University of Southern California Dissertations and Theses

The role of Fgfr2 within Scx-expressing cells of the hair follicle

(USC Thesis Other)

The role of Fgfr2 within Scx-expressing cells of the hair follicle

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content The role of Fgfr2 within Scx-expressing cells of the hair follicle
by
Yi Sui

A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfilment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR MEDICINE)
August 2020
Copyright 2020 Yi Sui
ⅱ
Acknowledgements
Time flies, but time passes. I still remembered the scene when I first entered the university
campus, but then I had to say goodbye to the University of Southern California and say goodbye
to my master student life.
I would like to express my heartfelt gratitude to my mentor, Dr. Amy E. Merrill, for allowing
me to be part of her wonderful laboratory and giving me opportunity to learn, conduct and
complete my master thesis project. Thank to her conscientious and selfless support and guidance,
so that I kept my enthusiasm for scientific research. She’s the best mentor you can ever imagine
and her spirit of passion and preciseness toward research influence and motivate me. I appreciate
the time while was I working with her and I will remember and treasure this precious experience
in my life.
I would also like to extend my thanks to my most lovely, conscientious and rigorous lab
members, Siyan Wang, Ryan R. Roberts, Lauren Bobzin, Audrey Nickle, Creighton T. Tuzon and
Diana Rigueur. It is their tireless guidance and companionship to help me, support me, so that I
overcome the research difficulties one after another; And it is their joy, courage and the spirit of
never giving up inspire me, so that I can continue to walk on the great and difficult road of sciences.
And thanks to my committee members, Dr. Cheng-Ming Chuong and Dr. Jian Xu, for their
patience, insightful suggestions and generous support for my research project. I’m very proud to
be able to enter such an academic environment at USC, Keck School of Medicine, and meet such
a group of excellent and warm professors, teaches, advisors, and stuffs. I would like to thank all
the teachers who have taught me in the past two years, and all my companions who have walked
ⅲ

with me – especially Siyan Wang, Han Wang, Qing Zhao and Minxiao Yang.
Lastly, I would like to thank my parents for supporting me in times of sadness and distress,
and giving me a safe, comfortable harbor forever. Thank you to my mom and dad for letting me
become an independent person. Grateful for the unconditional support, you will always be my
strongest backing and most inexhaustible motivation.
ⅳ

Table of Contents
Acknowledgements………………………………………………………………ⅱ
List of Tables……………………………………………………………………..ⅵ
List of Figures…………………………………………………………...…..…..ⅶ
Abbreviations…………………………………………………………………...ⅷ
Abstract……………………………………………………………….………….ⅸ
Chapter One: Introduction………………………………………………………1
1.1 Hair follicle anatomy……………………………………………………………………...…1
1.2 Molecular heterogeneity and compartmentalization of hair follicle…………………………3
1.2.1 Stem cell heterogeneity and compartmentalization………………………………….3
1.2.2 TACs and DPs heterogeneity and compartmentalization………………....……….....6
1.3 Hair cycle………………………………………………………………………………….....7
1.4 Signaling in hair follicle cycling……………………………………………………………..8
1.4.1 Wnt signaling………………………………………………………………………...8
1.4.2 Bmp signaling………………………………………………………………………..9
1.4.3 Shh signaling………………………………………………………………………...10
1.4.4 Fgf signaling………………………………………………………………………...10
1.5 Objectives of Project………………………………………………………………………...11
Chapter Two: Materials and Methods………………………………………….12
2.1 Mice and Procedures………………………………………………………………………....12
2.2 Hair plucking assay…………………………………………………………………………..13
2.3 H&E staining…………………………………………………………………………………13
2.4 Immunofluorescent analysis………………………………………………………………....14
2.5 Fluorescent In situ hybridization………………………………………………………….....15
Chapter Three: Results…………………………………………………………..17
3.1 Scx marks molecularly distinct subdomains of hair follicle…………………………………17
3.2 Scx lineage cells give rise to multiple cell type in hair follicle…………………….…….…..20
3.3 Scx and Fgfr2 is co-expressing in hair germ cells and matrix cells………………………….21
3.4 Scx-Cre Fgfr2
fl/fl
mice display abnormal hair phenotype …………………………….……...22
3.5 Fgfr2 regulate hair shaft medulla and cuticle structures……………………….………….....24
3.6 Fgfr2 is required for stem cell activation in long-term hair cycle progression……………....25
ⅴ

Chapter Four: Discussion…………………………………………………….....36
4.1 The Scx-expressing cells and their progeny in HFs…………………………………………39
4.2 Possible molecular mechanism to explain the phenotype difference between Scx-Cre; Fgfr2
fl/fl
mice and their control littermates……………………………………………………………40
4.3 The secondary defects including APM dislocation and SG expansion in Fgfr2-cKO mice...43
4.4 The difference and possible affects between Fgfr2-IIIb and Fgfr2-IIIc isoform in HFs…… 44
4.5 The Scx expressing pattern in other hairy-regions………………………………………......44
References………………………………………………………………………..45
ⅵ

List of Tables

Table 2.1 Primer for PCR……………………………………………………………………..13
Table 2.4.1 Primary antibodies used for immunofluorescence……………………………….15
Table 2.4.2 Secondary antibodies used for immunofluorescence…………………………….15
Table 3.6 Asynchronous hair cycle in control and Fgfr2-cKO mice…………………………26
ⅶ

List of Figures
Figure Figure legend title Page no.
Figure 1.1 The hair follicle 3
Figure 1.2.1 Hair follicle stem cells in murine telogen hair follicles. 5
Figure 1.2.2 The heterogeneity of TACs and DPs 6
Figure 1.3 The hair follicle cycle 7
Figure 3.1.0 Scx marks CD34+ hair follicle stem cells and hair germ cells. 18
Figure 3.1.1 Scx marks Sox9+ hair follicle stem cells and hair germ cells. 28
Figure 3.1.2 Scx marks Gli1+ upper bulge cells 29
Figure 3.2 Scx lineage cells give rise to multiple cell type in hair follicle 30
Figure 3.3 Scx and Fgfr2 is co-expressing in hair germ cells and matrix cells 31
Figure 3.4 Scx-Cre Fgfr2
fl/fl
cKO mice display abnormal hair phenotype 32
Figure 3.5 Fgfr2 is required for hair shaft medulla structure formation 33
Figure 3.6 Progressive hair loss and specific anatomical defects in Scx-Cre
Fgfr2
fl/fl
cKO mice
34
Figure 4.1 Scx-expression and Scx-lineage tracing pattern 36
Figure 4.2 Hypothesized model for the role of Fgfr2-related signaling in adults
HFs
37
ⅷ

Abbreviations
Fibroblast growth factor receptor 2 (Fgfr2)
Fibroblast growth factor (Fgf)
Scleraxis (Scx)
SRY-Box transcription factor 9 (Sox9)
Hair follicle stem cells (HFSCs)
Hair germ cells (HGs)
Bulge stem cells (Bu-SCs)
Transit-amplifying cells (TACs)
Arrector pili muscle (APM)
Outer root sheath (ORS)
Inner root sheath (IRS)
Hair shaft (HS)
Hair follicle (HF)
Dermal papilla (DP)
Companion layer (Cp)
Sebaceous gland (SG)
Connective tissue sheath (CTS)
Sonic Hedgehog (SHH)
Bone morphogenetic proteins (BMP)
Transforming growth factor-β (TGF-β)
ⅸ

Abstract
Fibroblast growth factor receptor 2 (Fgfr2) signaling plays an important role in embryo hair
follicle (HF) development and adult hair growth. In mice, loss of Fgfr2 disrupts hair placode
formation and cutaneous homeostasis (Petiot A et al., 2003; Yang J et al., 2010). In humans, gain-
of-function FGFR2 mutations cause excessive and ectopic hair growth all over the body and
FGFR2 polymorphism affects the variation in human hair thickness (Akihiro Fujimoto et al., 2009;
Merrill A.E et al., 2012). However, currently, the functional role of FGFR2 in mature hair follicle
stem cells (HFSCs), including bulge stem cells (Bu-SCs) and hair germ cells (HGs), as well as
transit-amplifying matrix cells (TACs) during long-term hair cycle is not well understood. During
our analysis of Scx-Cre; Fgfr2
fl/fl
mutant mice, I unexpectedly found that their fur was abnormally
matted, unkept, and showed progressive hair loss. Histological analysis showed that the hairs of
Fgfr2 mutant mice were thinner and had unstructured hair shafts compared to littermate controls.
Using genetic lineage tracing and transgenic analysis I discovered that Scx+ cells mark both Bu-
SCs and HGs of HFSCs and that their lineage gives rise to multiple cell subpopulation in hair
follicles, as well as the arrector pili muscle (APM). Using in situ hybridization I showed that Scx
and Fgfr2 are co-expressed in HG, the HFSCs primed for activation, and the TACs, which are
derived from the HGs. I hypothesize that loss of Fgfr2 in the HGs and their TACs derivatives alter
their ability to respond to the pro-proliferative Fgf7 and Fgf10 signals, which is critical for HGs
activation, anagen entry, and normal hair shaft formation. I also hypothesize that loss of Fgfr2 in
the upper HGs, which are a putative source of outer root sheath cells (ORS), inhibits their FGF-
mediated activation and proliferation.
ⅹ

Without sufficient activation and proliferation, replenishment of primed-HFSCs to form first
a new HG and then Bu-SCs for the next hair cycle is compromised. Eventually this impaired Fgfr2
signaling results in hair follicular reduction, hair shaft defects, and inhibition of long-term HF
regeneration. Although not fully investigated, the co-expression of Fgfr2-related signaling in the
Bu-SCs, HGs, TACs and DP cells, raises the significance of Fgf signaling in HF system and extend
our understanding of the pathogenesis of the hair phenotypes in the FGFR2-related disorder.

Key works: hair follicle; hair cycle; Scx; Fgfr2; mouse model
1

Chapter One: Introduction

1.1 Hair follicle anatomy
The hair follicle (HF) is an essential mini-organ that is important for appearance,
environmental sensing, and protection from cold and other harmful environmental factors. HFs
form from embryonic ectoderm and undergo cyclic regeneration to produce new hairs during adult
life (Alonso L et al., 2006; Lee J et al., 2012). The HF is divided into distinct sections, as detailed
in Fig1.1 (Helen B Everts, 2013).
The HF consists of a permanent upper portion and a cycling lower portion that undergoes cycles
of destruction and restoration (Panteleyev A.A, 2018). The upper sections of the HF are permanent,
with the infundibulum located from the opening of the sebaceous gland (SG) duct to the point
where the HF meets the epidermis, providing a funnel shaped cavity through the epidermis and
offering an opening for the hair shaft (HS). The isthmus is located at the lower boundary of the SG
at the insertion point for the arrector pili muscle (APM). This region is also commonly described
as the bulge, and contains a population of epithelial HF stem cells (HFSCs). The progeny of these
stem cells produces the outer root sheath (ORS). In telogen (resting) phase, a small cluster of cells
beneath the bulge are called the hair germ (HG) or secondary hair germ (SHG). The secondary is
used to distinguish the “germ” in hair morphogenesis. The lower portion of the HG generates the
transit-amplifying cells (TACs) known as the matrix cells (Mx), as well as all ascending HF layers,
including inner root sheath (IRS) (consisting of the cuticle and Huxley’s and Henle’s layers) and
hair shaft (HS) (consisting of the medulla, cortex and hair cuticle).
2

Matrix enclose a mesenchymal pocket of cells called dermal papillae (DP), a signaling center with
fate instructive properties. The hair bulb, which is on the proximal end of HF with onion-shaped
thickening also contains the HF pigmentary unit, within which are found the melanocytes
responsible for hair color. The HF is primarily epithelial in origin, with the exception of the DP
and connective tissue sheath (CTS), which are mesenchymal. Inductive signals for HF growth and
cycling originate from the DP. And this reciprocal interaction between SCs and DP are essential
for hair follicle formation and maintenance (Sven Müller-Röver et al., 2001; Sada A et al., 2013;
Dunnill CJ et al., 2017; Panteleyev A.A, 2018).
Besides HF itself, other organs and tissue structures around HF are also very important for HF
homeostasis. The APM is anchored in bulge region and provides the physical force in HF erection
necessary for body temperature and appearance. Recent evidence suggests that the bulge region
which is enriched Nephronectin serve as a niche for muscle cells (Fujiwara H et al., 2011). And
the Gli1+ upper bulge region serves as a niche for nerve connection and tactile sensation (Cheng
C-C et al., 2018).
3

Figure 1.1 The hair follicle (Helen B Everts, 2013)
The illustration of the hair follicle, structures labeled as they change during the hair cycle.

1.2 Molecular heterogeneity and compartmentalization of hair follicle
1.2.1 Stem cell heterogeneity and compartmentalization
In many tissues, stem cells (SCs) can divide into two different populations, based on their
proliferative characteristics, one is quiescent-SCs population which cycles infrequently, another is
primed-SCs population, which is more sensitive to activation (Li and Clevers, 2010). In HFs,
HFSCs also can be divided into these two distinct population, Bu-SCs and HG. Bu-SCs and HG
have many common molecular features, as detailed in Fig 1.2.1 (Geyfman M et al., 2014).
However, HG cells are always first to respond the proliferation cues from DP upon anagen entry,
4

and Bu-SCs are activated 1-2 days later than HGs, majority of bulge stay quiescent and serve as
the permeant portion of HFs (Greco et al., 2009; Hsu Y-C et al., 2014).
Although HFSCs all reside in bulge and HG region, they are heterogeneous in their molecular
and functional properties and different compartments are identified by various cell surface markers
and nuclear factors (Geyfman M et al., 2014; Cheng C-C et al., 2018). The most representative
marker for Bu-SCs is CD34, which specifically mark the outermost layer of mid-bulge region and
were once thought to be the master stem cells. Sox9 is also accepted as another HFSC marks,
which marks not only the outermost layer of mid-bulge region, but also marks both inner bulge
region from upper bulge to the lower bulge, as well as HG. Sox9-deficient HFs can’t maintain the
HFSCs and their number is reduced, as well as unstained ORS, and arrest HF downgrowth (Meelis
Kadaja et al., 2014). In addition to Sox9, Gli1 also marks a specific and functional subpopulation
of HFSCs, which expressed only in the upper and lower bulge region, as well as HG, and absent
in the mid-bulge region. The Gli1+ upper bulge is unique for HF regeneration and wound healing
of interfollicular epidermis (Fujiwara H et al., 2011).
Besides the Bu-SCs, the HG are also thought to be heterogenous. By performing single cell
RNA-seq analysis, one previous study reviewed that telogen-phase HG cells constituted three
different populations and in early anagen activation stage, two additional HG population emerged,
the analysis is based on the different expression pattern. (Yang H et al., 2017). In addition to
expression pattern, another study proposed the HG contains two functionally distinct cell
populations, one in the lower HGs that proliferates to contribute to the Mx cells and then form HS
and IRS and another in the upper HGs that form ORS. These two populations are distinguished by
5

specific markers, such as K15 for upper HGs, and Runx1 for lower HGs (Panteleyev A.A, 2018).

Figure 1.2.1 Hair follicle stem cells in murine telogen hair follicles. (Geyfman M et al., 2014)
The telogen hair follicle contains multiple stem cell compartments identified by various cell surface markers and
nuclear factors, located not only in the bulge but also in the secondary hair germ and in the upper follicle (isthmus
and infundibulum). Stem cell populations above the bulge are responsible primarily for the renewal and repair of the
upper follicle, sebaceous gland and interfollicular epidermis (Woo & Oro, 2011). SHG, secondary hair germ; HF,
hair follicle.

6

1.2.2 TACs and DPs heterogeneity and compartmentalization
The TACs and the signaling center DP’s heterogeneity were unearthed recently. Lineage-
tracing and single cell analyses showed that TACs are composed of at least seven heterogeneous
progenitors, including progenitors of three layers of IRS and three layers of HS, respectively. In
addition, four distinct DP subpopulations were spatially mapped using in situ hybridization and
potential epithelial-mesenchymal crosstalk between TACs and DPs has been found, as the temporal
establishment of TAC progenitors matched temporal DP state, as detailed in Fig 1.2.2. TAC and
DP heterogeneity is committed to build the complex HS and IRS from the outside in (Yang H et
al., 2017).

Figure 1.2.2 The heterogeneity of TACs and DPs (Yang H et al., 2013)
The graphic summary of epithelial-mesenchymal micro-niche govern stem cell linage choice

7

1.3 Hair cycle
Hair cycle (HC), a repetitive process of hair follicle regeneration. The hair cycle is typically
divided into three morphologically recognizable phases, resting, growing and regressing phases,
referred to as telogen, anagen and catagen, respectively. Detailed in Fig 1.3 (Panteleyev A.A, 2018).
The length of the HS is controlled by the duration of anagen, while how fast the new HS is made
is controlled by the duration of telogen. In order to achieve the optimal hair length and density,
telogen to anagen and anagen to catagen transition events must be highly regulated (Maksim V
Plikus, 2012).

Figure 1.3 The hair follicle cycle (Panteleyev, 2018, adopted with changes from Panteleyev et al., 2001)
8

In telogen, HFSCs including both Bu-SCs and HGs lie dormant in a resting phase. There’s no
proliferation, apoptosis or differentiation during this phase. Bulge, HG and DP are aligned along
the longitudinal axis of the hair follicle (Alonso L, Fuchs E, 2006). In early anagen activation, HGs
receive the activation signaling from DP with a burst of proliferation and then Bu-SC is activated
and emerged to proliferate. Then the epithelial portion of the HF grows downward and completely
encompasses DP. Mx cells which are generated mostly from HGs undergo intense proliferation
after several divisions results in the formation of the HS and IRS that form a channel to guide the
growing HS (Alonso L, Fuchs E, 2006; Lee J et al., 2012; Panteleyev A.A, 2018). ORS is generated
mostly by the Bu-SCs proliferation, the ascending HF layers are encased by the ORS, as ORS
grows, it expands the distance between bulge and Mx (Hsu et al., 2011; Rompolas et al., 2013).
With the transition to catagen, the HS differentiation stops, the hair bulb shrinks and the. lower
portion of HF regresses and undergoes apoptosis driven reduction, but some ORS cells are
remained and forming a new bulge (New-Bu) and a new HG. The adjacent old bulge (Old-Bu) has
no HG or DP, and respond only upon injury. (Hsu et al., 2011). A unique temporary structure which
called the epithelial strand is formed. The DP condenses and travels upward along with the
epithelial strand. Eventually the new telogen HFs are generated in the end of catagen (Alonso L,
Fuchs E, 2006; Lee J et al., 2012; Panteleyev A.A, 2018)

1.4 Signaling in hair follicle cycling
1.4.1 Wnt signaling
In postanal hair cycle, Wnt signaling components are expressed in HFs and HGs at early
9

anagen, and expressed in Mx, DP during anagen. While, in telogen, WNT signaling is nearly
undetectable (DasGupta and Fuchs, 1999; Maretto et al., 2003). Previous studies reviewed the Wnt
signaling is important for postnatal HC: Global deletion of epithelial β-catenin in telogen causes
stem cell depletion (Lowry et al., 2005). Specifically deleted epithelial β-catenin in DP causes
proliferation failure and premature catagen (Enshell-Seijffers et al., 2010; Myung et al., 2012). The
telogen to anagen transition process is highly regulated by Wnt signaling, as low level of Wnt
signaling is essential for maintaining HF quiescence and increased expression of activated β-
catenin in the second telogen resulted in precocious induction of anagen-like HF structure
associating hyper-proliferation (Choi YS et al., 2013).

1.4.2 Bmp signaling
In addition to Wnt signals, Mx cells and IRS also express Bmp ligands and receptors during
anagen, such as Bmpr1a/b, Bmpr2 in Mx, Bmp7/8 in IRS. Bmp signaling stops TAC proliferation
and allow them to enter the terminal differentiation program (Rendl M et al., 2005). Moreover,
Bmp 2/4 are lowly expressed in DP in early anagen, and highly expressed in late anagen, which
function as signaling cues for proliferation inhibition (Plikus MV et al., 2008). Besides anagen
stage, Bmp signaling also contributes to telogen-to-anagen transition. Onset of anagen, Bmp
signaling inhibitors are largely eliminated with transient rise in Wnt ligands to overcome the
refractory-to-competent signaling threshold in HFs. HFSCs quiescence is also maintained via Bmp
signaling. Expressing Bmp6 in the inner bulge layer (K6+) leads to inhibition of Bu-SC
proliferation. (Plikus et al., 2008).
10

1.4.3 Shh signaling
In postanal hair cycle, Shh and its transcriptional targets (Ptc1, Smo, Gli1 and Gli2) were
detected mainly in the anagen hair follicle. Shh signaling pathway is unique for Bu-SC activation
in early anagen stage, by analyzing K15-CrePGR; Shh
null/fl
mice referred to Shh-cKO and Sox9-
Cre
ERT
; Gli2
fl/fl
cKO mice referred to Gli2-cKO mice, they found sparser hair coat phenotype in
postnatal hair cycle, with smaller HG and dwindling of Bu-SC numbers and failure upon anagen
entry. They indicated that’s the consequences of defective Bu-SCs proliferation, with shorter ORS
in anagen, the formation for first a new HG and then Bu-SCs are affected, which results in
compromised and insufficient HFSC activation for next hair cycle, overtime, inability to generate
new HFs. (Hsu Y-C et al., 2014).

1.4.4 Fgf signaling
Besides the critical and well-known Bmp inhibiting and Wnt activating pathways, Fibroblast
growth factor (Fgf) signaling pathway was thought also very important for activating the hair cycle
(Greco et al., 2009; Maksim V Plikus et al., 2012). Genetic alterations in Fgf cause potent mutant
hair phenotypes, including thinner, abnormal hair shaft medulla formation and hair follicle number
reduction in Fgfr2-IIIb
-/-
, Fgf10
-/-
and Foxn1::dnFgfr2-IIIb mice (Petiot et al., 2003; Schlake T et
al., 2005; Ohuchi et al., 2000; Lee J et al., 2012) ; lack of hair follicle formation and loss of skin
appendages in K14-Fgf7 and K5-Cre; Fgfr1
fl/fl
and Fgfr2
fl/fl
(Guo et al., 1993, Yang J et al., 2010;
Lee J et al., 2012); Elongated hair follicle and shortened telogen length in Fgf5-/- and K5-Cre;
11

Fgf18
fl/fl
mice (Herbert et al., 1994; Kimura-Ueki et al., 2012; Lee J et al., 2012). Besides fully KO
or cKO mice model, a previous functional in vitro study suggested that increased expression of
Fgf7 and Fgf10 can precociously activates HG cells and induce them to proliferate, which is the
first step upon anagen entry (Greco V et al., 2008; Yang J et al., 2010).

1.5 Objectives of Project
The Scx-Cre; Fgfr2
fl/fl
mice model largely phenocopies the defect of K5-cre; Fgfr2
fl/fl
cKO
mice and Sox9-Cre
ER
; Gli2
fl/fl
cKO mice (Grose et al., 2007; Yang J et al., 2010; Hsu Y-C et al.,
2014). Therefore, my aim was to determine: 1) where the tendon-related gene Scx is expressed in
the HFs, 2) the functional role of Fgfr2 in HFSCs and TACs during long-term hair cycle, and 3)
the molecular mechanism for hair loss in Scx-Cre; Fgfr2
fl/fl
mice. These three questions have not
been addressed by previous studies. Moreover, I aimed to investigate whether Scx has functional
roles in HFs, as well as whether Fgfr2-IIIc is expressed in HFs and their potential roles in HFs in
the future.

12

Chapter Two: Materials and Methods

2.1 Mice and Procedures
Scx-GFP was used to mark Scx+ progenitors as previously described (Pryce et al., 2007;
Roberts et al., 2019). Fgfr2 was conditionally knockout by crossing Fgfr2
flx/flx
(JAX 007569, The
Jackson Laboratory) mice with Scx-Cre mice. The Scx-Cre and Fgfr2
flx/flx
line used has previously
been described (Blitz et al., 2009, Lewis et al., 2013; Yu et al.,2003). The Ai9 allele (JAX 007909,
The Jackson Laboratory) was used as a lineage marker for those cells targeted by Scx-Cre (Madisen
et al., 2010). According to the date of birth, postnatal samples were staged and samples were
euthanized by Carbon dioxide (CO2) overdose and followed by cervical dislocation. The mice were
shaved by electronic shaver and then dorsal skin was dissected out. Skin samples were rinsed by
cold PBS and followed by doing paraffin or cryo-embedding. Mice were weaned and collected
tails for genotyping by PCR (See PCR primers in Table 2.1. All experimental protocols were
approved by the Institutional Animal Care and Use Committee (IACUC) of University of Southern
California

13

Table 2.1 Primer for PCR
PCR was performed using 2x Taq PCR premix (Bioland) using the following primers:
Gene Primers (5’-3’) Product size
Scx-Cre
F: CTCTGGTGTAGCTGATGA
~300 bp
R: TAATCGCCA TCTTCCAGCAG
GFP
F: GCACGACTTCTTCAAGTCCGCCA TGCC
~280 bp
R: GCGGATCTTGAAGTTCACCTTGA TGCC
Fgfr2
wild type allele
F1(F): ATAGGAGCAACAGGCGG
~142/207 bp
F2(WT/R): TGCAAGAGGCGAACCAGTCAG
Fgfr2
knock-out allele
F1(F): ATAGGAGCAACAGGCGG
~471 bp
F3(KO/R): CATAGCACAGGCCAGGTTG
Ai9
wild type allele
F: AAGGGAGCTGCAGTGGAGTA
~300 bp
R: CCGAAAA TCTGTGGGAAGTC
Ai9
knock-in allele
F: CTGTTCCTGTACGGCA TGG
~200 bp
R: GGCATTAAAGCAGCGTA TCC

2.2 Hair plucking assay
Dorsal hairs of dissected from different ages were plucked from anesthetized wild type mice
(Fgfr2
flx/flx
) and cKO mice (Scx-Cre; Fgfr2
flx/flx
) using forceps. Hair types were distinguished by
their structure and pigmentation pattern using microscopy. Plucked hairs were placed on glass
slides, cover slip with mounting medium, and then the length, width, and pigmentation pattern
were analyzed under microscope.

2.3 H&E staining
For histological staining, samples were fixed in 4% PFA overnight at 4℃, dehydrated in an
ethanol series from 50% up to 100%, equilibrated in Citrisolv, embedded in paraffin and sectioned
in the coronal plane at 10 μM. Slides with paraffin sections were baked on a hot plate for 30 min
at 43°C, deparaffinized using CitriSolv, rehydrated in an ethanol series to 30%, and washed in
14

water. Slides were stained with Mayer’s Hematoxylin (Sigma-Aldrich) for 5 min and then rinsed
in running tap water for 5 min. The slides were dipped 3 times in Acid EtOH (1% Glacial Acetic
Acid in 100% EtOH), rinsed in 95% EtOH 2 times for 1min, stained in eosin for 30 sec, and
dehydrate to 100% EtOH, and equilibrated in CitriSolv. Slides were cover slipped with mounting
medium. These experiments were performed on two biological replicates per genotype.

2.4 Immunofluorescent analysis
Dorsal skin samples were dissected from different stages, fixed in 4% paraformaldehyde (PFA)
for 15 min, and washed 3 times in PBS for 5 min each. Skin samples were equilibrated in 15%
sucrose/PBS for 1.5h then 30% sucrose/PBS 1.5h at 4°C. Skin samples were incubated in the
optimal cutting temperature (O.C.T.) compound (Electron Microscopy Sciences) for 20 min, then
carefully inserted into the O.C.T-filled cryomold, taking care to remove air bubbles, and frozen on
powered dry ice. Samples were cryosectioned in the plane paralleled with the hair follicle growth
orientation at 10 μm. Frozen sections were then washed with PBST (1× PBS with 0.1% Triton X-
100) and blocked with 10% donkey serum (Sigma-Aldrich) for 1 hour at room temperature. All
sections were incubated with primary antibodies (see Table 2.4.1 below) overnight at 4°C. The
next day, sections were washed with PBST and incubated with Alexa Fluor secondary antibodies
(see Table 2.4.2 below) at 1:500/PBST for 1 hour at room temperature, washed with PBST, and
mounted with Vectashield containing DAPI (Vector Labs). Slides were imaged on a Leica TCS
SP5/8 confocal system. These experiments were performed on at least two biological replicates
per genotype.
15

Table 2.4.1 Primary antibodies used for immunofluorescence.
Antigen Species Source Catalog number Dilution
Sox9 rabbit Novus Biologicals NBP1-85551 1:1000
Gli1 goat R&D system AF3324 1:300
GFP goat ABCAM ab5450 1:1000
GFP rabbit ABCAM ab6556 1:1000
RFP rabbit Rockland antibodies and assays 600-401-379 1:500

Table 2.4.2 Secondary antibodies used for immunofluorescence.
Source Catalog number Secondary antibody description
Thermo Fisher Scientific A-11055 Donkey anti-goat IgG Alexa Fluor 488 conjugate
Thermo Fisher Scientific A-11057 Donkey anti-goat IgG Alexa Fluor 568 conjugate
Thermo Fisher Scientific A-21447 Donkey anti-goat IgG Alexa Fluor 647 conjugate
Thermo Fisher Scientific A-21206 Donkey anti-rabbit IgG Alexa Fluor 488 conjugate
Thermo Fisher Scientific A10042 Donkey anti-rabbit IgG Alexa Fluor 568 conjugate
Thermo Fisher Scientific A-31573 Donkey anti-rabbit IgG Alexa Fluor 647 conjugate

2.5 Fluorescent in situ hybridization
By using RNAscope Fluorescent Multiplex Assay (ACD), we’re able to detect transcripts for
Scx and Fgfr2 as per the manufacturer’s instructions at two different stages. Briefly, slides with
paraffin sections were baked on a hot plate for 30 min at 43°C and then deparaffinized using xylene
for 5 min, dehydrated in 100% EtOH, covered with paper towel and allowed to completely air dry.
Quenching the endogenous peroxidase activity by using the hydrogen peroxide provided within
the kit and then slides were washed in deionized water. Then performing the antigen retrieval by
using the provided Target Retrieval Reagent for 20 min in an Oster steamer heated to 99°C,
followed by dehydration in 100% EtOH and complete air drying. The slides were treated with
ACD Protease Plus in a humidified slide chamber for 20 min at 40°C. Probe hybridization was
also performed in a 40°C humidified slide chamber for 2 hours with the Scx (ACD, 439981-C3)
16

and Fgfr2 (ACD, 401051-C2) probes. Slides were then stored in 5× SSC solution overnight. As
prescribed by manufacturer and signal development, amplification steps were performed for
channels two & three and were carried out using TSA Plus fluorophores Cyanine 3 (PerkinElmer,
NEL744E001KT) and Cyanine 5 (PerkinElmer, NEL705A001KT) diluted 1:750 in the ACD-
provided TSA buffer. Slides were then counterstained using Vectashield mounting medium with
DAPI and imaged using confocal microscopy. All steps, other than those recommended by the
manufacturer to complete in a humidified slide chamber at 40°C, were carried out using plastic
five-slide capacity mailers at room temperature. Slides were images using the Leica TCS SP5/8
confocal system confocal microscope. These experiments were performed on two biological
replicates. (Method described in previous paper: Roberts RR et al., 2019)

17

Chapter Three: Results

3.1 Scx marks a molecularly distinct subdomain of the hair follicle
Scx-GFP transgenic mice were widely used as tendon reporter that marked tenogenic cells and
tenocytes (Pryce et al., 2007). In our lab’s previous study on tendon, we found that the Scx-GFP
transgene also labels the whiskers follicles. Therefore, I decided to use this line to further identify
and characterize Scx-expressing cells in the HFs. At postnatal day P21, during the first adult mouse
telogen (1
st
telogen), I detected strong Scx-GFP expression in the Bu-SCs and HGs, both of these
two regions were also marked by Sox9 expression (Fig. 3.1.1 A). Unlike the Sox9 (Nowak et al.,
2008) and many other known HFSCs markers [e.g. K15 (Liu et al., 2003), Tcf3 (Nguyen et al.,
2006)], Scx-GFP marked a zone of cells within the outermost bulge layer (CD34+), but was absent
in the innermost bulge layer (K6+). The outermost CD34+, bulge cells contain the Bu-SCs that
will become activated and give rise to the ORS later in anagen stage (Hsu et al., 2011; Rompolas
et al., 2013). The innermost K6+ bulge cells, on the other hand, inhibit HFSCs activation and
maintain Bu-SCs in a quiescent state (Fantauzzo and Christiano, 2011; Hsu et al., 2011). At P30,
during the first anagen phase (1
st
anagen) of the postnatal hair cycle , Scx-GFP was expressed in
Sox9+ cells within the upper ORS. Consistently, Scx-GFP was detected in the Bu-SCs, but absent
in K6+ bulge (Fig. 3.1.1 B). Meanwhile, Scx-GFP expression was not detected in the TACs and
the DP cells at P30 (Fig. 3.1.1 C). At P56, during the second adult mouse telogen (2
nd
telogen),
expression of Scx-GFP was similar to that in the 1
st
telogen at P21. Scx-GFP expression in the old
and new telogen follicles was restricted to the outermost Bu-SCs compartment and absent in the
18

innermost bulge compartment (Fig. 3.1.1 D). The HGs in the new hair follicle were also marked
by Scx-GFP (Fig. 3.1.1 D). These data suggested Scx+ cells co-expressed Sox9 in the Bu-SCs as
well as HGs in telogen; upper ORS in anagen.
To confirm the identity of Scx expressing cells in the hair follicle, I performed a re-analysis
of a published single cell RNA-seq dataset for the hair follicle (Yang H et al., 2017). I found that
Scx expression is enriched mostly in CD34+ Telo-HFSCs and Telo-HGs (Fig. 3.1.0). Furthermore,
others have identified Scx expression by qPCR in the hair follicle (Morris et al., 2004; Joost S et
al., 2016). These data together with my finings in vivo, support the conclusion that Scx is a bonafide
marker of HFSC.

Figure 3.1.0. Scx marks CD34+ hair follicle stem cells and hair germ cells.
Marker-based indentification (t-SNE plots) of HFSCs and HG clusters. Shown are expression pattern of Scx and CD34.

The biological and physiological significance of heterogeneity and compartmentalization of
hair follicle epidermal stem cells has primarily been mentioned in a serious of studies. The mid-
bulge region contains CD34+ stem cells thought to be the master and classical reservoirs of
epidermal stem cells, while the upper bulge region contains Gli1+ epidermal stem cells thought to
Telo-HG3
Telo-HFSC Telo-HFSC
19

be another pool of different epidermal SCs. Several studies have shown that these bulge HFSC
contribute to wound healing, hair regeneration and hair follicle-nerve interactions (Brownell et al.,
2011; Cheng C-C et al., 2018). To test whether Scx-expressing cells in adult dorsal skin might
overlap with Gli1+ upper bulge cells, we conducted immunofluorescence staining for Gli1 along
with Scx-GFP reporter (Fig. 3.1.2). At 1
st
(P21) and 2
nd
(P56) telogen stages, Gli1 expression was
restricted to two distinct domains: the upper and lower bulge, as well as the adjacent HG cells.
These results are consistent with published data (Brownell et al., 2011). Scx-GFP expression
overlapped Gli1 expression. Specifically, Scx-GFP and Gli1 were overlapping in the upper, lower
bulge region as well as the HGs; however, there expression pattern was not identical, as Gli1 didn’t
mark the middle bulge cells. (Fig. 3.1.2 A, D). Interestingly, in the higher magnification images, I
found Gli1+/ Scx-GFP+ double positive cells tended to appear more in the rostral side of the hair
follicle and not on the caudal side where the APM and sensory nerves attach (Fig. 3.1.2 A’, D’).
At early (P23) and mid-anagen stage (P30), Gli1 was expressed in upper bulge, HGs, upper and
middle ORS. In addition to this region, Gli1 was strongly expressed in the middle, lower bulge
and DP at P23, but showed reduced expression in these regions at P30 (Fig. 3.1.2 B, C). This could
relate to the specific Bu-SC activation as Bu-SCs were located in the middle bulge, and need Shh
signaling to activate their proliferation ability only at early anagen stage which was mentioned in
previous study (Hsu Y-C et al., 2014). Besides, in early anagen stage at P23, Scx-GFP also
unexpectedly marked activated and transformed HGs, these HGs proliferated and elongated
between the bulge and DP (Fig. 3.1.2 B’, C’). Taken together, these data suggested Scx marks
molecularly distinct subdomains of hair follicle, including outermost layer of Sox9+ Bu-SC, Gli1+
20

upper Bu-SCs, and HGs in the telogen HF, as well as the upper ORS and activated HG in the
anagen hair follicle.

3.2 Scx-lineage cells contribute to multiple cell types within the hair follicle
To track the fate of Scx-lineage cells, I used the lineage marker Ai9 allele (JAX 007909, The
Jackson Laboratory) to trace those cells recombined by Scx-Cre (Madisen et al., 2010). In this
transgenic mouse line, the Cre sequence is followed by the GFP sequence, allowing it to report
on both active Scx-expressing cells and Scx-lineage cells (Madisen et al., 2010; Roberts RR et al.,
2019). At early anagen (P23), Scx-expressing cells were localized in the outermost layer of bulge
cells and expanding HGs, which consisted of the emerging TAC cells. This is consistent with the
expression pattern of Scx-GFP transgenic mice. Surprisingly, Scx-lineage cells (Ai9+ positive)
were identified in the innermost layer of bulge cells and APM (Fig. 3.2 A). At P30, in the mid-
anagen phase, Scx-lineage cells were distributed more broadly, in addition to upper ORS and
bulge, the middle ORS, IRS, hair shaft medulla, lower bulb which contains lower ORS in the
outer layer and TACs in the inner layers, and APM contained Scx-lineage cells (Fig. 3.2 C-F). In
particular, it is not clear based on the current models how Scx-lineage cells could give rise to K6+
inner bulge cells in the telogen hair follicle and needs further investigation. Overall, my genetic
tracing of Scx-expressing and Scx-lineage cells suggests that Scx is a unique marker specific for
HFSC populations, including quiescent Bu-SC and those in the HGs. Scx-lineage cells in the
telogen hair follicle can give rise to nearly all cells of the hair follicle during subsequent cycles
except for DP and companion layer (Cp) which is the layer between ORS and IRS. At P56, similar
21

to the early anagen stage at P23, all hair follicle compartments including the inner and outer layer
of bulge cells, HGs, and APM contained Scx-expressed progeny cells with the exception of the
mesenchymal-derived DP (Fig. 3.2 B).

3.3 Scx and Fgfr2 is co-expressing in hair germ cells and matrix cells
By examining several published papers, I found that although some real-time PCR and single-
cell RNA-seq data showed Fgfr2 was enriched in HGs in postnatal telogen (Greco V et al., 2008;
Yang H et al., 2017), currently it still remains uncertain, as the Fgfr2 expression pattern in telogen
and early anagen remains unclear, and one previous study indicate no detection in telogen by using
in situ analysis (Rosenquist TA et al., 1996). In order to determine the Scx and Fgfr2 co-expression
compartments in HFs, we conducted double fluorescent RNA in situ hybridization on the entire
hair follicle. At P21, 1
st
telogen in postnatal hair cycle, identified cells co-expressing Scx (red) and
Fgfr2 (green) mainly in the HG region, some lower bulge cells near the HGs also labeled as double
positive (white arrowhead) (Fig. 3.3 A-A’). In addition to HG and lower bulge, Scx was also
detected in upper and middle bulge, which consistent with previous Scx-GFP expression pattern
(Negative control experiment was conducted, not shown in the figure). Scx+/Fgfr2+ cells were
also identified in the matrix cells which adjacent to DP at P30, the mid-anagen stage (Fig. 3.3 C-
C’). In the bulb follicle, Scx is mainly expressing in lower bulb region including basal matrix cells
and some basal ORS cells. While Fgfr2-IIIb is mainly expressing in matrix cells at the middle bulb
layers which adjacent to the DP, and some are detected in the upper hair bulb which is consistent
with previous study (Rosenquist TA et al., 1996). Scx was also detected in the bulge and upper
22

ORS region, similar to the Scx-GFP expression pattern at P30 (Fig. 3.3 B-B’).
These in situ analysis showed the Fgfr2-IIIb mRNA expressed in the HGs in adult telogen
follicle, and Fgfr2-IIIb mRNA expressed in the TACs in adult anagen follicle. In the bulge and
upper ORS expressed Scx-GFP whereas the lower bulb region express Scx mRNA exclusively.
Together, these data suggested certain function of Fgfr2 would be eliminated not only in matrix
cells during anagen but also in HGs and even limit stem cells during telogen by using Scx-Cre
promoter.

3.4 Scx-Cre; Fgfr2
fl/fl
mice display abnormal hair phenotype
All previous studies suggested Fgfr2 and its main ligands FGF7,10 could potentially have two
different functional roles in postnatal hair cycle. One predicted aspect is Fgfr2-IIIb receptor in
TACs is responded to the Fgf7 and 10 signaling in DP and further control normal hair shaft
proliferation and differentiation. Some experiments were done in early morphogenesis stage,
checking proliferation or differentiation by xenografts experiments (Petiot et al., 2003; Yang J et
al., 2010). But due to the fact that these mice die shortly after birth, currently there’s no specific
way to check proliferation and differentiation during postnatal hair cycle in these mice. Although,
in another cKO model, K5-Cre-Fgfr2-null mice survive normally after birth, but currently studies
using these mice have mainly focus on the cutaneous homeostasis. Another predicted aspect is
Fgf7 and 10 could activated HGs in late telogen and initiation their transition to anagen, since the
Fgf7 progressively increased within DP (Greco et al., 2009). However, no clear evidence supports
this putative function in Fgf7
-/-
or Fgf10
-/-
models and whether Fgfr2 depletion has a functional
23

roles remains unclear too, besides, the molecular mechanism lead to Fgfr2 cKO defects remains
unknown.
In our lab previous study, we demonstrate loss of Fgfr2 in the mouse tendon-bone interface
reduces Scx expression in Scx+/Sox9+ progenitors (Roberts RR et al., 2019). Unexpectedly, during
our analysis in Scx-Cre; Fgfr2
fl/fl
mice, we noted that their fur was abnormally matted, unkept, and
showed progressive hair loss (Fig. 3.4 A-D’). At P21, the first telogen stage in postnatal hair cycle,
the difference between control and Fgfr2-cKO mice were not strikingly distinguishable (Fig. 3.4
A-A’), The hair coat in Fgfr2-cKO mice became sloppy and sparse during the second anagen stage
(Fig. 3.4 B-B’). From P56, the second round of telogen stage, the Fgfr2-cKO mice started to
display hair loss problem and their hair shaft color was paler than its control littermates (Fig. 3.4
C-C’). Later after several hair cycles, at P300, Fgfr2-cKO mice suffered from severe hair loss
problem, which was spread all over the dorsal skin, especially the dorsal skin in the middle and
towards the neck. We see that the skin of these mice is sparse, pale and thinner hair covered in
Fgfr2-cKO mice, while the control littermates’ skin was covered with thicker, darker and denser
hair (Fig. 3.4 D-D’). This phenotype continuously occurs in several groups.
Together, the abnormal hair phenotype in Scx-Cre; Fgfr2
fl/fl
mice largely phenocopies the
defect of K5-cre; Fgfr2
fl/fl
cKO mice (Grose et al., 2007; Yang J et al., 2010), which gave us a
chance to further study the molecular mechanism of how Fgfr2 is regulate the mature hair
patterning and determine if there asynchronous cycle in the postnatal hair growth in absence of
Fgfr2, and the mechanism for the subsequent hair loss.

24

3.5 Fgfr2 regulate hair shaft medulla and cuticle structure in mature hair
We then further check the difference in individual hair shaft between Scx-Cre; Fgfr2
fl/fl
cKO
mice and their littermates. Under the light microscope, mature hair in our Scx-Cre; Fgfr2
fl/fl
cKO
mice appeared to have thinner diameter and longer length in the same zigzag hair type (Fig. 3.5 G,
H). And more in detail, in Scx-Cre; Fgfr2
fl/fl
cKO mice, the outermost layer of hair shaft which
refers to hair cuticles, have jagged structure; the visible ladder-like medulla structure is totally
absent, and only had thin, linear-like medulla structure instead, moreover, the regular spacing of
air cells was missing. Together, these represented a weird hair shaft structure in both of the hair
coat and internal hair medulla structure.
Furthermore, by examining the H&E staining at P30, I also confirmed the disrupted medulla
in Fgfr2-cKO mice, which didn’t have the ladder like structure but more continuous and slender
structure (Fig. 3.5 A-F). Also, the Fgfr2-cKO mice seem to have less melanocytes in lower hair
bulb compared to their littermates. (Fig. 3.5 A, D) Not only in the hair shaft which reached out to
the epidermis (Fig. 3.5 C, F), the ladder-like medulla structure also existed in the upper bulb region
in control littermates, but the same structure was absent and even loss of medulla cells in the upper
bulb region in mutant mice. (Fig. 3.5 B, E)
Together, altered and disrupted medulla and cuticle structure in Scx-Cre; Fgfr2
fl/fl
cKO mice
indicate that Fgfr2 regulates normal hair shaft formation. While the specific mechanism is
unknown, the abnormal hair phenotype is likely caused by an apoptosis-driven reduction of
medulla-forming cells and probably also melanocyte-forming cells.

25

3.6 Fgfr2 is required for stem cell activation in long-term hair cycle progression
Limited careful histology examination has been conducted in previous postnatal Fgfr2-cKO
mice during hair cycle. We conducted histological longitudinal paraffin sections from control
(Fgfr2 fl/fl) and Fgfr2-cKO (Scx-Cre/GFP Fgfr2 fl/fl) mice at P21, P30, P56 with H & E (Fig.
3.6 A-G’). In lower magnification, we observed progressive hair follicle number reduction in
the absence of Fgfr2 in Scx+ cells (Fig. 3.6 E-G’). Unexpectedly, we found asynchronous wave
in the first postnatal hair cycle, especially from P21 to P30. Followed the guide for the accurate
classification of murine hair follicles (Sven Müller-Röver et al., 2001), we found although
majority of HFs in Fgfr2-cKO mice and their littermates are in telogen stage at P21, but some
HFs in Fgfr2-cKO mice were still in catagen VIII, as they still had tailing connective tissue
sheath (CTS) below the DP, which is part of the dermal connective tissue, tightly attached to the
outer side of HF, composed of connective tissue. Which means at P21, Fgfr2-cKO mice just
finished the transition from catagen to telogen, while their control littermates already finished
telogen and fully prepared to enter anagen stage. (Fig. 3.6 E-E’). At P30, we found dramatically
difference in HFs between Fgfr2-cKO mice and their littermates. Most of HFs in Fgfr2-cKO
mice were in Ana-III or Ana IV stage, some HFs were in Ana V , as the HFs showed large DP of
loose consistency and the newly formed HS reached up to the middle of follicle, while in their
control littermates, most of HFs are in Ana-V or Ana-VI, as narrow DP and HS emerged through
the epidermis. This indicates, the progression of anagen was delayed in Fgfr2-cKO mice (Fig.
3.6 F-F’). At P56, the HFs in Fgfr2-cKO mice or their littermates were in telogen stage, but HF
number was largely reduced, and the remained HF structure was largely disrupted by enlarged
26

SG and miniaturization of DP (Fig. 3.6 G-G’). The asynchronous hair cycle was summarized in
the following table.

Table 3.6 Asynchronous hair cycle in control and Fgfr2-cKO mice
Stage Fgfr2
fl/fl
Scx-Cre; Fgfr2b
fl/fl
P21 Majority of HFs in telogen phase (Tel-Ana) Majority of HFs in telogen phase (Cata-Tel)
P30 Majority of HFs in anagen VI or V Some HFs in anagen VI, Most HFs in Ana-III or
IV
P56 HFs in telogen phase; normal SG, APM,
Bu and HG
HFs in telogen phase; enlarged SG; dislocated
APM; Samll Bu & HG;
Long-term HC Normal hair regeneration Regeneration failure

Overall, the asynchronous hair cycle represented as delayed anagen progression during 1
st
hair cycle;
but by the fact that we didn’t check the anagen to catagen transition (P35) and catagen to telogen
transition (P42) stages, we could left some part of story that apoptosis may also play a role in this
asynchronous and disrupted hair cycle. Although not followed H&E histology analysis after 2
nd

telogen stage, we did observed some hair coat difference between Fgfr2-cKO mice and its control
littermates by shaving, that control mice had some darker anagen hair appeared in the two lateral
sides of mice dorsal skin, while in the same site of Fgr2-cKO, the hair coat still seems to be pink
and fewer hair density in its dorsal skin. This indicated, some HFs in control dorsal skin might
begin 2
nd
hair cycle, while the HFs in Fgfr2-cKO mice were still arrested in telogen in a long run
(Fig. 3.6 H-H’).
Individual HF structural changes between control and Fgfr2-cKO mice were examined in
higher magnification (Fig. 3.6 A-D’). Hair follicles showed enlarged SG, dislocated arrector pili
27

muscle from attached to the middle bulge to the lower bulge in Fgfr2-cKO mice though P21 to
P56 (black arrowhead). Although we didn’t conducted thoroughly statistical analysis of the
bulge and DP cell number between mutant mice and their control littermates, we could clearly
observe the bulge was shorten and the DP size was smaller in the mutant mice, which indicated
the HFSC number is reduced in the mutant mice (Fig. 3.6 C-D’). Notably, our Scx-Cre; Fgfr2

fl/fl
cKO mice display dramatically enlarged SG compared to control littermates and the SG still
attached to the HFs even in the 2
nd
telogen stage at P56, this finding was opposite to the K5-Cre;
Fgfr2
fl/fl
cKO mice results which they demonstrated SG atrophy in tail skin, but they also
indicated “silky” or more “oily” dorsal skin appearance (Grose et al., 2007). Whether this
enlarged SG phenotype is related to the dislocated APM or not, and why the SGs were not
atrophied in Scx-Cre; Fgfr2
fl/fl
cKO mice needs further investigation. In summary, loss of Fgfr2
in postnatal hair cycling, results in delayed anagen progression, and progressively reduced
number of HFSCs including Bu-SCs and HGs. Eventually, this impaired long-term HF
regeneration and trapped HFs in telogen stage, and mice showed hair loss problem as they age.

28

Scx-GFP; Fgfr2
+/fl

Scx-GFP Sox9 DAPI

Figure 3.1.1. Scx marks Sox9+ hair follicle stem cells and hair germ cells.
Immunofluorescence microscopy with Sox9 Abs (color coded) of back skin sections of Scx-GFP transgenic mice at
(A)1
st
telogen (P21), (B-C)1
st
anagen (P30) and (D) 2
nd
telogen (P56) stages. As known before, Sox9 marks inner
(K6+ HFSCs) and outer (CD34+ HFSCs) bulge layer, as well as the hair germ (HG). Similarly, GFP Ab staining of
Scx-GFP reporter mice shows Scx continues to mark a zone of cells within the outer bulge layer (CD34+ HFSCs)
and HG at 1
st
and 2
nd
telogen stage. Meanwhile, Scx marks the bulge and upper ORS region but Scx expression is
absent from the transient amplifying matrix at rapid anagen growing phase. (n=3 mice) Bu: bulge; HG: hair germ;
DP: dermal papillae; Mx: matrix cells; ORS: outer root sheath. Scale bars: 25 μm.

Bu
HG
DP
Bu
ORS
Mx
Mx
DP
Old Bu
New Bu
HG
DP
A 1
st
Tel (P21)
HG
B 1
st
Ana (P30) C 1
st
Ana (P30) D 2
nd
Tel (P56)
29

Scx-GFP; Fgfr2
+/fl

Scx-GFP Gli1 DAPI

Figure 3.1.2. Scx marks Gli1+ upper bulge cells.
Immunofluorescence microscopy with Gli1 Abs (color coded) of back skin sections of Scx-GFP transgenic mice at
(A) 1
st
telogen (P21), (B) Tel-Ana transition stage (P23), (C)1
st
anagen (P30) and (D) 2
nd
telogen (P56) stages. (A’-
D’) High magnification of upper bulge and other double positive regions within the dashed line from A-D. Double
staining against Gli1 and GFP at 1
st
and 2
nd
telogen in Scx-GFP mice demonstrating that besides the main HFSCs,
Scx also marks a molecularly distinct subdomains which is Gli1+ upper bulge region. Notably, in the early (P23) and
middle anagen (P30) stage, the lower bulge region and ORS region are also stained as double positive region. (P21,
P23: n=1 mouse, P30, P56: n=2 mice) Arrowheads indicate double positive cells. Bu: bulge; HG: hair germ; DP:
dermal papillae; Mx: matrix cells; ORS: outer root sheath. Scale bars: 25 μm.

A 1
st
Tel (P21) B Tel-Ana (P23) C 1
st
Ana (P30) D 2
nd
Tel (P56)
Bu
HG
DP
Mx
DP
Bu
HG
ORS
Bu
Old Bu
New Bu
HG
DP
A’ B’
B’’
C’
C’’
D’
30

Figure 3.2. Scx lineage cells give rise to multiple cell type in hair follicle.
Immunofluorescence microscopy with RFP and GFP Abs of back skin sections of Ai9 tg/- Scx-Cre/GFP; Fgfr2
+/+

transgenic mice at (A) Tel to Ana transition stage (P23), (B) 2
nd
telogen (P56), (C-F)1
st
anagen (P30) stages. GFP
staining reflective of Scx-expressing cells, TdTomato autofluorescence and staining reflective of Scx-expressing cells
and dorsal skin HFs. At telogen stage, derivatives were found in the outer bulge, HG region, and the inner bulge region.
At anagen stage, TdTomato staining marks the ORS, permanent bulge region, HS including Medulla; IRS, and Mx
cells. These indicating except for DP , Scx-derived progeny can contribute to nearly all skin epithelial linage, as well
as the APM (n ≥ 2 mice) Bu: bulge; HG: hair germ; DP: dermal papillae; Mx: matrix cells; ORS: outer root sheath;
IRS: inner root sheath; APM: arrector pili muscle; HS: hair shaft; Me: medulla; Cp: companion layer. Scale bars: 25
μm.

Scx-Cre/GFP; Fgfr2
+/+
; Ai9 tg/-
Anti-Ai9 Anti-GFP DAPI

Anti-Ai9 Anti-GFP DAPI

Anti-Ai9 Anti-GFP DAPI

Ai9
Anti-Ai9
Anti-GFP
DAPI
Anti-GFP
Anti-Ai9
A P23 B
P56
C
D
E F
P30 P30
P30
P30
Bu
HG
APM
Old Bu
New Bu
HG
DP
APM
Bu
ORS
ORS
Mx
DP
Me
ORS
Cp
IRS
31

Fgfr2
fl/fl

In situ: Fgfr2-IIIb Scx DAPI

Figure 3.3. Scx and Fgfr2 is co-expressing in hair germ cells and matrix cells.
Double fluorescent in situ hybridization for Fgfr2-IIIb (green), Scx (red) and hair shaft autofluorescence (bright
yellow) in the HF at (A-A’) 1
st
telogen stage and (B-C’) 1
st
anagen stage. Scx and Fgfr2-IIIb is colocalized in the
matrix cells at anagen stage; Scx is mainly expressing in lower bulb region while Fgfr2-IIIb is mainly expressing in
the middle bulb region. Scx is mostly expressing in the transient amplifying matrix cells, but some are found in the
permanent upper bulge region. At 1
st
telogen stage, Scx is wildly expressing in the bulge and HG region, surprisingly,
Fgfr2-IIIb is also expressing in HG region at this stage. (n=2 mice) Arrowheads indicate double-positive cells. Bu:
bulge; HG: hair germ; DP: dermal papillae; Mx: matrix cells; Dashed lines demarcate boundaries of the hair follicle
(A’-B’), DP and lower bulb region (C’). Scale bars: 25 μm.

A
A’ B’
B C
C’
P21
P30 P30
Bu
DP
HG
Bu
ORS
Mx
Mx
DP
32

Fgfr2fl/fl Scx-Cre/GFP; Fgfr2
fl/fl

Figure 3.4. Scx-Cre Fgfr2
fl/fl
cKO mice display abnormal hair phenotype.
(A-D’) Left: Schematic timeline of postnatal hair cycles. Right: Photos were taken from (A-D) control (Fgfr2 fl/fl)
and (A’-D’) Fgfr2-cKO (Scx-CreGFP Fgfr2
fl/fl
) mice at P21, P30, P56 and P300 (n ≥3 litter pairs). Depletion Fgfr2
in Scx-expressing cells yielding abnormally matted and unkempt hair coat with thinner hair shaft, unstructured and
reduced hair medulla columns, and progressive hair loss.

A A’
B B’
C C’
D D’
P21
P30
P56
P300
33

Fgfr2fl/fl Scx-Cre/GFP; Fgfr2
fl/f

ctl

cKO

Figure 3.5. Fgfr2 is required for hair shaft medulla structure formation
(A-F) Histological longitudinal paraffin sections from (A-C) control (Fgfr2
fl/fl
) and (D-E) Fgfr2-cKO (Scx-Cre/GF;
Fgfr2
fl/fl
) mice at P30 were stained with H & E (n ≥ 2 litter pairs). In control mice, hair shaft forms normal medulla
columns in zigzag hair (one column) while in Fgfr2-cKO mice, hair shaft medulla structure is disrupted and less
Melanocytes was expressed in anagen hair. (G-H) A compassion of hair shaft between control (Fgfr2
fl/fl
) and Fgfr2-
cKO (Scx-CreGFP Fgfr2
fl/fl
) mice at P97 (n=1 litter pairs). The overall length and shape of hair is shown in the
right and whereas the higher magnification microscope appearance of hair shaft medulla structure is shown in the
left. (G) In control mice, the hair shaft is thinker and longer (H) while cKO mice hair is thinner and the pigmentation
pattern is disrupted also in later stage

G
H
A B C D E F
34

1
st
Tel (P21) 1
st
Ana (P30) 2
nd
Tel (P56)
Fgfr2fl/fl

Scx-Cre/GFP; Fgfr2
fl/fl

Fgfr2fl/fl Scx-Cre/GFP; Fgfr2
fl/f

Bu
HG
DP
Bu
ORS
Mx
DP
Old Bu
New Bu
HG
Bu
HG
DP
Bu
ORS
Mx
DP
Old Bu
New Bu
HG
HG
SG
SG
SG
SG
SG
SG
A
A’
B
B’
C
C’
D
D’
E
E’
F
F’
G
G’
P21
P30
P56
35

Fgfr2
fl/fl
Scx-Cre/GFP; Fgfr2
fl/fl

Figure 3.6. Progressive hair loss and specific anatomical defects in Scx-Cre Fgfr2
fl/fl
cKO mice
(A-G’) Histological longitudinal paraffin sections from (A-G) control (Fgfr2
fl/fl
) and (A’-G’) Fgfr2-cKO (Scx-
Cre/GFP Fgfr2
fl/fl
) mice at P21 (1
st
Tel), P30 (1
st
Ana), P56 (2
nd
Tel) were stained with H & E (n ≥ 2 litter pairs). (H-
H’) A compassion of postanal hair cycle initiation between control (Fgfr2
fl/fl
) and Fgfr2-cKO (Scx-Cre/GFP Fgfr2
fl/fl
) mice at P56 (n=1 litter pairs). (A-D’) Higher magnification shows individual hair follicle structures changes
between control and Fgfr2-cKO mice. Hair follicles in Fgfr2-cKO showed shorten bulge; enlarged sebaceous gland,
follicular miniaturization, mini and dislocated arrector pili muscle (black arrowhead). (E-G’) Lower magnification
shows progressive hair follicle number reduce and enlarged dermis in Fgfr2-cKO mice. (H-H’) Control mouse
showed some dense anagen hair in the edge of dorsal skin, while Fgfr2-cKO mouse hair coat is sparse and didn’t
have anagen transition initiation at same location. Arrows indicate anagen hair appearance in control and Fgfr2-cKO
mice. Bu: bulge; HG: hair germ; DP: dermal papillae; Mx: matrix cells; SG: sebaceous glands. Scale bars: 25 μm
(A-D’), 100 μm (E-G’).
H
H’ P56
36

Chapter Four: Discussion

Figure 4.1 Scx-expression and Scx-lineage tracing pattern
(A) Scx-expression pattern in HFs from 1
st
telogen to 2
nd
telogen stage
The pattern of Scx-expressing and Scx-lineage cells were distinct from any previously described HFSC marker,
A
B
37

including K15, CD34, Sox9, Lgr5 and Tcf3. In telogen stage, Scx expressing cells are overlapped with K15+
and Sox9+ cells, that they all mark upper, middle and lower bulge, as well as HGs. However, Scx-GFP doesn’t
mark the innermost layer of the bulge, which is K6+, and instead, Scx-GFP marks continuously restricted to
the outermost layer of bulge which is CD34+. However, Scx-expressing cells is distinct from CD34+ cells
because CD34 is not expressed in the upper and lower bulge, as well as HGs. Currently, the most common view
of HFSCs is that they contain the Bu-SCs and HGs (Hsu Y-C et al., 2014). To this extend, Scx-expressing cells
marks not only very specific to HFSCs, as they don’t mark the inner K6+ bulge, but also very comprehensive
to HFSCs, as they mark both Bu-SCs and HGs populations. This indicate Scx could be one of the most useful
HFSC markers for telogen follicles. In anagen stage, Scx expressing cells are overlapped with K15+ cells too,
which is reliably expressed in high levels in the bulge and in lower levels in the middle ORS and diminished
in the basal hair bulb (Gay et al., 2014). In the bulge and upper ORS expressed Scx-GFP whereas the lower
bulb region express Scx mRNA exclusively.

(B) Scx-lineage tracing in HFs from 1st telogen to 2nd telogen stage
As for lineage tracing, very interestingly, at 1
st
and 2
nd
telogen stage, the inner K6+ bulge cells also labeled as
Scx+, the mechanism of contribution of anagen Scx+ cells to the telogen bulge remains unknown. It will be
important to determine how Scx-lineage cells could give rise to the inner bulge cells in morphogenesis catagen
stage or in postnatal catagen stage in furure, since the Scx not identical to any previously described HFSC
marker

38

Figure 4.2 Hypothesized model for the role of Fgfr2-related signaling in adults HFs
Altogether, mechanism for the abnormal phenotype in Scx-Cre; Fgfr2
fl/fl
cKO mice are described in detail in this
model. In conclusion, I hypothesize: loss of Fgfr2 in the HGs and their TACs derivatives alter their ability to respond
to the pro-proliferative Fgf7 and Fgf10 signals, which is critical for HGs activation, anagen entry, and normal hair
shaft formation. I also hypothesize that loss of Fgfr2 in the upper HGs, which are a putative source of outer root sheath
cells (ORS), inhibits their FGF-mediated activation and proliferation. Without sufficient activation and proliferation,
replenishment of primed-HFSCs to form first a new HG and then Bu-SCs for the next hair cycle is compromised.
Eventually this impaired Fgfr2 signaling results in hair follicular reduction, hair shaft defects, and inhibition of long-
term HF regeneration.
39

4.1 The Scx-expressing cells and their progeny in HFs
The pattern of Scx-expressing and Scx-lineage cells were distinct from any previously
described HFSC marker, including K15, CD34, Sox9, Lgr5 and Tcf3. In telogen stage, Scx
expressing cells are overlapped with K15+ and Sox9+ cells, that they all mark upper, middle and
lower bulge, as well as HGs. However, Scx-GFP doesn’t mark the innermost layer of the bulge,
which is K6+, and instead, Scx-GFP marks continuously restricted to the outermost layer of bulge
which is CD34+. However, Scx-expressing cells is distinct from CD34+ cells because CD34 is
not expressed in the upper and lower bulge, as well as HGs. Currently, the most common view of
HFSCs is that they contain the Bu-SCs and HGs (Hsu Y-C et al., 2014). To this extend, Scx-
expressing cells marks not only very specific to HFSCs, as they don’t mark the inner K6+ bulge
which will is excluded from Bu-SCs and inhibit HFSC proliferation, but also very comprehensive
to HFSCs, as they mark both Bu-SCs and HGs populations. This indicate Scx could be one of the
most useful HFSC markers for telogen follicles.
In anagen stage, Scx expressing cells are overlapped with K15+ cells too, which is reliably
expressed in high levels in the bulge and in lower levels in the middle ORS and diminished in the
basal hair bulb (Gay et al., 2014). Very interestingly, at 1
st
telogen stage, the inner K6+ bulge cells
also labeled as Scx+, in other words, Scx is also expressing during morphogenesis process
although not conducted real experiments, and the mechanism of contribution of anagen Scx+ cells
to the telogen bulge remains unknown. It will be important to determine how Scx-lineage cells
could give rise to the inner bulge cells in morphogenesis catagen stage or in postnatal catagen
stage, since the Scx not identical to any previously described HFSC marker, including K15, CD34,
40

Sox9 or Lgr5. Models depicting Scx expressing cells and their progeny in HFs are described in
detail in Figure 4.1.

4.2 Possible molecular mechanism to explain the phenotype difference between
Scx-Cre; Fgfr2
fl/fl
mice and their control littermates
The Scx-Cre; Fgfr2
fl/fl
model is currently the best model to study the functional role of Fgfr2-
related signal in HF system. Firstly, the mice wouldn’t die after birth, contrast to other models need
to do xenograft experiments and couldn’t investigate the Fgfr2 role in long-term hair regeneration
(Petiot A et al., 2003; Yang J et al., 2010). Secondly, it gave us a chance to further study the
predictive but not fully investigated roles of Fgfr2-Fgf7 pro-proliferation signaling in either TACs
or more importantly in HFSCs. Since HFs and other skin appendages were not dramatically loss
in the first hair cycle (Grose et al., 2007).
In TACs, the Scx-Cre; Fgfr2
fl/fl
model gave us a chance to remedy the drawbacks in previous
Foxn1::dnFgfr2-IIIb transgenic mice study (Schlake T 2005). Fonx1 promoter produces strong
expression of dominant-negative Fgfr2-IIIb receptor only in hair cortex which is one of several
epithelial compartments in hair follicle, and that lead to indistinguishable proliferation analysis in
the TACs which are the progenitor cells for medulla cells. (Schlake T 2005). While Scx-Cre;
Fgfr2
fl/fl
cKO the Fgfr2 receptor directly in TACs and their progeny IRS and HS cells. Therefore,
my hypothesis for the altered structural change in HS in Scx-Cre; Fgfr2
fl/fl
cKO mice, is that due
to an apoptosis-driven reduction of TACs, plus, the reduced proliferation in TAC cells which will
affect normal IRS and HS formation.
41

Very interestingly, the outermost layer of HS, which called cuticle layer appeared to be
affected more in broadly Fgfr2-cKO model, such as K5-Cre; Fgfr2
fl/fl
cKO model (Grose et al.,
2007) or our Scx-Cre; Fgfr2
fl/fl
cKO model, compared to Foxn1::dnFgfr2-IIIb model which
specifically expressed the dominant negativeFgfr2-IIIb in hair cortex, the middle layer of HS. The
hair cuticles in broadly Fgfr2-cKO mice have jagged structure, while the Foxn1::dnFgfr2-IIIb
transgenic mice didn’t appear same phenotype, their cuticles are continuously smooth compared
to their littermates control. Which indicate by using the stem cell promoter and broadly knockout
the Fgfr2 in anagen HF, could affected all layers of HS, including the innermost layer, medulla;
the middle layer cortex and the outermost layer cuticle. While specific express dn-Fgfr2 receptor
could only affect medulla structure. And whether this maybe through alteration in IRS milieu
around the HS remains unknown. Mild affected cuticle also appeared in the Fgf10-/- mice (Suzuki
K et al., 2000). The proliferation and apoptosis comparison between Scx-Cre; Fgfr2
fl/fl
cKO mice
and their littermates during anagen at P30-P35 would be the most important ongoing studies in
future. And further quantitative studies should be done to test if the hair diameter and the hair
length between Scx-Cre; Fgfr2
fl/fl
cKO and their control littermates have the statistical significance
difference.
In HFSCs, we could fully study which subpopulation of HFSCs whether the HGs or Bu-SCs,
or those two populations together, would response to the Fgf7-Fgfr2 proliferation signaling at
telogen to anagen transition stage. And how could loss of activated HGs and Bu-SCs resulted in
gradually follicular miniaturization and hair loss problem.
Above hypothesis based on Scx-Cre; Fgfr2
fl/fl
cKO referred to Fgfr2-cKO mice largely
42

phenocopied the K15-CrePGR; Shh
null/fl
mice referred to Shh-cKO and Sox9-Cre
ER
; Gli2
fl/fl
cKO
mice referred to Gli2-cKO mice. These mice have similar sparser hair coat phenotype in postnatal
hair cycle, and smaller HG and dwindling of Bu-SC numbers followed by each hair cycle, which
eventually leads to failure of long-term regeneration. (Hsu Y-C et al., 2014). The difference
between Shh-cKO mice and Gli2-cKO mice is that both HGs and Bu-SCs proliferation are
inhibited in Shh-cKO mice, and only Bu-SCs proliferation ability is inhibited in Gli2-cKO mice.
The Shh-cKO mice showed great hair cycle arrest after Ana II and HF couldn’t down-growth and
recovery. While, contrast to Shh-cKO mice, HFs in Gli2-cKO mice could fully generated at1
st

anagen, but the ORS in anagen HFs are shorter, and at 2
nd
telogen, the HG size and Bu-SC numbers
was significantly reduced compared to controls, then in later hair cycle, the Gli2-cKO HFs failed
to regenerate completely. They indicated that’s the consequences of defective Bu-SCs proliferation,
with shorter ORS in anagen, the formation for first a new HG and then Bu-SCs are affected,
together these are two main populations of HFSCs in new HFs, which results in compromised and
insufficient HFSC activation for next hair cycle, overtime, inability to generate new HFs. (Hsu Y-
C et al., 2014).
Therefore, the possible mechanism of progressive hair loss in Scx-Cre; Fgfr2
fl/fl
cKO mice
also could due to proliferation defects in either HGs or Bu-SCs or these cells together. By the fact
that in K14-Cre; Fgfr2
fl/fl
cKO mice (Nguyen MB et al., 2018), differentiation and specification
are not altered in P35 mutant xenografts HFs, but only shortened ORS (the proliferation ability
was not checked in their study); And in Scx-Cre; Fgfr2
fl/fl
cKO mice, anagen HFs could normally
formed at P30, but just ORS are shorten and little bit lagged anagen progression behind controls.
43

My hypothesis for the hair loss mechanism in Fgfr2-cKO is that only one specific population of
HFSCs is affected by ablation of Fgfr2, either the HGs or the Bu-SCs, both of these cells in telogen
could give rise to ORS cells in anagen, and proliferation defects in ORS cells, results in shorten
ORS in anagen follicle, then without sufficient input from ORS, the formation of HGs and Bu-SCs
for new HFs are negatively affected, smaller HGs size and reduced number of Bu-SCs lead to
progressive inability to respond to proliferation signaling in new HFs and eventually lead to
inability to regenerate new HFs over time.
Together, model depicting the possible mechanism for the abnormal phenotype in Scx-Cre;
Fgfr2
fl/fl
cKO mice are described in detail in Figure 4.2.

4.3 The secondary defects including APM dislocation and SG expansion in
Fgfr2-cKO mice
One unique phenotype in Scx-Cre; Fgfr2
fl/fl
cKO mice which differs from K5-Cre; Fgfr2b
fl/fl
cKO
mice is that SGs are not atrophy during postnatal hair cycle, but SGs are enlarged and tightly
connected to the HFs during postnatal hair cycle, accompany with dislocated APM which not
attached in the middle bulge, but attached to the lower bulge or disconnected to the bulge. Whether
this is the directly consequence of ablation Fgfr2 in Scx-expressing cells or this is the secondary
defects due to miniaturization HFs need further investigation.Very interestingly, in human, the
APM degeneration was also founded in an irreversible alopecia. Currently, the mechanism of APM
connection loss in alopecia remains unknown and one hypothesis was mentioned in previous study,
that this also related to miniaturization of HFs. (Torkamani N et al., 2014).
44

4.4 The difference and possible affects between Fgfr2-IIIb and Fgfr2-IIIc
isoform in HFs
As well known before, Fgfr2 could encode two receptor isoforms, Fgfr2-IIIb and Fgfr2-IIIc.
Fgfr2-IIIb are highly expressed in epithelial cells, while Fgfr2-IIIc are highly expressed in
mesenchymal cells (Petiot et al., 2003;). Nearly all previous studies in HFs mainly focused on the
functional role of Fgfr2-IIIb isoform and its main ligands FGf7 and 10. However, which ligands
binds to Fgfr2-IIIc isoform, and where’s Fgfr2-IIIc isoform expressed in HFs remained largely
unknown (Yang J et al., 2010). One important study in future is by using in situ probes which can
specific distinguish the Fgfr2-IIIb and Fgfr2-IIIc RNA isoform to investigate whether Fgfr2-IIIc
has similar or districted roles in mesenchymal cells in HFs. For example, could the unique enlarged
SG phenotype in Scx-Cre; Fgfr2
fl/fl
mice contrast to SG atrophy in K5-Cre;Fgfr2b
fl/fl
mice is due
to the ablation of Fgfr2-IIIc in APM need to be further investigated.

4.5 The Scx expressing pattern in other hairy-regions
Besides the mice dorsal skin, I observed that Scx-Cre; Fgfr2
fl/fl
mutant mice whiskers become
pale and curly while compared to the control mice. Since the expression pattern of mammalian
hair growth vary in different regions of the body, such as ear, tail, nose and the dorsal skin (Yu et
al., 2018). We hypothesize that Scx gene expression in HFs varies along the anterior-posterior body
axis and perhaps contributes more to the region that needs high sensory and movement, like
whiskers on the nose. And Fgf-related signaling pathway may give a new insight of mechanisms
controlling this heterogeneity.
45

References
1. Adam RC, Yang H, Ge Y, et al. Temporal Layering of Signaling Effectors Drives Chromatin Remodeling
during Hair Follicle Stem Cell Lineage Progression. Cell Stem Cell. 2018;22(3):398-413.e7.
doi:10.1016/j.stem.2017.12.004
2. Akihiro Fujimoto, Nao Nishida, Ryosuke Kimura, et al. FGFR2 is associated with hair thickness in Asian
populations. Journal of Human Genetics. 2009;54(8):461-465. doi:10.1038/jhg.2009.61
3. Alonso L, Fuchs E. The hair cycle. Journal of cell science. 2006;119(3):391-393. doi:10.1242/jcs02793
4. Anna Meilana, Nurrani Mustika Dewi, Andi Wijaya. Heterogeneous Stem Cells in Skin Homeostatis and
Wound Repair. Indonesian Biomedical Journal. 2015;7(2):87-100. doi:10.18585/inabj.v7i2.74
5. Avigad Laron E, Aamar E, Enshell-Seijffers D. The Mesenchymal Niche of the Hair Follicle Induces
Regeneration by Releasing Primed Progenitors from Inhibitory Effects of Quiescent Stem Cells. Cell Reports.
2018;24(4):909-921.e3. doi:10.1016/j.celrep.2018.06.084
6. Blitz E, Sharir A, Akiyama H, Zelzer E, Blitz E. Tendon-bone attachment unit is formed modularly by a
distinct pool of Scx- and Sox9-positive progenitors. Development (Cambridge). 2013;140(13):2680-2690.
doi:10.1242/dev.093906
7. Brent AE, Schweitzer R, Tabin CJ. A Somitic Compartment of Tendon Progenitors. Cell. 2003;113(2):235-
248. doi:10.1016/S0092-8674(03)00268-X
8. Brownell I, Guevara E, Bai C brian, Loomis C a, Joyner A l. Nerve-Derived Sonic Hedgehog Defines a
Niche for Hair Follicle Stem Cells Capable of Becoming Epidermal Stem Cells. Cell Stem Cell. 2011;8(5):552-
565. doi:10.1016/j.stem.2011.02.021

46

9. Cheng C-C, Tsutsui K, Taguchi T, et al. Hair follicle epidermal stem cells define a niche for tactile sensation.
eLife. 2018;7. doi:10.7554/eLife.38883
10. Chovatiya GL, Sarate RM, Sunkara RR, Gawas NP, Kala V , Waghmare SK. Publisher Correction:
Secretory phospholipase A 2 -IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair
shaft differentiation and impaired wound healing response. Scientific Reports. 2020;10(1):1-1.
doi:10.1038/s41598-020-62012z
11. Dunnill CJ, Al-Tameemi W, Collett A, Haslam IS, Georgopoulos NT. A Clinical and Biological Guide for
Understanding Chemotherapy-Induced Alopecia and Its Prevention. Oncologist. 2018;23(1):84‐96.
doi:10.1634/theoncologist.2017-0263
12. Fujiwara H, Ferreira M, Donati G, et al. The Basement Membrane of Hair Follicle Stem Cells Is a Muscle
Cell Niche. Cell. 2011;144(4):577-589. doi:10.1016/j.cell.2011.01.014
13. Greco V , Chen T, Rendl M, et al. A two-step mechanism for stem cell activation during hair regeneration. Cell
stem cell. 2009;4(2):155-169. doi:10.1016/j.stem.2008.12.009
14. Grose R, Fantl V , Werner S, et al. The role of fibroblast growth factor receptor 2b in skin homeostasis and
cancer development. EMBO Journal. 2007;26(5):1268-1278. doi:10.1038/sj.emboj.7601583
15. Heitman N, Sennett R, Mok K-W, et al. Dermal sheath contraction powers stem cell niche relocation during
hair cycle regression. Science (New York, NY). 2020;367(6474):161-166. doi:10.1126/science.aax9131
16. Hsu Y-C, Li L, Fuchs E. Transit-Amplifying Cells Orchestrate Stem Cell Activity and Tissue Regeneration.
Cell. 2014;157(4):935-949. doi:10.1016/j.cell.2014.02.057

47

17. Jiang T, Harn HI, Ou K, Lei M, Chuong C. Comparative regenerative biology of spiny (Acomys cahirinus)
and laboratory (Mus musculus) mouse skin. Experimental Dermatology. 2019;28(4):442-449.
doi:10.1111/exd.13899
18. Joost S, Zeisel A, Jacob T, et al. Single-Cell Transcriptomics Reveals that Differentiation and Spatial
Signatures Shape Epidermal and Hair Follicle Heterogeneity. Cell Systems. 2016;3(3):221-237.e9.
doi:10.1016/j.cels.2016.08.010
19. Kandyba E, Kobielak K. Wnt7b Is an Important Intrinsic Regulator of Hair Follicle Stem Cell Homeostasis
and Hair Follicle Cycling. STEM CELLS. 2014;32(4):886-901. doi:10.1002/stem.1599
20. Katz T c, Singh M k, Degenhardt K, et al. Distinct Compartments of the Proepicardial Organ Give Rise to
Coronary Vascular Endothelial Cells. Developmental Cell. 2012;22(3):639-650.
doi:10.1016/j.devcel.2012.01.012
21. Kulessa H, Turk G, Hogan BLM. Inhibition of Bmp signaling affects growth and differentiation in the anagen
hair follicle. EMBO Journal. 2000;19(24):6664-6674. doi:10.1093/emboj/19.24.6664
22. Lay K, Kume T, Fuchs E, Lay K. FOXC1 maintains the hair follicle stem cell niche and governs stem cell
quiescence to preserve long-term tissue-regenerating potential. Proceedings of the National Academy of
Sciences of the United States of America. 2016;113(11):E1506-E1515. doi:10.1073/pnas.1601569113
23. Lee E-C, Yu D, Martinez de Velasco J, et al. A Highly Efficient Escherichia coli-Based Chromosome
Engineering System Adapted for Recombinogenic Targeting and Subcloning of BAC DNA. Genomics.
2001;73(1):56-65. doi:10.1006/geno.2000.6451
24. Lee J, Tumbar T. Hairy tale of signaling in hair follicle development and cycling. Seminars in Cell and
Developmental Biology. 2012;23(8):906-916. doi:10.1016/j.semcdb.2012.08.003
48

25. Lei M, Schumacher LJ, Lai Y-C, et al. Self-organization process in newborn skin organoid formation inspires
strategy to restore hair regeneration of adult cells. Proceedings of the National Academy of Sciences of the
United States of America. 2017;114(34):E7101-E7110. doi:10.1073/pnas.1700475114
26. Liao C-P, Booker RC, Morrison SJ, Le LQ. Identification of hair shaft progenitors that create a niche for hair
pigmentation. (Report). Genes & Development. 2017;31(8):744-756. doi:10.1101/gad.298703.117
27. Lim X, Tan SH, Yu KL, Lim SBH, Nusse R. Axin2 marks quiescent hair follicle bulge stem cells that are
maintained by autocrine Wnt/[beta]-catenin signaling.(DEVELOPMENTAL BIOLOGY). 2016;113(11):E1498-
505. doi:10.1073/pnas.1601599113
28. Maksim V Plikus. New Activators and Inhibitors in the Hair Cycle Clock: Targeting Stem Cells’ State of
Competence. Journal of Investigative Dermatology. 2012;132(5):1321-1324. doi:10.1038/jid.2012.38
29. Maksim V Plikus, Cheng-Ming Chuong. Complex Hair Cycle Domain Patterns and Regenerative Hair Waves
in Living Rodents. Journal of Investigative Dermatology. 2008;128(5):1071-1080. doi:10.1038/sj.jid.5701180
30. Melnik B. Role of FGFR2-signaling in the pathogenesis of acne. Dermato-Endocrinology. 2009;1(3):141-156.
doi:10.4161/derm.1.3.8474
31. Melnik B, Schmitz G. FGFR2 signaling and the pathogenesis of acne. JDDG: Journal der Deutschen
Dermatologischen Gesellschaft. 2008;6(9):721-728. doi:10.1111/j.1610-0387.2008.06822.x
32. Merrill A e, Sarukhanov A, Krejci P, et al. Bent Bone Dysplasia-FGFR2 type, a Distinct Skeletal Disorder,
Has Deficient Canonical FGF Signaling. The American Journal of Human Genetics. 2012;90(3):550-557.
doi:10.1016/j.ajhg.2012.02.005
33. Mesler AL, Veniaminova NA, Lull MV , Wong SY. Hair Follicle Terminal Differentiation Is Orchestrated by
Distinct Early and Late Matrix Progenitors. Cell Reports. 2017;19(4):809-821.doi:10.1016/j.celrep.2017.03.077
49

34. Millar SE. Hox in the Niche Controls Hairy-geneity. Cell Stem Cell. 2018;23(4):457-458.
doi:10.1016/j.stem.2018.09.012
35. Morgan BA, Morgan BA. The dermal papilla: an instructive niche for epithelial stem and progenitor cells in
development and regeneration of the hair follicle. Cold Spring Harbor perspectives in medicine.
2014;4(7):a015180-a015180. doi:10.1101/cshperspect.a015180
36. Mukhopadhyay A, Krishnaswami SR, Cowing-Zitron C, et al. Negative regulation of Shh levels by Kras
and Fgfr2 during hair follicle development. Developmental Biology. 2013;373(2):373-382.
doi:10.1016/j.ydbio.2012.10.024
37. Murchison ND, Price BA, Conner DA, et al. Regulation of tendon differentiation by scleraxis distinguishes
force-transmitting tendons from muscle-anchoring tendons. Development (Cambridge, England).
2007;134(14):2697-2708. doi:10.1242/dev.001933
38. Nguyen MB, Cohen I, Kumar V , et al. Publisher Correction: FGF signalling controls the specification of hair
placode-derived SOX9 positive progenitors to Merkel cells. Nature Communications. 2018;9(1):1-1.
doi:10.1038/s41467-018-05361-8
39. Nowak JA, Polak L, Pasolli HA, Fuchs E, Nowak JA. Hair follicle stem cells are specified and function in
early skin morphogenesis. Cell stem cell. 2008;3(1):33-43. doi:10.1016/j.stem.2008.05.009
40. Panteleyev A.A. Functional Anatomy of the Hair Follicle: the Secondary Hair Germ.
Exp Dermatol. 2018 Apr 19 Published online 2018 Apr 19. doi: 10.1111/exd.13666
41. Petiot A, Conti FJA, Grose R, et al. A crucial role for Fgfr2-IIIb signalling in epidermal development and hair
follicle patterning. Development (Cambridge, England). 2003;130(22):5493-5501. doi:10.1242/dev.00788
42. Qiu W, Chuong C, Lei M. Regulation of melanocyte stem cells in the pigmentation of skin and its appendages:
50

Biological patterning and therapeutic potentials. Experimental Dermatology. 2019;28(4):395-405.
doi:10.1111/exd.13856
43. Rebecca J Morris, Yaping Liu, Lee Marles, et al. Capturing and profiling adult hair follicle stem cells. Nature
Biotechnology. 2004;22(4):411-417. doi:10.1038/nbt950
44. Roberts RR, Bobzin L, Teng CS, et al. FGF signaling patterns cell fate at the interface between tendon and
bone. Development (Cambridge, England). 2019;146(15). doi:10.1242/dev.170241
45. Rodrigo FG, Cotta‐Pereira G, David‐Ferreira JF. The fine structure of the elastic tendons in the human
arrector pili muscle. British Journal of Dermatology. 1975;93(6):631-637. doi:10.1111/j.1365-
2133.1975.tb05112.x
46. Rosenquist TA, Martin GR, Rosenquist TA. Fibroblast growth factor signalling in the hair growth cycle:
expression of the fibroblast growth factor receptor and ligand genes in the murine hair follicle. Developmental
dynamics : an official publication of the American Association of Anatomists. 1996;205(4):379-386.
doi:10.1002/(SICI)1097-0177(199604)205:43.0.CO;2-F
47. Sada A, Jain P, Wang S, Leung E, Tumbar T. Slc1a3-CreER as a Targeting Tool for the K6+ Epithelial Stem
Cell Niche and its Precursors during Mouse Hair Follicle Cycle. Journal of Investigative Dermatology.
2017;137(7):1569-1571. doi:10.1016/j.jid.2017.02.974
48. Sada A, Tumbar T, Sada A. New insights into mechanisms of stem cell daughter fate determination in
regenerative tissues. International review of cell and molecular biology. 2013;300:1-50. doi:10.1016/B978-0-
12-405210-9.00001-1

49. Sakabe T, Sakai K, Maeda T, et al. Transcription factor scleraxis vitally contributes to progenitor lineage
51

direction in wound healing of adult tendon in mice. The Journal of biological chemistry. 2018;293(16):5766-
5780. doi:10.1074/jbc.RA118.001987
50. Schlake T, Schlake T. FGF signals specifically regulate the structure of hair shaft medulla via IGF-binding
protein 5. Development. 2005;132(13):2981-2990. doi:10.1242/dev.01873
51. Schuler N, Timm S, Rübe CE. Hair Follicle Stem Cell Faith Is Dependent on Chromatin Remodeling Capacity
Following Low‐Dose Radiation. STEM CELLS. 2018;36(4):574-588. doi:10.1002/stem.2768
52. Suzuki K, Yamanishi K, Mori O, et al. Defective terminal differentiation and hypoplasia of the epidermis in
mice lacking the Fgf10 gene. Febs Letters. 2000;481(1):53-56.
53. Sven Müller-Röver, Bori Handjiski, Carina Van Der Veen, et al. A Comprehensive Guide for the Accurate
Classification of Murine Hair Follicles in Distinct Hair Cycle Stages. Journal of Investigative Dermatology.
2001;117(1):3-15. doi:10.1046/j.0022-202x.2001.01377.x
54. Takeda N, Jain R, Leboeuf MR, et al. Hopx expression defines a subset of multipotent hair follicle stem cells
and a progenitor population primed to give rise to K6+ niche cells. Development (Cambridge, England).
2013;140(8):1655-1664. doi:10.1242/dev.093005
55. Torkamani N, Rufaut N, Jones L, Sinclair R. Beyond goosebumps: Dfoes the arrector pili muscle have a role
in hair loss? International Journal of Trichology. 2014;6(3):88-94. doi:10.4103/0974-7753.139077
56. Tumbar T, Guasch G, Greco V , et al. Defining the epithelial stem cell niche in skin. Science (New Y ork, NY).
2004;303(5656):359-363. doi:10.1126/science.1092436
57. Viljar Jaks, Nick Barker, Maria Kasper, et al. Lgr5 marks cycling, yet long-lived, hair follicle stem cells.
Nature Genetics. 2008;40(11). doi:10.1038/ng.239
58. Wang EC., Dai Z, Ferrante AW, Drake CG, Christiano AM. A Subset of TREM2+ Dermal Macrophages
52

Secretes Oncostatin M to Maintain Hair Follicle Stem Cell Quiescence and Inhibit Hair Growth. Cell Stem Cell.
2019;24(4):654-669.e6. doi:10.1016/j.stem.2019.01.011
59. Xin T, Gonzalez D, Rompolas P, Greco V . Flexible fate determination ensures robust differentiation in the hair
follicle. Nature Cell Biology. 2018;20(12):1361-1369. doi:10.1038/s41556-018-0232-y
60. Xu Z, Wang W, Jiang K, et al. Embryonic attenuated Wnt/β-catenin signaling defines niche location and long-
term stem cell fate in hair follicle. eLife. 2015;4:e10567-e10567. doi:10.7554/eLife.10567
61. Yang H, Adam RC, Ge Y , Hua ZL, Fuchs E. Epithelial-Mesenchymal Micro-niches Govern Stem Cell
Lineage Choices. Cell. 2017;169(3):483-496.e13. doi:10.1016/j.cell.2017.03.038
62. Yang J, Meyer M, Muller A-K, et al. Fibroblast growth factor receptors 1 and 2 in keratinocytes control the
epidermal barrier and cutaneous homeostasis. (Author abstract)(Report). The Journal of Cell Biology.
2010;188(6):935-952. doi:10.1083/jcb.200910126
63. Yu Z, Jiang K, Xu Z, et al. Hoxc-Dependent Mesenchymal Niche Heterogeneity Drives Regional Hair Follicle
Regeneration. Cell Stem Cell. 2018;23(4):487-500.e6. doi:10.1016/j.stem.2018.07.016
64. Zhang B, Hsu Y. Emerging roles of transit‐amplifying cells in tissue regeneration and cancer. Wiley
Interdisciplinary Reviews: Developmental Biology. 2017;6(5):n/a-n/a. doi:10.1002/wdev.282
65. Zhang B, Tsai P-C, Gonzalez-Celeiro M, et al. Hair follicles’ transit-amplifying cells govern concurrent
dermal adipocyte production through Sonic Hedgehog. Genes & Development. 2016;30(20):2325-2338.
doi:10.1101/gad.285429.116
66. Zhou L, Yang K, Carpenter A, Lang RA, Andl T, Zhang Y. CD133-positive dermal papilla-derived Wnt
ligands regulate postnatal hair growth. The Biochemical journal. 2016;473(19):3291-3305.
doi:10.1042/BCJ20160466

Abstract (if available)

Abstract Fibroblast growth factor receptor 2 (Fgfr2) signaling plays an important role in embryo hair follicle (HF) development and adult hair growth. In mice, loss of Fgfr2 disrupts hair placode formation and cutaneous homeostasis (Petiot A et al., 2003

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Fgfr2 regulates cell fate at the interface between tendon and bone

PDF

Macroenvironmental regulation of hair follicle stem cells

PDF

Nuclear fibroblast growth factor receptor 2 regulates skeletal development and joint formation

PDF

FGFR2 Regulates Connective Tissue Development in the Skull

PDF

In vitro generation of chondrocyte-osteoblast hybrid cells through differentiation of ATDC5 cells

PDF

Characterizing the role of Dnmt1 and its downstream factors in progressive alopecia

PDF

Characterization of the progenitor cell zone in feather follicles

PDF

Investigating the role of cardiac fibroblasts in modulating angiogenesis during heart injury

PDF

The role of Runx2 in the development of the tendon-bone attachment unit

PDF

Implications of constitutively active bone morphogenetic protein (BMP) signaling in skin morphogenesis and skin postnatal homeostasis

PDF

Tracking human acute lymphoblastic leukemia cell clones in xenograft mouse models

PDF

Characterization of osteoclast-specific cytokines during bone repair

PDF

Functions of Msx2 and Msx1 during mouse skull and hair follicle development

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

Development of an “in cubo” culture system for the study of early avian development using dynamic imaging

PDF

Development of the lymphatics in the eye

PDF

Utilizing zebrafish and mouse models to uncover the underlying genetics of human craniofacial anomalies

PDF

Characterization of a new HER2 positive mouse model of metastatic breast cancer

PDF

The role of insulin-like growth factors in size regulation during embryonic feather development

PDF

The role of Hedgehog signaling in Sox9 expressing progenitors during large scale bone repair

Asset Metadata

Creator Sui, Yi (author)

Core Title The role of Fgfr2 within Scx-expressing cells of the hair follicle

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 07/26/2020

Defense Date 05/21/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag FGFR2,hair cycle,hair follicle,mouse model,OAI-PMH Harvest,Scx

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Merrill-Brugger, Amy (committee chair), Chuong, Cheng-Ming (committee member), Xu, Jian (committee member)

Creator Email yisui@usc.edu,yisui1227@yeah.net

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-339752

Unique identifier UC11665857

Identifier etd-SuiYi-8771.pdf (filename),usctheses-c89-339752 (legacy record id)

Legacy Identifier etd-SuiYi-8771.pdf

Dmrecord 339752

Document Type Thesis

Rights Sui, Yi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA