Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content i

Modeling Lung Adenocarcinoma Progression In Vitro
Using Immortalized Human Alveolar Epithelial Cells
By
Tuo Shi

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA

In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(Biochemistry and Molecular Medicine)
August 2019

Copyright 2019 Tuo Shi
ii
Acknowledgements
I would like to express my sincere gratitude towards my mentor Dr. Ite Offringa for taking
me in as part of her lab and supporting me throughout my Master’s thesis project. Her continuous
guidance and advice have played a huge role in completing my thesis. I also really appreciate her
enthusiasm towards science and problem solving, which encouraged me to further pursue a career
in scientific research.
I would also like to thank my thesis committee members Dr. Axel Schönthal and Dr.
Crystal Marconett, who have provided very constructive suggestions on this thesis. I am grateful
for their time and effort spent helping me along the way.
I would also like to extend my thanks to Dr. Zea Borok and Dr. Amy Ryan from USC, and
Dr. Michael Teitell and Dr. Alexander Patananan from UCLA, as well as their lab members, for
sharing their equipment and facility, which was essential to my thesis project.
Last but not least, I am truly grateful for all members of the Offringa Lab and Marconett
Lab, who have welcomed me into the family and supported me throughout my journey. I would
like to give special thanks to Evelyn Tran, who has spent tremendous effort deriving and
characterizing the cells used in this thesis. Without her fantastic work and patient guidance, I would
not have accomplished my Master’s thesis project.

iii
Table of Contents
ACKNOWLEDGEMENTS ......................................................................................................... II
TABLE OF CONTENTS ........................................................................................................... III
LIST OF ABBREVIATIONS ...................................................................................................... V
1. ABSTRACT ........................................................................................................................... 1
2. INTRODUCTION ................................................................................................................. 3
2.1 Lung Cancer and Lung Adenocarcinoma .............................................................................. 3
2.2 Mutations in Lung Adenocarcinoma ..................................................................................... 5
2.3 EGFR Mutations in Lung Adenocarcinoma .......................................................................... 9
2.4 Hallmarks of Cancer and Cell Transformation ................................................................... 12
2.5 In vitro Models for Lung Adenocarcinoma ......................................................................... 13
2.6 Immortalized Normal Human Alveolar Epithelial Cells as a Model of LUAD .................. 14
3. MATERIALS AND METHODS ........................................................................................ 19
4. RESULTS ............................................................................................................................. 27
4.1 Constitutive Expression of EGFR
L858R
in SV40 LT-Transduced AEC-LT14 ..................... 27
4.2 Constitutive Expression of EGFR
L858R
in HEK293T and LUAD Cancer Cell Lines .......... 30
4.3 Doxycycline-Inducible EGFRL858R Expression in AEC-ROCK14 Transduced
Simultaneously with SV40 LT, hTERT, and pSLIK-EGFR
L858R
iT .......................................... 33
4.4 Attempts to Deliver CRISPR/Cas9 System in AEC-LT+hTERT14 to Directly Edit EGFR
in its Genomic Context .............................................................................................................. 36
5. DISCUSSION & FUTURE DIRECTIONS ....................................................................... 42
iv
6. SUPPLEMENTARY FIGURES ........................................................................................ 52
7. REFERENCES .................................................................................................................... 53

v
List of Abbreviations
AAV – Adeno-associated Virus
AEC – Alveolar Epithelial Cell
AKT – Protein Kinase B
BLAST – Biophotonic Laser Assisted Surgery Tool
CDK – Cyclin-Dependent Kinase
CDS – Coding DNA Sequence
CRISPR – Clustered Regularly Interspaced Short Palindromic Repeats
CSC – Cigarette Smoke Condensate
EGF – Epidermal Growth Factor
EGFR – Epidermal Growth Factor Receptor
EMT – Epithelial to Mesenchymal Transition
ERRFI1 – ERRB Receptor Feedback Inhibitor 1
GAP – GTPase Activating Protein
GEF – Guanine Exchange Factor
gRNA – Guide RNA
HBEC – Human Bronchial Epithelial Cell
HDR – Homology-directed Repair
hTERT – Catalytic Subunit of Human Telomerase
IF - Immunofluorescence
IRES – Internal Ribosome Entry Site
LUAD – Lung Adenocarcinoma
MAPK – Mitogen-Activated Protein Kinase
vi
MKP – MAPK Phosphatases
NHEJ – Non-homologous End Joining
NSCLC – Non-Small Cell Lung Cancer
PAM – Protospacer Adjacent Motif
PCR – Polymerase Chain Reaction
PD-L1 – Programmed Death-Ligand 1
PP2A – Protein Phosphatase 2A
PTEN – Phosphatase and Tensin Homolog
RB1 – Retinoblastoma Protein 1
RNP - Ribonucleoprotein
RTK – Receptor Tyrosine Kinase
rtTA – Transactivator of TRE
SCLC – Small Cell Lung Cancer
sgRNA – Single-guide RNA
ssODN – Single-Stranded Donor Oligonucleotide
SV40 LT – Simian Virus 40 Large T Antigen
TKI – Tyrosine Kinase Inhibitor
TP16 – Tumor Protein 16
TP53 – Tumor Protein 53
tracrRNA – Trans-activating CRISPR RNA
TRAP – Telomerase Repeated Amplification Protocol
TRE – Tetracycline Response Element
1
1. Abstract
Lung cancer is the leading cause of cancer-related deaths among men and women in the United
States and worldwide. Lung cancer can be categorized into small cell lung cancer (SCLC) and
non-small cell lung cancer (NSCLC), of which the most common subtype is lung adenocarcinoma
(LUAD). Limited targeted therapies are currently available for LUAD, and the overall five-year
survival rate for NSCLC remains very poor, at around 18%. Although cancer cell lines such as
A549 have brought us valuable insights in understanding LUAD, they are not suited to recapitulate
early events in disease development, or the genetic and epigenetic diversity seen in LUAD patients.
In order to investigate effects of different mutations and epigenetic changes in driving LUAD
progression, we propose to manipulate immortalized normal human alveolar epithelial cells
(AECs), the presumed cell-of-origin for LUAD, to model LUAD development in vitro. The
objective is to introduce individual cancer driver mutations into AECs derived from different
human donors, to deeply characterize the effects of these drivers in different genetic backgrounds.
As a first step, a known oncogenic EGFR
L858R
mutation was introduced in immortalized AECs. Its
expression and downstream signaling activation were verified by immunoblotting and in vitro
transformation assays were used to determine the level of transformation by the EGFR mutant. It
was found that overexpression of EGFR
L858R
did not result in a more transformed phenotype in
immortalized AECs, suggesting that additional (epi)genetic alterations may be required to make
AECs receptive to transformation by EGFR
L858R
.

2
Graphical Abstract

3
2. Introduction
2.1 Lung Cancer and Lung Adenocarcinoma
Lung Cancer is the leading cause of cancer-related deaths among men and women in the
United States and worldwide
1,2
. It was estimated that over 1.7 million lung cancer deaths occurred
in 2018 worldwide, constituting 18.4% of total cancer deaths
2
. The biggest risk factor for lung
cancer is cigarette smoking, with other factors such as gender, age, and ethnicity associated with
different patterns of lung cancer incidence and mortality
3
. Tobacco smoke contains a variety of
compounds that have been classified as carcinogens, many of which can cause DNA damage by
formation of DNA adducts, leading to oncogenic mutations if not repaired correctly
4
. Increased
mutational burden has been found in non-small cell lung cancer (NSCLC) patients who are current
or former smokers compared to never-smokers
5,6
. Other significant risk factors, such as genetic
and environmental factors, are thought to contribute to lung cancer incidences in never-smokers,
comprising approximately 10-40% of NSCLC patients
6
, especially in females
7
. In never-smokers,
a predominant C:G ->A:T mutation spectrum was observed compared to the C:G->T:A spectrum
in smokers; distinctive mutations such as EGFR mutations and ROS1 or ALK fusions have also
been identified in never-smokers
6
, suggesting different mechanisms of tumorigenesis in never-
smoker NSCLC patients. Even though lung cancer incidences and mortality rates have been
decreasing in the United States due to smoke cessation
3
, they remain the highest among all cancers,
emphasizing the dire need for further understanding of the disease and development of effective
detection and treatment methods.
Over the past few decades, lung cancer has seen a marginally increased, yet still low 5-year
survival rate at around 18%
3
. Lung cancer survival is very dependent on disease stage at diagnosis,
with early-stage surgically resectable tumors showing a favorable prognosis versus very poor
4
survival at later stages. Unfortunately, most patients are diagnosed at advanced stages, where
treatment options are poor and remission is unlikely
3,8,9
. This suggests that we are in need of further
development and refinement of lung cancer screening and early detection methods. Traditionally,
surgical resection is the treatment of choice for NSCLC in early-stage tumors, whereas platinum-
based chemotherapy with or without radiation is the standard treatment option for unresectable
late-stage NSCLC
10
. However, with recent advancement of molecular biology, more and more
drugs are being developed to target driver mutations that have been identified in NSCLC
10,11
. Small
molecule tyrosine kinase inhibitors (TKI) have been approved clinically to treat patients with these
genetic alterations, even though most patients eventually show disease progression due to
molecular changes that render the tumor resistant to TKI treatment
10,11
. On the other hand, with
the development of immunotherapy, anti-programmed death-ligand 1 (PD-L1) treatment has been
taken under consideration for patients with advanced NSCLC
10
. Despite the progress seen in
treatment options lately, NSCLC disease prognosis remains poor, emphasizing the need for further
research in understanding NSCLC at a molecular and cellular level.
Lung cancer can be categorized into two major histological groups: small cell lung
carcinoma (SCLC, 15% of all lung cancer) and non-small cell lung carcinoma (NSCLC, 85% of
all lung cancer). NSCLCs are then subcategorized into adenocarcinoma, squamous cell carcinoma,
and large cell carcinoma
12
, of which lung adenocarcinoma (LUAD) is the most common
histological subtype
13
(Fig. 1), representing about 40% of all lung cancers
14
. LUAD is thought to
originate from distal alveolar epithelium of the lung
15,16
. Similar to other types of lung cancer,
LUAD has a strong association with the use of tobacco, but is also the most common subtype
diagnosed in never-smokers
14
. More recently, LUAD has been further divided into different
molecular subtypes based on specific driver mutations found in tumors, which has led to improved
5
clinical outcomes as a result of replacing conventional chemotherapies with targeted therapies
directed at druggable driver mutations as first-line treatment
17
.

2.2 Mutations in Lung Adenocarcinoma
Advancement in sequencing technology in the past decade has revealed several
significantly altered genes via whole-genome or exome sequencing and RNA sequencing of
LUAD patient tumor samples
18
(Fig. 2). Several of these alterations include activating mutations
in oncogenes, such as KRAS, EGFR, and BRAF, as well as mutations in tumor suppressor genes,
such as TP53, RB1, and CDKN2A
13,19
. Other mutations were also found in genes involved in
chromatin modification and RNA splicing
13
. Other than somatic mutations, other alterations
include copy number variations in genes such as NKX2-1 and TERT and chromosomal
translocations, leading to aberrant fusion proteins involving ALK and ROS1
13,19
. However, many
Figure 1. Histological categorization of lung cancer. Data based on American Cancer Society. What Is Non-
Small Cell Lung Cancer? Atlanta: American Cancer Society; 2016.

6
LUAD tumors do not exhibit a
known driver oncogene,
suggesting that additional
driver mutations or
tumorigenesis mechanisms are
yet to be identified, hindering
treatment process in patients
with these tumors
13,20
.
Even though alterations
are found in several different genes in LUAD, they usually affect certain key pathways including
p53 pathway, cell cycle regulation, and receptor tyrosine kinase (RTK)/RAS/RAF pathway
13
.
TP53 gene encodes a 53 kDa protein, TP53, which serves as a tumor suppressor under
normal conditions. It functions in response to various cellular stress including DNA damage,
activating or repressing transcriptional activities at corresponding sites, resulting in a net effect
ranging from DNA damage repair, to cell cycle arrest and apoptosis
5
. TP53 is one of the most
commonly mutated genes in LUAD and is highly correlated with a history of smoking
5,13
. TP53
mutations are usually inactivating, resulting in a loss-of-function in the tumor suppressor protein.
It has also been reported that gain-of-mutant-function of TP53 mutants can play a role in the
tumorigenesis process
5
.
The cell cycle is a complicated process during which cells grow and proliferate. It is
comprised of G1, S, G2, and M phases, as well as G0 phase, where cells exit the cycle but still have
the potential to divide
21
. The entry and exit into each phase are highly regulated in normal cells,
by numerous cyclin proteins and cyclin-dependent kinases (CDKs). One example is cyclin D and
Figure 2. Genetic aberrations in oncogenes found in LUAD. Figure
adapted from Kumarakulasinghe et al. Molecular targeted therapy in the
treatment of advanced stage non-small cell lung cancer (NSCLC).
Respirology. 2015;20(3):370-378.

7
CDK4. When expressed, cyclin D binds to
CDK4 and the resulting cyclin D-CDK4
complex can phosphorylate the
retinoblastoma protein (RB1), which
normally binds and inactivates the
transcription factor E2F.
Hyperphosphorylated RB1 dissociates
from E2F, releasing the transcription factor
to activate transcription of various genes
and pushing cells from G1 to S phase
21,22
.
In addition to cyclins and CDKs, cell cycle
is also regulated by CDK-inhibitory
proteins, one of which is the protein
encoded by CDKN2A, TP16. The TP16 protein binds and inactivates CDK4, arresting cells at G1
phase as CDK4 is unable to phosphorylate RB1
21,22
(Fig. 3). Because of their function in arresting
cells at G1 phase and preventing cell division, RB1 and TP16 are considered tumor suppressors.
Unfortunately, the genes that encode for these proteins, RB1 and CDKN2A, have been found
altered in LUAD by a variety of mechanisms ranging from inactivating mutations and copy
number deletion, to promoter inactivation by deletion or methylation
13,19
, causing the tumor cells
to lose cell cycle regulation.
The receptor tyrosine kinase (RTK)/RAS/RAF pathway is the most commonly altered
pathway found in LUAD, including multiple genes involved in different levels of this signaling
cascade
13
. RTK/RAS/RAF signaling is very important in regulating several key cellular functions
Figure 3. The cell cycle and G1/S phase regulation by RB1
and TP16

8
involved in tumorigenesis, such as cell growth and division and angiogenesis
23
. Briefly, the
signaling process often starts with binding of growth factors to RTK, triggering oligomerization
of the RTK, activating its kinase activity. RTKs first transphosphorylate themselves, providing
recognition sites for adaptor proteins such as GRB2, which then recruits guanine nucleotide
exchange factors (GEFs) such as SOS-1. GEFs can then promote the exchange of GDP to GTP of
RAS protein, leading to its activation. Activated RAS can then activate kinase function of RAF
protein isoforms, triggering a signaling cascade by phosphorylation. First, RAF phosphorylates
mitogen-activated protein kinase (MAPK) kinase, also known as MEK or MAPKK, which
phosphorylates and causes the activation and nuclear translocation of MAPK or ERK1/2. Once
activated, ERK1/2 phosphorylates a wide range of transcription factors and kinases involved in
cellular processes such as cell proliferation, survival, migration, and angiogenesis
23,24
(Fig. 4).
KRAS, a gene encoding an isoform of the RAS protein, and one of the key players in
RTK/RAS/RAF pathway, is the most frequently mutated oncogene in LUAD
13,19
. KRAS mutants,
with or without additional oncogenes, have been shown to be capable of malignant transformation
of lung epithelial cells in vitro or in vivo
15,25
. Under normal conditions, RAS proteins are GTPases
that are active when GTP is bound. When GTP is converted to GDP, RAS undergoes a
conformational change and becomes inactive. However, its intrinsic GTPase activity is very slow
and is accelerated with the help of GTPase activating proteins (GAPs), which promote RAS
inactivation
24
. The most common KRAS mutation found in LUAD localizes on codon 12
26
, which
results in its insensitivity to GAP inactivation, leaving KRAS protein at its active state, triggering
downstream MAPK signaling
23,24
(Fig. 4). KRAS mutations are strongly correlated with tobacco
use
6,26,27
. Interestingly, KRAS mutations are more in European/US patients compared to Asian
patients
18
, as well as in African-American patients than in Caucasians
26
. KRAS mutations are
9
considered a unfavorable biomarker clinically, correlating with a shorter overall survival in
patients
26
, partly due to the fact that activating mutant KRAS is not currently druggable
17,18
.
2.3 EGFR Mutations in Lung Adenocarcinoma
Also a part of the RTK/RAS/RAF pathway, epidermal growth factor receptor (EGFR), a
member of the ERBB family RTKs
26
, is the second most commonly mutated oncogene found in
LUAD, following KRAS
13,28
. However, EGFR mutations are almost always mutually exclusive
with KRAS mutations, as EGFR mutants are more commonly found in non-smokers whereas KRAS
mutants are usually found in smokers
13,26,29
, suggesting distinct mechanisms of tumorigenesis
depending on patient smoking status. EGFR mutations are mostly associated with LUAD and
Figure 4. RTK/RAS/RAF and PI3K/AKT pathways and mechanism of EGFR and KRAS mutants in
dysregulating these pathways

10
EGFR is the most frequently altered gene in non-smoker LUAD patients
26,27,30
. EGFR mutations
are also more frequently observed in East Asian population and females
26,30,31
. In a study using
Asian LUAD patient samples, EGFR mutations were shown to be truncal events, which occur
early and are common in a heterogeneous tumor cell population, signifying its role as a potent
onco-driver
32
. In addition, the oncogenicity of EGFR mutants have been demonstrated both in vitro
and in vivo
33-35
.
Activating mutations of EGFR in LUAD are found within exons 18 to 21, which encode
the ATP-binding pocket of EGFR tyrosine kinase domain
26,30
. Most of these mutations are in-
frame deletions of exon 19 and point mutations in exon 21, with delE746-A750 and L858R
constituting about 45% and 40-45%, respectively, of total EGFR mutations found in LUAD
26
(Fig.
5). These mutations were identified in the early 2000s when some NSCLC patients were reported
to be sensitive to treatment with gefitinib
29
, a small molecule inhibitor of EGFR. Since then,
targeted therapies using small molecule EGFR-tyrosine kinase inhibitors (TKIs) including
gefitinib, erlotinib, and afatinib have become standard first-line treatment for LUAD patients with
activating mutations of EGFR
10,26
. Despite their remarkable initial response, patients undergoing
EGFR-TKI treatment will inevitably relapse and develop resistant tumors. In most cases, these
patients acquire a secondary T790M mutation in EGFR, which causes its ATP-binding pocket to
have an increased affinity for ATP, outcompeting TKIs for binding
26,29
.
The EGFR protein is a transmembrane protein that is approximately 170 kDa in size. The
extracellular domain is responsible for ligand binding, while the intracellular domain comprises a
tyrosine kinase region and a tyrosine-rich C-terminal region for phosphorylation
29
(Fig. 5). Upon
binding to its ligands, EGFR undergoes a conformational change that allows dimerization of the
receptor to another EGFR or other members of the ERBB family. Upon dimerization, EGFR
11
activates its tyrosine kinase activity, which first transphosphorylates the receptors themselves at
the tyrosine-rich C-terminal region, creating an interface to interact with other proteins in different
signaling pathways involved in cell proliferation and survival
26,29
. Among these pathways is the
RTK/RAS/RAF pathway, which eventually leads to phosphorylation and activation of ERK1/2,
promoting cell proliferation. In addition, PI3K/AKT pathway can also be activated by EGFR
dimerization, resulting in phosphorylation and activation of AKT, which plays a role in cell
survival
29
(Fig. 4).

Figure 5. Simplified representation of EGFR showing its different domains and locations for LUAD relevant
mutations and their frequency. Figure taken from Sharma et al. Epidermal growth factor receptor mutations
in lung cancer. Nat Rev Cancer. 2007;7(3):169-181.

12
Activating mutations in EGFR cause a conformational change in its tyrosine kinase domain,
which allows for more potential in forming dimers or even oligomers thus activating its kinase
activity with a reduced dependence on ligand stimulation. With its kinase activity activated in a
less ligand-dependent fashion, mutant EGFR is able to trigger downstream signaling more
efficiently than wildtype, upregulating pathways in cell proliferation and survival, conferring
oncogenicity
36,37
(Fig. 4). However, it has been reported that classical single-mutation EGFR
mutants only have modest ligand-independent kinase activation, whereas double mutants of
L858R/T790M or delE746-A750/T790M have a much higher catalytic efficiency and potent
transformation ability
31,37
.
2.4 Hallmarks of Cancer and Cell Transformation
Malignant transformation of mammalian cells from normal to cancerous is usually
characterized by a variety of capabilities known as hallmarks of cancer. Classical hallmarks of
cancer are comprised of sustained proliferating signaling, from deregulated growth factor or
signaling pathways; evasion of growth suppressors, such as cell cycle regulation and contact
inhibition; resistance to cell death induced by apoptosis; replicative immortality, enabled by
increased telomerase activity; ability to initiate angiogenesis and cell invasion and metastasis. In
addition, transformed cells also experience genomic instability and tumor-promoting inflammation,
as well as having altered cellular energetics and ability to evade immune destruction
38
.
In an experimental setting, several techniques are used to characterize the level of
transformation in cells with endogenous expression or overexpression of oncogenes. First of all,
morphological and growth pattern changes are usually observed in high-level transformed cells,
corresponding to epithelial to mesenchymal transition (EMT) and loss of contact inhibition
31,38,39
.
Further confirmation of EMT and loss of contact inhibition can be verified via immunofluorescent
13
(IF) staining for E-Cadherin and Vimentin, which mark cells that are either more epithelial-like or
mesenchymal-like, respectively
39
. As for investigating abnormal proliferating signals and
resistance to apoptosis, immunoblotting can be utilized to verify abnormal levels of factors
involved in growth pathways, and proliferation assay without or without the addition growth
factors can be used to examine different proliferation rates in cells expressing oncogenes compared
to those that do not
25,31,39
. Other techniques such as telomerase repeated amplification protocol
(TRAP) and genomic or epigenomic analyses can be used to study changes in cell immortality and
genomic stability
39,40
. More notably, colony formation assay in soft agar has become a standard
test in vitro to examine cell transformation, as transformed cells acquire the ability to growth
independent of anchorage, and tumorigenicity assay in vivo by injecting cells in immunodeficient
mice is the ultimate test for malignant transformation
25,31,39
.
2.5 In vitro Models for Lung Adenocarcinoma
Using these methods, several groups have shown transformation abilities of potent onco-
drivers such as KRAS and EGFR mutants in either NIH3T3 cells or immortalized human bronchial
epithelial cells (HBECs) in attempts to investigate the roles of these oncogenes in disease initiation
and progression in NSCLC
25,31,39
. However, these models may not be the best approach to research
LUAD disease initiation and progression, as the presumed cell-of-origin is alveolar epithelial cells
(AECs)
15,16
, rather than HBECs or NIH3T3, a mouse fibroblast cell line that has been shown to
transform spontaneously in culture
41
. Other in vitro models that have been used to study LUAD
include primary tumor and tumor-adjacent samples derived from patients
42,43
, which are not readily
available for all researchers, especially those without clinical access, and LUAD cancer cell
lines
44,45
, which are fully transformed and not suitable for the study of tumor initiation capabilities
of oncogenes.
14
Even though LUAD cancer cells lines have been a great tool for researcher to investigate
the abnormalities that occur in the disease, we still need an inexpensive and readily available model
to learn what is necessary to drive LUAD initiation and progression and how they contribute to
the process. Recent studies using massive amount of sequencing data from patient tumor samples
have revealed not only well-known oncogenes in LUAD such as KRAS and EGFR mutations, but
also low-frequency or newly-proposed drivers for transformation, as well as a significant number
of what is thought to be passenger mutations that may or may not play a role in tumorigenesis
13,19,32
.
Furthermore, it appears that even potent drivers like KRAS require a certain unknown genetic
background to fully transform immortalized lung epithelial cells, by either prolonged cigarette
smoke condensate (CSC) exposure or co-expression of other oncogenes, implicating the
complexity of malignant transformation beyond the presence of a single oncogene
39,46
. Here, we
propose to use immortalized AECs from normal lung tissues as a model to aid in the investigation
of whether and how these mutations can contribute to oncogenesis of LUAD. AECs better
represent the cell-of-origin for LUAD and through work in our lab have become accessible and
readily maintained in culture, in addition to retaining a fairly normal genome compared to cancer
cell lines.
2.6 Immortalized Normal Human Alveolar Epithelial Cells as a Model of LUAD
Our lab has successfully derived a collection of immortalized AECs from normal lungs
from three donors using lentiviral particles coding for Simian Virus 40 (SV40) large T (LT) antigen
alone, SV40 LT plus catalytic subunit of human telomerase (hTERT), CDK4
R24C
(a CDK4 mutant
that is hyperactive due to unresponsiveness to TP16 inhibition) alone, hTERT alone, and
CDK4
R24C
plus hTERT (Tran et al. manuscript in prep). In my thesis project, SV40 LT- or SV40
15
plus hTERT-transduced AECs were used as they are more proliferative than the other collections
of cells, making it possible to perform experiments needed in a confined time window.
It has long been a struggle for researchers to culture terminally differentiated primary
human epithelial cells in vitro due to cell senescence and cell cycle arrest caused by telomere
shortening and TP16-mediated stress response. In order to maintain these cells in culture, several
proteins, including viral oncoproteins, have been used to bypass cell cycle arrest and maintain
primary epithelial cells in culture
47
, one of which is the SV40 LT antigen. The ability of SV40 LT
to immortalize primary human AECs, as well as other primary epithelial cells, relies on its ability
to inhibit two important tumor suppressor
proteins in cells – RB1 and TP53 (Fig. 6).
Inhibition of these tumor suppressors
disrupts their ability to arrest cell
proliferation at G1/S or G2 phases
48
. In
addition, loss of TP53 function also
hinders cellular response to DNA damage,
which is commonly seen in cancer cells due to replicative stress
5
. Other than cell cycle arrest, the
immortalization process also needs to overcome proliferative senescence, which is caused by
telomere shortening at the chromosomal ends, leading to a halt of proliferation in response to this
stress
38
. This can be addressed by expressing hTERT to restore telomeres, giving cells unlimited
proliferative potential
25,46,47
.
Nonetheless, there are several concerns over using SV40 LT as an immortalizing agent in
mammalian cells, as the oncoprotein itself is quite transformative
25,47
. Indeed, our SV40 LT-
transduced AECs already have the ability to form colonies in soft agar, albeit at a much lower
Figure 6. Schematic of SV40 LT immortalizing AECs

16
efficiency compared to A549 LUAD cancer cell line, but we are currently testing their
tumorigenicity in mouse xenograft (Tran et al. manuscript in prep). This is because BEAS-2B cells,
an immortalized HBEC cell line using SV40 LT, were also shown to form colonies in soft agar
but not tumors in immunodeficient mice; they are able to be further transformed and form soft agar
colonies at much higher efficiency and tumors in nude mice, suggesting that SV40 alone is not
fully transformative
47,49
. Furthermore, LUAD disease development is a multistep process, and cell
cycle dysregulation by loss of TP16 or RB1, loss of TP53 function, and increased telomerase
activity are thought to be the earliest and most universal events in LUAD
13,25,32
, making
overexpressing hTERT and using SV40 LT to inhibit RB1 and TP53 appropriate as a step to mimic
LUAD disease initiation. It has also been shown that the inactivation of TP16/RB1 and TP53
functions is also critical to evade oncogene-induced senescence
25,50
, which occurs when the
expression of an oncogene can trigger a stop on cell cycle progression. This makes SV40 LT a
reasonable choice to immortalize AECs; we could then attempt to introduce expression of
oncogenes in order to further transform SV40 transduced AECs and study the role of different
oncogenes in further driving LUAD disease progression.
Other than their ability to form colonies in soft agar, SV40-transduced AECs appear fairly
normal. First, via karyotyping, we have shown that they retain a normal ploidy. Secondly, they
express epithelial markers in 2-dimensional (2D) culture and in 3-dimensional (3D) culture with
fibroblasts they express lung lineage markers such as NKX2-1 and AQP5 and form alveolar-like
organoids (Fig. 7A). Furthermore, their gene expression profile clusters together with other
immortalized AECs, and is distinct from primary AECs and, more importantly, from LUAD cancer
cell lines (Fig. 7C). We have also found out later on that SV40 LT-transduced AECs lack
telomerase activity via TRAP assay (Fig. 7B), so we continued on our experiments with AECs
17
transduced with SV40 LT along with hTERT for true immortalization (Tran et al. manuscript in
prep). In this thesis project, I attempted to express a well-studied oncogene, EGFR
L858R
, via either
Figure 7. A) AEC-LT14 cells form spheroids and show lung lineage and epithelial makers (NKX2-1, AQP5,
ECAD) in 3D culture with mouse fibroblasts B) TRAP assay showing lack of telomerase activity in AECs
compared to A549 LUAD cancer cell line C) RNA-seq-based unsupervised Euclidean sample distance matrix
indicating that immortalized AECs are distinct from both primary AECs and LUAD cancer cell lines. From
Tran et al. manuscript in prep.

18
lentiviral transduction or CRISPR/Cas9 genome editing, to establish a proof-of-principle protocol
for further investigations of other less-studied or unknown genetic alteration that may drive the
disease progression of LUAD using this in vitro model. EGFR
L858R
was chosen because, other
than the fact that it is well studied, it is one of the most common mutations seen almost exclusively
in LUAD (40-45% of total EGFR mutations seen in LUAD
26
). Moreover, unlike KRAS mutants,
small molecule inhibitors are available for this mutant
26
and could be used potentially in further
experiments. To validate EGFR
L858R
mutant expression, immunoblotting for EGFR
L858R
mutant
protein and changes in downstream signaling pathways such as phospho-ERK1/2 and phospho-
AKT levels was performed, followed by standard in vitro transformation assays such as
proliferation and colony formation assays to investigate the level of transformation after
expressing EGFR
L858R
mutant in SV40 LT- or SV40 LT- and hTERT-transduced AECs.

19
3. Materials and Methods
Site-Directed Mutagenesis of EGFR to EGFR
L858R
:
The plasmid with cDNA encoding full-length human EGFR was a gift from Dr. Mark Frey’s lab.
The EGFR
L858R
mutation was introduced by polymerase chain reaction (PCR) using QuikChange
Lightning Site-Directed Mutagenesis Kit (Agilent Cat. # 210518). Forward primer 5’-
TCACAGATTTTGGGCGGGCCAAACTGCTGGG-3’ and reverse primer 5’-
CCCAGCAGTTTGGCCCGCCCAAAATCTGTGA-3’ (IDT Inc.) were used to introduce T to G
transversion at EGFR coding DNA sequence (CDS) position 2573, which would result in change
of amino acid at position 858 from Leucine to Arginine. The PCR product was then transformed
in XL10-Gold Ultracompetent Cells (Agilent Cat. # 200314), plated on LB agar plates containing
5 µg/ml gentamicin, and incubated at 37 °C overnight. Colonies were picked and inoculated in LB
containing 5 µg/ml gentamicin overnight at 37 °C for plasmid isolation. EGFR CDS as well as T
to G transversion at position 2573 were verified by Sanger Sequencing (Genewiz Inc.).
Generation of Lentiviral Constructs:
Constitutive EGFR
L858R
-IRES-tdTOMATO and IRES-tdTOMATO control: Lentiviral vector
LeGO-iT (control) was a gift from Boris Fehse (Addgene plasmid # 27361). 5’ and 3’ NotI
restriction sites were added to EGFR
L858R
CDS, along with a Kozak sequence ACC, by PCR using
forward primer 5’-TAATGCGGCCGCACCATGCGACCCTCCGGGACGGC-3’ and reverse
primer 5’-CTCTGCGGCCGCTCATGCTCCAATAAATTCACTGCTTTGTGGCGC-3’ (IDT
Inc.). PCR product and LeGO-iT vector were then digested with restriction enzyme NotI-HF (NEB
Cat. # R3189) and subsequently ligated overnight at 16 °C using T4 DNA ligase (NEB Cat. #
0202). Ligated DNA was then transformed into One Shot Stbl3 Chemically Competent E. Coli
(Invitrogen Cat. # C737303), plated on LB agar plates containing 100 µg/ml ampicillin, and
20
incubated at 37 °C overnight for plasmid isolation. Resulting desired lentiviral construct LeGO-
EGFR
L858R
-iT is then confirmed by Sanger Sequencing (Genewiz Inc.).
Dox-inducible EGFR
L858R
-IRES-tdTOMATO: 5’ SpeI and 3’ NotI restriction sites were added to
EGFR
L858R
CDS, along with a Kozak sequence ACC, by PCR using forward primer 5’-
TACTACTAGTACCATGCGACCCTCCGGGACGGC-3’ and reverse primer 5’-
CTCTGCGGCCGCTCATGCTCCAATAAATTCACTGCTTTGTGGCGC-3’ (IDT Inc.). PCR
product was then digested with restriction enzymes SpeI-HF (NEB Cat. # R3133) and NotI-HF
(NEB Cat. # R3189). Vector pEN_TmiRc3 was a gift from Iain Fraser (Addgene plasmid # 25748)
and digested with restriction enzymes SpeI-HF and NotI-HF. Digested vector and PCR product
were then ligated overnight at 16 °C using T4 DNA ligase (NEB Cat. # 0202). Ligated DNA was
then transformed into One Shot Stbl3 Chemically Competent E. Coli (Invitrogen Cat. # C737303),
plated on LB agar plates containing 5 µg/ml gentamicin, and incubated at 37 °C overnight for
plasmid isolation. EGFR
L858R
CDS was then sequenced (Genewiz Inc.). A positive clone was then
used to set up Gateway recombination with pSLIK-Hygro lentiviral destination vector, a gift from
Iain Fraser (Addgene plasmid # 25737), using Gateway LR Clonase II Enzyme Mix (Invitrogen
Cat. # 11791-020). Recombination product was transformed in One Shot OmniMAX 2 T1R
Chemically Competent E. coli (Invitrogen Cat. # C854003), plated on LB agar plates containing
100 µg/ml ampicillin, and incubated at 37 °C overnight for plasmid isolation. Resulting desired
lentiviral construct pSLIK-EGFR
L858R
iT was confirmed by Sanger Sequencing (Genewiz Inc.).
Constitutive SV40 T antigen-IRES-GFP and hTERT-IRES-tdTOMATO: Evelyn Tran in our lab had
previously cloned these during her thesis project, by subcloning SV40 Large T antigen CDS
from pBABE-puro SV40 LT plasmid (Addgene plasmid # 13970) into LeGO-iG vector (Addgene
plasmid # 27358) between BamHI and EcoRI sites, and hTERT CDS from pBABE-puro-hTERT
21
(Addgene plasmid # 1771) into LeGO-iT vector (Addgene plasmid # 27361) between BglII and
EcoRI sites. Resulting plasmids LeGO-SV40-iG and LeGO-hTERT-iT sequences were verified
by Sanger Sequencing (Genewiz Inc.).
Production of Lentiviral Particles:
Third generation lentiviral particles were produced in low passage HEK293T cells by transfection
using BioT (BioLand LLC Cat. # B01-00). HEK293T cells were plated at a density of 4-5 million
cells per 10-cm dish and transfected the next day with 15 µl of BioT and 2 µg of each pMD2G
(Addgene plasmid # 12259), pRSV-Rev (Addgene plasmid # 12253), pMDLg/pRRE (Addgene
plasmid # 12251), and lentiviral construct carrying desired transgene. Media containing viral
particles were collected twice, at 48 and 72 hours post-transfection, and pooled. Cell debris was
removed by centrifuging at 300xg and filtering media though 0.45 µm cellulose acetate filter
(VWR cat. # 28145-481). Viral particles were then precipitated using Lenti-X concentrator
(Takara Bio cat. # 631231) followed by centrifuging at 1500xg for 2 hours at 4 °C. Lentiviral
pellets were resuspended in DMEM (Corning Cat. # 10-013 CV), aliquoted, and stored at -80 °C.
Viral infectivity was tested empirically on HEK293T cells.
Cell Culture
HEK293T cell line was maintained in DMEM (Corning Cat. # 10-013 CV) with 10% FBS
(GenClone Cat. # 25-514) and 1x antibiotic-antimycotic (Life Tech Cat. # 15240-062). A549 and
PC9j LUAD cell lines were maintained in RPMI 1640 (Corning Cat. # 10-040 CV) with 10% FBS
(GenClone Cat. # 25-514) and 1x antibiotic-antimycotic (Life Tech Cat. # 15240-062). AEC-
ROCK14, AEC-LT14, AEC-LT14-LeGOiT, AEC-LT14-EGFR
L858R
iT, AEC-LT+hTERT14 and
AEC-SHE14 were maintained in 3:1 ratio of DMEM/F12 50/50 (Corning Cat. # 10-090 CV) and
phenol red-free DMEM (USC cell culture core), supplemented with 5% FBS (Omega Sci Cat. #
22
FB-11) or tet-free FBS (Omega Sci Cat. # FB-15), 0.4 µg/ml hydrocortisone (Sigma Cat. # H0888),
5 µg/ml insulin (Sigma Cat. # I0516), 8.4 µg/ml cholera toxin (Sigma Cat. # C8052), 10 ng/ml of
hEGF (Gibco Cat. # PHG0314), 1x antibiotic-antimycotic (Life Tech Cat. # 15240-062), and
10µM of Y-27632 dihydrochloride (ROCK inhibitor, Enzo Cat. # ALX-270-333-M005), unless
otherwise indicated. AEC-SHE14 cells were cultured in the presence of hygromycin and either
DMSO vehicle control or 0.8 µg/ml doxycycline (Enzo Cat. # ALX-380-273-G001) dissolved in
DMSO, unless otherwise indicated. All cell lines were maintained at 37 °C and 5% CO2.
Transfection and Lentiviral Transduction
HEK293T cells were plated at about 60% confluency overnight and transfected next day using
BioT (BioLand LLC Cat. # B01-00). HEK293T, A549, PC9, AEC-LT14, and AEC-ROCK14 cells
were plated at about 40% confluency overnight and transduced with lentiviral particles diluted in
cell culture media containing 8 µg/ml polybrene the next day. Lentiviral infectivity and amount
used were empirically determined on HEK293T cells each time a new batch of viruses were made.
Lentiviral media were replaced with fresh cell culture media 48 hours post-transduction.
Transduced cells were then FACS sorted by tdTOMATO only, or by both GFP and tdTOMATO
(USC Flow Cytometry Core).
Western Blot Analysis
Cells to be analyzed were serum starved for 6 hours and then trypsinized and pelleted at 220xg for
5 min. Cell pellets were then lysed in RIPA buffer containing 1x Halt protease and phosphatase
inhibitor (Thermo Cat. # 78440) and kept on ice for 15 min. Cell lysates were passed through 25G
needles 8 times using a syringe. Lysate protein concentration was determined using Bio-Rad DC
TM

Protein Assay (Cat. # 5000112). 20 µg of total protein of each sample was then loaded onto either
a 10% polyacrylamide gel for electrophoresis and transferred onto PVDF membrane. PVDF
23
membrane was then stained with Ponceau S solution (Biotium Cat. # 220001) to check for transfer
quality, and subsequently blocked in 5% BSA in TBST for 1 hours at room temperature. Blocked
membranes were then cut and incubated in primary antibodies (Table 1) diluted in 5% BSA in
TBST overnight at 4 °C. Next day, blots were washed 3 times in TBST for 5 min each, followed
by 1-hour incubation in secondary anti-rabbit-IgG, HRP-linked antibody (Cell Signaling Cat. #
7074S) or goat-anti-mouse IgG-HRP (Santa Cruz Cat. # sc-2005) at room temperature. Blots were
then washed 3 times in TBST for 5 min each, and imaged using Immobilon Western
Chemiluminescent HRP Substrate (Millipore Cat. # WBKLS0500) and Bio-Rad ChemiDoc XRS+.
Images were analyzed using Image J (NIH).
Antibody Dilution Company Catalog #
Rabbit-anti-EGFR 1:1000 ThermoFisher PA1-1110
Rabbit-anti-EGFRL858R 1:1000 Cell Signaling 3197S
Rabbit-anti-p-EGFR (Tyr992) 1:1000 Cell Signaling 2235T
Rabbit-anti-AKT 1:1000 Cell Signaling 9272S
Rabbit-anti-p-AKT 1:1000 Cell Signaling 9271S
Rabbit-anti-p42/44 MAPK (Erk1/2) 1:1000 Cell Signaling 9102S
Rabbit-anti-p-p42/44 MAPK (p-Erk1/2) 1:1000 Cell Signaling 3470S
Rabbit-anti-His-tag 1:2000 Cell Signaling 2365S
Rabbit-anti-b-Actin 1:2000 Cell Signaling 4970S
Mouse-anti-Lamin A/C 1:2000 Santa Cruz sc-7292
Table 1. Antibody List
RNA Isolation and qRT-PCR
Cells of interest were trypsinized and pelleted at 220xg for 5 min. Total cellular RNA was isolated
using Aurum
TM
Total RNA Mini Kit (BioRad Cat. # 7326820). 1 µg total RNA was then used for
cDNA synthesis using iScript
TM
cDNA Synthesis Kit (BioRad Cat. # 1708891) and BioRad MJ
Mini Thermo Cycler. 3 µl of 5x diluted cDNA was then used to set up quantitative polymerase
24
chain reaction (qPCR) in a 96-well plate using iQ
TM
SYBR Green Supermix (BioRad Cat. # 170-
8886) and primers specific for b-actin, EGFR, and reverse tetracycline-controlled transactivator
(rtTA) (Table 2). qPCR Reactions were run using BioRad CFX Connect Real-Time PCR Detection
System and following parameters:
1. 95 °C, 3 min
2. 95 °C, 30 sec
3. 53 °C, 30 sec
4. 72 °C, 30 sec, capture fluorescence, repeat from step 2 49x
5. 45 °C – 95 °C at 1 °C increment for melting curve
Gene Forward Primer Reverse Primer
b-actin
5’- GTTGAGAACCGTGTACCATGT -3’ 5’- TTCCCACAATTTGGCAAGAGC -3’
EGFR 5’- GGTGCGGAAGAGAAAGAATAC -3’ 5’- ACATCACTCTGGTGGGTATAG -3’
rtTA 5’- GAAACAGCTAAAGTGCGAAAG -3’ 5’- TCAAGGTCAAAGTCGTCAAG -3’
Table 2. qPCR Primers
Soft Agar Assay
Equal volumes of 1.2% noble agarose and 2x growth media for appropriate cell lines were mixed
and distributed across 6-well plates for 0.6% agarose bottom layer. Equal volumes of 0.6% noble
agarose and cells resuspended in 2x growth media were then mixed and distributed on top of
bottom layer, for a 0.3% top layer. Each well was then covered with 1x growth media. Growth
media were refreshed every 3 days for 21 days.
Proliferation Assay
Cells were seeded on day 0 at 3000 cells/well in all of the wells of 24-well plates. Cells from four
of the wells were trypsinized and counted using a hemocytometer daily for the next 6 days. Cells
from each well were counted four times total, giving 16 total cell counts per cell line per day. Cell
25
numbers obtained from each day were averaged and plotted to generate growth curves of
corresponding cell lines.
Generation of CRISPR/Cas9 Plasmids
pSpCas9(BB)-2A-Puro (pX459) v2.0 (Addgene plasmid # 62988) and pSpCas9(BB)-2A-GFP
(pX458) (Addgene plasmid # 48138) were gifts from Feng Zhang. Either pX458 or pX459 was
digested with BbsI-HF (NEB Cat. # R3539S) at 37 °C for 2 hours. Linearized vectors were then
gel purified and ligated with oligos coding for guide RNAs (gRNAs) targeting EGFR exon 21
around genomic locus of EGFR
L858R
mutation (hg38 Chr7: 55191822) (Table 3). Oligo insertion
and sequence were verified via Sanger Sequencing (Genewiz Inc.).
Oligo Forward Sequence Reverse Sequence
T6 5’- CACCGCTCTTCCGCACCCAGCAGTT -3’ 5’- AAACAACTGCTGGGTGCGGAAGAGC -3’
T8 5’- CACCGTTTTGGGCTGGCCAAACTGC -3’ 5’- AAACGCAGTTTGGCCAGCCCAAAAC -3’
T11 5’- CACCGCTGGCCAAACTGCTGGGTG -3’ 5’- AAACCACCCAGCAGTTTGGCCAGC -3’
T12 5’- CACCGCAAGATCACAGATTTTGGGC -3’ 5’- AAACGCCCAAAATCTGTGATCTTGC -3’
T16 5’- CACCGTTTGGGCTGGCCAAACTGCT -3’ 5’- AAACAGCAGTTTGGCCAGCCCAAAC -3’
Table 3. gRNA Oligos List
Nucleofection
AEC-LT14 cells were harvested using Accutase (ICT Inc. Cat. # AT-104), divided into 1 million-
cell aliquots, and pelleted at 220xg for 5 min. Each cell pellet was then resuspended in 82 µl
Nucleofector
TM
Solution for Primary Mammalian Epithelial Cells and 18 µl Supplement 1 (Lonza
Cat. # VPI-1005), along with 2µg of DNA with or without single-stranded donor oligonucleotides
(ssODN) for homology directed repair in order to mutate EGFR exon 21 (5’-
GCCTGGTCCCTGGTGTCAGGAAAATGCTGGCTGACCTAAAGCCACCTCCTTACTTTG
CCTCCTTCTGCATGGTATTCTTTCTCTTCGGCACCCAGCAGTTTGGCGCGCCCAAAAT
26
CTGTGATCTTGA -3’) (IDT, Inc), or 10µg of Cas9 protein (NEB Cat. # M0646T). Cell
resuspension was transferred to nucleofection cuvette and nucleofected using Nucleofector
TM
2b
(Lonza Cat. #AAB-1001). Nucleofected cells were then transferred to 6-well plates with pre-
warmed media and incubated at 37 °C with 5% CO2 overnight. Nucleofection efficiency was
determined by either puromycin selection or fluorescence.
Biophotonic Laser Assisted Surgery Tool (BLAST) Transfer of pX459 v2.0 Plasmids
BLAST transfer experiments were optimized and performed by Dr. Alexander Patananan from Dr.
Michael Teitell’s lab at UCLA as described in their manuscript
51
, using monoclonal SV40 LT- and
hTERT-immortalized AECs (AEC-LT+hTERT14C7) and different pX459 v2.0 or pX459v2T11
(targeting EGFR exon 21) with or without ssODN. After BLAST transfer, cells were harvested
and plated in a 6-well plate. After cells had attached, media was changed to fresh media containing
1.5 µg/ml puromycin to select for cells that had taken up the pX459 v2.0 plasmids for 72 hours.

27
4. Results
4.1 Constitutive Expression of EGFR
L858R
in SV40 LT-Transduced AEC-LT14
To study the effect of overexpressing EGFR
L858R
in SV40 LT-transduced AECs, lentiviral
particles were used to integrate EGFR
L858R
expression vector into the genome of AEC-LT14.
LeGO-EGFR
L858R
-iT, the vector with constitutive expression of EGFR
L858R
with tdTOMATO
fluorescent protein expressed through an internal ribosomal entry site (IRES), and control vector
LeGO-iT with only tdTOMATO expression were used to transduced AEC-LT14 at passage 11.
After cells had recovered from infection for 10 days, integration of the coding DNA sequences
(CDS’s) was verified by fluorescence microscopy using TRITC channel for expression of
tdTOMATO. Transduced cells at passage 15 were then FACS sorted (USC Flow Cytometry Core)
into single cells in a 96-well plate and expanded into monoclonal cell lines, AEC-LT14-LeGOiT
or AEC-LT14-EGFR
L858R
(Fig. 8). Both cell lines were at passage 17 when ROCK inhibitor was
removed from tissue culture media and at minimum passage 19 when they were populated enough
for experiments. Since these cell lines were expanded from single cells, each passage is defined as
detachment and reattachment from a smaller-sized well to a bigger well during clonal expansion
up until they were in T25 flasks, then they were split 1:3 each time.

In order to determine the level of transformation in AEC-LT14-EGFR
L858R
after the
expression of EGFR mutant, several features of transformation were characterized.
Figure 8. Cell line derivation scheme of AEC-LT14-LeGOiT/EGFR
L858R
via lentiviral transduction
28
Morphologically, AEC-LT14-EGFR
L858R
cells adopted a more spindle-like structure and were able
to grow on top of each other, compared to AEC-LT14-LeGOiT cells, which forms a monolayer of
cobble stone-shaped cells (Fig. 9). It is worth noting that both cell lines had a significant number
of cells detaching from tissue culture plates
daily. Detached cells did not appear to be
viable, but were collected and kept in
culture and no cell proliferation was seen
in these detached cells from either AEC-
LT14-LeGOiT or AEC-LT14-EGFR
L858R

lines.
Whole cell lysates were collected
from AEC-LT14-LeGOiT and AEC-LT14-EGFR
L858R
using RIPA buffer containing working
concentration of protease and phosphatase inhibitors, after 6 hours of serum starvation to reduce
the effect of growth factors on activation of EGFR downstream pathways. For each cell line,
technical triplicates of either LeGOiT control or EGFR
L858R
overexpression were loaded onto a gel,
and four gels were run in total in order to probe for all of the antibodies that were used. Equal
loading was ensured by Ponceau S staining as well as probing for both Actin and Lamin A/C (Fig.
S1). Phospho-ERK1/2 or AKT band intensity was measured using ImageJ software and
normalized to Actin. Statistical analysis of phospho-protein levels between control and EGFR
L858R

cell lines was done using paired t-test. Western analysis of these lysates (Fig. 10A) showed that
despite the fact that EGFR
L858R
mutant was expressed and EGFR proteins were phosphorylated at
tyrosine-992, phosphorylation level of AKT did not change significantly compared to AEC-LT14-
Figure 9. Brightfield microscopic images of AEC-
LT14-LeGOiT/ EGFRL858R
29
LeGOiT (Fig. 10C). Meanwhile, a significant decrease in phosphorylation level of ERK1/2 was
observed in AEC-LT14-EGFR
L858R
(Fig. 10B),
indicating there was less signaling for the cells to
proliferate through the MAPK pathway. Figure 10A
shows representative images of western blots, but this
downregulation of p-ERK1/2 was observed across two
biological replicates and several technical replicates
(Fig. S2).
To determine the proliferation rate of these cells, 3000 cells of each cell line were plated
in each well of a 24-well plate. Cell numbers in four of the wells were counted using a
hemocytometer every day for 6 days after plating, and each well was counted four times. In line
with what was observed in MAPK pathway activation, AEC-LT14-EGFR
L858R
cells had a
significantly decreased proliferation rate compared to AEC-LT14-LeGOiT after the initial lag
phase (Fig. 11), suggesting that overexpression of a constitutively active EGFR mutant was not
able to increase the proliferation rate of AEC-LT14.
Figure 10. A) Representative western blot showing EGFR
L858R
mutant expression and phosphorylation level
of EGFR, AKT, and ERK1/2 in AEC-LT14-LeGOiT/EGFR
L858R
B) Quantitation of phospho-ERK1/2 level.
Statistical analysis was done using paired t-test (** p<0.01) C) Quantitation of phospho-AKT level. Statistical
analysis was done using paired t-test
30
To determine whether the expression of EGFR
L858R
mutant receptor protein could increase
anchorage independent colony formation efficiency of these AEC-LT14 cell lines, 1500 cells of
each cell line was plated in media with 0.3% noble agarose (for mammalian cell culture) in 6-well
plates containing a layer of 0.6% noble agarose and cell culture media mix. Colony formation
assay showed that both AEC-LT14-LeGOiT and AEC-LT14-EGFR
L858R
lost their ability to form
colonies (Fig. 12), even though their parent cells were shown to form colonies in soft agar (Tran
et al. manuscript in prep).
4.2 Constitutive Expression of EGFR
L858R
in HEK293T and LUAD Cancer Cell Lines
Other than the observation that both cell lines lost their ability to form colonies in soft agar,
it was surprising that overexpression of EGFR
L858R
did not increase the phosphorylation level of
ERK1/2, since an increased level of phospho-EGFR (active EGFR) was observed and ERK1/2 is
a downstream effector of that pathway. In order to verify that the EGFR
L858R
mutant construct that
was used was able to activate downstream pathways correctly, the same lentiviral particles that
were used to transduce AEC-LT14 were used to transduce three different cell lines: HEK293T, a
*
ns
ns
*
****
****
10000
20000
30000
1 2 3 4 5 6
Day
Cell Number
AEC−LT14−EGFRL858R
AEC−LT14−LeGOiT
AEC−LT14−LeGOiT/EGFRL858R Proliferation Assay
Figure 11. Proliferation assay of AEC-LT14-LeGOiT/EGFR
L858R

across 6 days. Statistical analyses were done using paired t-test (*
p<0.05, **** p<0.0001)
Figure 12. Anchorage independent
growth of A549 positive control and
AEC-LT14-LeGOiT/EGFR
L858R
in soft
agar
31
human embryonic kidney cell line that expresses SV40 LT, and A549 and PC9j, both of which are
LUAD cancer cell lines.
In order to determine phosphorylation levels of ERK1/2 and AKT with or without the
expression of EGFR
L858R
in these cell lines, the same western blot analyses were done using whole
cell lysates collected from 293T-ctrl/EGFR
L858R
, A549-ctrl/EGFR
L858R
, and PC9j-ctrl/EGFR
L858R

(Fig. 13A-C). In both 293T and A549 cells, overexpression of EGFR
L858R
mutant did not result in
a significant increase in phospho-ERK or phospho-AKT level (no p-AKT detected in A549) while
an increased phospho-EGFR level was observed (Fig 14A-B). Surprisingly, overexpression of
EGFR
L858R
in PC9j cell line, which has an endogenous activating mutation of EGFR, resulted in
Figure 13. Representative western blot showing EGFR
L858R
mutant expression and phosphorylation level of
EGFR, AKT, and ERK1/2 in A) 293T-CTRL/EGFR
L858R
B) A549-CTRL/EGFR
L858R
C) PC9j-CTRL/EGFR
L858R

32
significantly lower levels of both phospho-ERK and phospho-AKT, even though an increased level
of phospho-EGFR at Tyr-992 was observed (Fig. 14C).

Figure 14. A) Quantitation of phosphorylation level of AKT, and ERK1/2 in 293T-CTRL/EGFR
L858R
.
Statistical analyses were done using paired t-test B) Quantitation of phosphorylation level of ERK1/2 in A549-
CTRL/EGFR
L858R
. Statistical analysis was done using paired t-test C) Quantitation of phosphorylation level of
AKT, and ERK1/2 in PC9-CTRL/EGFR
L858R
. Statistical analyses were done using paired t-test (* p<0.05, **
p<0.01)

33
4.3 Doxycycline-Inducible EGFRL858R Expression in AEC-ROCK14 Transduced
Simultaneously with SV40 LT, hTERT, and pSLIK-EGFR
L858R
iT
With the observations seen in AEC-LT14 transduced with LeGO-iT or LeGO-EGFR
L858R
-
iT, three hypotheses were proposed for possible lack of exhibition of transformed characteristics
in AEC-LT14 cells: 1) constitutive overexpression of EGFR
L858R
leads to oncogene-induced
senescence; 2) lack of telomerase activity triggered proliferative senescence; 3) secondary
lentiviral transduction caused adverse effects on AEC-LT14, which had already been infected by
lentivirus once before. To address these issues, three lentiviruses, pSLIK-EGFR
L858R
iT, LeGO-
SV40-iG, and LeGO-hTERT-iT, were used simultaneously to transduce AEC-ROCK14, the
precursor of AEC-LT14, in order to bypass a secondary lentiviral transduction, introduce
telomerase activity and control of EGFR
L858R
expression (Fig. 15). The resulting cells were named
AEC-SHE14 and selected for hygromycin resistance conferred by pSLIK-EGFR
L858R
iT then
sorted into 96-well plates by both GFP and tdTOMOTO expression, conferred by LeGO-SV40-iG
and LeGO-hTERT-iT respectively, for monoclonal expansion.
The tet-on system is an inducible gene expression system using an inactive promoter
controlled by a tetracycline response element (TRE). With the addition of tetracycline or its
derivative doxycycline, the transactivator of TRE (rtTA) can bind to TRE and activate
transcription of a TRE-controlled gene
52
(Figure 16A). To verify that EGFR
L858R
expression was
Figure 14. Quantitation of phospho-ERK1/2 and phospho-AKT levels ) in
A) 293T-CTRL/EGFR
L858R
B) A549-CTRL/EGFR
L858R
C) PC9j-
CTRL/EGFR
L858R
. Statistical analyses were done using paired t-test (*
p<0.05, ** p<0.01)
Figure 15. Cell line derivation scheme of AEC-SHE14 via lentiviral transduction
34
under TRE control and responsive to doxycycline, 293T cells were transfected with pSLIK-
EGFR
L858R
iT or pSLIK-iT plasmids and cultured in cell culture media containing tetracycline-free
FBS and an increasing dosage of doxycycline. Whole cell lysates from these cells were then
collected for western blot, which showed low expression of EGFR
L858R
in the absence of
doxycycline but increasing EGFR
L858R
expression with increasing doxycycline concentration (Fig.
16B), suggesting that the TRE is responsive to doxycycline, but leaky under the conditions of this
experiment.
However, western blots of lysates from 7 different clones of AEC-SHE14 showed no
expression of EGFR
L858R
protein (Fig. 17A). It was stipulated that the TRE and its controlled
promoter was silenced and lost its inducibility during prolonged culturing without the addition of
doxycycline, which has been documented in mammary epithelial cells
52
. Therefore, two polyclonal
Figure 16. A) Schematic of dox-inducible pSLIK-EGFR
L858R
iT B) Western blot showing EGFR
L858R
mutant
expression in response to increasing dosage of doxycycline in 293T cells transfected with pSLIK-
EGFR
L858R
iT or control pSLIK-iT
35
AEC-SHE14 cell collections were thawed out and cultured in media containing hygromycin with
or without the presence of doxycycline: AEC-SHE14 25+10+10, which is the cell population prior
to FACS sorting and may contain uninfected cells, but is the population immediately after lentiviral
transduction; and AEC-SHE14 ++, which is a population of cells that were FACS sorted but at an
earlier passage than monoclonal cell lines of AEC-SHE14. Neither of the cell populations showed
EGFR
L858R
protein expression on western blots (Fig. 17B). In addition, different concentrations of
doxycycline were used to treat AEC-SHE14 polyclonal cells but were not able to induce
EGFR
L858R
protein expression (Fig. 17C). Furthermore, mRNA levels of rtTA and EGFR were
measured by qRT-PCR. It was shown that rtTA was expressed in AEC-SHE14 with or without the
addition of doxycycline, but EGFR mRNA level did not respond to doxycycline treatment (Fig.
18A-B), ruling out the possibilities that the lack of rtTA expression or EGFR mRNA translation
were causing problems for EGFR
L858R
inducibility.
Figure 17. A) Western blot showing EGFR
L858R
mutant expression with or without doxycycline (0.8 µg/ml)
in AEC-SHE14 monoclonal cell lines B) Western blot showing EGFR
L858R
mutant expression with or
without doxycycline (0.8 µg/ml) in earlier passage AEC-SHE14 polyclonal cells C) Western blot showing
EGFR
L858R
mutant expression with increasing dosage of doxycycline in AEC-SHE14 polyclonal cells
36
4.4 Attempts to Deliver CRISPR/Cas9 System in AEC-LT+hTERT14 to Directly Edit EGFR
in its Genomic Context
In addition to using lentiviruses, attempts to use the CRISPR/Cas9 genome editing system
to edit EGFR exon 21 in its genomic context were made in order to minimize integration of
lentiviral genomes and preserve the endogenous expression level of EGFR in AEC-LT+hTERT14,
an AEC cell line that was immortalized with both SV40 LT and hTERT. The Cas9 nuclease is part
of the clustered regularly interspaced short palindromic repeats (CRISPR) microbial adaptive
immune system. The RNA-guided nuclease has been utilized to engineer eukaryotic genomes, by
complexing the Cas9 protein with a guide RNA (gRNA) and trans-activating CRISPR RNA
(tracrRNA). The Cas9-RNA ribonucleoprotein (RNP) can then be directed to different genomic
loci based on the sequence of the gRNA. The S. pyogenes-derived Cas9 nuclease can introduce a
double-stranded break (DSB) in the DNA that is complementary to the gRNA and immediately
followed by a 5’-NGG protospacer adjacent motif (PAM). The DSB can then be repaired by the
cellular DNA damage repair systems, such as non-homologous end joining (NHEJ) or homology-
directed repair (HDR), resulting in nucleotide deletion, insertion, or substitution at the target site
53
.
Figure 18. RT-qPCR results showing RNA levels of A) rtTA and B) EGFR in AEC-SHE14 polyclonal
cells with or without doxycyline (0.8 µg/ml). Statistical analyses were done using one-way ANOVA (*
p<0.05, ** p<0.01). p values were adjusted using Bonferroni correction for multiple comparisons
37
Here, attempts were made to introduce Cas9 protein and target it near the EGFR
L858R
mutation site
in immortalized AECs using single-guide RNAs (sgRNAs) containing both gRNA and tracrRNA.
A single-stranded donor oligonucleotide (ssODN) was used in combination with the RNP to
introduce T to G transversion via HDR at EGFR nucleotide position 2573. A synonymous mutation
at nucleotide position 2574 (G->C) to create an AscI restriction site, which can be used to verify
editing on an agarose gel using PCR amplified and AscI digested EGFR exon 21. In addition, a
synonymous mutation was introduced at the PAM site to prevent recutting by Cas9 (Fig. 19).

Previously, it was shown in our lab that AECs are resistant to plasmid transfection methods
using standard reagents such as Lipofectamine (Unpublished). Since genome editing via HDR has
a low efficiency and thus requires a large number of cells for screening, a more potent plasmid
delivery method is needed to effectively deliver DNA coding for Cas9 and sgRNA, as well as
ssODN, into these AECs. First, nucleofection technology by Lonza was used to deliver plasmids
Figure 19. Schematic of using Cas9-gRNA RNP and ssODN to introduce EGFR
L858R
mutation whilst
creating an AscI restriction site for HDR verification and destroying PAM site to prevent recutting
38
directly into the nuclei of AEC-LT14 or AEC-LT+hTERT14 cells. To optimize conditions for
nucleofection in our cells, pmaxGFP plasmid supplied by the nucleofection kit was nucleofected
into AEC-LT14 using different recommended programs. Brightfield and FITC fluorescent images
were taken to determine nucleofection efficiency and cell viability with each program (Fig. 20A),
after which program T-20 was chosen to deliver pX459 v2.0 plasmid, which expresses sgRNA
targeting EGFR exon 21 and Cas9 protein, and confers puromycin resistance. An ssODN was co-
transfected for HDR. Twenty-four hours after nucleofection, cells were placed under 1.5 µg/ml
puromycin selective pressure. This concentration had been pre-determined to be the minimal
concentration needed to kill non-resistant AEC-LT14 cells in 48 hours. However, after 48 hours
of puromycin selection, none of the nucleofected cells survived. In order to directly assess the
nucleofection efficiency of plasmids coding for Cas9 and gRNA expression, pX458 plasmid,
which is identical to pX459 v2.0 with the exception of GFP expression instead of conferring
puromycin resistance, was used in nuclefection reactions of AEC-LT14. After 48 hours of
nucleofection, brightfield and FITC fluorescent images were taken to determine the nucleofection
efficiency (Fig. 20B). None of the cells had increased GFP expression, suggesting that pX458
plasmid was not delivered via nucleofection using program T-20. Even though pmaxGFP plasmid
(~3.5 kb) had a high nucleofection efficiency in AEC-LT14 cells, pX458 plasmid (~10 kb) was
not able to be delivered using the same program, indicating that the size of pX458 plasmid may be
hindering its entry into AEC-LT14.
39
In addition to expressing Cas9 and sgRNA via plasmids in cells, pre-assembled Cas9-
sgRNA RNPs can also be used to perform genome editing. To determine whether Cas9 protein
can be delivered into AEC-LT+hTERT14 cells using nucleofection, 10 µg of Cas9 protein were
nucleofected along with 1 µg of pmaxGFP to estimate the nucleofection efficiency, using a
Figure 20. A) Fluorescent and brightfield images of AEC-LT14 after nucleofection of pmaxGFP using different
programs B) Fluorescent and brightfield images of AEC-LT14 after nucleofection of pX458 plasmid with
program T-20 C) Fluorescent images of AEC-LT+hTERT14 after nucleofection of Cas9 protein with pmaxGFP
plasmid using program T-30 D) Western blot for His-tagged Cas9 protein from cells in C
40
stronger program, T-30. In the nucleofection reaction without Cas9 protein, a very high
nucleofection efficiency of pmaxGFP only was observed. However, the efficiency decreased
drastically when Cas9 protein was co-nucleofected (Fig. 20C). Furthermore, western blot of Cas9
protein, which contains a his-tag, showed that Cas9 was absent in cell lysates collected from these
nucleofected cells (Fig. 20D).
Since nucleofection did not seem to have delivered either Cas9 plasmids or protein, a
different approach was tried to deliver these elements into our immortalized AECs. Biophotonic
Laser Assisted Surgery Tool (BLAST) is a tool that creates micro-cavitation bubbles that are able
to disrupt the adjacent plasma membrane upon explosion, delivering cargos of various sizes into
cells
51
. BLAST experiments were optimized and performed by Dr. Alexander Patananan (Teitell
Lab) at UCLA using AEC-LT+hTERT14 and pX459 v2.0 plasmid. After BLAST transfer, cells
were transferred back to our lab and put under 1.5 µg/ml puromycin selection pressure. Brightfield
Figure 21. A) AEC-LT+hTERT14C7 post-BLAST transfer of pX459 v2.0 plasmid and pre-puromycin selection B)
AEC-LT+hTERT14C7 post-BLAST transfer of pX459 v2.0 plasmid and B) 24 hours C) 48 hours D) 72 hours
post-puromycin selection (1.5 µg/ml)
41
images of BLAST transferred cells were taken before and after puromycin selection (Fig. 21A-D).
Within 48 hours of puromycin selection, most of the cells that were supposed to receive the
plasmid died (Fig. 21C), similar to cells that did not receive the plasmid, and within 72 hours, all
of the cells had died regardless of whether they received the plasmids conferring puromycin
resistance (Fig. 21D).

42
5. Discussion & Future Directions
To better understand disease initiation and progression of LUAD, our lab proposed to
introduce different onco-drivers in AECs purified and immortalized from normal lung tissues. Our
objective was to test whether they are sufficient to cause tumor transformation, and if so, how they
are driving this process. To verify that AECs transduced with SV40 LT can be further transformed,
a known oncogene, EGFR
L858R
, was introduced in AEC-LT14 via a secondary lentiviral
transduction. EGFR is one of the most frequently altered genes found in LUAD, and EGFR
L858R

constitutes about 40-45% of these EGFR mutations
26
. Numerous studies involving EGFR
mutations have shown that LUAD patient tumor samples expressing EGFR mutant receptors have
constitutive upregulation of cell proliferation and survival pathways
42,43
. These EGFR mutants also
have the potential to drive cell transformation in vitro
25,31
. They have also been shown to be one
of the earliest events occurring in lung tumorigenesis in the Asian population
32
, underlining their
potency as a oncogenic driver. Based on these observations, we hypothesized that overexpressing
EGFR
L858R
mutant is sufficient to further drive cell transformation in AEC-LT14 cells, which
retain fairly normal AEC characteristics, despite their ability to proliferate in culture (Tran et al.
Manuscript in prep).
With the overexpression of EGFR
L858R
, these SV40 LT transduced AECs were expected to
show a more transformed phenotype: upregulation of proliferation and survival pathways, increase
in proliferation rate, decrease in anchorage dependence for growth, etc. Western blot showed that
EGFR
L858R
is expressed in AEC-LT14-EGFR
L858R
, using a mutant specific antibody. However,
AEC-LT14-EGFR
L858R
cell lines show significantly decreased phospho-ERK1/2 levels compared
to AEC-LT14-LeGOiT, suggesting that the cell proliferation pathway is downregulated in AEC-
LT14-EGFR
L858R
. This is supported by their significantly lower proliferation rate. Meanwhile, no
43
significant difference was observed in phospho-AKT levels, indicating that this cell survival
pathway is not affected by expression of EGFR mutant receptors in these cells. These observations
were made in multiple biological and technical replicates (Fig. S2). In order to verify that the
EGFR
L858R
mutant receptor expressed through this construct is activatable in the absence of its
ligand EGF, a phospho-EGFR specific antibody was used for western blot. This showed that when
EGFR
L858R
was expressed, there was an increase in the phophorylation level of EGFR Tyr992, one
of the autophosphorylation sites that responds to this specific mutation
31
. This suggests that our
EGFR
L858R
construct is functional and the observed phospho-levels of ERK1/2 and AKT may be
affected by other elements involved in EGFR signaling or trafficking.
Similarly, overexpression of the same EGFR
L858R
construct in 293T cells, which express
SV40 LT, and A549 LUAD cancer cell line resulted in increased phosphorylation of Tyr992 of
EGFR, but not significantly increased phosphorylation of ERK1/2 or AKT. This further verified
that this EGFR mutant receptor is capable of being autophosphorylated independent of ligand
binding and yet is not able to activate downstream signaling. Notably, overexpression of
EGFR
L858R
in the PC9j cell line, which has an endogenous activating mutation of EGFR (exon 19
deletion), showed significantly reduced phospho-ERK1/2 and AKT levels on western blots, even
though this cell line has a genetic background that is potentially more conducive to responding to
an activating EGFR mutant. Here too, a significant increase in EGFR Tyr992 phosphorylation was
observed, again implying that downregulations of ERK1/2 and AKT pathway activation involve
other parts of EGFR signaling or trafficking.
EGFR signaling pathways to activate ERK1/2 or AKT are complicated and riddled with
feedback inhibitions
54-56
. These inhibitions can occur at multiple levels, such as through the ERRB
receptor feedback inhibitor 1 (ERRFI1), which inhibits EGFR when it is highly expressed
54
, and
44
various phosphatases that downregulate ERK1/2 or AKT activation, including phosphatase and
tensin homolog (PTEN), protein phosphatase 2A (PP2A), and MAPK phosphatases (MKPs)
56,57
.
Moreover, active ERK itself has been shown to inhibit SOS, RAF, and PI3K, which are upstream
of ERK1/2 and AKT phosphorylation
58
(Fig. 22). In the case of AEC-LT14, since these cells were
derived from normal AECs, their cellular feedback mechanisms may still be intact and able to
temper the increased EGFR activity. To further investigate where the downregulation of these
pathways occurs, one can probe for expression or activation of effectors upstream of ERK1/2 or
AKT, stimulatory or inhibitory, such as p-MEK or PTEN, via western blots or RT-qPCR.

Figure 22. RTK/RAF/RAS and PI3K/AKT signaling pathways and some examples of cellular mechanisms
to inhibit activation of these pathways
45
If the effects of an activating EGFR mutation can be mitigated, then simply introducing an
EGFR mutant in cells with a normal genetic background may not be sufficient to transform the
cells, and other factors may be required for EGFR to assume its role as an onco-driver. It has been
shown that singly mutated EGFR
L858R
is able to transform NIH3T3, a mouse fibroblast cell line
that is readily transformed, but not immortalized HBECs, which are more relevant to human lung
cancer development
31
. This observation supports the hypothesis that factors other than EGFR
L858R
may be needed to further transform immortalized AECs. Additionally, researchers have only had
success in transforming HBECs with KRAS in combination with other oncogenes such as c-Myc
or prolonged CSC treatment, but not KRAS alone
25,39
, indicating single driver mutations may not
be sufficient to drive cells with a normal genetic background to malignancy. They may even drive
cells without a conducive background to senescence or apoptosis. To further test this hypothesis,
other genetic perturbations can be introduced alongside with this EGFR mutant to see whether the
additional changes can make cells permissive for transformation.
Another possibility to explain why the EGFR mutant is autophosphorylated at tyrosine 992
but not able to activate downstream signaling pathways is that this mutant receptor is not able to
bind to adaptor proteins such as GRB2 or SOS, which are important in bridging phospho-EGFR
to RAS or PI3K (Fig. 22). This could be a result of improper tyrosine phosphorylation within the
C-terminal domain of EGFR. It is thought that the position or even sequence of tyrosine residue
phosphorylation is important in receptor tyrosine kinase activation
58
. Furthermore,
phosphorylation of different tyrosine residues has been shown to regulate specific signaling
pathways
59,60
. Even though increased EGFR Tyr992 phosphorylation is observed with active
L858R mutant
31
, it does not necessarily mean it is responsible for the activation of downstream
ERK and AKT pathways. As a result, I propose to examine the phosphorylation statuses of
46
different EGFR tyrosine residues to ensure that the important ones associated with activation of
ERK1/2 and AKT pathways, such as Tyr 1068 and 1086
59
, are phosphorylated, by immunoblotting
using antibodies specific to EGFR phosphorylated at those tyrosine residues. In addition, we can
also verify the interactions between EGFR and adaptor proteins by co-immunoprecipitation (IP)
of either EGFR or GRB2/SOS.
Furthermore, dimerization and phosphorylation of EGFR are not necessarily indicative of
activation of downstream signaling pathways. One group in Japan has shown that monoclonal
antibodies to EGFR such as Cetuximab can induce EGFR receptor dimerization and
phosphorylation, but not ERK or AKT pathways
61
. Recently, another group has shown that
dimerized and autophosphorylated EGFR receptors are not sufficient to activate RAS. They
observed that clustering of phospho-EGFR oligomers, which is driven by EGF, is required in order
to activate RAS activity and propagate downstream signaling
62
. Thus, I would also like to
investigate activation status of RAS in AEC-LT14-EGFR
L858R
compared to AEC-LT14-LeGOiT
using RAS-GTP pulldown assay, which enriches and detects active RAS-GTP with glutathione
agarose resin-tagged RAF1 RAS binding domain. In addition, I believe IF staining of EGFR
L858R

in AEC-LT14-EGFR
L858R
cells, cultured with or without EGF, would also yield useful information
on receptor localization and distribution.
Last but not least, it is also possible that the cell lines used, either cancer cell lines or cells
expressing SV40 LT, already have high levels of signaling pathway activation, making it difficult
to detect changes in phosphorylation levels caused by EGFR
L858R
activation. As a matter of fact,
we do observe a marginal, but not statistically significant, increase in phospho-ERK1/2 levels in
293T and A549 cell lines with EGFR
L858R
overexpression (p = 0.063 and 0.069 respectively, using
paired t-test. a = 0.05).
47
One unexpected behavior we observed in both AEC-LT14-LeGOiT and AEC-LT14-
EGFR
L858R
is that they lost the ability to form colonies in soft agar, which their parental cell line
AEC-LT14 is capable of. This cannot be fully explained by the expression of EGFR mutant, since
AEC-LT14-LeGOiT, which does not express EGFR
L858R
, also exhibits this behavior. A possible
explanation came to light when we found that AEC-LT14 cells lack telomerase activity (Fig. 7B).
Combined with the observation that colony formation efficiency for AEC-LT14 drastically
decreases with increased passage number, it was hypothesized that the lack of telomerase activity
contributed to the deficiency in soft agar colony formation in AEC-LT14-LeGOiT/EGFR
L858R
,
since these cells had been in culture for a prolonged period due to clonal expansion.
To introduce telomerase activity, control EGFR
L858R
mutant expression, and minimize
lentiviral transduction, three different lentiviral particles containing SV40 LT-iG, hTERT-iT, and
a doxycycline-inducible EGFR
L858R
(pSLIK-EGFR
L858R
iT) expression constructs were used to
simultaneously transduce AEC-ROCK14, the non-immortalized AECs that have limited
proliferation capacity in cell culture media containing ROCK inhibitor. Transduced cells were
selected and maintained in media containing hygromycin and then FACS sorted for both GFP and
tdTOMATO. These hygromycin-resistant, GFP- and tdTOMATO-positive cells were then
expanded from single cells for monoclonal cell lines, AEC-SHE14.
Unfortunately, when doxycycline was added to cell culture media to induce EGFR
L858R

expression, immunoblotting showed no EGFR mutant expression in any of the independent clones.
To exclude technical issues, the functionality of pSLIK-EGFR
L858R
iT was verified by transfecting
this construct in 293T cells and treating them with increasing doses of doxycycline. EGFR
L858R

expression was induced dose-dependently. In addition, mRNA for transactivator of TRE (rtTA)
was detected in AEC-SHE14 via RT-qPCR, ruling out the possibility that the lack of rtTA
48
expression is causing problems. These cells are also hygromycin resistant, which is conferred
through the same promoter as rtTA. Furthermore, the uninducible EGFR
L858R
is also not a result
of a defect in translation, since there is no significant EGFR mRNA increase in AEC-SHE14
treated with doxycycline versus AEC-SHE14 without doxycycline, or AEC-LT+hTERT14, an
AEC cell line that has both SV40 LT and hTERT expression, but no inducible EGFR
L858R
. These
observations imply that the issue is at the transcriptional level.
It has been documented in the literature that TRE and its controlled promoter can be
inactivated by either methylation or histone deacetylation if doxycycline is not present in culture
media for an extended period of time
52
. However, two of the earliest passage cell populations
available (about 14 days post-transduction) do not show any EGFR mutant inducibility either. In
addition, treating these cells with different concentrations of doxycycline was not effective either
in inducing EGFR
L858R
expression. Thus, I conclude that the tet-on system is incompatible with
AECs, likely due to possibly early promoter inactivation. While epigenetic inhibitors or
demethylating agents might be considered to reverse possible epigenetic inactivation, such
globally acting agents would likely cause broad epigenetic changes in the cells, which would
confound any downstream observations.
In addition to using lentiviral particles to overexpress EGFR
L858R
, I attempted to use the
CRISPR/Cas9 genome editing system to introduce the EGFR
L858R
mutation in its genomic context.
Since it was previously shown that AEC-LT14 cells are resistant to chemical transfection, I tried
to use nucleofection, a form of electroporation, to deliver the pX459 v2.0 plasmid, which expresses
Cas9 protein and sgRNA, and confers puromycin resistance. First, I optimized nucleofection
conditions for AEC-LT14 using pmaxGFP, a ~3.5kb plasmid supplied by Lonza that encodes GFP
expression. Brightfield and FTIC channel images of AEC-LT14 cells after nucleofection were
49
taken and compared to those that were not nucleofected. Based on the number of cells that survived
and expressed GFP, program T-20 was determined to be optimal. However, after using this
program to deliver the pX459 v2.0 plasmid, none of the cells survived under puromycin selection.
It was suspected that the size of this plasmid, which is about 10kb, hindered its delivery into cells.
To test this, the plasmid pX458, a plasmid similar in size that expresses Cas9, sgRNA, and GFP
was used for nucleofection, and none of the nucleofected cells showed increased GFP expression.
It is interesting that these immortalized AECs were able to take up the pmaxGFP plasmid
but not pX458 or px459 v2.0 plasmids. Similarly, I have attempted to nucleofect plasmids with
sizes ranging from 5 to 13kb into AEC-LT14 with no avail. I hypothesize that there is a plasmid
size limit to which these cells can be nucleofected. In order to determine the plasmid size limit, I
propose to engineer plasmids with incrementally increasing sizes using the pmaxGFP plasmid and
nucleofect them into immortalized AECs and check for nucleofection efficiency via GFP
expression.
Next, instead of using plasmids, Cas9 protein delivery was attempted using nucleofection
program T-30, a stronger program than T-20 (program specs are proprietary to Lonza). The
plasmid pmaxGFP was co-nucleofected as an indicator for nucleofection efficiency. It was noted
that when Cas9 protein was added to the nucleofection mixture, nucleofection efficiency
drastically decreased compared to pmaxGFP alone, shown by fluorescent images. In addition, cell
lysates collected from nucleofected cells did not show the presence of Cas9 protein, suggesting
that Cas9 protein was not able to be nucleofected into AECs.
Further attempts to deliver the px459 v2.0 plasmid into AECs were done using Biophotonic
Laser Assisted Surgery Tool (BLAST) by Dr. Alexander Patananan (Dr. Michael Teitell lab) from
UCLA. After the procedure, BLAST transferred cells were put under puromycin selection for 72
50
hours. Most cells did not survive after the first 48 hours, and all of them died after 72 hours under
selective pressure. This suggests that the px459 v2.0 plasmid was not delivered into AECs using
BLAST. With multiple attempts to deliver plasmids encoding Cas9 protein, or Cas9 protein itself
failed, delivering exogenous material into AECs is clearly very challenging, possibly due to its
alveolar epithelial nature and its natural resistance to pathogens. Further optimization will be
needed to deliver CRISPR/Cas9 elements into these AECs. Perhaps we can segregate the pX459
v2.0 plasmid into smaller plasmids that separately encode gRNA and Cas9 expression, or a smaller
version of Cas9. Alternatively, we can utilize adenoviruses or adeno-associated viruses (AAVs) to
package gRNA and Cas9 coding sequences and transiently express them in cells to achieve
genome editing.
Overall, I believe the results from overexpressing EGFR
L858R
in immortalized AECs is
inconclusive. It is possible that simply overexpressing this mutant is not sufficient to drive
malignant transformation of immortalized AECs, but various technical challenges also hindered
us from drawing that conclusion. First of all, the mutant construct used showed promising
autophosphorylation, but failed to activate downstream signaling pathways in multiple cell lines.
This could be technical due to genomic instability caused by using lentiviruses, but also biological,
in that this mutant may not be processed correctly post-translationally or certain cells may still
retain feedback mechanisms to resist changes from overactive signaling pathways. It is also
possible that our observations are due to senescence caused by either lack of telomerase activity
or overexpression of an oncogene. Further experiments are needed for us to draw a conclusion,
such as investigating signaling pathways each step along the way or establishing a better model to
reduce certain technical issues. For example, the use of SV40 LT is a big concern since the viral
oncoprotein itself is fairly transformative, but it is needed for the cells to proliferate well. One
51
possible solution would be to introduce CRE-inactivatable SV40 LT, so that we can remove SV40
LT expression once an oncogene like KRAS is introduced, to study its transforming effect without
SV40 LT interfering in the background. Furthermore, if we could further optimize the delivery of
CRISPR/Cas9 system, we can potentially bypass the use of SV40 LT to immortalize AECs by
permanently knocking out TP53 and RB1 in the genome, as well as introducing oncogenic
mutations in their genomic context for a “natural” expression level. An added benefit of this
strategy would be reduced integration of lentiviral genomes.
On the other hand, if it can be determined that the overexpression of EGFR
L858R
, a
universally recognized oncogenic driver, is not sufficient to drive transformation of AECs, it would
raise further questions on how we define a driver mutation, the roles of so-called passenger
mutations, and whether genetic backgrounds such as gender or racial differences play a role in
how transformative a mutation is. Investigation of these questions is potentially achievable, with
a better-defined immortalized AEC system, and a collection of samples with multiethnic
backgrounds. Once a proper method has been established, we can also investigate less-known
mutations that are found in LUAD. The observation that AEC-LT14 cells can form organoids in
3-dimensional culture in Matrigel (Tran et al. manuscript in prep) suggests that it would also be of
great interest to study disease progression using organoids. Such organoids carrying activated
oncogenes could also be used to study the development of resistance to drugs. Further refinement
of this immortalized AEC system can result in a powerful tool to help us understand different
aspects of LUAD disease initiation and progression.

52
6. Supplementary Figures

Figure S1. A) Ponceau S staining of PVDF
membrane showing that loading is roughly equal
across wells B) Representative western blot images
of lamin A/C and actin showing that loading is
roughly equal across wells
Figure S2. Western blot technical replicates
showing EGFR
L858R
mutant expression and
phosphorylation level of AKT and ERK1/2 in
biological replicates of AEC-LT14-
LeGOiT/EGFR
L858R

53

7. References
1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69(1):7-
34.
2. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics
2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185
countries. CA Cancer J Clin. 2018;68(6):394-424.
3. Torre LA, Siegel RL, Jemal A. Lung Cancer Statistics. Adv Exp Med Biol. 2016;893:1-19.
4. Pfeifer GP, Denissenko MF, Olivier M, Tretyakova N, Hecht SS, Hainaut P. Tobacco
smoke carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene.
2002;21(48):7435-7451.
5. Gibbons DL, Byers LA, Kurie JM. Smoking, p53 mutation, and lung cancer. Mol Cancer
Res. 2014;12(1):3-13.
6. Govindan R, Ding L, Griffith M, et al. Genomic landscape of non-small cell lung cancer
in smokers and never-smokers. Cell. 2012;150(6):1121-1134.
7. Hosgood HD, Pao W, Rothman N, et al. Driver mutations among never smoking female
lung cancer tissues in China identify unique EGFR and KRAS mutation pattern associated with
household coal burning. Respir Med. 2013;107(11):1755-1762.
8. Blandin Knight S, Crosbie PA, Balata H, Chudziak J, Hussell T, Dive C. Progress and
prospects of early detection in lung cancer. Open Biol. 2017;7(9).
9. Provencio M, Isla D, Sánchez A, Cantos B. Inoperable stage III non-small cell lung cancer:
Current treatment and role of vinorelbine. J Thorac Dis. 2011;3(3):197-204.
10. Majem M, Juan O, Insa A, et al. SEOM clinical guidelines for the treatment of non-small
cell lung cancer (2018). Clin Transl Oncol. 2019;21(1):3-17.
54
11. Mitsudomi T. Advances in target therapy for lung cancer. Jpn J Clin Oncol.
2010;40(2):101-106.
12. Inamura K. Lung Cancer: Understanding Its Molecular Pathology and the 2015 WHO
Classification. Front Oncol. 2017;7:193.
13. Network CGAR. Comprehensive molecular profiling of lung adenocarcinoma. Nature.
2014;511(7511):543-550.
14. Myers D, Wallen J. Cancer, Lung Adenocarcinoma. In. StatPearls [Internet]: Treasure
Island (FL): StatPearls Publishing; [Updated 2019 Jan 11].
15. Xu X, Rock JR, Lu Y, et al. Evidence for type II cells as cells of origin of K-Ras-induced
distal lung adenocarcinoma. Proc Natl Acad Sci U S A. 2012;109(13):4910-4915.
16. Chen Z, Fillmore CM, Hammerman PS, Kim CF, Wong KK. Non-small-cell lung cancers:
a heterogeneous set of diseases. Nat Rev Cancer. 2014;14(8):535-546.
17. Kumarakulasinghe NB, van Zanwijk N, Soo RA. Molecular targeted therapy in the
treatment of advanced stage non-small cell lung cancer (NSCLC). Respirology. 2015;20(3):370-
378.
18. Saito M, Suzuki H, Kono K, Takenoshita S, Kohno T. Treatment of lung adenocarcinoma
by molecular-targeted therapy and immunotherapy. Surg Today. 2018;48(1):1-8.
19. Imielinski M, Berger AH, Hammerman PS, et al. Mapping the hallmarks of lung
adenocarcinoma with massively parallel sequencing. Cell. 2012;150(6):1107-1120.
20. Campbell JD, Alexandrov A, Kim J, et al. Distinct patterns of somatic genome alterations
in lung adenocarcinomas and squamous cell carcinomas. Nat Genet. 2016;48(6):607-616.
21. Schafer KA. The cell cycle: a review. Vet Pathol. 1998;35(6):461-478.
55
22. Martin LG, Demers GW, Galloway DA. Disruption of the G1/S transition in human
papillomavirus type 16 E7-expressing human cells is associated with altered regulation of cyclin
E. J Virol. 1998;72(2):975-985.
23. Molina JR, Adjei AA. The Ras/Raf/MAPK pathway. J Thorac Oncol. 2006;1(1):7-9.
24. Santarpia L, Lippman SM, El-Naggar AK. Targeting the MAPK-RAS-RAF signaling
pathway in cancer therapy. Expert Opin Ther Targets. 2012;16(1):103-119.
25. Sato M, Larsen JE, Lee W, et al. Human lung epithelial cells progressed to malignancy
through specific oncogenic manipulations. Mol Cancer Res. 2013;11(6):638-650.
26. Calvayrac O, Pradines A, Pons E, Mazières J, Guibert N. Molecular biomarkers for lung
adenocarcinoma. Eur Respir J. 2017;49(4).
27. An SJ, Chen ZH, Su J, et al. Identification of enriched driver gene alterations in subgroups
of non-small cell lung cancer patients based on histology and smoking status. PLoS One.
2012;7(6):e40109.
28. Schneeberger VE, Ren Y, Luetteke N, et al. Inhibition of Shp2 suppresses mutant EGFR-
induced lung tumors in transgenic mouse model of lung adenocarcinoma. Oncotarget.
2015;6(8):6191-6202.
29. Siegelin MD, Borczuk AC. Epidermal growth factor receptor mutations in lung
adenocarcinoma. Lab Invest. 2014;94(2):129-137.
30. Sharma SV, Bell DW, Settleman J, Haber DA. Epidermal growth factor receptor mutations
in lung cancer. Nat Rev Cancer. 2007;7(3):169-181.
31. Godin-Heymann N, Bryant I, Rivera MN, et al. Oncogenic activity of epidermal growth
factor receptor kinase mutant alleles is enhanced by the T790M drug resistance mutation. Cancer
Res. 2007;67(15):7319-7326.
56
32. Nahar R, Zhai W, Zhang T, et al. Elucidating the genomic architecture of Asian EGFR-
mutant lung adenocarcinoma through multi-region exome sequencing. Nat Commun.
2018;9(1):216.
33. Greulich H, Chen TH, Feng W, et al. Oncogenic transformation by inhibitor-sensitive and
-resistant EGFR mutants. PLoS Med. 2005;2(11):e313.
34. Ji H, Li D, Chen L, et al. The impact of human EGFR kinase domain mutations on lung
tumorigenesis and in vivo sensitivity to EGFR-targeted therapies. Cancer Cell. 2006;9(6):485-495.
35. Politi K, Zakowski MF, Fan PD, Schonfeld EA, Pao W, Varmus HE. Lung
adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond
to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev. 2006;20(11):1496-
1510.
36. Popper HH, Ryska A, Tímár J, Olszewski W. Molecular testing in lung cancer in the era
of precision medicine. Transl Lung Cancer Res. 2014;3(5):291-300.
37. Red Brewer M, Yun CH, Lai D, Lemmon MA, Eck MJ, Pao W. Mechanism for activation
of mutated epidermal growth factor receptors in lung cancer. Proc Natl Acad Sci U S A.
2013;110(38):E3595-3604.
38. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell.
2011;144(5):646-674.
39. Vaz M, Hwang SY, Kagiampakis I, et al. Chronic Cigarette Smoke-Induced Epigenomic
Changes Precede Sensitization of Bronchial Epithelial Cells to Single-Step Transformation by
KRAS Mutations. Cancer Cell. 2017;32(3):360-376.e366.
40. Mender I, Shay JW. Telomerase Repeated Amplification Protocol (TRAP). Bio Protoc.
2015;5(22).
57
41. Cooper CS, Tempest PR, Beckman MP, Heldin CH, Brookes P. Amplification and
overexpression of the met gene in spontaneously transformed NIH3T3 mouse fibroblasts. EMBO
J. 1986;5(10):2623-2628.
42. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor
receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med.
2004;350(21):2129-2139.
43. Paez JG, Jänne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical
response to gefitinib therapy. Science. 2004;304(5676):1497-1500.
44. Tracy S, Mukohara T, Hansen M, Meyerson M, Johnson BE, Jänne PA. Gefitinib induces
apoptosis in the EGFRL858R non-small-cell lung cancer cell line H3255. Cancer Res.
2004;64(20):7241-7244.
45. Tsai MF, Chang TH, Wu SG, et al. EGFR-L858R mutant enhances lung adenocarcinoma
cell invasive ability and promotes malignant pleural effusion formation through activation of the
CXCL12-CXCR4 pathway. Sci Rep. 2015;5:13574.
46. Sato M, Vaughan MB, Girard L, et al. Multiple oncogenic changes (K-RAS(V12), p53
knockdown, mutant EGFRs, p16 bypass, telomerase) are not sufficient to confer a full malignant
phenotype on human bronchial epithelial cells. Cancer Res. 2006;66(4):2116-2128.
47. Ramirez RD, Sheridan S, Girard L, et al. Immortalization of human bronchial epithelial
cells in the absence of viral oncoproteins. Cancer Res. 2004;64(24):9027-9034.
48. Ali SH, DeCaprio JA. Cellular transformation by SV40 large T antigen: interaction with
host proteins. Semin Cancer Biol. 2001;11(1):15-23.
58
49. Park YH, Kim D, Dai J, Zhang Z. Human bronchial epithelial BEAS-2B cells, an
appropriate in vitro model to study heavy metals induced carcinogenesis. Toxicol Appl Pharmacol.
2015;287(3):240-245.
50. Chandeck C, Mooi WJ. Oncogene-induced cellular senescence. Adv Anat Pathol.
2010;17(1):42-48.
51. Wu YC, Wu TH, Clemens DL, et al. Massively parallel delivery of large cargo into
mammalian cells with light pulses. Nat Methods. 2015;12(5):439-444.
52. Yu Y, Lowy MM, Elble RC. Tet-On lentiviral transductants lose inducibility when silenced
for extended intervals in mammary epithelial cells. Metab Eng Commun. 2016;3:64-67.
53. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using
the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281-2308.
54. Cairns J, Fridley BL, Jenkins GD, Zhuang Y, Yu J, Wang L. Differential roles of ERRFI1
in EGFR and AKT pathway regulation affect cancer proliferation. EMBO Rep. 2018;19(3).
55. Yang CH, Chou HC, Fu YN, et al. EGFR over-expression in non-small cell lung cancers
harboring EGFR mutations is associated with marked down-regulation of CD82. Biochim Biophys
Acta. 2015;1852(7):1540-1549.
56. Manning BD, Toker A. AKT/PKB Signaling: Navigating the Network. Cell.
2017;169(3):381-405.
57. Theodosiou A, Ashworth A. MAP kinase phosphatases. Genome Biol.
2002;3(7):REVIEWS3009.
58. Lemmon MA, Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell.
2010;141(7):1117-1134.
59
59. Oda K, Matsuoka Y, Funahashi A, Kitano H. A comprehensive pathway map of epidermal
growth factor receptor signaling. Mol Syst Biol. 2005;1:2005.0010.
60. Jones RB, Gordus A, Krall JA, MacBeath G. A quantitative protein interaction network for
the ErbB receptors using protein microarrays. Nature. 2006;439(7073):168-174.
61. Yoshida T, Okamoto I, Okabe T, et al. Matuzumab and cetuximab activate the epidermal
growth factor receptor but fail to trigger downstream signaling by Akt or Erk. Int J Cancer.
2008;122(7):1530-1538.
62. Liang SI, van Lengerich B, Eichel K, et al. Phosphorylated EGFR Dimers Are Not
Sufficient to Activate Ras. Cell Rep. 2018;22(10):2593-2600.

Asset Metadata

Creator Shi, Tuo (author)

Core Title Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

Contributor Electronically uploaded by the author (provenance)

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 07/23/2021

Defense Date 06/19/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag alveolar epithelial cells,epidermal growth factor receptor,lung adenocarcinoma,lung cancer,mutations,non-small cell lung cancer,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Advisor Offringa, Ite (committee chair), Marconett, Crystal (committee member), Schönthal, Axel (committee member)

Creator Email tuoshi@usc.edu,tuoshi2.0@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-187563

Unique identifier UC11663608

Identifier etd-ShiTuo-7605.pdf (filename),usctheses-c89-187563 (legacy record id)

Legacy Identifier etd-ShiTuo-7605.pdf

Dmrecord 187563

Document Type Thesis

Format application/pdf (imt)

Rights Shi, Tuo

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Abstract (if available)

Abstract Lung cancer is the leading cause of cancer-related deaths among men and women in the United States and worldwide. Lung cancer can be categorized into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), of which the most common subtype is lung adenocarcinoma (LUAD). Limited targeted therapies are currently available for LUAD, and the overall five-year survival rate for NSCLC remains very poor, at around 18%. Although cancer cell lines such as A549 have brought us valuable insights in understanding LUAD, they are not suited to recapitulate early events in disease development, or the genetic and epigenetic diversity seen in LUAD patients. In order to investigate effects of different mutations and epigenetic changes in driving LUAD progression, we propose to manipulate immortalized normal human alveolar epithelial cells (AECs), the presumed cell-of-origin for LUAD, to model LUAD development in vitro. The objective is to introduce individual cancer driver mutations into AECs derived from different human donors, to deeply characterize the effects of these drivers in different genetic backgrounds. As a first step, a known oncogenic EGFRᴸ⁸⁵⁸ᴿ mutation was introduced in immortalized AECs. Its expression and downstream signaling activation were verified by immunoblotting and in vitro transformation assays were used to determine the level of transformation by the EGFR mutant. It was found that overexpression of EGFRᴸ⁸⁵⁸ᴿ did not result in a more transformed phenotype in immortalized AECs, suggesting that additional (epi)genetic alterations may be required to make AECs receptive to transformation by EGFRᴸ⁸⁵⁸ᴿ.