University of Southern California Dissertations and Theses

Elucidating the cellular origins of lung adenocarcinoma

(USC Thesis Other)

Elucidating the cellular origins of lung adenocarcinoma

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Elucidating the Cellular Origins of Lung Adenocarcinoma

by
Minxiao Yang

A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR MEDICINE)

August 2020
Copyright 2020 Minxiao Yang

ii

Acknowledgements
Firstly, I would like to thank the members of my thesis committee for their generous
support in my graduate career. I am especially grateful to my primary mentor, Dr. Zea
Borok, who offered me the chance to take charge of this project as well as my secondary
mentor, Dr. Crystal Marconett who has always been by my side to offer guidance. Their
passion towards science and earnest attitude for life have greatly helped me to think,
learn and grow as a graduate student. Before initiation of project, I worried a lot about
whether the tumor induction experiment would succeed. Luckily, with the technical
support and academic guidance provided from Dr. Zea Borok, Dr. Beiyun Zhou and Dr.
Crystal Marconett, I was able to successfully generate the results contained herein.
Secondly, I would especially like to thank Hua Shen and Yanbin Ji for their efforts in
teaching me mouse husbandry, genotyping, and best breeding strategies. Also, I would
like to appreciate the labs of Drs. Zea Borok, Ite Offringa and Crystal Marconett for
providing equipment for my project and for creating a harmonious environment in lab. I
learned diligence, rigorousness, creativity and teamwork from the members of the
Offringa lab: Chunli Yan, Evelyn Tran, Daniel Mullen, Anusha Muralidhar and Laurence
St. Pierre. I would also like to thank Johnathan Castillo, Zhengmin Cong and Gopika
Nandagopal from the Marconett lab for their help with the project.
iii

Lastly, I also want to express my gratitude to Wright Foundation, Department of Animal
Resources at USC, the USC Molecular Imaging Center for helping with micro CT
scanning and analysis, the USC Immunohistochemistry lab for technical support in
staining, TRL lab for sample processing, and Dr. Michael Koss for lending his pathology
expertise to the histologic classification of lung adenocarcinoma.
Due to the outbreak of COVID-19 and the shutdown of university, I was unable to fully
complete all of my research aims. Even though we are going through such a special and
tough time, I am glad that people in my lab and committee stay united and keep marching
forward together. I believe we will finally meet again and shake hands and hug with each
other after conquering COVID-19.

iv

TABLE OF CONTENTS
Acknowledgements ..........................................................................................................ii
LIST OF TABLES ............................................................................................................vi
LIST OF FIGURES ......................................................................................................... vii
ABSTRACT ................................................................................................................... viii
CHAPTER 1 Introduction ................................................................................................ 1
1.1 Lung Cancer .......................................................................................................... 1
1.2 Lung Cancer Classification .................................................................................... 2
1.3 Alveolar Epithelium ................................................................................................ 3
1.4 Preliminary Data .................................................................................................... 4
Chapter 2: Systemic Gramd2-CreERT2-driven Kras
G12D
activation results in multifocal
adenocarcinoma lesions in mouse lung .......................................................................... 8
2.1 Introduction ............................................................................................................ 8
2.2 Materials and Methods ........................................................................................... 9
2.2.1 Mouse Models used in this study ..................................................................... 9
2.2.2 Tailing ............................................................................................................ 10
2.2.3 PCR ............................................................................................................... 10
2.2.4 Gel Electrophoresis ....................................................................................... 11
2.2.5 Tamoxifen Administration .............................................................................. 11
2.2.6 Dissection and Processing of Lung Samples ................................................. 12
2.2.7 Embedding and Sectioning ............................................................................ 12
2.2.8 H&E Staining ................................................................................................. 13
2.2.9 IHC Staining................................................................................................... 13
2.2.10 Silication & Micro CT Scanning .................................................................... 14
2.3 Results ................................................................................................................. 15
2.3.1 Generation of the Gramd2-CreERT2; Kras
LSL-G12D
and Sftpc-CreERT2;
Kras
LSL-G12D
Mouse Models ..................................................................................... 15
v

2.3.2 Lungs of Gramd2-CreERT2; Kras
LSL-G12D
mice have a distinct phenotype ..... 16
2.3.3 Kras
G12D
activation in AT1 cells leads to hyperplasia around the bronchioles
and adenocarcinomas in the alveoli........................................................................ 17
2.3.4 Lung Adenocarcinoma Primarily Occurs in Distal Alveolar Epithelium .......... 23
2.3.5 Multifocal Tumors Form in the Whole Lung ................................................... 25
2.4 Discussion ............................................................................................................ 26
Chapter 3: SUMMARY .................................................................................................. 31
CHAPTER 4: FUTURE DIRECTIONS ........................................................................... 33
REFERENCES .............................................................................................................. 35
SUPPLEMENTAL DATA ............................................................................................... 39

vi

LIST OF TABLES

Table 1………………………………………………………………………………..……...…39
Table 2……………………………………………………………………………………...…..39
Table 3…………………………………………………………………………………..…..….40
Table 4………………………………………………………………………………………….40
Table 5………………………………………………………………………………………….41
Table 6……………………………………………………………………………………….…41

vii

LIST OF FIGURES

Figure 1……………………………………………………………………………………….….1
Figure 2…………………………………………………………………………………………..2
Figure 3…………………………………………………………………………………………..5
Figure 4…………………………………………………………………………………………..6
Figure 5………………………………………………………………………………………......7
Figure 6…………………………………………………………………………………………..9
Figure 7…………………………………………………………………………………..……..17
Figure 8…………………………………………………………………………………………19
Figure 9…………………………………………………………………………………………21
Figure 10………………………………………………………………………………………..22
Figure 11………………………………………………………………………………………..24
Figure 12…………………………………………………………………………………..……26

viii

ABSTRACT
Lung cancer is the leading cause of cancer-related death (Fabricius and Lange, 2003).
Lung adenocarcinoma (LUAD) is the most prevalent histological subtype of lung cancer
(Thun MJ, 1997). Typically, LUAD is thought to arise in the distal alveolar epithelium
where two types of epithelial cell are harbored: alveolar type Ⅰ(AT1) and type Ⅱ(AT2)
cell. Here, AT2 cell is widely accepted as a cell of origin for LUAD (Xu X, 2012), while
AT1 cell has been assumed to terminally differentiated, and its ability to give rise to LUAD
has not been reported yet (Shaohua Wang, 2011). Our laboratory, by analyzing
expression profiling of Human LUAD tumors from The Cancer Genome Atlas (TCGA-
LUAD), previously determined that a significant portion of human LUAD tumors express
AT1 cell gene signatures. Knowing that the GRAM domain containing 2 (GRAMD2) gene
is a highly specific AT1 cell marker, and that surfactant protein C (SFTPC) gene is
specifically expressed in AT2 cells, we therefore sought to determine if AT1 cells can also
serve as a cell of origin for LUAD. In this study, we activated the Kras
LSL-G12D
oncogene
specifically in AT1 cells using the Gramd2-CreERT2 tamoxifen-inducible transgenic
mouse model system, alongside control Sftpc-CreERT2 mice that will activate Kras
LSL-
G12D
in AT2 cells as well as corn-oil vehicle controls. Lung samples of the mice were
harvested at 14
th
weeks post-tamoxifen injection. Then, lung sections underwent H&E
staining and IHC staining followed by pathology review, and micro CT scanning. We found
that, in the lungs of Gramd2-CreERT2; Kras
LSL-G12D
mice, activation of Kras gene was
ix

able to induce multiple tumor nodules and hyperplastic foci. AE1/AE3, NK2 homeobox
1 (NKX2-1, aka thyroid transcription factor, TTF-1), and CD68 were detected in or around
these foci. The staining results suggest that the primary site where the generated
adenocarcinomas arise is lung, that those tumors originated from pulmonary epithelial
cells, and macrophages infiltrated the neoplastic foci and hyperplastic foci. We believe
that understanding the cellular origins of LUAD can yield fundamental knowledge about
the mechanism by which this cancer develops. This knowledge in turn will impart
implications for effective prevention, risk stratification, targeted therapy, and responses
to therapeutic interventions of LUAD.

1

CHAPTER 1 Introduction
1.1 Lung Cancer
Lung cancer has been the world-wide leading cause of cancer-related deaths. According
to the Cancer Stat Facts: Lung and Bronchus Cancer (2010–2016) from US National
Cancer Institute, Surveillance, Epidemiology, and End Results Program, the 5-year
average survival rate of lung cancer is 20.5 percent (Figure 1A). It is estimated that
~140,000 people will die of lung cancer in 2020 in the Unites States. This number will be
4 times the number of deaths from breast cancer that results in the second highest deaths,
and it will account for ~23 percent of all cancer deaths. (Figure 1B, Siegel, Cancer
Statistics, 2020).

FIGURE 1
Epidemiology of Lung Cancer: A. Gray figures represent those who have died from lung and bronchus cancer.
Green figures represent those who have survived 5 years or more. B. Estimated deaths of cancers in 2020.

2

1.2 Lung Cancer Classification
Lung cancer can be subdivided into Small Cell Lung Cancer (SCLC, ~15%) and Non-
Small Cell Lung Cancer (NSCLC, ~85%) (Risteski et al., 2013). In addition, NSCLC can
be further subdivided by histology and biomarker expression into three major subtypes:
adenocarcinoma, squamous cell carcinoma and large cell carcinoma (Figure 2), among
which, Lung Adenocarcinomas (LUAD) is the most prevalent subtype of NSCLC (~50%
of NSCLC cases).

FIGURE 2
Lung Cancer Subtypes: The main types of Lung Cancer are small cell lung cancer (~15%) and non-small cell lung
cancer (~85%), and the latter type includes adenocarcinoma (~50%), squamous cell carcinoma (~23%) and large cell
carcinoma (~12%).

Despite these refined subtypes, there is still considerable clinical, pathologic, and
molecular heterogeneity within tumors classified as LUAD, as shown in the World Health

3

Organization (WHO) classification of lung tumors (Travis WD, 2004). Nevertheless, in
2011, the International Association for the Study of Lung Cancer, American Thoracic
Society, and European Respiratory Society (IASLC/ATS/ERS) revised the classification
of LUAD and proposed new morphologic criteria to provide a uniform diagnostic
terminology for multidisciplinary patient management. The new IASLC/ATS/ERS
classification for LUAD includes five comprehensive subtypes of lepidic, acinar, papillary,
solid and micropapillary patterning (Seung Yeon Ha and Mee Sook Roh, 2013).

1.3 Alveolar Epithelium
Worldwide, considerable effort has been exerted to determine the molecular origins of
LUAD. LUAD is a type of carcinoma that arises from epithelial tissue, and develops in
distal alveolar epithelium (Rowbotham and Kim, 2014). Within the alveolar epithelium,
there are two main epithelial cell types: AT2 and AT1 cell. The two types of cells have
distinct morphological and physiologic behavior. AT2 cells are small and cuboidal cells
that produce and secrete surfactant into the lumen of the lung to reduce surface tension
and prevent lung collapsing. In contrast, AT1 cells are large and exceptionally thin cells
that form the lung cell layer of the alveolar sac to facilitate gas exchange into the adjacent
capillaries. Another point worth mentioning is that AT1 cells can be differentiated from
AT2 cells.

4

For further understanding the relationship between alveolar epithelial cells and LUAD
cellular origins, much work has established that the AT2 cell serves as a progenitor of
LUAD during development and responses to environmental damage (Ayobami M Olajuyin,
2019). So far, only AT2 cells have been widely accepted as a cell origin of LUAD (Kate,
D Sutherland, 2014), although AT1 cells cover >95 percent of alveolar epithelium. This is
because prior research has shown they have little replicative capacity, and are considered
terminally differentiated (Jun Yang, 2016). Nevertheless, it was also suggested that
HOPX
+
AT1 cells have some limited proliferative capacity (Rajan Jain, 2015).
Furthermore, AT1 cells are an unexpected source of VEGFA and their normal
development is required for alveolar angiogenesis. Notably, a majority of AT1 cells
proliferate upon ectopic SOX2 expression and undergo stage-dependent cell fate
reprogramming. These results provide evidence that AT1 cells have both structural and
signaling roles in alveolar maturation and can exit their terminally differentiated non-
proliferative state. Therefore, any contribution of AT1 cells to the cellular origins of LUAD
is largely unexplored.

1.4 Preliminary Data
Our laboratory has studied the process of in vitro differentiation of human primary AT2
cells into AT1-like cells over the course of 6 days, mimicking wound healing activity in

5

vivo (Marconett CN, 2013, 2014). During the differentiation period, our laboratory
analyzed the RNA-seq profiles of purified AT2 (Day 0), and AT1-like cells (Day 2-6 in
culture; the largest transition is on Day 2), including profiles of long non-coding RNAs
(lncRNAs; long, often spliced RNAs that do not encode for proteins). These regulatory
sRNAs have been shown to have extreme cell-type specificity during development.
Comparison of lncRNA expression in AT2, AT1-like cells and LUAD cell lines, revealed
dramatic differences between AT1 and AT2 cells, and roughly half of the LUAD cell lines
grouped with each primary cell type (Figure 3). This suggests that a substantial fraction
of LUAD cell lines (and by extrapolation, tumors) may be derived from AT1 cells.
FIGURE 3
lncRNAs cluster LUAD cell lines into two distinct subsets based on AT2- or AT1 cell-like expression patterns.
The top 5% of variant lncRNAs underwent unsupervised heirarchical clustering. Tumor/normal status was not the
driving factor between the major clusters, nor were technical issues or common mutational status associated with the
tumors, smoking status, stage or metastasis state. ***NOTE PC3 and PC9 are lung adenocarcinoma cell lines from
Japan, NOT prostate cells***

6

This hypothesis has also been tested by categorizing TCGA LUAD tumor cells regarding
expression of AT2 and AT1 cell markers, noting that they cluster separately (Figure 4A).
In addition, AT1-like and AT2-like LUAD tumor cell also show difference in their survival
ability (Figure 4B, Marconett CN, 2017).

FIGURE 4
Human TCGA LUAD samples segregate into two clusters based on AT cell markers with differing survival
outcomes. (A) 287 TCGA LUAD tumors underwent unsupervised hierarchical clustering based on expression levels
of AQP5 (AT1 cell marker) and SFTPC (AT2 cell marker). Orange = ‘AT1-like’ cluster with high AQP5, low SFTPC
expression. Magenta = ‘AT2-like’ cluster with low AQP5 and high SFTPC expression. (B) Survival curve of samples
denoted as ‘AT1-like’ or ‘AT2-like’ based on expression of markers.

Testing the role of AT1 cells in LUAD emergence and development requires an AT1-
specific promoter, which can be used to label the cells and/or specifically activate
oncogenes in them in vivo. Indeed, a major limitation to determining the role of AT1 in
LUAD emergence and development has been the lack of an effective cell-type-specific
A B

7

marker identifying AT1 cells in the mouse. Although previous studies have identified a set
of AT1 cell-specific markers, and the most prominent of which is Aqp5 (Per Flodby, 2010),
Aqp5 unfortunately has expression in other organs of rat and mouse, including
submandibular, parotid, lacrimal gland and trachea (Surabhi Raina, 1995). Therefore,
Aqp5 is not a suitable marker for generation of Cre driver mouse lines for studying the
possibility of AT1 cells serving as a progenitor for LUAD. Consequently, our laboratory
turned to a newly identified marker of AT1 cells with high specificity in rat, mouse and
human, Gramd2, that is not expressed in AT2 cells, nor in the submaxillary glands,
lacrimal, gland, trachea, or other major organs. This gene has been validated extensively
using in vivo and in vitro methods in the rat, mouse, and human (Figure 5, Marconett,
Crystal N, 2017).
FIGURE 5
Evaluation of AT1 cell-type specific marker Gramd2 for use in transgenic animal models. (A) RNA-seq of
GRAMD2 in human primary AT2 and in vitro differentiated AT1-like cells. Biological replicates are shown. (B)
Expression of Gramd2 specifically in mouse whole lung tissue. qRT-PCR expression levels of Gramd2 were compared
between submaxillary gland (SMG), lacrimal gland (LG) (two tissues that often show overlap with AT1 cell gene
expression), whole lung (WL) and trachea in mouse. Expression values were normalized to negative control (PCR well
without template). (C) Immunofluorescence of mouse lung using Gramd2 antibody. Gramd2 transmembrane staining
was observed in mouse AT1 (but not AT2) cells. Green = GRAMD2, red = SFTPC, blue = DAPI (nuclear stain).

8

Chapter 2: Systemic Gramd2-CreERT2-driven Kras
G12D

activation results in multifocal adenocarcinoma lesions in
mouse lung
2.1 Introduction
LUAD harbors considerable molecular and phenotypic heterogeneity, which may relate
to the combinations of different mutated genes in multiple progenitor cells (Kate D.
Sutherland, 2013). Currently, the theory that AT2 cells are the main cell origin of LUAD is
from experiments performed by Mark W. Onaitis group. They utilized two knock-in Cre-
estrogen receptor alleles to induce expression of Kras
G12D
in AT2 cells (Xia Xu, 2011).
Moreover, Kate D. Sutherland et al. concluded that co-expression of CC10 and Kras
G12D

club cells also have the ability to initiate malignant transformation towards lung
adenocarcinoma following the introduction of these genetic alterations (Kate D.
Sutherland, 2013).
Based on our preliminary data, our laboratory has hypothesized that AT1 cells are another
candidate progenitor of LUAD. To test the ability of AT1 cell as a cell of origin for LUAD,
we utilized the endogenous Gramd2 regulatory system by cloning the CreERT2
downstream of the 3’UTR of Gramd2 gene. In this way, CreERT2 can be conditionally
expressed in AT1 cells. Only after binding to tamoxifen, the CRE-ER fusion protein in the
cytoplasm would then translocate to the nucleus. Subsequently, the fusion protein would

9

induce deletion of stop codon in Kras
G12D
sequence, and Kras
G12D
gene is then activated.
Relying on this well-designed inducible system, carcinogenesis can be specifically
initiated in AT1 cells.

2.2 Materials and Methods
2.2.1 Mouse Models used in this study
Heterozygous Gramd2-CreERT2 and Sftpc-CreERT2 mice were kindly provided by Dr
Zea Borok and Dr. Beiyun Zhou. These two types of mice were respectively crossed to
heterozygous Kras
LSL-G12D
mice obtained from the Jackson laboratory (Figure 6).
Gramd2-CreERT2 and Sftpc-CreERT2 mice are in a B6/129 mixed strain (129 N1), while
Kras
LSL-G12D
mice are in a B6/129S4 mixed strain (C57BL/6 N10) as well.
FIGURE 6
Breeding pathway for Gramd2-CreERT2; Kras
LSL-G12D
and Sftpc-CreERT2; Kras
LSL-G12D
mice. The parent mice
are heterozygotes. The possible genotypes of pups are shown.

10

2.2.2 Tailing
Pups were weaned before 18
th
day after birth. For each pup, 0.1 cm of tail was cut off and
stored in a 1.5 mL microcentrifuge tube. 100 μL DirectPCR (#102-T, Viagen) with 10 μL
proteinase K (50μg/ml) was then added to each tube and incubated with the tail overnight
at 60℃. To inactivate the proteinase, a two-hour incubation at 92℃ was performed the
next day, and crude DNA was ready to use. Next, the concentration of the crude DNA
preparation was diluted to 50 ng/ul, so that it was ready for being template for subsequent
genotyping PCR reactions.

2.2.3 PCR
PCR was prepared using Go Taq G2 Hot Start Polymerase (0000362382, Promega). For
Gramd2 gene, reactions consisted of 1 μL DNA, 5 μL buffer, 2 μL MgCl2, 0.5 μL dNTP,
1 μL common forward primer, mutant reverse primer and wild type reverse primer, 0.12
μL polymerase, and nuclease-free water to a total volume of 20 μL. For Kras gene, the
PCR recipe is similar except using 3 μL of DNA template. For Sftpc gene, the PCR recipe
is similar except two sets of primers: one for mutant Sftpc allele and wild type Sftpc allele.
For Gramd2 gene and Kras gene, the reaction system was incubated for 2 minutes at
94°C, 35 cycles including 20 seconds at 94°C, 30 seconds at 58°C and 90 seconds at
72°C, and 10 minutes at 72°C using the C1000 Touch Thermal Cycler (Bio-Rad). For

11

Sftpc gene, the reaction system was incubated for 3 minutes at 94°C, 35 cycles including
30 seconds at 94°C, 30 seconds at 58°C and 40 seconds at 72°C, and 2 minutes at 72°C
using the C1000 Touch Thermal Cycler (Bio-Rad).

2.2.4 Gel Electrophoresis
PCR products were loaded into a 1.2% agarose gel, which was prepared using LE
Agarose (Gene Mate) and nuclease-free water. The PowerPac Basic Power Supply (BIO-
RAD) was used to perform gel electrophoresis at 80V for 1 hour. Lastly, the gel was
imaged on a Molecular Imager ChemiDox XRS+ (BIO-RAD).

2.2.5 Tamoxifen Administration
Tamoxifen (CAS: 10540-29-1, Sigma) was prepared before use. Tamoxifen powder was
first dissolved in 100% ethanol (SHBJ8384, Sigma-Aldrich) and then diluted to the final
concentration of 40 mg/mL by corn oil (Sigma, # MKCG3257). To ensure that tamoxifen
was fully dissolved, the mixture was gently shaken in a shaking incubator (SHEL LAB) at
55℃ for 2 hours. After shaking, tamoxifen was ready to use.
Six-week-old mice were injected with tamoxifen via intraperitoneal injection. For Gramd2-
CreERT2; Kras
LSL-G12D
, Kras
LSL-G12D
and WT mice, 40 mg/mL tamoxifen was injected via

12

intraperitoneal injection. The dosage of tamoxifen was 200 mg/g according to bodyweight
of each mouse. Tamoxifen was given three times within a week. For Sftpc-CreERT2;
Kras
LSL-G12D
mice, 40mg/mL tamoxifen was injected via intraperitoneal injection. The of
tamoxifen dosage was 100 mg/g according to bodyweight of each mouse. Tamoxifen was
given twice within a week.

2.2.6 Dissection and Processing of Lung Samples
At 14
th
weeks post-tamoxifen injection, the mice were euthanized by injecting 100 μL
Euthasol (ANADA #200-071, Virbac) via intraperitoneal injection. The lungs were then
perfused with phosphate buffered saline (PBS, 21-031-CV, CORNING) and inflated with
4% paraformaldehyde (PFA, CAS: 30520-89-4, Sigma-Aldrich) at a hydraulic pressure of
25 cm water. After fixation, the lung was transferred into a 50 mL Falcon tube and fixed
in 4% PFA overnight. Fixed lungs were then washed three times with 15 mL sterile PBS
and stored in 70% ethanol for future use.

2.2.7 Embedding and Sectioning
Embedding and sectioning were accomplished with assistance of the USC TRLab. Lung
samples were processed in an automatic tissue processor (Thermo Scientific Spin Tissue

13

Processor Microm STP 120) following a standard gradient of dehydration (70%, 80%, 95%
and 100% of ethanol), clearing (Clear-Rite 3) and paraffin infiltration. After embedding,
samples were sectioned at 5 µm using a rotary microtome (Thermo Fisher Microm HM310
Rotary Microtome) and affixed to clean slides.

2.2.8 H&E Staining
H&E staining was accomplished with assistance of the USC Immunohistochemistry lab.
The slides were deparaffinized and stained in Hematoxylin and Eosin using an automated
stainer (Varistain™ Gemini ES Automated Slide Stainer).

2.2.9 IHC Staining
Immunohistochemistry (IHC) staining was accomplished with assistance of the USC
Immunohistochemistry laboratory. First, sections were baked in an oven at 60℃ for one
to two hours and were left to cool for fifteen minutes. After cooling, the following steps
were processed in a Leica Bond III Auto-stainer. Sections were deparaffinized and
underwent antigen retrieval by incubating with EDTA Antigen Retrieval buffer (Ready To
Use, Leica Bio Systems) for twenty minutes. After antigen retrieval, slides were washed
by distilled water for three times. Each time lasted two minutes. Then, processed sections
were incubated with AE1/AE3 (Ready To Use, Leica), CD68 (Ready To Use, Leica) and

14

TTF-1 (1:500, Cell Marque) antibodies for fifteen minutes. After primary incubation,
sections were washed with PBS and tween twenty three times. Each time lasted two
minutes. Next, sections were incubated with post primary block and polymer (BOND IHC
Polymer Detection Kit (DS9800), Leica micro-biosystem). Each incubation lasted for eight
minutes. After that, sections were blocked with peroxide for five minutes, then staining
was performed with DAB Chromogen (BOND IHC Polymer Detection Kit (DS9800), Leica
micro-biosystem) for ten minutes. In addition, sections were stained with Mayer's
Hematoxylin (American Master Tech). The processed sections were then taken out from
Leica Bond III Auto-stainer and were dehydrated by dipping in 95% Isopropyl alcohol for
one minute, 100% Isopropyl alcohol for one minute, and Xylene for one minute.
Dehydrated sections were mounted and covered by glass coverslip.

2.2.10 Silication & Micro CT Scanning
After fixation with 4% PFA, the lungs of Gramd2-CreERT2; Kras
LSL-G12D
and Sftpc-
CreERT2; Kras
LSL-G12D
mice were gently rinsed with PBS, and then with 50% EtOH,
before placing in 70% EtOH. This rinse was repeated three times. Next, lung samples
were dehydrated by using an ethanol gradient as follows at room temperature: 2hrs in 70%
EtOH; 2hrs in 80% EtOH; 2hrs in 90% EtOH; overnight in 100% EtOH; 2hrs in
hexamethyldisilazane (SHBG4111V, Sigma-Aldrich). Lung samples were then left in the

15

chemical hood for 1-2 hours until they thoroughly dried and solidified. After fully drying,
the silicified lung sample is ready for micro CT scanning.
Micro CT scanning was assisted by the USC Molecular Imaging Center. Specimens were
scanned at Molecular Imaging Center, in the Department of Radiology at Keck School of
Medicine, USC. An AGE Pheonix nanotom M micro CT scanner was used with the
following parameters: 60 kV energy, 200 μA current, and 1440 projection along a 360-
degree rotation, at 1 frame per second. The voxel resolution of the resulting images is
between 0.006-0.008 mm. Raw image data were reconstructed into 16-bit DICOM images.
Visualization and quantification of volume were performed using VGSTUDIO MAX
3.3.2.170119 64 bit © Copyright 1997-2019 by Volume Graphics GmbH.

2.3 Results
2.3.1 Generation of the Gramd2-CreERT2; Kras
LSL-G12D
and
Sftpc-CreERT2; Kras
LSL-G12D
Mouse Models
The Gramd2-CreERT2; Kras
LSL-G12D
and Sftpc-CreERT2; Kras
LSL-G12D
mouse models
were successfully generated and their genotypes were verified by regular PCR. Six
mouse strains were utilized for this project: Gramd2-CreERT2; Kras
LSL-G12D
, Sftpc-
CreERT2; Kras
LSL-G12D
, Gramd2-CreERT2, Sftpc-CreERT2, Kras
LSL-G12D
and WT. Eight
mice of each genotype were generated for the following experiments except for the

16

Kras
LSL-G12D
and WT controls, where we only maintained three mice per experiment. All
experimental mice are in a B6/129 mixed strain.

2.3.2 Lungs of Gramd2-CreERT2; Kras
LSL-G12D
mice have a
distinct phenotype
After dissection, it was observed that the lungs of Gramd2-CreERT2; Kras
LSL-G12D
mice
have a distinctly dark yellow coloration (Figure 7B), whereas the Gramd2-CreERT2
control lungs appear to be bright red (Figure 7A). In addition, the texture of the control
lungs was homogeneous and uniform (Figure 7A). On the contrary, the Gramd2-CreERT2;
Kras
LSL-G12D
lungs appeared spotted with internal tubercles. It was also grossly apparent
that some areas in the Gramd2-CreERT2; Kras
LSL-G12D
lungs were denser than the
surrounding tissues and control lungs (Figure 7B). This phenomenon is especially
apparent in the periphery of the lung.

17

FIGURE 7
Anatomical appearance of lungs from Gramd2-CreERT2 and Gramd2-CreERT2; Kras
LSL-G12D
mice before
perfusion: (A) Gramd2-CreERT2 lung; (B) Gramd2-CreERT2; Kras
LSL-G12D
lung (arrow indicates one of tubercles).

2.3.3 Kras
G12D
activation in AT1 cells leads to hyperplasia
around the bronchioles and adenocarcinomas in the alveoli
To study the emergence and development of tumors resulting from the tamoxifen-
inducible activation of Kras
G12D
, we examined the lungs of our experimental and control
mice via H&E staining. Histological examination of lungs from all experimental mice 14
weeks following tamoxifen injection was taken for necropsy. With the guidance and
assistance kindly provided by Dr. Michael Koss, neoplastic and hyperplastic lesions were
examined, characterized and classified on basis of their phenotypical appearance, spatial
location, organization, and cellular characteristics. As shown in Figure 8, the alveoli of
WT lung are clear: no nodules or lesions were observed in the alveoli, or bronchioles

18

(Figure 8A, 8B and 8C). In contrast, in the Gramd2-CreERT2; Kras
LSL-G12D
lungs, multiple
small regions of nodules and lesions were found in the alveoli, bronchioles and
bronchioalveolar duct junction (BADJ) (Figure 8G). Lepidic adenocarcinoma was first
identified (Figure 8H and 8I). The lepidic adenoma was composed of neoplastic cells
lining with no architectural disruption/complexity in alveoli (Figure 8I). Similarly,
examination on the Sftpc-CreERT2; Kras
LSL-G12D
lungs revealed presence of focal
hyperplasia of the AT2 cells. Lepidic adenocarcinoma was also spotted in the alveoli of
Sftpc-CreERT2; Kras
LSL-G12D
lungs (Figure 8E and 8F).

19

FIGURE 8
Tumors formed in Sftpc-CreERT2; Kras
LSL-G12D
& Gramd2-CreERT2; Kras
LSL-G12D
lungs: (A-C) H&E section of WT
mouse lung 14 weeks after tamoxifen injection. There are no nodules or lesions in the alveoli or the bronchioles. (D-F)
H&E section of Gramd2-CreERT2; Kras
LSL-G12D
mouse lung 14 weeks after tamoxifen injection, showing (E&F) lepidic
adenocarcinoma. (G-I) H&E section of Sftpc-CreERT2; Kras
LSL-G12D
mouse lung 14 weeks after tamoxifen injection,
showing (H&I) lepidic adenocarcinoma. (Scale bar in A, D and G, 2900μm; B, E and H, 100μm; C, F and I, 25μm.)

B E H
A D G
C F I

20

However, apart from the lepidic lung adenomas, a subset of Gramd2-driven tumors
present different histologic signatures of LUAD. Atypical adenomatous hyperplasia (AAH),
a forerunner of pulmonary adenocarcinoma (Mori M, 2001), was observed in alveoli
(Figure 9A). The size of AAH is usually less than 5 mm, and it presents the irregular linear
single-layered outlook. In addition, nodules were found in the forming process from the
AAH to carcinoma (Figure 9A); What’s more, papillary adenocarcinoma was found in
alveoli (Figure 9C and 9D). Furthermore, papillary hyperplasia was found to infiltrate and
reside at the lumen of terminal bronchiole as well (Figure 9E and 9F), and it was also
identified as adenocarcinoma. These large nodular or irregular lesions present in the
bronchioles (Figure 9E and 9F) as well as in the alveolar spaces exhibited malignancy
features such as atypia and necrosis.

21

FIGURE 9
Gramd2-driven tumors present signatures of multiple subtypes of adenocarcinoma: (A-F) micrographs of H&E
section (5μm) of Gramd2-CreERT2; Kras
LSL-G12D
mouse lung 14 weeks after tamoxifen injection, showing (A-B) AAH
(arrow indicates emerging carcinoma), (C-D) papillary adenocarcinoma and (E-F) bronchial infiltrative adenocarcinoma.
(Scale bar in A, C and E, 100μm; B, D and F, 25μm.)

In addition to the identification and classification above, the histologic composition of
tumor subtypes in Sftpc-CreERT2; Kras
LSL-G12D
and Gramd2-CreERT2; Kras
LSL-G12D
mice are summarized in Figure 10. The number and subtype of Gramd2-driven and
Sftpc-driven adenocarcinomas are distinctly different. Papillary is the main subtype in
Gramd2-CreERT2; Kras
LSL-G12D
lung, while lepidic is the main subtype in Sftpc-
Gramd2-CreERT2; Kras
LSL-G12D

A C E
B D F

22

CreERT2; Kras
LSL-G12D
lung. We did not observe the acinar or solid subtypes of lung
adenocarcinoma in either model, suggesting that there may be even more cell types
within the lung contributing to the observed histologic variation in LUAD. In addition, we
observed that there were many papillary adenocarcinomas that had infiltrated the lower
bronchiole space but had not yet invaded the basement membrane. This form of
invasive LUAD is not observed in human tumors but has previously been observed in
another model of LUAD that utilized oncogenic activation driven by the Gprc5a gene
(Huijing Yin, 2020).

FIGURE 10
Histologic composition of lung adenocarcinoma from different AT cell origins: In Gramd2-CreERT2; Kras
LSL-G12D

(black bars; n = 3; 14 weeks) & Sftpc-CreERT2; Kras
LSL-G12D
(grey bars; n = 3; 14 weeks) lungs, the subtypes of
generated adenocarcinomas were examined and the number of tumor in each subtype per section per lung was
accounted. The bar graph represents the average number of lesions per section per lung: papillary adenocarcinoma,
lepidic adenocarcinoma and bronchial infiltrative adenocarcinoma. Data represent means ± SEM.

23

2.3.4 Lung Adenocarcinoma Primarily Occurs in Distal
Alveolar Epithelium
Immunohistochemical (IHC) staining of 4 μm serial sections revealed that weak positive
signals for AE1/AE3 appeared in tumors and bronchial adenocarcinomas (Figure 11D
and Figure 11G). Because AE1 detects the high molecular weight cytokeratins 10, 14, 15,
16 and 19, and AE3 detects the cytokeratins 1, 2, 3, 4, 5, 6, 7 and 8 (Chakraborti S, 2014),
the positive signals of AE1/AE3 combined antibody mean that a broad spectrum of
cytokeratins existed in the generated adenocarcinomas. Knowing that the existence of
cytokeratins is the potent evidence for carcinoma of epithelial origin (Sawaf MH, 1992), the
positive signals of AE1/AE3 indicate that the formed adenocarcinomas have an epithelial
origin. In addition, Gramd2-CreERT2; Kras
LSL-G12D
tumors were positive for TTF-1 (Figure
11E and Figure 11H), a known tissue-specific nuclear transcription factor expressed in
nucleus of lung cancer cell indicating lung cellular origin of pulmonary adenocarcinoma
(G Stenhouse, 2004). Based on that, it could be concluded that the primary originating
and developing site of generated adenocarcinoma is lung. Besides, the Gramd2-
CreERT2; Kras
LSL-G12D
tumors were weakly positive for CD68, a marker of macrophage
infiltration, mainly localized around the periphery of the tumors in alveoli and bronchial
adenocarcinoma sites (Figure 11F and Figure 11I). In addition, minor CD68 penetrance
was also observed in adenocarcinomas (black arrow in Figure 11F and Figure 11I).

24

FIGURE 11
Lung adenocarcinoma was primarily induced in lung epithelium: (A-C) Microphotographs of IHC-stained sections
(4μm) from Gramd2-CreERT2 (controls) showing negative staining for (A) the cytokeratins (B) TTF-1 and (C) CD68;
(D-I) microphotographs of IHC-stained sections (4μm) from Gramd2-CreERT2; Kras
LSL-G12D
mice showing positive
staining for (D&G) the cytokeratins (E&H) TTF-1 and (F&I) CD68 in tumor and around bronchiolar hyperplasia (arrow
indicates macrophage infiltration). (Scale bar in A, B and C, 100μm; D, E and F, 100μm; G and I 50μm; H, 25μm.)

A D G
B E H
C F I

25

2.3.5 Multifocal Tumors Form in the Whole Lung
To understand the extent of tumor distribution throughout the Gramd2-CreERT2; Kras
LSL-
G12D
and Sftpc-CreERT2; Kras
LSL-G12D
lungs, micro CT scanning was respectively
performed on lungs of tamoxifen-induced Gramd2-CreERT2; Kras
LSL-G12D
mice as well as
one treated with corn oil vehicle control. The Sftpc-CreERT2; Kras
LSL-G12D
lung was
silicified and is ready for scanning after university reopens. The lung samples were
thoroughly scanned in both lateral, vertical and horizontal transverses. From the results,
we observed no tumor nodules in the corn oil control group (Figure 12C). The alveoli and
bronchioles were unobstructed (Figure 12A& 12B). In contrast, the tamoxifen-induced
Gramd2-CreERT2; Kras
LSL-G12D
lung had multifocal tumors scattered throughout the
whole lung (Figure 12F). The texture in some area presented as ground glass (Figure
12D& 12E), and this phenomenon is clinically named as Ground Glass Opacity (GGO),
which may be suggestive of a neoplastic condition and an indicator of malignancy
(Migliore M, 2018).
The Gramd2-CreERT2; Kras
LSL-G12D
lung had a total of 208 tumors dispersed throughout
the whole lung. The total volume of tumors is 3.743 mm
3
, and the overall tumor burden
was 0.79%.

26

FIGURE 12
Micro CT imaging reveals lung tumor formation in response to tamoxifen stimulation: (A-C) Micro CT scanning
results of corn oil treated lung of Gramd2-CreERT2; Kras
LSL-G12D
mouse: (A) horizontal transverse, (B) lateral
transverse and (C) 3D structure overview. (D-F) Micro CT scanning results of tamoxifen treated lung of Gramd2-
CreERT2; Kras
LSL-G12D
mouse: (D) horizontal transverse, (E) lateral transverse and (F) 3D structure overview.

2.4 Discussion
The difference in anatomical appearance of Gramd2-CreERT2; Kras
LSL-G12D
and Gramd2-
CreERT2 control lungs implies that the tumor burden in Gramd2-CreERT2; Kras
LSL-G12D
lung impairs

proper blood circulation and consequently, gas exchange. These findings

27

are consistent with our observations on overall mouse health. At the endpoint of
experiment (14
th
week after tamoxifen injection), most of Gramd2-CreERT2; Kras
LSL-G12D
appeared to be hunched and scruffy to some degree, and their breathing frequency is
higher than controls, though it was below the IASLC-defined level that required
euthanasia similar to Sftpc-CreERT2; Kras
LSL-G12D
mice. Therefore, we infer that the tumor
burden in Gramd2-CreERT2; Kras
LSL-G12D
lungs was so heavy that impaired normal lung
function.
Results from the H&E staining showed that the Gramd2-driven tumors include two
subtypes of adenocarcinoma: papillary and lepidic, among which, papillary adenomas did
not only form in alveoli, but they also formed in bronchioles. What’s more, by definition,
papillary adenocarcinoma was invasive, but the adenocarcinomas in bronchioles did not
invade the substratum, so it may be because we caught it before that happened.
Moreover, the bronchial papillary adenocarcinoma is not usually seen in human LUAD,
so it could be mouse-specific phenomenon, which is largely unexplored. Besides, the
H&E staining revealed foci of AAH that formed in lungs of Gramd2-CreERT2; Kras
LSL-G12D

mice, and this is also potent evidence of LUAD formation.
Encouragingly, TTF-1 staining was positive in the Gramd2-driven adenocarcinomas,
indicating that they primarily arose in the lung, and were not the result of metastases from
distant organs. In addition, AE1/AE3 staining implies that the formed adenocarcinomas
originated from epithelial cells. However, the weakness of cytokeratin signals in

28

adenocarcinoma maybe resulted from the fact that low amount of cytokeratins is harbored
in thin cytoplasm of AT1 cells. Besides, the result of CD68 staining suggests that
macrophages infiltrated alveoli and bronchioles but most of them surrounded tumors and
only few of them penetrated tumors and hyperplastic tissues. The reason for this
phenomenon could be that growing hyperplastic tissues obstructed the space of alveoli
and airways and made tumors hard to penetrate. On top of these evidence from IHC
staining, it can be concluded that adenocarcinoma could be induced in lung of Gramd2-
CreERT2; Kras
LSL-G12D
mice and AT1 cells could be a progenitor of a subset of human
lung adenocarcinomas.
Results from the micro CT imaging indicate that multi focal tumors formed in the Gramd2-
CreERT2; Kras
LSL-G12D
lungs that were scattered throughout the whole lung, and the size
of tumors varied. Additionally, we observed no hyperplasia or lesions in the corn oil control,
suggesting there was no leakage of Kras
G12D
outside the context of activated Cre.
When we compare the features of Gramd2-driven and Sftpc-driven tumor, the difference
between the two types of tumor mainly rely on subtypes of LUAD and spatial location.
The Gramd2-driven tumor includes three main types: papillary adenocarcinoma, lepidic
adenocarcinoma and bronchial infiltrative adenocarcinoma, while lepidic adenocarcinoma
is the main adenocarcinoma observed in Sftpc-driven tumor. In addition, the histologic
composition of lung adenocarcinoma from different AT cell origins was summarized, and
a significant difference of subtypes in the two models was obtained. In term of spatial

29

location, the Gramd2-driven tumors were visually observed in both alveoli, bronchioles
and BADJ, but the alveolus is the only site that Sftpc-driven tumor was found.
Unfortunately, the relationship between bronchioles and tumors formed near bronchioles
is still undetermined. This may be done by computing the nearest neighbor bronchiole of
each tumor and then averaging distances between each tumor and its nearest bronchiole.
As for the marker of LUAD in IHC staining, the positive signals of AE1/AE3, TTF-1 and
CD68 were both found in two types of tumor. This suggest that generated tumors in two
models were lung adenocarcinoma. Our laboratory also plans to further compare the
micro CT scanning result and transcriptomic profiles between two types of tumor after the
university reopens.
Despite our extensive previous experimentation that showed Gramd2 is expressed
specifically in AT1 cells, there is still a question as to whether some rare cell type in the
lung other than AT1 cells that is responsible for our observations. We are currently testing
the specificity of Gramd2-CreERT2 expression and Kras
G12D
activation in purified
populations of AT1 cells as well as in vitro models of AT differentiation to validate our
previous findings.
According to Kate D. Sutherland et al., tumor suppressor gene Trp53 loss concomitant
with Kras
G12D
activation leads to an overall faster tumor progression in both Ad5–SPC–
Ce- and Ad5–CC10–Cre-induced tumors (Kate D. Sutherland et al., 2013), while our
experiment design does not introduce Trp53 knockout to Gramd2-CreERT2; Kras
LSL-G12D

30

mouse model. This could be one of the reasons why we waited for 14 weeks until the
mice became moribund. To perfect the experiment, a comparison between gain of Trp53
and loss of Trp53 in Gramd2-CreERT2; Kras
LSL-G12D
mouse could be helpful. Besides,
our experiments only presented the conditions of formed tumors at the 14th week, while
the lineage tracing experiment could provide a more comprehensive understanding about
Gramd2-driven tumor formation

31

Chapter 3: SUMMARY
We previously identified GRAMD2 as a cell-type specific marker gene for AT1 cells, and
SFTPC is a widely utilized marker gene of AT2 cells. On top of that, I utilized the Gramd2-
CreERT2 mouse model that was generated recently in Dr. Borok’s laboratory to cross
with the Kras
LSL-G12D
mice. Here, Kras is an oncogenic driver gene, which is present in
~30% of human LUAD tumors (The Cancer Genome Atlas Research Group, 2014).
Regarding the fact that AT2 cell is one of cellular origins of LUAD, Sftpc-CreERT2;
Kras
LSL-G12D
mice were used as a positive control for LUAD tumor formation. Along with
our multiple control mice: Gramd2-CreERT2, Sftpc-CreERT2, Kras
LSL-G12D
and WT mice,
these models provided a well-designed system for studying the potential of AT1 cells to
serve as a cell of origin for lung carcinogenesis.
Our results suggest that carcinogenesis can be induced in AT1 cells and that the resultant
tumors can be classified as LUAD, thus AT1 cells are able to serve as a cell origin of
LUAD. From these studies, it could be concluded that at least two subtypes of LUAD,
papillary and lepidic lung adenocarcinoma, formed in Gramd2-CreERT2; Kras
LSL-G12D

lung. What’s more, AAH, the purported precursor of LUAD, was also found in alveoli and
around bronchioles in Gramd2-CreERT2; Kras
LSL-G12D
lung. In addition, AE1/AE3, TTF-1
and CD68 positive results from IHC staining indicate that the tumors developed from lung
epithelium and immune infiltration existed in the tumors and hyperplastic tissues. In

32

addition, micro CT results established that Gramd2-driven tumors are multifocal and
scattered throughout the whole lung.

33

CHAPTER 4: FUTURE DIRECTIONS
To provide additional evidence to further support our hypothesis, three supplementary
experiments were originally included in this project, but they failed to be conducted due
to COVID-19. The three experiments will be carried on after university reopens.
The first one is to preclude the possibility that, in Gramd2-CreERT2; Kras
LSL-G12D
mice,
CRE recombinase can be expressed in other cells except AT1 cell or CRE recombinase
leaks out AT1 cell. Thus, this experiment is important to support that Kras is specifically
expressed in AT1 cells of Gramd2-CreERT2; Kras
LSL-G12D
mice, and carcinogenesis only
happen in AT1 cells. The experiment requires that, via in situ hybridization, Kras
conversion rate is measured in AT1 cells and AT2 cells isolated from Gramd2-CreERT2;
Kras
LSL-G12D
mice and in vitro differentiated AT1-like cells. The controls can be AT2 cells
and AT1 cells isolated from Sftpc-CreERT2; Kras
LSL-G12D
mice and in vitro differentiated
AT1-like cells.
Another supplementary experiment is differential expression analysis. We are interested
in figuring out the correlation of expression profiling between Gramd2-driven and Sftpc-
driven tumors and human LUAD. We will perform RNA-seq analysis on mouse AT1- and
AT2-derived tumors, determine which genes are differentially expressed between the two,
and determine what is happening to those genes in human LUAD cases present in The
Cancer Genome Atlas (TCGA) and ORIEN databases.

34

Thirdly, we will ask if induction of Kras
G12D
in AT1 cells alters the proliferation rate of cells.
To measure this, we will perform an EdU incorporation assay with co-staining for AT1 and
AT2 cell markers. The amount of Edu incorporation, reflective of the proliferation rate, will
be compared between AT1 cells from Gramd2-CreERT2; Kras
LSL-G12D
alongside Gramd2-
CreERT2, SpC-CreERT2; Kras
LSL-G12D
, SpC-CreERT2, and WT controls.
Moreover, in order to further substantiate the LUAD identity of generated tumors in
Gramd2-CreERT2; Kras
LSL-G12D
lungs, we want to utilize a subset of alternative maker
genes for LUAD specificity. It was reported that a set of glycolysis-related genes (HMMR,
B4GALT1, SLC16A3, ANGPTL4, EXT1, GPC1, RBCK1, SOD1, and AGRN) are
significantly associated with metastasis and overall survival (OS) of LUAD (Lei Zhang,
2019). In addition, eight miRNAs (miR-31, miR-196b, miR-766, miR-519a-1, miR-375,
miR-187, miR-331 and miR-101-1) were determined to be potent prognostic marker of
LUAD patients (Xuelian Li, 2014).
Most importantly for understanding human LUAD, we also want to test the ability of other
known LUAD oncogenes in vivo to induce carcinogenesis in AT1 cells. This includes
dominant mutations in EGFR, RET, and ALK, among others. By understanding the
cellular origins of LUAD we hope to uncover the differences of morphological and genetic
features from different oncogene-driven tumors, which could ultimately affect patient
prognosis and treatment course in the clinic.

35

REFERENCES
1. Fabricius PG, Lange P. [Diet and lung cancer]. Ugeskr Laeger.
165(34):3234-3237.
2. Thun M, Lally C, Flannery J, Calle E. Cigarette smoking and changes in the
histopathology of lung cancer. Journal of the National Cancer Institute.
1997;89(21):1580-1586. doi:10.1093/jnci/89.21.1580.
3. Xu X, Rock JR, Lu Y, et al. Evidence for type II cells as cells of origin of K-Ras-induced
distal lung adenocarcinoma. Proceedings of the National Academy of Sciences of the
United States of America. 2012;109(13):4910-4915. doi:10.1073/pnas.1112499109.
4. Wang S, Hubmayr RD, Wang S. Type I alveolar epithelial phenotype in primary culture.
American journal of respiratory cell and molecular biology. 2011;44(5):692-699.
doi:10.1165/rcmb.2009-0359OC.
5. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA: A Cancer Journal for
Clinicians. 2020;70(1):7-30. doi:10.3322/caac.21590.
6. Yang J, Hernandez B, Martinez Alanis D, et al. The development and plasticity of
alveolar type 1 cells. Development (Cambridge). 2016;143(1):54-65.
doi:10.1242/dev.130005.
7. Olajuyin AM, Zhang X, Ji H-L, Olajuyin AM. Alveolar type 2 progenitor cells for lung
injury repair. Cell death discovery. 2019;5(1):63-63. doi:10.1038/s41420-019-0147-9.
8. Sutherland KD, Song J-Y, Kwon MC, et al. Multiple cells-of-origin of mutant K-Ras-
induced mouse lung adenocarcinoma. Proceedings of the National Academy of
Sciences of the United States of America. 2014;111(13):4952-4957.
doi:10.1073/pnas.1319963111.
9. Rajan Jain, Christina E. Barkauskas, Norifumi Takeda, et al. Plasticity of Hopx+ type
I alveolar cells to regenerate type II cells in the lung. Nature Communications.
2015;6(1):6727. doi:10.1038/ncomms7727.

36

10. Risteski M, Crvenkova S, Atanasov Z, Isjanovska R. Epidemiological analysis of
progression-free survival (PFS) and overall survival (OS) in non-small-cell lung cancer
patients in Republic of Macedonia. Pril (Makedon Akad Nauk Umet Odd Med Nauki).
2013;34(3):49-61.
11. Rowbotham SP, Kim CF, Rowbotham SP. Diverse cells at the origin of lung
adenocarcinoma. Proceedings of the National Academy of Sciences of the United
States of America. 2014;111(13):4745-4746. doi:10.1073/pnas.1401955111.
12. Danto S, Shannon J, Borok Z, Zabski S, Crandall E. Reversible Transdifferentiation
of Alveolar Epithelial Cells. American Journal of Respiratory Cell and Molecular
Biology. 1995;12(5):497-502. doi:10.1165/ajrcmb.12.5.7742013.
13. Ha SY, Roh MS, Ha SY. The new 2011 international association for the study of lung
cancer/american thoracic society/european respiratory society classification of lung
adenocarcinoma in resected specimens: clinicopathologic relevance and emerging
issues. Korean journal of pathology. 2013;47(4):316-325.
doi:10.4132/KoreanJPathol.2013.47.4.316.
14. Marconett CN, Zhou B, Rieger ME, et al. Integrated Transcriptomic and Epigenomic
Analysis of Primary Human Lung Epithelial Cell Differentiation (Differentiating Lung
Cell Transcriptome/Epigenome). 2013;9(6):e1003513.
doi:10.1371/journal.pgen.1003513.
15. Marconett CN, Zhou B, Siegmund KD, Borok Z, Laird-Offringa IA. Transcriptomic
profiling of primary alveolar epithelial cell differentiation in human and rat. Genomics
Data. 2014;2(C):105-109. doi:10.1016/j.gdata.2014.05.011.
16. Flodby P, Borok Z, Banfalvi A, et al. Directed expression of Cre in alveolar epithelial
type 1 cells. American journal of respiratory cell and molecular biology.
2010;43(2):173-178. doi:10.1165/rcmb.2009-0226OC.
17. Raina S, Preston GM, Guggino WB, Agre P, Raina S. Molecular cloning and
characterization of an aquaporin cDNA from salivary, lacrimal, and respiratory tissues.

37

The Journal of biological chemistry. 1995;270(4):1908-1912.
doi:10.1074/jbc.270.4.1908.
18. Marconett CN, Zhou B, Sunohara M, et al. Cross-Species Transcriptome Profiling
Identifies New Alveolar Epithelial Type I Cell-Specific Genes. American journal of
respiratory cell and molecular biology. 2017;56(3):310-321. doi:10.1165/rcmb.2016-
0071OC.
19. Mori M, Rao SK, Popper HH, Cagle PT, Fraire AE, Mori M. Atypical adenomatous
hyperplasia of the lung: a probable forerunner in the development of adenocarcinoma
of the lung. Modern pathology: an official journal of the United States and Canadian
Academy of Pathology, Inc. 2001;14(2):72-84. doi:10.1038/modpathol.3880259.
20. Yin H, Jiang Z, Feng X, Ji Z, Jin W. Identification of Sca-1 + Abcg1 + bronchioalveolar
epithelial cells as the origin of lung adenocarcinoma in Gprc5a-knockout mouse model
through the interaction between lung progenitor AT2 and Lgr5 cells. Oncogene.
2020;39(18):3754-3773. doi:10.1038/s41388-020-1251-2
21. Chakraborti S, Nag T., Das D, Sanyal Chatterjee T, De S. Cytokeratin localization in
toe pads of the anuran amphibian Philautus annandalii (Boulenger, 1906). Tissue and
Cell. 2014;46(3):165-169. doi:10.1016/j.tice.2014.03.001.
22. Sawaf MH, Ouhayoun JP, Shabana AH, Forest N. [Cytokeratins, markers of epithelial
cell differentiation: expression in normal epithelia]. Pathologie biologie.
1992;40(6):655-665.
23. Stenhouse G, Fyfe N, King G, Chapman A, Kerr KM. Thyroid transcription factor 1 in
pulmonary adenocarcinoma. Journal of Clinical Pathology. 2004;57(4):383-387.
doi:10.1136/jcp.2003.007138.
24. Migliore M, Fornito M, Palazzolo M, et al. Ground glass opacities management in the
lung cancer screening era. Annals of translational medicine. 2018;6(5):90-90.
doi:10.21037/atm.2017.07.28.

38

25. Comprehensive molecular profiling of lung adenocarcinoma. Nature.
2014;511(7511):543-550. doi:10.1038/nature13385.
26. Zhang L, Zhang Z, Yu Z. Identification of a novel glycolysis-related gene signature for
predicting metastasis and survival in patients with lung adenocarcinoma. Journal of
Translational Medicine. 2019;17(1):1-13. doi:10.1186/s12967-019-02173-2.
27. Li X, Shi Y, Yin Z, Xue X, Zhou B, Li X. An eight-miRNA signature as a potential
biomarker for predicting survival in lung adenocarcinoma. Journal of translational
medicine. 2014;12(1):159-159. doi:10.1186/1479-5876-12-159.

39

SUPPLEMENTAL DATA
TABLE1 List of Primers
Primer Name Primer Sequence (5’—3’)
Gramd2-CreERT2 common forward CTAGTCCTGTCCTCGTCCTATC
Gramd2-CreERT2 mutant allele reverse GGGAAACCATTTCCGGTTATTC
Gramd2-CreERT2 WT allele reverse CACATCCCAGCCTTCTCAAA
Sftpc-CreERT2 WT allele forward TGGTTCCGAGTCCGATTCTTC
Sftpc-CreERT2 WT allele reverse CCTTTTGCTCTGTTCCCCATTA
Sftpc-CreERT2 mutant allele forward TGAGGTTCGCAAGAACCTGATGGA
Sftpc-CreERT2 mutant allele reverse ACCAGCTTGCATGATCTCCGGTAT
Kras
LSL-G12D
common reverse CTGCATAGTACGCTATACCCTGT
Kras
LSL-G12D
mutant forward GCAGGTCGAGGGACCTAATA
Kras
LSL-G12D
WT forward TGTCTTTCCCCAGCACAGT

TABLE2 Tail Digestion
Step Reagents Temperature Time
1 DirectPCR 60 ℃ Overnight
2 Proteinase K (50μg/ml) 92 ℃ 2 hours

40

TABLE3 Recipe of PCR System
Gramd2 Kras Mutant Sftpc WT Sftpc
H 2O (μL) 8.375 6.375 6.775 6.775
DMSO 0 0 0.6 0.6
Buffer (μL) 5 5 5 5
Mg
2+
(μL) 2 2 2 2
dNTP (μL) 0.5 0.5 0.6 0.6
Primers (μL) 1 for each 1 for each 1 for each 1 for each
Taq (μL) 0.125 0.125 0.125 0.125
DNA (μL) 1 3 3 3

TABLE4 PCR Protocol of GRAMD2 and KRAS Gene
TEMPERATURE TIME
94 ℃ 2MIN
94 ℃ 20S
58 ℃ 30S
72 ℃ 1MIN30S
72 ℃ 10MIN
4 ℃ ∞

35 cycles

41

TABLE5 PCR Protocol of SFTPC Gene
TEMPERATURE TIME
94℃ 3MIN
94℃ 30S
58℃ 30S
72℃ 40S
72℃ 2MIN
4℃ ∞

TABLE6 Protocol of Silication
Step Reagents Temperature Time
1 70% EtOH room temperature 2 hours
2 80% EtOH room temperature 2 hours
3 90% EtOH room temperature 2 hours
4 100% EtOH room temperature 2 hours
5 hexamethyldisilazane room temperature 2 hours
1) At the end of the fixation, pour off the 4% PFA. Gently rinse the lungs with PBS, and
then with 50% EtOH, before placing lung sample in 70% EtOH. Leave lung sample at
4 ℃ until further processing.
2) Dehydrate lung sample through an ethanol gradient as follows at RT:
70% EtOH for 2hrs; 80% EtOH for 2hrs; 90% EtOH for 2hrs; 100% EtOH for overnight;
hexamethyldisilazane (HDS) for 2hrs.
3) Leave lung sample in chemical hood until it is thoroughly dried.

35 cycles

Abstract (if available)

Abstract Lung cancer is the leading cause of cancer-related death (Fabricius and Lange, 2003). Lung adenocarcinoma (LUAD) is the most prevalent histological subtype of lung cancer (Thun MJ, 1997). Typically, LUAD is thought to arise in the distal alveolar epithelium where two types of epithelial cell are harbored: alveolar type Ⅰ(AT1) and type Ⅱ(AT2) cell. Here, AT2 cell is widely accepted as a cell of origin for LUAD (Xu X, 2012), while AT1 cell has been assumed to terminally differentiated, and its ability to give rise to LUAD has not been reported yet (Shaohua Wang, 2011). Our laboratory, by analyzing expression profiling of Human LUAD tumors from The Cancer Genome Atlas (TCGA-LUAD), previously determined that a significant portion of human LUAD tumors express AT1 cell gene signatures. Knowing that the GRAM domain containing 2 (GRAMD2) gene is a highly specific AT1 cell marker, and that surfactant protein C (SFTPC) gene is specifically expressed in AT2 cells, we therefore sought to determine if AT1 cells can also serve as a cell of origin for LUAD. In this study, we activated the KrasLSL-G12D oncogene specifically in AT1 cells using the Gramd2-CreERT2 tamoxifen-inducible transgenic mouse model system, alongside control Sftpc-CreERT2 mice that will activate KrasLSL-G12D in AT2 cells as well as corn-oil vehicle controls. Lung samples of the mice were harvested at 14th weeks post-tamoxifen injection. Then, lung sections underwent H&E staining and IHC staining followed by pathology review, and micro CT scanning. We found that, in the lungs of Gramd2-CreERT2

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

PDF

Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

In vitro lineage tracing of immortalized human alveolar epithelial cells

PDF

Tight junction protein CLDN18.1 attenuates malignant properties and related signaling pathways of human lung adenocarcinoma in vivo and in vitro

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

DNA methylation changes in the development of lung adenocarcinoma

PDF

LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

PDF

Evaluating the impact of long non-coding RNAs on tumor mutational burden in cancer

PDF

Generation of an epigenetic toggle switch to test LINC00261 function on lung adenocarcinoma cellular response to the chemotherapeutics oxaliplatin and carboplatin

PDF

Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

PDF

Development of immunotherapy for small cell lung cancer using iso-aspartylated antigen

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

Molecular and cellular characterization of alveolar epithelium

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

Using epigenetic toggle switches to repress tumor-promoting gene expression

PDF

Development of immunotherapy for small cell lung cancer using novel modified antigens

PDF

CpG methylation profiling in lung cancer cell lines, tumors and non-tumors

PDF

Design, synthesis and validation of Axl-targeted monoclonal antibody probe for microPET imaging of human lung cancer

PDF

Anti-Hu immuno-responsivenss in small-cell lung cancer

Asset Metadata

Creator Yang, Minxiao (author)

Core Title Elucidating the cellular origins of lung adenocarcinoma

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 07/29/2020

Defense Date 06/05/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag alveolar type 1 cell,Gramd2 gene,H,IHC staining,lung adenocarcinoma,micro CT scanning,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Borok, Zea (committee chair), Marconett, Crystal (committee member), Zhou, Beiyun (committee member)

Creator Email minxiaoy@usc.edu,yangminxiao1213@163.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-351826

Unique identifier UC11663391

Identifier etd-YangMinxia-8823.pdf (filename),usctheses-c89-351826 (legacy record id)

Legacy Identifier etd-YangMinxia-8823.pdf

Dmrecord 351826

Document Type Thesis

Rights Yang, Minxiao

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA