extracellular loop and transmembrane domain to provide advantages for interacting with other
proteins, including immunoglobulin superfamily and membrane-bound growth factors (Wang et
al., 2011). Hence, the attempt that recreating another construct through removing anti-CD16-
anti-EGFR to fuse to CD9 protein may offer one possible solution for further studying.

42
Another practicable method to express both anti-CD16 and anti-EGFR monoclonal
antibodies on the surface of exosome is co-transfection, which may give a chance to co-express
several isolated components in the same cell (Assur et al., 2012). This strategy only requires co-
transfection of multiple, separate plasmids at the same time, and the kind of encoding genes of
plasmid do not really matter the efficiency of co-transfection. Thus, designing two individual
constructs, one only expressing anti-CD16 antibody and the other expressing anti-EGFR
antibody, to produce plasmids for co-transfection. This system also can be established in
Expi293 cells, and the major difference is the ratio of treated plasmid which may need several
rounds to find the balance between two components. Overall, this study may not work at some
stages, but based on the discussion, it provides more ideas and suggestions for future derivative
experiments.

43
References
Abel, A. M., Yang, C., Thakar, S. M., and Malarkannan, S. (2018). Natural Killer Cells:
Development, Maturation, and Clinical Utilization. Front. Immunol., 9.
Alexa Fluor® 488-conjugated antibodies. (2020). Abcam.
Assur, Z., Hendrickson, W. A., and Mancia, F. (2012). Tools for coproducing multiple proteins
in mammalian cells. Methods in molecular biology (Clifton, N.J.), 801, 173–187.
Bowles, J. A., and Weiner, G. J. (2005). CD16 polymorphisms and NK activation induced by
monoclonal antibody-coated target cells. Journal of Immunological Methods, 304, 88-89.
Bunggulawa, E. J., Wang, W., Yin, T., Wang, N., Durkan, C., Wang, Y., and Wang, G. (2018).
Recent advancements in the use of exosomes as drug delivery systems. Journal of
Nanobiotechnology, 16.
Bellavia, D., Raimondi, L., Costa, V., Luca, A. D., Carina, V., Maglio, M., Fini, M., Alessandro,
R., and Giavaresi, G. (2018). Engineered exosomes: A new promise for the management of
musculoskeletal diseases. Biochimica et Biophysica Acta (BBA) – General Subjects, 1862,
1893-1901.
FCGR3A Gene (Protein Coding). (n.d.). GeneCards.
Gomari, H., Forouzandeh Moghadam, M., and Soleimani, M. (2018). Targeted cancer therapy
using engineered exosome as a natural drug delivery vehicle. OncoTargets and therapy, 11,
5753–5762.

44
Gomez, C. T., Goreham, R. V., Serra, J. J. B., Nann, T., and Kussmann, M. (2018).
"Exosomics"-A Review of Biophysics, Biology and Biochemistry of Exosomes With a
Focus on Human Breast Milk. Frontiers in Genetics, 9, 92.
Hung, M. E., and Leonard, J. N. (2015). Stabilization of exosome-targeting peptides via
engineered glycosylation. The Journal of biological chemistry, 290, 8166–8172.
Hunter, S. A., and Cochran, J. R. (2016). Cell-Binding Assays for Determining the Affinity of
Protein-Protein Interactions: Technologies and Considerations. Methods in
enzymology, 580, 21–44.
Li, J., Deffieu, M. S., Lee, P. L., Saha, P., and Pfeffer, S. R. (2015). Glycosylation inhibition
reduces cholesterol accumulation in NPC1 protein-deficient cells. Proceedings of the
National Academy of Sciences of the United States of America, 112, 14876–14881.
Li, P., Kaslan, M., Lee, S. H., Yao, J., and Gao, Z. (2017). Progress in Exosome Isolation
Techniques. Theranostics, 7, 789–804.
Flow Cytometry Fundamental Principle, How FACS works. (n.d.). Boster.
Liu, C., and Su, C. (2019). Design strategies and application progress of therapeutic
exosomes. Theranostics, 9, 1015–1028.
Liu, X., Yang, X., Sun, W., Wu, Q., Song, Y., Yuan, L., and Yang, G. (2018).
Systematic Evolution of Ligands by Exosome Enrichment: A Proof‐of‐Concept Study for
Exosome‐Based Targeting Peptide Screening. Advanced Biosystems, 3.

45
Martinelli, E., De Palma, R., Orditura, M., De Vita, F., and Ciardiello, F. (2009). Anti-epidermal
growth factor receptor monoclonal antibodies in cancer therapy. Clinical and experimental
immunology, 158, 1–9.
Flaherty, M. M., MacLachlan, T. K., Troutt, M., Magee, T., Tuaillon, N., Johnson, S., Stein, K.
E., Bonvini, E., Garman, R. and Andrews L. (2011). Nonclinical Evaluation of GMA161—
An Antihuman CD16 (FcγRIII) Monoclonal Antibody for Treatment of Autoimmune
Disorders in CD16 Transgenic Mice, Toxicological Sciences, 125, 299–309.
Milane, L., Singh, A., Mattheolabakis, G., Suresh, M., and Amiji, M. M. (2015). Exosome
mediated communication within the tumor. Journal of Controlled Release, 219, 278-294.
Nicholson, R. I., Gee, J. M. W., and Harper, M. E. (2001). EGFR and cancer prognosis.
European Journal of Cancer, 37, 9-15.
Normanno, N., Luca, A. D., Bianco, C., Strizzi, L., Mancino, M., Maiello, M. R., Carotenuto, A.,
Feo, G. D., Caponigro, F., and Salomon, D. S. (2005). Epidermal growth factor receptor
(EGFR) signaling in cancer. Gene, 366, 2-16.
Pierce™ Coomassie Plus (Bradford) Assay Kit. (n.d.). Thermofisher Scientific.
Romee, R., Foley, B., Lenvik, T., Wang, Y., Zhang, B., Ankarlo, D., Luo, X., Cooley, S.,
Verneris, M., Walcheck, B., and Miller, J. (2013). NK cell CD16 surface expression and
function is regulated by a disintegrin and metalloprotease-17 (ADAM17). Blood, 121, 3599–
3608.

46
Shim, A. H., Liu, H., Focia, P. J., Chen, X., Lin, P. C., and He, X. (2010). Structures of a platelet-
derived growth factor/propeptide complex and a platelet-derived growth factor/receptor
complex. Proceedings of the National Academy of Sciences of the United States of
America, 107, 11307–11312.
Shi, X., Cheng, Q., Hou, T., Han, M., Smbatyan, G., Lang, J. E., Epstein, A. L., Lenz, HJ., and
Zhang, Y. (2019). Genetically Engineered Cell-Derived Nanoparticles for Targeted Breast
Cancer Immunotherapy. Molecular Therapy, 28, 536-547.
Transfecting Plasmid DNA Into MDA-MB-453 Cells Using Lipofectamine 3000 Reagent. (n.d.).
Thermofisher Scientific.
Vakhshiteh, F., Atyabi, F., and Ostad, S. N. (2019). Mesenchymal stem cell exosomes: a two-
edged sword in cancer therapy. International journal of nanomedicine, 14, 2847–2859.
Wang, H. X., Kolesnikova, T. V., Gygi, S. P., and Hemler, M. E. (2011). The C-
terminal tail of tetraspanin protein CD9 contributes to its function and molecular
organization. Journal of Cell Science,124, 2702-2710.
Wieduwilt, M. J., and Moasser, M. M. (2008). The epidermal growth factor receptor family:
biology driving targeted therapeutics. Cellular and molecular life sciences (CMLS), 65,
1566–1584.
Zhao, Z., McGill, J., Gamero-Kubota, P., and He, M. (2019). Microfluidic on-demand
engineering of exosomes towards cancer immunotherapy. Lab on a Chip, 19, 1877-1886.

Abstract (if available)

Abstract Nowadays, the exosomes become a novel drug delivery carrier to induce cellular processes, such as immune responses. They can be selectively packed with genetic materials, like microRNA, messenger RNA, and proteins. And they also can be modified to be delivered to target organelles. Therefore, many studies focus on modifying the exosomes to enhance not only its delivery ability but also certain conjugate’s function. In this study, we explored a new concept to create a novel class of exosomes, from initially designing, generating to characterizing, which is considered to be a promising immunotherapeutic. We genetically displayed two monoclonal antibodies, which are anti-CD16 and anti-EGFR antibodies, on the surface of exosome membrane. To facilitate the anchoring of two antibodies on the surface, one transmembrane protein, lysosome-associated membrane protein 2b (Lamp2b), is respectively fused with two antibodies. Under monoclonal anti-CD16 antibody-coated exosomes, the NK cells are recruited for targeted cell lysis (Romee et al., 2013). Simultaneously, the anti-EGFR antibody would detect the tumor cells which have an abundant of EGFR receptor expression. Therefore, the modified exosomes target directly to these tumor cells and redirect the NK cells for anti-cancer immunity.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Reprogramming exosomes for immunotherapy of acute myeloid leukemia

PDF

Employing engineered exosomes for combating colon cancer and engineering CD38 as an optimized drug carrier

PDF

Antibodies and elastin-like polypeptides: cellular and biophysical characterization of an anti-ELP monoclonal and an anti-CD3 single-chain-ELP fusion

PDF

Optimization of exosome isolation protocols for mouse serum and rabbit primary lacrimal gland acinar cells

PDF

Development of new approaches for antibody modification

PDF

Novel approaches of mobilizing human iNKT cells for cancer immunotherapies

PDF

Secretion of exosomes through the potential endolysosomal pathway in Rab3DKO and Non-Obese Diabetic murine models

PDF

A novel chemoenzymatic conjugation method for bispecific antibody production

PDF

Engineering chimeric antigen receptor (CAR) -modified T cells for enhanced cancer immunotherapy

PDF

Enhancing the anti-cancer specificity of chimeric antigen receptor T cells through targeting HLA loss

PDF

Optimization of nanomedicine based drug delivery systems for the treatment of solid tumors

PDF

Site-specific PEGylation of recombinant immunotoxin antiFAP-CD8h-PE38 with an expanded genetic code

PDF

Enhancing the anti-HIV potency of eCD4-Ig by unnatural amino acid mutagenesis

PDF

Development of engineered antibodies as novel anti-cancer agents

PDF

Immunotherapy of cancer

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Development of cyclized bispecific antibodies for enhanced serum stability

PDF

Engineering chimeric antigen receptor-directed immune cells for enhanced antitumor efficacy in solid tumors

PDF

Investigating the effects of targeting CD99 on T cells to enhance their antileukemia activity

PDF

Engineered humanized antibody inhibitors for cathepsin S

Asset Metadata

Creator Duan, Xinping (author)

Core Title Engineered exosomes for immunotherapy

School School of Pharmacy

Degree Master of Science

Degree Program Pharmaceutical Sciences

Publication Date 05/05/2020

Defense Date 05/15/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CD16,EGFR,exosomes,immunotherapy,OAI-PMH Harvest,protein engineering

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Zhang, Yong (committee chair), Okamoto, Curtis (committee member), Tabancay, Angel (committee member)

Creator Email sydney.duan313@gmail.com,xinpingd@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-297776

Unique identifier UC11665840

Identifier etd-DuanXinpin-8428.pdf (filename),usctheses-c89-297776 (legacy record id)

Legacy Identifier etd-DuanXinpin-8428.pdf

Dmrecord 297776

Document Type Thesis

Rights Duan, Xinping

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA