University of Southern California Dissertations and Theses

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

(USC Thesis Other)

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Copyright 2021 Jessica Pantuso

THE ROLE OF AMPHISOMES AND RAB11 PROTEIN IN RELEASE OF MATURE
HEPATITIS B VIRAL PARTICLES AND ANALYSIS OF THE ARGININE-RICH C-
TERMINAL DOMAIN OF HBV PRECORE PROTEIN

by

Jessica Pantuso

A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

May 2021

ii
AKNOWLEDGEMENTS
I would like to express how grateful I am for Dr. James Ou who welcomed me into his lab
and supported my work. I am so thankful for his guidance and expertise; he was patient and guided
me through difficulties in my project. I would also like to thank Dr. Keigo Machida and Dr.
Weiming Yuan for sitting on my committee. They were thorough and provided crucial suggestions
and commentary during my defense.
I would like to thank my mentor Dr. Ja Yeon Kim Chu who took the time to teach me
techniques and protocols. She was incredibly patient and went through new protocols step-by-step
to teach me. I would also like to thank my other mentor, Dr. Yu-Chen Chuang, who came in and
began a new project with me, and who took over my first project when Jay began a new career.
Jane was so gracious with her time and taught me so thoroughly. This thesis would not be
completed without all of my lab members who answered my questions and created an environment
of excellence. I am very thankful for their generosity in helping me.
I would like to thank my parents for being so supportive and loving. Their constant hard
work is an example I have always strived to follow. I would like to also thank my little sister,
Allison, who is my biggest cheerleader and always provides a good laugh when I need
encouragement.
Most importantly, I want to thank the Lord whose grace compels me and whose merciful
love guides me. I feel blessed to study the great detail of His creation.

iii
TABLE OF CONTENTS
ACKNOWLEDGMENTS ii

LIST OF FIGURES iv

ABBREVIATIONS v

ABSTRACT vii

PART I: INTRODUCTION 1
i. Hepatitis B Virus 1
ii. HBV Infectivity 1
iii. HBV Life Cycle 3
iv. HBV Persistence 4
v. The Status of Current Treatments 5
vi. Autophagy 6
vii. Autophagy and HBV 7
viii. Endosomal Pathway 8
ix. Multivesicular Bodies, Rab Protein, and HBV 8

PART II: MATERIALS AND METHODS 10
i. Cell Culture 10
ii. Plasmids 10
iii. Transfection 12
iv. Immunofluorescent Staining 13
v. Western Blotting 13
vi. Quantitative Polymerase Chain Reaction 14

PART III: RESULTS 15
i. Autophagosomes serve as a vehicle to deliver HBV particles to MVBs 15
ii. Suppression of autophagosome and MVB fusion prevents release of
mature HBV particles from the cell 16
iii. The arginine-rich C-Terminal Domain of p22 is important in the
expression of HBV. 20

PART IV: DISCUSSION 24

REFERENCES 30

iv
LIST OF FIGURES

Figure 1 Autophagosomes serve as the vehicle of delivery of HBV to MVBs 16
Figure 2 Knockdown of Rab11 protein results in an increase of intracellular HBV
viral particles 18
Figure 3 Quantification of extracellular HBV DNA after knockdown of Rab11 18
Figure 4 Rab11 dominant negative mutant results in diffuse HBV signal and
decreased HBV and MVB interaction 19
Figure 5 Truncated p22 plasmid construction 21
Figure 6 Loss of the arginine rich C-terminal domain results in the loss of HBV
core expression 22

v
ABBREVIATIONS

Atg Autophagy Related Gene
cccDNA Covalently Closed Circular DNA
CTD C-Terminal Domain
DN Dominant Negative
DMEM Dulbecco’s Modified Eagle’s Medium
FBS Fetal Bovine Serum
HBcAg Hepatitis B core Antigen
HBeAg Hepatitis B e Antigen
HBV Hepatitis B Virus
HBx Hepatitis B X Protein
HCC Hepatocellular Carcinoma
IFN-a Interferon-a
IL Interleukin
JAK Janus Kinase
mTOR Mammalian Target of Rapamycin
MVB Multivesicular Body
NK Natural Killer Cell
NTCP Sodium Taurocholate Cotransporting Polypeptide
ORF Open Reading Frame
PCR Polymerase Chain Reaction
pgRNA Pregenomic RNA
PI3K Class III Phosphatidylinositol-3-Kinase Complex
vi
PIC Protease Inhibitor Cocktail
q-PCR Quantitative Polymerase Chain Reaction
RIPA Radioimmunoprecipitation
SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
STAT Signal Transducer and Activator of Transcription
Vps Vacuolar Protein Sorting

vii
ABSTRACT
Globally, Hepatitis B virus infects approximately 250 million people, resulting in about 1
million death annually. HBV infection can lead to chronic hepatitis, liver cirrhosis, and
hepatocellular carcinoma. HBV hijacks the autophagic and endocytic pathways to replicate and
egress. Autophagosomes can fuse with multivesicular bodies to form amphisomes. To study
whether or not autophagosomes serve as a vehicle to deliver HBV to MVBs for release of mature
viral particles, we found amphisomes containing HBV could be detected by immunofluorescent
microscopy. The Rab11 protein is a small GTPase that is required for amphisome formation. In
studying if viral release could be inhibited, we examined the results of Rab11 knockdown with
siRNA or dominant negative mutant by western blot analysis and immunofluorescent microscopy.
We presented evidence that a decrease in Rab11 protein caused a noticeable accumulation of
intracellular HBV when amphisome formation was blocked. Further, we quantified extracellular
HBV DNA by qPCR, confirming our results. The C gene of HBV codes for the precore protein,
p25. When the p25 signal peptide sequence is cotranslationally cleaved, the p22 protein remains.
The C-Terminal domain of p22 interacts with the pathway responsible for initiating and organizing
the immune response, JAK-STAT, to evade host immune response. The CTD can be cleaved by a
furin protease to produce p17, HBeAg. We examined the effects of removing the CTD before HBV
infected host cells with a plasmid that excludes the domain. Western blot analysis and
immunofluorescent microscopy showed that HBV cannot be detected without the CTD. Our
findings reveal a more cohesive pathway for viral release and the importance of Rab11 in
preventing the blockage of that pathway. Further we showed that the C-Terminal domain of p22
has an important role in the expressing of HBV.

1
Part I: Introduction
Hepatitis B Virus
Hepatitis B virus (HBV) is a hepatotropic virus that chronically infects approximately 250
million people worldwide, with nearly one million deaths annually. HBV can cause serious
conditions like chronic hepatitis, cirrhosis, and hepatocellular carcinoma (HCC) [12, 25]. The virus
can be transmitted vertically from a carrier mother to their child, and horizontally through sex or
sharing drug-injection needles, but can even include household items like razors or toothbrushes
[37]. Vertical transmission from mother to child often leads to chronic infection possibly because
of in utero tolerization of the fetal immune system to HBV antigens or due to immune system
immaturity in children [24]. A vaccine currently exists and is given in doses that should be
complete by six months of age, but unvaccinated children, adolescents, and adults are
recommended to be vaccinated [27, 38].

HBV Infectivity
HBV is part of the Hepadnaviridae family of viruses with characteristics similar to
retroviruses [35, 37]. Hepatocytes are unique to the liver and make up approximately 70% of liver
cells, meaning one could assume that the liver would be a major target of hepatotropic viruses. In
fact, hepatocytes are the only confirmed site of the Hepadnaviruse family viral replication, but
HBV is noncytopathic in most circumstances [34, 37]. The damage done to hepatocytes in HBV
infection is a result of the immune response to viral infection [38]. The strength and coordination
of the adaptive and innate immune responses determine viral clearance, and thus chronicity of
infection [37, 38]. Acute infection or progression to chronic infection can be influenced by the
age in which the virus is contracted. Acute infection is a brief infection within 6 months of
2
contracting the virus and occurs mostly in adults. Acute infection is a self-resolving infection that
may have few or no symptoms and leads to viral clearance; however, there are cases of severe
infection that can lead to fulminant hepatitis and even death [36, 38]. When an acute infection is
cleared, it is unlikely that the individual will be re-infected [37]. Acute liver failure occurs in about
1% of patients with acute HBV infection [35].
Persistent chronic HBV infection usually lasts more than 6 months. Chronic HBV infection
typically takes place at birth due to vertical transmission from the mother or within the first 2 years
of life [25, 38]. Of the infants infected with HBV, roughly 90% will develop chronic infection,
whereas about 5% of infected adults develop chronic infection [34, 36]. Chronic infection makes
up the majority of perinatal infections due to their immature immune system [24, 37]. Subviral
particles can downregulate signaling pathways of the innate immune system which suppresses
inflammatory cytokines. During HBV infection, macrophages can have immunosuppressive
effects on T cells. With high levels of circulating HBV DNA, the adaptive immune system
experiences significant decrease in HBV-specific CD4
+
and CD8
+
T cells, and the T cells that are
present during infection are hardly functional. High levels of subviral particles cause T cell
exhaustion from constant triggering of signaling pathways of virus-specific T cells. The
immunopathogenesis of HBV infection can inflict so much change that the signaling molecules
responsible for stimulating T cell proliferation are suppressed, leading to an increase in the
immunosuppressive IL-10 [37, 38].
Areas such as Africa, Southeast Asia, and China experience a high prevalence of HBV
infection with more than 8% of the population being infected. High prevalence areas tend to see
more chronic infections, and individuals are mostly infected vertically. Estimates indicate that
about 45% of the world’s population live in high prevalence areas. Areas of low endemic levels
3
have infection levels less than 2% of the population and include Western Europe, North America,
and Australia. Infection in these countries tend to be transmitted horizontally in young adults and
make up about 12% of the world’s population [37,40].

HBV Life Cycle
HBV is a 3.2 kb enveloped virus [25, 24]. The virus has a circular genome with partially
double-stranded DNA. The genome codes for four overlapping genes: S, C, P, and X [12, 25].
HBV enters the cell through the sodium taurocholate cotransporting polypeptide (NTCP) receptor
and is directed to the nucleus. [30, 31]. In the nucleus, the genome is repaired to covalently closed
circular DNA (cccDNA), which serves as the template to guide RNA transcription of the virus.
The C gene codes for 21 kDa core protein (p21) and the 25 kDa precore protein (p25) [5, 12].
Precore contains the sequence of the core protein and a 29 amino acid extension at the amino
terminus [12, 31]. The open reading frame (ORF) of the C gene contains two in-frame initiation
codons that encode core and precore [12]. The core protein packages its own mRNA, also known
as pregenomic RNA (pgRNA), to form the core particle [12, 25]. p21 is translated on the core
protein pgRNA, initiating at the second AUG site [12]. The core particle displays the core antigenic
determinant, HBcAg [25]. p25 is translated on the precore mRNA, initiating at the first AUG site
[12, 25].
Of the 29 amino acid extension on the amino-terminal end, 19 amino acids form a signal
peptide sequence that bind to the signal recognition particle (SRP) complex [12, 25, 31]. The signal
peptide sequence serves to direct the precore mRNA to the endoplasmic reticulum (ER) [12, 6].
The signal peptide is then cotranslationally cleaved by a signal peptidase, forming p22 [9, 6]. p22
then has three fates: it can be translocated into the ER, released back to the cytoplasm, or it can be
4
transported back into the nucleus by the nuclear localization signal (NLS) on the arginine-rich C-
terminal domain (CTD) [12, 31]. From the ER, p22 goes to the Golgi complex where the CTD is
cleaved by a furin protease, leaving p17, otherwise known as the HBV e antigen (HBeAg). HBeAg
is highly conserved in HBV and serves as an indicator of viral replication clinically, but is not
needed for HBV DNA replication [12, 25]. The exact function of HBeAg is currently unknown
[12], though it has been suspected to be important for HBV to establish persistence after vertical
neonatal infection [24].

HBV Persistence
Several factors contribute to the HBV persistence. HBV cccDNA is very stable in the host
nucleus and establishes persistent infection, making it very difficult to treat. The persistence
established often leads to viral reappearance when treatment is stopped [20, 25]. Interferon-a (IFN-
a) is naturally occurring in the body and provides immunomodulatory and antiviral effects like
increased antigen presentation, cytokine production, and natural killer (NK) cell activation [15].
Antiviral activity includes inhibition of protein synthesis and mRNA degradation [15]. Patient
studies suggest that HBV infection induces an insignificant Type 1 IFN immune response,
suggesting that HBV can evade the innate immune response. HBV can evade Type 1 IFN response
through the inhibition of IFN-b activation when HBV DNA polymerase disrupts the interaction
and phosphorylation of the transcription factor that induces IFN-b expression. IFN-a has
immunomodulatory influence on NK cells activation, which provide rapid response to viral
infection [12, 15, 25].
Patient studies have shown that patients with HBeAg are less responsive to IFN-a
treatment than patients without HBeAg. It is known that p17 manipulates host immune responses
5
to aid in the persistence of viral infection [12, 24]. Mitra et al. report that cytosolic p22, not
secreted p17 (HBeAg), reduce interferon-stimulated response elements and genes when IFN-a is
triggered [12]. Type 1 IFNs bind to the IFNa/b receptor which activates its associated JAK1 (janus
kinase), as well as phosphorylating and activating STAT (signal transducer and activator of
transcription) proteins that are important in initiating and organizing the innate and adaptive
immune responses [25, 17]. When treated with IFN-a, p22 does not change the levels of STAT1;
however, the nuclear translocation of STAT1 is obstructed by the interaction of the nuclear
transport factor with the arginine-rich C-terminal domain of p22. Thus, p22 obstructs the JAK-
STAT pathway not only to evade host innate immunity, but also to develop IFN treatment
resistance [12]. Other ways in which HBV persists include: T-cell exhaustion, dendritic cell
functional impairment, decreased T-cell stimulatory capacity, reduced interleukin-12 (IL-12)
production, and inhibited toll-like receptor ligand-induced production of IL-12 and IL-18 [15, 17].

The Status of Current Treatments
As mentioned, the cccDNA is very stable in the host hepatocyte nucleus and establishes
persistent infection [12, 20]. Interferon-a (IFN-a) and nucleos(t)ide analogues are current
treatment options. Peginterferon-a offers the benefit of higher response rates to HBV due to the
addition of a polyethylene glycol for enhanced pharmodynamics and kinetics, but has the
disadvantage of adverse side effects and substantial expense [15, 20]. Nucleos(t)ide analogues are
reverse transcriptase inhibitors that can suppress the virus for extended treatment periods as they
inhibit the HBV DNA synthesis in the cytoplasm and reverse transcription of the pregenomic RNA
(pgRNA) [11, 38]. Because these nucleos(t)ide analogues do not have an effect on the cccDNA,
they often require extended treatment due to relapse after ceasing therapy. The extended treatment
6
period nucleos(t)ide analogues require provide the chance to improve virologic and serologic
response, but risk viral resistance developing and side effects [11, 20].

Autophagy
Autophagy is a regulatory “housekeeping” mechanism in eukaryotic cells that maintains
homeostasis by removing damaged organelles and debris and adapting to cellular stress like
nutrient deprivation and infection [7, 18]. Autophagy is a self-degradative process that is well
conserved across species [1]. Autophagosomes are double-membrane organelles that engulf
cytosolic components and fuse with the endolysosomal pathway. The fusion of autophagosomes
with lysosomes forms autolysosomes where the cytosolic aggregates are degraded by lysosomal
proteases and transported across the lysosomal membrane to be recycled [7].
There are three steps in the development of autophagosomes: initiation, nucleation, and
elongation, and two important complexes in the initiation of autophagy. G protein-coupled
receptors have been implicated in sensing extracellular amino acid levels; when amino acid levels
are depleted, the mammalian target of rapamycin (mTOR) complex is inactivated. mTOR is the
negative regulator of the ULK complex that is required for autophagy initiation. Inactive mTOR
dissociates from ULK1, leaving ULK1 active to increase the ULK kinase activities, and ULK
proteins to associate with membranes [1, 7].
The class III phosphatidylinositol-3-kinase complex (PI3K) enhances enzymatic activity
and increases autophagic flux. During nucleation, ULK phosphorylates vacuolar protein sorting
protein 34 (Vps34), a catalytic subunit of PI3K, and enhances the PI3K complex activity [7, 18].
Enhancement of the PI3K complex drives the nucleation of the crescent-shaped isolation
7
membranes known as phagophores. Phagophores sequester the cargo that is engulfed from the
cytosol [1, 10].
Elongation includes two ubiquitin-like systems that are essential to autophagy, the first
being the conjugation of autophagy related (Atg) gene 5 and Atg12, followed by the recruitment
of Atg16 to form the Atg5-12/16L1 complex for isolation membrane elongation [1, 22]. The Atg5-
12/16L1 complex functions as a ubiquitin ligase in the second system to mediate the lipidation of
LC3 [7,]. The second system conjugates the lipidation of LC3 to phosphatidylethanolamine [10,
18]. LC3-II aids in the expansion and closure of phagophores, and serves as an important and
widely used marker of autophagosomes [3, 7]. When phagophores close, the Atg proteins
dissociate and LC3-II stays lipidated on both the outer and inner membranes of the autophagosome
[18, 7].

Autophagy and HBV
HBV can induce autophagy as the HBV X protein (HBx) binds Vps34, the catalytic subunit
of PI3K, enhancing its enzymatic activity, and increasing its autophagic flux [18, 19]. Evidence
also indicates that autophagy is required for replication of HBV in cell culture and transgenic mice,
as seen in Atg5 knockout mice [22, 33]. Studies have shown that HBV undermines the ubiquitin-
like conjugation complex necessary in phagophore formation and elongation. When cells were
treated with siRNAs for Atg5 or Atg12, it was found to reduce levels of lipidated LC3-II and
significantly decreased levels of intracellular nucleocapsids and extracellular virions, indicating
that the Atg5-12/16L1 complex became nonfunctional [3, 22]. In the knockdown cells,
unconjugated Atg5 survived in siAtg12 cells and vice-versa without enabling HBV propagation,
concluding the Atg5-12/16L1 complex is required for viral maturation and replication [22]. LC3
8
is not required for viral replication, but serves as an important and widely used marker of
autophagosomes [3, 7].

Endosomal Pathway
Exosomes are extracellular vesicles derived from the endocytic pathway, a process that
employs plasma membrane invagination in order to internalize receptors, membranes,
macromolecules, and fluids [29]. Endocytic vesicles fuse with early endosomes that mature with
late endosomes, and eventually with lysosomes. The endocytic vesicles can go through further
events of membrane invaginations during endosome maturation to form intermediate organelles
known as multivesicular bodies (MVBs) [16, 29]. MVBs have the ability to fuse with the plasma
membrane to release their contents into the extracellular space in the form of exosomes [4, 16].
Autophagosomes can interact with the endosomal pathway and fuse with endosomes to form a
hybrid organelle, the amphisome. MVBs are the main endosomal organelle that fuse with
autophagosomes. A study by Fader et al. shows that the induction of autophagy can stimulate the
fusion of autophagosomes with MVBs to form amphisomes [4, 29].

Multivesicular Bodies, Rab Protein, and HBV
Rab proteins belong to a family of small GTPases that have an important role in membrane
trafficking regulation; Rab11 has been shown to associate with secretory vesicles and
pericentriolar recycling endosomes. Rab11 decorates the membranes of MVBs and is believed to
function at the level of recycling. The exosome pathway is regulated by Rab11 [16, 21], and Fader
et al. also showed that Rab11 is required for the fusion of autophagosomes and MVBs [4]. Finally,
in studying viral exit, some enveloped RNA viruses require host vacuolar sorting proteins (VPS)
9
of the membranes of late endosomes that lead to MVB budding [28]. Being that MVBs depend on
several class E VPS proteins, some of which are binding partners for the proteins of viruses
dependent on MVBs, it can be inferred that the viruses bind to class E proteins to gain access to
MVB vesicle budding [28]. It has been shown that MVB class E proteins interact with HBV
envelope proteins to aid in viral replication and budding [28].
In this study, our goal was to determine if autophagosomes serve as a vehicle for delivery
of HBV particles to MVBs for release. Being that autophagosomes and MVBs both have a role in
viral replication [3, 22] and release [28], and that autophagosomes and MVBs interact to form
amphisomes [4], amphisomes that contain HBV particles should be detected in HBV infected cells.
Further, we attempted to suppress autophagosome and MVB fusion for viral release using siRNA
to knockdown Rab11 and the Rab11 dominant negative (DN) mutant Rab11S25N [16, 26]. In
addition, we sought to determine the role of the arginine-rich CTD of HBV pre/core proteins
through a plasmid constructed without the domain [14].

10
Part II: Materials and Methods
Cell Culture
Huh7.5 human hepatoma cells stably expressing GFP-LC3 were grown in Dulbecco’s
modified Eagle’s medium (DMEM) augmented with 10% fetal bovine serum (FBS) and 1% PSA
(Antibiotic-Antimycotic (100X)) (Gibco) at 37 ºC in 5% CO2. Cells were kept at a minimum
density of 2.2 x 10
6
and were passaged when they reached confluency at a density of 8.8 x 10
6
.

Plasmids
Plasmid expressing Flag-tag was generated by polymerase chain reaction (PCR) to establish the
Flag-tag in the pcDNA3 vector. Primers
(pCDNAwFlag_F-HindIII:
AGCTTCGCACCAGCACCATGGATTACAAGGATGACGACGATAAGTAGG and
pCDNAwFlag&Stop_R-BamHI:
GATCCCTACTTATCGTCGTCATCCATGGTGCTGGTGCGA) were used for amplification
(Integrated DNA Technologies). The PCR was carried out for 1 cycle in the thermal cycler. The
cycle consisted of 0.5 min at 95 ºC, 2 min at 72 ºC, 2 min at 37 ºC, and 2 min at 25 ºC. The
amplified product was then digested by appropriate restriction enzymes and inserted between the
HindIII and BamHI sites of the pCDNA vector.

Plasmid expressing p22 with a Flag-tag was generated by PCR to amplify the sequence of the
HBV precore protein. Primers
(p22wFlag_F-HindIII:
AAGCTTCGCACCAGCACCATGGATTACAAGGATGACGACGATAAGTCCAAGCTGTG
11
CCTT and p22wSTOP_R-BamHI: GGATCCCTAACATTGAGATTCCCG) were used for
amplification (Integrated DNA Technologies). The PCR was carried out for 35 cycles in the
thermal cycler. Each cycle consisted of 10 s at 98 ºC, 30 s at 55 ºC, and 30 s at 72 ºC. An extra
cycle was performed at the end for 2 min at 72 ºC. The amplified product was digested by the
appropriate enzymes and ligated between the HindIII and BamHI (New England Biolabs) sites of
the pJET intermediate vector (CloneJET). The pJET-p22-Flag plasmid was used to transform
DH5⍺ E. Coli competent cells. Bacteria were grown in 3 ml of Luria Broth (LB) medium
supplemented with 1µl/ml ampicillin at 37 ºC overnight. Plasmid DNA was abstracted from the E.
coli cells using MiniPrep (Qiagen) according to the manufacturers protocol. The plasmids were
sent out for sequencing (GeneWiz) to ensure no mutations were present. Plasmids were then
digested with the appropriate enzymes and inserted between the HindIII and BamHI sites of the
pCDNA vector.

Plasmids expressing truncated p22 without the C-terminal domain (CTD) with a Flag-tag was
generate by PCR to amplify the sequence of the HBV truncated precore protein. Primers
(p22wFlag_F-HindIII:
AAGCTTCGCACCAGCACCATGGATTACAAGGATGACGACGATAAGTCCAAGCTGTG
CCTT and
HBVwoCTD/Stop_R-BamHI: GGATCCCTAAACAACAGTAGTTTCCGGAAGTG)
were used for amplification (Integrated DNA Technologies). The PCR was carried out for 35
cycles in the thermal cycler. Each cycle consisted of 10 s at 98 ºC, 30 s at 55 ºC, and 30 s at 72 ºC.
an extra cycle was performed at the end for 2 min at 72 ºC. The amplified product was digested by
the appropriate enzymes and ligated between the HindIII and BamHI (New England Biolabs) sites
12
of the pJET intermediate vector (CloneJET). The pJET-Δp22-Flag plasmid was used to transform
DH5⍺ E. Coli competent cells. Bacetria were grown in 3 ml of LB medium supplemented with
1µl/ml ampicillin at 37 ºC overnight. Plasmid DNA was abstracted from the E. coli cells using
MiniPrep according to the manufacturers protocol. The plasmids were sent out for sequencing
(GeneWiz) to ensure no mutations were present. Plasmids were then digested with the appropriate
enzymes and inserted between the HindIII and BamHI sites of the pCDNA vector.

Transfection
To study amphisomes containing HBV, seeded GFP-LC3-Huh7 cells were transfected with
8µg of 1.3mer HBV genomic DNA using Lipofectamine 3000 (Invitrogen) according to
manufacturer’s protocol. After a 15 min incubation period at room temperature, the plasmids were
added to the GFP-LC3-Huh7 cells at a density of 1.6 x 10
6
in DMEM with 10% FBS and 1% PSA.
To study the role of Rab11 in HBV release, seeded GFP-LC3-Huh7 cells were co-
transfected with 8µg of 1.3mer HBV genomic DNA and Rabll siRNA (Sigma Aldrich) using
Lipofectamine 3000 (Invitrogen) according to manufacturer’s protocol. After a 15 min incubation
period at room temperature, the plasmids were added to the 2.2 x 10
6
Huh7 cells seeded in DMEM
with 10% FBS and 1% PSA.
Additionally, seeded Huh7 cells were double transfected with 8µg of 1.3mer HBV genomic
DNA, and Rabll plasmid using TransIT-X2 Dynamic Delivery System (MirusBio) according to
manufacturer’s protocol. Rab11S25N is a dominant negative mutant that is GTP-binding deficient
[16]. Rab11Q70L is a GTPase deficient mutant [16]. The Rab11 wt, Rab11S25N, and Rab11Q70L
plasmids are GFP-tagged and were generously shared by Dr. Fader (Laboratory of Cellular and
Molecular Biology, Institute of Histology and Embryology, National University of Cuyo,
13
Mendoza, Argentina). After a 30 min incubation period at room temperature, the plasmids were
added to the 2.2 x 10
6
Huh7 cells seeded in DMEM with 10% FBS and 1% PSA.
To study the effects of p22 protein without the arginine-rich CTD, seeded Huh7 cells were
transfected with 8µg of the plasmids described above using Lipofectamine 3000 (Invitrogen)
according to manufacturer’s protocol. After a 15 min incubation period at room temperature, the
plasmids were added to the cells at a density of 1.6 x 10
6
in DMEM with 10% FBS and 1% PSA.

Immunofluorescence
At 24h posttransfection, cells were trypsinized and plated on a 3.5 cm dish at a density of
0.4 x 10
6
on coverslips. At 48h posttransfection, cells were washed with immunofluorescent (IF)
wash buffer (1X PBS with 1% BSA, 0.02% saponin, and 0.05% sodium azide) for three 5-minute
periods. Cells were then fixed with acetone for 2 minutes and washed once more with IF wash
buffer. Cells were then treated with primary antibodies and incubated for 1 h at 37º C. Cells were
washed with IF wash buffer for three 5-minute periods. Cells were treated with secondary
antibodies and incubated for 45 min at 37 ºC. Cells were washed for three 5-minute periods with
IF wash buffer and coverslips were mounted onto slides. Images were obtained using the
fluorescent microscope (Keyence Biorevo BZ-9000) and BZ-II Viewer and Analyzer Software.
All steps were done in the absence of light.

Western Blotting
At 24h posttransfection, cells were trypsinized and replated on a 6 cm dish at a density of
1.2 x 10
6
. At 48h posttransfection, cells were washed twice with PBS (Invitrogen) 1X, lysed with
50 µl of radioimmunoprecipitation (RIPA) buffer (10% protease inhibitor cocktail (PIC)), and
14
centrifuged at 13,000 rpm for 5-min at 4 °C. The supernatant was collected and 20µg were
homogenized in 20µl of 1X Laemmli buffer. The sample was boiled at 107 ºC for 4-min. Proteins
were separated on a 15% sodium dodecyl sulfate (SDS) polyacrylamide gel and transferred to a
nitrocellulose membrane (Bio-Rad). Membranes were incubated for 30-min at room temperature
in blocking buffer containing Tris-buffered saline with 0.05% Tween-20 (TBST) and 5% non-fat
dry milk. Membranes were then incubated with primary antibody overnight at 4 ºC. Membranes
were subjected to three 5-min washes in TBST. Membranes were then incubated in secondary
antibody for 45 minutes at room temperature, followed by three 5-min washes in TBST.
Membranes were activated with West Pico Signal Solution (Thermo Fisher Scientific) and
visualized with LAS-4000 software.

Quantitative Polymerase Chain Reaction
At 48h posttransfection, growth media of siRNA-treated cells were collected and
ultracentrifuged at 50,000 rpm at 4 ºC for 30 min. The supernatant was discarded and the pellet
was resuspended in 15 µl of PBS 1X. In order to cleave DNA, samples were treated with 8 µl of
DNase buffer and 4 µl of 10X TURBO DNase (Thermo Fisher Scientific 4022G) and incubated
for 30 min at 37 ºC. The reaction was stopped with 2 µl of EDTA at 75 ºC for 10 min. In order to
break down proteins and release nucleic acids, samples were treated with 2.7 µl of proteinase k
and 2 µl of tRNA carrier overnight at 65 ºC. DNA was extracted and isolated by
phenol:chloroform:isoamyl alcohol (25:24:1, v/v) (Thermo Fisher Scientific 15593049) treatment
and ethanol precipitation. qPCR was then performed with a TaqMan probe to quantify extracellular
viral DNA.

15
Part III: Results

Autophagosomes serve as a vehicle to deliver HBV particles to MVBs.
It is well established that HBV subverts the autophagic process in order to egress, in fact,
autophagy is required for viral replication [3, 22]. It is also established that autophagosomes and
MVBs interact with each other to form amphisomes [4], and MVBs are involved in the release of
mature viral particles [8, 28]. In order to explore whether autophagosomes may serve as the vehicle
that delivers HBV to MVBs, we analyzed the distribution of HBV core proteins (HBcAg) within
the cell.
Being that LC3 is an important and widely used marker of autophagosomes, GFP-LC3-
Huh7 cells were transfected with 1.3mer HBV genomic DNA [3, 7]. At 48h post transfection, cells
were incubated with primary and secondary antibodies and visualized by immunofluorescent
microscopy. CD63 is a marker for MVBs [29]. Rabbit anti-core protein (1:100 dilution) and mouse
anti-CD63 protein (1:50 dilution) (Santa Cruz Biotechnology) were used as primary antibodies
and incubated for 1h at 37º C. Rhodamine anti-rabbit (1:50 dilution) (Invitrogen) and Alexafluor
405 anti-mouse (1:25 dilution) (Thermo Fisher Scientific) were used as secondary antibodies and
incubated for 45 min at 37 ºC. Cover slips were mounted with 90% glycerol.
After western blot membranes were blocked with 5% milk, they were incubated with
primary antibody: CD63 (1:500 dilution in blocking buffer) (Novus Biologicals, mouse host), actin
(1:2,000 dilution in blocking buffer) (rabbit host), and HBeAg (1:1,000) (rabbit host), overnight
at 4 ºC. Secondary antibody: anti-mouse (1:10,000) and anti-rabbit (1:10,000) (Abcam), were
incubated for 45 min at room temperature.
We found an increase in autophagosomes in HBV infected cells (Figure 1a,e). There was
a puncta pattern showing colocalization of autophagosomes, HBcAg, and CD63 (Figure 1d), as
16
seen by the white signals. Past studies by our laboratory have presented HBV with a puncta pattern
localized in the nucleus; however, this experiment has consistently displayed a puncta pattern in
the cytoplasm. Western blot analysis was performed to confirm the presence of HBV in cells
transfected with HBV and the expression of CD63 (Figure 1i).

Figure 1. Autophagosomes serve as the vehicle of delivery of HBV to MVBs. (a-d) Immunofluorescent
staining of HBV infected cells. Autophagosomes are green and indicated by GFP-LC3. HBV core protein
is red (HBcAg, rhodamine anti-rabbit). CD63 is blue (CD63, AlexaFluor 405 anti-mouse). A cytoplasmic
puncta pattern is seen in each panel. The white signal shows the colocalization of autophagosomes, HBV,
and MVBs. (e-h) Immunofluorescent staining of pUC19 control cells. Autophagosomes are green and
indicated by GFP-LC3. CD63 is seen in blue. Compared to control cells, HBV-infected cells show an
increase in autophagosomes and amphisomes (i) Western blot analysis of CD63 in control and HBV
infected cells. Actin is a loading control.

Suppression of autophagosome and MVB fusion prevents release of mature HBV particles
from the cell.
To test suppression of amphisome formation in order to prevent HBV viral release, we
examined the effects of Rab11 siRNA and Rab11 mutant plasmids on mature viral particle release.
Rab11 is a small GTPase protein that decorates the membranes of MVBs and is required for the
fusion of autophagosomes and MVBs [4, 16]. Rab11S25N is a dominant negative mutant that is
GTP-binding deficient [16]. Rab11Q70L is a GTPase deficient mutant [16].
GFP-LC3-Huh7 cells were co-transfected with 1.3mer HBV genomic DNA and Rab11
siRNA. At 48h posttransfection, the release of viral particles was examined by immunofluorescent
microscopy, western blot analysis, and qPCR. The immunofluorescent coverslips were incubated
17
in primary antibody. Rabbit anti-core protein (1:100 dilution) and mouse anti-CD63 protein (1:50
dilution) (Santa Cruz Biotechnology) were used as primary antibodies and incubated for 1 h at 37º
C. Rhodamine anti-rabbit (1:50 dilution) (Invitrogen) and Alexafluor 405 anti-mouse (1:25
dilution) (Thermo Fisher Scientific) were used as secondary antibodies and incubated for 45 min
at 37 ºC. Cover slips were mounted with 90% glycerol.
After western blot membranes were blocked with 5% milk, they were incubated with
primary antibody: Rab11 (1:1000 dilution in blocking buffer) (Novus Biologicals, mouse host),
actin (1:2,000 dilution in blocking buffer) (rabbit host), and HBeAg (1:1,000) (rabbit host),
overnight at 4 ºC. Secondary antibodies: anti-rabbit (1:10,000) (Abcam), were incubated for 45
min at room temperature.
Compared to control siRNA, in the absence of Rab11 (Rab11 siRNA), there is a clear
decrease in the amount of Rab11 protein in treated cells (Figure 2a). There was also an increase of
intracellular HBV compared to control cells (Figure 2a, e, i). Clear colocalization of GFP-LC3 and
CD63 can be seen in control cells (Figure 2e) that is not observed in Rab11 siRNA treated cells
(Figure 2i). The cells with GFP-LC3-CD63 colocalization show less intracellular HBV, indicating
that the MVB pathway is functioning normally, allowing mature viral particles to exit the cell. The
increase of intracellular HBV in the absence of Rab11 could be due to a variety of reasons, but we
hypothesize that the absence of Rab11 blocks the MVB pathway, preventing the excretion of
mature HBV particles.
To further confirm the blockage of the MVB pathway, we performed qPCR to quantify
HBV DNA excreted from the cell in siRNA treated cells. At 48h posttransfection, cell growth
media was collected and treated with DNase to cleave the HBV DNA. The sample was then treated
with proteinase k to break down proteins and the nucleic acids. After phenol-chloroform extraction
18
and ethanol precipitation, extracellular HBV DNA was quantified by qPCR with a TaqMan probe.
Cells treated with Rab11 siRNA had notably reduced extracellular DNA compared to control
siRNA cells (Figure 3). This reduction further confirms our findings that in the absence of Rab11
protein, the MVB pathway is blocked, inhibiting the release of mature HBV virions.

Figure 2. Knockdown of Rab11 results in increased intracellular HBV viral particles. (a) Western
blot analysis of Rab11 protein knockdown and HBV expression in cells with control or Rab11 siRNA.
Cells with Rab11 siRNA result in a decrease of Rab11 protein and an increase of intracellular HBV
compared to cells with control siRNA. Actin is a loading control. (b-e) Immunofluorescent staining of
HBV and control siRNA co-transfected cells. Autophagosomes are green and indicated by GFP-LC3.
HBV core protein is red (HBcAg, rhodamine anti-rabbit). CD63 protein is blue (CD63, AlexaFlour 405
anti-mouse). A puncta pattern of distribution and colocalization between GFP-LC3, HBcAg, and CD63
is seen in cells transfected with HBV and control siRNA showing amphisomes containing HBV. (f-i)
Immunofluorescent staining of HBV and Rab11 siRNA co-transfected cells. Autophagosomes are green
and indicated by GFP-LC3. HBV core protein is red. CD63 protein is blue. There is an increased
distribution of intracellular HBV in cells transfected with Rab11 siRNA indicating inhibition of mature
viral particle exit. There is also decreased colocalization of LC3 and CD63 indicating decreased
amphisome formation.

Figure 3. Quantification of extracellular HBV DNA after knockdown of Rab11. Histogram
representing the fold change (2^ddCt) in the quantitation of extracellular HBV DNA after Rab11 siRNA
treatment compared to the control siRNA.

19
Immunofluorescent microscopy was used to visualize the GFP-tagged Rab11 plasmids.
Huh7 cells were double transfected with 1.3mer HBV genomic DNA and GFP-Rab11 plasmid. At
48h posttransfection, coverslips were incubated in primary antibody. Rabbit anti-core protein
(1:100 dilution) was used as primary antibody and incubated for 1 h at 37º C. Rhodamine anti-
rabbit (1:50 dilution) (Invitrogen) was used as secondary antibodiy and incubated for 45 min at 37
ºC. Cover slips were mounted with DAPI. The Rab11wt and Rab11Q70L plasmids both showed
strong HBV core signal with puncta pattern distribution (Figure 4a, g). There was also strong and
colocalized signals for the Rab11 protein in these samples (Figure 4a-c, g-i). Bright signals are a
result of the colocalization of HBV core and GFP-Rab11, showing a strong interaction between
HBV and MVBs. In comparison, the Rab11 dominant negative mutant (Rab11S25N) plasmid
showed a more diffuse distribution of HBV core and significantly less Rab11 signaling (Figure
4d-f). This result indicates that decreased Rab11 protein affects HBV distribution in the cell and
release as viral particles try to exit the cell.

Figure 4. Rab11 dominant negative mutant results in diffuse HBV signal and decreased HBV and
MVB interaction (a-c) Immunofluorescent staining of HBV and Rab11wt double transfected cells. HBV
core protein is red (HBcAg, rhodamine anti-rabbit). Rab11 protein is green and GFP-tagged (Fader). The
cells are mounted with DAPI stain. A puncta pattern of HBcAg and GFP-Rab11 is seen. Bright signals
20
are a result of the colocalization of HBcAg and GFP-Rab11. (d-f) Immunofluorescent staining of HBV
and Rab11 dominant negative mutant (Rab11S25N) double transfected cells. There is a decreased and
diffuse HBcAg signal compared to cells transfected with the Rab11wt and Q70L plasmids. The dominant
negative mutant shows a decrease in the Rab11 protein compared to the Rab11wt and Q70L plasmids. (g-
i) Immunofluorescent staining of HBV and Rab11 constitutively activated mutant (Rab11Q70L) double
transfected cells. A puncta pattern of HBcAg and GFP-Rab11 is seen similar to the Rab11wt cells. Bright
signals are a result of the colocalization of HBcAg and GFP-Rab11.

The arginine-rich C-Terminal domain of p22 is important in the expression of HBV.
In order to investigate the role of the arginine-rich C-terminal domain of p22 in HBV
expression, we constructed plasmids without the CTD. p22 is the precursor to HBeAg (p17). When
the CTD is cleaved, HBeAg is formed [12, 25]. In order to study the removal of the CTD (Figure
5a), we constructed three plasmids using the pcDNA3 vector. Plasmids were constructed using
primers described in the material and methods. A Flag-tag was introduced to detect the protein; it
was ligated between the HindIII and BamHI sites of the pcDNA3 (Figure 5f). The pcDNA primer
has a kozak sequence directly following the HindIII site of the pCDNAwFlag_F-HindIII primer to
ensure translation of the Flag-tag (Figure 5d). The kozak sequence was followed by the start codon,
and then the Flag tag. The pCDNAwSTOP&Flag_R-BamHI primer has a sticky end that
overhangs and correlates to the overhanging, sticky end of the pcDNA forward primer (Figure 5e).
The forwards primer for both p22 plasmids, p22wFlag_F-HindIII, has a kozak sequence
immediately after the HindIII site to ensure translation of the p22 protein. The kozak sequence was
followed by the start codon, and then the Flag-tag. The Flag-tag was added to detect the protein
(Figure 5b). The p22-Flag plasmid was made to express the p22 protein as a whole; it was inserted
between the HindIII and BamHI sites of pcDNA3 (Figure 5g). Its reverse primer, p22wSTOP_R-
BamHI, stops translation of p22 at the original stop codon (Figure 5c). The truncated p22-Flag
(Δp22-Flag) plasmid was made to express p22 without the CTD; it was inserted between the
HindIII and BamHI sites of pcDNA3 (Figure 5g). Its reverse primer, HBVwoCTD/Stop_R-
BamHI, has a kozak sequence immediately after the HindIII site to ensure translation of the p22
21
protein. The kozak sequence was followed by the start codon, and then the Flag-tag. The Flag-tag
was added to detect the protein.

Figure 5. Truncated p22 plasmid construction. (a) C-terminal sequence of the p22 gene. Experimental
p22 shows the original sequence and stop codon of p22 and indicated the arginines that characterize this
domain. The HBVwoCTD_R-BamHI shows the sequencing of the truncated p22 plasmid where the new
stop codon was introduced to remove the arginine-rich domain. (b-e). The primers used to construct
experiment plasmids. (f-g) Plasmid constructed with primers as described above.

Huh7 cells were transfected with plasmids. At 48h posttransfection, samples were
analyzed by immunofluorescent microscopy and western blot. Immunofluorescent coverslips
were treated with primary antibodies. Rabbit anti-core protein (1:100 dilution) and mouse anti-
Flag(M2) (1:100 dilution) were used as primary antibodies and incubated for 1 h at 37º C.
22
Rhodamine anti-rabbit (1:50 dilution) and FITC anti-mouse (1:50 dilution) (Thermo Fisher
Scientific) were used as secondary antibodies and incubated for 45 min at 37 ºC and mounted
with 90% glycerol.
After western blots were blocked with 5% milk, they were treated with primary antibodies:
Flag (M2) (1:100 dilution) (mouse host), actin (1:1,000 dilution) (rabbit host), and HBeAg
(1:1,000 dilution) (rabbit host), and incubated overnight at 4 ºC. Secondary antibodies: anti-mouse
(1:10,000) and anti-rabbit (1:10,000), were incubated for 45 min at room temperature.
HBV core could be detected in cells expressing complete p22 DNA, seen by bright puncta
signals (Figure 5a, g). The p22-Flag plasmid constructed shows bright puncta signals for both
HBV core and Flag that colocalize within the cell (Figure 5g-i). The plasmid expressing truncated
p22 shows no detectable signal for HBV or Flag. To further confirm these results, proteins were
analyzed by western blot. HBV core could be detected in cells expressing the full p22 protein, but
could not be detected in the truncated p22 sample (Figure 5m). The western blot and
immunofluorescent microscopy conclude that without the C-terminal domain, HBV cannot be
expressed (Fig. 5j-l, m).

23

Figure 6. Loss of the arginine rich C-terminal domain results in the loss of HBV core expression.
HBV core protein is seen in red (HBcAg, rhodamine anti-rabbit). Flag is seen in green (Flag (M2), FITC
anti-mouse). (a-c) Immunofluorescent staining of cells transfected with pECE1-p22. The HBV core
protein is seen in red and Flag is undetectable. (d-f) Immunofluorescent staining of cells transfected with
pCDNA-Flag plasmid. There is no detectable HBV or Flag signal in these cells. (g-i) Immunofluorescent
staining of cells transfected with pCDNA-p22-Flag plasmid. The HBV core protein is seen in red. The
Flag signal is seen in green. A puncta pattern of HBcAg and Flag is seen. Bright signals are colocalization
of HBcAg and Flag indicating the presence of the p22 domain of HBV. (j-l) Immunofluorescent staining
of cells transfected with the truncated p22-Flag plasmid (pCDNA-Δp22-Flag). There is no detectable
HBV of Flag signal in these cells. (m.) Western blot analysis of p22 plasmids in Huh7 infected cells.
Actin is a loading control.
24
Part IV: Discussion
Hepatitis B virus was discovered over 55 years ago and chronically infects 250 million
people worldwide, with close to one million deaths annually. Despite the abundance of information
about the mechanisms of viral entrance and replication in host cells, the mechanism of viral release
remains elusive. In this study, we aimed to show the relationship between autophagosomes and
multivesicular bodies in order to then block their fusion and prevent the release of mature viral
particles. We determined that autophagosomes serve as a vehicle for delivering HBV to MVBs
(Figure 1). This fusion that forms amphisomes can be blocked by the absence of the Rab11 protein
by siRNA knockdown or with dominant negative Rab11 plasmids (Figure 2). We are currently
attempting to further confirm the effect that Rab11 has on HBV release by amphisomes. Further,
the HBV genome has an arginine rich C-terminal domain on its precore protein, known as p22.
When the CTD is cleaved by furin, the result is p17, or HBeAg. HBeAg is important in viral
persistence, but the importance of the CTD in p22 is unclear. We aimed to produce a p22 plasmid
that did not express the CTD of p22 (Figure 3). We showed that without the CTD, HBV precore
protein cannot be detected in the cell.
Autophagy is a well conserved regulatory “housekeeping” mechanism in eukaryotic cells
[1, 7]. It adapts to infections and nutrient deprivation that cause the cell stress and removes debris
and damaged organelles in order to maintain cellular homeostasis [7, 18]. Despite autophagy’s
antiviral capabilities, it is well established that HBV can subvert the autophagic pathway and
associate with the Atg5-12/16L complex of phagophore elongation for viral replication and
maturation [3, 8]. MVBs are a form of endosome that release their contents into extracellular space
by fusing with the plasma membrane and have been shown to be important in the release of mature
HBV viral particles. [16, 28]. Autophagosomes can interact with the endosomal pathway. The
25
induction of autophagy can stimulate the fusion of autophagosomes with MVBs to form
amphisomes [4]. Some enveloped RNA viruses require host vacuolar sorting proteins (VPS) of the
membrane of late endosomes that lead to MVB budding [28]. MVBs depend on several class E
VPS proteins, some of which are binding partners for the proteins of viruses dependent on MVBs
[28]. Watanabe et al showed that MVB class E proteins interact with HBV envelope proteins to
aid in viral replication and budding [28]. When complete understanding of the mechanism by
which HBV exits a cell is established, targets to inhibit viral release can be assessed. In order to
determine if autophagosomes could serve as a delivery mechanism of HBV to MVBs for viral
release, we showed that autophagosomes and MVBs interact in cells infected with HBV. HBV
1.3mer genomic DNA was introduced to Huh7 human hepatoma cells with GFP-tagged LC3
(GFP-LC3-Huh7). Cells were treated with antibodies for CD63, marker for MVBs, and HBcAg.
Immunofluorescent microscopy showed an increase of autophagosomes compared to the control
group (Figure 1a, e). Microscopy also showed colocalization of GFP-LC3, HBcAg, and CD63 in
cytoplasmic puncta patterns (Figure 1d). The interaction of autophagosomes, HBV, and MVBs
indicates the delivery of HBV from autophagosomes to MVBs for viral release.
With a cohesive pathway for viral exit established through amphisomes, we proceeded to
looked for a way to block the fusion of autophagosomes and MVBs to prevent viral release. Rab
proteins belong to a family of small GTPases that play an important role in the regulation of
membrane trafficking [16]. Rab11 decorates the membranes of MVBs and regulates the exosome
pathway [16]. A study by Fader et al. show that Rab11 is required for amphisome formation. To
assess if the release of mature viral particles could be inhibited, we showed the importance of
Rab11 in this process. Huh7 cells were co-transfected with HBV 1.3mer genomic DNA and Rab11
siRNA. Western blot analysis of blots treated with HBeAg and Rab11 antibodies showed a
26
decrease in the presence of Rab11 compared to control (Figure 2a). The blot also showed a
noticeable increase HBeAg signal intensity (Figure 2a), indicating that with decreased Rab11
protein, viral release was impaired, resulting in the accumulation of intracellular HBV.
Immunofluorescent microscopy an increase of intracellular HBV in cells treated with Rab11
siRNA compared to controls (Figure 2c, g). Control cells showed colocalization of GFP-LC3 and
CD63, amphisome formation that we saw in our previous experiment. This colocalization was not
observed in cells treated with Rab11 siRNA. The colocalization along with the increase of
intracellular HBV indicate that the MVB pathway is not functioning normally and not allowing
mature HBV viral particles to leave the cell. To quantify the release of HBV virions, we conducted
qPCR. There was a significant decrease in fold change in cells treated with Rab11 siRNA
compared to control cells (Figure 3), further confirming the need for Rab11 in order for mature
HBV DNA to exit the cells. Our results conclude that in the absence of Rab11 protein inhibits the
MVB pathway, preventing the release of HBV virions. Future experiments will need to be done
with pUC19 as a negative control for HBV.
To further investigate the influence of Rab11, Huh7 cells were transfected with HBV
1.3mer genomic DNA and Rab11 plasmids kindly gifted from Dr. Claudio Fader (National
University of Cuyo) [28]. These plasmids included a dominant negative (DN) mutant
(Rab11S25N) plasmid and a constitutively activated mutant (Rab11Q70L) plasmid [28]. Cells
were treated with antibody against HBcAg and the Rab11 was GFP-tagged. Immunofluorescent
microscopy showed that similar to wild type Rab11, the Rab11Q70L plasmid showed similar HBV
core and Rab11 signaling in both quantity and puncta pattern distribution (Figure 4b-d, h-j). In the
DN mutant plasmid, however, Rab11 signal was minimal and HBcAg signal was diffuse (Figure
4e-g). The decrease in puncta pattern and signal intensity indicate that Rab11 is important in
27
release of mature HBV virions. What causes the HBcAg signal to become diffuse is still in
question.
The results from the western blot and immunofluorescent microscopy of Rab11 siRNA and
Rab11 mutant plasmids indicate that the decrease of Rab11 in cells infected with HBV leads to
blockage of the MVB pathway, preventing viral excretion from the cell. Future experiments will
be conducted with the purpose of confirming the presence of amphisomes in cells transfected with
HBV and Rab11 plasmids. These experiments will use the GFP-LC3-Huh7 cell line with a Rab11
DN mutant. GFP-LC3 will indicate autophagosomes and CD63 will indicate MVBs.
Immunofluorescent staining can identify autophagosomes, MVBs, and HBV to show amphisomes
containing HBV, similar to the experiment we conducted with Rab11 siRNA. Detecting
amphsiome formation in the immunofluorescent staining can indicate the role of Rab11 as well.
Rab11 DN mutant will be HA-tagged, allowing the visualization of Rab11 and HBV signal in the
cell. Rab11 levels can always be determined by western blot analysis. qPCR will also be conducted
to quantify extracellular HBV DNA of cells with Rab11 wt or Rab11 DN plasmids to further study
the role of Rab11 in blocking the release of mature virions. Furthermore, future experiments need
to be designed to identify why the HBV signal becomes diffuse in cells with Rab11 DN mutant
plasmid, and how that affects viral release.
There is evidence indicating that the induction of autophagy causes calcium to accumulate
in autophagosomes [4]. Previous studies by this group have shown that increased intracellular
calcium levels are favorable for MVBs to dock and fuse [4, 40]. Based on these two findings, they
wanted to investigate whether calcium is required for the formation of amphisomes. They showed
that in the presence of the calcium chelator BAPTA without its acetoxymethyl ester, vesicles were
significantly decreased in size and the interactions between autophagosomes and MVBs were
28
blocked. Under starved conditions and in the presence of the BAPTA chelator, amphisome levels
dropped below levels of cells in homeostatic conditions, showing that calcium is required for the
fusion of autophagosomes and MVBs to form amphisomes [4]. Investigating the calcium-
dependent mechanisms of amphisomes could be a future experiment in studying the release of
mature HBV viral particles.
In addition to our study on the release of mature HBV virions, we investigated the arginine
rich C-terminal domain of HBV precore gene. The C gene of HBV codes for the precore protein
(p22), which contains the core protein (p21) and an extension of 29 amino acids on the amino
terminus (p25) [5, 31]. Nineteen of the 29 amino acid extension form a signal peptide sequence
to direct the precore mRNA to the ER where the signal peptide is cotranslationally cleaved [6, 12].
The cleavage of the signal peptide forms p22 [9]. p22 is important because its arginine-rich CTD
can be cleaved, producing p17, or HBeAg [12, 25]. HBeAg is not needed for viral replication, so
its function is still enigmatic, though it has been suspected to be important for HBV to establish
persistence after vertical neonatal infection [12, 24]. The goal of this experiment was to determine
the effects of removing the arginine-rich CTD of precore before HBV infects a cell. To begin,
plasmids without the p22 C-terminal domain were constructed with primers described in the
materials and methods. A kozak sequence was placed before the start codon to ensure translation
of our protein of interest. Directly after the start codon was a Flag-tag to detect our protein,
followed by the truncated p22. The insert was then ligated between the HindIII and BamHI sites
of the pcDNA3 vector (Figure 5c-d). Huh7 cells were transfected with the p22 plasmids. Western
blot analysis of membranes treated with HBeAg and Flag antibodies showed that without the CTD
of p22, HBV cannot be detected (Figure 6a). In order to further confirm this result, cells were
visualized by immunofluorescent microscopy. Compared to plasmids that expressed the full p22
29
protein, the plasmid with truncated p22 did not exhibit HBV signal (Figure 6j-i). These results
indicate that the C-terminal domain plays an important role in the expression of p22, and in
association, HBV e antigen. Interaction of the nuclear transport factor with the arginine rich C-
terminal domain of p22 obstructs the JAK-STAT pathway to evade host immunity and establish
treatment resistance [17, 25]. p17 aids in the persistence of viral infection [24]. The roles of both
p22 and p17 that function either with the CTD or after its cotranslational cleavage indicate that the
CTD is important in the expression of these precore proteins and establishing viral persistence.
Conditions need to be optimized to further assess the role of the CTD of p22. It is unclear how the
lack of the CTD causes the protein to become destabilized. Further studies will be needed to answer
this question.

30
References
1. Abada, Adi, and Zvulun Elazar. “Getting Ready for Building: Signaling and Autophagosome
Biogenesis.” EMBO Reports, vol. 15, no. 8, 2014, pp. 839–852.,
doi:10.15252/embr.201439076.
2. Chen, Wei, and Et al. “Rab11 Is Required for Trans-Golgi Network–to–Plasma Membrane
Transport and a Preferential Target for GDP Dissociation Inhibitor.” Molecular Biology of
the Cell, Nov. 1998, doi:10.1091/mbc.9.11.3241.
3. Döring, Tatjana, et al. “Hepatitis B Virus Subverts the Autophagy Elongation Complex
Atg5-12/16L1 and Does Not Require Atg8/LC3 Lipidation for Viral Maturation.” Journal of
Virology, vol. 92, no. 7, 2018, doi:10.1128/jvi.01513-17.
4. Fader, Claudio M., et al. “Induction of Autophagy Promotes Fusion of Multivesicular Bodies
with Autophagic Vacuoles in K562 Cells.” Traffic, vol. 9, no. 2, 2008, pp. 230–250.,
doi:10.1111/j.1600-0854.2007.00677.x.
5. Gallucci, Lara, and Michael Kann. “Nuclear Import of Hepatitis B Virus Capsids and
Genome.” Viruses, vol. 9, no. 1, 2017, p. 21., doi:10.3390/v9010021.
6. Garcia PD, Ou JH, Rutter WJ, Walter P. 198. Targeting of the hepatitis B virus precore
protein to the endoplasmic reticulum membrane: after signal peptide cleavage translocation
can be aborted and the product released into the cytoplasm. J Cell Biol 106:1093–
1104. doi:10.1083/jcb.106.4.1093.
7. Lamb, Christopher A., et al. “The Autophagosome: Origins Unknown, Biogenesis Complex.”
Nature Reviews Molecular Cell Biology, vol. 14, no. 12, 8 Dec. 2013, pp. 759–774.,
doi:10.1038/nrm3696.

8. Li, J., et al. “Subversion of Cellular Autophagy Machinery by Hepatitis B Virus for Viral
Envelopment.” Journal of Virology, vol. 85, no. 13, 20 July 2011, pp. 6319–6333.,
doi:10.1128/jvi.02627-10.

9. Lin, Wen-Jye, et al. “Suppression of Hepatitis B Virus Core Promoter by the Nuclear Orphan
Receptor TR4.” Journal of Biological Chemistry, vol. 278, no. 11, 1 Aug. 2003, pp. 9353–
9360., doi:10.1074/jbc.m205944200.
10. Lippai, Mónika, and Zsuzsanna Szatmári. “Autophagy—from Molecular Mechanisms to
Clinical Relevance.” Cell Biology and Toxicology, vol. 33, no. 2, 12 Dec. 2016, pp. 145–
168., doi:10.1007/s10565-016-9374-5.
31
11. Lok, Anna Suk-Fong. “Hepatitis B Treatment: What We Know Now and What Remains to
Be Researched.” Hepatology Communications, vol. 3, no. 1, 15 Nov. 2018, pp. 8–19.,
doi:10.1002/hep4.1281.
12. Mitra, Bidisha, et al. “Hepatitis B Virus Precore Protein p22 Inhibits Alpha Interferon
Signaling by Blocking STAT Nuclear Translocation.” Journal of Virology, vol. 93, no. 13,
24 Apr. 2019, doi:10.1128/jvi.00196-19.

13. Ni, Yi, et al. “Hepatitis B and D Viruses Exploit Sodium Taurocholate Co-Transporting
Polypeptide for Species-Specific Entry into Hepatocytes.” Gastroenterology, vol. 146, no. 4,
Apr. 2014, doi:10.1053/j.gastro.2013.12.024.

14. Ou, J H, et al. “Transport of Hepatitis B Virus Precore Protein into the Nucleus after
Cleavage of Its Signal Peptide.” Journal of Virology, vol. 63, no. 12, Dec. 1989, pp. 5238–
5243., doi:10.1128/jvi.63.12.5238-5243.1989.

15. Rijckborst, Vincent, and Harry L. A. Janssen. “The Role of Interferon in Hepatitis B
Therapy.” Current Hepatitis Reports, vol. 9, no. 4, 26 Aug. 2010, pp. 231–238.,
doi:10.1007/s11901-010-0055-1.

16. Savina, Ariel, et al. “The Exosome Pathway in K562 Cells Is Regulated by Rab11.” Journal
of Cell Science, vol. 115, 1 Apr. 2002. Seif, F., Khoshmirsafa, M., Aazami, H. et al. The role
of JAK-STAT signaling pathway and its regulators in the fate of T helper cells. Cell Commun
Signal 15, 23 (2017). https://doi.org/10.1186/s12964-017-0177-y

17. Seif, F., Khoshmirsafa, M., Aazami, H. et al. The role of JAK-STAT signaling pathway and
its regulators in the fate of T helper cells. Cell Commun Signal 15, 23 (2017).
https://doi.org/10.1186/s12964-017-0177-y

18. Sir, Donna, and Jing-Hsiung James Ou. “Autophagy in Viral Replication and Pathogenesis.”
Molecules and Cells, vol. 29, no. 1, Jan. 2010, pp. 1–7., doi:10.1007/s10059-010-0014-2.

19. Sir D, Tian Y, Chen WL, Ann DK, Yen TS, Ou JH. The early autophagic pathway is
activated by hepatitis B virus and required for viral DNA replication. Proc Natl Acad Sci U S
A. 2010 Mar 2;107(9):4383-8. doi: 10.1073/pnas.0911373107. Epub 2010 Feb 8. PMID:
20142477; PMCID: PMC2840127.

20. Sonneveld, Milan J., and Harry L. A. Janssen. “Pros and Cons of Peginterferon Versus
Nucleos(t)Ide Analogues for Treatment of Chronic Hepatitis B.” Current Hepatitis Reports,
vol. 9, no. 2, 15 May 2010, pp. 91–98., doi:10.1007/s11901-010-0041-7.
32
21. Szatmári, Zsuzsanna, et al. “Rab11 Facilitates Cross-Talk between Autophagy and
Endosomal Pathway through Regulation of Hook Localization.” Molecular Biology of the
Cell, vol. 25, no. 4, 15 Feb. 2014, pp. 522–531., doi:10.1091/mbc.e13-10-0574.
22. Tian, Y., et al. “Autophagy Required for Hepatitis B Virus Replication in Transgenic Mice.”
Journal of Virology, vol. 85, no. 24, 28 Sept. 2011, pp. 13453–13456.,
doi:10.1128/jvi.06064-11.

23. Tian, Yongjun et al. “Effects of interferon-α/β on HBV replication determined by viral
load.” PLoS pathogens vol. 7,7 (2011): e1002159. doi:10.1371/journal.ppat.1002159

24. Tian, Yongjun, et al. “Maternal-Derived Hepatitis B Virus e Antigen Alters Macrophage
Function in Offspring to Drive Viral Persistence after Vertical Transmission.” Immunity, vol.
44, no. 5, 17 May 2016, pp. 1204–1214., doi:10.1016/j.immuni.2016.04.008.

25. Tsai, Kuen-Nan, et al. “Mechanisms of Hepatitis B Virus Persistence.” Trends in
Microbiology, vol. 26, no. 1, Jan. 2018, pp. 33–42., doi:10.1016/j.tim.2017.07.006.

26. Ullrich, O, et al. “Rab11 Regulates Recycling through the Pericentriolar Recycling
Endosome.” Journal of Cell Biology, vol. 135, no. 4, 1996, pp. 913–924.,
doi:10.1083/jcb.135.4.913.

27. “Vaccine Information Statement.” Centers for Disease Control and Prevention, Centers for
Disease Control and Prevention, 5 Apr. 2019, www.cdc.gov/vaccines/hcp/vis/vis-
statements/hep-b.html.

28. Watanabe, T., et al. “Involvement of Host Cellular Multivesicular Body Functions in
Hepatitis B Virus Budding.” Proceedings of the National Academy of Sciences, vol. 104, no.
24, 12 June 2007, pp. 10205–10210., doi:10.1073/pnas.0704000104.

29. Xu, Jing, et al. “The Interplay between Exosomes and Autophagy – Partners in Crime.”
Journal of Cell Science, vol. 131, no. 15, 1 Aug. 2018, doi:10.1242/jcs.215210.

30. Yan, Huan et al. “Sodium taurocholate cotransporting polypeptide is a functional receptor for
human hepatitis B and D virus.” eLife vol. 1 e00049. 13 Nov. 2012, doi:10.7554/eLife.00049

31. Yeh, C T, et al. “The Arginine-Rich Domain of Hepatitis B Virus Precore and Core Proteins
Contains a Signal for Nuclear Transport.” Journal of Virology, vol. 64, no. 12, 4 Dec. 1990,
pp. 6141–6147., doi:10.1128/jvi.64.12.6141-6147.1990.

33
32. Zheng Y, Li J, Johnson DL, Ou JH. Regulation of hepatitis B virus replication by the ras-
mitogen-activated protein kinase signaling pathway. J Virol. 2003 Jul;77(14):7707-12. doi:
10.1128/jvi.77.14.7707-7712.2003. PMID: 12829809; PMCID: PMC161924.

33. Sir D, Ann DK, Ou JH. Autophagy by hepatitis B virus and for hepatitis B virus. Autophagy.
2010 May;6(4):548-9. doi: 10.4161/auto.6.4.11669. Epub 2010 May 16. PMID: 20305390.

34. Seeger, Christoph, and William S Mason. “Molecular biology of hepatitis B virus
infection.” Virology vol. 479-480 (2015): 672-86. doi:10.1016/j.virol.2015.02.031

35. Liang, T Jake. “Hepatitis B: the virus and disease.” Hepatology (Baltimore, Md.) vol. 49,5
Suppl (2009): S13-21. doi:10.1002/hep.22881

36. “Hepatitis B General Information.” Centers for Disease Control and Prevention, Centers for
Disease Control and Prevention, June 2016,
https://www.cdc.gov/hepatitis/hbv/pdfs/hepbgeneralfactsheet.pdf

37. Lee, William M. “Hepatitis B Virus Infection.” New England Journal of Medicine, vol. 337,
no. 24, 1997, pp. 1733–1745., doi:10.1056/nejm199712113372406.

38. Yuen, Man-Fung, et al. “Hepatitis B Virus Infection.” Nature Reviews Disease Primers, vol.
4, no. 1, 2018, doi:10.1038/nrdp.2018.35.

39. MacLachlan, Jennifer H, and Benjamin C Cowie. “Hepatitis B virus epidemiology.” Cold
Spring Harbor perspectives in medicine vol. 5,5 a021410. 1 May. 2015,
doi:10.1101/cshperspect.a021410

40. Savina, Ariel, et al. “Exosome Release Is Regulated by a Calcium-Dependent Mechanism in
K562 Cells.” Journal of Biological Chemistry, vol. 278, no. 22, 2003, pp. 20083–20090.,
doi:10.1074/jbc.m301642200.

41. Kowal, Joanna, et al. “Proteomic Comparison Defines Novel Markers to Characterize
Heterogeneous Populations of Extracellular Vesicle Subtypes.” Proceedings of the National
Academy of Sciences, vol. 113, no. 8, 2016, doi:10.1073/pnas.1521230113.

Abstract (if available)

Abstract Globally, Hepatitis B virus infects approximately 250 million people, resulting in about 1 million death annually. HBV infection can lead to chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma. HBV hijacks the autophagic and endocytic pathways to replicate and egress. Autophagosomes can fuse with multivesicular bodies to form amphisomes. To study whether or not autophagosomes serve as a vehicle to deliver HBV to MVBs for release of mature viral particles, we found amphisomes containing HBV could be detected by immunofluorescent microscopy. The Rab11 protein is a small GTPase that is required for amphisome formation. In studying if viral release could be inhibited, we examined the results of Rab11 knockdown with siRNA or dominant negative mutant by western blot analysis and immunofluorescent microscopy. We presented evidence that a decrease in Rab11 protein caused a noticeable accumulation of intracellular HBV when amphisome formation was blocked. Further, we quantified extracellular HBV DNA by qPCR, confirming our results. The C gene of HBV codes for the precore protein, p25. When the p25 signal peptide sequence is cotranslationally cleaved, the p22 protein remains. The C-Terminal domain of p22 interacts with the pathway responsible for initiating and organizing the immune response, JAK-STAT, to evade host immune response. The CTD can be cleaved by a furin protease to produce p17, HBeAg. We examined the effects of removing the CTD before HBV infected host cells with a plasmid that excludes the domain. Western blot analysis and immunofluorescent microscopy showed that HBV cannot be detected without the CTD. Our findings reveal a more cohesive pathway for viral release and the importance of Rab11 in preventing the blockage of that pathway. Further we showed that the C-Terminal domain of p22 has an important role in the expressing of HBV.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The effects of SRPK1 and SRPK2 on HBV precore protein

PDF

The effects of autophagy on hepatitis C virus

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

The effects of hepatitis C virus infection on host immune response and signaling pathways

PDF

Expression of recombinant hepatitis B virus e antigen and analysis of its effect on macrophages

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

Characterization of invariant natural killer T cells in a novel humanized HBV-transgenic model

PDF

Role of TLR4 and AID in lymphomagenesis induced by obesity and hepatitis C virus

PDF

Virus customization of host protein machinery for efficient propagation

PDF

A truncating mutation in the autophagy gene UVRAG drives inflammation and tumorigenesis in mice

PDF

WAVE1 is a novel mediator of HPV trafficking to the Golgi apparatus

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Hepatic c-Jun overexpression metabolically reprograms cancer cells through mTORC2/AKT pathway

PDF

Design and characterization of multiplex anti-HIV single domain antibodies for genome editing of the immunoglobulin locus

PDF

Roles of epithelial-mesenchymal transition and niche in tumorigenesis of tumor-initiating cells

PDF

Beclin 2-mediated autophagic degradation of the pathogenic proteins in neurodegenerative diseases

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Regulation of T cell HLA-DR by CD3 ζ signaling

PDF

Single cell gene expression analysis of KSHV infection in three-dimensional oral epithelial tissue cultures

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

Asset Metadata

Creator Pantuso, Jessica Nicole (author)

Core Title The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 03/30/2021

Defense Date 03/02/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amphisomes,autophagy,CTD,HBV,Hepatitis B virus,OAI-PMH Harvest,precore,rab11

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Ou, James (committee chair), Machida, Keigo (committee member), Yuan, Weiming (committee member)

Creator Email jessicapantuso@aol.com,pantuso@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-433710

Unique identifier UC11668107

Identifier etd-PantusoJes-9375.pdf (filename),usctheses-c89-433710 (legacy record id)

Legacy Identifier etd-PantusoJes-9375.pdf

Dmrecord 433710

Document Type Thesis

Rights Pantuso, Jessica Nicole

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA