University of Southern California Dissertations and Theses

Modeling SynGAP1 truncating mutations in neurodevelopmental disease using iPSC-derived neurons

(USC Thesis Other)

Modeling SynGAP1 truncating mutations in neurodevelopmental disease using iPSC-derived neurons

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

MODELING SYNGAP1 TRUNCATING MUTATIONS IN NEURODEVELOPMENTAL
DISEASE USING IPSC-DERIVED NEURONS
By
Jiazhen Xu

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(Molecular Microbiology and Immunology)
August 2019

2

Acknowledgements
I sincerely appreciate my research supervisor, Marcelo Pablo Coba. When I first came to this lab
two years ago, his enthusiasm encouraged me to start research in a field that I have never studied.
Every time I need his help in a rush, he will reply if he is available. I like our free talks in lab.
Marcelo, Brent, and I can talk in the lab for hours. Even though most of time I am just listening, I
think it is a better way to communicate and exchange thoughts than in a lab meeting. I am also
grateful that Dr. Coba could believe me and let me work on this topic. I learned a lot from this
topic. It is the chance to work here, in a field that I was not familiar with that has enabled me to
develop novel knowledge. Because of this, I have become a better researcher than I was two
years ago, in both technical skills and knowledge.
I must give my acknowledgement to my friend Brent. Brent Wilkinson is the most enthusiastic
man I have met pouring himself to research. His insistence and enthusiasm inspired me to move
on in academia. As a friend, he is optimistic and always willing to help. Thanks for his advice in
hard times. Furthermore, I would not be able to complete my experiments and this thesis without
the help of Brent. As a colleague, he is reliable and whenever I have question he will try to
answer even if he is busy himself. I never thought I would meet such a good friend in my first
two months in US. I think that is why we should always keep gratitude in mind.
I am thankful for all my committee members who reviewed my work and gave their advice. I
spent a lot of time on this thesis and really wanted to accomplish this thesis well. Your advice
gave me a different view to see my work which helped to find flaws that I previously ignored. I
am glad to have your help in completing my thesis.

3

Table of Contents
Acknowledgements 2
Table of Contents 3
Abbreviations 4
List of Tables 6
List of Figures 7
Abstract 8
Introduction 9
Materials and Methods 14
Results 27
Discussion and Conclusion 44
References 47

4

Abbreviations
FBS Fetal Bovine Serum
DMSO Dimethyl Sulfoxide
P/S Penicillin-Streptomycin
MEF cells Mouse Embryonic Fibroblasts
IL-2 Interleukin-2
BSA Bovine Serum Albumin
RT Room Temperature
hES medium human Embryonic Stem Cell medium
NEAA Non-Essential Amino Acid
bFGF Fetal Growth Factor-basic
ROCK inhibitor Rho Kinase inhibitors
T4 PNK T4 Polynucleotide Kinase
DTT DL-Dithiothreitol
ATP Adenosine Triphosphate
PFA Paraformaldehyde
5

PBST Phosphate Buffered Saline with Tween-20
NT3 Neurotrophin 3
BDNF Brain-Derived Neurotrophic Factor
ara-c 1-β-D-Arabinofuranosylcytosine
TRIS Hydroxymethyl Aminomethane
DOC Deoxycholate
TBST Tris-Buffered Saline with Tween 20
PLO Poly-L-ornithine Hydrochloride

6

List of Tables
Table 1 Patient 1 Primers and Restriction Enzyme Used for CRISPR and Genotyping
Table 2 Patient 3 Primers and Restriction Enzyme Used for CRISPR and Genotyping
Table 3 SYNGAP1 Mutation Sites in Patients

7

List of Figures
Figure 1 Mutations in NDDs patients and variants in the Exome Aggregation (ExAc)
database on SYNGAP1
Figure 2-1 PBMC Isolation from blood samples
Figure 2-2 Timeline of iPSC generation
Figure 3-1 Schematic of CRISPR/Cas9 gene editing in Patient 1
Figure 3-2 Genotyping of Patient 1 corrected cell line
Figure 4 Immunofluorescence and karyotype of Patient 1 and corrected cell lines
Figure 5 Timeline of iPSC differentiation
Figure 6 Western Blot of SynGAP1 from iPSC-derived neurons
Figure 7 Schematic of SynGAP1 in AMPARs recycle and electrical activity of neurons
Figure 8 Schematic of spine categorization and spine analysis
Figure 9 Genotyping and immunofluorescence of additional patient iPSCs

8

Abstract
The synaptic Ras-GTPase activating protein, SynGAP1, is one of the most abundant proteins at
the postsynaptic site of excitatory neurons. SynGAP1 plays a critical role in the organization of a
complex protein-protein interaction networks at the synapse with a profound impact on the
scaffolding and structural functions that shape dendritic spines and synaptic activity. De novo
mutations in SYNGAP1 gene are autosomal dominant, highly prevalent in intellectual disability
and have been associated with developmental diseases including autism spectrum disorders.
Mouse models have showed that mutations in SYNGAP1 alter neuronal morphology and synaptic
function. However, the role and mechanisms altered by mutations present in human neurons
remains to be explored. To study the mechanism altered by mutations in SYNGAP1 in patients,
we generated Induced pluripotent stem cells (iPSCs) from haploinsufficient patient samples (+/-)
and differentiated iPSCs to induced excitatory neurons (iNs). Mutation-corrected cell lines (+/+)
were generated by CRISPR-Cas9 and differentiated to iNs. We analyzed the expression of
SynGAP1 protein, the morphology and electrical activity from patient and control cell lines.
Expression of SynGAP1 protein is restored in CRISPR-corrected neurons and used as isogenic
iN controls. Patient derived neurons present abnormal dendritic spines morphology together with
alterations in bursts and spikes frequencies in multielectrode array recordings. Here we show that
the study of patient-derived neurons can be used to study the role of mutations in components of
the postsynaptic synapse and help to understand their role in neurodevelopmental disease.

9

Introduction
Neurodevelopmental Disorders
Neurodevelopmental Disorders (NDDs), an impairment in the growth and development of
central nervous system, can be caused by multiple factors including genetics, metabolism,
exposure to toxic substances, and traumatic experiences
[1]
. Patients affected by NDDs usually
show various symptoms early in childhood including dysfunction in cognition, motion, verbal
communication, behaviors, and others
[2, 3]
. Intellectual disabilities (ID) and autism spectrum
disorder (ASD) are two classifications of NDDs. ID refers to deficits in general mental abilities
such as problem solving, judgment, learning and memory
[4]
. The degree of ID can be reflected
by IQ and adaptive functioning: from mild ID to moderate, severe and even profound ID, IQ
ranges from 50-69, 35-49, 20-35, below 20 respectively
[4]
. Its prevalence estimates aggregate
around 2-3 % in high income countries with a majority in mild type and there is higher rate in
lower income countries. No effective treatment for ID is presently available
[4]
. Chromosomal
anomalies are considered one of the causes of ID, with 15% of severe ID being identified as
chromosomal anomalies by cytogenetic methods
[5]
. In addition, copy number variations (CNVs),
a DNA segment >1kb presenting at variable copy number
[6]
, has been revealed as risk factor of
both ID and ASD
[7]
.
Together with ID, ASD is the most frequent neurodevelopmental disorder
[2]
, and both can co-
occur (co-morbidity) in a number of patients diagnosed with one of these disorders
[4]
. Within the
spectrum of this disorder, ASD is frequently associated with: persistent deficits in social skills,
such as the ability to engage communication and share feelings; repetitive behavior such as hand
flapping and finger flicking
[2]
. From research reported in 2011, frequencies for ASD have
10

approached to 1% and the prevalence is not related to age
[8]
. Genome-wide analysis revealed
that specific SNPs are strongly associated with ASD
[9]
. In addition, credible SNPs are enriched
in enhancer marks of fetal brain, suggesting the regulatory role of SNPs in brain development
[10]
.
In ASD patients, about 22 % develop epilepsy
[11]
. Epilepsy is neurological disorder whose
cardinal feature is recurrent seizures
[12]
. Research has shown mutations in genes encoding ion
channels lead to hyperexcitability of neurons which then might cause epilepsy
[12]
. The most
important sodium channel subunit related to epilepsy is SCN1A, whose mutation causes 80% of
Dravet syndrome
[13]
. Abnormalities of the gene encoding γ‐aminobutyric acid (GABA)A
receptor, the main inhibitory system in CNS, has been proven to cause epilepsies
[14]
. These
studies reveal an important role of dysfunctional channel-related proteins in developing of
epilepsy.
SYNGAP1
SynGAP1, a synaptic GTPase activating protein coded by SYNGAP1 gene, was first reported in
1998
[15]
. It is a second most abundant protein in PSD
[16]
. There are at least five 130-kDa C-
terminal isoforms (α1, α2, β1/2, β3/4 and γ) majoring in SynGAPα1 and SynGAPβ
[17, 18]
. All of
these isoforms contain four common domains including the PH, C2, RasGAP, and DUF3498
domains. The PH domain is a pleckstrin homology domain involved in phospholipid binding
[19]
.
C2 domains have been found to be related to catalytic activity and calcium binding
[20]
. The
RasGAP domain is the central functional domain serving as Ras specific GTPase activating
protein and therefore downregulates Ras/MEK1/ERK2 activity
[21]
. The function of the protein
domain DUF3498 has not yet been characterized and remains classified as a domain of
unidentified function (DUF). As a scaffold protein, SynGAP1 participates in regulation of
11

multiple signaling pathways. In 1998, researchers found that SynGAP1 down regulates Ras
activity by stimulating GTPase activity
[22]
. Moreover, overexpression of SynGAP1 results in a
decrease of extracellular signal-regulated kinase 2 (Erk2), in excitatory neurons
[21]
, and mouse
models of SynGAP1 happloinsuffiency show increased Erk2 activity
[23]
. These studies revealed
that SynGAP1 a Ras/Rap GTPase activator to mediate the ERK/MAPK signaling pathway. In
addition, SynGAP1 negatively regulates synaptic α-amino-3-hydroxy-5-methyl-4-
isoxazolepropionic acid receptors (AMPARs) surface expression, which consequently mediates
fast-synaptic transmission
[21]
. A well-studied SynGAP-binding protein is PSD-95, a highly
abundant scaffold protein that interacts with NMDA receptors
[16]
. Furthermore, SynGAP1, PSD-
95 and NMDARs affect long-term potentiation (LTP), which is thought to be the foundation of
learning and memory
[23]
.
SYNGAP1 is composed of 19 exons and mutations in most of these exons could lead to NDDs. A
number of mutations in SYNGAP1 have been associated to DD, ASD, epilepsy
[31]
(Figure 1) and
schizophrenia
[24]
. For example, in a study for nonsyndromic mental retardation, researchers
found two SYNGAP1-mutation sites in 142 subjects with ASD and three sites from 143 subjects
with schizophrenia
[25]
. Furthermore, SYNGAP1 mutations are observed in 1-1.2 % of epileptic
encephalopathies
[26]
. In contrast to bioinformatical analysis on human patients, studies in mice
focus on the pathogenetic mechanism of SYNGAP1 mutation. For instance, increased spine
volume in dendrites from SYNGAP1 heterozygous knockout mice has been observed. Longer
dendrites, higher dendritic complexity, and more dendritic spines in SYNGAP1 heterozygous
knockout mice from postnatal day 21 suggests an inhibitory function of SynGAP1 protein in the
early maturation of neuron
[27]
. Interestingly, both dendritic morphology of wild type and Het
mice come to the same level in postnatal day 60, which suggests that SynGAP1 accelerates the
12

maturation in early development but does not influence the complexity of dendrites in adulthood.
Animal models of SYNGAP1 mutations have also been reported to show a variety of cognitive
abnormalities
[28, 29, 30]
. A recurrent phenotype is the impairment in learning and memory tasks in
SYNGAP1 heterozygous (-/+) mice
[28]
. Synaptic plasticity mechanisms such as long-term
potentiation (LTP), which is suggested to be the molecular substrate of learning and memory
[29]
.
It is suggested that, as a negative regulator in excitatory neurons, SynGAP1 plays a role in
Excitatory/Inhibitory balance
[28]
. This point is further proved by studies up-or-down regulating
SynGAP1 protein in mice.
[21, 30]
. However, little is known about SYNGAP1 genotype/phenotype
relationships in patients with SYNGAP1 mutations

Figure 1 Mutations in NDDs patients and variants in the Exome Aggregation (ExAc)
database on SYNGAP1 (Mignot et al. 2016)

13

iPSC and iPSC-derived neurons
Stem cells are undifferentiated cells with ability to proliferate and differentiate to different types
of cells. According to their differentiation potential, stem cells can be categorized to different
groups
[32]
. Pluripotent stem cells (PSC) are one of the groups present at the early embryo and are
able to differentiate to the three germ layers
[33]
. Usage of PSCs was limited until 2006 when,
fibroblast-derived induced pluripotent stem cells (iPSCs) were generated by expressing four
genes, Oct3/4, Sox2, c-Myc, and Klf4, in somatic cells
[34]
. Generation and usage of iPSCs
avoided the ethical concerns, simplified the application of stem cells, and made it possible to
generate patient-derived iPSC for research and therapeutic purposes
[33]
. Due to the
differentiation potential of iPSCs, iPSC-derived neurons can be generated as a cellular model for
NDDs and neuropsychiatric disorders
[35]
. For example, DNA methylation changes were
observed in iPSC-derived neurons compared to undifferentiated iPSC from patients with
Parkinson's disease
[36]
. Nonsynonymous mutations in the cation channel TRPC6 were found to
alter neural development, morphology, and function in iPSC-derived neurons from ASD patients.
[37]
. These studies indicate the potential of iPSCs and iPSC-derived neurons in neurogenetic
research. iPSC-derived neurons can recapitulate a single patient's genomic context, which can't
be emulated in animal experiments or bioinformatic mutation analysis.
The overall goal of this project was to clarify the mechanism altered by heterozygous truncating
mutations in SYNGAP1 in patients with complex brain disorders. We used iPSC and CRISPR-
Cas9 gene editing to correct truncating mutations in patient-derived iPSCs and then generated
their corresponding excitatory neurons from both patient and corrected iPSCs. SynGAP1
expression, electrical activity and spine morphology of these neurons were analyzed. Overall,
14

our results overall suggested that SynGAP1 inhibits the electrical activity and maturation of
neurons.

Materials and Methods
Isolation of peripheral blood mononuclear cells (PBMCs)
Blood samples were collected from patients with truncating mutations in SYNGAP1. 5 ml blood
sample and 5 ml sterile PBS were mixed in a 15 ml centrifuge tubes. This was slowly added on
top of 7.5 ml Ficoll in a 50 ml centrifuge tube ensuring no disruption to the surface of Ficoll
reagent. Samples were centrifuged at 800 g for 15 min, at RT. The 3rd layer, which contains the
mononuclear cells, was transferred to a new 15 ml centrifuge tube (Figure 2-1). 14 ml PBS was
added to the tube and then centrifuge at 700g for 5 min, at RT. PBS was aspirated and the cells
were resuspended in 3 ml of freezing medium (90% FBS, 10% DMSO). Cells were aliquoted to
cryovials and then cryopreserved until use.

Figure 2-1 PBMC Isolation from blood samples. Blood sample is mixed with an equal volume
of PBS and slowly added to ficoll. After centrifugation, PBMCs are located within the third layer
from bottom.
15

Generation of iPSC
Day 1:
We prepared 0.1 % gelatin 400 ml: 0.4 g gelatin dissolves in 400 ml autoclaved water and store
in 4 ℃.
MEF medium 20 ml: DMEM 17.8 ml, FBS 2 ml, P/S 200 μl, filter by 0.2 μm filter.
6-well plate was coated with 0.1 % gelatin (1 ml for each well) and put into incubator for 1 hour.
MEF cells were thawed in 37 ℃ and transferred to 15 ml centrifuge tube. 10 ml DMEM was
added slowly to the tube and it was invert, and centrifuged at 400 g for 5 min, in RT. Supernatant
was aspirated and precipitant was resuspended with 600 μl MEF medium. We Aspirated two of
coated wells and added 2 ml MEF medium for each. 100 μl MEF cells were added to each well.
6-well plate was put into incubator overnight. Rest of MEF cells were centrifuged, diluted with 1
ml freezing medium and stored in - 80 ℃.
Day 2:
We prepared IL-2 storage solution: we first spun down IL-2 powder (10 μg). Then we made 5 ml
PBS with 0.1 % BSA and diluted IL-2 in 100 μl. IL-2 was aliquoted to each tube for 5 μl and
stored in -80 ℃.
We added 0.6 μl IL-2 storage solution to 20 mL X-vivo and inverted them to mix. Two wells
containing MEF were aspirated and 3 ml mixed X-vivo was added in. The plate was put back
into the incubator. We took 20 μl Dynabeads in 1.5 ml tube and put it on magnet tube holder for
1 min. Supernatant was aspirated and 1 ml PBS was added. The tube was put back to holder and
we turned the tube to wash beads, staying for 2 min. After aspirating supernatant, we added 20 μl
16

mixed X-vivo to resuspend. Resuspended dynabeads were added to two wells, 5 μl for each. The
plate was incubated in incubator. We thawed PBMC in 37 ℃ and transferred PBMC to a 15 ml
centrifuge tube. 9 ml X-vivo was added slowly and it was spun at 400 g for 5 min, in RT. We
aspirated supernatant and resuspended with 1 ml X-vivo. 20 μl of cells was taken out and diluted
in 180 μl DMEM. 10 μl diluted cells were mixed with 10 μl Trypan Blue. And then we counted
cell number by hemocytometer. One million cells were added to a new 15 ml centrifuge tube and
spun at 400 g for 5 min in RT. Amaxa Nuclerfector was set up with program V-024 at the same
time. Supernatant was aspirated and 100 μl Necleoofector solution (Ingenio Kit), plus four
plasmids (pCXLE-hOCT3/4-shp53 0.83 μg, pCXLE-hSK 0.83 μg, pCXLE-hUL 0.83 μg,
pCXWB-EBNA1 0.5 μg) were mixed with cells quickly. We transferred cell and plasmid
suspension to transfection cuvette (Amaxa NHDF Nucleofector Kit). We electroporated cells
using Amaxa Nuclerfector by program V-024. Electroporated cells were added to two prepared
wells. The plate was put back to incubator and incubated for 2 days.
Day 4 and later:
We Prepared hES medium: 38.5 ml DMEM/F12, 10 ml Knockout Serine replacement
(supplement supporting the growth of stem cells, Gibco 10828028), 0.5 ml glutamax, NEAA, 0.5
ml P/S, 12.5 μl bFGF, 91 μl beta-mercaptoethanol.
3 ml hES medium and 1.5 μl ROCK inhibitor to each well. The plate was incubated in incubator
for two days. Cells were fed with hES medium every other day. We check cells every day till
MEF is exhausted. New MEF was thawed in 37 ℃, diluted in 5 ml DMEM and centrifuged at
400 g for 5 min in RT. MEF cells were then resuspended in 600 μl DMEM and 100 μl was added
to each well.
17

When iPSC colonies appeared, we coated each well of 24-well plate with 300 μl cold DMEM
diluted geltrex (1:200). The coated plate was incubated in 37 ℃ for one hour. We aspirated
coating solution and added 400 μl mTeSR with ROCK inhibitor (1: 4000) to each well. Colonies
were picked to 24-well plate, which was then put back to incubator overnight. We fed iPSC
colonies every day with 400 μl mTeSR. When iPSC colony was 40 % confluent, we coated a 6-
well plate with cold DMEM diluted geltrex (1:200), 1 ml for each well. The plate was incubated
in 37 ℃ for one hour. We aspirated coating solution and added 1.5 ml mTeSR + ROCK inhibitor
(1: 4000) for each well. The wells of 24-well plate were aspirated and 300 μl ReleSR was added
to react for 30 second. ReleSR was aspirated and we incubated the 24-well plate in 37 ℃ for 3
min. Cells was resuspended by 300 μl mTeSR + ROCK inhibitor (1: 4000) and transferred to 6-
well plate. The 6-well plate was incubated overnight. Medium was changed with 1.5 ml mTeSR
every day until cells are confluent. Confluent wells were aspirated and add 500 μl ReleSR to
react for 30 second. And then ReleSR was aspirated and we incubated the 6-well plate in 37 ℃
for 3 min. Cells were resuspended with 500 μl mTeSR and then mixed with 400 μl FBS and 100
DMSO in cryovial. vial stayed in -80 ℃ overnight and transferred to nitrogen tank.

CRISPR correction
Repair Template and Primers design:
gRNA was designed in https://benchling.com/academic. We set up length as 20 nt. gRNAs of
Patient #1, 2 and 3 were assembled with plasmid px459 2.0v; gRNA of Patient 4 is assembled
with plasmid pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA. Primers
for gRNA are showed in Table 1. Repair template including the mutation sites and PAM change
18

was designed (Table 1). Two wings of template are about 55 bp long. We changed PAM to make
sure that the gRNA would lose its function after modification without changing the translated
amino acid. We designed restriction enzyme that target mutation site for genotype (Table 1).,
PCR primers and sequencing primers for genotype (Table 1).
Cloning of constructs:
gRNA primers were phosphorylated and annealed as follow: mix 1 μl of primer (100 μM) for
each, 1 μl 10X T4 Ligation Buffer (NEB), 6.5 μl H2O, 0.5 μl T4 PNK. Anneal in a thermocycler
using the following parameters: 37 ℃ 30 min, 95 ℃ 5 min and then ramp down to 25 ℃ at 5 ℃
/min. Annealed solution was diluted for 250 fold. Digestion and ligation were set up as follow:
100 ng backbone vector, 2 μl diluted annealed solution, 2 μl FastDigest Buffer, 1 μl DTT, 1 μl
ATP, 1 μl FastDigest BbsI/BsaI, 0.5 μl T7 DNA ligase, fill H2O to 20 μl in total. Set up
thermocycler as follow: 37 ℃ for 5 min, 23 ℃ for 5 min, cycle last two steps for 6 times, hold in
4 ℃. Single use E. Coli (NEB 5-alpha kit) was put on ice for 10 min. Heater was set up to 42 C.
1 ml SOC medium (NEB 5-alpha kit) and three LB/agar plates (with ampicillin (100μg/ml))
were warmed up in RT. We transferred 2 μl of reacted mixture into E. Coli tube and flicked 6
times. Tube was placed on ice for 30 min. We heated shock E. Coli in 42 ℃ for 30 second and
returned it to ice for 5 min. 450 ml SOC medium was added to tube and the tube was incubated
at 225 rmp in 37 ℃ for one hour. We plated bacterial in LB/agar plates as 300 μl, 150 μl and 50
μl respectively. Plates were incubated in incubator for 18 hours. We made 6 culture tubes with 3
ml LB plus 3 μl ampicillin and used pipette tips to pick colonies. The tip was placed into
respective culture tubes. Plates were parafilmed and stored in 4 ℃. We placed the culture tubes
in a shaker at 37 ℃, 225 rpm for 16 hours. We used Zyppy Plasmid Miniprep Kit to extract
gRNA plasmid. gRNA plasmid was sent for sequencing to confirm the insertion of gRNA. 70 ml
19

LB + 70 μl ampicillin solution was added in a conical flask. We added 2 ml of cultured E. Coli to
flask and put flask into a shaker at 37 ℃, 225 rmp Staying overnight. Extraction of plasmid was
completed by ZymoPure II plasmid midiprep kit. The concentration of plasmid was measured
and gRNA plasmid was frozen in - 20 ℃.
Nucleofection:
Repair template was dissolved in 40 μl molecular water to make it to 0.1 nmol/μl. 100 μl
Necleoofector solution (Ingenio Kit) was warmed up in a 1.5 ml centrifuge tube. The confluent
iPSC well of 6-well plate was washed by 1 ml PBS, which was then replaced by 1 ml Accutase.
Cells were incubated with Accutase in incubator to react for 5 min. We prepared a new 15 ml
centrifuge tube with 5 ml DMEM. Accutase + cells suspension was added to DMEM and
Centrifuged at 400 g for 5 min in RT. We aspirate DMEM and resuspended cells with 500 μl
mTeSR. Cell number was counted and one million cells were added to a new 15 ml centrifuge
tube. We centrifuged these cells at 400 g for 5 min in RT. At the same time, three geltrex-coated
wells of 6-well plate were aspirated and added 1.5 ml mTeSR with 1: 4000 ROCK inhibitors for
each. Amaxa Nuclerfector was set up with program B-016. After centrifuge we aspirated
supernatant and added 100 μl Necleoofector solution (Ingenio Kit), 6 μg gRNA plasmid and 1 μl
repair template quickly. Suspension was transferred to transfection cuvette (Amaxa NHDF
Nucleofector Kit). Cells were Electroporated using Amaxa Nuclerfector by program B-016. We
added electroporated cells to two prepared wells. 0.2 million cells (without nucleofection) were
passaged to a prepared well as control. The plate was put back to incubator to stay overnight. We
changed medium to 2 ml mTeSR with puromycin to both nucleofected and passaged iPSC to
make puromycin final concentration to 0.3-0.7 μg/ml. Cells are incubated until all cells in control
20

well die. And then we changed the medium to normal mTeSR and feed cells with mTeSR every
day.
Genotype:
when single colonies appeared, we picked colonies to 24-well plate with mTeSR plus 1: 4000
ROCK inhibitors. At the same time we took a piece of colonies for genotype. For 5 μl of colony
samples, we added 10 μl Lysis Reagent and 0.2 μl Proteinase K. After vortex and spinning down,
we incubated samples in 55 ℃ for 50 min and then 85 ℃ for 30 min. PCR was done with
genotype primers using Q5 DNA polymerase. For each sample, 10 μl reaction system with 1 μl
digested colony was conducted. After PCR, we added 17 μl water, 3 μl cutsmart and 0.5 μl
restriction enzyme to PCR product. Reaction was last overnight at optimal temperature. We ran
digested products in a 2 % Agarose gel (1: 25, 000 Ethidium bromide) at 135 V for 35 min. The
positive results of genotype were recorded and kept. PCR and sequencing were done for these
positive colonies. If sequencing result showed that mutation site was corrected, we would save
these colonies. Colonies were fed with mTeSR every day until they were ready to passage to 6-
well plate. We fed passaged cells with mTeSR every day and when it was confluent, we froze
these cells with 500 μl mTeSR, 400 μl FBS and 100 μl DMSO in -80 ℃.
Immunofluorescence and Karyotype:
iPSC in 6-well plate was treated with 500 μl ReLeSR for 30 second. ReLeSR was then aspirated
and the plate was incubated in 37 ℃ for 3 min. We resuspended cells in 1 ml mTeSR and
passage iPSC 2 μl, 3 μl, 4 μl, 5 μl, 7 μl to different wells of 24-well plate respectively. At the
same time, 150 μl of cells was passaged to a cell culture flask. We fed 24-well plate and flask
every day with mTeSR. when flask was confluent, we sent the flask to CHLA Cytogenetics
21

Laboratory for karyotype. When the first well of 24-well plate was confluent, we chose two
wells that are closing to 50 % confluent and washed with 500 μl PBS. PBS was replaced with
400 μl 4 % PFA. The plate was stayed in dark at RT for 15 min. We washed the plate three times
with 400 μl PBS and added 0.5% PBST. The plate was parafilmed and kept overnight in 4 ℃.
We changed solution to 300 μl 0.1 % PBST/10 % FBS and incubated the plate in RT for one
hour. Solution was changed to 300 μl 0.1 % PBST/10 % FBS with Antibodies. We added Tra I
and Sox2 Antibody to one well and added Oct 4 and SSEA4 to another. The plate was
parafilmed and kept it in dark at 4 ℃ overnight. Wells were washed with 0.1 % PBST quickly
for 3 times. 300 μl secondary antibody solution was added and we kept the plate in RT for one
hour. At the same time, we made DAPI solution: DAPI 1:2000 in PBS. The plate was washed
with 0.1% PBST quickly for 3 times. 300 μl DAPI solution was added to react for 7 min. We
washed the plate with PBS 3 times, 5 min for each. 600 μl PBS was added to each well and we
parafilmed, wrapped and stored the plate at 4 ℃. Image was taken by fluorescence microscope.

Differentiation
Lentivirus Generation:
We seeded confluent HEK 293T cells two days before transfection. Cells must be 90 %
confluent for transfection. For a 10 cm dish, we mixed 67 μl PEI (1 mg/ml) to 1.33 ml opti-MEM
in a 50 ml centrifuge tube and stay for 5 min. 6.67 μg Ngn2/rtta Plasmid + pPAX2 + VSVG were
added and mixed. After 15 min and mixture was dropped to a 10 cm dish evenly. We rocked the
plate back and forth and put the dish into incubator and stay for 24 hours. Medium was replaced
with 6.5 ml DMEM + 10 % FBS +1 % P/S. After 24 hours the medium was harvested, and we
22

replaced with the same medium to incubate for another 24 hours. Harvested medium was stored
in 4 ℃. We did a second-round harvest and opened UV to clean dishes for 30 min. Harvested
medium was mixed and filtered through 0.45 μm syringe filter. We added 1/3 volume of Lenti-X
concentrator and mixed them by invert several times. Mixture was stored in 4 ℃ overnight and
centrifuged at 1500 g for 45 min in 4 ℃. Supernatant was discarded but remain about 200 μl. We
resuspend the pellet gently and aliquoted in vials. Vials were frozen at -80 ℃.
iPSC-induced neuron generation:
When iPSC in 6-well plate grew up to be confluent, we washed wells with PBS and react with 1
ml Accutase for 5 min in 37 ℃. After centrifuge and resuspending we counted cell number and
passaged 0.3 million cells to each well of 6-well plate. The plate was put back to incubator and
stayed overnight. We prepare transfection medium as following: for 10 ml mTeSR, add 5 μl
polybrene, 60 μl Ngn2 Lentivirus and 60 μl rtta Lentivirus. We mixed the medium and fed 1.5 ml
mTeSR to each well. Plates were put back to incubator and UV was opened to clean everything
in the hood. After 16 hours, medium was changed to normal mTeSR and we fed cells with
mTeSR every day. When Ngn2 iPSC became confluent, we put slips into 24-well plates. 24-well
plates ,6-well plates and 10 cm dishes were coated with geltrex for at least one hour. We
prepared N2+ROCK inhibitor medium as following: N2 supplement 500 μl, NEAA 500 μl,
DMEM/F-12 48 ml, P/S 500 μl, doxycycline 1 μl (1 μg/ml), BDNF 5 μl (10 μg/L), NT3 5 μl (10
μg/L), laminin 8.3 μl (0.2 μg/L), 12.5 μl ROCK inhibitor. We aspirated 24-well plates, 6-well
plates and dishes. We add 400 μl to each well of 24-well plates, 1.5 ml to each well of 6-well
plate and 7 ml to each dish. Ngn2 iPSC was counted and we added 15,000 cells to each well of
24-well plate, 0.2 million cells to each well of 6-well plate and 1.2 million cells to each dish.
Plates and dishes were put back to incubator and so differentiation started. Medium was changed
23

to N2 + puromycin (0.7 μg/ml) at the second day. Plates and dishes were stayed in incubator for
two days. We prepared B27 medium as following: B27 supplement 1ml, neurobasal 48 ml,
glutamax 0.5 ml, P/S 0.5 ml, doxycycline 1 μl (1 μg/ml), BDNF 5 μl (10 μg/L), NT3 5 μl (10
μg/L), laminin 8.3 μl (0.2 μg/L). Medium was changed to B27 medium and cells were kept
culture for one day. We washed Astrocytes in flask by PBS and added 1 ml Trypsin to incubate
for 5 min. Suspension was added to 5 ml DMEM in a 15 ml tube and centrifuged at 400 g, for 5
min, in RT. We aspirated supernatant and resuspended astrocytes by 600 μl DMEM. 10 μl
suspension was added to each well of 24-well plates. After one-day culture, medium was
changed to B27 + ara-c (2 μM) to keep for two days. We half fed cells with B27 medium every
other day until 13 days after differentiation. Medium was changed to B27 +FBS (2.5 %) and then
we half fed cells every week.

SynGAP Expression Analysis
Protein Extraction:
After 4 weeks of differentiation, neurons in 6-well plates were washed with PBS. We fill each
well with 500 μl PBS and Shook plate to peel off neuron. Neurons were transferred to a 1.5 ml
tube and then centrifuged at 400 g for 5 min in RT. PBS was aspirated. We prepared 5 ml lysis
solution as follow: milliQ water: 2500 μl, Tris (500mM, pH: 9): 500 μl, NaF (500 mM) 500 μl,
beta-glycerol phosphate (400mM) 500 μl, ZnCl2 (2,000uM) 50 μl, Na3VO4 250 μl, ROCHE
(dilute a pillar in 1 ml) 200 μl, 10% DOC 500 μl. We vortexed and added 120 μl lysis solution
for each tube. Samples were kept on ice. We Pipetted and vortexed every 8 min until 40 min.
These samples were centrifuged at 20,000 g for 35 min in 4 ℃. We collected supernatant to new
24

1.5 ml centrifuge tube and put them on ice. Protein concentration was measured by Pierce BCA
protein assay kit. We added 4X LDS sample buffer and DTT (1:50) to samples. Samples were
heated at 95 ℃ for 15 min to denature and then stored at -20 ℃.
Western Blot:
We prepared NuPage runing buffer 600 ml and thawed protein samples in 95 ℃ for 10 min. 15
μg of Samples were run in a 4-12% Bis-Tris gel for each lane. The gel was run in 135 V for 100
min. Transmembrane was done at 25 V 1 A for 60 min, using a PVDF membrane which is pre-
treated by 100% methanol for 30 second. 10 ml blocking buffer was made in 50 ml centrifuge
tube as following: 10 ml 0.05 % TBST dissolving 0.5 g BSA. The membrane was transferred to
50 ml centrifuge tube and incubated in a roller at RT for one hour. We prepared primary
antibody solution as following: 0.8 ml blocking buffer, 3.2 ml 0.05 % TBST, antibody.
Membrane was cut at certain molecular weight and incubated in different antibodies. We put
membrane back to roller and incubated the membrane at 4 ℃ overnight. Membrane was washed
with 0.05 % TBST for four times, 10 min for each. We made secondary antibody solution as
following: 1 % BSA, 0.05 % TBST and secondary antibody. Membrane was incubated in
secondary antibody for one hour in RT. We next washed membrane with 0.05 % TBST for three
times, 5 min for each. At the same time, we opened the camera. ECL kit was used to image
membrane. After image, membrane was stored in TBS at 4 ℃.

25

Electrical activity Analysis
Multi-electrode arrays (MEA) was bought from Multichannel Systems. For iPSC differentiated
in dishes, one day before puromycin treatment finish, we prepared MEA as following: Dilute
PLO to 50 μg/ml by cold autoclaved water; add 300 μl to each well of MEA; incubate two hours;
aspirate and wash with autoclaved water for three times; aspirate and place under UV overnight.
Laminin was dissolved in DMEM to 20 μg/ml and we dropped 5 μl exactly to the spot of sensor.
MEA was put in a dish with some water around and the dish was put into incubator for one hour.
Differentiated iPSC was washed with PBS and 3 ml Accutase was added to react in 37 ℃ for 5
min. Suspension was transferred to 7 ml DMEM in a 15 ml centrifuge tube and centrifuged at
400 g for 5 min in RT. We aspirated and resuspended cells in 100 μl B27 medium. Cell number
was counted, and we took 40,000 cells to a 1.5 ml centrifuge tube. The tube was centrifuged at
400 g for 5 min in RT. We aspirated and resuspended the cells with 5 μl B27. We took MEA out
and aspirated DMEM. 5 μl of cells was added on each coated site carefully to avoid touching the
sensor. MEA was put back to incubator for 1.5 hours. B27 was added to fill each well of MEA
and we put it back to incubator to stay overnight. Astrocytes was added at the second day and we
kept feeding for eight weeks after differentiation. The day before recording, media was replaced
with fresh B27 medium without FBS. The next day, neural activity was recorded using a
Multichannel Systems MEA 2100 multielectrode array amplifier with a stage heated to 37 C.
Neurons were allowed to acclimate for 5 min and then neural activity was recorded for 7 min.
All analysis of acquired data was completed using spike and burst detection modules in
MC_Rack software (Multichannel systems).

26

Spine and Morphology Analysis
Transfection:
For iPSC-induced neurons in 24-well plates, eight weeks after differentiation, we transfected
neurons using Lipofectamine LTX kit: medium was changed to non-P/S B27 medium with 2.5 %
FBS; Tube1 (per well of 24wp) was mixed as following: 25 μl opti MEM + 1.5 μl lipofectamine
LTX; Tube2 (per well of 24wp) was mixed as following: 25 μl opti MEM + 1 μg EGFP plasmid
+ 1 μl PLUS; After vortexing Tube1 and Tube 2, we mixed Tube1 and Tube2. The mixture was
stood for 15 min; 50 μl of mixture was transferred to each well of 24wp. We carefully mixed the
solution in the wells. Plates were put back into incubator and stayed overnight. Medium was
changed with B27 + 2.5 % FBS and neurons were cultured at least one more day.
Immunofluorescence and Spines Analysis:
We washed neurons with 500 μl PBS and added 400 μl 4 % PFA/ 4 % sucrose. The plate was
kept in dark at RT for 15 min and then washed three times with 400 μl PBS. We aspirated PBS
and added 0.2 % PBST for 15 min in RT in dark. Solution was changed to 300 μl 0.1 %
PBST/10 % FBS and plate was incubated in RT for one hour. We changed solution to 300 μl 0.1 %
PBST/10 % FBS with GFP antibody (1: 10,000). We parafilmed and kept it in dark at 4 ℃
overnight. Wells were washed with 0.1 % PBST quickly for 3 times. 300 μl secondary antibody
solution (secondary antibody 1: 500 in blocking solution) were added and stayed in RT for one
hour. We made DAPI solution: DAPI 1:2000 in PBS. Wells were washed with 0.1% PBST
quickly for 3 times. 300 μl DAPI solution was added and stayed for 7 min. We washed wells
with PBS 3 times, 5 min for each. 600 μl PBS was added to each well. Cover slides were wiped
with scan paper. We dropped two drops of mountant at slides. Stained slips were transferred to
27

slide and put the cell face to the slide. We removed the bubbles and kept them in RT, darkness,
overnight. Slips were cleaned with glass cleaner. We added insta-dri at the edge of slips and
cover the slide with labelled basal slide. Slides were kept in dark at 4 ℃. Image was taken in
confocal microscope for dendrite spine morphology. Spine data were collected and analyzed by
Imaris software.

Results
Generation of iPSC
Patient 1 (P#1) has a heterozygous mutation from Cytosine to Thymidine at exon 9 of the
SYNGAP1 gene which changes the translated amino acid from a Glutamine (Q) to a stop codon,
resulting in a truncation in SynGAP1 protein (Figure 3-1). Whole blood from P#1 was mixed
with Ficoll and centrifuged to obtain mononuclear cells. Mononuclear cells were reprogramed to
iPSCs by episomal expression of four iPSC transcriptional factors (Oct3/4, SOX2, Klf4 and L-
MYC) and three assistant factors EBNA1, LIN28 and p53 shRNA. (Figure 2-2) After 21 to 28
days, iPSC colonies were transferred to geltrex-coated tissue culture plates. To verify the
expression of pluripotent markers, we fixed, and stained these cells with antibodies against TRA-
1, SOX2, OCT4 and SSEA4. (Figure 4) The transcription factors, SOX2 and OCT4, showed
nuclear expression while TRA-1 and SSEA4 expressed on the surface of cells. These results
suggest colonies are undifferentiated iPSCs.

28

Figure 2-2 Timeline of iPSC generation. MEFs were plated on gelatin coated plates the day
before electroporation. PBMCs were electroporated with four transcriptional factors and three
assistant genes to induce reprograming. After 3-4 weeks, colonies were transferred to geltrex-
coated 24-well plates. Finally, iPSCs were expanded in 6-well plates and cryopreserved until
further experiments.

29

Figure 3-1 Schematic of CRISPR/Cas9 gene editing in Patient 1. Mutation in the RasGAP
domain leads to a pre-mature stop codon and results of a truncation of SynGAP1. We used the
CRISPR/Cas9 genome editing system including a gRNA and a repair template specific for the
mutation for correction by homology directed repair. Two nucleotides were changed: one is the
mutation site and one is the PAM. The former corrected nucleotide restores translation of
Glutamine. The latter is a silent mutation in the PAM. PAM change is necessary to stop repeat
cutting via Cas9 can lead to unwanted mutations.

30

Utilizing CRISPR/Cas9 to Correct Mutations
gRNA and repair template for CRISPR were designed as displayed in Table 1. PAM was
changed from C to T to stop repeated modification, but no amino acid was changed. (Figure 3-1)
Oligonucleotides containing the gRNA sequence were annealed, phosphorylated, and ligated into
the Cas9 plasmid, px459 V2.0 (selectable marker is puromycin). The newly constructed plasmid
was transformed to E. Coli for amplification. Successfully transformed colonies were amplified
to miniprep gRNA plasmid and the gRNA insertion was verified via Sanger sequencing. Repair
template was ordered from Integrated DNA Technologies. (Table 1) P#1 iPSC was transfected
with both gRNA and repair template by electroporation. iPSC colonies were picked up after
puromycin selection and genotyping was performed following colony lysis. We amplified a 310
bp long DNA segment including the mutation site via PCR. The PCR products of all colonies
were digested by restriction enzyme DrdI, which only targets and cuts the corrected site. Because
patient is haploinsufficient, P#1 cell line would show two bands: one complete mutated band and
one band digested from corrected allele. In contrast, corrected cell lines would show single band
because all alleles are digested (Figure 3-2). Sequencing results of these PCR products provided
further evidence of successful correction in iPSC colonies identified via restriction enzyme
digest. (Figure 3-2) Immunofluorescence was carried out for two corrected cell lines. (Figure 4)
P#1 iPSC and two corrected iPSC cell lines were shown to have normal karyotypes. (Figure 4)

31

Table 1 Patient 1 Primers and Restriction Enzyme Used for CRISPR and Genotyping
Name Patient 1
gRNA forward
primer
CACCGCCATACCAATGGCATCCTTG
gRNA reverse
primer
AAACCAAGGATGCCATTGGTATGGC
Repair Template CCGCGAGAACACGCTTGCCACTAAAGCCATAGAAGAGTATAT
GAGACTGATTGGTCAGAAATATCTCAAGGATGCCATTGGTAT
GGCCCACACTCAGGCCCTCTTCTTCCCAAACCTGCCA
PCR forward
primer
GTTAGTGAGGACAGGGCAAAT
PCR reverse primer AGCTTGATACTTCCTAACCCAG
Sequencing primer GTTCATGGAACGGGAGCA
Restriction enzyme Drd I

32

Figure 3-2 Genotyping of Patient 1 corrected cell line. (a) Gel image of Drd I digested PCR
products from different colonies. Corrected cell line has only one band at 207 bp. (b) Sanger
sequencing results of the corrected cell line. Mutation sites has been corrected to translate
Glutamine as normal.

33

Figure 4 Immunofluorescence and karyotype of Patient 1 and corrected cell lines. (a) Four
embryonic stem cell markers were used to identify P#1 and corrected iPSCs. For stem cells,
TRA-1 and SSEA4 are expressed on membrane; OCT4 and SOX2 are expressed in nucleus. (b)
Karyotype of P#1 and corrected cell lines.
34

Differentiation of iPSC-induced Neuron
Confluent iPSC was passaged to 6-well plates with mTeSR + ROCK inhibitor. After 18 to 24
hours, medium was changed to mTeSR + 10 μl Ngn2 and 10 μl rtTA lentivirus for each well.
Infection lasted for 16 hours and then medium was changed back to mTeSR. Infected Ngn2
iPSCs were cultured to confluency and then passaged to 24-well plates, 6-well plates and 10 cm
dishes with N2 medium supplemented with ROCK inhibitor and doxycycline to induced Ngn2
expression. Puromycin selection was started at the second day and lasted for two days. Following
puromycin selection, medium was changed to B27 medium and Astrocytes were added to 24-
well plates. Neurons were cultured for four weeks in 6-well plates and eight weeks in 24-well
plates. Neurons in dishes were passaged to MEAs following puromycin selection and electrical
activity was recorded at 8 weeks post differentiation. (Figure 5)
35

Figure 5 Timeline of iPSC differentiation. iPSCs were infected by lentiviruses encoding rtTA
and Ngn2. Ngn2 gene was not expressed until day 8 when we feed cells with N2 medium +
doxycycline. Doxycycline coeffects with rtTA to initiate the gene transcription of Ngn2, which
36

starts the neuron differentiation. We cultured induced neurons in 6-well plate without astrocytes
for four weeks. For cultures in MEAs and 24-well plates, we cultured for eight weeks with
astrocytes. Following maturation of neurons, experiments were conducted.

Expression of SynGAP1 is Recovered after CRISPR Correction
After four weeks culture, iPSC-induced neurons in 6-well plates were harvested, protein was
extracted and the concentration was measured. LDS sample buffer and DTT were added to
protein samples before denaturing. We loaded 15 μg protein in each lane for western blotting.
We used total SynGAP antibody that binds to sites approaching the C-terminal of SynGAP (exon
15). Here, the SynGAP protein with a truncation at exon 9 would not be detected if it were
present. Because SynGAP has multiple isoforms and the antibody used recognizes all these
isoforms, we don’t see a single band but a diffused signal around 130 kD. (Figure 6) We
generated three cell lines from P#1 iPSC through CRISPR. Two of them are corrected cell lines
and recovered expression of SynGAP protein can be visualized in Figure 6. Corrected # 1 has a
higher expression of SynGAP comparing to Correct # 2, which implies some differences
between even corrected cell lines. One of three cell lines is a knockout cell line and no SynGAP
protein was detected. We generated this knockout cell line randomly and this cell line was not
included in following experiments. There is a non-specific band located at 110 kD as no
SynGAP isoforms weighs 110 kD and this band is also observed in the knockout cell line. Beta-
tubulin was used as a loading control.

37

Figure 6 Western Blot of SynGAP1 from iPSC-derived neurons. iPSC induced neurons were
harvested four weeks after differentiation. Proteins were extracted and total protein concentration
was measured. We loaded 15 μg of protein for each lane and incubated with total SynGAP1
antibody or beta-tubulin as a loading control. All SynGAP1 isoforms are around 130-140 KDa.

Electrical activity recordings
One day after puromycin treatment, cells in 10 cm dishes were passaged to Microelectrode
Arrays (MEAs), a device containing microelectrode to detect neural signals. Astrocytes were
added to support neurons. And eight weeks after differentiation, electrical activity was recorded.
We allowed neurons to acclimate for 5 minutes before recording and then neural activity was
recorded for 7 minutes. We analyzed burst frequency, burst duration and spikes numbers. (Figure
7) Burst frequency and spikes numbers were increased in the patient cell line. This result is
consistent with SynGAP expression. SynGAP could decrease the insertion of AMPARs,
38

important neural transmission receptors, to the post-synaptic membrane, so higher expression of
SynGAP could result in less AMPARs in membrane
[21]
. Therefore, the electrical activity
decreased along with the decrease expression of AMPARs in the membrane. (Figure 7) There is
no significant difference between the mean burst duration in patient and corrected cell lines.

Figure 7 Schematic of SynGAP1 in AMPARs recycle and electrical activity of neurons. (a)
SynGAP1 protein inhibits the recycling of AMPARs, which decreases the amount of AMPARs
on the membrane. (b, c, d) Data of both Corrected cell lines were divided normalized to that of
patient cell line in the same MEA to remove the influence of background. Burst per minute
presents the number of burst per minutes. Burst Duration represents the average length of the
observed bursts in 7 minutes recording time period. Total Spike Number represents the number
of spikes in 7minute recording time period.
39

Spine Morphology Changes in corrected Cell Line
We transfected neurons in 24-well plates with a GFP plasmid via lipofectamine after eight-weeks
of differentiation. Neurons were then fixed and stained with an anti-GFP antibody. We imaged
these neurons via confocal microscopy and analyzed spine density, spine volume, and spine
shape using Imaris software. (Figure 8) Spine density and volume were increased in the patient
cell line, suggesting an inhibitory function of SynGAP1 protein in spine formation during early
development. Spine shape can be classified according to four categories: stubby, thin, mushroom
and branched
[38]
. We classified spines in three of these categories excluding branched because it
is identified by the number of heads, but the other three shapes are identified by the ratio of head
diameter to neck diameter or spine length to neck diameter. (Figure 8) Spines develop and
mature from stubby, to thin, and finally to mushroom shape
[39]
. From Figure 8 we can observe a
tendency of maturation delay; (e.g. more immature spines), in the corrected cell line, which also
suggests that SynGAP inhibits the maturation of neurons.
40

Figure 8 Schematic of spine categorization and spine analysis. (a) Considering the diameter
and length of spine, we can classify spines to three shapes: Stubby, Thin and Mushroom. L
represent the length of spine; dn represents the diameter of neck; dh represents the diameter of
head (Harris, 1992). Here, we defined: Stubby: L/dn <=2; Thin: L/dn > 5 and 2 > dh/dn > 1;
Mushroom: dh/dn >= 2. (b) The proportion of the three kinds of shapes in P#1 and Corrected cell
lines. (c) The spine volume in P#1 and Corrected cell lines. (d) The spine density (spines/ 10 μm)
in P#1 and Corrected cell lines.
Generation of Other Patient iPSC Cell Line
We generated three additional patient iPSC lines and one of their corrected iPSC cell lines in the
following experiments. Primers and restriction enzyme that were used are shown in Table 2.
41

Patient 2 (P#2) has a milder phenotype comparing to other patients carrying heterozygous
truncating mutations in SynGAP. In P#2, there is a deletion of adenine in exon 4. Patient 3 (P#3)
has a mutation from guanine to adenine in an intron before exon 17 which is believed to located
within an essential spice site. Patient 4 (P#4) has a deletion of thymine at exon 15 which also
results in a premature stop codon. (Table 3) We also performed genotyping and
immunofluorescence for these iPSC lines. (Figure 9) The results were able to show that the
generated iPSCs are pluripotent and mutation sites are corrected in patient 3.
Table 2 Patient 3 Primers and Restriction Enzyme Used for CRISPR and Genotyping
Name Patient 3
gRNA forward
primer
CACCGTACTCCTTCACCTGCCCGCT
gRNA reverse
primer
AAACAGCGGGCAGGTGAAGGAGTAC
Repair Template GGCTGGGTGGTGGGCTTGGGGTGGGGCGCCCCTCATAGTGCG
GGGTCGTGTGCCCGGCGGGCAGGTGAAGGAGTACGAGGAGG
AGATTCACTCACTGAAAGAGCGGCTGCA
PCR forward
primer
CACCATGGCAGGGTCTTCTC
PCR reverse primer GGAGCAGAGTGAGAAGAGGC
Sequencing primer GCCTCCGCTCATACTCTTCCAG
Restriction enzyme Hpa II

42

Table 3 SYNGAP1 Mutation Sites of in Patients
Wildtype Sequence Patient Sequence
Patient 2 CCCAGGG CCCGGG
Patient 3 CCCGGCG CCCAGCG
Patient 4 AGTTGAC AGTGAC

43

Figure 9 Genotyping and immunofluorescence of additional patient iPSCs. (a) Gel image of
Patient 3 corrected cell line PCR product digested by Hpa II. Because Hpa II only cuts the
corrected allele, patient cell line has a band at 350 bp but corrected cell line doesn’t. (b)
44

Immunofluorescence of pluripotency markers in Patient 2, Patient 3, Patient 3 corrected, Patient
4 iPSC cell lines.

Discussion and Conclusion
We generated four patient iPSCs and differentiated them to neurons, indicating our protocol is
feasible for the study of neurodevelopmental disease. In the past, a majority of studies
investigating neuro-related diseases were based on either animal models or cellular models
derived from rodents, models in which it may be difficult to recapitulate the developmental
phenotypes observed in patients. iPSCs from patient could solve these problems, because iPSCs
have the same genomic context as patients which eliminates these influences. In addition, iPSCs
can differentiate to specific neurons that play an important role in these diseases. In the neuronal
studies with SynGAP1 patients, we directly differentiated iPSCs to iNs. While some protocols
suggest the generation of neural progenitor cells (NPCs) before neuronal differentiation
[44, 45]
,
this method requires an increased amount of time and reagents. Therefore, inducing iPSC
directly to neurons, as mentioned in our protocol, is more practical and time-saving
CRISPR gene editing, in conjunction with iPSCs, presents several advantages for the research of
neurodevelopmental disease. iPSCs’ ability to quickly reproduce compensates for the low
efficiency of CRISPR gene editing in some special editing sites. It was reported that the
efficiency of Cas9-based gene editing for effective repair is only 0.5-20 %
[42]
. Aside from
precise repair via Homology Directed Repair (HDR), NHEJ (Non-homologous end joining) can
occur, which is how the KO cell line was generated. In our hands, the efficiency of HDR is
enough to obtain corrected colonies in one round of gene-editing. However, off target effects of
45

CRISPR has been a major concern for biological and clinical application
[43]
. In our research, we
did several measures to avoid off target effects in our experiments, including selecting the gRNA
with lowest chance of off target cutting and using a long repair template.
We analyzed the expression of SynGAP1 protein for both patient and corrected cell lines and
found the recovery of SynGAP1 expression in latter. This suggested the successful gene editing
and implied the role of SynGAP1 protein in NDDs. In the past studies, SynGAP1
happloinsuffient and knockout animal models have been used to explore the mechanism of
SynGAP1 in diseases
[21, 23, 29]
. They reported some important findings of SynGAP1, such as its
inhibitory function in the MAPK pathway, AMPAR trafficking and postsynaptic currents,
accelerated maturation of the excitatory synapse, and regulation of learning. However, few
researchers have utilized human iPSCs to study the SynGAP1 protein. Our research could
complement and promotion for their studies. Therefore, to reveal the SynGAP1 function in
human cells, we conducted experiments to measure neural electrical activity and spines. We
observed a significant change in electrical activity between patient and corrected cell lines.
Patient neurons showed a stronger electrical activity for both burst frequency and spike numbers.
This is consistent with experiments carried out in rodent models, which suggested that SynGAP1
inhibits the currents at the post-synaptic region. Once we found the function of synapse was
changed after correction, we measured the morphology of dendritic spines. Spine density and
volume decreased in corrected cell line, and more immature spines were observed in corrected
cell line. These results suggested patient neurons are more mature than corrected neurons, which
recapitulates what has previously been observed in rodent models.
To conclude, CRISPR-corrected iPSCs successfully differentiated to excitatory neurons and
compared to patient neurons, corrected neurons expressed more SynGAP1 protein, showed
46

higher burst frequency, higher spike numbers and more mature spines. SynGAP1 protein plays
an important role in synaptic function and development in patient neurons. We have three more
patient cell lines with different SynGAP mutations that will be corrected and differentiated to
neurons in the future. These results can further confirm our conclusion if they are consistent to
patient 1.

47

References
1. Stores, G. Multifactorial Influences, Including Comorbidities, Contributing to Sleep
Disturbance in Children with a Neurodevelopmental Disorder. CNS Neurosci. Ther. 22, 875–
879 (2016).
2. Neurodevelopmental Disorders. in Diagnostic and Statistical Manual of Mental Disorders
(American Psychiatric Association, 2013). doi:10.1176/appi.books.9780890425596.dsm01
3. Ahn, S. & Hwang, S. Cognitive rehabilitation with neurodevelopmental disorder: A
systematic review. NeuroRehabilitation 41, 707–719 (2017).
4. Griffin, M. M., Burke, M. M. & Hodapp, R. M. Intellectual Disabilities. in Encyclopedia of
Human Behavior: Second Edition 444–451 (John Wiley & Sons, Ltd, 2012).
doi:10.1016/B978-0-12-375000-6.00232-9
5. Ropers, H. H. Genetics of Early Onset Cognitive Impairment. Annu. Rev. Genomics Hum.
Genet. 11, 161–187 (2010).
6. Redon, R. et al. Global variation in copy number in the human genome. Nature 444, 444–54
(2006).
7. Cook, E. H. & Scherer, S. W. Copy-number variations associated with neuropsychiatric
conditions. Nature 455, 919–923 (2008).
8. Brugha, T. S. et al. Epidemiology of autism spectrum disorders in adults in the community in
England. Arch. Gen. Psychiatry 68, 459–466 (2011).
48

9. Smoller, J. W. et al. Identification of risk loci with shared effects on five major psychiatric
disorders: A genome-wide analysis. Lancet 381, 1371–1379 (2013).
10. Grove, J. et al. Identification of common genetic risk variants for autism spectrum disorder.
Nat. Genet. 51, 431–444 (2019).
11. Bolton, P. F. et al. Epilepsy in autism: Features and correlates. Br. J. Psychiatry 198, 289–
294 (2011).
12. Monteiro, G. C., Aroca, I. L. Z., Margarit, B. P. & Herá n, I. S. Epilepsy. Med. 12, 4222–
4231 (2019).
13. Oliva, M., Berkovic, S. F. & Petrou, S. Sodium channels and the neurobiology of epilepsy.
Epilepsia 53, 1849–1859 (2012).
14. Hirose, S., Mitsudome, A., Okada, M. & Kaneko, S. Genetics of Idiopathic Epilepsies.
Epilepsia 46, 38–43 (2005).
15. Chen, H. J., Rojas-Soto, M., Oguni, A. & Kennedy, M. B. A synaptic Ras-GTPase activating
protein (p135 SynGAP) inhibited by CaM kinase II. Neuron 20, 895–904 (1998).
16. Sheng, M. & Hoogenraad, C. C. The Postsynaptic Architecture of Excitatory Synapses: A
More Quantitative View. Annu. Rev. Biochem. 76, 823–847 (2007).
17. Li, W. et al. Characterization of a Novel synGAP Isoform, synGAP-β. J. Biol. Chem. 276,
21417–21424 (2001).
18. Moon, I. S., Sakagami, H., Nakayama, J. & Suzuki, T. Differential distribution of synGAPα1
and synGAPβ isoforms in rat neurons. Brain Res. 1241, 62–75 (2008).
49

19. LEMMON, M. A. & FERGUSON, K. M. Signal-dependent membrane targeting by
pleckstrin homology (PH) domains. Biochem. J. 350, 1–18 (2015).
20. Pena, V. et al. The C2 domain of SynGAP is essential for stimulation of the Rap GTPase
reaction. EMBO Rep. 9, 350–355 (2008).
21. Rumbaugh, G., Adams, J. P., Kim, J. H. & Huganir, R. L. SynGAP regulates synaptic
strength and mitogen-activated protein kinases in cultured neurons. Proc. Natl. Acad. Sci.
103, 4344–4351 (2006).
22. Kim, J. H., Liao, D., Lau, L. F. & Huganir, R. L. SynGAP: A synaptic RasGAP that
associates with the PSD-95/SAP90 protein family. Neuron 20, 683–691 (1998).
23. Komiyama, N. H. et al. SynGAP regulates ERK/MAPK signaling, synaptic plasticity, and
learning in the complex with postsynaptic density 95 and NMDA receptor. The Journal of
neuroscience: the official journal of the Society for Neuroscience 22, 9721-32 (2002)
24. Hamdan, F. F. et al. Mutations in SYNGAP1 in Autosomal Nonsyndromic Mental
Retardation. N. Engl. J. Med. 360, 599–605 (2009).
25. Fitzgerald, T. W. et al. Large-scale discovery of novel genetic causes of developmental
disorders. Nature 519, 223–228 (2015).
26. Carvill, G. L. et al. Targeted resequencing in epileptic encephalopathies identifies de novo
mutations in CHD2 and SYNGAP1. Nat. Genet. 45, 825–830 (2013).
50

27. Aceti, M. et al. Syngap1 haploinsufficiency damages a postnatal critical period of pyramidal
cell structural maturation linked to cortical circuit assembly. Biol. Psychiatry 77, 805–815
(2015).
28. Kilinc, M. et al. Species-conserved SYNGAP1 phenotypes associated with
neurodevelopmental disorders. Molecular and Cellular Neuroscience 91, 140–150 (2018).
29. Clement, J. P., Ozkan, E. D., Aceti, M., Miller, C. A. & Rumbaugh, G. SYNGAP1 Links the
Maturation Rate of Excitatory Synapses to the Duration of Critical-Period Synaptic Plasticity.
J. Neurosci. 33, 10447–10452 (2013).
30. Kim, J. H., Lee, H.-K., Takamiya, K. & Huganir, R. L. The role of synaptic GTPase-
activating protein in neuronal development and synaptic plasticity. J. Neurosci. 23, 1119–24
(2003).
31. Mignot, C. et al. Genetic and neurodevelopmental spectrum of SYNGAP1-associated
intellectual disability and epilepsy. J. Med. Genet. 53, 511–522 (2016).
32. Kolios, G. & Moodley, Y. Introduction to stem cells and regenerative medicine. Respiration
85, 3–10 (2012).
33. de Miguel, M. P., Fuentes-Juliá n, S. & Alcaina, Y. Pluripotent Stem Cells: Origin,
Maintenance and Induction. Stem Cell Reviews and Reports 6, 633–649 (2010).
34. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic
and adult fibroblast cultures by defined factors. Cell 126, 663–76 (2006).
51

35. McKinney, C. E. Using induced pluripotent stem cells derived neurons to model brain
diseases. Neural Regeneration Research 12, 1062–1067 (2017).
36. Fernandez-Santiago, R. et al. Aberrant epigenome in iPSC-derived dopaminergic neurons
from Parkinson’s disease patients. EMBO Mol. Med. 7, 1529–1546 (2015).
37. Griesi-Oliveira, K. et al. Modeling non-syndromic autism and the impact of TRPC6
disruption in human neurons. Mol. Psychiatry 20, 1350–1365 (2015).
38. Harris, K., Jensen, F. & Tsao, B. Three-dimensional structure of dendritic spines and
synapses in rat hippocampus (CA1) at postnatal day 15 and adult ages: implications for the
maturation of synaptic physiology and long-term potentiation [published erratum appears in J
Neurosci 1992 Aug;1. J. Neurosci. 12, 2685–2705 (2018).
39. Feldman, D. E. Developmental synaptic plasticity: LTP, LTD, and synapse formation and
elimination. in Encyclopedia of Neuroscience 495–501 (Academic Press, 2010).
doi:10.1016/B978-008045046-9.00348-X
40. TCW, J. Human iPSC application in Alzheimer’s disease and Tau-related neurodegenerative
diseases. Neuroscience Letters 699, 31–40 (2019).
41. Xiao, B., Hui Ng, H., Takahashi, R. & Tan, E. K. Induced pluripotent stem cells in
Parkinson’s disease: Scientific and clinical challenges. Journal of Neurology, Neurosurgery
and Psychiatry 87, 697–702 (2016).
42. Lino, C. A., Harper, J. C., Carney, J. P. & Timlin, J. A. Delivering crispr: A review of the
challenges and approaches. Drug Delivery 25, 1234–1257 (2018).
52

43. Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S. & Yang, S. H. Off-target effects in
CRISPR/Cas9-mediated genome engineering. Molecular Therapy - Nucleic Acids 4, e264
(2015).
44. Brennand, K. J. et al. Modelling schizophrenia using human induced pluripotent stem cells.
Nature 473, 221–225 (2011).
45. Ho, S. M. et al. Rapid Ngn2-induction of excitatory neurons from hiPSC-derived neural
progenitor cells. Methods 101, 113–124 (2016).

Abstract (if available)

Abstract The synaptic Ras-GTPase activating protein, SynGAP1, is one of the most abundant proteins at the postsynaptic site of excitatory neurons. SynGAP1 plays a critical role in the organization of a complex protein-protein interaction networks at the synapse with a profound impact on the scaffolding and structural functions that shape dendritic spines and synaptic activity. De novo mutations in SYNGAP1 gene are autosomal dominant, highly prevalent in intellectual disability and have been associated with developmental diseases including autism spectrum disorders. Mouse models have showed that mutations in SYNGAP1 alter neuronal morphology and synaptic function. However, the role and mechanisms altered by mutations present in human neurons remains to be explored. To study the mechanism altered by mutations in SYNGAP1 in patients, we generated Induced pluripotent stem cells (iPSCs) from haploinsufficient patient samples (+/-) and differentiated iPSCs to induced excitatory neurons (iNs). Mutation-corrected cell lines (+/+) were generated by CRISPR-Cas9 and differentiated to iNs. We analyzed the expression of SynGAP1 protein, the morphology and electrical activity from patient and control cell lines. Expression of SynGAP1 protein is restored in CRISPR-corrected neurons and used as isogenic iN controls. Patient derived neurons present abnormal dendritic spines morphology together with alterations in bursts and spikes frequencies in multielectrode array recordings. Here we show that the study of patient-derived neurons can be used to study the role of mutations in components of the postsynaptic synapse and help to understand their role in neurodevelopmental disease.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Elucidating neurodevelopmental consequences of syngap1 mutations and inactivated functional regions in human iPSC-derived neurons

PDF

The autism-associated gene SYNGAP1 regulates human cortical neurogenesis

PDF

An induced neuron cell model derived from human olfactory epithelial cells

PDF

Derivation, expansion and characterization of human hippocampal primordial cells from normal and diseased iPSCs

PDF

Signaling networks in complex brain disorders

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

The splicing error of FOXP1 in type I myotonic dystrophy

Asset Metadata

Creator Xu, Jiazhen (author)

Core Title Modeling SynGAP1 truncating mutations in neurodevelopmental disease using iPSC-derived neurons

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Publication Date 07/23/2020

Defense Date 07/04/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag CRISPR-Cas9,iPSC,neurodevelopmental disease,OAI-PMH Harvest,SynGAP1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Yuan, Weiming (committee chair), Bonnin, Alexandre (committee member), Coba, Marcelo (committee member), Schonthal, Axel (committee member)

Creator Email jiazhen5x@gmail.com,jiazhenx@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-193473

Unique identifier UC11663341

Identifier etd-XuJiazhen-7600.pdf (filename),usctheses-c89-193473 (legacy record id)

Legacy Identifier etd-XuJiazhen-7600-0.pdf

Dmrecord 193473

Document Type Thesis

Format application/pdf (imt)

Rights Xu, Jiazhen

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA