University of Southern California Dissertations and Theses

SGLT2 inhibitors reverse adipocyte differentiation and reduce daunorubicin metabolism in acute lymphoblastic leukemia treatment

(USC Thesis Other)

SGLT2 inhibitors reverse adipocyte differentiation and reduce daunorubicin metabolism in acute lymphoblastic leukemia treatment

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content SGLT2 INHIBITORS REVERSE ADIPOCYTE DIFFERENTIATION AND REDUCE
DAUNORUBICIN METABOLISM IN ACUTE LYMPHOBLASTIC LEUKEMIA
TREATMENT
by
Yulu Liu

A Thesis Presented to the
FACULTY OF THE USC SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
MOLECULAR PHARMACOLOGY AND TOXICOLOGY

August 2020
Copyright 2020 Yulu Liu
ii
Acknowledgements
First of all, I would like to thank to School of Pharmacy. Thanks for provide me a great
environment to learn and do my research. Teachers in School of Pharmacy are kind and
supportive. I really enjoy the time in this school.
I would like to thank my mentor Dr. Stan G. Louie. You have been a great teacher and scientist
that create the perfect environment for innovation, learning and development. Your modest
approach to solving complex issues has given me an indispensable tool for life. I am forever
grateful to you for your confidence and opportunity you gave me.
A special prayer of gratitude swells in my heart for my co-worker Andrew Mead and Rita Li.
We formed a really great team. It’s happy to work with you guys and I really learnt a lot from
you on how to design, operate and analysis a set of trials. Thanks for your kindly support.
I also thank my great family of laboratory mates. Thank you, Hua, Isaac, Eugene, Kabir,
Tiange, Tracey. Thanks for all the support and friendship. Each of you meant so much to me.
Last but not the least, I would like to thank my parents. Without your help and support, I won’t
finish all my study. You helped me pass the most difficult time when I first time came here.
Thank you, you are the best parents.

iii

Table of Contents
Acknowledgements ................................................................................................................. ii
List of Tables ......................................................................................................................... iv
List of Figures ........................................................................................................................ v
Abstract ................................................................................................................................. vi
Chapter 1. Introduction of Obesity and Acute Lymphoblastic Leukemia ................................. 1
1.1 Epidemiology of Obesity ........................................................................................................... 1
1.1.1 Definition and Criteria for Obesity .................................................................................... 2
1.2 Lipogenesis and Adipogenesis ................................................................................................... 3
1.3 Effect of Obesity on Cancer Chemotherapy Treatment ........................................................... 4
1.4 Obesity Impact on Leukemia Treatment .................................................................................. 6
1.5 Effect of Obesity on ALL .......................................................................................................... 7
1.6 Chemotherapy for ALL .......................................................................................................... 11
1.7 Sodium Glucose Transporter .................................................................................................. 12
1.7.1 SGLT inhibitors ................................................................................................................... 14
1.7.2 SGLT2 inhibitors and obesity .............................................................................................. 15
Chapter 2. Development of cell assays for cell differentiation and Daunorubicin metabolism 17
2.1 Introduction ............................................................................................................................ 17
2.2 Methods .................................................................................................................................. 18
2.3 Results ..................................................................................................................................... 26
2.4 Conclusion .............................................................................................................................. 42
References ............................................................................................................................ 44

iv

List of Tables
1. Classification of BMI and body habitus………………………………………………… 2
2. Different protocol from different literature that we would like to test. For Group 8, we
only use differentiation media as a negative control……………………………………19
3. Primers designed for RT-PCR ………………………………………………………… 21
4. Study Design to determine Differentiated 3T3-L1 Pre-adipocytes Viability ………… 22
5. Glucose modulating agent concentration used for assay ……………………………… 23

v
List of Figures
1. Metabolism of daunorubicin to daunorubicinol, a less cytotoxic metabolite, is mediated
by CBR1 and NADPH. …………………………………………………………………7
2. Relationship between adipocyte and inflammation. ……………………………………9
3. Structure of phloridzin, the prototype SGLT2 inhibitor ……………………………… 13
4. Structures of four FDA approved SGLT2 inhibitors, canagliflozin, empagliflozin,
dapagliflozin, and ertugliflozin. Ipraglifolozin is a SGLT2 inhibitor approved in
Japan.……………………………………………………………………………………14
5. Oil Red O staining result of different media change time………………………………26
6. Oil red O staining of differentiated adipocyte in different level of glucose in the medium
where maximal fat droplets were seen with cells grown with 100% glucose ………… 29
7. Absorbance at 510 nm in 3T3-pre-adipocyte grown at different concentrations of glucose
………………………………………………………………………………… ……… 29
8. Effect of GLUT1 inhibitor apigenin and its effect 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel) ………………………… 30
9. Effect of GLUT4 inhibitor cytochalasin and its effect 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel) ………………………… 31
10. Effect of Dapagliflozin, SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel) ………………………… 32
11. Effect of ipragliflozin, SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over time
(Left panel). Oil Red Stain quantification (Right panel) ……………………………… 33
12. Effect of Empagliflozin, SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel) ………………………… 34
13. Effect of Canagliflozin SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel) ………………………… 35
14. Effect of metformin, OCT1 inhibitor, have on 3T3-L1 adipocyte maturation over time
(Left panel). Oil Red Stain quantification (Right panel) ……………………………… 36
15. Effect of cimetidine, OCT1 inhibitor, have on 3T3-L1 adipocyte maturation over time
(Left panel). Oil Red Stain quantification (Right panel) ……………………………… 37
16. Effect of glucose modulator on daunorubicin disposition and its metabolism…………38
17. Viability of differentiated 3T3-L1 treated with daunorubicin (A) and daunorubicinol (B)
………………………………………………………………………………………… 38
18. IC50 of Daunorubicin and Daunorubicinol on leukemia cell line.…………………… 39
19. Gene expression changes in 3T3-L1 treated with glucose modulating agents. ……… 41

vi
Abstract
Background: Acute lymphoblastic leukemia ranks as leading cause of cancer-related death in
children. Latest researches reveal that acute lymphoblastic leukemia is quite related to obesity.
Children who have obesity are easier to gain poorer chemotherapy outcome and have a higher
chance to relapse.
The objective of this study the following:
1) Determine the effect of glucose modulating agents on adipocyte formation and intracellular
lipid droplet accumulation
2) Determine the effect of glucose modulating agents on adipocyte differentiation and
expression of transporters and metabolic enzymes in the adipocytes.
3) Determine disposition of daunorubicin and its metabolite in pre-adipocyte cells treated with
various glucose modulating agents
Results: SGLT2 inhibitors did not significantly change the morphology of preadipocyte
formation. When lipid droplet was quantified using Red Oil staining, all of the glucose
modulating agents were able to reduce the level of Red Oil stain when compared to untreated
cells. More excitedly, these findings were also supported by daunorubicin disposition and
metabolism study. The use of SGLT2 inhibitor reduce intracellular daunorubicin, and its
metabolite, daunorubicinol by more than 50%. Preliminary gene expression analysis did not
show significant alteration of metabolic enzymes. However, metformin, an OCT1 inhibitor, was
found not reduce metabolic enzymes but the expression of SGLT2 transporters.
Conclusions The preliminary data in this study suggest that the use of glucose modulating agents
may have profound effect on daunorubicin in fat tissues. If these findings are supported in
vii
animal models of obesity, it is potentially plausible that effect therapy can alter poor clinical
outcomes in obese patients with ALL.

1
Chapter 1. Introduction of Obesity and Acute Lymphoblastic
Leukemia
1.1 Epidemiology of Obesity
Epidemiology studies have shown that people from developed countries are more likely to be
obese as compared to individuals residing in developing countries
1
. In addition, the prevalence of
obesity is more common in urban centers, where food is easily assessible, as compared to rural
areas. However, the incidence of obesity has expanded into individuals in low to middle income
countries.
In 2016, it was estimated approximately 1.9 billion persons or approximately 40% of the global
adult population were classified as either being overweight or obese. Additionally, the World
Health Organization (WHO) estimated that approximately 650 million were defined as obese
2
.
These findings have led the WHO to designate the goal to reducing obesity as a significant
challenge.
Regards to the global prevalence of obesity, it is estimated that the prevalence has almost
tripled from 1975 to 2015. In this study, women were more prone to be obese as compared to their
male counterpart
3
. The proportion of adults with a body mass index (BMI) >25 kg/m
2
has
increased between 28.8% to 36.9% in men, and from 29.8% (29.3–30.2) to 38.0% in women from
1980 to 2013, respectively
4
.
Studies have also shown that BMI increases from birth until 7 years of age. The level of
body fat starts to diminish and nadir at about 7 years of age. After this nadir, there is a steady
increase of BMI which changes during puberty. It is during puberty development that has been
shown to increase the risk for obesity. More commonly known as adolescence associated weight
gain, this may be a predictor of ultimate obesity development during adult.
2
1.1.1 Definition and Criteria for Obesity
Obesity is a complex disease where the hallmark clinical manifestation is excessive amount of
body fat. Obesity is often confused with overweight, where individuals with these conditions will
have excessive fat as a common denominator. To delineate the difference between being
overweight and obesity, clinical measures have been established. Clinically, obesity is identified
by using the body mass index (BMI). BMI is a height-independent measure that has been shown
to be strongly correlative with percent body fat. This is calculated by the using the individual’s
actual body weight in kilograms divided by the height in meters squared [kg/m
2
]
5
. Table 1
summarizes the overall habitus classification in relations to BMI. Current standards have defined
individuals with BMI 18.5 to 24.9 kg/m
2
as having normal body habitus (Table 1). For individuals
with BMI>25 kg/m
2
but less than 30 kg/m
2
, people with this morphological characteristic is
classified as being overweight. However, people whose BMI>30 kg/m
2
is the minimal threshold
for obesity. The level of obesity are also subcategorized, where individuals with BMI between
35-39.9 and >40 kg/m
2
are classified as obesity class II and III, respectively, which are more
clinically referred to either as very obese or morbidly obese.
BMI (kg/m
2
) Classification Obesity Class
<18.5 Underweight

18.5-24.9 Normal

25.0-29.9 Overweight

30.0-34.9 Obese I
35.0-39.9 Very Obese II
>40.0 Morbidly Obese II
Table 1: Classification of BMI and body habitus
The diagnosis of obesity must be individualized balancing risk for other morbidities such
as diabetes. This begins to increase at a BMI of 23 kg/m
2
for individuals who are Asian (e.g.,
Chinese, Japanese, or Indians) descent. Normal BMI for this population is defined as a BMI of
3
18.5–22.9 kg/m
2
, where overweight as 23.0–24.9 kg/m
2
, and obese as ≥ 25.0 kg/m
2
. In contrast,
disease risk may be lower in African Americans when compared to whites at the same BMI.
Although overall BMI is a marker of obesity, body fat is another independent criterion for
obesity. Within the context of sex and fat distribution, higher body fat is seen in women, when
compared to males at the same BMI where fat level is about 12% higher in women. BMI can also
be misleading for older individuals at a given BMI have a higher risk for obesity-associated co-
morbidities. Older patients are more likely to have reduced muscle mass and thus fat becomes
disproportional in this population. In contrast, BMI may also be misleading indicator in elite
athletes, whose elevated weight may be attributable to increased lean mass which does not
contribute equally in terms of fat deposits.
Obesity is associated with a number chronic conditions which include Type 2 Diabetes
mellitus, cardiovascular conditions, and even cancers. A number of risk factors have been
associated with increased risk for obesity, which include genetics, epigenetics, hormonal,
microbial, life imprint and neuropsychological status.

1.2 Lipogenesis and Adipogenesis
As stated earlier, fat plays a critical role in energy balance. Fat expansion can occur
using two different processes more commonly referred as adipogenesis and lipogenesis
6.7.8
.
Adipogenesis is the formation of adipocyte from stem cell mediated expansion. Stem cells are
mobilized into the tissues where these precursor cells will undergo tissue determination,
maturation and terminal differentiation. Determination is the process where mesenchymal stem
cells (MSC) commit to form adipocyte precursor cells. In this process, MSCs lose their potential
to differentiate to other type of cellular lineages. Terminal differentiation is the final stage of
differentiation in which preadipocyte will finally differentiate to mature adipocyte.
4
In contrast, lipogenesis is the metabolic process where metabolic precursors such as
acetyl-CoA is converted into triglyceride and fatty acid. In this process, the breakdown of
glucose forms metabolites that are critical of fatty acid biosynthesized and stored in adipose
tissue. Both adipogenesis and lipogenesis are processes responsible for the energy storage and
fat accumulation.
Both of these fat expansion processes are highly regulated by hormones and cytokines.
Important peptides include insulin and leptin which are two hormones that can regulate adipose
tissue formation. Fat accumulation occurs when there is excess carbohydrate and energy. In this
context, insulin will promote cellular internalization of carbohydrate which can enhance
production of fatty acid and lead to its accumulation. In contrast, leptin is a mediator that inhibit
fat accumulation. Leptin can reduce appetite stimulation and thus modulate food seeking
behaviors which ultimately reduce total food intake. This indirectly reduces fat accumulation
into adipose tissue. These morphologic changes have been associated with gene expression also
changes for both of these two processes
9
. An example of gene expression mediated activities is
exemplified by the relationship of adipogenesis with high expression of peroxisome proliferator-
activated receptor gamma (PPAR-gamma), a nuclear receptor that regulate a myriad of
biological functions
10
. At the termination of adipogenesis, it is thought that fat accumulation
transition to lipogenesis, the expression of PPAR-gamma returns back to baseline.

1.3 Effect of Obesity on Cancer Chemotherapy Treatment
Although obesity is notable for body hiatus changes, it is also associated with an increased
risk for other metabolic diseases such as diabetes, and cardiovascular disease (e.g. dyslipidemia,
hypertension and atherosclerosis). Obesity has been associated with increased inflammation, thus
linking obesity with malignancies like breast cancers, prostate cancers and leukemia.
5
In addition, it has been proposed that obesity may impact the clinical outcomes of patients
with cancers. Obese cancer patients have poorer clinical outcomes as compared with non-obese
patients. The exact mechanism contributing to poorer clinical outcome has not well elucidated.
Differences in pharmacokinetics, metabolic dysregulation, or physicians’ decision to reduce
chemotherapy dose-intensity during treatment to minimize toxicities can all contribute to poor
clinical outcomes.
Two parameters of pharmacokinetics are tightly related to obesity which are volume of
distribution and clearance
11
. Volume of distribution (Vd), measured from plasma, is a parameter
to estimate drug distribution in extra vascular tissue. Vd can be determined by physical property
of drug, tissue blood flow and plasma protein binding. For example, for a lipophilic drug, since
obese patients have a higher fat content in peripheral tissue when compared with non-obese
patients, it is thought that obese patients will have a higher Vd. On the other hand, tissue perfusion
and cardiac function may be decreased in patients thereby decreasing Vd and protein binding in
plasma may not be significantly altered by body composition. Taking all of these into consideration,
obese patients can have a different plasma concentration but similar tissue concentration.
Drug clearance is a critical component for devising correct dosages. Clearance is only
affected by patients’ physical condition. For most drugs, there are removed from liver. For obese
patients, fat can be accumulated in liver, altering blood flow, reducing total clearance. Another
important organ for drug clearance is kidney. There is not clear data showing that kidney clearance
can be affected by obesity. But based on some articles, since clearance correlated with lean body
mass and obese patients have a higher lean body weight, they tend to have a higher absolute drug
clearance
12
.

6
1.4 Obesity Impact on Leukemia Treatment
Leukemia is the most common childhood malignancy and the second leading cause of
cancer death in children.
6
In addition, leukemia is the 11
th
most common adult cancer in the U.S.
6

The relations between obesity, cancer development has been associated. Current understanding is
that obesity is associated with increased risk for cancer development. This has been established
in acute lymphoblastic leukemia where over 20% of pediatric acute lymphoblastic leukemia (ALL)
patient are found to be obese
12,1416
. This is also found in adults
15
with leukemias as well. These
findings have highlighted the impact of obesity on leukemia, where some have characterized
obesity as a major public health impact. The presence of obesity was associated with poorer clinical
outcomes and even increase risk for cancer-related mortality
13
. It is currently estimated that
obesity may be responsible for >90,000 cancer deaths/year in the US
14
. The impact of obesity was
also assessed in pediatric ALL, where the presence of obesity correlated with poorer disease-free
survival
15
. These finding were also confirmed in meta-analysis
16
.
Mechanistic dissection as how obesity may influence clinical outcomes have been reported
previously. One group showed that obesity impairs the efficacy of initial chemotherapy to clear
ALL from the bone marrow
17
. Our group have interrogated pharmacological mechanism(s) as to
how obesity can impact ALL treatment outcome
18
. We have found that adipocytes can protect
ALL using various mechanisms. This includes enhanced clearance of cytotoxic chemotherapy.
We have found that adipocytes can upregulate the expression of aldoketo reductases which are
important enzymes that participate in the metabolism of chemotherapeutic drugs. For example,
these enzymes can convert widely used chemotherapeutic drug anthracycline such as daunorubicin
(DNR) to a less cytotoxic metabolite, daunorubicinol (DRN-ol) (Figure 1). The present proposal
7
focuses on one mechanism by which obesity and adipocytes affect ALL treatment outcome:
anthracycline uptake and deactivation.
Another mechanism involves oxidative stress response in adipocytes. A study suggested
that ALL cells induce intracellular reactive oxygen species (ROS) and an oxidative stress response
in adipocytes
19
. This oxidative stress response leads to cytokine secretion from adipocytes which
can protect acute lymphoblastic leukemia (ALL) cells from a variety of chemotherapy such as
daunorubicin. Chemotherapy resistance may also be due to adipocyte activation of autophagy and
upregulation of the autophagic proteins
20
, thereby suppressing chemotherapy efficacy.
Due to the wide distribution of adipose tissue, it is in close contact with variety of solid
tumors during tumor growth, local invasion and progression
21
. For supporting tumor growth,
many tumor cells express receptors for adipokines secreted by adipocyte such as leptin,
adiponectin, insulin-like growth factor-1. Adipocytes also promote angiogenesis by releasing
angiotensin, a cytokine that participates in angiogenesis (Figure 2?). Based on another literature,
stromal cells such as fibroblast could promote tumor survival and drug resistance
22
.

1.5 Effect of Obesity on ALL
Acute lymphoblastic leukemia (ALL) is a malignant disease arising from the bone marrow.
Since the occurrence of leukemia, cancer cells can invade into circulation and quickly spread to

Figure 1: Metabolism of daunorubicin to daunorubicinol, a less cytotoxic metabolite, is
mediated by CBR1 and NADPH.
8
some other organs like lymph nodes, spleen, which can disturb the normal regeneration of blood
cell. In tumor microenvironment, there are multiple kinds of cells like normal cells, fibroblast,
macrophages, adipocytes and so on
23
. All of these cells interact with each other and provide
leukemia cells a hospitable microenvironment to survive, proliferate and metastasize
24
.
Pediatric patients with ALL and obesity have been associated with poor chemotherapy
outcomes, where the effects has implicated the lack of daunorubicin antitumor activity. We have
hypothesized the reduction of systemic daunorubicin-mediated antitumor activity may be
attributed to adipocyte sequestration and metabolism of the active cytotoxic compound. We have
previously shown that adipose tissue can alter the pharmacokinetics of daunorubicin through
sequestration of this hydrophobic compound into fat. More importantly, the adipocyte sequestered
daunorubicin can be rapidly metabolized into the less active daunorubicinol (DRN-ol). This
presents an additional problem in that daunorubicinol is not only has reduced antitumor activity
but has been implicated as a cardiotoxic moiety that can promote drug-induced cardiomyopathy.
The metabolism of daunorubicin to daunorubicinol is well-elucidated, which is mediated
by carbonyl reductase 1 (CBR1). This is one of the key enzymes responsible for the
biotransformation of daunorubicin (Figure 1)
25
. Interestingly, CBR1 is in the family of aldoketo
reductase, that is critical in metabolizing various steroids and steroid hormones. In our previous
study, we have shown that adipocytes have increased expression of this metabolic enzyme.
Besides some basic function like energy storage and triglyceride acid synthesis, adipose
tissue is also a secretion-activated tissue
26
. Fat is a combination of adipocytes, preadipocyte, and
macrophages, where the interactions can lead to a host of cytokine production and elaboration
(Figure 2)
27
. Cytokines and lipid mediators found in fat include compounds that can promote
adipogenesis, inflammation and tumor proliferation. These factors point to the potential of direct
9
activation of ALL proliferation
28
. In obese mouse model, we saw a high plasma level of insulin,
leptin and IL-6. Insulin is a potential activator of ALL cellular proliferation. Interestingly, pre-B
lymphoblastic cell ALL translocation has been shown to promote the expression of insulin receptor.
This finding suggests insulin-related pathway maybe a potential contributor to ALL development
and disease acceleration.
Leptin, a type of hormone predominately secreted by adipose tissue, is also believed to be
a stimulator of hematopoietic activation. Although there is no evidence to show that leptin has a
direct effect on ALL, the ability to activate the hematopoietic system suggests that leptin can
potentially promote leukemia. This hypothesis is spawned by the expression of leptin receptor on
ALL blasts indicating leptin can be a possible modulator of ALL proliferation.

Figure 2: Relationship between adipocyte and inflammation.
10
Additionally, interleukin-6 (IL-6) is an inflammatory cytokine associated with the
pathogenesis of several types of cancer. As IL-6 is one of the cytokines that secreted by adipose
tissue, it has been investigated as a potential link between obesity and several types of cancer
development. IL-6 is believed to also impair insulin pathway
29
, reducing insulin sensitivity and
resulting in insulin resistance and ultimately lead to type 2 diabetes as a consequence of obesity.
Another important proinflammatory cytokine associated with adipose tissue includes
adiponectin. Adiponectin is a peptide cytokine that regulates glucose levels as well as fatty acid
breakdown. ADIPOQ is the gene that encodes for adiponectin where its expression is found in
adipose tissue
30
. Its biological activity includes the ability to promote pre-adipocyte differentiation
into mature adipocyte.
Tumor necrosis factor-alpha (TNF) is the primary inflammatory cytokine with pluripotent
activity in a variety of cells. One biological activity of TNF is the impairment of insulin sensitivity
in mature adipocyte
31
. This biological property is widely accepted and thought to be a contributor
to obesity and thus inducing Type 2 diabetes. In vitro studies have shown that TNF also plays a
role in promotion of leukemia and maintaining survival of leukemia stem cells
32
.
Vascular endothelial growth factor or VEGF has been closely associated with cancers,
where therapeutic strategies have targeted this critical angiogenic factor. VEGF was originally
referred to vascular permeability factor (VPF) which not only stimulate formation of blood vessels
but enhance blood vessel permeability. Although VEGF has been associated with solid tumors
such as breast, colorectal and brain cancers, its role in leukemia has also been implicated. High
levels of VEGF in microenvironment has been associated with poor chemotherapeutic response
33
.

11
1.6 Chemotherapy for ALL
In general, the strategy for ALL chemotherapy is using chemotherapeutic combination over
a longer period of time to reduce drug-induced side effect
34
. Some common chemotherapeutic
agents used for the treatment of ALL include Vincristine, Daunorubicin, Doxorubicin, and
Cyclophosphamide. Corticosteroids have been shown to induce leukemic cell apoptosis and thus
is a critical compound in induction therapy, where dexamethasone is often employed. Each of
these chemotherapeutic components have their own specific side effects, such as peripheral
neuropathy associated with vincristine which can manifest as persistent numbness or tingling.
Anthracyclines like daunorubicin is a key component in ALL chemotherapy-regimen, where its
inclusion is associated with better ALL treatment outcomes.
Daunorubicin is an anti-cancer chemotherapy drug. This drug is classified as an
“anthracycline antitumor antibiotics.” It is mainly used for treating ALL, acute myelogenous
leukemia (AML), and acute promyelocytic leukemia (APL). Its mechanism of antitumor has been
attributed to its ability to prevent cellular division. Chemical analyses have shown that
daunorubicin intercalates DNA and inhibits progression of topoisomerase II. Additionally,
daunorubicin have been shown inhibit the activity of polymerase. Unrelated to these antitumor
properties, daunorubicin can also generate superoxide that can cleave DNA and macromolecules.
Taken together, daunorubicin is a cytotoxic chemotherapy that can effectively eliminate leukemia.
The chemical properties of daunorubicin has been compared to other anthracyclines such
as doxorubicin, epirubicin and idarubicin where all of these agents have anti-leukemic effects. The
LogP and Vd of Daunorubicin is 1.83 and 68.1L/m
2
respectively
35
. These physicochemical
properties indicate that Daunorubicin can be easily absorbed by tissue or tumor then accumulated
there. It has a plasma half-life time about 18.5 h, which is shorter than both Doxorubicin and
Idarubicin, which can indicate this drug can be quickly removed resulting in reduced potential
12
toxicity. The lethal dose 50% or LD50 of daunorubicin has been identified to be 20 mg/kg (IV,
mice) and 13 mg/kg (IV, rat), which indicate Daunorubicin is a safe drug to be administrated in
human.
There are some common side effects of Daunorubicin including hematologic,
gastrointestinal and cardiovascular, where these side effects are dosage dependent. In particular,
cardiovascular toxicity is associated with cumulative dose over 400-550mg/m
2

Since the level of adipose tissue has been associated with reduced daunorubicin efficacy,
we want to understand the impact of obesity on antitumor activity(ies) associated daunorubicin. In
this case, adipocyte plays an important role on drug metabolism. If we can reduce the generation
of adipocyte, it may result in a desirable dose in leukemia microenvironment.

1.7 Sodium Glucose Transporter
Carbohydrates represent a major component of our dietary intake, where excess
consumption of carbohydrate has been implicated in the development of obesity. The level of
carbohydrates, and in particular glucose is tightly regulated by complex but integrated system,
which include insulin. Glucose is a central carbohydrate moiety the sustains biochemical
processes and biosynthesis of critical components. Due to its importance, not only is the utilization
of the glucose is highly regulated but also its elimination. Glucose can be filtered in the kidneys
but are reabsorbed by sodium-glucose co-transporter (SGLT) in kidney.
When people take more carbohydrates than needed, part of carbohydrates will be
metabolized to fat (mainly triglyceride) storing in our body. When the sugar supply is insufficient,
triglyceride can be metabolized into fatty acids and glycerol to generate Acetyl-CoA providing
energy. The balance between consumed calorie and ingested calorie is the key in weight loss.
Weight change is caused by a long-time imbalance of food intake and energy expenditure.
13
There are two members of SGLT family and are classified as either SGLT1 or SGLT2.
These influx transporters are members of the solute carrier 5A (SLC5A) gene family. SGLT-2 is
mainly expressed in segment 1 and 2 (S1–S2) of renal proximal tubule and is responsible for the
reabsorption of about 90% of the filtered glucose. While SGLT-1 is responsible for the
reabsorption of nearly 10% of the filtered glucose load in the renal proximal tubule segment 3 (S3)
(Wright, LOO, & Hirayama, 2011).

SGLT-1 also locates in liver, heart, lung and small intestine
where it is largely responsible for intestinal absorption of glucose live, heart and lung.
The compound phloridzin (Figure 3) is the first SGLT inhibitor isolated in 1835 by French
chemists from the root bark of the apple tree. This glucoside of phloerin is classified as a bicyclic
flavonoid. Biologically, it was shown to improve blood glucose levels in animals (Petersen, 1835).

Despite these results, phloridzin was initially abandoned as a potential treatment of type 2
diabetes due to its rapid degradation and poor absorption in the gastrointestinal tract.

Figure 3: Structure of phloridzin, the prototype SGLT2 inhibitor
14
1.7.1 SGLT inhibitors
Currently, there are four SGLT2 inhibitors that are approved by Food and drug
administration (FDA) which include Canagliflozin, Dapagliflozin, Empagliflozin and
Ertugliflozin (Figure 4). Known commonly as the gliflozins, other compounds such as
Ipragliflozin or Luseogliflozin are not approved in the United State but were approved in some
other countries. These inhibitors have a high selectivity of SGLT2 transporter when compared to
SGLT1 transporter. Inhibition of the SGLT2 transporter, they can decrease the glucose
reabsorption from urine back into blood, and thus lowering blood glucose level. Besides that,
SGLT2 inhibitors also decrease the threshold of glucose reabsorption, which can enhance the
efficacy to control blood glucose level. All of these functions will contribute to the outcome of
weight loss. Some studies have shown the use of SGLT2 inhibitor empagliflozin lead to improved

Figure 4. Structures of four FDA approved SGLT2 inhibitors, canagliflozin,
empagliflozin, dapagliflozin, and ertugliflozin. Ipraglifolozin is a SGLT2 inhibitor
approved in Japan.
15
cardiovascular parameters. In this study, a 38% cardiovascular risk reduction was found in patients
receiving empagliflozin when compared to patients receiving placebo. These pharmacologic
benefit of SGLT2 inhibitors in Type 2 Diabetes Mellitus (T2DM) have promoted some to use
SGLT2 in patients with and T2DM-related obesity.

1.7.2 SGLT2 inhibitors and obesity
Besides T2DM effect, SGLT2 inhibitors also shows promising effect direct on body weight
loss, largely accounted for by body fat reduction
36
. SGLT2 inhibitors have been associated with
an average weight loss ranging from 1.5 to 2 kg. These significant weigh losses have promoted
clinicians to promote their use for the treatment of obesity. The mechanism of weight loss is
thought to be based on glucose excretion and this glucose lowering capacity is blood-glucose
dependent which can minimizing hypoglycemic events, making it much safer to administere. Some
SGLT2 inhibitors have reported reduction of subcutaneous and visceral adipose tissue which refers
to white adipose tissue (WAT) rather than lean tissue.
These findings have been confirmed in experimental models. Additionally, in diet-induced
obese rat model, SGLT2 inhibitors also increased lipolysis and ketone circulating level. This
reduction in blood glucose concentration together with hormonal change lead to mobilization of
lipid storage. All of these resulted in energy substrate from glucose to lipid for energy generation.
Under such conditions, lipolysis will increase in adipose tissue and release non-esterified fatty acid
which are converted to ketone bodies in the liver through mitochondrial beta oxidation and
ketogenesis, resulting in metabolic condition resembling a prolonged fast. Finally, all of these will
contribute to the total body weight loss.
Besides weight loss, SGLT2 inhibitors has been associated with other benefits include
reduction of adipose tissue inflammation and increase brown adipose tissue in rodent model as
16
well
37
. As aforementioned, obesity, T2DM as well as malignancies like ALL have significant
inflammation. This include elevation of inflammatory cytokines such as IL-6 or leptin. If SGLT2
inhibitors can reduce inflammation, it may potentially enhance anti-obesity effects. But the thing
is that, this anti-inflammation mechanism is not well elucidated, more researches are needed.
Based on background, here comes the hypothesis. Because adipogenesis is quietly related
with imbalance between energy uptake and energy consumption. If we can use SGLT2 inhibitors
to reduce glucose uptake, decreasing plasma glucose level, this will lead to a down-regulation of
carbohydrate accumulation in cells, and all of these cases will disturb adipogenesis. Besides that,
since some articles mentioned SGLT2 inhibitors also show anti-inflammation effect, this effect
would also potentially contribute to prevent adipogenesis. If adipogenesis pathway is inhibited,
daunorubicin won’t be absorbed by adipocyte which will provide a higher intracellular
concentration. What’s more, because of the metabolic enzyme of daunorubicin in adipocyte,
decreased adipocyte will also metabolize less daunorubicin. More chemotherapy will be preserved
and exert their effect on ALL treatment.

17
Chapter 2. Development of cell assays for cell differentiation and
Daunorubicin metabolism
2.1 Introduction
3T3-L1 is a fibroblast cell line derived from mouse. It has a fibroblast-like morphology
where under the right conditions, 3T3-L1 can differentiate into an adipocyte-like cell. Four
components when added together can promote the transformation from fibroblast to adipocyte
morphology. 3-Isobutyl-1- methylxanthine (IBMX), dexamethasone, insulin and rosiglitazone
containing medium can promote transformation from fibroblast to pre-adipocyte with
triglyceride and fatty acid within the intracellular contents.
Since excess carbohydrates can promote obesity, it is reasonable that high glucose is the
key substrate for fat accumulation. So, we detected all potential glucose-uptake related
transporters to see if they show any effect on inhibiting glucose uptake. These includes glucose
transport-1 (GLUT1) inhibitor (apigenin), GLUT4 inhibitor (cytochalasin), SGLT2 inhibitor
(gliflozin), OCT1 antagonist (cimetidine), OCT1 agonist (metformin). In addition, we also
directly test how glucose level will affect fat accumulation.

Hypothesis: Since fat accumulation in pre-adipocytes, there is an increase the ROS which
product additional ROS metabolites. To accommodate increased in ROS, pre-adipocyte cells
will need to increase expression of aldoketo reductase expression. We hypothesis, the addition of
SGLT2 can alter fat accumulation in pre-adipocyte 3T3-L1, and thus impact the transition to pre-
adipocyte.
Specific Aim 1: Determine the optimal culture conditions leading to 3T3-L1 differentiation into
pre-adipocytes.
18
Specific Aim 2: Determine the impact of SGLT-2 inhibitor on 3T3-L1 differentiation and
expression of aldoketo reductase.

2.2 Methods
1. Cell culture protocol
Normal 3T3-L1 preadipocyte can be maintained in DMEM media with 10% FBS, 1%Glutamax
and 1% Anti-Anti (maintenance media). For differentiated adipocyte, extra FBS will be added
since it will provide more lipid and nutrients that can enhance fat accumulation. Differentiation
media is DMEM media that contain 15% FBS, 1% Glutamax and 1% Anti-Anti (differentiation
media). When we start cell assay in plates, it’s necessary to coat the plate with coating buffer.
Coating buffer is a PBS solution that contains 10% Fibronectin bovine plasma, 6% collagen and
0.1% BSA. To differentiate 3T3-L1 preadipocyte, we will use “induction cocktail”. It is
differentiation media with 500uM IBMX, 250nM dexamethasone, 5ug/mL insulin and 2uM
rosiglitazone.
Usually a new culture starts on Wednesday. A new vial of cell from liquid nitrogen will
be directly add into a T75 and wait another day to let them recover. On Friday, cells would be
splited in T75, some would be seeded into plate for assay, some would be kept as a subculture
and the left would be refreeze and store in liquid nitrogen.
Passage number is an important factor that can affect differentiation efficiency where low
passage number can more rapidly mature and differentiate into pre-adipocytes. Additionally,
3T3-L1 confluency may lose their ability to differentiation. It’s better to split cell in flask when
they become 70%-80% confluence.
When cells in plate become 80%-90% confluence, old media will be aspirated and induction
cocktail will be added (Day -2). Volume can affect lipid accumulation. According to some
19
articles, 325 µL per well in a 24 well plate will ensure a good accumulation. It’s important to
keep it constant. The way we used is adding blank PBS into well interval to reduce evaporation
in cell well. After two days induction, half of induction cocktail will be substituted with insulin
media (half amount of insulin in induction cocktail without any other component). After
induction, cells will release adipogenesis related cytokines. It’s better to keep them in the media.
So, we did a volume half change, just remove half of media in well and add insulin media to
keep volume constant (Day 0). Then we will do this half change with insulin media every two
days until Day 6.

2. Differentiation protocol selection
There a number of differentiation protocols found in literature. Although there are subtleties in
the various differentiation protocols, all of the protocols used medium containing IBMX (3-
isobutyl-1-methylxanthine), dexamethasone, insulin and Rosiglitazone. There was no variation
on the inclusion of IBMX and rosiglitazone. IBMX was used in all of the protocols where the
concentration of 0.5 mM was consistent. Rosiglitazone is used to enhance insulin sensitivity
where the final concentration is 2 µM. The protocols varied the concentration of dexamethasone
ranging from 250 nM to 1.0 µM. The other important varying factor include insulin
concentration vary from 0.87 to 10 µg/ml. In addition, all of the protocols used high
Group
Ingredients 1 2 3 4 5 6 7 8
IBMX (mM) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0
Dexamethasone (µM) 1 0.25 1.0 0.25 0.25 0.25 0.25 0
Insulin (µg/mL) 1 1 10 10 5 5 1 0
Rosiglitazone (µM) 2 2 2 2 2 2 0 0
FBS (%) 10 10 10 10 10 15 15 15

Table 2. Different protocol from different literature that we would like to test. For Group 8,
we only use differentiation media as a negative control.
20
concentration of FBS to accelerate pre-adipocyte differentiation. Since there are many
parameters that can affect differentiation, we wanted to determine the conditions that
consistently accelerated pre-adipocyte formation. Our plan is summarized in Table 2 which alter
the various concentration of insulin, dexamethasone and FBS concentrations. In group 8, this is
the negative control.
Day -4: Coat plate with coating buffer first. The coating buffer contains BSA, fibronectin and
collagen. Then seed cells in coated 24 well plate with a seeding density equals 30000 cells/well.
Day -2: After two-days proliferation, cells in well will reach 80%-90% confluency and it’s
ready to differentiate. Change normal maintenance media to induction cocktail in table above.
Day 0: After two-days induction, change media to insulin media which only have half amount
of insulin in each group without any other component.
Day 2, 4, 6, 8: Use Day 2 media to refresh media in well plate.
After 8 days after induction, most of cells will finish differentiation and we can use Oil Red
O staining and qPCR to check the differentiation efficiency between different protocol.
Finally, we found that Group 6 which refers to 0.5mM IBMX, 250nM Dexamethasone,
5ug/ml insulin and 2uM Rosiglitazone in 15% FBS differentiation media is the most efficient
protocol.

3. IC50 of Daunorubicin and Daunorubicinol on differentiated adipocyte
To find out the IC50 of Daunorubicin and Daunorubicinol on differentiated adipocyte, we seed
3T3-L1 preadipocyte in 96 well plate with a seeding density at 5000cells/well and differentiate
them according to protocol we determined. For 96 well plate, to make sure cells grow normally,
we added PBS in the peripheral wells to compensate evaporation of media in central 60 wells.
21
Then to test what impact will Daunorubicin or Daunorubicinol have on differentiated 3T3-L1
have on cellular viability, we used concentration escalation design, where cells are incubated at
the designated concentrations for 24, 48 or 72 hours. At every 24 hour time point, cellular
viability is determined using Alamar Blue evaluation.

4. Check genes that mainly related to Daunorubicin metabolism.
We wanted to determine the impact of various treatment on pre-adipocyte, in particular their
ability to metabolize Daunorubicin. RT-PCR was used to determine the gene expression of these
targeted metabolic genes such as AKR and CBR. Table 3 summarizes the targeted genes and
their respective primers to probe for gene expression

Targets Forward primer Reverse primer
Leptin ATTTCACACACGCAGTCGGT ACTCAGAATGGGGTGAAGCC
Glut4 CAGATCGGCTCTGACGATGG GCCACGTTGCATTGTAGCTC
PPAR-gamma TTCGCTGATGCACTGCCTAT TTCGCTGATGCACTGCCTAT
Nox-4 TGGCCAACGAAGGGGTTAAA GATGAGGCTGCAGTTGAGGT
IL-6 CCCCAATTTCCAATGCTCTCC CGCACTAGGTTTGCCGAGTA
SGLT2 GCTGCCTATTTCCTGCTGGT GAACAGAGAGGCTCCAACCG
Adiponectin ATCTGGAGGTGGGAGACCAA ATCTGGAGGTGGGAGACCAA
β-actin CTGAACCCTAAGGCCAACCGT TACGTACATGGCTGGGGTGT
GAPDH CATGGCCTTCCGTGTTCCTA ACTTGGCAGGTTTCTCCAGG
Table 3. Primers designed for RT-PCR
22
5. Determine the IC50 of each drug used on differentiated adipocyte.
We also determined the cytotoxic capacity of the glucose altering agents that are being tested in
differentiated 3T3-L1 cells. Thus, a concentration escalation of these compounds were tested in
relations to cellular viability and morphologic changes (Table 4). The concentration used were
within the dynamic range used clinically and a physiologically sustainable concentration (Table
4). We will test the concentration between 0.1x relative concentration and 10x relative
concentration. Then we will use Alamar Blue to detect cell viability. This was achieved by
adding resazurin reagent into treated cells and incubating for 4 hours under darkness at 37℃.
The fluorescence was measured at 560nm excitation and 590nm emission.

6. Determine how these drugs will affect adipogenesis
To determine whether treatment using glucose modulating agents can affect either the
adipogenesis or lipogenesis pathways, we compared treatments at various concentration (Table
5) with cells treated with PBS. After 8 days of induction, the differentiated cells were treated.
After 6 days of treatment, cells were harvested and RNA was extracted using Trizol reagent.
RNA was isolated according to manufacturers recommended procedures and the RNA
Drug name Concentrations
Low Medium High
Apigenin 1µM 10µM 50µM
Cytochalasin B 0.1 µM 0.5 µM 1 µM
Canagliflozin 0.1 µM 1 µM 10 µM
Dapagliflozin 0.1 µM 1 µM 10 µM
Empagliflozin 0.1 µM 1 µM 10 µM
Ipragliflozin 0.1 µM 1 µM 10 µM
Cimetidine 0.1 mM 0.5 mM 1 mM
Metformin 1 mM 5 mM 10 mM

Table 4 Study Design to determine Differentiated 3T3-L1 Pre-adipocytes Viability

23
concentration were measured using nanodrop. The RNA is converted in cDNA and the level of
expression was determined using qRT-PCR.

7. Oil Red O staining for differentiated adipocyte
To quantify the level of triglyceride and fatty acid accumulation in the 3T3-L1 cells, cells
were stained using Oil Red O dye at the end of the treatment period. To quantify the level of Oil
Red O stain, the cells were dissociated using isopropanol to lyse all intact cell .
After treatment with the various glucose-modulators, the medium from treated cells were
aspirated, and washed with PBS to eliminate unincorporated stains and cell debris. Cells were
then fixed with 10% Formalin for 10 mins. After fixation, the wells were washed with PBS
twice. After the cells were washed, Oil Red O staining dye 400 µL was added into each well and
incubated for 30 mins. After 30 mins incubation, the Oil Red O stain was removed and wells
washed with deionized water twice and images (10X and 40X) were acquired at 5 different
fields.
After images were taken, the cells were extracted using undiluted isopropanol to
dissociate the cells and solubilize the dye. After the cells were solubilized, quadruple samples
were added into a 96 well plate, and the concentration of Oil Red stain was quantified using
Glucose Modulating
Agents
Concentration
Apigenin 1uM 10 uM 50uM
Cytochalasin B 0.1uM 0.5 uM 1uM
Canagliflozin 0.1uM 1 uM 10uM
Dapagliflozin 0.1uM 1 uM 10uM
Empagliflozin 0.1uM 1 uM 10uM
Ipragliflozin 0.1uM 1 uM 10uM
Cimetidine 0.1mM 0.5mM 1mM
Metformin 1mM 5mM 10mM
Table 5. Glucose modulating agent concentration used for assay.
24
absorbance set at 510 nm wavelength. The relative concentration of Oil Red stain was compared
to differentiated 3T3-L1 pre-adipocyte that were untreated.

8. Determining factors affecting differentiation
3T3-L1 differentiation is regulated by glucose levels and various adipokines. To evaluate
the impact of these factors, we evaluated the impact of the conditioned medium where the 3T3-
L1 cells has been proliferating in. Conditioned media were collected after each time points when
fresh medium was required. Using various concentration of the conditioned medium, we
compared them with low glucose(1g/L) DMEM differentiation media supplemented with 15%
FBS, 1% Glutmax and 1% essential amino acid. Low glucose media was used to dilute high
glucose containing media so we can dissect the role of glucose in 3T3-L1 differentiation. Cells
grown under these conditions were evaluated morphologically where images were acquired at
10X and 40X magnification. In addition, Red Oil Staining were used to quantify the impact of
these variables in regard to cellular differentiation.

9. Detection of Daunorubicin metabolism by LC-MS
Our ultimate goal is to use SGLT2 inhibitor(s) or glucose modulators to alter adipocyte
expression of CBR1 and AKR expression that can reduce the overall level of daunorubicin in
patients receiving cytotoxic chemotherapy for their ALL. Thus, our goal was to develop an
assay that is able to simultaneously determine the intracellular concentration of daunorubicin and
daunorubicinol.
Undifferentiated 3T3-L1 (1.0 X 10
4
cells per well) were seeded onto a 12-well plate,
which were differentiated into pre-adipocyte using the procedures that were describe in section 2.
25
To differentiated preadipocytes, various concentrations of Daunorubicin or Daunorubicinol were
added and incubated for 16h. The medium was collected. Cells were collected and extracted
using 80% ethanol. The cellular extracts were then centrifuged at 13,000 rpm at 4
o
C for 10
minutes. An aliquot of ethanol extract was used to determine the protein level in the extracted
material, which will be used to normalize the samples. The remaining supernatant was
transferred into a clean Eppendorf tube and the ethanol was evaporated to dryness using a steady
stream of filtered nitrogen gas. The levels of daunorubicin and daunorubicinol were qualified
using an established LC-MS as described by Zheng et al.

10. Leukemia cells culture protocol
Since our ultimate goal is to determine the effect of these glucose modulating agents in
adipocyte-leukemia microenvironment that can mimic actual bone marrow adipose tissue and
ALL. We picked representative B-cell leukemia cell lines which were a gift from Alan Epstein ,
MD, PhD, Keck School of Medicine of USC. The B-cell leukemia that were evaluated include
BALL-1, KM-3, NALM-6, MOLT-4 and CEM. These suspension cells were passaged in RPMI-
1640 supplemented with 10% FBS and 1% essential amino acid. A total of 2 X 10
5
cells/ml were
introduced into a T75 flask, where the densities were maintained between 1X10
5
-2X10
6
cells/ml.

11. IC50 of Daunorubicin and Daunorubicinol in leukemia cells
To establish the dynamic range where daunorubicin and daunorubicinol may affect the survival
and proliferation of these B-cell leukemia, we wanted to determine the IC50 for all of the cell
lines described in section 10. Inhibitory concentration 50% (IC50) was evaluated using the
following protocol: cells were seed into wells found in a 96 well plate at a density at 3.0 X 10
4

26
cells/well. These cells were treated with escalating concentration of either daunorubicin or
daunorubicinol over 4 log concentration range. At the end of treatment period (24-72 hours),
cellular viability was assessed using Alamar Blue, where 10 µl 1X resazurin was added into well
and incubate 2 hours. After incubation, the level of fluorescence was measured using the
following parameters: Excitation wavelength 560 nm and 590 nm for emission.

2.3 Results
1. Cell differentiation selection and Oil Red O staining
After testing different differentation protocols, we found the following protocol to be the
most optimal where we used media containing 0.5 mM IBMX, 250 nM Dexamethasone, 5 µg/ml
insulin and 2 µM Rosiglitazone in 15% fetal bovine serum (FBS) as the differentiation media.

Day 4 Day 6

Day 8 Day 10

Figure 5. Oil Red O staining result of different media change time.
27
This medium was used where we designated as Group 6. This was selected on the bases of high
differentiating efficacy while ability to maintain cellular viability.
Differentiation efficacy were measured morphological changes. This include high density of
intracellular fat accumulation that was confirmed with Oil Red staining. To determine the
optimal time for pre-adipocyte differentiation, we evaluate the level of Red Oil staining from day
4 to day 10. Others have reported that 3T3-L1 require two days for induction which is followed
by differentiation with lipid droplet accumulation. However, we wanted to ascertain the optimal
time required for this differentiation process.
Figure 5 is light microscopy images of the pre-adipocytes stained with Red Oil stain that
were differentiated from 4 to 10 days. On Day 6 the level of pre-adipocyte differentiation has
plateau which is balanced between with a high level of cellular viability. Although the level of
intracellular fat accumulation was higher on Day 8 and Day 10, the viability of these pre-
adipocytes appear to be reduced on Days 8 and 10. From this study, we found that the level of
fat accumulation is maximal at Day 6.

2. Glucose induced preadipocyte differentiation in a concentration-dependent manner
In Figure 6, 3T3-L1 were differentiated in varying concentrations of glucose in the
differentiation medium. At 0% glucose, little fat accumulation was seen, where the 3T3-L1
retained their spindle-like shape supporting the notion that these cells were not forming pre-
adipocytes. When the concentration of glucose was escalated, notable accumulation of fat
droplets were detected on Red Oil Stain, where at 100% glucose, the lipid droplets were maximal
in this study.
28
The levels of Red Oil staining were quantified using isopropanol treatment to lyse the cells
and solubilize the Red oil stain. The level of Red Oil staining was quantified using absorbance at
510 nm,
29
where the results are summarized in Figure 7. In this study, glucose concentration in the
medium is a critical factor for fat accumulation. This is consistent with known biology where

Figure 6. Oil red O staining of differentiated adipocyte in
different level of glucose in the medium where maximal fat
droplets were seen with cells grown with 100% glucose

Figure 7: Absorbance at 510 nm in 3T3-pre-adipocyte
grown at different concentrations of glucose
0 20 40 60 80 100
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Glucose Concentration (%)
Absorbance (510 nm)
30
excess carbohydrate level will provide the energetic and precursors for fat formation.

3. Efficiency of GLUT Inhibitors on 3T3-L1 differentiation
In the section above, we showed that the glucose concentration was a key predictor of
pre-adipocyte differentiation. We then wanted to determine whether glucose modulator can have
an impact on lipid droplet formation.
We evaluated the impact of GLUT1 and GLUT4 inhibitors, respectively apigenin and
cytochalasin, on lipid droplet formation in differentiated 3T3-L1 cells. Using a concentration
escalation design study, the level of lipid droplet form was evaluated at Day 2, 4, and 6 of
differentiation. In Figure 8, the effect of apigenin showed that did not adversely impact pre-
adipocyte formation. On Day 6, the level of Red Oil staining was quantified and compared to
untreated cells (Fig. 8A). The addition of GLUT1 inhibitor, apigenin, was able to reduce the
lipid droplet accumulation when compared to untreated differentiated 3T3-L1 cells (Figure 8,

Figure 8 Effect of GLUT1 inhibitor apigenin and its effect 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel)

NT 1 10 50
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Apigenin (µM)
Absorbance (510 nm)
31
Right panel). No additional effect on lipid droplet formation was noted when apigenin
concentrations were escalated.
Among all these figures, we can see glucose level can directly affect fat accumulation during
differentiation. With the concentration decrease, fat accumulated in adipocyte decrease. While
for other drug treatment groups, there isn’t an obvious decline in lipid droplet accumulation.
Specifically, for GLUT1 inhibitor treatment group, there is an increase trend showed in figure.
The possible reason for this situation is that although we blocked GLUT1 transporter, there are
still some other transporters that could transport glucose across cell membrane and lead to fat
accumulation.
4.

The effect of cytochalasin, GLUT4 inhibitor, on 3T3-L1 pre-adipocyte differentiation is
summarized in Figure 9. In the Left panel, increasing concentration of cytochalasin has marginal
morphological changes. On Day 6, Red Oil Staining showed significant contraction of the lipid
droplets at greater than 0.5 µM concentration. The presence of cytochalasin was able to
dramatically reduce oil red staining by about 30%. Similar to apigenin, no additional reduction
in lipid droplets were demonstrated with increasing concentration.

Figure 9: Effect of GLUT4 inhibitor cytochalasin and its effect 3T3-L1 adipocyte maturation over time
(Left panel). Oil Red Stain quantification (Right panel)
NT 0.1 0.5 1
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Cytochalsin (µM)
Absorbance (510 nm)
32
4. Determine the efficiency of treatment on 3T3-L1 differentiation using SGLT2
Inhibitors
SGLT2 inhibitors have reported to reduce subcutaneous and visceral adipose tissue, thus we
evaluated the impact of various SGLT2 analogues with regard to lipid droplet accumulation. Since
all of the SGLT2 inhibitors are similar in potency, three log concentration range was evaluated to
determine whether these compounds can alter adipogenesis.
The effect of dapagliflozin was evaluated in a concentration escalation manner, where 3T3-L1
differentiation was evaluated from Day 2 to Day 6. No notable histological changes with 3T3-L1
were noted (Figure 10, Left Panel). At Day 6, the level of lipid droplets were quantified using red
oil stain where the treatment of dapagliflozin reduce the red oil accumulation as compared to
untreated controls (Figure 10, Right Panel).
Similarly, the effect of Ipragliflozin was evaluated where the results are summarized in
Figure 11. Similar to dapagliflozin, treatment with ipragliflozin showed reduction in the lipid

Figure 10. Effect of Dapagliflozin, SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel)
NT 0.1 1 10
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Dapagliflozin (µM)
Absorbance (510 nm)
33
droplet reduction that was not detectable using histological examination. Ipragliflozin treatment
was not as potent as dapagliflozin with regards to reduction of red oil staining levels.

Figure 11. Effect of ipragliflozin, SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel)
NT 0.1 1 10
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
ipragliflozin (µM)
Absorbance (510 nm)

Figure 12. Effect of Empagliflozin, SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation
over time (Left panel). Oil Red Stain quantification (Right panel)

NT 0.1 1 10
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Empaglifozin (µM)
Absorbance (510 nm)
34
The effect of empagliflozin 3T3-L1 differentiation is summarized in Figure 12. Using the
same methods to evaluate other SGLT2 inhibitors, empagliflozin did not differ from other
SGLT2 inhibitors where the morphological changes were not detectable but the treatment with
empagliflozin showed reduction in Red Oil staining, suggesting a reduction in the lipid
accumulation.
Canagliflozin was dissimilar to other SGLT2 where a modest reduction in lipid accumulation
was shown in Figure 12, Right Panel. Although the reduction was modest, this SGLT2 showed a
dosage dependent reduction which may show that the reduction of intracellular glucose may
reduce the formation of lipid droplets.

Figure 13. Effect of Canagliflozin SGLT2 inhibitor, have on 3T3-L1 adipocyte maturation over
time (Left panel). Oil Red Stain quantification (Right panel)

NT 0.1 1 10
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Canaglifozin (µM)
Absorbance (510 nm)
35
5. Effect of OCT1 inhibitor on 3T3-L1 differentiation
Organic Cation Transporter 1 (OCT1) has been previously shown to be a regulator of glucose
uptake. It has been proposed the metformin exert is anti-diabetic activity by inhibiting the
OCT1. We evaluated the impact of metformin treatment on 3T3-L1 adipocyte transition, which

Figure 15. Effect of cimetidine, OCT1 inhibitor, have on 3T3-L1 adipocyte maturation over time
(Left panel). Oil Red Stain quantification (Right panel)

NT 0.1 1 10
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Cimetidine (µM)
Absorbance (510 nm)

Figure 14. Effect of metformin, OCT1 inhibitor, have on 3T3-L1 adipocyte maturation over time
(Left panel). Oil Red Stain quantification (Right panel)

NT 1 5 10
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Metformin (mM)
Absorbance (510 nm)
36
like other glucose modulators, had no morphological impact on adipocyte formation. In Figure
13, metformin was found to similar activity as other glucose modulators. We also evaluated
cimetidine, a well-known histamine-2 blocker, which is also known as an OCT1 inhibitor.
Similar to metformin, cimetidine has similar activity as those seen with metformin (Figure 14).

6. LC-MS of Daunorubicin metabolism
We investigated the impact of glucose modulators on daunorubicin and daunorubicinol
disposition on a cellular level. As shown in Figure 15A, 3T3-L1 cells were treated with 10 nM
daunorubicin, and the various glucose modulating compounds. After 20 hours of treatment, the
supernatant and cellular extracts were collected the concentration of daunorubicin and

Figure 16: Effect of glucose modulator on daunorubicin disposition and its metabolism.
0.0 0.5 1.0 1.5 2.0 2.5
DRN
DRN+ 1µM Cyto
DRN+ 50 µM Api
DRN + 10µM Ipra
DRN + 10 µM Dapa
DRN + 10 µM Cana
DRN + 10µM Empa
DRN
DRN-ol
DRN/DRN-ol (ng/ml)
0 5 10 15 20 25
DRN
DRN+ 1µM Cyto
DRN+ 50 µM Api
DRN + 10µM Ipra
DRN + 10 µM Dapa
DRN + 10 µM Cana
DRN + 10µM Empa DRN
DNR-ol
DRN/DRN-ol (ng/mg cells)
A
B
37
daunorubicinol were evaluated using a validated LC-MS assay. After 20 hours, no daunorubicin
was detected in the supernatant, however the levels of daunorubicinol was approximately 1.5
ng/mL. This suggest that all of the daunorubicin were either absorbed intracellularly, as shown in
Figure 15B, where DRN levels were 15 ng/mg of cellular protein. This corresponded to
approximately 23 ng/mg of daunorubicinol suggesting that adipocytes can effective metabolize
daunorubicin to the less cytotoxic metabolite. All of the glucose modulating agents reduced the
level of daunorubicin by more than 50%, however the level of daunorubicinol is similar to
daunorubicin treatment.
However, SGLT-2 inhibitor not only reduce the level of intracellular daunorubicin, but
also reduced the level of daunorubicinol by about 50% of daunorubicin treatment only. In this
regard, empagliflozin, canagliflozin and ipragliflozin had similar reduction in daunorubicinol
production, and reduction of intracellular daunorubicin.

7. IC50 of Daunorubicin and Daunorubicinol on differentiated adipocyte
This study was undertaken to determine whether exposure to daunorubicin can impact
on pre-adipocyte viability. We want to ascertain that daunorubicin used did not impact on the
viability of adipocyte survival. In Figure 16B, differentiated adipocyte appears to resistant to
daunorubicinol treatment, which is known to be less cytotoxic as compared daunorubicin. In
addition, changed the medium every 24 hours to determine whether the resistance is attributed to
pre-adipocyte’s ability to breakdown the anthracycline. No additional reduction in cellular
viability was seen when fresh daunorubicinol was changed every 24 hours.
Similar chemoresistance towards daunorubicin was also seen in Figure 16A. However,
when we introduce daunorubicin every 24 hours, the differentiated 3T3-L1 viability dropped
38
suggesting that increase metabolism of daunorubicin may lead to differentiated 3T3-L1
resistance towards anthracycline.
In this study, the IC50 for all of the treatments were not established using the concentration
range that is achievable in humans. However, at 10 µM Daunorubicin and daunorubicinol, at
these supraphysiological concentrations showed some cellular inhibition

Figure 17. Viability of differentiated 3T3-L1 treated
with daunorubicin (A) and daunorubicinol (B)
-13 -12 -11 -10 -9 -8 -7 -6 -5
0
10
20
30
40
50
60
70
80
90
100
110
Drug Concentration(logM)
Cell Viability (%)
24h
48h
72h
48h (media change from 24h)
72h (media change from 48h)
72h (media change from 24h)
-13 -12 -11 -10 -9 -8 -7 -6 -5
0
10
20
30
40
50
60
70
80
90
100
110
Drug Concentration(logM)
Cell Viability (%)
24h
48h
72h
48h (media change from 24h)
72h (media change from 48h)
72h (media change from 24h)
A
B
39
8. IC50 of Daunorubicin and Daunorubicinol on leukemia cells
Our ultimate goal to show that the addition of glucose modulating agents will be able to enhance
anti-leukemic activity in the obese patients. We will establish the utility of using glucose
modulating agents such as OCT-1, GLUT and SGLT-2 inhibitors. In this context, we wanted to

Figure 18. IC50 of Daunorubicin and Daunorubicinol on leukemia cell line.
40
establish the effect of daunorubicin on these B-cell leukemia cells lines. Figure 17, show the
antileukemic effect of either daunorubicin or daunorubicinol. All the leukemic cell lines are
more sensitive towards these anthracyclines as compared to 3T3-L1 pre-adipocytes.
9. Effect of glucose modulating agents on fat related gene expression

41
To determine the molecular changes of glucose modulators on 3T3 cells, RNA was isolated after
treatment, and qRT-PCR was used to determine gene expression changes.
All the gene changes were relative to untreated cells. In most of these treatments, the changes
were not significantly altered, where the threshold for increase expression is 2-fold above
untreated controls. Threshold for significant downregulation was set a priori at 0.5-fold

Figure 19. Gene expression changes in 3T3-L1 treated with glucose modulating agents
1C18
adiponectin
CBR1
NOX4
PPAR gamma
SGLT 2
0.0
0.5
1.0
1.5
2.0
2.5
Gene
Fold-Change
Api
Api 1uM
Api 10uM
Api 50uM
1C18
adiponectin
CBR1
NOX4
PPAR gamma
SGLT 2
0
1
2
3
4
Cimetidine
Gene
Fold-Change
Cimetidine0.1mM
Cimetidine0.5mM
Cimetidine1mM
1C18
adiponectin
CBR1
NOX4
PPAR gamma
SGLT 2
0.0
0.5
1.0
1.5
2.0
Metformin
Gene
Fold-Change
Meformin 5uM
Meformin 10uM
1C18
adiponectin
CBR1
NOX4
PPAR gamma
SGLT 2
0
1
2
3
4
5
Canagliflozin
Gene
Fold-Change
Canagliflozin0.1uM
Canagliflozin1uM
Canagliflozin10uM
1C18
adiponectin
CBR1
NOX4
PPAR gamma
SGLT 2
0
1
2
3
4
5
Empagliflozin
Gene
Fold-Change
Empagliflozin 0.1uM
Empagliflozin 1uM
Empagliflozin 10uM
42
reduction in gene expression. Most notable is metformin at 5 µM was able to reduce CYP1C18,
CBR1 and SGLT2, where dosage escalation increased expression back to baseline levels. These
finding suggest metformin may synergize with SGLT2 inhibitors. In addition, metformin appear
to also reduce expression of NADPH oxidase which will led to reduction of ROS.

2.4 Conclusion
We have previously shown that obesity would compromise chemotherapy treatment in
patients with ALL. In this report, we evaluated whether the use of glucose modulators like
OCT1, GLUT, SGLT-2 and OCT1 inhibitors on adipocyte differentiation and intracellular
droplets. First, we differentiate pre-adipocyte 3T3-L1 cell into mature adipocyte. In this process,
we used induction cocktail to initiate cell pathway and induce the change of 3T3-L1. We found
that 0.5mM IBMX, 250nM Dexamethasone, 5ug/mL insulin and 2uM Rosiglitazone was able
enhance 3T3-L1 differentiation.
We also found that the glucose was an important factor leading to enhance adipocyte
formation and intracellular lipid droplet accumulation. With glucose concentration increase,
more and more lipid droplet will generate. This is consistent with current understanding where
increase carbohydrate is a key element for obesity. Glucose provided the metabolite precursor
for fatty acid synthesis and the energetics that will drive this biosynthetic process.
Since the carbohydrate levels such as glucose can enhance lipid droplet accumulation, we
reasoned that the ability to limit glucose uptake can alter adipocyte differentiation. We used
GLUT1 inhibitor, GLUT4 inhibitor, SGLT2 inhibitor, OCT1 agonist and OCT1 antagonist. In
our preliminary finding, the addition of these glucose modulators did not alter morphology of
pre-adipocytes at the concentration employed. However when oil droplet levels were quantified,
there appear to some drop in the level of Red Oil staining.
43
We also evaluate the impact of glucose modulator with regards to daunorubicin
disposition in both the medium and cellular concentration. We found that after 20 hours of
treatment, daunorubicin in the medium was undetectable. Intracellular daunorubicin and its
metabolite, daunorubicinol were detected at relative high levels in the 3T3-L1 differentiated
adipocytes. Interestingly, SGLT-2 inhibitors were able to reduce the intracellular daunorubicin
and daunorubicinol. We believe that reduction in daunorubicin may mean that the it is more
available for anti-leukemia effect. The reduction of daunorubicin also coincided a reduction of
daunorubicinol by more than 50% of that found in cells treated with daunorubicin only. These
preliminary finding are exciting and need to be further clarified with co-culture studies, and in
vivo animal studies.

44
References
1. Swinburn, B. A., Sacks, G., Hall, K. D., McPherson, K., Finegood, D. T., Moodie, M. L., &
Gortmaker, S. L. (2011). The global obesity pandemic: shaped by global drivers and local
environments. The Lancet, 378(9793), 804-814
2. Obesity and overweight. (n.d.). Retrieved December 6, 2019, from https://www.who.int/news-
room/fact-sheets/detail/obesity-and-overweight
3. Gonazlez-Munisea P et al. Obesity. Nature Rev 2017; 10734
4. Brown, E., Wilding, J. P., Barber, T. M., Alam, U., & Cuthbertson, D. J. (2019). Weight loss
variability with SGLT2 inhibitors and GLP‐1 receptor agonists in type 2 diabetes mellitus and
obesity: Mechanistic possibilities. Obesity Reviews, 20(6), 816-828
5. Ng, M., Fleming, T., Robinson, M., Thomson, B., Graetz, N., Margono, C., ... & Abraham, J.
P. (2014). Global, regional, and national prevalence of overweight and obesity in children and
adults during 1980–2013: a systematic analysis for the Global Burden of Disease Study
2013. The lancet, 384(9945), 766-781.
6. Rosen, E. D., & Spiegelman, B. M. (2000). Molecular regulation of adipogenesis. Annual
review of cell and developmental biology, 16(1), 145-171.
7. Kersten, S. (2001). Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO
reports, 2(4), 282-286.
8. Gregoire, F. M., Smas, C. M., & Sul, H. S. (1998). Understanding adipocyte
differentiation. Physiological reviews, 78(3), 783-809.
9. Ntambi, J. M., & Young-Cheul, K. (2000). Adipocyte differentiation and gene expression. The
Journal of nutrition, 130(12), 3122S-3126S.
45
10. White, U. A., & Stephens, J. M. (2010). Transcriptional factors that promote formation of
white adipose tissue. Molecular and cellular endocrinology, 318(1-2), 10-14.
11. Horowitz, N. S., & Wright, A. A. (2015). Impact of obesity on chemotherapy management
and outcomes in women with gynecologic malignancies. Gynecologic oncology, 138(1), 201-
206
12. Han, P. Y., Duffull, S. B., Kirkpatrick, C. M. J., & Green, B. (2007). Dosing in obesity: a
simple solution to a big problem. Clinical Pharmacology & Therapeutics, 82(5), 505-508.
13. Parekh N, Chandran U, Bandera EV. Obesity in Cancer Survival. Annual Review of
Nutrition. 2012;32(1):311-42.
Yang HS, Yoon C, Myung SK, Park SM. Effect of obesity on survival of women with epithelial
ovarian cancer: a systematic review and meta-analysis of observational studies. IntJ
GynecolCancer. 2011;21(9):1525-32.
14. Calle EE, Rodriguez C, Walker-Thurmond K, Thun MJ. Overweight, obesity, and mortality
from cancer in a prospectively studied cohort of U.S. adults. NEnglJMed. 2003;348(17):1625-38.
15. Butturini AM, Dorey FJ, Lange BJ, Henry DW, Gaynon PS, Fu C, Franklin J, Siegel SE,
Seibel NL, Rogers PC, Sather H, Trigg M, Bleyer WA, Carroll WL. Obesity and outcome in
pediatric acute lymphoblastic leukemia. J Clin Oncol. 2007;25(15):2063-9
16. Amankwah EK, Saenz AM, Hale GA, Brown PA. Association between body mass index at
diagnosis and pediatric leukemia mortality and relapse: a systematic review and meta-analysis.
Leukemia & Lymphoma. 2015:1-9.
17. Yun JP, Behan JW, Heisterkamp N, Butturini A, Klemm L, Ji L, Groffen J, Muschen M,
Mittelman SD. Diet-Induced Obesity Accelerates Acute Lymphoblastic Leukemia Progression in
Two Murine Models. Cancer PrevRes (Phila Pa). 2010;3:1259-64
46
18. Behan JW, Yun JP, Proektor MP, Ehsanipour EA, Arutyunyan A, Moses AS, Avramis VI,
Louie SG, Butturini A, Heisterkamp N, Mittelman SD. Adipocytes impair leukemia treatment in
mice. Cancer Res. 2009;69(19):7867-74
19. Sheng, X., Tucci, J., Parmentier, J. H., Ji, L., Behan, J. W., Heisterkamp, N., & Mittelman, S.
D. (2016). Adipocytes cause leukemia cell resistance to daunorubicin via oxidative stress
response. Oncotarget, 7(45), 73147–73159. https://doi.org/10.18632/oncotarget.12246
20. Liu, Z., Xu, J., He, J., Liu, H., Lin, P., Wan, X., Navone, N. M., Tong, Q., Kwak, L. W.,
Orlowski, R. Z., & Yang, J. (2015). Mature adipocytes in bone marrow protect myeloma cells
against chemotherapy through autophagy activation. Oncotarget, 6(33), 34329–34341.
https://doi.org/10.18632/oncotarget.6020
21. Duong, M. N., Geneste, A., Fallone, F., Li, X., Dumontet, C., & Muller, C. (2017). The fat
and the bad: Mature adipocytes, key actors in tumor progression and
resistance. Oncotarget, 8(34), 57622–57641. https://doi.org/10.18632/oncotarget.18038
22. Iyengar, P., Combs, T. P., Shah, S. J., Gouon-Evans, V., Pollard, J. W., Albanese, C., ... &
Pestell, R. G. (2003). Adipocyte-secreted factors synergistically promote mammary
tumorigenesis through induction of anti-apoptotic transcriptional programs and proto-oncogene
stabilization. Oncogene, 22(41), 6408-6423.
23. Herroon M, Rajagurubandara E, Hardaway AL, Powell K, Turchick A, Feldmann D, et al.
Bone marrow adipocytes promote tumor growth in bone via FABP4-dependent mechanisms.
Oncotarget. 2013 Oct 30;4(11):2108–23.
24. Ferguson, D. C., Cheng, Q., & Blanco, J. G. (2015). Characterization of the canine
anthracycline-metabolizing enzyme carbonyl reductase 1 (cbr1) and the functional isoform cbr1
V218. Drug Metabolism and Disposition, 43(7), 922-927
47
25. Gustafson, B., Hammarstedt, A., Andersson, C. X., & Smith, U. (2007). Inflamed adipose
tissue: a culprit underlying the metabolic syndrome and atherosclerosis. Arteriosclerosis,
thrombosis, and vascular biology, 27(11), 2276-2283.
26. Yun, J. P., Behan, J. W., Heisterkamp, N., Butturini, A., Klemm, L., Ji, L., ... & Mittelman,
S. D. (2010). Diet-induced obesity accelerates acute lymphoblastic leukemia progression in two
murine models. Cancer Prevention Research, 3(10), 1259-1264.
27. Zhou, X., Li, Z., & Zhou, J. (2017). Tumor necrosis factor α in the onset and progression of
leukemia. Experimental hematology, 45, 17-26.
28. Demacq, C., Vasconcellos, V. B., Izidoro-Toledo, T. C., da Silva Silveira, V., Canalle, R., de
Paula Queiroz, R. G., ... & Tanus-Santos, J. E. (2010). Vascular endothelial growth factor
(VEGF) and endothelial nitric oxide synthase (NOS3) polymorphisms are associated with high
relapse risk in childhood acute lymphoblastic leukemia (ALL). Clinica Chimica Acta, 411(17-
18), 1335-1340.
29. https://www.cancer.org/cancer/acute-lymphocytic-leukemia/treating/chemotherapy.html
30. Thompson, P., Wheeler, H. E., Delaney, S. M., Lorier, R., Broeckel, U., Devidas, M., ... &
Berg, S. L. (2014). Pharmacokinetics and pharmacogenomics of daunorubicin in children: a
report from the Children’s Oncology Group. Cancer chemotherapy and pharmacology, 74(4),
831-838.
31. Liu, Q. G., Zhao, X., Xu, N., Wu, L. H., Li, S. Z., & Mi, Y. C. (2013). Organ toxicity and
efficacy of high-dose daunorubicin-based chemotherapy in the treatment of acute
leukemia. Zhonghua xue ye xue za zhi= Zhonghua xueyexue zazhi, 34(7), 587-590.

48
32. Rammeloo, L. A. J., Postma, A., Sobotka‐Plojhar, M. A., Bink‐Boelkens, M. T. E., Berg, A.
V. D. V., Veerman, A. J. P., & Kamps, W. A. (2000). Low dose daunorubicin in induction
treatment of childhood acute lymphoblastic leukemia: No long‐term cardiac damage in a
randomized study of the Dutch Childhood Leukemia Study Group. Medical and Pediatric
Oncology: The Official Journal of SIOP—International Society of Pediatric Oncology (Societé
Internationale d'Oncologie Pédiatrique, 35(1), 13-19.
33. Pereira, M. J., & Eriksson, J. W. (2019). Emerging role of SGLT-2 inhibitors for the
treatment of obesity. Drugs, 79(3), 219-230.
34. Xu, L., Nagata, N., Nagashimada, M., Zhuge, F., Ni, Y., Chen, G., ... & Ota, T. (2017).
SGLT2 inhibition by empagliflozin promotes fat utilization and browning and attenuates
inflammation and insulin resistance by polarizing M2 macrophages in diet-induced obese
mice. EBioMedicine, 20, 137-149.
35. Cao, X., Fang, L., Gibbs, S., Huang, Y., Dai, Z., Wen, P., ... & Sun, D. (2007). Glucose
uptake inhibitor sensitizes cancer cells to daunorubicin and overcomes drug resistance in
hypoxia. Cancer chemotherapy and pharmacology, 59(4), 495-505.

Abstract (if available)

Abstract Background: Acute lymphoblastic leukemia ranks as the leading cause of cancer-related death in children. The latest researches reveal that acute lymphoblastic leukemia is quite related to obesity. Children who have obesity are easier to gain poorer chemotherapy outcomes and have a higher chance of relapse. ❧ The objective of this study the following: ❧ 1) Determine the effect of glucose modulating agents on adipocyte formation and intracellular lipid droplet accumulation ❧ 2) Determine the effect of glucose modulating agents on adipocyte differentiation and expression of transporters and metabolic enzymes in the adipocytes ❧ 3) Determine disposition of daunorubicin and its metabolite in pre-adipocyte cells treated with various glucose modulating agents. ❧ Results: SGLT2 inhibitors did not significantly change the morphology of preadipocyte formation. When lipid droplet was quantified using Red Oil staining, all of the glucose modulating agents were able to reduce the level of Red Oil stain when compared to untreated cells. More excitedly, these findings were also supported by daunorubicin disposition and metabolism study. The use of SGLT2 inhibitor reduces intracellular daunorubicin, and its metabolite, daunorubicinol by more than 50%. Preliminary gene expression analysis did not show significant alteration of metabolic enzymes. However, metformin, an OCT1 inhibitor, was found not reduce metabolic enzymes but the expression of SGLT2 transporters. ❧ Conclusions: The preliminary data in this study suggest that the use of glucose modulating agents may have a profound effect on daunorubicin in fat tissues. If these findings are supported in animal models of obesity, it is potentially plausible that effect therapy can alter poor clinical outcomes in obese patients with ALL.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Effects of glucose modulation on adipocytes maturation and metabolism

PDF

The role of adipocytes in acute lymphoblastic leukemia cell migration and survival against daunorubicin

PDF

Maternal embryonic leucine zipper kinase (MELK) as a novel therapeutic target in the treatment of acute lymphoblastic leukemia

PDF

Renin-angiotensin system modulation for the prevention and treatment of metabolic dysfunction

PDF

Characterization of upregulated adhesion GPCRs in acute myeloid leukemia

PDF

Characterization of epithelial-mesenchymal transition in acute myeloid leukemia

PDF

Beneficial effect of antibiotic treatment on alcohol-related liver pathology in mice is not due to reduction in the butyrate-producing gut microbial phyla

PDF

Endocrine disrupting chemicals: identifying reproductive toxic effects and disease of endocrine disrupting chemicals on male spermatogenesis

PDF

Role of steroidogenic acute regulatory protein (STAR) and sterol carrier protein-x (SCPx) in the transport of cholesterol and other lipids

PDF

Inhibition of NR3B1 attenuates the progression of NAFLD and NASH in liver-specific Pten knockout mice

PDF

The study of DHM effects on counteracting ethanol intoxications

PDF

Using novel small molecule modulators as a tool to elucidate the role of the Myocyte Enhancer Factor 2 (MEF2) family of transcription factors in leukemia

PDF

Harnessing environmental and culture conditions to alter fungal ‘omics’

PDF

Regulation of mitochondrial bioenergetics via PTEN (phosphatase and tensin homolog deleted on chromosome 10)/estrogen-related receptor alpha (ERRα) signaling

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) signaling regulates fatty acid beta-oxidation

Asset Metadata

Creator Liu, Yulu (author)

Core Title SGLT2 inhibitors reverse adipocyte differentiation and reduce daunorubicin metabolism in acute lymphoblastic leukemia treatment

School School of Pharmacy

Degree Master of Science

Degree Program Molecular Pharmacology and Toxicology

Publication Date 07/25/2020

Defense Date 07/22/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag acute lymphoblastic leukemia,adipocyte,daunorubicin,OAI-PMH Harvest,SGLT2 inhibitor

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Louie, Stan (committee chair), Asatryan, Liana (committee member), Duncan, Roger (committee member)

Creator Email Simonliu9501@gmail.com,yululiu@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-341023

Unique identifier UC11664174

Identifier etd-LiuYulu-8744.pdf (filename),usctheses-c89-341023 (legacy record id)

Legacy Identifier etd-LiuYulu-8744.pdf

Dmrecord 341023

Document Type Thesis

Rights Liu, Yulu

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA