University of Southern California Dissertations and Theses

Antibiotic immunomodulation in Staphylococcus aureus bloodstream infection

(USC Thesis Other)

Antibiotic immunomodulation in Staphylococcus aureus bloodstream infection

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Antibiotic Immunomodulation in Staphylococcus aureus
Bloodstream Infection

by
Marquerita Algorri

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
CLINICAL AND EXPERIMENTAL THERAPEUTICS

August 2020

Copyright 2020 Marquerita Algorri
ii
Acknowledgements

I owe my sincerest gratitude and thanks to Dr. Annie Wong-Beringer for her ongoing support,
patience, mentorship, insights, and encouragement throughout my graduate educational journey.
I greatly appreciate the opportunity to work in her laboratory and engage in a variety of novel
explorations in infectious disease and pathogen-host interactions. I have experienced tremendous
personal, professional, and academic growth under her tutelage.

I sincerely thank my dissertation committee members, Dr. Paul Beringer and Dr. Jianming Xie
for their constructive feedback and continuous support throughout my doctoral studies.

I would also like to thank the members of the Wong-Beringer & Beringer lab: Dr. Karen Tan, A
Young Jenny Park, Dr. Corey Kelsom, Michelle Kalu, Mansour Dughbaj, Fatimah Alhurayri,
and (former member) Dr. Jordanna Jayne. Thank you for your friendship, experimental and
scientific guidance, and encouragement throughout this entire journey.

I also wish to thank my family as well as my friends on both coasts for always encouraging me
to chase my dreams and achieve my goals. My mom and stepdad, Maria Algorri and Tom
Sickler, deserve special recognition for believing in me. Importantly, my long-term partner,
Adam Hrenko, has been a constant, unconditional, and understanding source of support and
encouragement throughout my educational and professional journey.

iii
Table of Contents
Acknowledgements ......................................................................................................................... ii
List of Tables .................................................................................................................................. v
List of Figures ................................................................................................................................ vi
List of Abbreviations .................................................................................................................... vii
Abstract .......................................................................................................................................... ix
Preface ............................................................................................................................................ xi
Chapter 1: Background and Significance. ...................................................................................... 1
Introduction. ................................................................................................................................ 1
Sepsis – Evolving Definitions & Epidemiology. ........................................................................ 2
Sepsis Immunoparalysis. ............................................................................................................. 7
S. aureus Bacteremia as an Important Cause of Sepsis. ........................................................... 10
Host Immune Perturbations in S. aureus Bacteremia. .............................................................. 13
S. aureus Virulence Factors Impact Host Immune Response. .................................................. 16
S. aureus Lipoteichoic acid (LTA) & Host Immune Response ................................................ 18
Antibiotics as Modulators of LTA Release. ............................................................................. 23
Direct Immunomodulatory Effects of Antibiotics. ................................................................... 25
Summary ................................................................................................................................... 27
Chapter 2 - Correlation of the Variable Release of Lipoteichoic Acid from S. aureus
Bloodstream Isolates With Different Clinical Phenotypes and Whole Genome Analysis ........... 30
Materials & Methods. ............................................................................................................... 33
Results. ...................................................................................................................................... 39
Discussion ................................................................................................................................. 53
Supplementary Data .................................................................................................................. 57
Chapter 3: Differential effects of antibiotics on neutrophil activation against S. aureus ex vivo. 69
Materials & Methods. ............................................................................................................... 71
Results ....................................................................................................................................... 74
Discussion ................................................................................................................................. 81
Chapter 4: Antibiotics Differentially Modulate LTA-mediated Host Immune Response to ........ 85
Staphylococcus aureus in Human PBMCs. .................................................................................. 85
Materials & Methods. ............................................................................................................... 88
Results ....................................................................................................................................... 91
Discussion ................................................................................................................................. 98
Chapter 5: Summary & Future Directions. ................................................................................. 104
Future Directions .................................................................................................................... 108
iv
References. .................................................................................................................................. 111

v
List of Tables

Table 1 Selected SAB bloodstream isolates with associated clinical characteristics of the infected
patients. ......................................................................................................................................... 34
Table 2 ST-specific genetic variations within the LTA biosynthesis, modification, and export
pathways in relation to vancomycin-induced LTA release. .......................................................... 47
Table 3 Genetic Differences Between ST8 Strains: USA300 vs LA82. ....................................... 49
Table 4 Genetic Differences Between ST8 Strains: USA300 vs HH131. .................................... 50
Table 5 Comparison of Virulence-encoding genes across strains ................................................ 53
Table 6 Characterization of genetic variations across strains ....................................................... 59
Table 7 Virulence genes present in all selected strains ................................................................. 68

vi

List of Figures

Chapter 1
Figure 1. Theory of Dysregulated Host Immune Response in Sepsis. ........................................... 9
Figure 2. Gram positive cell wall structure. .................................................................................. 23

Chapter 2
Figure 3 LTA Release from S. aureus Bacteremia (SAB) Isolates. .............................................. 41
Figure 4 Differential LTA release upon antibiotic exposure. ....................................................... 43

Chapter 3
Figure 5 Effects of high (10 μg) and low (1 μg) level of LTA and antibiotics on CD11b (A) and
CD62L expression (B) in human neutrophils isolated from healthy volunteers. ......................... 76
Figure 6 Effects of high (10 μg) and low (1 μg) levels of LTA and antibiotics on phagocytosis
(A) and TLR-2 expression (B) in human neutrophils isolated from healthy volunteers .............. 77
Figure 7 Effects of high (10 μg) and low (1 μg) levels of LTA and antibiotics on PMN lifespan
(A) and survival (B) in human neutrophils isolated from healthy volunteers. ............................. 79
Figure 8 Effects of high (10 μg) and low (1 μg) concentrations of LTA and antibiotics on
production of CXCL8 in human neutrophils isolated from healthy volunteers. ........................... 81

Chapter 4
Figure 9 Effects of high (10 μg/ml) and low (1 μg/ml) exposure levels of purified S. aureus LTA
on THP-1 Monocytes. ................................................................................................................... 92
Figure 10 Expression of select immune markers in THP-1 monocytes exposed to antibiotics and
10 μg/ml (high) (A, B, C, D, E, F) and 1 μg/ml (low) (G, H, I, J, K, L) purified S. aureus LTA. 94
Figure 11 Effects of high (10 μg/ml) and low (1 μg/ml) exposure levels of purified S. aureus
LTA on (A) IL-10, (B) PD-L1, (C) TNFα, and (D) HLA-DR expression in human PBMCs ...... 96
Figure 12 Expression of select immune markers in human PBMCs (n=4) exposed to antibiotics
and 10 μg/ml (high) (A, B, C, D) or 1 μg/ml (low) (E, F, G, H) purified S. aureus LTA. ........... 98

vii
List of Abbreviations

Abbreviation Definition
ABX Antibiotics
AUC/MIC Area under the curve / minimum inhibitory concentration
ANOVA Analysis of Variance
CD11b Integrin alpha M
CD62L L-selectin
CFT Ceftaroline
CFU Colony forming units
CXCL8 Interleukin-8
DAP Daptomycin
DltA d-Alanyl carrier protein ligase
DltD d-Alanyl transfer protein
ELISA Enzyme linked immunosorbent assay
FBS Fetal bovine serum
HLA Alpha hemolysin
HLA-DR Human leukocyte antigen, DR-isotype
HRP Horse radish peroxidase
ICU Intensive care unit
IFNγ Interferon gamma
IgG Immunoglobulin G
IL-1β Interleukin 1-beta
IL-10 Interleukin 10
IL-13 Interleukin 13
IL-17 Interleukin 17
IL-4 Interleukin 4
IL-5 Interleukin 5
IL-6 Interleukin 6
LPS Lipopolysaccharide
LTA Lipoteichoic acid
ltaS Lipoteichoic acid synthase
MHC Major histocompatibility complex
MIC Minimum inhibitory concentration
MLST Multilocus sequence typing
MRSA Methicillin resistant Staphylococcus aureus
MSSA Methicillin susceptible Staphylococcus aureus
NA No antibiotic
NF-κB Nuclear factor kappa B
PAMP Pathogen associated molecular pattern
PBMC Peripheral blood mononuclear cell
PBS Phosphate buffered saline
PGP Polyglycerol phosphate
PD-1 Programmed cell death receptor
PD-L1 Programmed cell death ligand 1
viii
PMN Polymorphonuclear leukocyte (Neutrophil)
PRR Pattern recognition receptor
PSM Phenol soluble modulin
PVL Panton-Valentine leukocidin
SAB Staphylococcus aureus bacteremia
SEA Staphylococcal enterotoxin A
SIRS Systemic inflammatory response syndrome
Spa Staphylococcal protein A
ST Sequence type
TED Tedizolid
Th1 Type 1 T helper cells
Th2 Type 2 T helper cells
Th17 Type 17 T helper cells
TLR2 Toll-like receptor 2
TNFα Tumor necrosis factor alpha
Treg T regulatory cell
TSB Tryptic soy broth
TSST-1 Toxic shock syndrome toxin 1
VAN Vancomycin
WGS Whole genome sequencing
WTA Wall teichoic acid
ypfP Processive diacylglycerol beta-glucosyltransferase

ix
Abstract

Staphylococcus aureus is an important cause of bloodstream infections and sepsis in the
United States. Sepsis occurs when the immune response to infection is dysregulated, and
frequently presents with protracted anti-inflammatory responses that preclude bacterial clearance
and are associated with mortality. Similar findings with respect to anti-inflammatory
mechanisms have been reported in cases of persistent S. aureus bacteremia (SAB), as evidenced
by an elevated ratio of IL-10/TNFα. Persistent SAB develops in 1 out of every 3 patients and is
associated with an increased risk of mortality and metastatic complications. Antibiotics are the
primary treatment for SAB and bacterial sepsis, however, despite showing in vitro susceptibility,
administration of antibiotic therapy can fail to result in timely infection clearance. This is likely
due to a combination of factors that encompass the interactions between the host, microbial, and
antibiotic. Accordingly, there is an unmet need for innovative therapies to address immune
dysfunction in sepsis, and similarly, there is no standard therapy for patients who develop
persistent SAB.
In this thesis, we propose using antibiotics, which have known immunomodulatory
properties, to alter the balance of host immune response to favor the host. We examine both the
direct immunomodulatory effects of antibiotics by examining their effects on host immune cells,
as well as the indirect immunomodulatory effects, by manipulating the release of lipoteichoic
acid (LTA), an inflammatory component of the gram-positive bacterial cell wall that is present in
all strains.
We found that antibiotics have both indirect and direct immunomodulatory effects on
different populations of immune cells. We also showed that clinical SAB strains release variable
amounts of LTA from their cell wall, which may attribute to the heterogeneous outcomes
x
observed in SAB patients. Notably, patients who experienced persistence and/or died were
infected with low LTA releasing strains. We demonstrated that antibiotics can increase release of
LTA from the S. aureus cell wall, and that the effects are dependent on genetic background of
the infecting strain (e.g. lineage). In addition, we showed that in the presence of purified LTA,
antibiotics can differentially influence the host response of human neutrophils and peripheral
blood mononuclear cells (PBMCs). Some antibiotics trended towards anti-inflammatory effects,
whereas others demonstrated immunoactivating potential. The data indicates that antibiotics
present a potential therapeutic approach for modulating the host immune response, which would
be of interest particularly for patients exhibiting a dysregulated response to infection. The
findings also suggest that in addition to microbial susceptibility data, the host immune response,
as well as the release of microbial factors, should be taken into account when selecting
antibiotics therapies for the treatment of SAB.

xi
Preface

The aim of this dissertation is to characterize the immunoactivating potential of antimicrobial
agents in modulating S. aureus LTA-mediated host response and patient outcome to lay the
framework for establishing a personalized medicine approach to infectious disease therapy, with
particular emphasis on persistent S. aureus bacteremia (SAB). We demonstrated that clinical
isolates obtained from SAB patients release different quantities of LTA from their cell walls, an
effect that is enhanced by anti-staphylococcal antibiotics based on strain genetic background.
Based on this finding, we hypothesized that antibiotics from different pharmacologic classes may
also act directly as immunomodulators in the presence of LTA. Our results support the ability of
antibiotics, particularly vancomycin and ceftaroline, to influence inflammatory processes in
human immune cells in the presence of LTA. Ultimately, this work develops a framework
towards encompassing both host and microbial factors in the selection of antimicrobial therapies
to promote expedient bacterial clearance

This thesis is based on the following manuscripts.

1. Algorri, M. and Wong-Beringer A. Correlation of the Variable Release of Lipoteichoic
Acid from S. aureus Bloodstream Isolates with Different Clinical Phenotypes and Whole
Genome Analysis (In preparation).
2. Algorri, M. and Wong-Beringer A. Differential Effects of Antibiotics on Neutrophil
Activation Against S. aureus ex vivo. Ann Clin Microbiol Antimicrob. April 2020, Under
Review.
3. Algorri, M. and Wong-Beringer A. Antibiotics Differentially Modulate LTA-mediated
Host Immune Response to S. aureus. Med Microbiol Immunol. April 2020, Under
Review.

1
Chapter 1: Background and Significance.

Introduction.

Staphylococcus aureus is the most common bacterial cause of sepsis in ICU patients (1). Despite
receipt of standard antibiotic therapy, one in three patients diagnosed with S. aureus bacteremia
(SAB) will experience persistent growth of bacteria in the blood beyond 7 days and is at
significant risk for metastatic complications, relapse, and death (2). Recent advances recognize
sepsis as a dynamic process marked by a dysregulated pro-inflammatory and anti-inflammatory
host immune response after infection and highlight the heterogeneity in the host immune
response (3, 4). A subset of patients develops immunoparalysis resulting in persistence of
primary infection and development of secondary infections leading to >70% of sepsis-related
deaths (5). This hypoimmune state is characterized by a predominance of the anti-inflammatory
cytokine interleukin-10 (IL-10), downregulation of expression of cell surface markers showing
reduced antigen presenting capacity, such as human leukocyte antigen-D related (HLA-DR),
inhibition of T cell activation as indicated by increased expression of programmed cell death
ligand 1 (PD-L1), induction of apoptosis, and impaired neutrophil phagocytosis (5).

Parallel to the observations in patients with sepsis-induced immunoparalysis, our group
discovered, in the largest cohort of patients with SAB, that a dysregulated cytokine response
predominated by anti-inflammatory cytokine phenotype (high IL-10/TNFα ratio) early during
infection is strongly predictive of persistence and death (6). Bacterial pathogens have developed
diverse strategies utilizing toxins or other microbial factors to subvert and evade host innate and
adaptive immune response to ensure their survival (7, 8). Whereas S. aureus contains an arsenal
of diverse virulence factors, some factors are be differentially expressed between strains of
2
different genetic backgrounds (9). Accordingly, a ubiquitous microbial target is desirable for the
development of targeted therapeutic strategies. Of interest, S. aureus contains lipoteichoic acid
(LTA), an immunomodulatory cell wall component that is present in all S. aureus strains. LTA is
released spontaneously from the bacterial cell wall, but it can be further induced or suppressed
following antibiotic exposure, creating an opportunity for leveraging the use of antibiotics for
controlling bacterial virulence through LTA (10, 11).

Precision medicine’s individualized and molecular approach to oncology has provided a strong
framework for adopting this strategy in the management of infectious diseases (12). However,
current clinical practice does not include the assessment of an individual patient’s immune
response during sepsis, and therapy remains non-specific other than to target the causative
pathogens with antibiotics. Data from our lab and others have shown that anti-staphylococcal
agents exert varying immunomodulatory and antivirulent activities in addition to their direct
effect upon bacterial growth inhibition (13-15). These findings underscore the need for a deeper
understanding of the molecular alterations that underlie immunoparalysis during SAB and the
immunomodulatory potential of antibiotic agents. Thus, we hypothesized that strain-specific
microbial factors of S. aureus can alter host immune response by inducing an immunoparalysis
state that favors its persistence in bloodstream infection, which can be ameliorated by harnessing
the immunoactivating potential of antibiotic agents commonly prescribed against S. aureus
infections.

Sepsis – Evolving Definitions & Epidemiology.

Sepsis is a complex, life-threatening syndrome characterized by a dysregulated immune response
to infection. Its varied signs and symptoms can include altered mental status, hypotension,
3
tachycardia, tachypnoea, fever, and organ dysfunction (16). Sepsis is the most common cause of
infectious disease-related mortality (17). In 2017, 48.9 million cases of sepsis were reported
globally, resulting in 11 million deaths, illustrating that sepsis presents a significant threat to
public health (18). In the United States, the incidence of sepsis is estimated to be 1.7 million
cases, causing more than 250,000 deaths annually (19, 20). Despite improvements in supportive
care treatments and interventions, approximately 30% of patients who develop sepsis will
experience mortality (21). Accordingly, sepsis is the most common cause of death in the
intensive care unit (ICU), accounting for 1 in 3 of all deaths that occur in a hospital (22). This
indicates that current treatments are insufficient for addressing and correcting the causative
factors driving sepsis.

Though the clinical manifestations of sepsis have been described since antiquity, with historical
records dating back to 1,000 B.C., its etiology and treatment remain poorly understood (16, 23).
In 1991, a consensus definition of sepsis as a systemic inflammatory response syndrome (SIRS)
was established by an expert review panel. This definition considered sepsis to be the result of
excess production of pro-inflammatory mediators and cytokines (24). An accompanying set of
SIRS criteria were determined, which included altered patient body temperature (<35°C or
>38.5°C), increased heart rate, increased respiratory rate, and elevated white blood cell count, of
which a patient must meet two or more of the established cut-offs. However, these parameters
are not sensitive enough for discriminating sepsis from non-infectious inflammation caused by
trauma, burns, or severe stress and several studies have demonstrated that up to 90% of ICU
patients met at least 2 SIRS criteria, even in the absence of infection (17, 23, 25).

4
In 2016, an expert task force comprised of the European Society of Intensive Care Medicine and
the Society of Critical Care Medicine recognized the need to refine and clarify sepsis definitions
to better differentiate sepsis from nonseptic infection and to incorporate updated findings in
sepsis pathogenesis into the definition. While animal and in vitro models have shown evidence
that strongly implicates the pro-inflammatory response as a causative factor of morbidity and
mortality in sepsis, clinical findings suggest a more complex pathology (5, 26, 27). The updated
definition focuses not only on the robust activation of proinflammatory mediators, but also on
the anti-inflammatory response, which is also amplified in septic patients. Sepsis is now
understood to be distinct from nonseptic infection due to its presentation as a dysregulated host
immune response that damages the host’s own tissues, leading to organ failure (17).

No treatments are currently available to address aberrations in the host immune response during
sepsis. Therapies administered are primarily comprised of supportive care measures, such as
administration of fluids and vasopressors, as well as antibiotics to address the causative
infection(s) (21, 28). While ICU interventions have improved Previous clinical trials focusing
on obliterating proinflammatory response in sepsis by inhibiting the actions of cytokines (tumor
necrosis factor alpha (TNFα), interleukin 1 beta (IL-1β), toll-like receptors, and bacterial
endotoxins have failed, either showing no significant reduction in mortality or in some
circumstances, increased mortality rates (29-31). There is an unmet need for sepsis treatments
that seek to restore the balance between pro- and anti-inflammatory immune functions to
ameliorate the maladaptive, dysregulated responses that are hallmarks of sepsis pathology.

5
Host Immune Response to Infection.

The human immune system is equipped with a variety of cellular and molecular mechanisms to
recognize and defend against microbial pathogens. When faced with an infectious challenge, the
immune system works to effectively eliminate pathogens while simultaneously aiming to prevent
damage to the host’s own tissues through a well-controlled and “balanced” response consisting
of pro-inflammatory and anti-inflammatory responses (32). If immune homeostasis is disrupted,
pathologies such as sepsis can develop, in which the immune response becomes unbalanced and
unproductive, allowing the invading organism to persist, subsequent organisms to invade, and/or
causing uncontrolled damage to host tissues (27, 29).

During infection, innate immune cells recognize invading pathogens through nonspecific
pathogen associated molecular patterns (PAMPs), which detect conserved molecular signatures
displayed by a variety of pathogens, such as lipopolysaccharide (LPS) in gram-negative bacteria,
lipoteichoic acid (LTA) in gram-positive bacteria, and viral RNA. PAMPs typically interact with
recognition receptors, such as toll-like receptors on the surface of neutrophils, monocytes, and
dendritic cells (26, 33). Neutrophils are typically the first responders to recognize pathogens and
utilize a series of strategies to attempt to eliminate microbes to prevent worsening of infection,
including phagocytosis and interleukin-8 (IL-8) dependent recruitment of other immune cells
(34, 35). Monocytes and macrophages, which are terminally differentiated monocytes with a
longer lifespan that reside locally in tissues throughout the body, also play a significant role in
PAMP recognition, phagocytosis, and produce a variety of cytokines that drive the inflammatory
response (36). PAMP recognition in innate cells can then activate nuclear factor kappa B (NFkB)
to escalate a pro-inflammatory cytokine cascade (33, 37). If innate immune cells are unable to
6
clear the infection, the immune system will begin to establish an antigen-specific, adaptive
immune response. Activated dendritic cells, monocytes, and B cells, will work as antigen-
presenting cells (APCs) that stimulate T cells by binding to the T cell receptor (TCR) (38).
Whereas the innate immune response adaptive immune response typically peaks several days (3-
7 days) following innate immune activation. Once activated, T cells are then able to mount a
cell-mediated, pathogen-specific response to the infecting organism. Antibody-producing B cells
can also become activated following exposure to an antigen, or can become activated in a T cell
dependent manner (39).

A variety of T cell subsets, including CD4+ T Helper cells and CD8+ cytotoxic T cells are
involved in defense against pathogens and maintenance of immune homeostasis. CD4+ T cells
are further categorized into Th1, Th2, Th17, and regulatory T cells (Tregs) (40). Th1 cells
primarily produce interferon gamma (IFNγ), promote cell-mediated killing, and are involved in
defense against intracellular pathogens (40, 41). If left uncontrolled, aggressive pro-
inflammatory Th1 responses can contribute to tissue damage (42). Th2 cells, which produce IL-
4, IL-5, and IL-13, are associated with allergic inflammation, provide defense against
extracellular parasites, and are involved in driving humoral immunity (40, 43). Th17 cells are
thought to be pleiotropic, having both pro- and anti-inflammatory functions, and play a pivotal
role in host defense against extracellular bacteria and fungi and secrete IL-17, IL-22, and IL-26
(40, 44). Unlike Th1, Th2, and Th17 cells, Tregs have a primarily anti-inflammatory function.
Tregs are necessarily for maintaining homeostatic balance of the immune system to prevent
recognition of self-antigens, minimize damage to host tissues, and release IL-10 to regulate
inflammatory processes (45).
7
Sepsis Immunoparalysis.

Whereas the normal immune response to infection involves a well-controlled, balanced response
to eradicate pathogens, the immune response during sepsis presents through exaggerated,
maladaptive pro- and anti-inflammatory responses that are triggered by innate and adaptive
immune cells (5). While the precise, stepwise nature of the trajectory of the host immune
response throughout sepsis remains unknown, it is theorized that the syndrome begins with an
amplified hyperinflammatory response, marked by increased TNFα, IFNγ, and IL-1β, interleukin
12 (IL-12), and interleukin 18 (IL-18) (5, 26) which triggers a compensatory release of the anti-
inflammatory cytokine IL-10, which counteracts the effector functions of the pro-inflammatory
cytokines in an effort to maintain immunologic balance (46). If sepsis persists, many key effector
cells start to undergo “exhaustion” – characterized by decrease in proliferation, altered antigen
presentation, apoptosis, and failure to release cytokines (26). A study by Boomer et al.
demonstrates that immune cells harvested from the spleens of sepsis patients who died in the
ICU had only 10% of the TNFα, IFNγ, IL-6, and IL-10 cytokine response compared to controls
(nonsepsis deaths or splenectomy samples) when stimulated with LPS or CD3/CD28 antibodies
ex vivo (47). Spleen tissue from these patients also showed an influx of T regulatory cells and a
decreased number of CD4+ T helper cells and CD8+ cytotoxic T cells (47) .

In addition to blunting of cytokine response and shifts in T cell populations, specific cell surface
markers can be used as indicators of immunoparalysis and exhaustion. Notably, downregulation
of human leukocyte antigen, DR-isotype (HLA-DR) has been demonstrated to be the most
prominent and widespread marker of immune function in sepsis in a multitude of studies (5, 48,
49). HLA-DR is a major histocompatibility (MHC) class II cell surface receptor present on
8
monocytes, dendritic cells, and B cells that is responsible for presenting antigens to CD4+ T cells
and influences selection of T helper cells in the thymus, thereby activating an adaptive immune
response (50). The previously mentioned study of recently deceased sepsis patients by Boomer et
al also found that HLA-DR cell surface expression was significantly decreased on the
macrophages and other APCs harvested from sepsis patients, in comparison to non-sepsis control
patients, with some sepsis patients experiencing complete depletion of HLA-DR+ cells (47).

An additional marker of interest also includes programmed cell death ligand 1 (PD-L1) on
monocytes, which communicates with the inhibitory programmed cell death receptor (PD-1)
located on the surface of activated T cells. These markers are immune checkpoint regulators,
which can cause apoptosis, decreased pro-inflammatory cytokine production, and impaired cell
proliferation in T cells (51). Specifically, PD-L1 expression on monocytes is strongly associated
with increased risk of mortality in patients with septic shock (26, 52). A study conducted by
Zhang et al. demonstrated that administration of anti-PD-L1 in mouse models of septic shock
enhances bacterial clearance and promotes survival (53). A recent phase 1b clinical trial of an
anti-PD-L1 antibody that prevents PD-L1 binding to PD-1 has demonstrated that patients treated
with the highest tested dose had increased HLA-DR expression, persisting for up to 90 days after
administration (54). The experimental anti-PD-L1 antibody also did not cause cytokine storm in
any of the study participants, and had no clinically significant effect on cytokine production,
suggesting that its administration does not cause a compensatory surge in pro-inflammatory
activity. Together, these data provide strong support for the role of PD-L1 as a potential novel
therapeutic target in sepsis.

9
The majority of patients survive the early phase of sepsis, wherein pro-inflammatory response
and symptoms of cytokine storm (high fever, shock) are predominant. While some patients will
succumb to shock or organ injury secondary to overwhelming inflammation within the first 3
days, 70% of sepsis-related of deaths occur at a more protracted phase of the illness, 72 hours or
later, following diagnosis (29). This suggests that that the immunoparalysis phase, which extends
further than the pro-inflammatory stage, is responsible for more deaths, as patients succumb to
either to the unresolved initial infection, the onset of secondary infections, or accumulative organ
failure. A schematic of the proposed models of sepsis mortality and recovery is presented in
Figure 1.

Figure 1. Theory of Dysregulated Host Immune Response in Sepsis.
Adapted from Hotchkiss, et al. 2013 (5). Blue lines correspond to the innate immune response, driven by
neutrophils and monocytes, which peaks within the first 3 days of infection. Early mortality due to
10
inflammation is indicated at the juncture of the red and blue lines at day 3. Green lines signify the
adaptive immune response, which also rises during sepsis onset, but can robustly increase after day 3,
leading to late mortality beyond 7 days due to inability to mount an immune response sufficient to clear
the primary pathogen and/or development of secondary infection. An ideal, balanced response results in
restoration of innate and adaptive immunity to baseline and recovery by day 6.

S. aureus Bacteremia as an Important Cause of Sepsis.

While any infectious organism has potential to cause sepsis, Staphylococcus aureus is the most
common bacterial cause of gram-positive sepsis in ICU patients, which encompasses the
population of patients that is the most at risk of experiencing sepsis-related mortality (1). S.
aureus is a commensal bacterium, colonizing the skin and mucus membranes of nearly 30% of
the population, that can cause a variety of different infections including skin and soft tissue
infections, osteomyelitis, endocarditis, pneumonia, and bacteremia (55). Once considered to be
primarily an opportunistic nosocomial pathogen affecting patients predisposed to infection,
within the past three decades, the burden of S. aureus infections has reached epidemic
proportions in the U.S., particularly with the rapid spread of methicillin-resistant strains in the
community affecting otherwise healthy individuals (3, 56).

Specifically, bloodstream infections caused by S. aureus affect an estimated 80/100,000 persons,
with an overall mortality rate of 19% to 57% in adults (57, 58). Bloodstream infections caused
by S. aureus are typically more severe than bacteremia caused by other organisms, resulting in
greater morbidity and mortality, due to a variety of factors that may include the ability of S.
aureus to evade the host immune system, form biofilms, develop resistance to antibiotics, and
11
adhere to epithelial tissues and implanted devices (2). The source of S. aureus bacteremia (SAB)
is highly variable and attests to S. aureus’ pathogenic adaptability and ability to invade a wide
variety of body sites. Common sources include skin and soft tissue infections, implanted devices
(intravenous lines, catheters, prosthetic valves, prosthetic joints), surgical wounds, and
endocarditis (59, 60). The source of bacteremia has been shown to correlate with morbidity and
mortality, with endocarditis and pulmonary sources having the highest 30-day mortality. In a
subset of patients, the source of infection remains unknown, which is associated with a 14-day
mortality rate of 49% (59).

In addition to source control, which can include removal of implanted devices or surgical
debridement, antibiotics are the primary treatment used for SAB. Antibiotic therapy regimes vary
based upon the resistance types that are common in S. aureus clinical strains. Bacteremia caused
by methicillin-resistant S.aureus (MRSA) is more difficult to treat due to the presence of
penicillin-binding proteins and beta-lactamase enzymes that inactivate beta-lactam antibiotics
(61). For treatment of MRSA, the cell-wall synthesis inhibiting glycopeptide, vancomycin, is
typically considered as the “gold standard” for therapy (62). In the incidence of vancomycin
resistance or allergy, other options include daptomycin, a lipopeptide that depolarizes the
bacterial cell membrane, and linezolid, an oxazolidinone and protein synthesis inhibitor (63, 64).
While neither linezolid or daptomycin is inferior to vancomycin, linezolid was shown to be
associated with higher mortality in bacteremia of catheter-related origin (65). If vancomycin
therapy fails, ceftaroline, a beta-lactam antibiotic and fifth-generation cephalosporin, is used off-
label by some clinicians as a salvage therapy for complicated MRSA bacteremia infections, with
largely positive results (66). For methicillin-susceptible S. aureus bloodstream infections
12
(MSSA), beta-lactam antibiotics are commonly used, as vancomycin and alternatives are
typically reserved for MRSA infection or beta-lactam intolerance (64, 65).

Though a fairly standardized and well-defined treatment regimen is established following
positive blood culture and organism identification, heterogeneous outcomes occur in SAB
patients, as some patients develop complicated infections despite the receipt of antibiotics that
should be effective based on organism antibiotic susceptibility profiles. Most notably, persistent
SAB occurs in 1 of 3 patients in which growth of bacteria from the bloodstream persists beyond
7 days (6, 67-69). Importantly, persistent bacteremia is significantly associated with metastatic
complications, relapse, prolonged hospitalization, and increased mortality (67, 70-72). A recent
study by the Wong-Beringer group indicated that risk of mortality increases by 16% with each
continued day of persistence, further highlighting the need to address this common complication
(6, 73).

Despite the frequency at which persistence appears and its associated cumulative mortality rate,
no standardized treatment for persistent SAB exists. Further complicating the matter, there is no
diagnostic tool that can be used to identify which patients will go on to develop persistence,
which precludes the administration of preventative therapies. Published studies report a variety
of potential clinical and microbial risk factors for the development persistent SAB. Studied
clinical variants include: age, sex, the presence of comorbidities (diabetes, cancer, renal failure,
cirrhosis), development of infective endocarditis, and the presence of indwelling medical devices
such as prosthetic valves and catheters (59, 69, 74, 75). On the microbial side, small colony
variants, increased expression of select virulence factors, and accessory gene regulator (agr)
13
dysfunction, have been demonstrated in ex vivo and in vitro models (76-78). Despite these
preliminary findings, none of these metrics have been utilized as diagnostic parameters used
within the clinical setting and their relevance across populations for broader applications remains
unknown. Heterogeneity of host immune response presents another significant variable
contributing to patient outcomes in SAB, as evidenced by differential cytokine response and
immune cell recognition of antigens (6, 79, 80). Ultimately, outcomes of persistent SAB are most
likely linked to a currently poorly understood combination of host, strain, and treatment factors
that interact to shape the trajectory of infection. Each of these factors will be explored further in
the following sections to examine their respective contributions to SAB outcomes.

Host Immune Perturbations in S. aureus Bacteremia.

The host immune response is highly heterogeneous across individuals, which can be attributed to
a multitude of complex heritable and acquired variables, including age, sex, ethnicity, the
microbiome, distribution of immune cell populations, and polymorphisms in immune signaling
genes (81). These factors can have dynamic impacts on response to stimuli and can potentially
predispose patients in certain “immunotypes” to developing severe infections or autoimmune
diseases by altering cytokine production and changing functional cell-mediated response (82). As
discussed previously, patient immune response has been shown to differ between sepsis patients,
with dramatic effects on outcomes: while a portion of patients demonstrate an initial robust
inflammatory response resulting in early mortality, many patients respond to the invading
pathogen with dampened pro-inflammatory responses and upregulated anti-inflammatory,
leading to inability to clear the infection and protracted mortality (29). Additionally, genomic
14
and transcriptomic profiling studies lend further support for the role of different “endotypes” in
sepsis based on markers of host immune response that correlate with patient outcomes (26, 83).

Accordingly, based on the findings of heterogeneity in sepsis studies, variability in the host
immune response to S. aureus likely contributes to differential outcomes and presentations in
SAB as well. Several groups have published findings of dysregulated immune response in S.
aureus bacteremia patients with poor outcomes, such as persistence and mortality. The observed
imbalance is typically characterized by excess production of the anti-inflammatory cytokine, IL-
10 (6, 84-86). A ratio of IL-10/ TNFα can be used as a means for assessing the balance of anti-
inflammatory to pro-inflammatory activity, wherein higher IL-10/ TNFα ratios are marked by
increased anti-inflammatory activity (6). A 2000 study by Gogos et al. demonstrates that
cytokine profiles that skew towards an anti-inflammatory state (high IL-10/TNFα ratio)
measured at 48 hours after onset of severe sepsis strongly predicts death in patients, while
another small study specifically found high IL-10 at infection onset predicts death in SAB
patients (84, 87). The Wong-Beringer group previously published observations from the largest
prospective cohort of patients with SAB and demonstrated that high IL-10/TNFα ratio at 72
hours is suggestive of an immunoparalysis state and strongly predicts persistent positive blood
cultures and mortality (6). In this study, serum levels of pro-inflammatory (TNFα, IL-6, IL-8, IL-
17) and anti- inflammatory (IL-10) cytokines were measured at onset and at 72 hours after
initiation of effective therapy. At onset of infection, patients with persistent bacteremia exhibited
a 3-fold more robust cytokine response than those with early resolution. When cytokine balance
of IL-10 to TNFα ratio was examined for individual patients, those with persistent SAB at day 4
showed a predominance of anti-inflammatory cytokine (IL-10/TNFα ratio: 1.51 vs. 0.69,
15
p=0.0002). In a multivariable analysis adjusting for confounders such as age, gender, infection
source, immunosuppression from other causes, and ICU admission, a sustained dysregulated
balance of high IL-10/TNFα ratio at day 4 despite antibiotic therapy was the strongest predictor
of both persistence and death.

Outside of IL-10/TNFα ratio, other clinical studies of SAB patients have evaluated alternate
markers of immune response to assess immune dampening secondary to sepsis immunoparalysis
such as HLA-DR. A study of adult SAB patients showed dampening of HLA-DR expression
throughout the first week of infection in patients with complicated SAB, suggesting that S.
aureus may impair the activation of the adaptive immune response in persistent infections (88).
A follow-up study validated this finding and demonstrated delayed recovery to baseline HLA-
DR expression levels following SAB infection (79). For comparison, patients affected by
bacteremia caused by another gram-positive organism, Streptococcus pneumoniae, demonstrated
significant HLA-DR recovery after 3 days, whereas S. aureus infected patients did not begin to
show increases recovery until day 14 (79). Other experimental studies implicate the role of S.
aureus in increasing IL-8 production in SAB infections causing mortality, inducing PD-L1 in
human monocytes to downregulate HLA-DR expression, and decreasing Th1 cytokines and
increasing Th17 response (80, 89, 90). Additionally, a study of host-specific immune response to
S. aureus strains of the same pulsed-field gel electrophoresis (PFGE) phenotype showed that S.
aureus-specific antibody production differs between recovered bacteremic patients,
demonstrating that response is differential based on the patient even amongst infections caused
by related strains (91). Though the strains had comparable virulence gene profiles, patients
exhibited antibody production against different staphylococcal virulence proteins, further
16
highlighting the heterogeneity of response between patients. This finding strongly implicates
towards the combined interaction between S. aureus virulence and host factors. To aid discovery
of unexplored potential biomarkers and targets, our research group has begun enrolling SAB
patients in a dual-RNASeq study of host and microbe that has shown preliminary findings of
differential immune gene expression in persistent versus resolving patients to be further explored
in future studies.

S. aureus Virulence Factors Impact Host Immune Response.

As evidenced by the breadth and diversity of infections S. aureus is known to cause, including
skin and soft tissue infections, bacteremia, pneumonia, endocarditis, and osteomyelitis, S. aureus
is able to infect a number of body sites (55). S. aureus is particularly well-adapted to colonize
and infect its host, as it is assisted by an arsenal of virulence factors that promote its invasion of
and survival in stressful environments (92, 93). Host immune cells have been shown to interact
with the many virulence factors produced by S. aureus strains, as these factors can influence the
development of inflammation, cause tissue damage, promote lysis of immune and hematologic
cells, and enable adhesion to endothelial and epithelial cells, among others (93, 94). Factors can
be secreted, such as toxins or on the surface of the organism, including adhesins, capsule
proteins, and cell wall-associated factors (95). Expression of virulence factors is controlled by a
system of global regulators, including the accessory gene regulator, agr, the most well-
characterized regulatory system that controls virulence factor production through a two-
component signal transduction system based on quorum sensing (96, 97). Virulence factors can
be encoded within the core bacterial genome or acquired externally through the integration of
plasmids, phages, and transposons leading to a great deal of potential variability across S. aureus
17
clinical strains. Many of the common staphylococcal superantigen toxins, such as Toxic shock
syndrome toxin-1 (TSST-1) and staphylococcal enterotoxin A (SEA) are differentially present
within clinical strains due to their presence within bacteriophages that have inserted within the
genome (98).

Several previous studies have attempted to identify a specific phenotype of virulence factors that
are relevant to specific infection types, but this has remained challenging due to the wealth of
genetic diversity present in SAB strains. Primary genes of interest in previous studies include
Panton-Valentine leucocidin (PVL), phenol soluble modulins (PSM), and alpha-hemolysin (hla),
which all interface with and in many cases, destroy, host immune cells (55, 58, 99). While PVL
has not shown consistent association with severe or invasive infections, both hla and PSM appear
to correlate with pathogenesis and infection severity in animal models, though these findings
require validation in human studies (100-103). An ex vivo gene study of S. aureus bloodstream
isolates causing sepsis grown in human serum shows upregulation of iron-acqusition genes
(isdD), hla, psm, and agr, in comparison to bacteria grown in microbial media (104). Another
study utilized to whole genome sequencing approach to characterize specific virulence factors
associated with bacteremia isolates and compared 785 SAB strains obtained from a hospital in
Madrid with 78 colonizing strains; the investigators found that in general, most strains, in both
the infection and colonization groups, contained comparable virulence factor expression,
concluding that most strains have the theoretical capability to cause bacteremia, though certain
strain types are more frequently associated with bacteremia (clonal complex 5) (58). Therefore,
it appears that while there is a general consensus that secreted host cell lytic factors may impact
the development and severity of infection, the effects of these factors in vivo are poorly
18
understood and the presence of toxin genes is variable across strains and does not consistently
predict infection outcome.

In addition to secreted toxins and cell surface proteins, cell wall components also contribute to S.
aureus virulence through their ability to elicit cytokine response and their roles as PAMPs
needed for innate immune recognition. The crucial phagocytic cells that respond to early S.
aureus infection, neutrophils and monocytes, recognize peptidoglycan and lipoteichoic acid on
the surface of S. aureus, thereby beginning the inflammatory cascade and shaping the outcome of
infection (93). While a variety of cell wall proteins and polymers, including peptidoglycan, wall
teichoic acids, and cell wall associated lipoproteins can influence host immune response, the
scope of the present work focuses on the dynamic role of lipoteichoic acid (LTA) as an
inflammatory mediator during bloodstream infection. A key advantage of targeting crucial cell
wall components, such as LTA, is that it is present in all clinical strains because it is necessary
for survival, which eliminates the need to address its presence or absence across clinicals strains
with unique genetic backgrounds. In contrast to the many conflicting studies assessing the roles
of secreted factors such as PVL, the relationship between LTA exposure and clinical outcomes in
SAB patients is not well understood and has not been previously evaluated.

S. aureus Lipoteichoic acid (LTA) & Host Immune Response

As discussed, S. aureus contains many unique microbial components that contribute to its ability
to infect a variety of different cell types. While recognizing the breadth of virulence factor
expression within this organism, LTA is of particular interest for further study due to its presence
in all S. aureus strains, whereas other factors, such as the superantigen toxins tsst-1 and
19
staphylococcal enterotoxins, as well as PVL, are associated with differential presence across
strains from different genetic backgrounds, rendering these as difficult widespread targets for
bacteremias caused by diverse populations of clinical isolates (55). While strains are able to
acquire external phage or plasmid-associated accessory genes containing virulence factors, LTA
remains a critical cell wall polymer present within all gram-positive bacteria, which renders it a
suitable target for all S. aureus strains, nosocomial as well as community-acquired. LTA can be
present on the surface of the bacterial cell, as it protrudes from the cell wall, or alternately, it can
be spontaneously released from bacteria during cell division (11). Strains with missing or altered
LTA are attenuated and experience poor growth and abnormal cell division (105).

The bacterial cell wall is comprised of layers of peptidoglycan with intermixed polymers of
teichoic acids (Figure 2) (30, 105, 106). Teichoic acids are divided into subtypes: lipoteichoic
acids (LTA) and wall teichoic acids (WTA). WTA and LTA are structurally related polymers,
but they are produced through distinct biosynthesis pathways (107). Teichoic acids, WTA and
LTA, have been shown to comprise at least 50% of the total weight of the bacterial cell wall
(108).WTA is attached directly to peptidoglycan via covalent bonds, whereas LTA attaches to
the cytoplasmic cell membrane via a glycolipid anchor (109). The glycolipid anchor is produced
by a diglucosyldiacylglycerol synthase encoded by the ypfP gene (110). The literature shows that
ypfP mutants generated for in vitro experimentation have demonstrated reduced, but not entirely
abrogated, growth in bacterial growth medium, increased cell turnover and autolysis rate, and
increased release of LTA from the cell wall (110).

20
LTA is a 1,3-linked glycerol phosphate polymer, of which the primary component is a
polyglycerol phosphate (PGP) backbone, synthesized by Lipoteichoic acid synthase (ltaS) (105).
LtaS was first discovered in Mu50, a clinical isolate with a thickened cell wall that confers
resistance to vancomycin (105, 111, 112). ltaS is the core synthesis gene that enables LTA
production and its presence is required for the growth of all S. aureus strains, as mutant ltaS
strains were unable to grow or produced empty cell envelopes lacking cytoplasm (105). PGP
synthesized by ltaS is further modified by positively-charged D-alanyl groups via the DLT
enzymes encoded within the dlt operon: dltA, dltB, dltC, and dltD, which transport D-alanyl
groups through the membrane and assist in their ligation to PGP (113). D-alanylation of LTA
confers S. aureus with a variety of survival benefits, as the addition of D-alanyl groups changes
the net charge of the cell wall (114). Increasing D-alanylation is associated with increased
resistance to cationic host defense peptides and increased immune evasion, as dlt mutant strains
are severely attenuated in murine models and are less likely to cause sepsis in mice (115).

The effects of LTA upon the host immune system are well-studied yet poorly understood, as
many conflicting studies exist. The many immune-stimulatory effects of LTA have been
demonstrated in previous studies. LTA has been shown to induce neutrophil activation, increase
neutrophil longevity, enhance phagocytic response, promote neutrophil chemotaxis, and induce
pro-inflammatory cytokine release in neutrophils and monocytes (116-119). LTA is recognized
by innate immune cells through TLR2 and CD14, which have been shown to bind directly to
LTA (120, 121). Following stimulation and internalization of TLR2, LTA can also influence
NF-kB translocation into the nucleus, thereby eliciting a regulatory effect on pro-inflammatory
gene production (122). A study by Lotz et al. shows the dose-dependent effects of LTA on
21
human neutrophils, indicating that higher doses of purified LTA result in more pronounced pro-
inflammatory effects, with maximal induction demonstrated at 10 μg/mL (116). Specifically, the
10 μg/mL concentration of LTA upregulated CD11b, downregulated CD62L, delayed apoptosis,
induced CXCL8, and activated NF-kB through interactions with TLR2 and CD14 (116). Because
LTA is a strong inducer of pro-inflammatory response at the onset of infection because it
stimulates first-responding cells, such as neutrophils, patients experiencing immunoparalysis
may benefit from early exposure to LTA to aid in immune recognition and rapid bacterial
clearance.

However, in addition to its many well-documented pro-inflammatory effects on innate immune
cells, others have found LTA to be a potent inducer of IL-10 production, resulting in reduction of
HLA-DR expression and inhibition of T cell activation (89, 108, 123). Studies investigating
LTA’s effect upon expression of HLA-DR have been controversial, as both up- and
downregulation has been reported (89, 124, 125). The pleotropic effects of LTA on host
inflammatory and immune response appears to be similar to lipopolysaccharide (LPS), the well-
characterized component present in gram-negative bacteria that can induce septic shock while
also known to induce a state of immune tolerance upon repeated challenge (126). This suggests
that LTA’s effects on the host may be cell-type dependent. While much of the previously
discussed pro-inflammatory evidence comes from innate immune cells such as neutrophils and
monocytes, antigen-presenting and adaptive immune cells demonstrate anti-inflammatory
responses, which may occur as a compensatory mechanism in response to prolonged
inflammation directed by innate immune cells. To better illustrate this, Kaesler et al. showed that
exposure to 10 μg/mL purified LTA from S. aureus induced temporary CD4
+
T cell paralysis and
22
dampening of pro-inflammatory cytokine production independently of TLR2 in a murine model
(127). Following removal of LTA, the cells were responsive to subsequent stimuli, indicating
that in this model, the anti-inflammatory effect is transient and does not impair long-term T cell
survival (127). A similar study in which CD4+ T cells were stimulated with purified S. aureus
showed induction of transforming growth factor (TGF)-β and forkhead box P3 expression, which
are markers of Tregs, an anti-inflammatory T helper cell subset (128). The immune response to
LTA appears to mirror the dysregulated immune response demonstrated in sepsis, characterized
by early intensity of inflammation and protracted anti-inflammatory activity leading to
immunoparalysis. Based on these similarities, the present work aims to further explore LTA’s
complex role in influencing the balance of pro- and anti-inflammatory immune response by
examining the dose-dependent effects of LTA upon different immune cells involved in the innate
and adaptive immune response. Interestingly, we have found that LTA release varies across
clinical strains causing different phenotypes, suggesting that LTA may play a role in the outcome
of infection by directly influencing early immune response, and potentially, contributing to
adaptive immune cell dampening.
23
Adapted from Brown, et al. (106). LTA is anchored to the bacterial cell membrane and is dispersed
throughout peptidoglycan layers, extending through the cell wall to the cell surface. Conversely, wall
teichoic acids, a related but biochemically distinct polymer, are anchored to peptidoglycan.

Antibiotics as Modulators of LTA Release.

LTA is released spontaneously from bacterial cell walls during normal cell growth and division.
However, LTA release can also be induced by environmental factors that disrupt the cell wall or
cause bacterial lysis, such as phenol, detergents, and antibiotics. Fittingly, cell-wall active
antibiotics, such has beta-lactams, have been shown to enhance release of LTA, likely due to
their mechanism of action which involves impairing the cell wall by inhibiting peptidoglycan
Figure 2. Gram positive cell wall structure.
24
synthesis. Conversely, other antimicrobials, particularly protein synthesis inhibitors have been
shown to have minimal or suppressive effects on LTA release. Protein synthesis inhibiting
antimicrobials act on bacterial ribosomes to disrupt the production of proteins needed for
bacterial growth.

Van Langvelde et al. studied the effects on LTA release of 3 beta-lactam drugs (imipenem,
flucloxacillin, and cefamandole) in comparison with 3 protein synthesis inhibiting drugs
(erythromycin, clindamycin, and gentamicin) (11). The antibiotics were used at concentrations at
and above the MIC to reflect a range of therapeutically relevant dosages (1, 2.5, 5, 5, 10, and 20
times the MIC). The results indicated that the beta lactam antibiotics maxmimally increased LTA
release by 4–9 fold at 20x MIC, whereas the protein synthesis inhibitors suppressed LTA release
by approximately 50%. A study by Lotz et al. utilized a similar approach and examined effects of
flucloxacillin, a beta lactam used outside of the United States; the protein synthesis inhibitors
gentamicin and erythromycin; and ciprofloxacin, a DNA gyrase inhibitor (10). Concentrations of
antibiotics used were 1x and 20x MIC, with the 20x concentrations producing the most robust
effects on release for flucloxacillin. The protein synthesis inhibitors exhibited no effects on LTA
in this study and ciprofloxacin at 1x MIC exhibited a small increase in LTA. LTA and antibiotic
containing supernatants were shown to have activating effects on human neutrophils, supporting
the notion that antibiotics allow for release of pro-inflammatory components such as LTA from
the cell wall (10, 11). Notably, these studies were completed using a single strain of S. aureus
(ATCC 25923, in both studies), rather than multiple genetically diverse clinical strains
originating from patient infection sites.

25
While these studies present compelling findings on antibiotic interactions with S. aureus and
imply potentially robust consequences for modulating the host immune response, no additional
antibiotics have been studied in S. aureus and current knowledge is limited to the X drugs stated
above. MRSA infections are not typically treated with beta-lactams due to antibiotic resistance
and therefore, the previously published studies present comparably fewer methods to enhance
LTA release in MRSA strains versus MSSA strains. Namely, vancomycin, a standard treatment
for MRSA, has not been previously evaluated for its influence on LTA release. There is a need
for further studies evaluating the effects of additional antibiotics upon LTA release, particularly
commonly used agents such as vancomycin, to expand applicability to MRSA infections.

Direct Immunomodulatory Effects of Antibiotics.

In clinical practice, the current approach to managing SAB relies primarily on the selection of
antibiotic based on organism identification and susceptibility alone, without specific regard to
the known variation in host immune response and S. aureus strain-specific ability to manipulate
the host immune response through differential virulence factor expression. While antimicrobial
therapy is prescribed to eliminate the causative pathogens through antimicrobial killing,
published studies have also demonstrated the varying immunomodulatory effects exhibited
directly by antibiotics, which may ultimately influence the outcome of infection. In inflammation
models, antibiotics have been shown to directly impact cytokine response, TLR expression,
phagocytosis, and NF-κB activation (129-131). Much of the published literature focuses on
macrolide antibiotics such as azithromycin, which has been shown in many studies to have
potent anti-inflammatory effects, which has been realized as a useful therapy for chronic
inflammatory diseases of the respiratory tract (131, 132). Other drugs that have been studied
26
across pharmacologic classes include fosfomycin, clarithromycin, daptomycin, ciprofloxacin,
linezolid, and vancomycin.

One study compared the effects of fosfomycin, clarithromycin, and dexamethasone on cytokine
response of monocytes and demonstrated that both fosfomycin and clarithromycin were found to
stimulate IL-10 while suppressing TNFα, CXCL-8, and GM- CSF production, suggesting that
those antibiotics can exert different regulatory effects on the production of pro- and anti-
inflammatory cytokines (14). A clinical study involving 58 patients with gram-negative sepsis
treated with ciprofloxacin or ceftazidime found that among those with high baseline TNFα
levels, significant increases in IL10/TNFα ratio at 24 and 48 hours compared to baseline
occurred in the ciprofloxacin group while no difference was observed in the ceftazidime group
(87). In a study of linezolid, daptomycin, and vancomycin effects on THP-1s stimulated with
E.coli LPS, daptomycin was shown to downregulate mRNA expression of TLR1, TLR2, and
TLR6, whereas vancomycin and linezolid upregulated TLR expression; however, all antibiotics
were also shown to upregulate IL-10 expression, indicating that antibiotics may alter the balance
of anti- to pro-inflammatory response (130). Additionally, while this specific study is outside of
the scope of bacterial infection, ceftaroline, an anti-staphylococcal antibiotic used as a salvage
therapy for MRSA bacteremia, has been shown to reduce inflammatory response and enhance
human beta defensin response in THP-1 monocytes stimulated with cigarette smoke extract
(133).

Specifically, in studies directly relating to S. aureus and gram positive organisms, Franks et al.
showed that linezolid is more potent than vancomycin in suppressing pro-inflammatory cytokine
27
production and that the effect diminishes when addition of the antibiotic to monocytes infected
with MRSA ex vivo is delayed from 3 to 9 hours (134). Pichereau et al. found daptomycin to
inhibit production of pro-inflammatory cytokines in monocytes after exposure to S. aureus toxins
such as Panton-Valentine leukocidin and a-toxin (15). Importantly, a recent retrospective clinical
study of SAB patients by Volk, et al. linked cytokine production and patient outcome with
receipt of specific antibiotic therapies (86). Specifically, the study examined IL-10 and IL-1β to
assess the balance of anti-inflammatory and pro-inflammatory activity. The findings showed that
patients receiving beta-lactam antibiotics had greater IL-1β response on day 3 and lower IL-10
production on day 7 in comparison to patients receiving vancomycin or daptomycin (86). While
a specific mechanism underlying this finding was not described, based on the previous
discussion of beta-lactam effects on cell wall components, it is hypothetically possible that an
increase in LTA release from S. aureus contributes to greater pro-inflammatory cytokine
response. As the aforementioned studies highlight, antibiotics can demonstrate direct
immunomodulatory effects on host cells in addition to their intended antimicrobial effects. A
two-pronged approach that utilizes both the antimicrobial and immunomodulatory properties of
antibiotics may aid in promoting early bacterial clearance, particularly for patients with aberrant
immunophenotypes such as immunoparalysis, who would likely benefit from a combination of
bactericidal and immunostimulatory effects.

Summary

SAB is an important cause of sepsis and mortality in the United States. Clinical presentations and
outcomes of SAB and sepsis can be highly heterogeneous based upon dynamic interactions
between the microbe, host, and pharmacologic therapies used. Notably, SAB infection can result
28
in complications such as bacterial persistence – a phenomena that is frequently observed but
poorly understood that increases the risk of mortality, relapse, and metastatic infection.
Immunoparalysis may contribute to the etiology of persistence in SAB. Immunoparalysis has
also been observed in patients with sepsis and is evidenced by a dysregulated immune response
biased towards anti-inflammatory mechanisms. Accordingly, high IL-10/TNFα ratios are
associated with mortality and persistence in SAB patients, supporting the relevance of
immunoparalysis to bacterial persistence. While a variety of bacterial virulence factors are
involved in S. aureus pathogenesis, the present work focuses on the contribution of the cell-wall
associated factor, LTA due to its invariable presence and necessity across strains. LTA has been
shown to interact directly with host immune cells, eliciting predominantly pro-inflammatory
responses in innate immune cells such as neutrophils, whereas anti-inflammatory responses have
been reported in lymphocytes. Importantly, release of LTA from the cell wall is modifiable by
currently available antibiotics. Prior studies suggest that beta-lactams enhance and protein
synthesis inhibitors suppress LTA, creating a potential method for manipulating LTA release in
vivo. In addition to their effects on bacteria, antibiotics have been shown to confer direct
immunomodulatory effects upon host cells and may meaningfully interact with LTA-mediated
inflammatory response to promote, or potentially suppress, enhanced immune cell effector
activity.

Based on the findings presented in prior studies, antibiotics may present a potential toolset that
can be leveraged to regulate LTA release from S. aureus to influence and shape the host immune
response to benefit the host. Using this theory, antibiotic selection for S. aureus infections could
take into account the patient’s immune response, in addition to microbial susceptibility. For
29
example, patients exhibiting an immunoparalysis phenotype could be administered antibiotics to
enhance LTA release to stimulate a pro-inflammatory innate immune response. Conversely,
patients exhibiting an exacerbated pro-inflammatory response could be treated with agents that
suppress or minimally affect LTA release. While clinical trials would be needed for validation,
this theoretical approach provides a potential opportunity to moving towards a personalized
medicine approach for infectious disease. While personalized medicine has made revolutionary
advances in other disease states, such as oncology, infectious disease has not seen innovation in
this area to date (12). In the present work, we make introductory strides towards the
establishment of personalized approaches for managing SAB infection by examining the direct
(effects on host cells) and indirect (effects on bacterial LTA release) immunomodulatory
capabilities of antibiotics.

30
Chapter 2 - Correlation of the Variable Release of Lipoteichoic Acid from S. aureus
Bloodstream Isolates With Different Clinical Phenotypes and Whole Genome Analysis

Staphylococcus aureus is among the most common causes of bloodstream infections and
bacterial sepsis (22). Despite achievements in infection control, the establishment of clinical
guidelines and algorithms, and availability of antimicrobial therapies, S. aureus bacteremia
(SAB) continues to present as a pervasive, high-mortality infection (2, 64) . Previous studies
have demonstrated notable heterogeneity in clinical presentation and outcomes in patients with
SAB (2, 59). While some patients respond quickly to antimicrobial intervention, at least 1 in 3
patients experiences bacterial persistence, defined by prolonged positive blood cultures beyond
72 hours of initiation of appropriate antibiotic therapy (6, 74, 80). We and others have shown
that persistence is associated with metastatic complications and increased mortality (6, 59, 69).
Importantly, our group and others have previously reported that a dysregulated host immune
response is predictive of persistence and mortality in SAB patients (6, 84). Of great concern is
that we have shown recently in a large study involving nearly 900 patients with SAB that each
day of sustained growth of bacteria in the blood increases the risk of mortality by 16% (73).

The observed heterogeneity in clinical outcomes can be attributed, in part, to differential
expression of virulence factors and resistance mechanisms across S. aureus strains and
variability in the host immune response (6, 58, 135). Variable strain-specific factors within
genetically diverse S. aureus strains have been shown to contribute to the development of
immune dysregulation and subsequently, SAB persistence (89, 116, 117).

31
S. aureus is exceptionally well-adapted to colonize and infect human and animal hosts. Clinical
S. aureus strains commonly contain an array of diverse virulence factors that aid its survival
within the host, including factors that promote immune evasion, biofilm formation, enhanced
growth in serum, and toxin-mediated lysis of neutrophils and platelets (93, 104). The repertoire
of genes encoding virulence factors is uniquely associated with strain sequence type (ST) or
clonal complex (CC), with CC8, CC5, and CC30 comprising the largest clades and most
common causes of bacteremia (77, 136-138). Previous studies have demonstrated that isolates
causing bacterial persistence have been shown to exhibit increased expression of cell-surface
related virulence factors, as well as increased tolerance to iron and mutations in cell membrane
associated factors. Isolates causing persistent bacteremia have demonstrated point mutations in
microbial cell-wall associated factors such as mprF, which modifies the phosphatidylglycerol
layer within the cell wall, ultimately altering the net charge of the bacterial surface, allowing for
increased immune evasion and enhanced strain fitness, which likely aids in enabling persistence
(139, 140).

The bacterial cell wall contains many immunogenic and immunomodulatory components that are
recognizable by the host. Early during infection, the innate immune response focuses primarily
upon targeting and recognizing bacterial cell wall components including peptidoglycan and
lipoteichoic acid (LTA) via toll-like receptor signaling (118, 123). Other virulence factors, such
as superantigens, affect primarily the adaptive immune response, which takes several days to
initiate. Cell wall-related factors such as LTA are recognized expediently by neutrophils, the
first-responder innate immune cell type (141). LTA is of particular interest due to its role in
stimulating pro-inflammatory cytokine response, activating neutrophils, delaying apoptosis, and
32
modulating phagocytic response, all of which contribute to its potential role in the development
of sepsis and severe infection by altering pro-inflammatory responses (116, 142, 143). Contrary
to virulence factors such as superantigens and enterotoxins which are often present within
accessory mobile elements not consistently present across strains, LTA is present in all S. aureus
strains as a necessary component of the cell wall that links the cell wall to the cell membrane
(108).

Our work and others have demonstrated that the quantity of LTA release from the cell wall
varies amongst S. aureus strains, though the mechanisms behind this observation have not been
previously described (11, 116). Of further interest, certain antibiotics such as cell-wall active
agents (e.g. beta-lactams), have been previously reported to increase LTA release from S. aureus
(10, 11). In this way, antibiotics may indirectly influence the outcome of infection by modulating
release of LTA, thereby prompting activated host immune cells to produce pro-inflammatory
cytokines. For patients with a dysregulated immune response that biases towards overproduction
of anti-inflammatory mediators such as IL-10, enhancing LTA release could be beneficial in
balancing and mounting a balanced inflammatory response that promotes bacterial clearance.

Given the ubiquitous presence of LTA across S. aureus strains and its effect on the host immune
response, we hypothesized that differential release of LTA may affect clinical outcomes in
patients with SAB. We examined LTA release in S. aureus bloodstream isolates selected for their
associated distinct clinical phenotypes (persistent vs. resolving bacteremia; patient survival vs.
death) and compared LTA release with or without addition of anti-staphylococcal antibiotics
from different pharmacologic classes (vancomycin, tedizolid, ceftaroline). In addition, we
33
utilized whole genome sequencing analyses to identify genetic differences in our study strains
focusing on the repertoire of virulence genes and in particular those that could affect synthesis,
release, and post-translational modification of LTA. Our findings demonstrate that our study
strains represent 6 different sequence types (STs) and that LTA release varies across strains by
14-fold. Upon exposure to anti-staphylococcal antibiotics, strain LTA release in response to
vancomycin was diminished for strains with MLST type ST8 compared to strains from other ST
types, possibly attributed to several point mutations within the autolysin pathway. Our findings
suggest that clinical S. aureus bloodstream isolates are endowed with a multitude of virulence
encoding genes and in particular, their strain-specific LTA-releasing capability may be
modulated by specific anti-staphylococcal antibiotics to potentially affect outcome of infection.

Materials & Methods.

Selection of bacterial isolates.
Study strains were collected from adult patients hospitalized for S. aureus bloodstream infection
enrolled in an IRB-approved multicenter prospective observational study as published previously
(6, 73). Selection of seven S. aureus strains (4 MRSA, 3 MSSA) for this study was based upon
distinct microbial and clinical phenotypes intended to represent a wide variety of clinical
presentations of bloodstream infection. Detailed patient and microbial characteristics that were
previously published are presented here for the selected study strains in Table 1. Factors that
were considered for selection included: persistent versus resolving infection; patient 30-day
mortality or survival; and methicillin-resistant S. aureus (MRSA) versus methicillin-susceptible
S. aureus (MSSA). Bacterial persistence was defined by positive blood cultures 72 hours or more
following initiation of appropriate antibiotic therapy, whereas resolving infections were
34
characterized by negative blood cultures in 72 hours or less. The isolates selected originate from
common sources of bacteremia including skin and soft tissue infection, wound infection, abscess,
catheter-related or unknown source. Two well-characterized MRSA clinical reference strains,
Mu3 and LAC USA300, were included as control strains for comparison of LTA release and
genomic variations related to virulence. Mu3, a vancomycin heteroresistant MRSA strain with a
thickened cell wall, was isolated from a patient in Japan in 1997 (112, 144). LAC USA300 is a
community-associated MRSA strain that is among the most common clonal strains in the United
States, notable for its virulence potential and spread (145, 146). Both Mu3 and LAC strains are
commonly used in experimental in vitro and in vivo models and their whole genomes have been
sequenced, assembled, and annotated, and are accessible on public sequence databases such as
GenBank.

Table 1 Selected SAB bloodstream isolates with associated clinical characteristics of the infected patients.
All strains were isolated from blood obtained from culture-positive patients hospitalized in 2 US medical
centers. Persistence was defined by continued positive blood cultures following at least 72 hours of appropriate
antibiotic therapy, whereas resolving infections were culture negative less than 72 hours of receipt of
Strain
ID
Patient
Characteristics
Resistance
type
Duration of
Bacteremia (Days)
Outcome MLST
Type
spa
type
HH35 70 y/o female MRSA 17 Persistent,
Died
ST97 t267
HH37 66 y/o male MRSA 1 Resolving,
Survived
ST5 t242
HH131 47 y/o male MRSA 7 Persistent,
Survived
ST8 t008
LA82 56 y/o male MRSA 17 Persistent,
Survived
ST8 t955
HH70 60 y/o female MSSA 11 Persistent,
Died
ST72 t148
HH92 66 y/o male MSSA 7 Persistent,
Survived
ST30 t338
LA164 34 y/o female MSSA 1 Resolving,
Survived
ST188 t189
35
antibiotics. Survival was considered at 30 days of admission. Whole genome sequencing of bacterial strains
was performed using Illumina MiSeq to determine MLST types and Protein A (spa) types.

Generation of bacterial supernatants.

Seven clinical strains (4 MRSA, 3 MSSA) and 2 well-characterized MRSA reference strains
(USA300, Mu3) were analyzed for LTA release in bacterial culture medium, with and without
the presence of antibiotics. S. aureus strains were incubated in tryptic soy broth at 37
o
C in a
shaking incubator for a total of 6 hours to capture bacterial growth at logarithmic phase.
Antibiotics were added following 2 hours of growth at concentrations that achieve optimal
pharmacodynamic parameter for efficacy: vancomycin (unbound) at AUC24 200; ceftaroline at
5x MIC; and tedizolid at AUC24 20. Supernatants were collected at 6 hours and filtered using a
0.45 um syringe filter and stored at -80C until use. Bacterial growth (CFU) was assessed on
tryptic soy agar at 0 hours, 2 hours, and 6 hours.

LTA ELISA.

An ELISA specific for detection of S. aureus LTA was performed as described in Lotz et al,
2006 (10). Briefly, commercially obtained purified LTA derived from S. aureus (Invivogen, San
Diego, CA) was used to establish a standard curve ranging from 31.2 to 2000 ng/ml. The
standard curve and bacterial supernatant samples collected as described above were incubated in
a 96-well Nunc Polysorp plate (Thermo Fisher, Waltham, MA) for 2 hours at room temperature
with shaking. After washing 3 times with 300 μl wash buffer (PBS and 0.05% Tween 20), wells
were blocked with 0.5% bovine serum albumin on a shaking incubator for 1 hour. Following
blocking, the wells were incubated with 1.2 μg/ml mouse IgG1 anti-gram positive LTA antibody
36
(GeneTex, Irvine, CA) at 37
o
c for 1 hour with shaking. The wells were washed 3 times with
wash buffer as stated above and incubated on a shaking incubator at 37
o
c for 1.5 hours with 2
μg/ml goat anti-mouse IgG-HRP conjugated detection antibody (Cell Signaling Technology,
Danvers, MA). Again, the wells were washed three times with wash buffer and then incubated
with TMB substrate (Biolegend, San Diego, CA) for 10 minutes in the dark. The reaction was
stopped using 1 M H2SO4 stop solution (Millipore Sigma, Burlington, MA) and plate absorbance
was measured at 450nm immediately. The assay was repeated with supernatants diluted 1:4 in
TSB if concentrations were determined to be above the standard curve. LTA concentration was
normalized to CFU count to allow for comparison between strains and antibiotic conditions.

Whole genome sequencing of bacterial isolates.

Bacterial genomic DNA extraction.

Clinical isolates (4 MRSA, 3 MSSA) were streaked and grown on tryptic soy agar overnight
prior to harvest for DNA extraction. DNA was extracted using the Qiagen QIAamp DNA Mini
Kit (Qiagen, Hilden, Germany) using the manufacturer’s modified protocol for gram positive
bacteria, including a mechanical lysis step using the Qiagen TissueLyser. DNA quantification
was assessed using Qubit fluorometric quantitation (Thermo Fisher, Waltham, MA). DNA
quality was analyzed using Nanodrop spectrophotometry (Thermo Fisher, Waltham, MA),
wherein absorbance ratios (260/280; 260/230) were used to determine sample impurities. The
target range for DNA purity was >1.8 for 260/280 and 260/230 ratios. All samples had >50ng/μl
of extracted DNA. Prior to DNA library prep, purified DNA samples were diluted to 0.2 ng/μl in
nuclease water and 5 μl of the diluted DNA was used for library prep, for a total input of 1 ng per
sample.
37
DNA Library Prep.

DNA libraries were prepared for sequencing using the Illumina Nextera XT kit (Illumina, San
Diego, CA) as per manufacturer’s instructions. Briefly, bacterial genomic DNA was fragmented
and tagged with adapters in a process known as tagmentation. PCR was used to label sample
libraries with specific i5 and i7 index codes for identification. The tagged and indexed libraries
were then washed three times and purified using ethanol and bead purification with Agencourt
AMPure XP beads to remove unused indexes (Beckman Coulter, Indianapolis, IN). Sample
libraries were then pooled and the quality of the pooled DNA libraries was then assessed on a
bioanalyzer to confirm that the indexed fragments were of the appropriate size, between 250-
1000 bp. The libraries were also quantified using the KAPA SYBR Fast Universal qPCR kit
(KAPA – Roche Sequencing, Indianapolis, IN) to inform sample loading to 20 pM. Before
sequencing, the pooled libraries were normalized to increase the likelihood of equal
representation of all sample libraries in the pool, diluted to 20 pM, and denatured. A 1% PhiX
library was added to the pooled library as a calibration control.

Illumina Whole Genome Sequencing.

Prior to initiating the sequencing run, the Illumina Miseq instrument (Illumina, San Diego, CA)
and all consumables, including the flow cell, were washed and prepared as indicated by the
manufacturer. The denatured pooled libraries were loaded into the MiSeq reagent cartridge and
sequenced using a paired run setup consisting of 2 x 301 cycles. The overall %>Q30, a measure
of quality, was 81.41% and the run had a 2.18% error rate. Following the completion of the
sequencing run, FASTQ files were generated using BaseSpace (Illumina, San Diego, CA) and
exported for further analysis.
38
Whole genome data analysis.

MLST & spa Typing

Multilocus sequence typing (MLST) was performed on the paired sequencing reads using the
MLST service provided by an online resource, the Center for Genomic Epidemiology (CGE)
bioinformatics server. CGE’s “spaTyper” algorithm was also used to assess spa typing of isolates
for further characterization. MLST types were further confirmed following alignment to
USA300_FPR3757 and assembly using the Complete Genome Analysis toolset provided by the
Pathosystems Resource Integration Center (PATRIC) (147). LTA release at baseline and upon
exposure to antibiotics were analyzed with respect to ST of the study strains.

Analysis of nucleotide and amino acid variations.
Comparison of strain nucleotide variation was conducted using PATRIC’s Variation Analysis
toolset. Clinical isolate paired end sequencing reads were assembled and compared to
USA300_FPR3757. While many variations were found, those relating to the LTA biosynthesis
pathway were specifically examined. Though there were numerous synonymous mutations in
which nucleotide sequences were altered but amino acid sequences remained the same,
nucleotide variations causing changes in protein amino acid sequence as well as frameshifts,
insertions, and deletions were of particular interest for further assessment. Variations of interest
were re-validated using Geneious Prime (Biomatters, Ltd. Auckland, New Zealand) sequencing
analysis software by mapping trimmed, error corrected, and normalized contigs to
USA300_FPR3757 and manually searching for single nucleotide polymorphisms (SNP) in genes
of interest. An online bioinformatics tool and predictive algorithm, Protein Variation Effect
Analyzer (PROVEAN), was used to predict the impact of amino acid substitutions on protein
39
function (148). A PROVEAN score of below -2.5 predicted that a given amino acid substitution
would have unspecified deleterious effects on protein function.

Virulence Factor Characterization.
Presence or absence of virulence factors was conducted through PATRIC Complete Genome
Analysis based on data compiled from Virulence Factor Database (VFDB) and Victors (149,
150). Virulence factor presence was also confirmed using CGE’s VirulenceFinder tool. In
addition to sequence type, study strains were grouped based on clinical phenotypes (resolving,
survived vs persistent, died) of the infected patients to determine if a specific set of virulence-
encoding genes may be associated with a negative clinical phenotype.

Statistical Analysis.
Statistical analysis was performed using Graphpad Prism version 8.0 (Graphpad Software, San
Diego, CA, USA) Data are represented through mean and standard error. One-way ANOVA or
paired t-tests, where applicable, were utilized to assess statistical differences between treatment
groups. P values ≤ 0.05 were considered significant.

Results.

S. aureus strains from patients with mortality due to persistent bacteremia are
characterized by low LTA release.

Release of LTA from bacterial cells into the culture supernatant was assessed using ELISA to
examine differences in LTA-releasing capabilities between strains that may correlate with
clinical phenotypes. The amount of LTA release from 7 bloodstream isolates during logarithmic
growth phase varies by 4-fold (Figure 3A and B). The median CFU-adjusted LTA release of the
40
7 clinical strains tested was 7.66e-006 ng. The strain (HH37) associated with the shortest
duration of growth in the blood and patient survival was shown to have the highest CFU-adjusted
LTA release (0.00201 ± 0.00039 ng), whereas the two strains (HH70 and HH35) associated with
prolonged duration of growth in the blood (11 and 17 days, respectively) and deaths had the
lowest release (1.70e-006 ng and 1.81e-006 ng, respectively). (Figure 3A) The observation of
lower LTA release with worse outcome (prolonged duration of bacteremia with or without death)
may be explained by low LTA release aiding immune evasion and preventing the host from
mounting a sufficiently robust pro-inflammatory response to facilitate bacterial clearance.

Additionally, we assessed the relationship between strain lineage background and LTA release
by comparing the amount of LTA release based on MLST sequence type (ST) (Figure 3B). A
total of six unique MLST types were represented in our collection of study strains (ST5, ST8,
ST97, ST30, ST72, ST188). Notably, LTA release at baseline did not correlate with strain
sequence type and differed greatly between strains from the same lineage (ST8 strains: HH131,
LA82, and USA300; ST5 strains: Mu3 and HH37).

41

Figure 3 LTA Release from S. aureus Bacteremia (SAB) Isolates.
A) Strains are grouped based upon duration of bacteremia from shortest to longest. B) Strains are grouped by
MLST sequence type from highest to lowest release. Other STs included ST97, ST30, ST72, ST188. LTA
release was quantified from bacterial supernatants using ELISA. Values are normalized by CFU to control for
differences in growth rate between strains. Supernatants were collected from 6 hour bacterial cultures and
represent the logarithmic phase of growth. CFU were determined by plating on tryptic soy agar. Statistical
analysis was performed using Student’s t test to compare strains of the same sequence type (black brackets,
ST8; red brackets, ST5). *p=0.05; **p=0.01; ***p=0.001.

S. aureus LTA release in response to antibiotic exposure was sequence type-specific
In addition to analyzing baseline LTA release from clinical strains (Figure 3), we also examined
LTA release in response to antibiotics for the study strains. The agents tested are anti-
staphylococcal antibiotics from different pharmacologic classes prescribed in the clinical setting.
Vancomycin, a standard treatment for SAB, is a glycopeptide antibiotic that disrupts cell wall
synthesis. Ceftaroline, a cephalosporin, also acts on the cell wall, whereas tedizolid is an
42
oxazolidinone and protein synthesis inhibitor that acts on the 50S bacterial ribosome. In general,
all antibiotics induced LTA release across strains but to varying degrees. (Figure 4A) Both
tedizolid and vancomycin robustly increased LTA release while ceftaroline contributed only
marginally to the increased release of LTA.

Furthermore, we analyzed whether strain response to antibiotic exposure on LTA release was
ST-specific. Interestingly, ST8 strains appeared to respond differently in comparison to ST5 and
other (ST30, ST72, ST97, and ST188) strains. ST8 strains released maximal LTA in the presence
of tedizolid while ST5 and other ST strains released maximal LTA in response to vancomycin
(Figure 4B). These data suggest that bacterial response in LTA release upon antibiotic exposure
may be ST-specific even though baseline LTA release appears to differ between strains within
the same lineage.
43

Figure 4 Differential LTA release upon antibiotic exposure.
(A) Mean LTA release with antibiotics shows maximal induction with vancomycin and tedizolid. (B) ST-
specific LTA release upon antibotic exposure. Response to antibiotics differs by MLST type, with
tedizolid inducing maximal release in ST8 strains and vancomycin inducing maximal release in non-ST8
strains. LTA release was quantified from bacterial supernatants with and without antibiotics using ELISA.
Antibiotics tested include ceftaroline (CFT), tedizolid (TED), and vancomycin (VAN). Antibiotic-treated
supernatants were compared with the no antibiotic control (NA). Values are normalized by CFU to
control for differences in growth rate between strains. CFU were determined by plating on tryptic soy
agar. Statistical analysis was performed using t test, ST5). *p=0.05.

44
Genetic Variations Within the LTA Biosynthesis, Modification, and Export Pathways

To better characterize the observed differential release of LTA across clinical strains, we
explored genetic variations in the LTA biosynthesis pathway that may lead to increased or
decreased release and/or synthesis of LTA. We identified missense mutations in DNA sequences
that impact the amino acid sequence of the protein, which may affect the protein’s function by
causing misfolding, loss of function, or other errors and examined variations in genes and
proteins that lead to structural modifications of LTA that could facilitate immune evasion, such
as depletion of D-alanylation, which renders S. aureus as less recognizable to toll-like receptors
(108, 151). We also evaluated nucleic acid changes in intergenic regions upstream of the gene
start site, as these changes could theoretically impact promoter regions and affect gene
expression (152). Specific genes of interest included: ltaS, dltA, dltD, ypfP, and
SAUSA300_0134 (rfbX) (Table 2). ltaS encodes a crucial biosynthetic enzyme that catalyzes the
production of polyglycerol-phosphate polymers that are necessary for LTA’s structural
composition (111). dltA and dltD encode proteins that facilitate the D-alanylation of LTA. dlt
mutants are more susceptible to TLR2 mediated killing and bacterial clearance because TLR2
more readily recognizes alanylated LTA. ypfP encodes a diglucosyldiacylglycerol synthase
glycolipid anchor that secures LTA to the cell membrane. Previous studies have demonstrated
that ypfP deletion mutants produce 50% more LTA in comparison to wild type S. aureus (110).
Additionally, we examined variations in SAUSA300_0134, also known as rfbX or polysaccharide
extrusion protein. This gene product is a relatively unknown protein that has been minimally
characterized in other species. The protein is theoretically involved in the export of LTA and
wall teichoic acids, according to the PATRIC analysis based upon the annotation of the USA300
genome.
45

All of the strains, outside of ST8, demonstrated mutations within the LTA biosynthesis pathway
(Table 2), with the highest number of unique mutations across genes attributed to HH92, a high-
releasing ST30 persistent strain. Overall the high releasing strains (HH37, HH92) showed
mutations in: ltaS intergenic region, dltA, dltD, rfxB, and rfxB intergenic region. The mutation
found in dltD was the same mutation in all strains, and thus most likely did not impact
differential LTA release. The mutations found in the high releasing strains were unique, as the
strains did not share any of the same mutations in ltaS intergenic region or dltA. On the other
hand, the strains shared several multiple amino acid mutations in rfxB which included:
AlaValIleAsnLeu363AlaValMetAsnLeu and IleIle371LeuVal (Supplementary Table S1).
However, both of these mutations were also shared with the low releasing strain, HH70, and
therefore are of unknown significance and may interact with another unknown gene to modulate
LTA release. In the rfxB intergenic region, there are 2 shared amino acid changes between HH37
and HH92, as shown in Supplementary Table S1, but low-to-moderate releasing strains LA164
and HH70 also share these variations. The low releasing strains HH70 and HH35, which are
persistent strains causing patient death, share 2 intergenic variations in ltaS, as shown in Table
S1. Both strains also share mutations in ypfP and rbfX with HH37, therefore it is unlikely this
mutation results in low LTA release. Similarly, the strains share nucleic acid variations with high
releasing strains HH92 and HH37 in the intergenic region of rbfX. There are no mutations shared
by all of the non-ST8 persistent strains (HH37, HH70, HH92); a similar finding is observed for
the resolving strains (LA164, HH37), which share none of the same genetic variations.

46
When mapped to USA300, the ST8 strains LA82 and HH131 showed no variations related to the
selected LTA biosynthesis genes or intergenic regions, suggesting that the LTA biosynthesis
pathway is conserved across ST8 strains, though additional strains would need to be analyzed to
support this notion. It is possible that because there were no genetic variations in biosynthesis
genes across ST8 strains, the observed differences in antibiotic response demonstrated in ST8
strains cannot be attributed to specific mutations in the LTA biosynthesis or modification
pathway, though there may still be alterations in gene expression due to mutations in regulatory
regions. The genetic differences in these strains that confer differential LTA-releasing
capabilities may be attributed to factors outside of the LTA pathway and/or features of LTA
biosynthesis that have not yet been identified and characterized. Additionally, post-translational
modifications and changes in mRNA production to facilitate gene expression could also affect
differential LTA release.
Strain characteristics Mutations in genes of interest
Lineage LTA release
upon VAN
exposure
Strain ltaS ltaS
intergenic
dltA dltd ypfP rbfX rbfX
intergenic
ST8 Moderate -
Low
LA 82,
HH131
none none none none none none none
ST5 High HH37 x x x x x x x
Non-ST8,
ST5
High HH35,
HH70,
HH92,
LA164
x x x x x x x
47

Table 2 ST-specific genetic variations within the LTA biosynthesis, modification, and export pathways in
relation to vancomycin-induced LTA release.
Whole genome data was obtained from SAB isolates using the Illumina Nextera XT DNA Library kit and
the Illumina MiSeq sequencing platform. Bacterial genomes and protein sequences were analyzed for
variations using PATRIC bioinformatics tools to align, assemble, and compare strains to USA300. If a
mutation is present, this is indicated with “x”. ST8 strains are marked with none, as ST8 strains did not
present any LTA-related mutations.

Variations in ST8 Strains that May Lead to Differential LTA Release

As discussed previously, the ST8 strains included in this study showed significant differences in
baseline LTA-releasing capability between strains, with HH131 demonstrating relatively high
release, USA300 releasing LTA quantities comparable to the median release of all strains, and
LA82 releasing the lowest quantity of LTA in the study. Despite these differences in baseline
LTA release, all three ST8 strains demonstrated the same trend in antibiotic-mediated LTA
release in comparison to other strains. However, there were no differences observed for the
selected genes of interest in the LTA synthesis, d-alanylation, or export pathways. Therefore, we
assessed genetic differences in ST8 strains beyond the selected LTA-related genes by examining
high-impact genetic mutations leading to amino acid changes, deletions, or insertions, as well as
select missense variants with putative relevance to LTA.

Mutations were found in a diverse set of proteins, including metabolic proteins (2-
isopropylmalate synthase; acryloyl-coa reductase; LysR transcriptional regulator), phage-
associated and mobile element proteins which would be expected to differ widely across strains
due to high transferability, and several hypothetical proteins that are not yet well characterized.
48
Interestingly, LA82 showed mutations in the autolysin gene (Atl) and had a missing start codon
upstream of the autolysin precursor gene. Autolysins in S. aureus are responsible for cleaving
cell walls during cell replication and cell turnover, and there is a regulatory relationship between
LTA and autolysin. When autolysins are depleted, wall teichoic acid production increases;
however, studies suggest that the effect upon LTA is inverse to wall teichoic acids, as ypfP
mutants demonstrate decreased autolytic activity (153, 154). Since LA82 is a low releaser of
LTA, it is plausible that changes in autolysin activity due to a mutation causes decreased LTA
synthesis or release, though additional studies are needed to better understand the relationship
between LTA release and autolysin activity. Conversely, HH131 did not display any autolysin-
related mutations. Instead, HH131 showed a missense variant in teichoic acid synthesis protein
X, produced by the tagX gene. TagX encodes a glucosyltransferase that may add glucosyl-
groups to wall teichoic acid molecules (155). However, it is unknown whether tagX mutations
are related to changes in LTA production.
Gene Product Nucleotide Change
(USA300 à LA82)
Amino Acid
Change
Mutation Type
Replication protein gaagaa à gaAAa Glu311fs Frameshift variant
Hypothetical protein
SAUSA300_1759
tgg à tgA Trp52* Stop Codon Gained
Mobile element
protein
SAUSA300_1810
gaaaaaaagaagacaacc à
GAAAAAAGAAGACAAC
Lys428fs Frameshift Variant
2-isopropylmalate
synthase
ttcaaaacctta à ttCAAACCTta Thr186fs Frameshift variant
Conserved
Hypothetical protein
SAUSA300_2615
ttggtaaaaaaaata à
ttGGTAAAAAAAAATa
Val66_Lys67fs Frameshift variant
Methionine ABC
transporter substrate-
binding protein
[upstream of autolysin
precursor]
atg à atA Met1? Start codon lost
49

Table 3 Genetic Differences Between ST8 Strains: USA300 vs LA82.
Whole genome data was obtained from SAB isolates using the Illumina Nextera XT DNA Library kit and the
Illumina MiSeq sequencing platform. Bacterial genomes and protein sequences were analyzed for variations using
PATRIC bioinformatics tools to align, assemble, and compare strains to USA300. Predicted High impact and/or
relevant mutations to LTA production or release are shown for LA82.

Gene Product Nucleotide Change (USA300
à HH131)
Amino Acid
Change
Mutation Type
Mobile element
protein
SAUSA300_1810
gaaaaaaagaagacaacc à
GAAAAAAGAAGACAACc
Lys428fs Frameshift
variant
Phage-associated
homing
endonuclease
tgtcacaacaaaaaagaa à
tgTCACAACAAAAAAAGaa
Asn81_Lys82fs Frameshift
variant
DNA-binding
protein, phage
associated
SAUSA300_1968
tcttaa à TCTTACTTAA Ser87_Ter88fs Frameshift
variant
Acryloyl-CoA
reductase
AcuI/YhdH
gaa à Taa Glu213* Stop gained
Putative antibiotic
transport-associated
protein
SAUSA300_2489
cgaatt à CGAAATt Arg610_Ile611fs Frameshift
variant
Exotoxin 15 aatacagct à aACt Asn108fs Frameshift
variant
Hypothetical
SAV0808 homolog,
near pathogenicity
islands SaPI att-site
agtgcaaaaaaagag à
agTGCAAAAAAAAGag
Ala25_Lys26fs Frameshift
variant
Teichoic acid
biosynthesis protein
X
gtg à gCg Val324Ala Missense variant
Hypothetical protein
SAUSA300_0081
aatatatatatatatataaattct à
AATATATATATATAAATTCt
Tyr290fs Frameshift variant
Transcriptional
regulator, LysR family

cttaaaaaaacg à
CTTAAAAAAAACg
Leu84_Lys85fs Frameshift variant
Autolysin agt à aAt Ser279Asn Missense variant
50
Table 4 Genetic Differences Between ST8 Strains: USA300 vs HH131.
Whole genome data was obtained from SAB isolates using the Illumina Nextera XT DNA Library kit and the
Illumina MiSeq sequencing platform. Bacterial genomes and protein sequences were analyzed for variations using
PATRIC bioinformatics tools to align, assemble, and compare strains to USA300. Predicted High impact and/or
relevant mutations to LTA production or release are shown for HH131.

Characterization of Overall Virulence of SAB Strains
We characterized the presence and absence of all virulence-encoding genes to determine other
contributing factors to the observed clinical phenotypes of bloodstream infection caused by the
study strains, independent of LTA release. The vast majority of assessed virulence-encoding
genes appeared in all strains (Table 5), showing that many of these are prevalent in bloodstream
isolates, whereas some appeared variably across strains; however, there was no clear association
between these variably present genes and patient outcome. A more detailed table with
descriptions of virulence factor function appears in Table S2, Supplementary Data.

Virulence-encoding genes that appeared only in select sequence types (ex. ST8 only, ST5 only)
were frequently members of the superantigen enterotoxin family (sea, seb, selk, selq, sec, sell).
Another superantigen, tsst-1, was found within the ST30 HH92 strain which caused bloodstream
infection in association with a cranial abscess in the patient. The ST8 strains also possessed
ACME, which is commonly found among strains within the ST8 lineage, and clfB, which is
involved in clumping and colonization. LA164, the ST188 strain, showed the presence of cna, a
collagen binding protein which functions as an adherence factor that facilitated bacterial
attachment in the patient’s urinary tract a potential nidus of bacteremia (156).

51
All strains had identical presence of cell-wall altering and stress response genes. The greatest
amount of variation appeared across the immunoregulatory genes, largely due to the differential
presence of toxin genes, as discussed previously. Notably, the resolving ST5 strain HH37, as
well as ST5 reference strain Mu3 appear to have the least number of genes encoding for
immunoregulatory factors and toxins, as both lack genes such as map, lukS-PV, and all
enterotoxins. Conversely, LA164, the other resolving strain contains an enterotoxin (seb) and a
unique adhesion (can), but shows fewer genes involved in global virulence regulation in
comparison to HH37.

ST5 ST8 Other STs
Gene HH37 Mu3 LAC82 HH131 USA300 HH92
(ST30)
HH70
(ST72)
HH35
(ST97)
LA164
(ST188)
Adhesion
cna
ebp
fnbA
icaABCD
icaR
sdrC
sdrD
thrB
Cell Wall Altering
femA / femB
mprF
msrR
SA1062 (stp)
SA1063 (stk)
Growth & Survival Within Host
ACME
adsA
aroA
asd
isdABCDEFGH
odhB
opp-2C
pURL
pyrAA
SAHV_0924
srtB
sspA
tilS (yacA)
52
trpABD
Immunoregulation
aur
capABCDEFGHIJKL
MNOP

chp
clfA
clfB
geh
hla
hlb
hld
hlgA
hlgB
hlgC
hysA
lip
lukF-PV
lukS-PV
lysA
map
msrA
sak
sbi
scn
sdrE
sea
seb
sec
selk
sell
selq
spa
sspB
tsst-1
vWbp
Stress Response
braB
clpP
clpX
dinG
recA
Virulence Regulation
ccpA
citB
esaA
esaB
esaC
essA
essB
essC
esxA
esxB
mgrA
53
oppD
oppF
SA1262 (cvfC)
SA1453
sspC
Table 5 Comparison of Virulence-encoding genes across strains
Whole genome data was obtained from SAB isolates using the Illumina Nextera XT DNA Library kit and the
Illumina MiSeq sequencing platform. Virulence-encoding genes were identified using Victors and VFDF databases
through the Complete Genome Analysis tool and confirmed with the CGE Virulence Finder tool. Blue highlights
correspond to presence of the gene within a given strain and gold indicates that the gene is absent, whereas purple
corresponds to variability within an operon of related genes, described further in Table S2. Strains are grouped by
MLST type.

Discussion.

Bloodstream isolates of S. aureus were examined for its LTA-releasing capability with or
without the presence of antibiotics in association with the varied clinical phenotypes, genetic
background, and mutations within LTA-related genetic pathways. In addition, overall presence
of virulence encoding genes was also assessed using whole genome sequence analysis.
The heterogeneity in LTA release, as well as virulence factor expression as a whole, may
significantly impact host immune response during SAB, contributing to the observed variability
in clinical presentation and patient outcomes. In contrast to other factors, such as staphylococcal
enterotoxins, which may be differentially expressed across strains, LTA plays a key role as a
ubiquitous, abundantly-present pro-inflammatory component of the S. aureus cell wall (108, 116,
117). As a virulence factor, it promotes immunomodulation primarily through its interactions
with TLR2, the primary host recognition receptor that recognizes LTA as an antigen (123, 142).
LTA also acts as a potential mediator of antibiotic and host defense peptide resistance through
cell wall thickening and D-alanylation, conferring enhanced strain fitness (155, 157).
54

We studied seven bloodstream isolates with different clinical phenotypes and two well-
characterized reference strains, Mu3 and USA300. Across strains, we found heterogeneity in the
amount of LTA released into the culture supernatant, ranging up to a 4-fold difference between
strains. When comparing clinical phenotypes with LTA release, we observed a general trend of
lower LTA release with more prolonged persistence of bacterial growth in blood of patients with
SAB. Specifically, the two low LTA releasing strains, HH35 and HH70, were obtained from
patients with 17 days of persistent bacteremia and died from the infection. It is possible that the
low level of LTA release may have failed to elicit a sufficiently robust pro-inflammatory
response, allowing for immune evasion and poor bacterial clearance. The association between
low LTA release and poor outcome and deserves confirmation with additional patients and
bacterial isolates. Conversely, HH37, the highest LTA release strain, caused bacteremia in a
patient with prompt clearance of bacteria after one day, suggesting that release of high
concentrations of LTA from S. aureus may have aided in early immune recognition. Future
studies should examine the relationship between strain LTA release and host immune response in
association of clinical outcomes as LTA release may be amenable to antibiotic modulation.

Antibiotic effects on LTA release have been previously reported with flucloxacillin,
ciprofloxacin, erythromycin, and clindamycin, wherein flucloxacillin and ciprofloxacin were
shown to induce LTA release while the protein synthesis inhibitors, erythromycin and
clindamycin, had inhibitory effects (11, 116). Vancomycin has not been previously studied,
however, its antimicrobial action on the cell wall may play a role in enhancing LTA release.
Though it has not been previously studied for its effects on LTA, we found that tedizolid, an
55
oxazolidinone protein synthesis inhibitor, increased LTA release, particularly in ST8 strains.
(10). This result was unexpected as other studies have reported suppression of LTA release with
protein synthesis inhibitors in laboratory strains of S. aureus. However, clinical strains may
respond differently than laboratory strains to antibiotics due to selective mutations gained from
their interaction with the host environment. It is possible that tedizolid could affect ST8 strains
differently due to differences in their membranes or cell walls. For example, tedizolid could
induce changes in synthesis of cell wall and membrane proteins, leading to weakening of the cell
wall and subsequent excess release of LTA.

Differences in antibiotic-induced LTA release across clinical strains may be related to antibiotic
resistance mechanisms and changes in cell wall structure, as demonstrated in a previously
published series of experiments in which S. aureus clinical strains were exposed to Triton-X, a
common detergent. In that study, clinical strains demonstrated differential LTA release following
treatment with Triton-X; changes were associated with differential expression of peptidoglycan
hydrolases, which are involved in forming and breaking peptidoglycan bonds, which would
change the structure of the cell wall (158). However, this theory requires further experimental
validation with antibiotic exposure in place of Triton-X.

LTA biosynthesis is a relatively conserved function in gram-positive organisms. Point mutations
causing amino acid variants can possibly alter protein production, protein-protein interactions,
protein structure, and/or protein function (159). Previous studies have similarly identified
genetic differences in LTA biosynthesis leading to structural changes in Streptococcus suis
strains, which may have implications for influencing the host immune response, though this has
56
not been extensively studied in S. aureus clinical strains (160). In this study, we identified
genetic differences in LTA biosynthesis and modification pathways in clinical strains causing
bloodstream infection, including variants in rfbX and dltA, that were predicted to have
deleterious impact upon protein function, in addition to several point mutations in ygfP, ltaS, and
dltD, which are of unknown significance. While much is unknown about the biological function
of rfbX in S. aureus, its expression has been shown to increase in mgrA mutant strains [49]. mgrA
is involved in cell surface protein expression and regulation of autolytic activity. Interactions
between mgrA and rfbX could potentially impact LTA production or release, as LTA is a cell
surface component that is also involved in the regulation of autolysis [50, 51]. No previously
published studies have examined specific mutations in S. aureus LTA biosynthesis pathways that
correspond with differential LTA release from the cell wall. Further experiments should be
conducted to confirm the contribution of these mutations to the observed differential LTA
release across strains using whole transcriptomic approach to assess LTA-related gene
expression in clinical strains and changes in gene expression level as the infection evolves.
Additionally, LA82, the lowest LTA releasing strain showed a point mutation in the autolysin
gene as well as a lost stop codon upstream of the autolysin precursor gene. Since autolysis and
LTA synthesis share a regulatory relationship, impaired autolysis could potentially decrease LTA
quantity within the cell wall. LTA release and expression of LTA biosynthetic genes should be
further characterized in autolysin (Atl) mutants to better elucidate the contributions of autolysin
to LTA production.

Taken together, the findings of this study suggest that that differential release of LTA in clinical
S. aureus bloodstream isolates may impact duration of bacteremia and ultimately outcome of
57
SAB. LTA release can be further modulated through the use of antibiotics, which could be used
selectively depending on strain genetic background (ST8 vs ST5 or others), to enhance host
immune response to facilitate prompt bacterial clearance and improve patient outcomes.
Additional studies are needed to better understand the significance of the identified genetic
variations and the numerous potential mechanisms leading to differential LTA release and their
interactions with antibiotics.

Supplementary Data.

Gene Gene Product Nucleotide Change
(USA300àISOLATE)
Amino Acid Change PROVEAN
SCORE
Strains
ltaS Lipoteichoic acid
synthase
ATT à CTT Ile129Leu 0.083 HH35
CAA à AAA Gln233Lys -0.888 LA164

ltaS
(Intergenic
region)
N/A C à T -- -- HH35,
HH70
G à A -- -- HH35,
HH92
GTTTTTATTATG à
GTTTTATTATG
-- -- HH35,
HH70
A à T -- -- HH70
T à A -- -- LA164
A à G -- -- LA164
dltA D-alanine--
poly(phosphoribit
ol) ligase subunit
1
GAA à AAA Gly177Lys 0.044 HH37
GTAAAC à GTGAG ValAsn274ValSer * HH37
CCA à CTA Pro318Leu -5.293 HH37
GAA à GAC Glu327Asp -1.418 HH37,
HH70
GAAGGC à
GCAGGT
GluGly111AlaGly * HH92
AAC à AGC Asn275Ser -0.400 HH92
dltD Poly(glycerophos
phate chain) D-
alanine transfer
protein DltD

GAA à GAT

Glu350Asp
-0.871 HH35,
HH37,
HH70,
HH92,
LA164
58
GAC à GAT Glu233Asp 0.536 HH70
ypfP Processive
diacylglycerol
beta-
glucosyltransferas
e (LTA membrane
anchor)

ACA à ATA

Thr249Ile
-1.355 HH35,
HH37,
HH70,
LA164

CGA à CAA

Arg363Gln

0.546

HH92
SAUSA300_
0134 / rfbX
Membrane protein
involved in the
export of O-
antigen, teichoic
acid lipoteichoic
acids
ATC à GTC Ile334Val -0.492 HH35

TTC à ATC

Phe392Ile

0.469
HH35,
HH37,
HH70,
LA164

ATT à GTT

Ile399Val

-0.055
HH35,
HH37,
HH70,
LA164
GCAGTGATAAACCT
A à
GCGGTAATGAATTT
A
AlaValIleAsnLeu
363AlaValMetAsn
Leu
* HH37,
HH70,
HH92
ATTATT à CTTGTT IleIle371LeuVal * HH37,
HHH70,
HH92
CAT à CTT His470Leu 1.791 HH70
GCA à GAA Ala127Glu -3.230 HH92
GGT à GTT Gly152Val 5.004 HH92
TCT à TGT Ser273Cys -0.885 HH92
ATG à TTG Met457Leu 0.466 LA164
Cà T -- -- HH35,
HH37,
HH92,
LA164
SAUSA300_
0134
Intergenic
region
N/A
Potential
regulatory role
T à C -- -- HH37,
HH92,
LA164
A à T -- -- HH37,
HH70,
HH92,
LA164
59
T à A -- -- HH92
T à G -- -- LA164
C à T -- -- LA164
Table 6 Characterization of genetic variations across strains
Whole genome data was obtained from SAB isolates using the Illumina Nextera XT DNA Library kit and
the Illumina MiSeq sequencing platform. Bacterial genomes and protein sequences were analyzed for
variations using PATRIC bioinformatics tools to align, assemble, and compare strains to USA300.
PROVEAN was used to determine the predicted impact of single point mutations on protein function.
*PROVEAN is unable to predict multiple amino acid mutation impact for bacterial species. Nucleic acid
variances leading to more than one amino acid substitution have not been assessed. Nucleotide variances
found in intergenic regions are nonprotein coding and thus do not correspond directly to amino acid
changes.

Gene Gene Product / Protein Function Clinical
Strains
Adhesion
cna Collagen binding protein MSCRAMM family adhesin,
adheres to collagen and
complement protein C1q
(161)
LAC164 (ST188)
ebp Elastin binding protein EbpS Integral membrane protein
involved in soluble elastin
and tropoelastin binding
(162)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
fnbA fibronectin binding protein A MSCRAMM, involved in
adhesion, invasion, and
colonization (163)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
icaA Polysaccharide intercellular adhesin (PIA)
biosynthesis, N-glycosyltransferase
Capsular polysaccharide
(Poly-N-acetyl-glucosamine)
and slime production, aids
biofilm formation;
synthesizes PNAG polymers
(164, 165)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
icaB Polysaccharide intercellular adhesin (PIA)
biosynthesis, deacetylase
Capsular polysaccharide
(Poly-N-acetyl-glucosamine)
and slime production, aids
biofilm formation – icaB
specifically produces
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
60
deacetylase needed for PNAG
affinity for the cell surface
(165)
icaC Polysaccharide intercellular adhesin (PIA)
biosynthesis protein icaC
Capsular polysaccharide
(Poly-N-acetyl-glucosamine)
and slime production, aids
biofilm formation; lengthens
oligomers of PNAG by
linking short polymers (165)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
icaD Polysaccharide intercellular adhesin (PIA)
biosynthesis protein icaD
Synergizes with icaA to
increase biofilm formation
and capsular polysaccharide
production (164, 165)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sdrC serine-aspartate repeat protein C MSCRAMM, Surface protein
important for biofilm
formation, interacts with
neighboring cell sdrC to
facilitate adhesion (166)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sdrD serine aspartate repeat-containing protein
D
MSCRAMM, adhesin that
binds to keratinocytes and
desquamated nasal cells via
desmoglein 1; neutrophil
contact upregulates
expression (167)
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
LA164 (ST188),
HH131 (ST8)
thrB Homoserine kinase Component of the threonine
synthesis pathway, potentially
related to biofilm formation
(168)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
Cell Wall Altering
femA / femB tRNA-dependent lipid II-Gly
glycyltransferase

Linked to methicillin
resistance, modulates glycine
content of peptidoglycan
(mutants have reduced
glycine content), leading to
less sensitivity to lysostaphin
and reduced autolysis;
reduction in peptidoglycan
cross-linking (169-171)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
mprF L-O-lysylphosphatidylglycerol synthase Membrane protein that
transports lysyl-
phosphatidylglycerol (PG) to
the outer leaflet of the
membrane; lysyl-PG supports
resistance to antimicrobial
peptides (172)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
msrR Peptide methionine sulfoxide reductase
regulator
Regulator of cell envelope
related functions; mutations
contribute to reduced wall
teichoic acids and partial loss
of virulence (173)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
SA1062 (stp) Protein serine/threonine phosphatase PrpC,
regulation of stationary phase
Mutants are larger, have
thicker cell walls with fragile,
electron dense membranes,
cell wall appears to “peel
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
61
away” from the bacterium
(174)
SA1063 (stk) Serine/threonine protein kinase PrkC,
regulator of stationary phase
Co-transcribed with SA1063,
mutants are larger, have
thicker cell walls with fragile,
electron dense membranes,
cell wall appears to “peel
away” from the bacterium
(174)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
Growth & Survival Within Host
ACME arginine catabolic mobile element Mobile genetic element that
allows for enhanced growth
of MRSA; consists of arc and
opp gene clusters; may
counteract nitric oxide
production by immune cells
(175)
LAC82 (ST8),
HH131 (ST8)
adsA Virulence-associated cell-wall-anchored
protein SasH; adenosine synthase
Excess adenosine promotes
immune evasion; adsA
required for S. aureus survival
in blood; helps SA immune
escape and abscess formation
(176)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
aroA 3-phosphoshikimate 1-
carboxyvinyltransferase
Required for pathogenesis,
mutants are attenuated in
mice; part of chorismite
biosynthetic pathway (177)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
asd Aspartate-semialdehyde dehydrogenase Enzyme essential for
synthesis of aspartate family
amino acids (lysine,
methionine, threonine);
essential for SA growth in
serum (178)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
isdABCDEFGH Cell surface protein/receptors involved in
heme transport
Hemoglobin binding and
membrane transport; iron
acquisition from host needed
to survive (179)
Missing isdE:
LA82 (ST8)

All genes present:
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
HH92 (ST30),
LA164 (ST188),
HH131 (ST8)
odhB Dihydrolipoamide succinyltransferase
component (E2) of 2-oxoglutarate
dehydrogenase complex
May aid survival and
virulence in whole blood,
involved in the TCA cycle,
upregulated by beta-lactam
exposure (180) (181)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
LA164 (ST188),
HH131 (ST8)
opp-2C Glutamine ABC transporter, permease
protein GlnP
Needed for growth and
virulence, downstream of
femA and femB, mutations
may affect peptidoglycan
crosslinking (182)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
62
purL Phosphoribosylformylglycinamidine
synthase, synthetase subunit
Purine synthesis during DNA
replication, alters colony
morphology so may play a
role in eliciting structural
changes (183)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
pyrAA Carbamoyl-phosphate synthase small chain Upregulated by agr, necessary
for growth in culture medium,
pyrimidine/arginine synthesis
(184)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
SAHV_0924 Hypothetical NagD-like phosphatase NagD mutant was severely
attenuated in its ability to
cause infection in C. elegans
model (184)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
srtB NPQTN specific sortase B Anchors iron-acquiring
surface proteins (virulence
factors) with NPXTN motif to
cell wall in response to
extracellular iron detection,
gene is located in iron-
regulated locus (isd); mutants
have impaired virulence and
cannot cause bacterial
persistence (185)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sspA Glutamyl endopeptidase precursor, serine
protease
Secreted as a precursor,
requires aur to become mature
serine protease; increases
autolytic activity which is
associated with virulence;
mutants are attenuated
particularly in systemic
infection model (186)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
tilS (yacA) tRNA(Ile)-lysidine synthetase Essential for growth, involved
in RNA modification and
lysidine synthesis, mutants
have attenuated growth (184)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
trpA Tryptophan synthase alpha chain Component of the tryptophan
synthase pathway (187)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
trpB Tryptophan synthase beta chain Component of the tryptophan
synthase pathway (187)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
trpD Anthranilate phosphoribosyltransferase Mutations cause auxotrophy
associated with TSST-1
production; now known that
mutations are found with
ST30 clade (HH92) (188)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
Immunoregulation
aur Zinc metalloproteinase aureolysin Major virulence factor:
cleaves LL-37, inhibits
complement system,
inactivates a1-protease
inhibitor which controls PMN
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
63
serine protease elastase (189,
190)
cap8A, cap8B,
cap8C, cap8D,
cap8E, cap8F,
cap8G, cap8H,
cap8I, cap8J,
cap8K, cap8L,
cap8M, cap8N,
cap8O, cap8P
Capsule type 8 synthesis enzymes

11 of the 16 cap8 open reading frames are
required for CP8 synthesis:
Capsules help SA to evade
phagocytosis, abscess
formation, bacterial
colonization, and aid in
survival and persistence on
mucosa and in the
bloodstream (191)
cap8H, I, J, K
missing or
mutated in HH70,
HH37, HH35,
LA82, HH131

HH131 most has
cap8A mutation
chp Chemotaxis-inhibiting protein CHIPS,
phage associated
CHIPS binds to neutrophils
and monocytes, inhibits PMN
calcium infiltration during
activation, and inhibits PMN
recruitment to site of infection
(192)
HH70 (ST72),
LA82 (ST8),
HH131 (ST8),

All persistent
strains
clfA Clumping factor ClfA, fibrinogen-binding
protein
ClfA binds plasma fibrinogen,
drives SA clumping in blood
plasma, helps SA evade
phagocytes, cell wall-
associated protein (162, 193)
HH35 (ST97),
HH37 (ST5),
HH70(ST72),
LA164 (ST188)
clfB Clumping factor ClfB, fibrinogen binding
protein
clfB binds plasma fibrinogen,
promotes nasal colonization
(194)
LAC82 (ST8)
geh Lipase precursor, glycerol ester hydrolase Confers esterase activity in
bacterial supernatants,
cleaving linoleic and oleic
acids and fatty acid
substrates; dampens immune
activation in host immune
cells (195, 196)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
hla Alpha hemolysin, cytolytic pore-forming
protein
Alpha toxin, involved in
disrupting a variety of host
responses, causing platelet
aggregation, lysis of immune,
epithelial, and endothelial
cells, tissue injury,
immunomodulation of host
cytokine response (197)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
hlb Beta-hemolysin Beta hemolysin, lyses red
blood cells and lymphocytes
(198)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
hld RNAIII Delta hemolysin, a phenol
soluble modulin; gene
embedded within RNA III
(small RNA with regulatory
function on agr); induce mast
cell activation and
degranulation (199)
HH37 (ST5),
HH70 (ST72),
HH92 (ST30),
LA82 (ST8),
LA164 (ST188),
HH131 (ST8)
hlgA Cytolytic pore-forming protein S
component, Gamma-hemolysin HlgA
Subunit A of gamma
hemolysin, plays regulatory
role in virulence via Sae (2
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
64
component sensing system)
(200)
LA164 (ST188),
HH131 (ST8)
hlgB Cytolytic pore-forming protein F
component, Gamma-hemolysin HlgB
Gamma hemolysin; Identical
to lukF, encoding PVL, pore-
forming toxin that leads to
cell lysis (201, 202)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
hlgC Cytolytic pore-forming protein S
component, Gamma-hemolysin HlgC
Gamma hemolysin; Identical
to lukS, encoding PVL, pore-
forming toxin that leads to
cell lysis (201, 202)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
hysA Hyaluronate lyase purcursor Cleaves hyaluronic acid;
hyaluronidases help virulence
factors disseminate and allow
for enhanced penetration into
tissues (203)
HH70 (ST72),
HH92 (ST30),
LA82 (ST8),
LA164 (ST188),
HH131 (ST8)
lip Triacylglycerol lipase Hydrolysis of extracellular
lipids to enhance immune
evasion (204)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
lukF-PV Cytolytic pore-forming protein F
component => Leukotoxin LukD
One of 2 secretory proteins
needed for PVL pore-forming
effect, destroys host immune
cells (neutrophils) (205)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
lukS-PV Panton-Valentine leukocidin chain S
precursor
One of 2 secretory proteins
needed for PVL pore-forming
effect, destroys host immune
cells (neutrophils) (205)
HH70, HH92,
LA82, LA164,
HH131
lysA Diaminopimelate decarboxylase Second-to-last enzyme in L-
lysine synthesis pathway;
mutants have decreased beta-
lactam resistance and overall
virulence (206)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
map Extracellular adherence protein of broad
specificity Eap/Map
MHC class II analog protein,
decreases T cell proliferation
and delays antigen-specific
response (207)
HH35 (ST97),
HH70 (ST72),
LA82 (ST8),
LA164 (ST188),
HH131 (ST8)
msrA Peptide-methionine (S) S-oxide reductase Expression enhanced by cell-
wall active antibiotics,
counteracts ROS production
in host phagocytes by
reversing reduction of
methionine (208)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sak Staphylokinase Converts plasminogen to
plasmin, which contributes to
fibrin breakdown; increases
bacterial invasiveness in skin
infection and confers
resistance to defensins
produced by neutrophils (209)
(210)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sbi IgG-binding protein SBI Second immunoglobulin-
binding protein (SBI), binds
the Fc receptor region of IgG
antibodies, similar to spa; can
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
65
also bind complement protein
C3; also enhances neutrophil
phagocytosis evasion and
promotes survival in whole
blood (211)
scn Staphylococcal complement inhibitor,
phage associated
Impairs neutrophil
phagocytosis by blocking
tagging of C3b on bacterial
cell surface by complement
proteins (212)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
HH92 (ST30),
LA164 (ST188),
HH131 (ST8)
sdrE serine aspartate repeat-containing protein E Binds complement regulatory
protein factor H (fH) and
cleaves C3b complement
tagging, leading to reduction
in phagocytosis (213)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
LA164 (ST188),
HH131 (ST8)
sea Exotoxin, Superantigen enterotoxin SEA Associated with food
poisoning, enhances
endotoxin effect,
pyrogenicity, and T cell
response, not regulated by agr
(214) (215)
HH92 (ST30)
seb Superantigen enterotoxin SEB Associated with food
poisoning, enhances
endotoxin effect,
pyrogenicity, and T cell
response, regulated by agr
(214) (215)
LAC164 (ST188)
sec Superantigen enterotoxin SEC Associated with food
poisoning, enhances
endotoxin effect,
pyrogenicity, and T cell
response, regulated by agr,
heterogeneous and can exist
in 3 subgroups
(214) (215)
HH70 (ST72)
selk Superantigen enterotoxin SEK Superantigen, enhances
endotoxin effect,
pyrogenicity, and T cell
response; associated with
food poisoning and toxic
shock syndrome; if seb and
sek are present together, this
is defined as a pathogenicity
island (216)
LAC82 (ST8),
HH131 (ST8)
sell Superantigen enterotoxin SEL Associated with food
poisoning, enhances
endotoxin effect,
pyrogenicity, and T cell
response (217)
HH70 (ST72)
selq Exotoxin, phage associated Superantigen, enhances
endotoxin effect,
pyrogenicity, and T cell
response; associated with
LAC82, HH131
66
food poisoning and toxic
shock syndrome
spa Protein A, von Willebrand factor binding
protein Spa
Allows for evasion of
phagocytosis through binding
of IgG, many variations
across clinical strains (spa
types) (218)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sspB Staphopain B precursor Impairs neutrophil and
monocyte phagocytosis and
chemotaxis, cleaves CD31 on
neutrophils causing
neutrophils to be
phagocytosed (219)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
tsst-1 Toxic shock syndrome toxin 1 Superantigen, causes
uncontrolled T cell response
associated with exaggerated
pro-inflammatory cytokine
response (220)
HH92
vWbp Secreted von Willebrand factor-binding
protein VWbp
Coagulase that causes
coagulation of human blood
plasma, binds to von
Willebrand factor and
converts fibrinogen to fibrin
via association with
prothrombin; necessary for
abscess formation and
persistent bacteremia in
animal models (221)
HH92, LAC82,
HH131
Stress Response
braB Na(+)-dependent branched-chain amino
acid transporter
Involved in NaCl tolerance
(222)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
clpP ATP-dependent Clp protease proteolytic
subunit
Important for stress survival
response and virulence, aids
in release of extracellular
toxins and enzymes (hla, spa,
RNAIII) (223)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
clpX ATP-dependent Clp protease ATP-binding
subunit
Associates with clpP to form
clpXP protease; important for
cell division, peptidoglycan
synthesis, replication of SaPI5
pathogenicity island (224)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
dinG DinG family ATP-dependent helicase Nuclease involved in DNA
repair, upregulated by agr
(225)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
recA Recombinase A Involved in DNA repair
during SOS response caused
by environmental stress (226)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
Virulence Regulation
ccpA catabolite control protein A Regulates gene expression for
a variety of functions in
growth & virulence, alters
HH35, HH37,
HH70, HH92,
67
transcription patterns of hla,
spa, and cap (227)
HH131, LA82,
LA164
citB Aconitate hydratase TCA cycle gene,
downregulation leads to
increased Staphyloxanthin
production (which helps SA
avoid ROS from PMNs) (228)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
esaA Putative secretion accessory protein
EsaB/YueB / bacteriophage SPP1 receptor
Component of the ESAT6-
like secretion system, part of
type VII secretion system –
membrane protein (229, 230)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
esaB Putative secretion accessory protein
EssB/YukD
Component of the ESAT6-
like secretion system, part of
type VII secretion system –
cytoplasmic protein, regulates
esaC production (229)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
esaC EsaC protein within ESAT-6 gene cluster Component of the ESAT6-
like secretion system, part of
type VII secretion system;
secretion substrate and
potential driver of persistent
infection (231)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
HH131 (ST8)
essA Putative secretion system component EssA Component of the ESAT6-
like secretion system, part of
type VII secretion system –
membrane protein (229)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
essB Putative secretion system component
EssB/YukC
Component of the ESAT6-
like secretion system, part of
type VII secretion system –
membrane protein (229)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
essC FtsK/SpoIIIE family protein, putative
EssC/YukB component of Type VII
secretion system
Component of the ESAT6-
like secretion system, part of
type VII secretion system –
membrane bound protein, 4
major variants (only essC1
produces esxC) (232)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
HH131 (ST8)
esxA 6 kDa early secretory antigenic target
ESAT-6
Component of the ESAT6-
like secretion system, effector
protein, may modulate
epithelial cell apoptosis and
contribute to PMN evasion
(233)
HH35, HH37,
HH70, HH92,
HH131, LA82,
LA164
esxB 10 kDa culture filtrate antigen CFP-10
(EsxB)
Component of the ESAT6-
like secretion system, effector
protein, may modulate
epithelial cell apoptosis and
contribute to PMN evasion
(233)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
LA82 (ST8),
HH131 (ST8)
mgrA Transcriptional regulator MgrA
(Regulatory of autolytic activity)
Global regulator that controls
cell surface protein
expression; involved in SA
clumping through ebh (Giant
Staphylococcal Surface
Protein) (234)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
68
oppD Oligopeptide ABC transporter, ATP-
binding protein OppD
Membrane-bound
cytoplasmic protein that binds
ATP needed for peptide
transport, may transport
“pheromones” that activate
virulence regulatory
mechanisms
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
oppF Putative glutathione transporter, ATP-
binding component
Membrane-bound
cytoplasmic protein that binds
ATP needed for peptide
transport, may transport
“pheromones” that activate
virulence regulatory
mechanisms (235)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
SA1262 (cvfC) hypothetical protein, cvfC operon Regulates expression of
virulence factors such as
hemolysin by controlling
thyA expression (thyA is
required for de novo DNA
synthesis and may play a role
in small colony variant
development) (236)
HH35 (ST97),
HH37 (ST5),
HH70 (ST72),
HH92 (ST30),
LA82 (ST8),
LA164 (ST188)
SA1453 hypothetical ortholog of CymR repressor controls cysteine synthesis
genes and affects sulfur
metabolism; alterations in
sulfur metabolism are evident
in pathogenic bacteria and
related genes are differentially
expressed upon
internalization of bacteria
within host cells; cymR
mutants also had impaired
biofilm formation and
decreased teichoic acid
synthesis and autolysin
activity but increased PSM
expression (237)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131
sspC Staphostatin B Cleaves staphopain B,
regulatory mechanism for
proteolytic activity (238)
HH35, HH37,
HH70, HH92,
LA82, LA164,
HH131

Table 7 Virulence genes present in all selected strains
Whole genome data was obtained from SAB isolates using the Illumina Nextera XT DNA Library kit and
the Illumina MiSeq sequencing platform. Bacterial genomes and protein sequences were analyzed for
variations using PATRIC bioinformatics tools to align, assemble, and compare strains to USA300.
PATRIC’s complete genome analysis tool was used to identify virulence factors.
69
Chapter 3: Differential effects of antibiotics on neutrophil activation against S. aureus ex
vivo.

Staphylococcus aureus is a leading cause of bacteremia and gram-positive sepsis in the United
States, affecting 80 per 100,000 individuals annually (57, 58). We and others have shown that
persistent bacteremia (SAB) despite receipt of antibiotics with in vitro activity, affects
approximately 1 in 3 patients and is a strong risk factor for mortality (6, 59, 69, 73). Specifically,
each day of persistence causes a 16% increase in the risk of 30-day mortality (73). Recent
evidence points to a dysregulated host immune response contributing to the development of
persistence (6, 84, 85, 239). S. aureus possesses a variety of virulence factors that can contribute
to immune dysfunction by modulating targeted pro-inflammatory responses. Importantly, S.
aureus can subvert the phagocytic actions of neutrophils (PMNs), which has been demonstrated
in animal models to drive persistent infection (240, 241).

Of interest, during S. aureus infection, neutrophils respond to a variety of bacterial pathogen
associated molecular patterns (PAMPs), including peptidoglycan and lipoteichoic acid (LTA),
which are recognized principally by the pathogen recognition receptor (PRR), Toll-like Receptor
2 (TLR2) (242). LTA is a lipoprotein cell wall component of all gram-positive bacteria that is
released from the bacterial cell wall spontaneously or following exposure to antibiotics (11, 116).
Previous studies have reported that LTA has significant pro-inflammatory effects on innate
immune cells and is able to initiate neutrophil activation, TLR2 signaling, and pro-inflammatory
cytokine response (10, 116, 142). Upon activation, PMNs undergo their effector functions that
aim to kill invading pathogens, including phagocytosis of bacteria; chemotaxis and migration to
70
the site of infection; interleukin-8 (CXCL8) secretion, which recruits additional PMNs and
immune cells; and prolonged lifespan, as evidenced by delayed apoptosis (243, 244). Activation
can be detected by shedding of L-selectin (CD62L) from the cell surface and upregulation of
integrin alpha M (CD11b) expression (116, 245). Ectodomain shedding of CD62L is necessary
for PMN “rolling” along epithelial tissues during chemotaxis, whereas CD11b is needed for
PMN adhesion to endothelial cells at the site of infection (246).

Baseline release of LTA from clinical strains that caused bloodstream infections appears to vary
by 4-fold, as discussed in detail in Chapter 2. In addition, exposure to antibacterial agents
appears to differentially affects the release of LTA release from S. aureus. Specifically, exposure
to cell-wall active antimicrobial agents, such as imipenem, flucloxacillin, and cefamandole has
been shown to significantly enhance the release of LTA whereas exposure to protein synthesis
inhibiting drugs, including clindamycin, gentamicin, and erythromycin, inhibits LTA release (10,
11). Therefore, we hypothesized that unique classes of anti-staphylococcal antibiotics may have
differential capacities for stimulating LTA-mediated PMN response. In this study, we sought to
investigate the stimulatory effects of ceftaroline, which has been used successfully as salvage
therapy in persistent MRSA bacteremia (247). We examined the immunomodulatory potential of
ceftaroline compared to the standard treatment vancomycin and daptomycin in the presence of
LTA. We tested antibiotics under the conditions of a high and a low exposure level of LTA in
human PMNs, to model the scenario in which different amounts of LTA are released during
infection due to variations in clinical strains and to examine the differential immunomodulatory
potential of antibiotics. Our results indicate that the pro-inflammatory effect of LTA is
concentration-dependent and that ceftaroline strongly promotes PMN activation and
71
phagocytosis while preserving cell survival and CXCL8 production, relative to other commonly
used drugs, such as vancomycin, which impairs CXCL8 secretion. In the context of persistent
bacteremia, our findings suggest that ceftaroline may be a preferred agent for stimulating PMN
function to facilitate prompt bacterial clearance and deserves confirmation in vivo.

Materials & Methods.

Isolation of Human Polymorphonuclear Leukocytes (PMNs) from Healthy Donors.
PMNs were obtained from whole blood of healthy volunteer donors. All donors gave informed
consent to participate in the study, as approved by the Institutional Review Board (IRB) for the
University of Southern California Health Sciences Campus. All research in this study was
conducted in compliance with IRB-approved methods and international human-subjects research
regulations.

PMNs were isolated from whole blood using EasySep™ Direct Human Neutrophil Isolation Kit
(STEMCELL Technologies, Vancouver, Canada). Briefly, whole blood was diluted and
incubated with immunomagnetic antibodies that bind to unwanted cells, leaving PMNs
undisturbed and in solution upon application of the tube to the EasySep™ magnet (STEMCELL
Technologies, Vancouver, Canada). Isolated cells were washed in PBS thrice and seeded at a
concentration of 1 x 10
6
cells/ml in complete medium at 37°C in 5% CO2. Following isolation,
cells were stimulated as indicated below.

72
Cell Culture and Stimulation.
Stimulation conditions. Cells were either unstimulated (cell culture media alone), stimulated
with antibiotics alone, stimulated with 1μg/ml or 10μg/ml of commercially obtained purified
LTA from S. aureus (Invivogen, San Diego, CA, USA), or stimulated with 1 or 10μg/ml of LTA
plus antibiotics. Antibiotics and LTA were added to the cells simultaneously. The following anti-
staphylococcal agents were selected for testing to represent different pharmacologic classes:
vancomycin (VAN), daptomycin (DAP), and ceftaroline (CFT). The active form of ceftaroline
was kindly provided by Allergan, Inc. (Irvine, California, USA). Antibiotics were tested at
concentrations needed to achieve the target AUC/MIC24 (VAN, DAP) or 5x MIC (CFT) for
efficacy using the respective MIC for each drug against the common and well-characterized
LAC USA300 community-acquired MRSA clinical strain (248-250) (23-25). MICs were
determined using broth microdilution testing and E-Test (bioMérieux, Marcy-l’Étoile, France).

Timepoint measurement.
The timepoints at which phagocytosis, flow cytometry, cell lifespan, and cytokine measurements
were taken are described below. For assessment of phagocytosis, time course studies were
completed at 4, 6, and 24 hours which indicated that PMN stimulation beyond 4 hours exhibited
a diminished phagocytic response, likely due to the rapid effector action of activated PMNs.
Examination of CD11b and CD62L was conducted at 4 hours, based on time course studies
completed at 3, 4, 6, and 24 hours which showed a diminished response beyond the 6-hour
timepoint and is consistent with previously conducted studies, which have shown sufficient and
differential expression of CD11b and CD62L with LPS at 3 hours while others have assayed
PMN CD11b expression at 6 hours (116, 251). Therefore, we have selected the 4 hour timepoint
73
for measurement of phagocytosis and cell surface expression of CD11b and CD62L as well as
TLR-2 to allow for comparison between phagocytosis and activation data. CXCL8 cytokine
measurements were collected at 16 hours, to compensate for both peak release and degradation.
Previous studies have also shown optimal CXCL8 production in PMNs with LTA stimulation at
16 hours (10, 116). Apoptosis and cell survival was measured at 16 hours via flow cytometry
since previous studies have shown that 40-60% of unstimulated PMNs are apoptotic between 12-
20 hours (252, 253); thus, we chose the later timepoint within the range to allow for sufficient
capturing of the effect of LTA on PMN survival.

PMN Functional Assessment by Flow Cytometry Analysis.
Following stimulation with LTA and/or antibiotics, PMNs were harvested for flow cytometry
analysis. At 4 hours, CD11b, CD62L, and TLR2 expression was analyzed by staining cells in
separate tubes with Rat PE Anti-Human CD11b Clone M1/70 (BD Biosciences, San Jose, CA,
USA), Mouse FITC Anti-Human CD62L clone DREG-56 (ThermoFisher Scientific, Waltham,
MA, USA), and PE Mouse Anti-Human CD282 (TLR2) Clone: TL2.1 (ThermoFisher Scientific,
Waltham, MA, USA). At 16 hours, PMN apoptosis was assessed by labeling PMNs with the
Invitrogen Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis Kit, per manufacturer’s
instructions (ThermoFisher Scientific, Waltham, MA, USA). Data was collected using the BD
LSR Fortessa X-20 and analyzed using FlowJo software (FlowJo, LLC, Ashland, OR, USA).

Phagocytic activity was assessed after incubating PMNs at 37°C for 3 h in a 96-well flat-bottom
plate with or without LTA and/or antibiotics, added simultaneously. Following 3 hours of
incubation in the presence of LTA and/or antibiotics, the pHrodo green S. aureus Bioparticles
74
Conjugate for Phagocytosis (ThermoFisher Scientific, Waltham, MA, USA) was added to assess
for changes in pH associated with phagocytosis per manufacturer’s instructions. PMNs were
incubated with pHrodo for 1 hour at 37°C without CO2 before reading on a spectrofluorometer,
for a total incubation time of 4 hours (3 hours LTA/antibiotics followed by 1 hour
LTA/antibiotics with added pHrodo).

Cytokine Quantification by ELISA.
Cell culture supernatants were collected in triplicate from PMNs following 16 hours of
stimulation with antibiotics and LTA. Supernatants were stored at -80°C until use. Release of
CXCL8 was determined using MesoScale Discovery multiplex ELISA and analyzed in duplicate
(MesoScale Discovery, Gaithersburg, MD, USA). The accompanying SECTOR Imager SI2400
and MSD Workbench software were used for analysis. The lower limit of detection for CXCL8
was 0.16 pg/mL, as per manufacturer’s instructions. Samples with values below the limit of
detection were assigned a value of 0 pg/ml.

Statistical Analysis.
Statistical analysis was performed using Graphpad Prism version 8.0 (Graphpad Software, San
Diego, CA, USA) Data are represented through mean and standard error. Paired T-test or Two-
way ANOVA with post-hoc corrections, where applicable, were utilized to assess statistical
differences between treatment groups. P values ≤ 0.05 were considered significant.

Results.

Neutrophil Activation, Phagocytosis, and Cell Survival is Differentially Affected by LTA
Exposure Level and Antibiotics.
75
We used two different exposure levels of LTA (high: 10μg/ml; low: 1μg/ml) in combination with
anti-staphylococcal antibiotics (vancomycin, VAN; daptomycin, DAP; and ceftaroline, CFT) to
stimulate PMNs isolated from healthy human donors. To measure whether antibiotics promote
neutrophil activation, we assessed cell surface expression of CD11b and CD62L after 4 hours of
stimulation with LTA and antibiotics. During PMN activation, CD11b has an inverse
relationship with CD62L; while CD11b is upregulated, CD62L is shed from the cell surface
(116, 245, 246).

PMNs exposed to high level of LTA appeared to show increased activation in the presence of all
antibiotics (Figure 5). Compared to high LTA alone, addition of CFT robustly induced CD11b
expression and decreased CD62L expression in PMNs, indicating a greater proportion of
activated PMNs in the presence of CFT (CD11b, p=0.01; CD62L, p=0.03). At the lower level of
LTA, none of the antibiotics tested had a significant effect on CD11b or CD62L expression.
DAP and VAN modestly increased CD11b and decreased CD62L, but the effect was not
significant. Antibiotics alone did not appear to have significant effects on CD11b or CD62L,
though a small increase in CD62L can be observed with the addition of antibiotics without LTA,
indicating a tendency for PMNs to remain in the resting state with antibiotics alone.

76
CD11b and CD62L expression were determined at 4 hours following stimulation using flow cytometry.
CD62L and CD11b are inversely correlated markers of PMN activation, with CD62L shedding and CD11b
upregulation indicative of activation. Statistical significance was determined using paired t-test * p<0.05;
**p<0.01. VAN, vancomycin; CFT, ceftaroline; DAP, daptomycin.

Neutrophil Phagocytosis
Human PMNs exposed to high and low levels of LTA in the presence of antibiotics were
analyzed for phagocytic function and TLR-2 expression following 4 hours of stimulation.
Phagocytosis was assessed using pHrodo S. aureus bioparticles, a commercially available
fluorescent pH-dependent assay which produces more fluorescence when particles are
phagocytosed due to an alteration in acidity. CFT alone had no effect on phagocytosis while
VAN and DAP had non-significant inhibitory effects (Figure 6A). LTA at the high level alone
caused a slight decrease in phagocytosis but were reversed by all tested antibiotics. In particular,
addition of CFT to PMNs exposed to high LTA level significantly increased PMN phagocytosis
(p=0.02) compared to high LTA alone while VAN and DAP also increased phagocytosis but to a
Figure 5 Effects of high (10 μg) and low (1 μg) level of LTA and antibiotics on CD11b (A) and CD62L expression
(B) in human neutrophils isolated from healthy volunteers.
77
lesser extent in comparison to CFT and the increase did not differ significantly from LTA alone
(p=0.56, p=0.51, respectively). With low level LTA exposure, VAN and CFT had no effects on
phagocytosis, whereas DAP had a mild inhibitory effect that was not statistically significant.

TLR2 expression was analyzed via flow cytometry (Figure 6B). TLR receptors are internalized
at the time of phagocytosis, and while they do not directly signal the cell to phagocytose external
materials, TLRs play a role in driving the inflammatory response with some studies suggesting
that phagocytosis is a component of effective TLR2 signaling, and that TLR2 internalization is
necessary for PMN activation (254, 255). While there were notable differences between the
phagocytosis and TLR2 findings, TLR2 signaling appeared to correspond with phagocytic
function overall as determined by Pearson’s r correlation (p=0.04). In general, as phagocytosis
increases, TLR2 cell surface expression decreases, which is most likely a function of TLR2
internalization prior to phagocytosis (123). However, addition of antibiotics did not appear to
directly alter TLR2 expression of PMNs in the presence of either high or low level of LTA.
Figure 6 Effects of high (10 μg) and low (1 μg) levels of LTA and antibiotics on phagocytosis (A) and TLR-2 expression
(B) in human neutrophils isolated from healthy volunteers
78
Phagocytosis was assessed at 4 hours after stimulation using pHrodo S. aureus bioparticles and a fluorescent
plate reader. TLR-2 expression was determined at 4 hours following stimulation using flow cytometry.
Statistical significance was determined using paired t test * p<0.05. VAN, vancomycin; CFT, ceftaroline;
DAP, daptomycin.

Neutrophil Survival
PMNs have a short half-life in circulation if not activated by external stimuli, surviving for less
than 24 hours in the bloodstream (256). PMN activation by LTA has been demonstrated to
significantly lengthen lifespan, which may occur through NFκB signaling (116, 256). In this
study, PMNs were stimulated with or without LTA and antibiotics for 16 hours. Following
incubation, cells were harvested and stained with FITC-conjugated Annexin V and propidium
iodide (PI). Annexin V binds to phosphatidylserine, a cell membrane component, which is
located on the cell surface during apoptosis, whereas PI is a DNA-intercalating agent that is only
able to permeate the cell membrane of dead cells. Double stained cells are considered to be in
late apoptosis or necrosis (257). Living cells, therefore, remain unstained by both Annexin V and
PI.

While cell death and necrosis were minimally observed across conditions, PMN apoptosis
appeared dependent on stimulation with LTA (Figure 7A). After 16 hours, healthy donor PMNs
that were not stimulated with LTA or antibiotics had a mean survival rate of 28.3% ± 12.70
(Figure 7B). In comparison, PMNs stimulated with 1μg/ml or 10μg/ml LTA had mean survival
rates of 48.3% ± 22.0 and 57.6% ± 18.5, respectively, which represents a significant increase in
survival versus the unstimulated control (1μg/ml, p= 0.01;10μg/ml p= 0.008). Antibiotics alone,
79
in the absence of LTA, had a modest, but not significant, positive effect on increasing PMN
lifespan, in comparison to unstimulated PMNs (VAN, 33.42%; CFT, 33.60%; DAP, 39.30%). In
the presence of high level LTA, a trend towards prolonging PMN lifespan was observed with the
addition of CFT (from 57.6% ± 18.59 to 62.1% ± 16.45, p=0.08). VAN and DAP had modest
positive effects on PMN survival. It is notable that significant differences in PMN survival were
more likely detected between the different levels of LTA exposure than between different
antibiotics, which supports LTA exposure level as the most likely factor contributing to the
length of PMN lifespan.
Effects on PMN lifespan and survival were determined at 16 hours following stimulation using flow cytometry
with Annexin V and propidium iodide (PI). Live cells are unstained, whereas Annexin V stains apoptotic cells
and PI permeates dead cells. Double-stained cells are considered necrotic. Statistical significance was
determined using paired t-test * p<0.05, **p<0.01. VAN, vancomycin; CFT, ceftaroline; DAP, daptomycin.

Figure 7 Effects of high (10 μg) and low (1 μg) levels of LTA and antibiotics on PMN lifespan (A) and survival
(B) in human neutrophils isolated from healthy volunteers.
80
Vancomycin Decreases CXCL8 Production in PMNs Under High Exposure Levels of LTA,
whereas Ceftaroline Preserves Pro-Inflammatory Response.
CXCL8 is a chemokine secreted by PMNs to stimulate a variety of pro-inflammatory innate
immune responses, including phagocytosis, chemotaxis, and recruitment of additional PMNs to
the site of infection (116, 258). Following incubation for 16 hours with or without LTA and
antibiotics, PMN secretion of CXCL8 in cell culture supernatants was determined via ELISA.
The effect was demonstrated to be concentration-dependent, with high LTA causing significantly
higher CXCL8 production in comparison to low LTA (p<0.0001) (Figure 8). In the presence of
the high LTA, addition of VAN significantly decreased CXCL8 response (p=0.005), and DAP
showed a strong trend towards CXCL8 reduction (p=0.06). Conversely, CXCL8 response was
not significantly affected by addition of CFT, suggesting preservation of the pro-inflammatory
response. In the presence of low LTA exposure, CFT and DAP had no effect on CXCL8
secretion from PMNs whereas a small, non-significant decrease was observed with VAN.
Additionally, CXCL8 response was correlated with TLR-2 response and cell survival, based on
Pearson r correlation (TLR-2, p= 0.01; survival, p=0.01), which supports the role of CXCL8 in
PMN activation and pro-inflammatory processes following exposure to LTA.

81
CXCL8 production was determined at 16 hours following stimulation using ELISA. Statistical significance
was determined using paired t test. * p<0.05, **p<0.01, ****, p<0.0001. VAN, vancomycin; CFT, ceftaroline;
DAP, daptomycin.

Discussion.

In this study, we evaluated antimicrobial agents commonly prescribed for the treatment of S.
aureus bacteremia, including vancomycin, used as a standard treatment, and alternative agents
such as daptomycin and ceftaroline; the latter are typically reserved for patients who have failed
or are intolerant to vancomycin. Ceftaroline fosamil, is a pro-drug formulation of ceftaroline,
approved by the FDA for the treatment of MRSA skin and soft tissue infections and community-
acquired pneumonia. Though it is not specifically approved for use in bacteremia, it has been
used successfully as salvage therapy in serious MRSA infections such as persistent bacteremia
and infective endocarditis. We hypothesized that the therapeutic benefit observed with
Figure 8 Effects of high (10 μg) and low (1 μg) concentrations of LTA and antibiotics on production of CXCL8
in human neutrophils isolated from healthy volunteers.
82
ceftaroline as salvage therapy during persistent bacteremia (66, 247, 259) may result from the
innate immune stimulatory effects of ceftaroline, which have not been previously assessed. In
this study, VAN and DAP demonstrated select, modest but insignificant stimulatory effects on
PMNs in the presence of LTA (increased phagocytosis, increased CD11b production). Previous
studies have shown that in the presence of the gram-negative endotoxin, lipopolysaccharide
(LPS), VAN enhanced phagocytosis and gene expression of TLRs 1, 2, 4, and 7 in a human
THP-1 monocytic cell line; however, VAN also induced IL-10 gene expression, as well as TNFα
and IL-1β response, indicating that it has pleiotropic effects on different cell types (130). In a
whole blood model of MRSA infection, VAN was shown to decrease IL-6 and CXCL8 response
(260); our study also demonstrated a reduction in CXCL8 production by VAN. Accordingly,
VAN has also been shown to impact adaptive immunity in a study of patients with inflammatory
bowel disease (IBD) in which VAN was shown to induce T regulatory cell production, which
may have protective effects in the IBD population, but could negatively impact patients with
sepsis by producing an excess of IL-10, contributing to the dysregulated immune response (261).

The immunomodulatory activities of DAP have also been assessed previously. Specifically, DAP
was shown to decrease TLR 1, 2, and 6 expression and had no effect on phagocytosis (130).
Others have shown that in the presence of LPS, DAP has no significant effects on host cytokine
response (262). Thallinger et al. speculated that DAP does not achieve high intracellular
concentrations for different types of immune cells, including neutrophils, which results in its
limited capacity to exert immunomodulatory effects (15). It is possible that the low volume of
distribution as well as the hydrophilic core of daptomycin limits the drug’s ability to penetrate
into the cytosol and nucleus necessary for exerting changes to host genetic regulatory
83
mechanisms that control immune response (262, 263). While the exact mechanisms that account
for the differential immunomodulatory effects observed between antibiotics from different
classes remain unknown, tight binding to intracellular structures or inactivation under low pH
conditions inside the phagosome may reduce the intracellular bioactivity of one drug more than
another (260, 264-268). Additional studies examining the underlying mechanisms of
immunomodulatory activity, including variability in drug intracellular distribution in immune
cells, are needed to better understand the complex interplay between host cells and antibiotics.

Our study demonstrates that in the presence of staphylococcal LTA, ceftaroline positively affects
PMNs in terms of phagocytosis, cell survival, and PMN activation, as evidenced by its effects on
CD11b and CD62L. Compared to vancomycin and daptomycin which demonstrated a
dampening in CXCL8 production in the presence of high LTA, ceftaroline did not alter CXCL8
production, indicating a preservation of the pro-inflammatory response. The results of this study
offer a biological basis for the therapeutic benefit observed with ceftaroline in the setting of
persistent S. aureus bacteremia through its immunostimulatory effects on neutrophils. Our
findings deserve confirmation with additional in vivo and clinical studies in patients with
persistent bacteremia.

Taken together, the results of our study may have implications on the selection of therapies for
the treatment of S. aureus bacteremia by harnessing the immunomodulatory potential of different
antibiotic agents. For example, agents such as vancomycin and daptomycin could be utilized for
their “neutral” effects on innate immunity, which would be beneficial for patients with a
relatively “balanced” pro-inflammatory and anti-inflammatory immune response. These patients
84
would likely have better outcomes with therapies that minimally interfere with the natural course
of the immune response, as not all patients are suitable candidates for agents that enhance pro-
inflammatory response. Conversely, ceftaroline could be beneficial in patients with persistent
bacteremia resulting from a dysregulated immune response, given the drug’s activating effect on
neutrophil function. Future studies of anti-staphylococcal therapeutics should examine the
mechanism of action to determine how antibiotics from different pharmacologic classes interact
with host immune cells to exert immunomodulatory activity besides their direct antibacterial
activity.

The findings from this study suggest that antibiotic therapy selection should take into account
bacterial burden, strain-specific differences in LTA production, and host immune status as initial
steps towards implementation of precision therapies for infectious diseases. Predictive modelling
experiments of SAB incorporating patient data such as genotypes and clinical outcomes, have
demonstrated the advantage of personalized therapies for SAB (269). Since antibiotics are the
primary therapy used to treat SAB, they present a unique opportunity to harness both direct
antibacterial and immunomodulatory activity as a comprehensive strategy to individualize
treatment for persistent S. aureus bacteremia.

85
Chapter 4: Antibiotics Differentially Modulate LTA-mediated Host Immune Response to
Staphylococcus aureus in Human PBMCs.

The majority of sepsis-related deaths (>70%) occur more than five days after onset of sepsis (5).
Late-stage mortality has been attributed to a dysregulated host immune response predominated
by increased production of anti-inflammatory cytokines (e.g. high IL-10/TNFα ratio) that confers
an immunoparalysis state leading to persistent primary infection or development of secondary
infections in a subset of patients (6, 29). This immunoparalysis state is further characterized by
monocyte deactivation, T-cell hyporesponsiveness and apoptosis induction, and impaired
phagocytosis (29). Notably, downregulation of HLA-DR is the most prominent and frequently
measured marker of immunoparalysis in sepsis (48). HLA-DR is a major histocompatibility
(MHC) class II cell surface receptor present on monocytes and dendritic cells that is responsible
for presenting antigens to CD4+ T cells and influences selection of T helper cells in the thymus,
thereby initiating and activating the adaptive immune response. An additional marker of interest
that bridges innate and adaptive immunity includes programmed cell death ligand 1 (PD-L1) on
monocytes, which communicates with the inhibitory program cell death receptor (PD-1) located
on the surface of activated T cells and initiates apoptosis of T cells. Increased PD-L1 expression
has been shown previously to be strongly associated with increased risk of mortality in patients
with septic shock (52).

Staphylococcus aureus bacteremia is a leading cause of sepsis and is associated with significant
morbidity and mortality. The incidence of S. aureus bacteremia varies between 10 to 30
infections per 100,000 person years and is the most common bacterial cause of sepsis in ICU
patients (1, 55). Despite receipt of antibiotic therapy, persistent growth of the bacterium in blood
86
for at least 3 days after start of antibiotic therapy occurs in 37% of patients and is associated with
16% increased risk of death for each day of persistent bacteremia (73). Similar to observations
described above in patients with sepsis, our group has reported that an early dysregulated host
response marked by high IL-10/TNFα ratio in patients with S. aureus bacteremia was predictive
of persistence and 30-day mortality (29, 270). High IL-10/TNFα ratio suggests a shift towards
immunoparalysis, which may preclude effective bacterial clearance, leading to bacterial
persistence.

Lipoteichoic acid (LTA) is an abundant and essential component of the cell wall of S. aureus and
other gram-positive bacteria that is released during normal growth, as well as following
antibiotic exposure (10, 11). Of interest, LTA has been shown to affect host immune response
through its interactions with immune cells in a multitude of ways (119, 123). Namely, LTA
exerts immunostimulatory effects through the induction of pro-inflammatory cytokine release in
neutrophils and monocytes, while others have found LTA to be a potent inducer of IL-10
production via toll-like receptor 2 signaling, which results in reduction of HLA-DR expression
and inhibition of T cell activation via PD-1/PD-L1 (89, 116-119, 123). The pleotropic effects of
LTA observed upon host inflammatory and immune response appear to be similar to
lipopolysaccharide (LPS), the well-characterized component present in gram-negative bacteria
that is involved in the development of septic shock while also known to induce a state of immune
tolerance upon repeated challenge (126). Previously published in vitro data demonstrates that
LTA release with and without antibiotics typically ranges between 1 and 10μg, with variations
among clinical S. aureus strains (10, 11). Others have shown that LTA is detectable in blood and
87
thus may serve as a marker of pathogen or virulence load for potential diagnostic and/or
therapeutic target for immunomodulation in S. aureus bacteremia (271).
In clinical practice, the current approach to managing SAB relies primarily on the selection of
antibiotics based on organism identification and susceptibility alone, without specific regard to
the heterogeneity in host immune response between individuals. Published studies have
demonstrated that some antibiotics can exert immunomodulatory effects on host cells, separate
from their direct inhibitory and killing action upon susceptible pathogens. One study found that
upon exposing monocytes to lipopolysaccharide (LPS), both fosfomycin and clarithromycin
stimulated IL-10 release while suppressing TNFα, CXCL-8, GM-CSF production (14). Others
have shown that linezolid is more potent than vancomycin in suppressing pro-inflammatory
cytokine production and that the effect diminishes when addition of the antibiotic to monocytes
infected with MRSA ex vivo is delayed from 3 to 9 hours (134).

Taken together, we hypothesize that host immune response is affected by LTA release from S.
aureus and that the LTA-mediated immune response is differentially impacted upon exposure to
anti-staphylococcal antibiotics from different pharmacologic classes: vancomycin (VAN),
tedizolid (TED), and daptomycin (DAP). In this study, we examine the effects of antibiotics
upon selected markers of immunoparalysis and immune activation ex vivo using THP-1
monocytes and human PBMCs exposed to two different doses of LTA to account for the range of
LTA release by different S. aureus strains and for potential for differences in bacterial burden
during infection. Our ultimate goal is to aid clinicians in the selection of an antimicrobial
regimen that maximizes treatment success for S. aureus bacteremia by harnessing both its
88
antimicrobial and immunomodulatory actions, specific to the individual patient’s immune
response to the infecting pathogen.

Materials & Methods.

Isolation of Peripheral Blood Mononuclear Cells (PBMCs).
PBMCs were obtained from whole blood of healthy volunteer donors. All donors gave informed
consent to participate in the study, as approved by the Institutional Review Board (IRB) for the
University of Southern California. All research conducted in this study was conducted in
compliance with IRB-approved protocol and international human-subjects research regulations.

PBMCs were isolated using SepMate™ PBMC Isolation tubes and Lymphoprep™ density
gradient (STEMCELL Technologies, Vancouver, Canada). Briefly, whole blood was diluted 1:1
in phosphate buffered saline (PBS) and 2% fetal bovine serum (FBS) and layered over the
density gradients in the separation tubes and centrifuged for 10 minutes at 1200 x g. Isolated
cells were washed in PBS three times and resuspended in fresh RPMI 1640 with 10% FBS.
Following isolation, PBMCs were seeded at a density of 2.5 x 10
5
cells per well in RPMI 1640
with 10% FBS. Cells were stimulated as described below.

THP-1 Lucia NFκB Reporter Cells.

NFkB Lucia Reporter THP-1 Monocytes (Invivogen, San Diego, CA, USA) were cultured in
10% FBS and RPMI 1640 with 2 mM L-glutamine and 25 mM HEPES. Zeocin was added at
every other passage to maintain cell line stability. Prior to stimulation, cells were cultured in 1%
FBS and RPMI 1640 with 2 mM L-glutamine and 25 mM HEPES and starved overnight. Cells
89
were then seeded at a density of 1 x 10
6
cells per well and allowed to rest for 4 hours prior to
stimulation for 16 hours.

Cell Culture and Stimulation.

Stimulation conditions. Cells were either untreated, stimulated with antibiotics alone, stimulated
with 1 ug or 10 ug of commercially obtained purified LTA from S. aureus (Invivogen, San
Diego, CA, USA), or stimulated with 1 or 10 μg of LTA plus antibiotics. The following anti-
staphylococcal agents were selected for testing to represent different pharmacologic classes:
vancomycin (VAN), tedizolid (TED), and daptomycin (DAP). Concentrations of antibiotic used
were the minimum inhibitory concentrations (MICs) for vancomycin, tedizolid, and daptomycin
against the common and well-characterized LAC USA300 community-acquired MRSA clinical
strain (1.5 μg/ml VAN, 2 μg/ml TED, and 0.25 μg/ml DAP, respectively). MICs were
determined using broth microdilution testing.

Timepoint measurement. The timepoints at which flow cytometry, cytokine measurements, and
NFkB measurements were taken are described below. Flow cytometry experiments were
conducted at 4 hours (data not shown) and 24 hours, with more prominent effects demonstrated
at 24 hours. Cytokine measurements were collected at 24 hours, to compensate for both peak
release and degradation, and to allow for direct comparison with flow cytometry data. NFkB
activation was measured according to manufacturer’s protocol.

90
Cytokine Quantification by ELISA.
Cell culture supernatants were collected in triplicate from PBMCs following 24 hours of
stimulation. Supernatants were stored at -80°C until use. Release of IL-10 and TNFα was
determined using MesoScale Discovery multiplex ELISA and analyzed in duplicate (MesoScale
Discovery, Gaithersburg, MD, USA). The accompanying SECTOR Imager SI2400 and MSD
Workbench software were used for analysis. The lower limit of detection for IL-10 and TNFα
was 0.04 pg/mL, as per manufacturer instructions. Samples with values below the limit of
detection were assigned a value of 0 pg/ml.

Immune Cell Surface Marker Expression by Flow Cytometry.

PBMCs were analyzed for HLA-DR and PD-L1 expression using flow cytometry following 24
hours of stimulation. Cells were stained and examined for expression of HLA-DR by staining
with a BD Quantibrite combined antibody reagent, consisting of an anti-human HLA-DR
monoclonal antibody, clone L243, labelled with PE and an anti-human CD14 monoclonal
antibody, clone MφP9, labeled with PerCP-Cy™5.5 (BD Biosciences, San Jose, CA, USA). PD-
L1 expression was assessed by staining with an APC-labeled anti-human PD-L1 monoclonal
antibody clone MIH1 (BD Biosciences, San Jose, CA, USA). Data was collected using the BD
LSR Fortessa X-20 and analyzed using FlowJo software (FlowJo, LLC, Ashland, OR, USA).
Total number of cells analyzed per tube included 100,000 donor PBMCs or THP-1 monocytes.

NFkB Lucia Luciferase Assay.

Following stimulation of the cells as described above, 20 ul of cell culture supernatant was
combined with 50 ul of QUANTI-Luc™ reagent (Invivogen, San Diego, CA, USA) to quantify
91
NFkB production through the secreted luminescent Lucia luciferase reporter. Luminescence was
measured using a luminescence spectrometer.

Statistical Analysis.

Statistical analysis was performed using Graphpad Prism version 8.0 (Graphpad Software, San
Diego, CA, USA) Data are represented through mean and standard error. One-way ANOVA or
Two-way ANOVA with post-hoc corrections, where applicable, were utilized to assess statistical
differences between treatment groups. P values ≤ 0.05 were considered significant.

Results.
High exposure levels of LTA are associated with increased anti-inflammatory response in
THP-1 monocytes.

We used two different concentrations of LTA (high: 10 μg /ml; low: 1 μg/ml) to stimulate THP-1
monocytes and measured the induction of selected cytokines (IL10, TNFα) expression of
relevant cell surface markers (HLA-DR, PD-L1, TLR2), and the activation of the pro-
inflammatory protein complex NFκB. Increased expression of PD-L1 and IL-10 would suggest
an immunoparalysis phenotype characterized by decreased pathogen recognition and dampened
pro-inflammatory response. Conversely, enhanced expression of TNFα, HLA-DR, TLR2, and
NFκB would be expected in activated cells, as these functions are associated with pathogen
detection, activation, and microbial clearance.

At baseline, THP-1 monocytes produced low concentrations of IL-10 and TNFα and minimal
NFκB activation (Figure 9A-F). Cell surface expression of HLA-DR was detectable in 74.1% of
92
cells, whereas TLR2 and PD-L1 cell surface expression was low. With addition of LTA, the
higher exposure level was associated with significantly increased IL-10 and PD-L1, in
comparison to baseline untreated THP-1s. High LTA also significantly increased NFκB
activation and TLR2 expression. LTA exposure significantly increased TNFα response compared
to untreated control, with low LTA inducing a slightly strong effect than high LTA (1.76 pg/ml
untreated; 3631 pg/ml low LTA; 3333 pg/ml high LTA). Low LTA also increased HLA-DR,
though the effect was not statistically significant, whereas high LTA had no effect on HLA-DR.
The results suggest that in THP-1 monocytes, LTA appears to contribute significantly to the
development of an immunoparalysis state in a dose-dependent manner, as high LTA had a
greater effect on inducing the expression of the anti-inflammatory markers IL-10 and PD-L1, and
less robust effects on TNFα and HLA-DR when compared to low LTA.
(A) IL-10, (B) PD-L1, (C) TNFα, (D) HLA-DR, (E) NFκB, and (F) TLR2. Protein expression was
determined using either flow cytometry (PD-L1, HLA-DR, TLR2), ELISA (IL-10, TNFα), or fluorescent assay
(NFκB). Data is displayed as means with error bars depicting standard deviation. Brackets indicate statistical
comparisons between treatments. * p<0.05; ***p<0.001, **** p<0.0001.

Figure 9 Effects of high (10 μg/ml) and low (1 μg/ml) exposure levels of purified S. aureus LTA on THP-1
Monocytes.
93
Antibiotics differentially effect pro- and anti-inflammatory responses in THP-1 monocytes.

To assess the immunomodulatory activity of select anti-staphylococcal antibiotics, THP-1
monocytes were exposed to high and low concentrations of LTA in the presence of either
vancomycin, tedizolid, or daptomycin. Select markers of immune status were measured via flow
cytometry (PD-L1, HLA-DR, TLR2), ELISA (IL-10, TNFα), or fluorescent assay (NFκB). In the
presence of high LTA (10 μg /ml), antibiotics had relatively minor impacts on TNFα, HLA-DR,
or TLR2 in comparison to high LTA alone (Figure 10A-I). The antibiotic-related changes
observed trended towards anti-inflammatory effects. Specifically, VAN was shown to
significantly increase IL-10, without a compensatory increase in TNFα, which may suggest the
development of an unbalanced response biased towards anti-inflammatory activity. Additionally,
DAP demonstrated a trend towards increasing PD-L1 in the presence of high LTA, which
impairs T cell activity and promotes T cell apoptosis (p=0.09). All antibiotics studied
significantly decreased NFκB, with DAP showing the greatest decrease, followed by TED and
VAN. Antibiotics, when used with the low LTA exposure level (1 μg/ml), did not cause any
significant changes in expression of any of the markers studied. However, there was a trend
towards VAN causing a decrease in NFκB (p=0.14) and an increase in PD-L1 (p=0.28),
suggesting an immune-dampening effect. DAP, in particular, appeared to have the least effect on
THP-1 monocytes stimulated with 1 μg/ml LTA, including NFκB activation, which decreased
with VAN and TED but remained elevated with DAP.
94

Antibiotics include VAN, vancomycin; TED, tedizolid; and DAP, daptomycin. Protein expression was
determined using either flow cytometry (PD-L1, HLA-DR, TLR2), ELISA (IL-10, TNFα), or fluorescent assay
(NFκB). Antibiotics alone and untreated cells were used as controls. Data is displayed as means with error bars
depicting standard deviation. Brackets indicate statistical comparisons between treatments. * p<0.05;
**p<0.01; ***p<0.001; **** p<0.0001.

Purified LTA from S. aureus differentially affected expression of cytokine and cell surface
markers in a dose-dependent manner in human PBMCs.
In addition to analyzing the concentration-dependent response of LTA on THP-1 monocytes, we
also assessed the effects of LTA on human PBMCs obtained from healthy volunteer donors. In
this cell population, we examined 4 relevant sepsis markers to assess host immune response
phenotype: IL-10, TNFα, HLA-DR, and PD-L1 (Figure 11A-D). Similar to baseline levels
observed in THP-1s, IL-10 and TNFα are produced in minimal quantities and there is low
expression of PD-L1 on the cell surface in the absence of stimuli. Because PBMCs are a mixed
Figure 10 Expression of select immune markers in THP-1 monocytes exposed to antibiotics and 10 μg/ml (high) (A,
B, C, D, E, F) and 1 μg/ml (low) (G, H, I, J, K, L) purified S. aureus LTA.
95
cell population containing T cells, B cells, monocytes, dendritic cells, and NK cells, there is a
relatively smaller proportion of cells that expresses HLA-DR in comparison to the THP-1
monocytes, which represent a monoculture cell line (1.6% of PBMCs HLA-DR+ at baseline vs.
74.1% of THP-1s HLA-DR+ at baseline).

When exposed to high concentrations of LTA, expression of IL-10 and TNFα significantly
increased in comparison to baseline, with a minimal observed increase in PD-L1 expression.
Even though the percentage of HLA-DR positive cells was low overall, HLA-DR expression also
significantly increased with high LTA versus low LTA (p=0.01) and untreated cells (p=0.05)
(2.96% HLA-DR+ with high LTA versus 1.93% HLA-DR+ with low LTA and 1.65% HLA-
DR+ untreated). There was a clear concentration-dependent effect in PBMCs, with high LTA
causing significantly greater response in comparison to low LTA, with respect to IL-10, TNFα,
and HLA-DR expression. While high LTA appeared to have a greater stimulatory effect, it was
accompanied by a compensatory increase in IL-10 and PD-L1 (high LTA IL-10, 123 pg/ml; low
LTA IL-10,12.23 pg/ml; high LTA, 1.65% PD-L1+; low LTA, 0.98% PD-L1+). Conversely, low
LTA minimally affected both TNFα and IL-10 production compared to untreated controls.

96

Figure 11 Effects of high (10 μg/ml) and low (1 μg/ml) exposure levels of purified S. aureus LTA on (A) IL-
10, (B) PD-L1, (C) TNFα, and (D) HLA-DR expression in human PBMCs
Protein expression was determined using either flow cytometry (PD-L1, HLA-DR) or ELISA (IL-10, TNFα.
Data is displayed as means with error bars depicting standard deviation. Brackets indicate statistical
comparisons between treatments. * p<0.05, **** p<0.0001.

Antibiotics exert drug- and dose-dependent LTA-mediated effects on cytokine and cell
surface marker expression in human PBMCs.
Following co-stimulation with LTA and antibiotics (VAN, TED, or DAP), PBMC protein
expression of IL-10, TNFα, HLA-DR, and PD-L1 was analyzed using ELISA or flow cytometry.
Figure 12 depicts the drug- and LTA-dose dependent effects observed in PBMCs treated with
VAN, TED, or DAP. In the presence of high-concentration LTA (Figure 12), VAN exposure
significantly increased IL-10 and TNFα cytokine production, had no effect on HLA-DR, and
modestly downregulated PD-L1 surface expression of PBMCs. TED significantly increased
TNFα cytokine release. DAP had no significant effects on any of the markers measured. Thus, it
appears that in the setting of high-dose LTA, TED appears to have the greatest immunoactivating
potential, through its actions on TNFα release. VAN may have anti-inflammatory properties
through its increase in IL-10 cytokine release while DAP appears to have no effect on the
97
selected anti- or pro-inflammatory markers, contributing a neutral effect on the host immune
response.

Conversely, at the low LTA exposure level, antibiotics had a less pronounced effect in
comparison to high LTA, indicating that with greater LTA-mediated immune stimulation,
antibiotics have an enhanced capacity to exert immunomodulatory effects, which was also
demonstrated in the THP-1 monocytes. When stimulated with low LTA, VAN demonstrated a
modest increase in HLA-DR and PD-L1 cell surface expression. TED significantly increased
HLA-DR (p=0.003). Similar to the high LTA and DAP exposure condition, in the presence of
low LTA, DAP had no significant effects on protein production for any of the markers of interest
examined. Overall, TED appeared to exert the least immune dampening effect upon exposure of
PBMCs to low LTA relative to VAN and DAP due to its ability to increase HLA-DR and TNFα.

98
Antibiotics include VAN, vancomycin; TED, tedizolid; and DAP, daptomycin. Protein expression was
determined using either flow cytometry (PD-L1, HLA-DR, TLR2) or ELISA (IL-10, TNFα). Antibiotics alone
and untreated cells were used as controls. Data is displayed as means with error bars depicting standard
deviation. Brackets indicate statistical comparisons between treatments: **p<0.01; ***p<0.001; ****
p<0.0001.

Discussion.
In this study, we compared the ability of antibiotics from unique pharmacologic classes on their
ability to shift the balance of pro- and anti-inflammatory host immune responses in the presence
of two different concentrations of LTA using human PBMCs and THP-1 monocytes. Two
concentrations of LTA were used to mimic the differential LTA-releasing abilities of clinical
strains, as well as to simulate different bacterial burden during infections, as higher inoculum
infections will expose host cells to larger amounts of LTA. Human PBMCs were selected to
demonstrate the effects on freshly isolated human cells and to characterize the interactions taking
place between immune cells in a mixed population. THP-1 monocytes were also included to
minimize confounding effects from human donor variability and to allow for a better
understanding of antibiotic-mediated effects with LTA stimulation on monocytes alone.

Our results demonstrated that antibiotics have greater potential to modulate host immunity in the
presence of high concentration LTA versus low LTA, suggesting potential implications for
antibiotic-mediated immune modulation during high-inoculum infections and/or infections
caused by high LTA-releasing strains. Vancomycin trended towards exerting an anti-
Figure 12 Expression of select immune markers in human PBMCs (n=4) exposed to antibiotics and 10 μg/ml
(high) (A, B, C, D) or 1 μg/ml (low) (E, F, G, H) purified S. aureus LTA.
99
inflammatory effect with increased IL-10 production in both THP-1s and PBMCs, whereas
tedizolid displayed pro-inflammatory effects on THP-1s and PBMCs, as evidenced through its
stimulatory actions on TNFα and HLA-DR. Daptomycin largely had no effect on host immune
response in the presence of LTA, though all drugs were found to decrease NFκB activation with
high levels of LTA. Trends in cytokine release were similar in both THP-1 monocytes and
PBMCs. However, PBMCs produced overall higher concentrations of IL-10 and lower quantities
of TNFα in comparison to THP-1 monocytes. PBMCs may produce less TNFα due to higher
production of IL-10 following LTA exposure. Differences found in PD-L1 and HLA-DR cell
surface expression in PBMCs and THP-1 monocytes may be attributable to differences in
interactions between different cell types in the PBMC mixed cell population.

To date, no published studies have examined the effects of different pharmacologic classes of
anti-staphylococcal antibiotics on the balance of pro- to anti-inflammatory response during S.
aureus bacteremia or following exposure to purified S. aureus LTA ex vivo. Prior studies have
demonstrated differential immunomodulatory potential of antibiotic agents on cytokine response
in monocytes from healthy donors when stimulated with LPS or bacteria ex vivo. A multitude of
experimental models have been employed varied by stimuli (LPS versus live versus heat-killed
bacteria), concentrations or inoculum tested, incubation time of monocytes with stimuli,
antibiotic agent and concentrations tested, and specific cytokines measured (14, 15, 134).
Antibiotic agents or drug classes that have been previously evaluated include: cephalosporins,
macrolides, fluoroquinolones, fosfomycin, vancomycin, linezolid, and daptomycin. Cytokines
measured are typically limited to pro-inflammatory mediators such as TNFα, IL-1ß, IFNγ, IL-6,
CXCL8, and GM-CSF. A concentration-dependent immunomodulatory effect is observed for
100
some agents on pro-inflammatory cytokines while other agents exerted no effect (14, 15, 134,
262, 272). Specifically, linezolid, an oxazolidinone that is pharmacologically similar to tedizolid,
has been shown to induce pro-inflammatory cytokine mRNA production in THP-1 monocytes
(130). However, the effect is not well characterized, as other studies examining linezolid’s
effects on immune cells in the presence of microbial components (LPS, Panton-Valentine
Leucocidin, Toxic shock syndrome toxin 1, Staphylococcal enterotoxin A) have shown
differential results that may be due to donor-specific variables or interactions with microbial
toxins (273).

While there is a general consensus amongst studies that antibiotics can directly influence host
cytokine response and affect expression of immune markers such as toll-like receptors (TLR),
including TLR-2, an important cell-recognition receptor for LTA, the mechanisms by which
these effects occur remain unclear. In our study, antibiotics did not demonstrate significant
effects on TLR2 in THP-1 monocytes. However, when we assessed antibiotic effects on NFkB,
we found that with high LTA exposure, NFkB activation decreased. NFkB is a crucial
transcriptional regulator for host inflammatory response (274). Decreases in NFkB are associated
with increased survival in mouse models of sepsis, and it has been suggested that IL-10 plays a
direct role in suppressing NFkB response (275, 276). In our study, high concentration LTA was
shown to elevate IL-10, which likely contributes to subsequent decreases in NFkB. Additionally,
other antibiotics, such as azithromycin and minocycline, have been shown to downregulate
NFkB, though the drugs assessed in our study have not been previously examined for their
effects on NFkB (131, 277). Other mechanisms, such as alteration of immune cell metabolism,
may be implicated in regulating cell surface markers and cytokines in SAB-related sepsis. Yang
101
et al. demonstrated that antibiotics, such as ciprofloxacin, can create perturbations in the
metabolic microenvironment by facilitating changes in host cell respiration and altering host
metabolite production (278). Changes in metabolic state are necessary for immune cell
activation, therefore, antibiotic-mediated changes in host cell metabolism may be a mechanism
that confers their immunomodulatory activity (279, 280).

Overall results from our study indicate that immune response from PBMCs and THP-1s was
dependent on LTA concentration and drug-specific exposure. Our results suggest that TED may
be preferred in patients who exhibit an immunoparalysis phenotype, as TED-mediated
enhancement in TNFα cytokine release and HLA-DR expression was observed, without
impacting IL-10 expression. It is possible that in the context of in vivo infection, TED exerts its
immunomodulatory effects indirectly through suppression of S. aureus toxin production (281).
In contrast, VAN significantly induces IL-10 protein expression which may tip the balance
towards an immunoparalysis state. DAP largely has no effect on the markers of interest at either
LTA exposure level, which may render this antibiotic as a neutral treatment option; selection for
treatment would be based primarily on its direct antimicrobial activity. In the setting of low LTA
exposure, antibiotics had less robust effects on cytokine or cell surface marker expression in
PBMCs and THP-1 monocytes which suggests that therapy selection would be based primarily
on the direct antimicrobial activity of the antibiotic agent.

We hypothesized that IL-10 production would increase PD-L1 expression and reduce HLA-DR
expression, which has been demonstrated in previous studies, whereas TNFα would have the
inverse effect (282-284). However, PD-L1 and HLA-DR protein expression did not seem to be
102
consistently correlated with cytokine response. Notably, when PBMCs exposed to LTA were
treated with three clinically prescribed antistaphylococcal agents, HLA-DR cell surface
expression did not decrease, which supported the positive impact of antibiotic therapy, especially
when decreases in HLA-DR expression in sepsis are associated with worse outcomes (48).
However, results on HLA-DR expression in PBMCs should be interpreted with caution, since
only a small percentage of cells demonstrated expression. The distinct mode of action of the
antibiotics tested here may contribute to the differential immunomodulatory effects imparted by
each drug. As proposed by Wolf et al., antibiotic immunomodulation could occur because of
decreased synthesis of pathogen associated molecular patterns and their associated proteins, lack
of bacterial lysis, or, in the case of bacteriostatic agents, increased reliance upon host defense
mechanism-based clearance of bacteria (285). Vancomycin acts by interrupting formation of the
bacterial cell wall, causing cell lysis and release of bacterial cell contents, such as LTA, teichoic
acids, and peptidoglycan, all of which can have pleiotropic effects upon pro- and anti-
inflammatory cytokine release (118). On the other hand, daptomycin disrupts polarity of the
bacterial cell membrane, while tedizolid inhibits ribosomal protein synthesis. Tedizolid is in the
same pharmacologic class as linezolid which has been shown in numerous studies to suppress
production of a variety of staphylococcal virulence factors and toxins, but its potential effects on
LTA or cell wall protein synthesis have not been assessed (130, 281, 282). Daptomycin has been
shown to inhibit LTA synthesis through its interactions with the cell membrane, thereby
potentially contributing to dampening of LTA-mediated host immune response (286). It is also
possible that antibiotics differentially affect immune cell metabolism, thereby influencing
immune cell response to LTA stimulation (278).

103
Importantly, given that anti-staphylococcal antibiotics from different drug classes modulate host
cytokine response in a distinct LTA dose-dependent manner, future studies evaluating clinical
efficacy of different treatment regimens should take into account the agent’s antibacterial effect
and immunomodulatory potential along with the patient’s immunophenotype based on
measurements of immune markers (e.g. pro- and anti-inflammatory cytokines), as well as LTA
release profile of the infecting strain. For individualized patient therapies, tempering of TNFα
response while preserving HLA-DR expression may be beneficial for patients infected with low
LTA-releasing strains, whereas patients infected with high LTA-releasing strains may benefit
from avoidance of antibiotics that exert an immune dampening effect. Additional studies are
necessary to further develop a model for precision antibiotic therapies which are currently
underway in our lab to better elucidate the complexities of host-microbial-antibiotic interaction
that drive outcomes of S. aureus bacteremia. Findings from our study support the rationale for
moving towards a precision medicine approach in infectious disease therapy by illustrating
complex antibiotic-specific immunomodulatory differences that likely impact patient outcomes
and survival.

104
Chapter 5: Summary & Future Directions.

S. aureus bloodstream infections are an important cause of sepsis that can present with
complications such as bacterial persistence, which increases the risk of mortality and places
substantial burden on the healthcare system (67). The cause of bacterial persistence is poorly
understood and there are many complex variables that can contribute to outcomes in SAB,
namely the host immune response, strain-specific microbial factors, and the antimicrobial and
immunomodulatory effects of antibiotics. In this thesis, we explored the intersections of these
factors by characterizing antibiotic effects on LTA release from S. aureus and examining
immunomodulatory effects of antibiotics on host immune cells in the presence of LTA. The
overarching goal of these studies was to develop the framework towards the innovation of a
personalized medicine approach towards SAB antimicrobial treatment based on LTA-mediated
host immune response. Since antibiotics have both antimicrobial and immunomodulatory effects,
we sought to find antibiotics that could provoke immune responses that would be beneficial to
the host, primarily by eliciting immunoactivating effects for patients with an over exuberant anti-
inflammatory response, as this phenotype is correlated with bacterial persistence and mortality.

First, we demonstrated that spontaneous LTA release is heterogenous among S. aureus clinical
strains, a novel finding that is not well reported in the literature, as most previously published
studies use laboratory strains to study LTA (11, 116). The SAB clinical strains characterized
were isolated from bacteremia patients with a range of different phenotypes. From these strains,
we found that low releasing strains were more likely to cause persistence and mortality,
supporting our hypothesis that LTA is an immunoactivating factor that promotes bacterial
clearance by innate immune cells. Additionally, while all antibiotics studied increased LTA
105
release, we found ST-specific response to antibiotics, with strains from the common ST8 lineage
producing the greatest quantity of LTA in the presence of tedizolid, whereas other non-ST8
strains has maximal LTA release in the presence of vancomycin. We found several point
mutations of interest within the LTA biosynthesis pathway that may contribute to differential
LTA release across strains. However, we did not identify any sequence variations within the
LTA biosynthesis pathway for ST8 strains. Mutations found in autolysin genes in a low
releasing strain are particularly relevant as LTA and autolysin have a regulatory relationship. It is
important to note that despite radical advances in bacterial genomics in recent years, many
ambiguities and unknown functional genes exist. Interestingly, we found mutations in and
upstream of a relatively unknown gene that is putatively involved in LTA export, rfxB, which
could play a role in determining LTA release. We also found mutations in several genes
encoding hypothetical proteins of unknown function in ST8 strains. Within these hypothetical
proteins could be a cell-wall or cell-membrane altering protein that would explain the enhanced
LTA release in ST8 strains upon exposure to tedizolid.

Based on the finding that strains release differential amounts of LTA spontaneously and with
antibiotics, we conducted studies examining the concentration-dependent effects of LTA on host
immune cells using 10µg/ml and 1 µg/ml to mimic “high” and “low” releasers. We then exposed
cells to anti-staphylococcal antibiotics to assess the influence of antibiotics on the LTA-mediated
inflammatory response. We examined two crucial immune cell populations: neutrophils, the
first-responders to S. aureus infection, and PBMCs, a mixed cell population that consists of
innate and adaptive immune cells. We also included THP-1 monocytes to examine specific
effects on monocytes outside of the PBMC mixed cell population. Exposure to high
106
concentrations (10µg/ml) of LTA induced significant inflammation; accordingly, antibiotics
demonstrated more robust immunomodulatory effects in the high LTA condition, whereas the
low dose of LTA, in comparison, induced less inflammation in general.

Antibiotics appeared to have contextual, differential effects on immune cell markers and
cytokine production in each cell type. Vancomycin appeared to have both anti- and pro-
inflammatory effects on immune cells. Specifically, in neutrophils, vancomycin was shown to
have an anti-inflammatory effect by significantly decreasing CXCL-8 response, but it also
demonstrated a low level of enhancement of immune activation and phagocytosis; however,
these small increases in activation and phagocytosis are likely minimized by the decrease in
CXCL-8. Similarly, in PBMCs, vancomycin increased IL-10, but also caused a compensatory
increase in TNFα with high concentration LTA. Daptomycin had minimal effects on cytokine
and immune cell markers in both PBMCs and PMNs, suggesting that daptomycin could present a
“neutral” option for patients without immune dysfunction, as in these patients, an
immunoactivating antibiotic could upset the balanced response. Ceftaroline was used only in
PMN studies, but it demonstrated robust pro-inflammatory effects by stimulating phagocytosis
and activation, as well as maintaining CXCL-8 response while other antibiotics reduced CXCL-
8. These findings lend support to ceftaroline’s successful use as a salvage therapy in MRSA
bacteremia, as ceftaroline may possess immunoactivating potential in the presence of S. aureus
cell wall components, as has been demonstrated with other beta-lactam agents (10). Ceftaroline
may be of interest for use particularly in patients with elevated IL-10/TNFα ratios and
persistence. Similarly, tedizolid presents another potential option for an immunoactivating
therapy. While tedizolid was used only in PBMC studies, it showed a trend towards increasing
107
pro-inflammatory activity through HLA-DR and TNFα, without significantly impacting IL-10 or
PD-L1.

From a mechanistic perspective, we examined antibiotic effects on LTA-mediated inflammation
through NF-kB, TLR2, and PD-1L. While LTA had dose dependent effects, with high dose LTA
increasing each respective marker in comparison to the unstimulated and low dose LTA
conditions, antibiotics had no significant effects on PD-L1 or TLR2 cell surface expression.
However, it was shown that all antibiotics also decreased NF-kB activation in response to high
dose LTA, confirming findings from previous studies, as well as the previously described IL-10
data, which indicates that many antibiotics may have an overall regulatory effect towards
promoting anti-inflammatory immune response; while they may show pro-inflammatory
activities at early time points, suppression of NF-kB activation by antibiotics suggests that they
ultimately are promoting anti-inflammatory functions. Antibiotics, when added to cells alone in
the absence of LTA, display higher than baseline levels of IL-10, which supports this finding,
though further explorations of the mechanisms of antibiotic manipulation of the host immune
response are warranted.

Ultimately, our findings suggest that antibiotics do play a role in influencing host immune
response through their direct effects on immune cell function and cytokine response as well as
indirectly, through their ability to modulate S. aureus release of LTA, a crucial cell wall polymer
that can provoke pro- and anti-inflammatory responses in different immune cell types. While
there are differences in host response between donors, antibiotics, and LTA doses, the results
highlighted in this work have potential treatment implications, particularly for patients exhibiting
108
indications of a dysregulated host immune response, marked by an elevated IL-10/TNFa ratio.
Presently, there is an unmet need for therapies to remedy sepsis immune dysfunction. There is
also a lack of established guidelines for treating persistent SAB patients, which contributes to the
observed variability in outcomes. This thesis addresses these outcome disparities by illustrating
that antibiotics can be used more strategically as a means for controlling the invading pathogen
as well as the host response. While sepsis is a pathogenic state marked by a dysregulated host
response, as infections persist unchecked and immune cells lose their ability to respond
meaningfully, antibiotics may be able to provide a needed mechanism to modulate response
favoring the host.

Future Directions

While the findings presented provide initial support for the integration of immunomodulatory
effects of antibiotics as a factor for consideration in therapy selection to treat S. aureus
bacteremia, additional studies are needed to support these findings. In vivo studies, in animal
models as well as in patients, could further highlight the importance of the antibiotic effects on
LTA-mediated inflammation during infection. Additionally, it would be of interest to quantify
LTA release in the blood of patients with SAB and correlate these quantities with patient
outcomes and cytokine response. These studies would further extend our ex vivo findings and
provide a substantive mechanistic rationale for the observed antibiotic effects on cytokine
response found by Volk et al. (86). While this approach would add value to the observed
findings, detection of PAMPs in whole blood presents a number of complex technical
challenges, which is supported by an overwhelming lack of published literature on this topic. We
found that antibody-based methods, particularly those that would be available for use in a
109
clinical setting, such as ELISA, are incompatible for use with whole blood, as even known
concentrations of purified LTA “spiked” into whole blood were undetectable. However,
innovations are currently in development as a group recently identified a method for detecting
LTA in human blood, discovering that it is partially bound to circulating lipoproteins in the host,
including HDL and LDL cholesterol (271). A similar finding has been made for LPS in gram-
negative organisms, which also binds to serum HDL and LDL cholesterol (271, 287).

Recently published studies have also identified the existence of LTA-coated membrane vesicles,
which are exocytosed from gram-positive organisms (288, 289). Originally discovered in gram-
negative organisms, it was found that gram-positive bacteria also produce these cargo-containing
extracellular vesicles. Membrane vesicles contain a variety of cytoplasmic proteins, lipids,
nucleic acids, and polysaccharides, many of which are unknown or poorly characterized, though
they are presently thought to be involved in virulence or resistance, as vesicles passed between
bacterial cells can spread acquired and accessory genes (290). Membrane vesicles present
another potential source of released LTA outside of the scope of this study and may further link
overall virulence with LTA, as high-releasers of LTA-coated vesicles would also release more
virulence-associated toxins, which could prime the host immune system to respond rapidly.
Similar to our findings of low LTA release in SAB strains causing death, strains releasing lower
quantities of membrane vesicles have been shown to correlate with worse outcomes in patients
infected with USA600 SAB strains (291).

Additional studies that would add value to our understanding of SAB pathogenesis from a host
as well as a microbial perspective include dual-RNASeq experiments of host and microbe to
110
provide a holistic view of gene regulation during host-pathogen interaction to aid in identifying
targets of interest and novel early biomarkers for persistence and mortality. A dual-RNASeq
study is active and ongoing within our research group, which is currently enrolling patients.
Simultaneous transcriptomic experiments for host and microbe in SAB infection have not been
previously published; similarly, there are also no published RNASeq studies of S. aureus
bacteremia patients. Our preliminary findings obtained from two patients (one persistent MSSA
patient, one resolving MSSA patient) show involvement of interferon-related pathways and
induction of a more diverse T cell clonal expansion in the resolving patient versus the persistent
patient. Unexpectedly, the persistent patient showed upregulation in many small noncoding
RNAs that are of unknown function or poorly characterized, highlighting the presence of many
remaining undiscovered factors involved in the development and progression of persistent SAB.
The addition of more patients to this ongoing study, as well as the studies proposed previously,
will provide higher resolution of the complex pathogenesis of SAB and a greater understanding
of novel biomarkers and therapies that can be utilized to improve outcomes and reduce mortality.

111
References.

1. Vincent JL, Rello J, Marshall J, Silva E, Anzueto A, Martin CD, et al. International study
of the prevalence and outcomes of infection in intensive care units. JAMA. 2009;302(21):2323-
9.
2. Naber CK. Staphylococcus aureus Bacteremia: Epidemiology, Pathophysiology, and
Management Strategies. Clinical Infectious Diseases. 2009;48(s4):S231-S7.
3. Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, et al. Invasive
Methicillin-Resistant Staphylococcus aureus Infections in the United States. JAMA.
2007;298(15):1763-71.
4. Boucher HW, Corey GR. Epidemiology of methicillin-resistant Staphylococcus aureus.
Clin Infect Dis. 2008;46 Suppl 5:S344-9.
5. Hotchkiss RS, Monneret G, Payen D. Sepsis-induced immunosuppression: from cellular
dysfunctions to immunotherapy. Nature Reviews Immunology. 2013;13(12):862-74.
6. Minejima E, Bensman J, She RC, Mack WJ, Tuan Tran M, Ny P, … Wong-Beringer, A.
A Dysregulated Balance of Proinflammatory and Anti-Inflammatory Host Cytokine Response
Early During Therapy Predicts Persistence and Mortality in Staphylococcus aureus Bacteremia.
Crit Care Med. 2016;44(4):671-9.
7. Finlay BB, McFadden G. Anti-immunology: evasion of the host immune system by
bacterial and viral pathogens. Cell. 2006;124(4):767-82.
8. Moine P, Abraham E. Immunomodulation and sepsis: impact of the pathogen. Shock.
2004;22(4):297-308.
112
9. Monecke S, Coombs G, Shore AC, Coleman DC, Akpaka P, Borg M, et al. A Field
Guide to Pandemic, Epidemic and Sporadic Clones of Methicillin-Resistant Staphylococcus
aureus. PLOS ONE. 2011;6(4):e17936.
10. Lotz S, Starke A, Ziemann C, Morath S, Hartung T, Solbach W, et al. Beta-lactam
antibiotic-induced release of lipoteichoic acid from Staphylococcus aureus leads to activation of
neutrophil granulocytes. Ann Clin Microbiol Antimicrob. 2006;5:15-.
11. van Langevelde P, van Dissel JT, Ravensbergen E, Appelmelk BJ, Schrijver IA,
Groeneveld PH. Antibiotic-induced release of lipoteichoic acid and peptidoglycan from
Staphylococcus aureus: quantitative measurements and biological reactivities. Antimicrob
Agents Chemother. 1998;42(12):3073-8.
12. Collins FS, Varmus H. A new initiative on precision medicine. N Engl J Med.
2015;372(9):793-5.
13. Yamaki J, Synold T, Wong-Beringer A. Tigecycline induction of phenol-soluble
modulins by invasive methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents
Chemother. 2013;57(9):4562-5.
14. Morikawa K, Watabe H, Araake M, Morikawa S. Modulatory effect of antibiotics on
cytokine production by human monocytes in vitro. Antimicrob Agents Chemother.
1996;40(6):1366-70.
15. Pichereau S, Moran JJ, Hayney MS, Shukla SK, Sakoulas G, Rose WE. Concentration-
dependent effects of antimicrobials on Staphylococcus aureus toxin-mediated cytokine
production from peripheral blood mononuclear cells. J Antimicrob Chemother. 2012;67(1):123-
9.
113
16. Hotchkiss RS, Moldawer LL, Opal SM, Reinhart K, Turnbull IR, Vincent J-L. Sepsis and
septic shock. Nat Rev Dis Primers. 2016;2:16045.
17. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, et al.
The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA.
2016;315(8):801-10.
18. Rudd KE, Johnson SC, Agesa KM, Shackelford KA, Tsoi D, Kievlan DR, et al. Global,
regional, and national sepsis incidence and mortality, 1990-2013; 2017: analysis for the Global
Burden of Disease Study. The Lancet. 2020;395(10219):200-11.
19. Rhee C, Dantes R, Epstein L, Murphy DJ, Seymour CW, Iwashyna TJ, et al. Incidence
and Trends of Sepsis in US Hospitals Using Clinical vs Claims Data, 2009-2014. JAMA.
2017;318(13):1241-9.
20. Rhee C, Jones TM, Hamad Y, Pande A, Varon J, O’Brien C, et al. Prevalence,
Underlying Causes, and Preventability of Sepsis-Associated Mortality in US Acute Care
Hospitals. JAMA Network Open. 2019;2(2):e187571-e.
21. Peters van Ton AM, Kox M, Abdo WF, Pickkers P. Precision Immunotherapy for Sepsis.
Front Immunol. 2018;9:1926.
22. Mayr FB, Yende S, Angus DC. Epidemiology of severe sepsis. Virulence. 2014;5(1):4-
11.
23. Vincent JL, Opal SM, Marshall JC, Tracey KJ. Sepsis definitions: time for change.
Lancet. 2013;381(9868):774-5.
24. Balk RA. Systemic inflammatory response syndrome (SIRS): where did it come from and
is it still relevant today? Virulence. 2014;5(1):20-6.
114
25. Sprung CL, Sakr Y, Vincent JL, Le Gall JR, Reinhart K, Ranieri VM, et al. An
evaluation of systemic inflammatory response syndrome signs in the Sepsis Occurrence In
Acutely Ill Patients (SOAP) study. Intensive Care Med. 2006;32(3):421-7.
26. van der Poll T, van de Veerdonk FL, Scicluna BP, Netea MG. The immunopathology of
sepsis and potential therapeutic targets. Nat Rev Immunol. 2017;17(7):407-20.
27. Iskander KN, Osuchowski MF, Stearns-Kurosawa DJ, Kurosawa S, Stepien D, Valentine
C, et al. Sepsis: multiple abnormalities, heterogeneous responses, and evolving understanding.
Physiol Rev. 2013;93(3):1247-88.
28. Rhodes A, Evans LE, Alhazzani W, Levy MM, Antonelli M, Ferrer R, et al. Surviving
Sepsis Campaign: International Guidelines for Management of Sepsis and Septic Shock: 2016.
Intensive Care Med. 2017;43(3):304-77.
29. Hotchkiss RS, Monneret G, Payen D. Immunosuppression in sepsis: a novel
understanding of the disorder and a new therapeutic approach. Lancet Infect Dis.
2013;13(3):260-8.
30. Brown KA, Brown GA, Lewis SM, Beale R, Treacher DF. Targeting cytokines as a
treatment for patients with sepsis: A lost cause or a strategy still worthy of pursuit? International
Immunopharmacology. 2016;36:291-9.
31. Angus DC. The Search for Effective Therapy for Sepsis: Back to the Drawing Board?
JAMA. 2011;306(23):2614-5.
32. Murray PJ, Smale ST. Restraint of inflammatory signaling by interdependent strata of
negative regulatory pathways. Nat Immunol. 2012;13(10):916-24.
33. Kawasaki T, Kawai T. Toll-Like Receptor Signaling Pathways. Frontiers in Immunology.
2014;5(461).
115
34. Kruger P, Saffarzadeh M, Weber ANR, Rieber N, Radsak M, von Bernuth H, et al.
Neutrophils: Between Host Defence, Immune Modulation, and Tissue Injury. PLOS Pathogens.
2015;11(3):e1004651.
35. Kuhns DB, Young HA, Gallin EK, Gallin JI. Ca2+-Dependent Production and Release of
IL-8 in Human Neutrophils. The Journal of Immunology. 1998;161(8):4332.
36. Prame Kumar K, Nicholls AJ, Wong CHY. Partners in crime: neutrophils and
monocytes/macrophages in inflammation and disease. Cell and Tissue Research.
2018;371(3):551-65.
37. Kawai T, Akira S. Signaling to NF-kB by Toll-like receptors. Trends in Molecular
Medicine. 2007;13(11):460-9.
38. Sprent J. Antigen-Presenting Cells: Professionals and amateurs. Current Biology.
1995;5(10):1095-7.
39. Parker DC. T cell-dependent B cell activation. Annu Rev Immunol. 1993;11:331-60.
40. Geginat J, Paroni M, Maglie S, Alfen JS, Kastirr I, Gruarin P, et al. Plasticity of Human
CD4 T Cell Subsets. Frontiers in Immunology. 2014;5(630).
41. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and
acquired immunity. Nat Immunol. 2001;2(8):675-80.
42. Berger A. Th1 and Th2 responses: what are they? BMJ. 2000;321(7258):424.
43. Walker JA, McKenzie ANJ. TH2 cell development and function. Nature Reviews
Immunology. 2018;18(2):121-33.
44. Peck A, Mellins ED. Precarious Balance: Th17 Cells in Host Defense. Infection and
Immunity. 2010;78(1):32.
45. Corthay A. How do regulatory T cells work? Scand J Immunol. 2009;70(4):326-36.
116
46. Schulte W, Bernhagen J, Bucala R. Cytokines in sepsis: potent immunoregulators and
potential therapeutic targets--an updated view. Mediators Inflamm. 2013;2013:165974-.
47. Boomer JS, To K, Chang KC, Takasu O, Osborne DF, Walton AH, et al.
Immunosuppression in patients who die of sepsis and multiple organ failure. JAMA.
2011;306(23):2594-605.
48. Monneret G, Venet F. Monocyte HLA-DR in sepsis: shall we stop following the flow?
Crit Care. 2014;18(1):102-.
49. Lekkou A, Karakantza M, Mouzaki A, Kalfarentzos F, Gogos CA. Cytokine Production
and Monocyte HLA-DR Expression as Predictors of Outcome for Patients with Community-
Acquired Severe Infections. Clinical and Diagnostic Laboratory Immunology. 2004;11(1):161.
50. Costantino CM, Ploegh HL, Hafler DA. Cathepsin S regulates class II MHC processing
in human CD4+ HLA-DR+ T cells. J Immunol. 2009;183(2):945-52.
51. Monneret G, Gossez M, Venet F. Sepsis in PD-1 light. Critical Care. 2016;20(1):186.
52. Shao R, Fang Y, Yu H, Zhao L, Jiang Z, Li CS. Monocyte programmed death ligand-1
expression after 3-4 days of sepsis is associated with risk stratification and mortality in septic
patients: a prospective cohort study. Crit Care. 2016;20(1):124.
53. Zhang Y, Zhou Y, Lou J, Li J, Bo L, Zhu K, et al. PD-L1 blockade improves survival in
experimental sepsis by inhibiting lymphocyte apoptosis and reversing monocyte dysfunction.
Crit Care. 2010;14(6):R220.
54. Hotchkiss RS, Colston E, Yende S, Angus DC, Moldawer LL, Crouser ED, et al. Immune
Checkpoint Inhibition in Sepsis: A Phase 1b Randomized, Placebo-Controlled, Single Ascending
Dose Study of Antiprogrammed Cell Death-Ligand 1 Antibody (BMS-936559). Crit Care Med.
2019;47(5):632-42.
117
55. Tong SY, Davis JS, Eichenberger E, Holland TL, Fowler VG, Jr. Staphylococcus aureus
infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin
Microbiol Rev. 2015;28(3):603-61.
56. Seybold U, Kourbatova EV, Johnson JG, Halvosa SJ, Wang YF, King MD, et al.
Emergence of Community-Associated Methicillin-Resistant Staphylococcus aureus USA300
Genotype as a Major Cause of Health Care—Associated Blood Stream Infections. Clinical
Infectious Diseases. 2006;42(5):647-56.
57. Howden BP, Johnson PD, Ward PB, Stinear TP, Davies JK. Isolates with low-level
vancomycin resistance associated with persistent methicillin-resistant Staphylococcus aureus
bacteremia. Antimicrob Agents Chemother. 2006;50(9):3039-47.
58. Pérez-Montarelo D, Viedma E, Larrosa N, Gómez-González C, Ruiz de Gopegui E,
Muñoz-Gallego I, et al. Molecular Epidemiology of Staphylococcus aureus Bacteremia:
Association of Molecular Factors With the Source of Infection. Front Microbiol. 2018;9:2210-.
59. van Hal SJ, Jensen SO, Vaska VL, Espedido BA, Paterson DL, Gosbell IB. Predictors of
Mortality in Staphylococcus aureus Bacteremia. Clinical Microbiology Reviews.
2012;25(2):362.
60. Cabrera-Perez J, Condotta SA, Badovinac VP, Griffith TS. Impact of sepsis on CD4 T
cell immunity. Journal of leukocyte biology. 2014;96(5):767-77.
61. Llarrull LI, Fisher JF, Mobashery S. Molecular basis and phenotype of methicillin
resistance in Staphylococcus aureus and insights into new beta-lactams that meet the challenge.
Antimicrob Agents Chemother. 2009;53(10):4051-63.
62. Rodvold KA, McConeghy KW. Methicillin-Resistant Staphylococcus aureus Therapy:
Past, Present, and Future. Clinical Infectious Diseases. 2014;58(suppl_1):S20-S7.
118
63. Shorr AF, Kunkel MJ, Kollef M. Linezolid versus vancomycin for Staphylococcus
aureus bacteraemia: pooled analysis of randomized studies. J Antimicrob Chemother.
2005;56(5):923-9.
64. Liu C, Bayer A, Cosgrove SE, Daum RS, Fridkin SK, Gorwitz RJ, et al. Clinical Practice
Guidelines by the Infectious Diseases Society of America for the Treatment of Methicillin-
Resistant Staphylococcus aureus Infections in Adults and Children. Clinical Infectious Diseases.
2011;52(3):e18-e55.
65. Holland TL, Arnold C, Fowler VG, Jr. Clinical management of Staphylococcus aureus
bacteremia: a review. JAMA. 2014;312(13):1330-41.
66. Cosimi RA, Beik N, Kubiak DW, Johnson JA. Ceftaroline for Severe Methicillin-
Resistant Staphylococcus aureus Infections: A Systematic Review. Open Forum Infectious
Diseases. 2017;4(2).
67. Lee BY, Singh A, David MZ, Bartsch SM, Slayton RB, Huang SS, et al. The economic
burden of community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA). Clin
Microbiol Infect. 2013;19(6):528-36.
68. Maor Y, Hagin M, Belausov N, Keller N, Ben-David D, Rahav G. Clinical features of
heteroresistant vancomycin-intermediate Staphylococcus aureus bacteremia versus those of
methicillin-resistant S. aureus bacteremia. J Infect Dis. 2009;199(5):619-24.
69. Hawkins C, Huang J, Jin N, Noskin GA, Zembower TR, Bolon M. Persistent
Staphylococcus aureus Bacteremia: An Analysis of Risk Factors and Outcomes. Archives of
Internal Medicine. 2007;167(17):1861-7.

119
70. Lodise TP, Graves J, Evans A, Graffunder E, Helmecke M, Lomaestro BM, et al.
Relationship between vancomycin MIC and failure among patients with methicillin-resistant
Staphylococcus aureus bacteremia treated with vancomycin. Antimicrob Agents Chemother.
2008;52(9):3315-20.
71. Moore CL, Lu M, Cheema F, Osaki-Kiyan P, Perri MB, Donabedian S, et al. Prediction
of failure in vancomycin-treated methicillin-resistant Staphylococcus aureus bloodstream
infection: a clinically useful risk stratification tool. Antimicrobial agents and chemotherapy.
2011;55(10):4581-8.
72. Sakoulas G, Moellering RC, Jr., Eliopoulos GM. Adaptation of methicillin-resistant
Staphylococcus aureus in the face of vancomycin therapy. Clin Infect Dis. 2006;42 Suppl 1:S40-
50.
73. Minejima E, Mai N, Bui N, Mert M, Mack WJ, She RC, et al. Defining the Breakpoint
Duration of Staphylococcus aureus Bacteremia Predictive of Poor Outcomes. Clin Infect Dis.
2020;70(4):566-73.
74. Chong YP, Park S-J, Kim HS, Kim ES, Kim M-N, Park K-H, et al. Persistent
Staphylococcus aureus bacteremia: a prospective analysis of risk factors, outcomes, and
microbiologic and genotypic characteristics of isolates. Medicine (Baltimore). 2013;92(2):98-
108.
75. del Rio A, Cervera C, Moreno A, Moreillon P, Miró JM. Patients at Risk of
Complications of Staphylococcus aureus Bloodstream Infection. Clinical Infectious Diseases.
2009;48(Supplement_4):S246-S53.
76. Kahl BC, Becker K, Löffler B. Clinical Significance and Pathogenesis of Staphylococcal
Small Colony Variants in Persistent Infections. Clinical Microbiology Reviews. 2016;29(2):401.
120
77. Pérez-Montarelo D, Viedma E, Murcia M, Muñoz-Gallego I, Larrosa N, Brañas P, et al.
Pathogenic Characteristics of Staphylococcus aureus Endovascular Infection Isolates from
Different Clonal Complexes. Front Microbiol. 2017;8(917).
78. Park SY, Chong YP, Park HJ, Park KH, Moon SM, Jeong JY, et al. agr Dysfunction and
persistent methicillin-resistant Staphylococcus aureus bacteremia in patients with removed
eradicable foci. Infection. 2013;41(1):111-9.
79. Cajander S, Rasmussen G, Tina E, Magnuson A, Söderquist B, Källman J, et al.
Dynamics of monocytic HLA-DR expression differs between bacterial etiologies during the
course of bloodstream infection. PLOS One. 2018;13(2):e0192883.
80. Guimaraes AO, Cao Y, Hong K, Mayba O, Peck MC, Gutierrez J, et al. A Prognostic
Model of Persistent Bacteremia and Mortality in Complicated Staphylococcus aureus
Bloodstream Infection. Clinical infectious diseases : an official publication of the Infectious
Diseases Society of America. 2019;68(9):1502-11.
81. Brodin P, Davis MM. Human immune system variation. Nature reviews Immunology.
2017;17(1):21-9.
82. Kaczorowski KJ, Shekhar K, Nkulikiyimfura D, Dekker CL, Maecker H, Davis MM, et
al. Continuous immunotypes describe human immune variation and predict diverse responses.
Proceedings of the National Academy of Sciences of the United States of America.
2017;114(30):E6097-E106.
83. Leligdowicz A, Matthay MA. Heterogeneity in sepsis: new biological evidence with
clinical applications. Crit Care. 2019;23(1):80-.

121
84. Rose WE, Eickhoff JC, Shukla SK, Pantrangi M, Rooijakkers S, Cosgrove SE, et al.
Elevated Serum Interleukin-10 at Time of Hospital Admission Is Predictive of Mortality in
Patients With Staphylococcus aureus Bacteremia. The Journal of Infectious Diseases.
2012;206(10):1604-11.
85. Rose WE, Shukla SK, Berti AD, Hayney MS, Henriquez KM, Ranzoni A, et al. Increased
Endovascular Staphylococcus aureus Inoculum Is the Link Between Elevated Serum Interleukin
10 Concentrations and Mortality in Patients With Bacteremia. Clinical infectious diseases : an
official publication of the Infectious Diseases Society of America. 2017;64(10):1406-12.
86. Volk CF, Burgdorf S, Edwardson G, Nizet V, Sakoulas G, Rose WE. IL-1beta and IL-10
Host Responses in Patients with Staphylococcus aureus Bacteremia Determined by
Antimicrobial Therapy. Clin Infect Dis. 2019.
87. Gogos CA, Drosou E, Bassaris HP, Skoutelis A. Pro- versus Anti-inflammatory Cytokine
Profile in Patients with Severe Sepsis: A Marker for Prognosis and Future Therapeutic Options.
The Journal of Infectious Diseases. 2000;181(1):176-80.
88. Rasmussen G, Cajander S, Backman A, Kallman J, Soderquist B, Stralin K. Expression
of HLA-DRA and CD74 mRNA in whole blood during the course of complicated and
uncomplicated Staphylococcus aureus bacteremia. Microbiol Immunol. 2017;61(10):442-51.
89. Wang J, Roderiquez G, Norcross MA. Control of adaptive immune responses by
Staphylococcus aureus through IL-10, PD-L1, and TLR2. Sci Rep. 2012;2:606.
90. Greenberg JA, Hrusch CL, Jaffery MR, David MZ, Daum RS, Hall JB, et al. Distinct T-
helper cell responses to Staphylococcus aureus bacteremia reflect immunologic comorbidities
and correlate with mortality. Critical Care. 2018;22(1):107.
122
91. Verkaik NJ, Boelens HA, de Vogel CP, Tavakol M, Bode LGM, Verbrugh HA, et al.
Heterogeneity of the humoral immune response following Staphylococcus aureus bacteremia.
Eur J Clin Microbiol Infect Dis. 2010;29(5):509-18.
92. Liu GY. Molecular Pathogenesis of Staphylococcus aureus Infection. Pediatric Research.
2009;65(7):71-7.
93. Powers ME, Wardenburg JB. Igniting the Fire: Staphylococcus aureus Virulence Factors
in the Pathogenesis of Sepsis. PLOS Pathogens. 2014;10(2):e1003871.
94. DeLeo FR, Diep BA, Otto M. Host defense and pathogenesis in Staphylococcus aureus
infections. Infect Dis Clin North Am. 2009;23(1):17-34.
95. Thomer L, Schneewind O, Missiakas D. Pathogenesis of Staphylococcus aureus
Bloodstream Infections. Annu Rev Pathol. 2016;11:343-64.
96. Jenul C, Horswill AR. Regulation of Staphylococcus aureus Virulence. Microbiol Spectr.
2018;6(1):10.1128/microbiolspec.GPP3-0031-2018.
97. Wang B, Muir TW. Regulation of Virulence in Staphylococcus aureus: Molecular
Mechanisms and Remaining Puzzles. Cell Chem Biol. 2016;23(2):214-24.
98. Sumby P, Waldor MK. Transcription of the Toxin Genes Present within the
Staphylococcal Phage φSa3ms Is Intimately Linked with the Phage’s Life Cycle. Journal of
Bacteriology. 2003;185(23):6841.
99. Schreiner J, Kretschmer D, Klenk J, Otto M, Buhring HJ, Stevanovic S, et al.
Staphylococcus aureus phenol-soluble modulin peptides modulate dendritic cell functions and
increase in vitro priming of regulatory T cells. J Immunol. 2013;190(7):3417-26.
123
100. Hamilton SM, Bryant AE, Carroll KC, Lockary V, Ma Y, McIndoo E, et al. In vitro
production of panton-valentine leukocidin among strains of methicillin-resistant Staphylococcus
aureus causing diverse infections. Clin Infect Dis. 2007;45(12):1550-8.
101. Chi CY, Lin CC, Liao IC, Yao YC, Shen FC, Liu CC, et al. Panton-Valentine leukocidin
facilitates the escape of Staphylococcus aureus from human keratinocyte endosomes and induces
apoptosis. J Infect Dis. 2014;209(2):224-35.
102. Li M, Cheung GY, Hu J, Wang D, Joo HS, Deleo FR, et al. Comparative analysis of
virulence and toxin expression of global community-associated methicillin-resistant
Staphylococcus aureus strains. J Infect Dis. 2010;202(12):1866-76.
103. Wang R, Braughton KR, Kretschmer D, Bach TH, Queck SY, Li M, et al. Identification
of novel cytolytic peptides as key virulence determinants for community-associated MRSA. Nat
Med. 2007;13(12):1510-4.
104. Oogai Y, Matsuo M, Hashimoto M, Kato F, Sugai M, Komatsuzawa H. Expression of
virulence factors by Staphylococcus aureus grown in serum. Applied and environmental
microbiology. 2011;77(22):8097-105.
105. Gründling A, Schneewind O. Synthesis of glycerol phosphate lipoteichoic acid in
Staphylococcus aureus. Proceedings of the National Academy of Sciences. 2007;104(20):8478.
106. Brown S, Meredith T, Swoboda J, Walker S. Staphylococcus aureus and Bacillus subtilis
W23 Make Polyribitol Wall Teichoic Acids Using Different Enzymatic Pathways. Chemistry &
Biology. 2010;17(10):1101-10.

124
107. Santa Maria JP, Jr., Sadaka A, Moussa SH, Brown S, Zhang YJ, Rubin EJ, et al.
Compound-gene interaction mapping reveals distinct roles for Staphylococcus aureus teichoic
acids. Proceedings of the National Academy of Sciences of the United States of America.
2014;111(34):12510-5.
108. Fournier B, Philpott DJ. Recognition of Staphylococcus aureus by the innate immune
system. Clinical microbiology reviews. 2005;18(3):521-40.
109. Xia G, Kohler T, Peschel A. The wall teichoic acid and lipoteichoic acid polymers of
Staphylococcus aureus. International Journal of Medical Microbiology. 2010;300(2):148-54.
110. Kiriukhin MY, Debabov DV, Shinabarger DL, Neuhaus FC. Biosynthesis of the
glycolipid anchor in lipoteichoic acid of Staphylococcus aureus RN4220: role of YpfP, the
diglucosyldiacylglycerol synthase. Journal of bacteriology. 2001;183(11):3506-14.
111. Lu D, Wörmann ME, Zhang X, Schneewind O, Gründling A, Freemont PS. Structure-
based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS. Proceedings of
the National Academy of Sciences. 2009;106(5):1584.
112. Cui L, Murakami H, Kuwahara-Arai K, Hanaki H, Hiramatsu K. Contribution of a
thickened cell wall and its glutamine nonamidated component to the vancomycin resistance
expressed by Staphylococcus aureus Mu50. Antimicrobial agents and chemotherapy.
2000;44(9):2276-85.
113. Wood BM, Santa Maria JP, Jr., Matano LM, Vickery CR, Walker S. A partial
reconstitution implicates DltD in catalyzing lipoteichoic acid d-alanylation. The Journal of
biological chemistry. 2018;293(46):17985-96.
114. Neuhaus FC, Baddiley J. A continuum of anionic charge: structures and functions of D-
alanyl-teichoic acids in gram-positive bacteria. Microbiol Mol Biol Rev. 2003;67(4):686-723.
125
115. Collins LV, Kristian SA, Weidenmaier C, Faigle M, Van Kessel KP, Van Strijp JA, et al.
Staphylococcus aureus strains lacking D-alanine modifications of teichoic acids are highly
susceptible to human neutrophil killing and are virulence attenuated in mice. J Infect Dis.
2002;186(2):214-9.
116. Lotz S, Aga E, Wilde I, van Zandbergen G, Hartung T, Solbach W, et al. Highly purified
lipoteichoic acid activates neutrophil granulocytes and delays their spontaneous apoptosis via
CD14 and TLR2. J Leukoc Biol. 2004;75(3):467-77.
117. Hattar K, Grandel U, Moeller A, Fink L, Iglhaut J, Hartung T, et al. Lipoteichoic acid
(LTA) from Staphylococcus aureus stimulates human neutrophil cytokine release by a CD14-
dependent, Toll-like-receptor-independent mechanism: Autocrine role of tumor necrosis factor-α
in mediating LTA-induced interleukin-8 generation. Critical Care Medicine. 2006;34(3):835-41.
118. von Aulock S, Morath S, Hareng L, Knapp S, van Kessel KP, van Strijp JA, et al.
Lipoteichoic acid from Staphylococcus aureus is a potent stimulus for neutrophil recruitment.
Immunobiology. 2003;208(4):413-22.
119. Rockel C, Hartung T. Systematic Review of Membrane Components of Gram-Positive
Bacteria Responsible as Pyrogens for Inducing Human Monocyte/Macrophage Cytokine
Release. Frontiers in Pharmacology. 2012;3.
120. Cleveland MG, Gorham JD, Murphy TL, Tuomanen E, Murphy KM. Lipoteichoic acid
preparations of gram-positive bacteria induce interleukin-12 through a CD14-dependent
pathway. Infect Immun. 1996;64(6):1906-12.
121. Triantafilou M, Manukyan M, Mackie A, Morath S, Hartung T, Heine H, et al.
Lipoteichoic acid and toll-like receptor 2 internalization and targeting to the Golgi are lipid raft-
dependent. J Biol Chem. 2004;279(39):40882-9.
126
122. Brandt KJ, Fickentscher C, Kruithof EK, de Moerloose P. TLR2 ligands induce NF-
kappaB activation from endosomal compartments of human monocytes. PLoS One.
2013;8(12):e80743.
123. Fournier B. The function of TLR2 during staphylococcal diseases. Frontiers in Cellular
and Infection Microbiology. 2013;2(167).
124. Jorgensen PF, Wang JE, Almlof M, Thiemermann C, Foster SJ, Solberg R, et al.
Peptidoglycan and lipoteichoic acid modify monocyte phenotype in human whole blood. Clin
Diagn Lab Immunol. 2001;8(3):515-21.
125. Poehlmann H, Schefold JC, Zuckermann-Becker H, Volk HD, Meisel C. Phenotype
changes and impaired function of dendritic cell subsets in patients with sepsis: a prospective
observational analysis. Crit Care. 2009;13(4):R119.
126. Sato S, Takeuchi O, Fujita T, Tomizawa H, Takeda K, Akira S. A variety of microbial
components induce tolerance to lipopolysaccharide by differentially affecting MyD88-dependent
and -independent pathways. Int Immunol. 2002;14(7):783-91.
127. Kaesler S, Skabytska Y, Chen K-M, Kempf WE, Volz T, Köberle M, et al.
Staphylococcus aureus-derived lipoteichoic acid induces temporary T-cell paralysis independent
of Toll-like receptor 2. Journal of Allergy and Clinical Immunology. 2016;138(3):780-90.e6.
128. Son YM, Song KD, Park SM, Han SH, Yun CH. Lipoteichoic acid suppresses effector T
cells induced by Staphylococcus aureus-pulsed dendritic cells. J Microbiol Biotechnol.
2013;23(7):1023-30.
129. Testro AG, Gow PJ, Angus PW, Wongseelashote S, Skinner N, Markovska V, et al.
Effects of antibiotics on expression and function of Toll-like receptors 2 and 4 on mononuclear
cells in patients with advanced cirrhosis. J Hepatol. 2010;52(2):199-205.
127
130. Bode C, Muenster S, Diedrich B, Jahnert S, Weisheit C, Steinhagen F, et al. Linezolid,
vancomycin and daptomycin modulate cytokine production, Toll-like receptors and phagocytosis
in a human in vitro model of sepsis. The Journal of Antibiotics. 2015;68(8):485-90.
131. Stellari FF, Sala A, Donofrio G, Ruscitti F, Caruso P, Topini TM, et al. Azithromycin
inhibits nuclear factor-κB activation during lung inflammation: an in vivo imaging study.
Pharmacol Res Perspect. 2014;2(5):e00058-e.
132. Amsden GW. Anti-inflammatory effects of macrolides--an underappreciated benefit in
the treatment of community-acquired respiratory tract infections and chronic inflammatory
pulmonary conditions? J Antimicrob Chemother. 2005;55(1):10-21.
133. Bruno A, Cipollina C, Di Vincenzo S, Siena L, Dino P, Di Gaudio F, et al. Ceftaroline
modulates the innate immune and host defense responses of immunocompetent cells exposed to
cigarette smoke. Toxicology Letters. 2017;279:9-15.
134. Franks Z, Campbell RA, Vieira de Abreu A, Holloway JT, Marvin JE, Kraemer BF, et al.
Methicillin-resistant Staphylococcus aureus-induced thrombo-inflammatory response is reduced
with timely antibiotic administration. Thromb Haemost. 2013;109(4):684-95.
135. Cyr DD, Allen AS, Du GJ, Ruffin F, Adams C, Thaden JT, et al. Evaluating genetic
susceptibility to Staphylococcus aureus bacteremia in African Americans using admixture
mapping. Genes Immun. 2017;18(2):95-9.
136. Cheung GY, Kretschmer D, Duong AC, Yeh AJ, Ho TV, Chen Y, et al. Production of an
attenuated phenol-soluble modulin variant unique to the MRSA clonal complex 30 increases
severity of bloodstream infection. PLoS Pathog. 2014;10(8):e1004298.
137. Dabul ANG, Camargo ILBC. Clonal complexes of Staphylococcus aureus: all mixed and
together. FEMS Microbiology Letters. 2014;351(1):7-8.
128
138. McCarthy AJ, Lindsay JA. Genetic variation in Staphylococcus aureus surface and
immune evasion genes is lineage associated: implications for vaccine design and host-pathogen
interactions. BMC Microbiology. 2010;10(1):173.
139. Richards RL, Haigh RD, Pascoe B, Sheppard SK, Price F, Jenkins D, et al. Persistent
Staphylococcus aureus isolates from two independent cases of bacteremia display increased
bacterial fitness and novel immune evasion phenotypes. Infection and immunity.
2015;83(8):3311-24.
140. Nawrocki KL, Crispell EK, McBride SM. Antimicrobial Peptide Resistance Mechanisms
of Gram-Positive Bacteria. Antibiotics (Basel). 2014;3(4):461-92.
141. Spaulding AR, Salgado-Pabón W, Kohler PL, Horswill AR, Leung DYM, Schlievert PM.
Staphylococcal and Streptococcal Superantigen Exotoxins. Clinical Microbiology Reviews.
2013;26(3):422.
142. Seo HS, Michalek SM, Nahm MH. Lipoteichoic acid is important in innate immune
responses to gram-positive bacteria. Infection and immunity. 2008;76(1):206-13.
143. Thammavongsa V, Kim HK, Missiakas D, Schneewind O. Staphylococcal manipulation
of host immune responses. Nat Rev Microbiol. 2015;13(9):529-43.
144. Hiramatsu K, Aritaka N, Hanaki H, Kawasaki S, Hosoda Y, Hori S, et al. Dissemination
in Japanese hospitals of strains of Staphylococcus aureus heterogeneously resistant to
vancomycin. Lancet. 1997;350(9092):1670-3.
145. Diekema DJ, Richter SS, Heilmann KP, Dohrn CL, Riahi F, Tendolkar S, et al.
Continued emergence of USA300 methicillin-resistant Staphylococcus aureus in the United
States: results from a nationwide surveillance study. Infect Control Hosp Epidemiol.
2014;35(3):285-92.
129
146. Kong EF, Johnson JK, Jabra-Rizk MA. Community-Associated Methicillin-Resistant
Staphylococcus aureus: An Enemy amidst Us. PLOS Pathogens. 2016;12(10):e1005837.
147. Wattam AR, Davis JJ, Assaf R, Boisvert S, Brettin T, Bun C, et al. Improvements to
PATRIC, the all-bacterial Bioinformatics Database and Analysis Resource Center. Nucleic Acids
Res. 2017;45(D1):D535-d42.
148. Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the Functional Effect of
Amino Acid Substitutions and Indels. PLOS ONE. 2012;7(10):e46688.
149. Sayers S, Li L, Ong E, Deng S, Fu G, Lin Y, et al. Victors: a web-based knowledge base
of virulence factors in human and animal pathogens. Nucleic Acids Res. 2019;47(D1):D693-
d700.
150. Chen L, Yang J, Yu J, Yao Z, Sun L, Shen Y, et al. VFDB: a reference database for
bacterial virulence factors. Nucleic Acids Res. 2005;33(Database issue):D325-8.
151. Reichmann NT, Cassona CP, Gründling A. Revised mechanism of D-alanine
incorporation into cell wall polymers in Gram-positive bacteria. Microbiology. 2013;159(Pt
9):1868-77.
152. Thorpe HA, Bayliss SC, Hurst LD, Feil EJ. Comparative Analyses of Selection Operating
on Nontranslated Intergenic Regions of Diverse Bacterial Species. Genetics. 2017;206(1):363.
153. Fedtke I, Mader D, Kohler T, Moll H, Nicholson G, Biswas R, et al. A Staphylococcus
aureus ypfP mutant with strongly reduced lipoteichoic acid (LTA) content: LTA governs
bacterial surface properties and autolysin activity. Molecular Microbiology. 2007;65(4):1078-91.
154. Atilano ML, Pereira PM, Vaz F, Catalão MJ, Reed P, Grilo IR, et al. Bacterial autolysins
trim cell surface peptidoglycan to prevent detection by the Drosophila innate immune system.
Elife. 2014;3:e02277.
130
155. Winstel V, Sanchez-Carballo P, Holst O, Xia G, Peschel A. Biosynthesis of the Unique
Wall Teichoic Acid of Staphylococcus aureus Lineage ST395. mBio. 2014;5(2):e00869-14.
156. Paharik AE, Horswill AR. The Staphylococcal Biofilm: Adhesins, Regulation, and Host
Response. Microbiol Spectr. 2016;4(2):10.1128/microbiolspec.VMBF-0022-2015.
157. Peschel A, Vuong C, Otto M, Götz F. The Alanine Residues of Staphylococcus aureus
Teichoic Acids Alter the Susceptibility to Vancomycin and the Activity of Autolytic Enzymes.
Antimicrobial Agents and Chemotherapy. 2000;44(10):2845-7.
158. Ohta K, Komatsuzawa H, Sugai M, Suginaka H. Triton X-100-induced lipoteichoic acid
release is correlated with the methicillin resistance in Staphylococcus aureus. FEMS
Microbiology Letters. 2000;182(1):77-9.
159. McLean K, Holmes EA, Penewit K, Lee DK, Hardy SR, Ren M, et al. Artificial Selection
for Pathogenicity Mutations in Staphylococcus aureus Identifies Novel Factors Relevant to
Chronic Infection. Infection and Immunity. 2019;87(4):e00884-18.
160. Gisch N, Auger JP, Thomsen S, Roy D, Xu J, Schwudke D, et al. Structural analysis and
immunostimulatory potency of lipoteichoic acids isolated from three Streptococcus suis serotype
2 strains. J Biol Chem. 2018;293(31):12011-25.
161. Herman-Bausier P, Valotteau C, Pietrocola G, Rindi S, Alsteens D, Foster TJ, et al.
Mechanical Strength and Inhibition of the Staphylococcus aureus Collagen-Binding Protein Cna.
mBio. 2016;7(5):e01529-16.
162. Downer R, Roche F, Park PW, Mecham RP, Foster TJ. The elastin-binding protein of
Staphylococcus aureus (EbpS) is expressed at the cell surface as an integral membrane protein
and not as a cell wall-associated protein. J Biol Chem. 2002;277(1):243-50.
131
163. Arciola CR, Campoccia D, Gamberini S, Baldassarri L, Montanaro L. Prevalence of cna
fnbA and fnbB adhesin genes among Staphylococcus aureus isolates from orthopedic infections
associated to different types of implant. FEMS Microbiology Letters. 2005;246(1):81-6.
164. Arciola CR, Baldassarri L, Montanaro L. Presence of icaA and icaD Genes and Slime
Production in a Collection of Staphylococcal Strains from Catheter-Associated Infections.
Journal of Clinical Microbiology. 2001;39(6):2151.
165. Cerca N, Jefferson KK, Maira-Litrán T, Pier DB, Kelly-Quintos C, Goldmann DA, et al.
Molecular basis for preferential protective efficacy of antibodies directed to the poorly acetylated
form of staphylococcal poly-N-acetyl-beta-(1-6)-glucosamine. Infection and immunity.
2007;75(7):3406-13.
166. Barbu EM, Mackenzie C, Foster TJ, Höök M. SdrC induces staphylococcal biofilm
formation through a homophilic interaction. Molecular microbiology. 2014;94(1):172-85.
167. Josse J, Laurent F, Diot A. Staphylococcal Adhesion and Host Cell Invasion:
Fibronectin-Binding and Other Mechanisms. Front Microbiol. 2017;8(2433).
168. Liu J, Yang L, Hou Y, Soteyome T, Zeng B, Su J, et al. Transcriptomics Study on
Staphylococcus aureus Biofilm Under Low Concentration of Ampicillin. Front Microbiol.
2018;9(2413).
169. Li X, Xiong Y, Fan X, Feng P, Tang H, Zhou T. The role of femA regulating gene on
methicillin-resistant Staphylococcus aureus clinical isolates. Médecine et Maladies Infectieuses.
2012;42(5):218-25.

132
170. Maidhof H, Reinicke B, Blümel P, Berger-Bächi B, Labischinski H. femA, which encodes
a factor essential for expression of methicillin resistance, affects glycine content of
peptidoglycan in methicillin-resistant and methicillin-susceptible Staphylococcus aureus strains.
Journal of Bacteriology. 1991;173(11):3507.
171. Henze U, Sidow T, Wecke J, Labischinski H, Berger-Bächi B. Influence of femB on
methicillin resistance and peptidoglycan metabolism in Staphylococcus aureus. Journal of
bacteriology. 1993;175(6):1612-20.
172. Andrä J, Goldmann T, Ernst CM, Peschel A, Gutsmann T. Multiple peptide resistance
factor (MprF)-mediated Resistance of Staphylococcus aureus against antimicrobial peptides
coincides with a modulated peptide interaction with artificial membranes comprising lysyl-
phosphatidylglycerol. The Journal of biological chemistry. 2011;286(21):18692-700.
173. Hübscher J, McCallum N, Sifri CD, Majcherczyk PA, Entenza JM, Heusser R, et al.
MsrR contributes to cell surface characteristics and virulence in Staphylococcus aureus. FEMS
Microbiol Lett. 2009;295(2):251-60.
174. Beltramini AM, Mukhopadhyay CD, Pancholi V. Modulation of Cell Wall Structure and
Antimicrobial Susceptibility by a Staphylococcus aureus Eukaryote-Like Serine/Threonine
Kinase and Phosphatase. Infection and Immunity. 2009;77(4):1406.
175. Shore AC, Rossney AS, Brennan OM, Kinnevey PM, Humphreys H, Sullivan DJ, et al.
Characterization of a novel arginine catabolic mobile element (ACME) and staphylococcal
chromosomal cassette mec composite island with significant homology to Staphylococcus
epidermidis ACME type II in methicillin-resistant Staphylococcus aureus genotype ST22-
MRSA-IV. Antimicrobial agents and chemotherapy. 2011;55(5):1896-905.
133
176. Thammavongsa V, Kern JW, Missiakas DM, Schneewind O. Staphylococcus aureus
synthesizes adenosine to escape host immune responses. The Journal of experimental medicine.
2009;206(11):2417-27.
177. O'Connell C, Pattee PA, Foster TJ. Sequence and mapping of the aroA gene of
Staphylococcus aureus 8325-4. J Gen Microbiol. 1993;139(7):1449-60.
178. Oogai Y, Yamaguchi M, Kawada-Matsuo M, Sumitomo T, Kawabata S, Komatsuzawa
H. Lysine and Threonine Biosynthesis from Aspartate Contributes to Staphylococcus aureus
Growth in Calf Serum. Appl Environ Microbiol. 2016;82(20):6150-7.
179. Wang D, Yu L, Xiang H, Fan J, He L, Guo N, et al. Global transcriptional profiles of
Staphylococcus aureus treated with berberine chloride. FEMS Microbiology Letters.
2008;279(2):217-25.
180. Keaton MA, Rosato RR, Plata KB, Singh CR, Rosato AE. Exposure of Clinical MRSA
Heterogeneous Strains to β-Lactams Redirects Metabolism to Optimize Energy Production
through the TCA Cycle. PLOS ONE. 2013;8(8):e71025.
181. Connolly J, Boldock E, Prince LR, Renshaw SA, Whyte MK, Foster SJ. Identification of
Staphylococcus aureus Factors Required for Pathogenicity and Growth in Human Blood.
Infection and immunity. 2017;85(11):e00337-17.
182. Coulter SN, Schwan WR, Ng EYW, Langhorne MH, Ritchie HD, Westbrock-Wadman S,
et al. Staphylococcus aureus genetic loci impacting growth and survival in multiple infection
environments. Molecular Microbiology. 1998;30(2):393-404.
183. Wermser C, Lopez D. Identification of Staphylococcus aureus genes involved in the
formation of structured macrocolonies. Microbiology. 2018;164(5):801-15.
134
184. Begun J, Sifri CD, Goldman S, Calderwood SB, Ausubel FM. Staphylococcus aureus
virulence factors identified by using a high-throughput Caenorhabditis elegans-killing model.
Infection and immunity. 2005;73(2):872-7.
185. Mazmanian SK, Ton-That H, Su K, Schneewind O. An iron-regulated sortase anchors a
class of surface protein during Staphylococcus aureus pathogenesis. Proceedings of the National
Academy of Sciences. 2002;99(4):2293.
186. Rice K, Peralta R, Bast D, de Azavedo J, McGavin MJ. Description of staphylococcus
serine protease (ssp) operon in Staphylococcus aureus and nonpolar inactivation of sspA-
encoded serine protease. Infection and immunity. 2001;69(1):159-69.
187. Proctor AR, Kloos WE. The tryptophan gene cluster of Staphylococcus aureus. J Gen
Microbiol. 1970;64(3):319-27.
188. Mcgavin M, Arsic B, Nickerson N. Evolutionary blueprint for host- and niche-adaptation
in Staphylococcus aureus clonal complex CC30. Frontiers in Cellular and Infection
Microbiology. 2012;2(48).
189. Laarman AJ, Ruyken M, Malone CL, van Strijp JAG, Horswill AR, Rooijakkers SHM.
Staphylococcus aureus Metalloprotease Aureolysin Cleaves Complement C3 To Mediate
Immune Evasion. The Journal of Immunology. 2011;186(11):6445.
190. Pietrocola G, Nobile G, Rindi S, Speziale P. Staphylococcus aureus Manipulates Innate
Immunity through Own and Host-Expressed Proteases. Frontiers in cellular and infection
microbiology. 2017;7:166-.
191. O'Riordan K, Lee JC. Staphylococcus aureus capsular polysaccharides. Clinical
microbiology reviews. 2004;17(1):218-34.
135
192. de Haas CJC, Veldkamp KE, Peschel A, Weerkamp F, Van Wamel WJB, Heezius ECJM,
et al. Chemotaxis inhibitory protein of Staphylococcus aureus, a bacterial antiinflammatory
agent. The Journal of experimental medicine. 2004;199(5):687-95.
193. Ganesh VK, Rivera JJ, Smeds E, Ko Y-P, Bowden MG, Wann ER, et al. A structural
model of the Staphylococcus aureus ClfA-fibrinogen interaction opens new avenues for the
design of anti-staphylococcal therapeutics. PLoS pathogens. 2008;4(11):e1000226-e.
194. O'Brien LM, Walsh EJ, Massey RC, Peacock SJ, Foster TJ. Staphylococcus aureus
clumping factor B (ClfB) promotes adherence to human type I cytokeratin 10: implications for
nasal colonization. Cell Microbiol. 2002;4(11):759-70.
195. Chen X, Alonzo F, 3rd. Bacterial lipolysis of immune-activating ligands promotes
evasion of innate defenses. Proc Natl Acad Sci U S A. 2019;116(9):3764-73.
196. Cadieux B, Vijayakumaran V, Bernards MA, McGavin MJ, Heinrichs DE. Role of
Lipase from Community-Associated Methicillin-Resistant Staphylococcus aureus Strain
USA300 in Hydrolyzing Triglycerides into Growth-Inhibitory Free Fatty Acids. Journal of
Bacteriology. 2014;196(23):4044.
197. Berube BJ, Bubeck Wardenburg J. Staphylococcus aureus α-toxin: nearly a century of
intrigue. Toxins (Basel). 2013;5(6):1140-66.
198. Huseby M, Shi K, Brown CK, Digre J, Mengistu F, Seo KS, et al. Structure and
Biological Activities of Beta Toxin from Staphylococcus aureus. Journal of Bacteriology.
2007;189(23):8719.

136
199. Hodille E, Cuerq C, Badiou C, Bienvenu F, Steghens J-P, Cartier R, et al. Delta
Hemolysin and Phenol-Soluble Modulins, but Not Alpha Hemolysin or Panton-Valentine
Leukocidin, Induce Mast Cell Activation. Frontiers in cellular and infection microbiology.
2016;6:180-.
200. Venkatasubramaniam A, Kanipakala T, Ganjbaksh N, Mehr R, Mukherjee I, Krishnan S,
et al. A Critical Role for HlgA in Staphylococcus aureus Pathogenesis Revealed by A Switch in
the SaeRS Two-Component Regulatory System. Toxins (Basel). 2018;10(9).
201. Cooney J, Kienle Z, Foster TJ, O'Toole PW. The gamma-hemolysin locus of
Staphylococcus aureus comprises three linked genes, two of which are identical to the genes for
the F and S components of leukocidin. Infection and immunity. 1993;61(2):768-71.
202. Vandenesch F, Lina G, Henry T. Staphylococcus aureus Hemolysins, bi-component
Leukocidins, and Cytolytic Peptides: A Redundant Arsenal of Membrane-Damaging Virulence
Factors? Frontiers in Cellular and Infection Microbiology. 2012;2(12).
203. Ibberson CB, Jones CL, Singh S, Wise MC, Hart ME, Zurawski DV, et al.
Staphylococcus aureus hyaluronidase is a CodY-regulated virulence factor. Infection and
immunity. 2014;82(10):4253-64.
204. Chen X, Alonzo F. Bacterial lipolysis of immune-activating ligands promotes evasion of
innate defenses. Proceedings of the National Academy of Sciences. 2019;116(9):3764.
205. Löffler B, Hussain M, Grundmeier M, Brück M, Holzinger D, Varga G, et al.
Staphylococcus aureus panton-valentine leukocidin is a very potent cytotoxic factor for human
neutrophils. PLoS pathogens. 2010;6(1):e1000715-e.
137
206. Ruane KM, Lloyd AJ, Fülöp V, Dowson CG, Barreteau H, Boniface A, et al. Specificity
determinants for lysine incorporation in Staphylococcus aureus peptidoglycan as revealed by the
structure of a MurE enzyme ternary complex. J Biol Chem. 2013;288(46):33439-48.
207. Lee LY, Miyamoto YJ, McIntyre BW, Höök M, McCrea KW, McDevitt D, et al. The
Staphylococcus aureus Map protein is an immunomodulator that interferes with T cell-mediated
responses. J Clin Invest. 2002;110(10):1461-71.
208. Singh VK, Vaish M, Johansson TR, Baum KR, Ring RP, Singh S, et al. Significance of
four methionine sulfoxide reductases in Staphylococcus aureus. PloS one. 2015;10(2):e0117594-
e.
209. Jin T, Bokarewa M, Foster T, Mitchell J, Higgins J, Tarkowski A. Staphylococcus aureus
Resists Human Defensins by Production of Staphylokinase, a Novel Bacterial Evasion
Mechanism. The Journal of Immunology. 2004;172(2):1169.
210. Kwieciński J, Josefsson E, Mitchell J, Higgins J, Magnusson M, Foster T, et al.
Activation of plasminogen by staphylokinase reduces the severity of Staphylococcus aureus
systemic infection. J Infect Dis. 2010;202(7):1041-9.
211. Smith EJ, Corrigan RM, van der Sluis T, Gründling A, Speziale P, Geoghegan JA, et al.
The immune evasion protein Sbi of Staphylococcus aureus occurs both extracellularly and
anchored to the cell envelope by binding lipoteichoic acid. Molecular microbiology.
2012;83(4):789-804.
212. van Wamel WJB, Rooijakkers SHM, Ruyken M, van Kessel KPM, van Strijp JAG. The
innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory
protein of Staphylococcus aureus are located on beta-hemolysin-converting bacteriophages.
Journal of bacteriology. 2006;188(4):1310-5.
138
213. Sharp JA, Echague CG, Hair PS, Ward MD, Nyalwidhe JO, Geoghegan JA, et al.
Staphylococcus aureus surface protein SdrE binds complement regulator factor H as an immune
evasion tactic. PloS one. 2012;7(5):e38407-e.
214. Pinchuk IV, Beswick EJ, Reyes VE. Staphylococcal enterotoxins. Toxins (Basel).
2010;2(8):2177-97.
215. Lee YD, Moon BY, Park JH, Chang HI, Kim WJ. Expression of enterotoxin genes in
Staphylococcus aureus isolates based on mRNA analysis. J Microbiol Biotechnol.
2007;17(3):461-7.
216. Orwin PM, Leung DY, Donahue HL, Novick RP, Schlievert PM. Biochemical and
biological properties of Staphylococcal enterotoxin K. Infection and immunity. 2001;69(1):360-
6.
217. Orwin PM, Fitzgerald JR, Leung DYM, Gutierrez JA, Bohach GA, Schlievert PM.
Characterization of Staphylococcus aureus enterotoxin L. Infection and immunity.
2003;71(5):2916-9.
218. Votintseva AA, Fung R, Miller RR, Knox K, Godwin H, Wyllie DH, et al. Prevalence of
Staphylococcus aureus protein A (spa) mutants in the community and hospitals in Oxfordshire.
BMC microbiology. 2014;14:63-.
219. Smagur J, Guzik K, Bzowska M, Kuzak M, Zarebski M, Kantyka T, et al. Staphylococcal
cysteine protease staphopain B (SspB) induces rapid engulfment of human neutrophils and
monocytes by macrophages. Biol Chem. 2009;390(4):361-71.
220. Silversides JA, Lappin E, Ferguson AJ. Staphylococcal toxic shock syndrome:
mechanisms and management. Curr Infect Dis Rep. 2010;12(5):392-400.
139
221. McAdow M, DeDent AC, Emolo C, Cheng AG, Kreiswirth BN, Missiakas DM, et al.
Coagulases as Determinants of Protective Immune Responses against Staphylococcus aureus.
Infection and Immunity. 2012;80(10):3389.
222. Vijaranakul U, Xiong A, Lockwood K, Jayaswal RK. Cloning and nucleotide sequencing
of a Staphylococcus aureus gene encoding a branched-chain-amino-acid transporter. Applied and
environmental microbiology. 1998;64(2):763-7.
223. Frees D, Qazi SNA, Hill PJ, Ingmer H. Alternative roles of ClpX and ClpP in
Staphylococcus aureus stress tolerance and virulence. Molecular Microbiology.
2003;48(6):1565-78.
224. Jensen C, Fosberg MJ, Thalsø-Madsen I, Bæk KT, Frees D. Staphylococcus aureus ClpX
localizes at the division septum and impacts transcription of genes involved in cell division, T7-
secretion, and SaPI5-excision. Scientific Reports. 2019;9(1):16456.
225. McRobbie AM, Meyer B, Rouillon C, Petrovic-Stojanovska B, Liu H, White MF.
Staphylococcus aureus DinG, a helicase that has evolved into a nuclease. Biochem J.
2012;442(1):77-84.
226. Cirz RT, Jones MB, Gingles NA, Minogue TD, Jarrahi B, Peterson SN, et al. Complete
and SOS-Mediated Response of Staphylococcus aureus to the Antibiotic Ciprofloxacin. Journal
of Bacteriology. 2007;189(2):531.
227. Seidl K, Stucki M, Ruegg M, Goerke C, Wolz C, Harris L, et al. Staphylococcus aureus
CcpA affects virulence determinant production and antibiotic resistance. Antimicrob Agents
Chemother. 2006;50(4):1183-94.
140
228. Ding Y, Liu X, Chen F, Di H, Xu B, Zhou L, et al. Metabolic sensor governing bacterial
virulence in Staphylococcus aureus. Proceedings of the National Academy of Sciences.
2014;111(46):E4981.
229. Warne B, Harkins CP, Harris SR, Vatsiou A, Stanley-Wall N, Parkhill J, et al. The
Ess/Type VII secretion system of Staphylococcus aureus shows unexpected genetic diversity.
BMC Genomics. 2016;17:222-.
230. Aly KA, Anderson M, Ohr RJ, Missiakas D. Isolation of a Membrane Protein Complex
for Type VII Secretion in Staphylococcus aureus. Journal of bacteriology. 2017;199(23):e00482-
17.
231. Burts ML, DeDent AC, Missiakas DM. EsaC substrate for the ESAT-6 secretion pathway
and its role in persistent infections of Staphylococcus aureus. Molecular microbiology.
2008;69(3):736-46.
232. Jäger F, Kneuper H, Palmer T. EssC is a specificity determinant for Staphylococcus
aureus type VII secretion. Microbiology. 2018;164(5):816-20.
233. Wang Y, Hu M, Liu Q, Qin J, Dai Y, He L, et al. Role of the ESAT-6 secretion system in
virulence of the emerging community-associated Staphylococcus aureus lineage ST398.
Scientific Reports. 2016;6(1):25163.
234. Crosby HA, Schlievert PM, Merriman JA, King JM, Salgado-Pabón W, Horswill AR.
The Staphylococcus aureus Global Regulator MgrA Modulates Clumping and Virulence by
Controlling Surface Protein Expression. PLOS Pathogens. 2016;12(5):e1005604.
235. Hiron A, Borezée-Durant E, Piard J-C, Juillard V. Only one of four oligopeptide
transport systems mediates nitrogen nutrition in Staphylococcus aureus. Journal of bacteriology.
2007;189(14):5119-29.
141
236. Ikuo M, Kaito C, Sekimizu K. The cvfC operon of Staphylococcus aureus contributes to
virulence via expression of the thyA gene. Microb Pathog. 2010;49(1-2):1-7.
237. Soutourina O, Poupel O, Coppée J-Y, Danchin A, Msadek T, Martin-Verstraete I. CymR,
the master regulator of cysteine metabolism in Staphylococcus aureus, controls host sulphur
source utilization and plays a role in biofilm formation. Molecular Microbiology.
2009;73(2):194-211.
238. Rzychon M, Sabat A, Kosowska K, Potempa J, Dubin A. Staphostatins: an expanding
new group of proteinase inhibitors with a unique specificity for the regulation of staphopains,
Staphylococcus spp. cysteine proteinases. Mol Microbiol. 2003;49(4):1051-66.
239. Mikkaichi T, Yeaman MR, Hoffmann A, Group MSI. Identifying determinants of
persistent MRSA bacteremia using mathematical modeling. PLOS Computational Biology.
2019;15(7):e1007087.
240. Gresham HD, Lowrance JH, Caver TE, Wilson BS, Cheung AL, Lindberg FP. Survival
of Staphylococcus aureus Inside Neutrophils Contributes to Infection. The Journal of
Immunology. 2000;164(7):3713.
241. McGuinness WA, Kobayashi SD, DeLeo FR. Evasion of Neutrophil Killing by
Staphylococcus aureus. Pathogens (Basel, Switzerland). 2016;5(1):32.
242. Oliveira-Nascimento L, Massari P, Wetzler LM. The Role of TLR2 in Infection and
Immunity. Frontiers in immunology. 2012;3:79-.
243. Sabroe I, Dower SK, Whyte MKB. The Role of Toll-Like Receptors in the Regulation of
Neutrophil Migration, Activation, and Apoptosis. Clinical Infectious Diseases.
2005;41(Supplement_7):S421-S6.
142
244. Sabroe I, Prince LR, Jones EC, Horsburgh MJ, Foster SJ, Vogel SN, et al. Selective roles
for Toll-like receptor (TLR)2 and TLR4 in the regulation of neutrophil activation and life span. J
Immunol. 2003;170(10):5268-75.
245. Fortunati E, Kazemier KM, Grutters JC, Koenderman L, Van den Bosch vJMM. Human
neutrophils switch to an activated phenotype after homing to the lung irrespective of
inflammatory disease. Clin Exp Immunol. 2009;155(3):559-66.
246. Ivetic A. A head-to-tail view of L-selectin and its impact on neutrophil behaviour. Cell
Tissue Res. 2018;371(3):437-53.
247. Burnett YJ, Echevarria K, Traugott KA. Ceftaroline as Salvage Monotherapy for
Persistent MRSA Bacteremia. Ann Pharmacother. 2016;50(12):1051-9.
248. Rybak MJ, Le J, Lodise TP, Levine DP, Bradley JS, Liu C, et al. Therapeutic monitoring
of vancomycin for serious methicillin-resistant Staphylococcus aureus infections: A revised
consensus guideline and review by the American Society of Health-System Pharmacists, the
Infectious Diseases Society of America, the Pediatric Infectious Diseases Society, and the
Society of Infectious Diseases Pharmacists. American Journal of Health-System Pharmacy.
2020.
249. Merck & Co. I. Full Prescribing Information for Cubicin.
250. Melard A, Garcia LG, Das D, Rozenberg R, Tulkens PM, Van Bambeke F, et al. Activity
of ceftaroline against extracellular (broth) and intracellular (THP-1 monocytes) forms of
methicillin-resistant Staphylococcus aureus: comparison with vancomycin, linezolid and
daptomycin. J Antimicrob Chemother. 2013;68(3):648-58.
143
251. Pillay J, Kamp VM, van Hoffen E, Visser T, Tak T, Lammers J-W, et al. A subset of
neutrophils in human systemic inflammation inhibits T cell responses through Mac-1. The
Journal of Clinical Investigation. 2012;122(1):327-36.
252. Sulowska Z, Majewska E, Klink M, Banasik M, Tchórzewski H. Flow cytometric
evaluation of human neutrophil apoptosis during nitric oxide generation in vitro: the role of
exogenous antioxidants. Mediators Inflamm. 2005;2005(2):81-7.
253. Xu Y, Loison F, Luo HR. Neutrophil spontaneous death is mediated by down-regulation
of autocrine signaling through GPCR, PI3Kγ, ROS, and actin. Proceedings of the National
Academy of Sciences. 2010;107(7):2950.
254. van Kessel KPM, Bestebroer J, van Strijp JAG. Neutrophil-Mediated Phagocytosis of
Staphylococcus aureus. Frontiers in immunology. 2014;5:467-.
255. Ip WKE, Takahashi K, Moore KJ, Stuart LM, Ezekowitz RAB. Mannose-binding lectin
enhances Toll-like receptors 2 and 6 signaling from the phagosome. The Journal of experimental
medicine. 2008;205(1):169-81.
256. McCracken JM, Allen L-AH. Regulation of human neutrophil apoptosis and lifespan in
health and disease. J Cell Death. 2014;7:15-23.
257. Wlodkowic D, Telford W, Skommer J, Darzynkiewicz Z. Apoptosis and beyond:
cytometry in studies of programmed cell death. Methods Cell Biol. 2011;103:55-98.
258. Russo RC, Garcia CC, Teixeira MM, Amaral FA. The CXCL8/IL-8 chemokine family
and its receptors in inflammatory diseases. Expert Rev Clin Immunol. 2014;10(5):593-619.
259. Bhowmick T, Liu C, Imp B, Sharma R, Boruchoff SE. Ceftaroline as salvage therapy for
complicated MRSA bacteremia: case series and analysis. Infection. 2019;47(4):629-35.
144
260. Estes KS, Derendorf H. Comparison of the pharmacokinetic properties of vancomycin,
linezolid, tigecyclin, and daptomycin. Eur J Med Res. 2010;15(12):533-43.
261. Abarbanel DN, Seki SM, Davies Y, Marlen N, Benavides JA, Cox K, et al.
Immunomodulatory effect of vancomycin on Treg in pediatric inflammatory bowel disease and
primary sclerosing cholangitis. J Clin Immunol. 2013;33(2):397-406.
262. Thallinger C, Rothenburger M, Marsik C, Wuenscher S, Popovic M, Endler G, et al.
Daptomycin does not exert immunomodulatory effects in an experimental endotoxin model of
human whole blood. Pharmacology. 2008;81(1):57-62.
263. Kelesidis T. The Interplay between Daptomycin and the Immune System. Frontiers in
Immunology. 2014;5(52).
264. Barcia-Macay M, Lemaire S, Mingeot-Leclercq M-P, Tulkens PM, Van Bambeke F.
Evaluation of the extracellular and intracellular activities (human THP-1 macrophages) of
telavancin versus vancomycin against methicillin-susceptible, methicillin-resistant, vancomycin-
intermediate and vancomycin-resistant Staphylococcus aureus. Journal of Antimicrobial
Chemotherapy. 2006;58(6):1177-84.
265. Peyrusson F, Tulkens PM, Van Bambeke F. Cellular Pharmacokinetics and Intracellular
Activity of Gepotidacin against Staphylococcus aureus Isolates with Different Resistance
Phenotypes in Models of Cultured Phagocytic Cells. Antimicrob Agents Chemother. 2018;62(4).
266. Pedrera MI, Barriga C, Rodriguez AB. Intracellular activity of both teicoplanin and
vancomycin against Staphylococcus aureus in human neutrophils. Comp Immunol Microbiol
Infect Dis. 1995;18(2):123-8.
145
267. Pruul H, McDonald PJ. Uptake of cefepime by phagocytosing polymorphonuclear
neutrophils and subsequent intracellular killing. Antimicrobial agents and chemotherapy.
1996;40(8):1870-4.
268. Solberg CO, Halstensen A, Digranes A, Hellum KB. Penetration of antibiotics into
human leukocytes and dermal suction blisters. Rev Infect Dis. 1983;5 Suppl 3:S468-73.
269. Jensen SO, van Hal SJ. Personalized Medicine and Infectious Disease Management.
Trends Microbiol. 2017;25(11):875-6.
270. Salas DE, Minejima E, Wu J, Fang C, Wang J, She R, et al. Staphylococcus aureus
Bacteremia in Patients not Meeting Sepsis Criteria: Clinical Features, Host Immune Response
and Outcomes. J Clin Med Ther. 2017;2(4):27.
271. Kubicek-Sutherland JZ, Vu DM, Noormohamed A, Mendez HM, Stromberg LR,
Pedersen CA, et al. Direct detection of bacteremia by exploiting host-pathogen interactions of
lipoteichoic acid and lipopolysaccharide. Scientific Reports. 2019;9(1):6203.
272. Plevin RE, Knoll M, McKay M, Arbabi S, Cuschieri J. The Role of Lipopolysaccharide
Structure in Monocyte Activation and Cytokine Secretion. Shock (Augusta, Ga). 2016;45(1):22-
7.
273. Wang J, Xia L, Wang R, Cai Y. Linezolid and Its Immunomodulatory Effect: In Vitro
and In Vivo Evidence. Frontiers in pharmacology. 2019;10:1389-.
274. Liu SF, Malik AB. NF-κB activation as a pathological mechanism of septic shock and
inflammation. American Journal of Physiology-Lung Cellular and Molecular Physiology.
2006;290(4):L622-L45.
146
275. Driessler F, Venstrom K, Sabat R, Asadullah K, Schottelius AJ. Molecular mechanisms
of interleukin-10-mediated inhibition of NF-kappaB activity: a role for p50. Clin Exp Immunol.
2004;135(1):64-73.
276. Abraham E. Nuclear factor-kappaB and its role in sepsis-associated organ failure. J Infect
Dis. 2003;187 Suppl 2:S364-9.
277. Szeto GL, Pomerantz JL, Graham DR, Clements JE. Minocycline suppresses activation
of nuclear factor of activated T cells 1 (NFAT1) in human CD4+ T cells. J Biol Chem.
2011;286(13):11275-82.
278. Yang JH, Bhargava P, McCloskey D, Mao N, Palsson BO, Collins JJ. Antibiotic-Induced
Changes to the Host Metabolic Environment Inhibit Drug Efficacy and Alter Immune Function.
Cell Host Microbe. 2017;22(6):757-65.e3.
279. Nicoli F, Papagno L, Frere JJ, Cabral-Piccin MP, Clave E, Gostick E, et al. Naïve CD8+
T-Cells Engage a Versatile Metabolic Program Upon Activation in Humans and Differ
Energetically From Memory CD8+ T-Cells. Frontiers in Immunology. 2018;9(2736).
280. Pearce EL, Pearce EJ. Metabolic pathways in immune cell activation and quiescence.
Immunity. 2013;38(4):633-43.
281. Yamaki J, Synold T, Wong-Beringer A. Antivirulence potential of TR-700 and
clindamycin on clinical isolates of Staphylococcus aureus producing phenol-soluble modulins.
Antimicrob Agents Chemother. 2011;55(9):4432-5.
282. Fumeaux T, Pugin J. Role of interleukin-10 in the intracellular sequestration of human
leukocyte antigen-DR in monocytes during septic shock. Am J Respir Crit Care Med.
2002;166(11):1475-82.
147
283. Zhang Y, Li J, Lou J, Zhou Y, Bo L, Zhu J, et al. Upregulation of programmed death-1
on T cells and programmed death ligand-1 on monocytes in septic shock patients. Crit Care.
2011;15(1):R70-R.
284. Winkler MS, Rissiek A, Priefler M, Schwedhelm E, Robbe L, Bauer A, et al. Human
leucocyte antigen (HLA-DR) gene expression is reduced in sepsis and correlates with impaired
TNFalpha response: A diagnostic tool for immunosuppression? PLoS One.
2017;12(8):e0182427.
285. Wolf AJ, Liu GY, Underhill DM. Inflammatory properties of antibiotic-treated bacteria. J
Leukoc Biol. 2017;101(1):127-34.
286. Canepari P, Boaretti M, Lleó MM, Satta G. Lipoteichoic acid as a new target for activity
of antibiotics: mode of action of daptomycin (LY146032). Antimicrob Agents Chemother.
1990;34(6):1220-6.
287. Levels JHM, Marquart JA, Abraham PR, van den Ende AE, Molhuizen HOF, van
Deventer SJH, et al. Lipopolysaccharide is transferred from high-density to low-density
lipoproteins by lipopolysaccharide-binding protein and phospholipid transfer protein. Infection
and immunity. 2005;73(4):2321-6.
288. Shiraishi T, Yokota S, Sato Y, Ito T, Fukiya S, Yamamoto S, et al. Lipoteichoic acids are
embedded in cell walls during logarithmic phase, but exposed on membrane vesicles in
Lactobacillus gasseri JCM 1131(T). Benef Microbes. 2018;9(4):653-62.
289. Lee EY, Choi DY, Kim DK, Kim JW, Park JO, Kim S, et al. Gram-positive bacteria
produce membrane vesicles: proteomics-based characterization of Staphylococcus aureus-
derived membrane vesicles. Proteomics. 2009;9(24):5425-36.
148
290. Wang X, Thompson CD, Weidenmaier C, Lee JC. Release of Staphylococcus aureus
extracellular vesicles and their application as a vaccine platform. Nature Communications.
2018;9(1):1379.
291. Dey S, Gudipati S, Giuliano C, Zervos MJ, Monk JM, Szubin R, et al. Reduced
Production of Bacterial Membrane Vesicles Predicts Mortality in ST45/USA600 Methicillin-
Resistant Staphylococcus aureus Bacteremia. Antibiotics (Basel). 2019;9(1).

Abstract (if available)

Abstract Staphylococcus aureus is an important cause of bloodstream infections and sepsis in the United States. Sepsis occurs when the immune response to infection is dysregulated, and frequently presents with protracted anti-inflammatory responses that preclude bacterial clearance and are associated with mortality. Similar findings with respect to anti-inflammatory mechanisms have been reported in cases of persistent S. aureus bacteremia (SAB), as evidenced by an elevated ratio of IL-10/TNFα. Persistent SAB develops in 1 out of every 3 patients and is associated with an increased risk of mortality and metastatic complications. Antibiotics are the primary treatment for SAB and bacterial sepsis, however, despite showing in vitro susceptibility, administration of antibiotic therapy can fail to result in timely infection clearance. This is likely due to a combination of factors that encompass the interactions between the host, microbial, and antibiotic. Accordingly, there is an unmet need for innovative therapies to address immune dysfunction in sepsis, and similarly, there is no standard therapy for patients who develop persistent SAB. ❧ In this thesis, we propose using antibiotics, which have known immunomodulatory properties, to alter the balance of host immune response to favor the host. We examine both the direct immunomodulatory effects of antibiotics by examining their effects on host immune cells, as well as the indirect immunomodulatory effects, by manipulating the release of lipoteichoic acid (LTA), an inflammatory component of the gram-positive bacterial cell wall that is present in all strains. ❧ We found that antibiotics have both indirect and direct immunomodulatory effects on different populations of immune cells. We also showed that clinical SAB strains release variable amounts of LTA from their cell wall, which may attribute to the heterogeneous outcomes observed in SAB patients. Notably, patients who experienced persistence and/or died were infected with low LTA releasing strains. We demonstrated that antibiotics can increase release of LTA from the S. aureus cell wall, and that the effects are dependent on genetic background of the infecting strain (e.g. lineage). In addition, we showed that in the presence of purified LTA, antibiotics can differentially influence the host response of human neutrophils and peripheral blood mononuclear cells (PBMCs). Some antibiotics trended towards anti-inflammatory effects, whereas others demonstrated immunoactivating potential. The data indicates that antibiotics present a potential therapeutic approach for modulating the host immune response, which would be of interest particularly for patients exhibiting a dysregulated response to infection. The findings also suggest that in addition to microbial susceptibility data, the host immune response, as well as the release of microbial factors, should be taken into account when selecting antibiotics therapies for the treatment of SAB.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Methicillin-resistant Staphylococcus aureus: molecular epidemiology, virulence in disease, and antibiotic modulation of virulence

PDF

Therapeutic potential of host defense peptides for the treatment of cystic fibrosis lung disease

PDF

Biological impact of fluoroquinolone resistance in Pseudomonas aeruginosa

PDF

Understanding the contribution of microbial resistance and virulence towards outcomes of Staphylococcus aureus bacteremia

PDF

Inflammatory responses during infection: implications for neurodegeneration

PDF

Clinical, functional and therapeutic analysis of CD99 in acute myeloid leukemia

PDF

Therapeutic potential of rhesus theta defensin-1 in the treatment of inflammatory lung diseases

PDF

Therapeutic potential of rhesus theta (θ) defensin-1 in cystic fibrosis airway infection and inflammation

PDF

Investigating the effects of T cell mediated anti-leukemia activity in FLT3-ITD positive acute myeloid leukemia

PDF

Outcomes of antibiotic use among children with acute respiratory tract infections

PDF

Factors that may impact drug disposition and metabolism

PDF

To evaluate the in vitro activity and potential synergistic effects of Imipenem-Relebactam alone and in combination with other antimicrobial agents against clinical isolates of M. abscesses…

PDF

Site-specific PEGylation of recombinant immunotoxin αFAP-PE38 for half-life extension

PDF

Beneficial effect of antibiotic treatment on alcohol-related liver pathology in mice is not due to reduction in the butyrate-producing gut microbial phyla

PDF

Neuroinflammation and ApoE4 genotype in at-risk female aging: implications for Alzheimer's disease

PDF

Enhancing the specificity and cytotoxicity of chimeric antigen receptor Natural Killer cells

PDF

Increased cathepsin S plays an important role in ocular surface manifestations in Sjögren’s syndrome

PDF

Predicting mortality of sepsis with machine learning model approaches

PDF

Parametric and non‐parametric modeling of autonomous physiologic systems: applications and multi‐scale modeling of sepsis

PDF

Fate of antibiotic resistance in anaerobic membrane bioreactors

Asset Metadata

Creator Algorri, Marquerita (author)

Core Title Antibiotic immunomodulation in Staphylococcus aureus bloodstream infection

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Clinical and Experimental Therapeutics

Publication Date 07/26/2020

Defense Date 05/28/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag antibiotics,host-pathogen interaction,immunomodulation,lipoteichoic acid,OAI-PMH Harvest,Staphylococcus aureus bacteremia

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Wong-Beringer, Annie (committee chair), Beringer, Paul (committee member), Xie, Jianming (committee member)

Creator Email algorri@usc.edu,m.algorri@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-346057

Unique identifier UC11663347

Identifier etd-AlgorriMar-8760.pdf (filename),usctheses-c89-346057 (legacy record id)

Legacy Identifier etd-AlgorriMar-8760.pdf

Dmrecord 346057

Document Type Dissertation

Rights Algorri, Marquerita

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA