University of Southern California Dissertations and Theses

Presynaptic glutamate receptors and auxiliary subunits in neurotransmission and homeostatic potentiation

(USC Thesis Other)

Presynaptic glutamate receptors and auxiliary subunits in neurotransmission and homeostatic potentiation

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1
PRESYNAPTIC GLUTAMATE RECEPTORS AND AUXILIARY SUBUNITS IN
NEUROTRANSMISSION AND HOMEOSTATIC POTENTIATION

A dissertation submitted by
Beril Kiragasi
to

THE FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA

in partial fulfillment of the requirements
for the degree of

Doctor of Philosophy (NEUROSCIENCE)

Los Angeles
August, 2018
2

© Copyright by Beril Kiragasi – 2018
All rights reserved

3
DEDICATION

To my grandparents and my mom, who always make my rebellious side feel loved and
supported, and to my hometown

4
ACKNOWLEDGEMENTS
To my always enthusiastic and forever encouraging grandparents Gulten Cetin and
Yusuf Cetin: Because I owe it all to you! Many thanks! My grandfather has always been
keen to know what I was doing in lab, how I was proceeding, and how my paper
writing was going, although it is likely that he never grasped what it was all about. My
grandmother, one of the strongest woman I know, has always been nurturing, caring
and supportive. Even when I was away, she always made sure that I was eating well.
I am grateful that I was raised by you!
To my loving mom, Ayse Cetin: the smartest and strongest woman I know! I
admire your intelligence, ambition and work ethic. I am forever grateful to you for
providing me continuous emotional support and encouraging me to follow my
passion.
I would like to thank my lab mates for all the fun and stimulating discussions
and friendships we had in the past six years. First of all, many thanks to my two
friends, Xun and Koto, with whom I started and completed my PhD journey. Xun Chen,
you are an amazing scientist! Your true passion for science and nature (spiders,
especially) has always been inspiring to me. I have learned a ton from you over the
years from molecular cloning to f45 training, and I am forever grateful! Koto Kikuma,
with your intelligence, patience and extraordinary organizational skills, you were a
great baymate to have for years. I am very lucky to have Pragya Goel as my coworker
and friend: she is not only very smart, ambitious and passionate about sicence and
life in general, but she also possesses great emotional intelligence and social skills,
which makes her an admirable, exceptional woman in science. I would also like to
5
thank Jerry Chien, for being my little brother and letting me tease him all the time;
Xiling Li, for encouraging me to ’keep pushing’ every day; Sarah Perry, for being
dreamy and crafty, and also for her emotional, technical, and intelligent contribution
in my project when I needed it the most; Yifu Han, for being my giant baby as well as
for his help in my project; Veronica for introducing me to J Balvin; Catherine, for being
our lab’s baby honey bee; Surbhi, for being a sister to me and for her technical support
in my project; Jeremy, for being my american ‘bro’ and teaching me ephys; our former
postdocs Wenpei, for tolerating my childish self and giving me scientific advice; and
Joyce, for teaching us all sorts of stuff; Hui Yang, for being a passionate explorer; AJ
Cooper, for being a supportive friend (but not a bro!) and many undergrads we had
over the years. Many thanks to you all!
I would not have been able to complete this journey without the enormous
emotional support of two very important friends, Seyma and Sebnem. Dr. Seyma Ekiz:
I am forever grateful that I got to meet you on my first day at USC. Over the years, you
have been a supportive friend, a fun roommate, and an adventurous neighbor. I have
learnt a lot from you and your intelligence, remarkable social skills, and the unique
way you express yourself will keep inspiring me! Dr. Sebnem Baran: you are my soul
sister! I am thankful to be able to reminisce, complain, learn, celebrate and dream
with you. I will forever believe that we were born together and separated at birth in
the Byzantine era only to be brought together by fate later in our lives at USC.
I would like to thank my earlier guidance committee members, Dr. Emily
Liman, and Dr. Andrew Hires for providing me valuable feedback along the way on
my projects. I would also like to thank my current thesis committee members, Dr.
6
Karen Chang, for her continuous feedback and support, and Dr. Bruce Herring, for his
support and for accepting to be my chair last minute.
And finally, last but by no means least, I would like to express my sincere
gratitude to my advisor, Dr. Dion Dickman: This work would not have been possible
without your continuous support, immense knowledge, and never ending ideas. Your
ambition and genuine curiosity has been truly inspiring! Thanks for being patient
with me during the ups and downs of paper submissions and motivating me to ‘keep
pushing’. I know your criticism was for us students to develop a thick skin in science.
I have learnt a great deal from you. You are an exceptional advisor and now when I
look back and I cannot imagine having a better advisor for my PhD study. Thank you!

7
ABSTRACT
The nervous system has the ability to reliably adapt to changes in neural activity in
order to keep the baseline synaptic function stable. Synapses are prone to a variety of
perturbations that can cause impaired function and result in, for example, learning
and memory defects and brain diseases such as autism and schizophrenia.
Nevertheless, they are endowed with molecular machines that homeostatically
restore baseline synaptic activity within a certain time despite the perturbations to
synaptic strength. Yet, despite the demonstration of robust homeostatic signaling in
diverse systems, the genes and molecular mechanisms that govern these processes
are largely unknown. As a glutamatergic synapse, Drosophila neuromuscular junction
has been established in investigating the homeostatic mechanisms that enhance
presynaptic release in response to a perturbation to postsynaptic receptor function.
Importantly, the orchestration of this complex and fundamental signaling system has
been shown to be synapse specific. However, to date, no roles for glutamate receptors
or other factors have been found to differentially enable the modulation of release
efficacy at individual synapses. To this extent, I have discovered 2 new glutamate
receptor subunits that revealed an unexpected autocrine mechanism to adaptively
modulate presynaptic activity at specific, individual active zones.
Kainate-type glutamate receptors (KARs) are known to be involved in
mediating both pre- and postsynaptic actions of glutamate at vertebrate synapses.

Moreover, they have been implicated in the short and long term modulation of
presynaptic release. However, the study in KARs field, unlike other receptors, has
suffered a lot due to the limitations of pharmacology. Indeed, to date, the presynaptic
8
functions of KARs have only been assessed indirectly. Given the genetic and
experimental tractability of Drosophila, encoding uncharacterized glutamate receptor
genes; this gave me an excellent genetic model organism to unravel the presynaptic
functions of KARs. By combining the genetics, electrophysiology and imaging
techniques, I aimed to provide important insights into the function of KARs, which are
the least understood glutamate receptors among all. Therefore, first part of my
graduate studies focused on characterizing the presynaptic KARs. Through a forward
genetic screen, I have identified the Drosophila kainate-type ionotropic glutamate
receptor subunit DKaiR1D to be required for the retrograde, homeostatic
potentiation of synaptic strength. I found that DKaiR1D is only expressed in the
nervous system and is presynaptically needed in motor neurons, localized at or near
active zones. My work revealed DKaiR1D as a presynaptic glutamate autoreceptor
that promotes robustness to synaptic strength and plasticity with active zone
specificity.
KARs have been suggested to operate on the presynaptic side of the synapse
to orchestrate synaptic plasticity. However, the molecules and, importantly, the
physiological mechanisms that regulate KAR trafficking, function, and expression
during plasticity have remained enigmatic. Neto auxiliary proteins were known to
modulate postsynaptic KAR function; however, it was not known whether the
auxiliary subunits had any presynaptic functions. Thus, in the second half of my PhD
work, I investigated, with an emphasis on auxiliary subunits, the molecular
mechanisms that DKaiR1D utilizes to potentiate presynaptic release. In an effort to
identify the DKaiR1D auxiliary subunit through a targeted forward genetic screen in
9
Drosophila, I discovered a novel auxiliary KAR subunit with homology to the neto
family, which I named neto-like (neli). Like DKaiR1D, neli is also exclusively expressed
in the nervous system and is required together with DKaiR1D in motor neurons for
both baseline neurotransmission and homeostatic potentiation. Strikingly, I found
that neli enhances presynaptic release by promoting the delivery and stabilization of
DKaiR1D at individual active zones. Thus, my work defined neli as an auxiliary KAR
subunit that controls synaptic strength by modulating KAR expression, localization,
and/or function at individual active zones to homeostatically tune neurotransmitter
release during adaptive plasticity.
Together, in an effort to identify the molecular players involved in homeostatic
synaptic plasticity, I found a new unexpected role for presynaptic glutamate
receptors and auxiliary subunits, in adaptively modulating release at distinct release
sites. In addition, my work implicated a link between homeostatic synaptic plasticity
and KARs, both of which are associated with brain disorders that perhaps will help us
unravel how these receptors can more efficiently serve as therapeutic targets for
neuropsychiatric diseases.

10
TABLE OF CONTENTS
DEDICATION 3
ACKNOWLEDGEMENTS 4
ABSTRACT 7
LIST OF FIGURES 11

CHAPTER 1: An introduction to homeostatic synaptic plasticity and
aaaaaaaaa presynaptic glutamate receptors 13
1.1 Presynaptic homeostatic potentiation 13
1.2 Kainate-type glutamate receptors 16
1.3 References 19

CHAPTER 2: A presynaptic glutamate receptor subunit confers robustness
asasasasa to neurotransmission and homeostatic potentiation 30
2.1 Summary 30
2.2 Introduction 31
2.3 Results 32
2.4 Discussion 47
2.5 Methods 51
2.6 References 60

CHAPTER 3: An auxiliary glutamate receptor subunit necessary for
asasasasa presynaptic efficacy and homeostatic plasticity 82
3.1 Summary 82
3.2 Introduction 84
3.3 Results 87
3.4 Discussion 105
3.5 Methods 110
3.6 References 116

CHAPTER 4: Conclusion 140
11
LIST OF FIGURES
Figure 1.1 A schematic summarizing PHP. 27
Figure 2.1 DKaiR1D, a neural kainate-type glutamate receptor subunit, is
asasasasasrequired in motor neurons for the acute and long-term expression
of PHP. 67
Figure 2.2 Altered calcium cooperativity and short-term plasticity in
DKaiR1D mutant synapses. 70
Figure 2.3 Elevated extracellular Ca
2+
restores PHP expression in DKaiR1D
asasasasassmutants. 72
Figure 2.4 Endogenous DKaiR1D receptors localize to synaptic neuropil and to
asasasasaspresynaptic terminals when overexpressed. 74
Figure 2.5 Glutamate uncaging induces calcium influx through DKaiR1D
sasasasaasreceptors at active zones. 76
Figure 2.6 Acute pharmacological blockade of DKaiR1D disrupts the expression
sasasasaasbut not induction of PHP. 78
Figure 2.7 Calcium permeability through DKaiR1D receptors is necessary for
sasasasaasbaseline transmission but not for PHP expression. 80
Figure 3.1 Neuronal neto expression promotes baseline neurotransmitter release
sasasasaasbut is dispensable for PHP expression. 124
Figure 3.2 The auxiliary glutamate receptor neto-like (neli) is necessary for PHP
sasasasaasexpression. 126
Figure 3.3 Neuronal expression of neli is required to promote baseline
sasasasaasneurotransmission and PHP. 128
12
Figure 3.4 Neli and DKaiR1D together promote basal presynaptic
sasasasaasneurotransmitter release. 130
Figure 3.5 DKaiR1D is necessary for neli to promote presynaptic
sasasasaasneurotransmiter release. 132
Figure 3.6 Neli-mediated potentiation occludes PHP expression downstream of
sasasasaasBRP remodeling. 134
Figure 3.7 Neli promotes delivery and stabilization of DKaiR1D to AZs to
sasasasaaspotentiate release. 136
Figure 3.8 Neto family proteins have conserved function in presynaptic receptor
sasasasaastrafficking. 138

13
CHAPTER 1

AN INTRODUCTION TO HOMEOSTATIC SYNAPTIC PLASTICITY AND
PRESYNAPTIC GLUTAMATE RECEPTORS

1.1 Presynaptic Homeostatic Potentiation
The nervous system is endowed with potent and adaptive homeostatic signaling
systems that maintain stable functionality despite the myriad changes that occur
during neural development, growth, maturation, and aging. Homeostatic control of
synaptic activity has been demonstrated in the central and peripheral nervous
systems of a variety of organisms, from invertebrate flies and crustaceans to rodents
and humans (Burrone and Murthy, 2003; Davis, 2013; Marder and Goaillard, 2006;
Pozo and Goda, 2010; Turrigiano, 2012). In each of these organisms, perturbations
that enhance or reduce synaptic activity lead to compensatory changes in
postsynaptic ion channels and/or presynaptic efficacy that restores baseline levels of
activity (Davis and Muller, 2015; Turrigiano, 2008). This homeostatic control of
synaptic function can be achieved through the modulation of ion channel expression,
neurotransmitter receptor sensitivity and density, and presynaptic efficacy (Aoto et
al., 2008; Davis and Muller, 2015; Turrigiano, 2008). The importance of homeostatic
regulation in the nervous system is underscored by the implication of defective
homeostatic signaling in a variety of neurological and neuropsychiatric disease
(Meier et al., 2014; Wondolowski and Dickman, 2013). Yet, despite the demonstration
14
of robust homeostatic signaling in these diverse systems, the genes and molecular
mechanisms that govern these processes are largely unknown.
A powerful model of presynaptic homeostatic plasticity has been established
at the Drosophila neuromuscular junction (NMJ). Here, genetic and pharmacological
manipulations that reduce postsynaptic (muscle) glutamate receptor function trigger
a trans-synaptic, retrograde feedback signal to the neuron that increases presynaptic
release to precisely compensate for this perturbation (Frank, 2013; Frank et al., 2006;
Petersen et al., 1997). Thus, while the postsynaptic response to the release of
neurotransmitter from individual synaptic vesicles is reduced (mEPSP amplitude or
quantal size), overall muscle excitation (EPSP amplitude) is maintained at normal
physiological levels because of this compensatory increase in presynaptic release
(quantal content). This process is referred to as presynaptic homeostatic potentiation
(PHP), because the expression mechanism requires a presynaptic increase in
neurotransmitter release. Parallel forms of regulation have been observed in other
invertebrates and in the mammalian central and peripheral nervous systems
(Burrone et al., 2002; Wang et al., 2016).
In recent years, forward and candidate genetic approaches have revealed
several new and unanticipated genes necessary for PHP at the Drosophila NMJ. These
studies have implicated protein synthesis-dependent and independent mechanisms
in the postsynaptic muscle that drive PHP signaling (Frank et al., 2006; Haghighi et
al., 2003; Paradis et al., 2001; Penney et al., 2012; Spring et al., 2016). Further,
retrograde signaling and presynaptic effectors (Bruckner et al., 2017; Dickman and
Davis, 2009; Dickman et al., 2012; Harris et al., 2015; Muller et al., 2012; Tsurudome
15
et al., 2010; Wang et al., 2014; Younger et al., 2013) have been identified that
ultimately lead to homeostatic increases in presynaptic calcium influx and the readily
releasable vesicle pool (Davis and Muller, 2015; Muller et al., 2012; Weyhersmuller
et al., 2011). The orchestration of this complex and fundamental signaling system
homeostatically tunes presynaptic function to achieve the adaptive increase in
vesicular release, with evidence for synapse-specific modulation (Davis and
Goodman, 1998; Lu et al., 2016; Newman et al., 2017). However, to date, no roles for
neurotransmitter receptors or other factors have been found to differentially enable
the modulation of release efficacy at individual synapses.
Two types of postsynaptic glutamate receptors mediate synaptic transmission
at the fly NMJ, GluRIIA- and GluRIIB-containing receptor complexes (DiAntonio, 2006;
DiAntonio et al., 1999; Qin et al., 2005). These receptors detect synaptically released
glutamate and drive the currents responsible for mEPSP and EPSP responses in the
muscle (DiAntonio et al., 1999; Featherstone et al., 2005; Marrus et al., 2004; Pawlu
et al., 2004). Genetic or pharmacological perturbations of GluRIIA-containing
receptors have clearly been shown to be crucial events in triggering the induction of
PHP (Frank et al., 2006; Petersen et al., 1997; Schmid et al., 2006). The genes that
make up the GluRIIA/B-containing receptor complexes are expressed in the
postsynaptic muscle (Ganesan et al., 2011; Qin et al., 2005), mediate the postsynaptic
currents driven by presynaptic glutamate release, and are important in the induction
mechanisms that initiate PHP signaling (DiAntonio et al., 1999; Frank et al., 2006;
Petersen et al., 1997). Although the five individual glutamate receptor subunits that
form these channels have been characterized, no other ionotropic glutamate
16
receptors (iGluRs) are known to be expressed or function at the Drosophila NMJ. The
Drosophila genome encodes nine other iGluR subunits: five kainate-type receptor
subunits, two AMPA-type, and two with homology to NMDA-type receptor subunits
(Benton et al., 2009; Li et al., 2016). There is also a single metabotropic glutamate
receptor encoded in the fly genome, mGluRA, which is present at the NMJ and serves
to depress presynaptic excitability during high frequency stimulation (Bogdanik et
al., 2004). Nonetheless, the only known roles for glutamatergic signaling in synaptic
transmission and plasticity at the Drosophila NMJ is limited to canonical postsynaptic
responses and the mediation of negative feedback during high activity through
metabotropic mechanisms.

1.2 Kainate-type glutamate receptors
Kainate type glutamate receptors (KARs) are classified as one of the three
types of ionotropic glutamate channels and named so due to the agonist, kainate, that
activates them. Even though they have been discovered long time ago, the study in
KARs field, unlike other receptors, has suffered a lot due to the limitations of
pharmacology. There is a substantial cross-reactivity of agonists and antagonists,
especially between AMPARs and KARs. For example, both AMPA and kainate are
found to activate both types of receptors, as a result of which many
misinterpretations of KARs function still exist in the literature. Our current
understanding of KARs has enriched when the subunits that form these receptors
were molecularly defined and resulted in generation of subunit specific knock out
mice. In addition, another real breakthrough happened when it is discovered that a
17
drug, GYKI53655, only antagonizes AMPARs and is completely inactive at KARs
(Paternain et al., 1995).
Structurally, KARs are tetrameric combinations of 5 different subunits: GluK1,
GluK2, GluK3, GluK4 and GluK5. Recombinant expression of these has shown that
while first three subunits can form homomeric and heteromeric functional receptors,
the last two subunit dimers require expression of one the first three to be functional.
Furthermore, mRNAs of GluK1-3 subunits have been subject to alternative splicing
and RNA editing, especially at the Q/R site in the pore domain like AMPA subunit
GluR2, which affects calcium permeability of the channels (Seeburg et al., 1998). In
situ hybridization experiments have shown tissue specific expression of subunits;
nevertheless, the subcellular distribution of a given subunit cannot be assessed due
to lack of subunit specific antibodies that work for immunohistochemistry.
In vertebrate systems, depending on where they are expressed in the brain,
KARs can have both pre- and post-synaptic functions at glutamatergic synapses. They
mediate currents with very small amplitudes postsynaptically only at a few central
synapses, unlike AMPAR-mediated currents, due to their slow activating and fast
desensitizing kinetics (Lerma and Marques, 2013). Moreover, different from
AMPARs, they are strikingly shown to act through two different modes of signaling:
in canonical pathway as ionotropic channels allowing sodium and calcium ions in, and
in noncanonical pathway acting as metabotropic channels through G proteins.
Noncanonical signaling has been found in postsynaptic KARs, activation of which
changes excitability of neurons (Melyan et al., 2002) and presnaptically, it is involved
in modulation of GABA release (Rodriguez-Moreno et al., 1997)
18
Presynaptic KARs at glutamatergic synapses: KARs are shown to regulate
transmitter release by acting auto or heteroreceptors at the presynaptic terminal
(Engelman and MacDermott, 2004). Pharmacological studies have shown that
activation of presynaptic KARs by kainate can either facilitate or depress
glutamatergic synapses depending on its concentration (Lerma and Marques, 2013).
Moreover, activation of presynaptic kainate autoreceptors has been shown to
mediate both short term (Pinheiro et al., 2007; Schmitz et al., 2000) and long term
synaptic plasticity (Lauri et al., 2003) at the hippocampal mossy fiber synapses,
evidence comes from both pharmacological studies (Pinheiro et al., 2013) and knock
out mice models (Fernandes et al., 2009), pointing out several important features of
presynaptic KARs.
First of all, because a single preceeding stimulus is sufficient to potentiate the
release, both PPF (Kamiya et al., 2002) and high frequency stimulation studies
(Pinheiro et al., 2007) suggest that a single action potential can activate the
presynaptic receptors. Therefore, the activation of presynaptic KARs has been
suggested to be very fast (10-30 ms), already ruling out a metabotropic effect and
perhaps suggesting that KARs should be found at or near active zones. Another line
of evidence for that comes from subunit specific knock out models that have implied
the contribution of low affinity receptors to this process by determining the
glutamate binding affinities of the required presynaptic subunits (GluK2: 740 M
whereas GluK3: 1.24 M). Considering the concentration of vesicular glutamate (60-
210 mM) (Clements, 1996) at these synapses, the studies indicate that these
receptors should be at the active zones in order to see enough glutamate and get
19
activated (Pinheiro et al., 2007). Nonetheless, later the low sensitivity of these
receptors are found to be due to their fast desensitization upon binding one or two
molecules of glutamate (Perrais et al., 2009) and raised questions about their
relevance for synaptic function (Perrais et al., 2010). In any case, neither the synaptic
location of these receptors nor the specific subunits at the site of action has been
visualized so far in vivo.
Second, a drug, philanthotoxin 433, which selectively blocks unedited, calcium
permeable glutamate receptors (Fletcher and Lodge, 1996) inhibits facilitation of
EPSCs at the mossy fibers, without affecting the first AMPA mediated EPSC during the
high frequency stimulation (Pinheiro et al., 2007). This is the first evidence showing
that calcium permeable presynaptic KARs are involved in facilitation. An in vivo
evidence also supported that, and showed that GluK2 containing calcium permeable
KARs can be activated by single release events. Moreover, several subsequent studies
agreed on the involvement of calcium release from internal stores in KAR mediated
facilitation at MF-CA3 synapses. It has been recently suggested that
calcium/calmodulin complex is activated by calcium entry through calcium
permeable KARs and it further activates AC/cAMP/PKA cascade to release calcium
from internal stores, required for facilitation of glutamate release mediated by KAR
activation (Andrade-Talavera et al., 2012).

1.3 References
Andrade-Talavera, Y., Duque-Feria, P., Negrete-Diaz, J.V., Sihra, T.S., Flores, G., and
Rodriguez-Moreno, A. (2012). Presynaptic kainate receptor-mediated facilitation of
20
glutamate release involves Ca2+ -calmodulin at mossy fiber-CA3 synapses. J
Neurochem 122, 891-899.
Aoto, J., Nam, C.I., Poon, M.M., Ting, P., and Chen, L. (2008). Synaptic Signaling by All-
Trans Retinoic Acid in Homeostatic Synaptic Plasticity. Neuron 60, 308-320.
Benton, R., Vannice, K.S., Gomez-Diaz, C., and Vosshall, L.B. (2009). Variant ionotropic
glutamate receptors as chemosensory receptors in Drosophila. Cell 136, 149-162.
Bogdanik, L., Mohrmann, R., Ramaekers, A., Bockaert, J., Grau, Y., Broadie, K., and
Parmentier, M.L. (2004). The Drosophila metabotropic glutamate receptor DmGluRA
regulates activity-dependent synaptic facilitation and fine synaptic morphology. J
Neurosci 24, 9105-9116.
Bruckner, J.J., Zhan, H., Gratz, S.J., Rao, M., Ukken, F., Zilberg, G., and O'Connor-Giles,
K.M. (2017). Fife organizes synaptic vesicles and calcium channels for high-
probability neurotransmitter release. J Cell Biol 216, 231-246.
Burrone, J., and Murthy, V.N. (2003). Synaptic gain control and homeostasis. Curr
Opin Neurobiol 13, 560-567.
Burrone, J., O'Byrne, M., and Murthy, V.N. (2002). Multiple forms of synaptic plasticity
triggered by selective suppression of activity in individual neurons. Nature 420, 414-
418.
Clements, J.D. (1996). Transmitter timecourse in the synaptic cleft: its role in central
synaptic function. Trends Neurosci 19, 163-171.
Davis, G.W. (2013). Homeostatic signaling and the stabilization of neural function.
Neuron 80, 718-728.
21
Davis, G.W., and Goodman, C.S. (1998). Synapse-specific control of synaptic efficacy at
the terminals of a single neuron. Nature 392, 82-86.
Davis, G.W., and Muller, M. (2015). Homeostatic control of presynaptic
neurotransmitter release. Annu Rev Physiol 77, 251-270.
DiAntonio, A. (2006). Glutamate receptors at the Drosophila neuromuscular junction.
Int Rev Neurobiol 75, 165-179.
DiAntonio, A., Petersen, S.A., Heckmann, M., and Goodman, C.S. (1999). Glutamate
receptor expression regulates quantal size and quantal content at the Drosophila
neuromuscular junction. The Journal of neuroscience : the official journal of the
Society for Neuroscience 19, 3023-3032.
Dickman, D.K., and Davis, G.W. (2009). The schizophrenia susceptibility gene
dysbindin controls synaptic homeostasis. Science 326, 1127-1130.
Dickman, D.K., Tong, A., and Davis, G.W. (2012). Snapin is critical for presynaptic
homeostatic plasticity. The Journal of neuroscience : the official journal of the Society
for Neuroscience 32, 8716-8724.
Engelman, H.S., and MacDermott, A.B. (2004). Presynaptic ionotropic receptors and
control of transmitter release. Nat Rev Neurosci 5, 135-145.
Featherstone, D.E., Rushton, E., Rohrbough, J., Liebl, F., Karr, J., Sheng, Q., Rodesch, C.K.,
and Broadie, K. (2005). An essential Drosophila glutamate receptor subunit that
functions in both central neuropil and neuromuscular junction. J Neurosci 25, 3199-
3208.
22
Fernandes, H.B., Catches, J.S., Petralia, R.S., Copits, B.A., Xu, J., Russell, T.A., Swanson,
G.T., and Contractor, A. (2009). High-affinity kainate receptor subunits are necessary
for ionotropic but not metabotropic signaling. Neuron 63, 818-829.
Fletcher, E.J., and Lodge, D. (1996). New developments in the molecular
pharmacology of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate and
kainate receptors. Pharmacol Ther 70, 65-89.
Frank, C.A. (2013). Homeostatic plasticity at the Drosophila neuromuscular junction.
Neuropharmacology.
Frank, C.A., Kennedy, M.J., Goold, C.P., Marek, K.W., and Davis, G.W. (2006).
Mechanisms underlying the rapid induction and sustained expression of synaptic
homeostasis. Neuron 52, 663-677.
Ganesan, S., Karr, J.E., and Featherstone, D.E. (2011). Drosophila glutamate receptor
mRNA expression and mRNP particles. RNA Biol 8, 771-781.
Haghighi, A.P., McCabe, B.D., Fetter, R.D., Palmer, J.E., Hom, S., and Goodman, C.S.
(2003). Retrograde control of synaptic transmission by postsynaptic CaMKII at the
Drosophila neuromuscular junction. Neuron 39, 255-267.
Harris, N., Braiser, D.J., Dickman, D.K., Fetter, R.D., Tong, A., and Davis, G.W. (2015).
The Innate Immune Receptor PGRP-LC Controls Presynaptic Homeostatic Plasticity.
Neuron 88, 1157-1164.
Kamiya, H., Ozawa, S., and Manabe, T. (2002). Kainate receptor-dependent short-term
plasticity of presynaptic Ca2+ influx at the hippocampal mossy fiber synapses. J
Neurosci 22, 9237-9243.
23
Lauri, S.E., Bortolotto, Z.A., Nistico, R., Bleakman, D., Ornstein, P.L., Lodge, D., Isaac, J.T.,
and Collingridge, G.L. (2003). A role for Ca2+ stores in kainate receptor-dependent
synaptic facilitation and LTP at mossy fiber synapses in the hippocampus. Neuron 39,
327-341.
Lerma, J., and Marques, J.M. (2013). Kainate receptors in health and disease. Neuron
80, 292-311.
Li, Y., Dharkar, P., Han, T.H., Serpe, M., Lee, C.H., and Mayer, M.L. (2016). Novel
Functional Properties of Drosophila CNS Glutamate Receptors. Neuron 92, 1036-
1048.
Lu, Z., Chouhan, A.K., Borycz, J.A., Lu, Z., Rossano, A.J., Brain, K.L., Zhou, Y.,
Meinertzhagen, I.A., and Macleod, G.T. (2016). High-Probability Neurotransmitter
Release Sites Represent an Energy-Efficient Design. Curr Biol 26, 2562-2571.
Marder, E., and Goaillard, J.M. (2006). Variability, compensation and homeostasis in
neuron and network function. Nat Rev Neurosci 7, 563-574.
Marrus, S.B., Portman, S.L., Allen, M.J., Moffat, K.G., and DiAntonio, A. (2004).
Differential localization of glutamate receptor subunits at the Drosophila
neuromuscular junction. J Neurosci 24, 1406-1415.
Meier, J.C., Semtner, M., Winkelmann, A., and Wolfart, J. (2014). Presynaptic
mechanisms of neuronal plasticity and their role in epilepsy. Front Cell Neurosci 8,
164.
Melyan, Z., Wheal, H.V., and Lancaster, B. (2002). Metabotropic-mediated kainate
receptor regulation of IsAHP and excitability in pyramidal cells. Neuron 34, 107-114.
24
Muller, M., Liu, K.S., Sigrist, S.J., and Davis, G.W. (2012). RIM controls homeostatic
plasticity through modulation of the readily-releasable vesicle pool. The Journal of
neuroscience : the official journal of the Society for Neuroscience 32, 16574-16585.
Newman, Z.L., Hoagland, A., Aghi, K., Worden, K., Levy, S.L., Son, J.H., Lee, L.P., and
Isacoff, E.Y. (2017). Input-Specific Plasticity and Homeostasis at the Drosophila Larval
Neuromuscular Junction. Neuron 93, 1388-1404 e1310.
Paradis, S., Sweeney, S.T., and Davis, G.W. (2001). Homeostatic control of presynaptic
release is triggered by postsynaptic membrane depolarization. Neuron 30, 737-749.
Paternain, A.V., Morales, M., and Lerma, J. (1995). Selective antagonism of AMPA
receptors unmasks kainate receptor-mediated responses in hippocampal neurons.
Neuron 14, 185-189.
Pawlu, C., DiAntonio, A., and Heckmann, M. (2004). Postfusional control of quantal
current shape. Neuron 42, 607-618.
Penney, J., Tsurudome, K., Liao, E.H., Elazzouzi, F., Livingstone, M., Gonzalez, M.,
Sonenberg, N., and Haghighi, A.P. (2012). TOR is required for the retrograde
regulation of synaptic homeostasis at the Drosophila neuromuscular junction.
Neuron 74, 166-178.
Perrais, D., Coussen, F., and Mulle, C. (2009). Atypical functional properties of GluK3-
containing kainate receptors. J Neurosci 29, 15499-15510.
Perrais, D., Veran, J., and Mulle, C. (2010). Gating and permeation of kainate receptors:
differences unveiled. Trends Pharmacol Sci 31, 516-522.
25
Petersen, S.A., Fetter, R.D., Noordermeer, J.N., Goodman, C.S., and DiAntonio, A.
(1997). Genetic analysis of glutamate receptors in Drosophila reveals a retrograde
signal regulating presynaptic transmitter release. Neuron 19, 1237-1248.
Pinheiro, P.S., Lanore, F., Veran, J., Artinian, J., Blanchet, C., Crepel, V., Perrais, D., and
Mulle, C. (2013). Selective block of postsynaptic kainate receptors reveals their
function at hippocampal mossy fiber synapses. Cereb Cortex 23, 323-331.
Pinheiro, P.S., Perrais, D., Coussen, F., Barhanin, J., Bettler, B., Mann, J.R., Malva, J.O.,
Heinemann, S.F., and Mulle, C. (2007). GluR7 is an essential subunit of presynaptic
kainate autoreceptors at hippocampal mossy fiber synapses. Proc Natl Acad Sci U S A
104, 12181-12186.
Pozo, K., and Goda, Y. (2010). Unraveling mechanisms of homeostatic synaptic
plasticity. Neuron 66, 337-351.
Qin, G., Schwarz, T., Kittel, R.J., Schmid, A., Rasse, T.M., Kappei, D., Ponimaskin, E.,
Heckmann, M., and Sigrist, S.J. (2005). Four different subunits are essential for
expressing the synaptic glutamate receptor at neuromuscular junctions of
Drosophila. The Journal of neuroscience : the official journal of the Society for
Neuroscience 25, 3209-3218.
Rodriguez-Moreno, A., Herreras, O., and Lerma, J. (1997). Kainate receptors
presynaptically downregulate GABAergic inhibition in the rat hippocampus. Neuron
19, 893-901.
Schmid, A., Qin, G., Wichmann, C., Kittel, R.J., Mertel, S., Fouquet, W., Schmidt, M.,
Heckmann, M., and Sigrist, S.J. (2006). Non-NMDA-type glutamate receptors are
26
essential for maturation but not for initial assembly of synapses at Drosophila
neuromuscular junctions. J Neurosci 26, 11267-11277.
Schmitz, D., Frerking, M., and Nicoll, R.A. (2000). Synaptic activation of presynaptic
kainate receptors on hippocampal mossy fiber synapses. Neuron 27, 327-338.
Seeburg, P.H., Higuchi, M., and Sprengel, R. (1998). RNA editing of brain glutamate
receptor channels: mechanism and physiology. Brain Res Brain Res Rev 26, 217-229.
Spring, A.M., Brusich, D.J., and Frank, C.A. (2016). C-terminal Src Kinase Gates
Homeostatic Synaptic Plasticity and Regulates Fasciclin II Expression at the
Drosophila Neuromuscular Junction. PLoS Genet 12, e1005886.
Tsurudome, K., Tsang, K., Liao, E.H., Ball, R., Penney, J., Yang, J.S., Elazzouzi, F., He, T.,
Chishti, A., Lnenicka, G., et al. (2010). The Drosophila miR-310 cluster negatively
regulates synaptic strength at the neuromuscular junction. Neuron 68, 879-893.
Turrigiano, G. (2012). Homeostatic Synaptic Plasticity: Local and Global Mechanisms
for Stabilizing Neuronal Function. Csh Perspect Biol 4.
Turrigiano, G.G. (2008). The self-tuning neuron: synaptic scaling of excitatory
synapses. Cell 135, 422-435.
Wang, T., Hauswirth, A.G., Tong, A., Dickman, D.K., and Davis, G.W. (2014). Endostatin
is a trans-synaptic signal for homeostatic synaptic plasticity. Neuron 83, 616-629.
Wang, X., Pinter, M.J., and Rich, M.M. (2016). Reversible Recruitment of a Homeostatic
Reserve Pool of Synaptic Vesicles Underlies Rapid Homeostatic Plasticity of Quantal
Content. J Neurosci 36, 828-836.
27
Weyhersmuller, A., Hallermann, S., Wagner, N., and Eilers, J. (2011). Rapid active zone
remodeling during synaptic plasticity. The Journal of neuroscience : the official
journal of the Society for Neuroscience 31, 6041-6052.
Wondolowski, J., and Dickman, D. (2013). Emerging links between homeostatic
synaptic plasticity and neurological disease. Front Cell Neurosci 7, 223.
Younger, M.A., Muller, M., Tong, A., Pym, E.C., and Davis, G.W. (2013). A presynaptic
ENaC channel drives homeostatic plasticity. Neuron 79, 1183-1196.

28
Figure 1.1 A schematic summarizing PHP
Schematic showing the process of homeostatic compensation in presynaptic release
induced by perturbing postsynaptic receptor function by using philanthotoxin
(PhTx), a selective use-dependent open channel blocker of insect muscle specific
glutamate receptors. Acute application of PhTx causes a rapid decrease in both
mEPSP and EPSP, latter of which recovers baseline values over the next 10 min due
to a compensatory increase in number of vesicles being released.

29
CHAPTER
30
CHAPTER 2

A PRESYNAPTIC GLUTAMATE RECEPTOR SUBUNIT CONFERS ROBUSTNESS TO
NEUROTRANSMISSION AND HOMEOSTATIC POTENTIATION

2.1 Summary
Homeostatic signaling systems are thought to interface with other forms of plasticity
to ensure flexible yet stable levels of neurotransmission. The role of neurotransmitter
receptors in this process, beyond mediating neurotransmission itself, is not known.
Through a forward genetic screen, we have identified the Drosophila kainate-type
ionotropic glutamate receptor subunit DKaiR1D to be required for the retrograde,
homeostatic potentiation of synaptic strength. DKaiR1D is necessary in presynaptic
motor neurons, localized near active zones, and confers robustness to the calcium
sensitivity of baseline synaptic transmission. Acute pharmacological blockade of
DKaiR1D disrupts homeostatic plasticity, indicating that this receptor is required for
the expression of this process, distinct from developmental roles. Finally, we
demonstrate that calcium permeability through DKaiR1D is necessary for baseline
synaptic transmission, but not for homeostatic signaling. We propose that DKaiR1D
is a glutamate autoreceptor that promotes robustness to synaptic strength and
plasticity with active zone specificity.

31
2.2 Introduction
The nervous system is endowed with potent and adaptive homeostatic signaling
systems that maintain stable functionality despite the myriad changes that occur
during neural development and maturation (Davis and Muller, 2015; Pozo and Goda,
2010). The importance of homeostatic regulation in the nervous system is
underscored by associations with a variety of neurological diseases (Wondolowski
and Dickman, 2013), yet the genes and mechanisms involved remain enigmatic. A
powerful model of presynaptic homeostatic plasticity has been established at the
Drosophila neuromuscular junction (NMJ), a model glutamatergic synapse with
molecular machinery that parallels central synapses in mammals. Here, genetic and
pharmacological manipulations that reduce postsynaptic (muscle) glutamate
receptor function trigger a trans-synaptic, retrograde feedback signal to the neuron
that increases presynaptic release to precisely compensate for this perturbation
(Frank, 2013). This process is referred to as presynaptic homeostatic potentiation
(PHP), because the expression mechanism requires a presynaptic increase in
neurotransmitter release.
In recent years, forward and candidate genetic approaches have revealed
several new and unanticipated genes necessary for PHP expression (Frank, 2013).
While perturbations to the glutamate receptors in muscle are crucial events in the
induction of PHP (Frank et al., 2006; Petersen et al., 1997), whether other ionotropic
glutamate receptors (iGluRs) function in PHP or are even expressed at the Drosophila
NMJ is unknown. Finally, although evidence has emerged that homeostatic
modulation is synapse-specific (Davis and Goodman, 1998; Newman et al., 2017), no
32
roles for neurotransmitter receptors or other factors have been found to enable the
presynaptic tuning of release efficacy at individual synapses.
We have identified the kainate-type iGluR subunit DKaiR1D to be necessary
for PHP expression at the Drosophila NMJ. We find that DKaiR1D is necessary for the
calcium sensitivity of baseline synaptic transmission, as well as for the acute and
chronic expression of homeostatic potentiation. Recently, the functional
reconstitution of DKaiR1D was achieved in heterologous cells, revealing that these
receptors form homomeric calcium permeable channels with atypical
pharmacological properties compared to their vertebrate homologs (Li et al., 2016).
We find that DKaiR1D is expressed in the nervous system and not the muscle, is
present near presynaptic active zones, and is required specifically in motor neurons
to enable the robustness of baseline neurotransmission and homeostatic plasticity.
We propose that glutamate activates DKaiR1D at presynaptic release sites to
translate autocrine activity into the robust stabilization of synaptic strength with
active zone specificity.

2.3 Results
DKaiR1D encodes a neural kainate-type glutamate receptor subunit
In the course of an electrophysiology-based, forward genetic screen to isolate genes
necessary for PHP expression (Dickman and Davis, 2009), we identified a mutant that
failed to homeostatically increase presynaptic release following acute application of
Philanthotoxin-433 (PhTx), a drug that specifically blocks postsynaptic glutamate
receptors at the Drosophila NMJ (Frank et al., 2006). Within 10 mins following
33
application of this antagonist, mEPSP amplitudes are reduced but EPSP amplitudes
are maintained at baseline values because of a homeostatic increase in presynaptic
release (Frank et al., 2006). This mutation contained a transposon insertion into an
intronic region of a gene, DKaiR1D, predicted to encode an ionotropic, kainate-type
glutamate receptor subunit (Fig. 1A). We named this allele DKaiR1D
1
. We identified a
second, independent transposon inserted into a coding exon of DKaiR1D (now named
DKaiR1D
2
), as well as a deficiency which removes the entire open reading frame.
Phylogenetic analysis revealed that DKaiR1D is distinct from the five iGluR
subunits expressed in the Drosophila muscle that drive the postsynaptic response to
presynaptic glutamate release (Li et al., 2016). There is evidence that DKaiR1D
functions in the adult fly visual system (Karuppudurai et al., 2014), but DKaiR1D has
not been investigated at the NMJ and its expression pattern is unknown. We therefore
performed in situ hybridization in embryos to determine DKaiR1D mRNA expression,
which demonstrated that DKaiR1D was exclusively expressed in the nervous system
(Fig. 1B). Finally, we generated an antibody against DKaiR1D which revealed a single
95 KDa band by immunoblot analysis, corresponding to the predicted size of DKaiR1D
(Fig. 1C). This band was observed in larval brain lysates, while no detectable signal
was found in lysates made from larval muscle (Fig. 1C). Further, both DKaiR1D
1
and
DKaiR1D
2
alleles are protein nulls, as no expression was detected in brain lysates
from these mutants. Thus, we have identified two independent null alleles of
DKaiR1D, a kainate receptor expressed in the nervous system and putatively required
for presynaptic homeostatic potentiation.

34
DKaiR1D is required in motor neurons for the acute and chronic expression of
presynaptic homeostatic potentiation
iGluRs have been shown to function in baseline synaptic transmission, contributing
to both postsynaptic currents and presynaptic facilitation (Lerma and Marques,
2013). We therefore characterized baseline synaptic transmission in addition to
homeostatic plasticity in DKaiR1D mutants. We observed no significant change in
mEPSP amplitude in DKaiR1D mutants, consistent with DKaiR1D being expressed
presynaptically and not present in the muscle to mediate the postsynaptic
responsiveness to glutamate release (Fig. 1D). Baseline EPSP amplitudes were
slightly reduced in DKaiR1D mutants. However, following acute inhibition of
postsynaptic glutamate receptors by application of PhTx, mEPSP values were
reduced, and EPSP amplitudes were also reduced, indicating no adaptive increase in
presynaptic release (quantal content) in either mutant allele alone, or in mutant
alleles in trans to a deficiency that removes the entire DKaiR1D locus (Fig. 1D,E). Next,
we asked if DKaiR1D expression is necessary cell autonomously in motor neurons for
PHP expression. Expression of DKaiR1D specifically in motor neurons restored PHP
expression in DKaiR1D mutants, while PHP remained disrupted when DKaiR1D was
expressed in muscle (Fig. 1F,G). Thus, DKaiR1D expression is necessary in motor
neurons for the acute expression of PHP.
PhTx was shown to inhibit reconstituted DKaiR1D homomers in vitro (Li et al.,
2016), so we performed several experiments to test whether PhTx influenced
DKaiR1D receptors in vivo. First, mutations in the postsynaptic GluRIIA receptor
subunit is a genetic means of inducing PHP expression, independently of PhTx
35
application. Loss of GluRIIA leads to a chronic reduction in mEPSP amplitude
throughout larval development and a robust compensatory increase in presynaptic
release (Fig. 1H). In GluRIIA, DKaiR1D double mutants, we observed reduced mEPSPs
but no increase in presynaptic release compared to DKaiR1D mutants alone,
confirming that DKaiR1D is required for PHP expression over chronic time scales and,
importantly, independently of PhTx application (Fig. 1H). Further, PHP expression is
restored in GluRIIA, DKaiR1D mutants when DKaiR1D expression is driven in motor
neurons (Fig. 1H), as expected. Next, we confirmed that application of PhTx to GluRIIA
mutants does not impact mEPSP amplitudes, while PHP is robustly expressed (Fig.
S1D-H), as shown previously (Frank et al., 2006). This indicates that the only
physiological target of PhTx in the conditions we are using are GluRIIA-containing
postsynaptic glutamate receptors. Finally, we used a second drug to block
postsynaptic GluRIIA-containing receptors, NSTX-3 (Frank et al., 2006), which has no
reported specificity for DKaiR1D receptors. Application of NSTX-3 reduced mEPSP
values to the same level in the absence or presence of PhTx in both wild type and
DKaiR1D mutant synapses (Fig. 1I,J and Fig. S1A-C). Importantly, while PHP was
robustly expressed at wild-type NMJs following NSTX-3 application, PHP was blocked
in DKaiR1D mutants, and PhTx application had no additional impact (Fig. 1I,J and Fig.
S1A-C). Taken together, there is no evidence that DKaiR1D receptors are targets of
PhTx in vivo, and PHP expression requires DKaiR1D independently of PhTx
application.
Finally, we also examined synaptic growth and structure in DKaiR1D mutants
by immunostaining synaptic structures at the NMJ. We found no significant difference
36
in the number or area of synaptic boutons or active zones in DKaiR1D mutants
compared with controls (Fig. S2). This indicates there are no obvious changes to
synaptic growth or structure in DKaiR1D mutants that may contribute to the inability
to express PHP. Thus, DKaiR1D is a glutamate receptor required in motor neurons for
both the acute and chronic expression of presynaptic homeostatic potentiation.

Altered calcium cooperativity and short term plasticity in DKaiR1D mutants
Presynaptic iGluRs modulate neurotransmission in rodent systems, particularly
during high levels of activity (Kamiya, 2002; Pinheiro and Mulle, 2008). We therefore
examined baseline synaptic transmission in DKaiR1D mutants in more detail.
Recording in reduced extracellular calcium (0.2 mM) revealed a decrease in EPSP
amplitude in DKaiR1D mutants compared to wild type (Fig. 2A) and an apparent
increase in the calcium cooperativity of synaptic transmission (Fig. 2B). We went on
to probe short term plasticity in lowered extracellular calcium, where wild-type
synapses show a moderate facilitation in synaptic transmission when stimulated at
20 Hz (Fig. 2C). Consistent with reduced initial release probability in DKaiR1D
mutants, facilitation was markedly increased, as has been observed in other
homeostatic mutants (Dickman and Davis, 2009; Younger et al., 2013). Together,
these experiments reveal increased calcium cooperativity and facilitation at DKaiR1D
mutant synapses.
An inverse process to PHP, referred to as presynaptic homeostatic depression
(PHD), has been demonstrated at the Drosophila NMJ. Here, excess glutamate release
is observed through overexpression of the vesicular glutamate transporter (vGlut;
37
(Daniels et al., 2004)). This leads to increased synaptic vesicle and quantal size but
normal EPSP amplitude, due to a homeostatic decrease in presynaptic release
(Daniels et al., 2004; Gavino et al., 2015). Some have speculated that PHD utilizes a
presynaptic glutamate receptor as part of a homeostatic feedback sensor and
signaling mechanism (Daniels et al., 2004; Frank, 2013), and we tested whether
DKaiR1D receptors may subserve this role. Overexpression of vGlut (vGlut-OE) in
motorneurons led to the expected increase in mEPSP amplitude and homeostatic
reduction in quantal content (Fig. 2D,E). Similarly, in DKaiR1D mutants
overexpressing vGlut (DKaiR1D+vGlut-OE), mEPSP amplitudes were increased and
quantal content was similarly reduced. Finally, in lowered extracellular calcium,
quantal content and EPSP amplitudes were further reduced in DKaiR1D+vGlut-OE
mutants compared to vGlut-OE alone (Fig. 2F). Both DKaiR1D mutants and vGlut-OE
lead to independent reductions in release probability, so a further reduction at
lowered extracellular calcium when these manipulations are combined may be
expected, given that vGlut-OE involves a reduction in presynaptic calcium influx
(Gavino et al., 2015). Thus DKaiR1D, while necessary for PHP expression, is
dispensable for the expression of PHD.

Elevated extracellular calcium restores PHP expression in DKaiR1D mutants
Since DKaiR1D mutants exhibited a pronounced reduction in release at lowered
extracellular calcium, we next probed baseline synaptic transmission and PHP at
elevated extracellular calcium using two-electrode voltage clamp (TEVC). As
expected, baseline transmission was unperturbed in DKaiR1D mutants in this
38
condition. However, PHP expression was now restored in DKaiR1D mutants, with
GluRIIA, DKaiR1D double mutants showing similar EPSC amplitudes compared with
GluRIIA mutants alone (Fig. 3A,B). This suggests that the requirement of DKaiR1D in
both PHP and baseline transmission is sensitive to extracellular calcium, where
lowered calcium highlights the importance of DKaiR1D in facilitating baseline
neurotransmission and PHP, while elevated calcium circumvents the need for
DKaiR1D in these processes.
One key expression mechanism underlying PHP is a homeostatic increase in
the readily releasable synaptic vesicle pool (RRP). This pool is defined as the number
of vesicles available for immediate release, and has been shown to be homeostatically
modulated following PhTx application and necessary for the expression of PHP
(Muller et al., 2012; Weyhersmuller et al., 2011). The state of the RRP has not been
determined in GluRIIA mutants. We therefore investigated the RRP in wild type,
GluRIIA, and DKaiR1D mutants, as well as in GluRIIA; DKaiR1D double mutants. Using
TEVC in 3 mM extracellular calcium, we estimated the RRP size by back extrapolating
the cumulative EPSC amplitude following 30 stimuli at 60 Hz (Fig. 3C,D; see methods).
Both GluRIIA and GluRIIA; DKaiR1D double mutants exhibited a robust increase in the
RRP relative to baseline (Fig. 3D), consistent with no defect in PHP expression in
DKaiR1D mutants at high extracellular calcium following homeostatic challenge.
Finally, we controlled for the possibility that the vesicle pool size may change in
DKaiR1D mutants at high and low calcium conditions. We measured the sucrose-
sensitive synaptic vesicle pool using hypertonic sucrose in zero extracellular calcium,
and observed no significant difference compared with controls (Fig. 3E,F). Together,
39
this indicates that while PHP expression is completely blocked in lowered
extracellular calcium, elevated calcium restores the expression of PHP along with the
expected RRP modulation in DKaiR1D mutants.

DKaiR1D localizes to synaptic neuropil and presynaptic terminals
The most obvious sources of glutamate that would activate DKaiR1D in motor
neurons are at dendrites, where glutamatergic inputs may signal to postsynaptic
DKaiR1D receptors, or at presynaptic terminals, where DKaiR1D receptors at or near
release sites may respond to synaptically released glutamate in an autocrine
mechanism. Indeed, DKaiR1D has been suggested to function postsynaptically in
dendrites in the Drosophila visual system (Karuppudurai et al., 2014), while rodent
kainate and NMDA receptors function presynaptically near active zones to modulate
synaptic transmission (Bouvier et al., 2015; Chittajallu et al., 1996; Pinheiro et al.,
2007). To determine the subcellular expression of DKaiR1D, we used antibody
staining in third-instar larvae. The polyclonal antibody we generated against
DKaiR1D revealed specific expression in a broad, synapse-rich region of the central
nervous system in the larval ventral nerve cord (Fig. 4A). This signal highly
overlapped with the active zone marker BRP, and was absent in DKaiR1D mutants
(Fig. 4A,B), indicating that in the central nervous system, DKaiR1D traffics to synaptic
neuropil. While the majority of synaptic inputs onto motor neurons are cholinergic
(Baines and Bate, 1998; Baines et al., 1999; Daniels et al., 2008), and the glutamate
that is released onto motor neurons is thought to be inhibitory through activation of
40
glutamate-gated chloride channels (Rohrbough and Broadie, 2002), we cannot rule
out the possibility that DKaiR1D may be present in the dendrites of motor neurons.
We then stained NMJs to determine whether DKaiR1D was present at
presynaptic terminals of motor neurons. We were unable to detect a consistent
endogenous DKaiR1D signal in wild-type motor neuron terminals (data not shown).
However, following overexpression of DKaiR1D in motor neurons, we observed a
punctate signal at presynaptic NMJ terminals, which localized at or near active zones
labeled by BRP (Fig. 4C-F). Interestingly, only a subset of BRP positive active zones
colocalized with DKaiR1D puncta (Fig. 4E), suggesting a heterogeneity of DKaiR1D
presence and position relative to individual active zones. We observed no significant
changes in the density or intensity of BRP signals at active zones following DKaiR1D
overexpression (Fig. 4D-F, Table S1). Given that overexpressed DKaiR1D can traffic
near active zones, we examined active zone ultrastructure in DKaiR1D mutants, but
did not detect any significant changes in NMJ ultrastructure in DKaiR1D mutants (Fig.
S3). Together, this demonstrates that DKaiR1D traffics to synapses in central neuropil
and to presynaptic NMJ terminals where it could, in principle, respond to synaptically
released glutamate.

Glutamate uncaging triggers calcium influx at active zones through DKaiR1D
DKaiR1D receptors were demonstrated to be calcium permeable in vitro (Li et al.,
2016), and we next sought to utilize calcium imaging to test for the functional
presence of endogenous presynaptic DKaiR1D activity at active zones. Conventional
presynaptic calcium imaging uses action-potential evoked stimulation to elicit
41
presynaptic calcium influx through voltage gated calcium channels at active zones
(Muller and Davis, 2012; Yao et al., 2017). This standard approach would be unlikely
to specifically detect the calcium signal through DKaiR1D receptors for two reasons.
First, much less calcium is passed through DKaiR1D receptors compared to the
voltage gated calcium channels that trigger synaptic vesicle release (illustrated in Fig.
S4). Second, conventional calcium imaging necessarily measures the spatially
averaged calcium signal across the entire synaptic bouton, and not the specific signal
at individual active zones. Further, the contribution of calcium through DKaiR1D
receptors is likely non-uniform, given the heterogeneity of DKaiR1D expression and
localization relative to active zones (Fig. 4). Thus, we sought an alternative means to
image presynaptic calcium influx through DKaiR1D at active zones independently of
action potential-evoked activity.
We developed a genetically encoded ratiometric calcium indicator targeted
specifically to active zones. We first engineered a transgene in which we fused
GCaMP6s (Chen et al., 2013) to the red-shifted, calcium insensitive fluorophore
mCherry (Fig. 5A). This enables the ratiometric analysis of the calcium-dependent
GCaMP6s signal to that of a constant mCherry signal. This indicator would also permit
the visualization of active zones at rest if targeted to release sites. To target this
indicator specifically to active zones, we inserted a short fragment of the active zone
scaffold BRP to the GCaMP6s::mCherry fusion. Fluorophores fused to BRP-short
(BRPs) localize specifically to active zones at the Drosophila NMJ (Schmid et al., 2008).
Expression of this transgene in motor neurons revealed co-localization of BRP,
mCherry, and GCaMP6s signals, as expected (Fig. 5B). Finally, to uncouple presynaptic
42
calcium influx through voltage-gated calcium channels and DKaiR1D receptors, we
used photo-uncaging of glutamate instead of electrical stimulation to trigger
extracellular glutamate release.
Glutamate uncaging at motor neuron terminals expressing
BRPs::mCherry::GCaMP6s revealed a GCaMP6s signal at individual mCherry-positive
active zones in 2 mM calcium (Fig. 5C,D,E). These calcium transients did not occur
spontaneously in the absence of photo-stimulation, and consistently failed to be
evoked in 0 mM extracellular calcium (Fig. 5D,E). Indeed, we found that only a subset
of mCherry-positive active zones were responsive to photo-stimulation (Fig. 5C,F),
consistent with DKaiR1D receptors being heterogeneously localized at BRP-positive
active zones. Lastly, to test whether this signal was due to glutamate activating
DKaiR1D receptors rather than an alternative glutamate-responsive target at
presynaptic terminals, we took advantage of both DKaiR1D pharmacology and
genetics. NMDA was reported to be an antagonist of DKaiR1D in heterologous
systems (Li et al., 2016), and we confirmed this in vivo (Fig. 6). We therefore repeated
glutamate uncaging in the presence of NMDA in the extracellular saline to block
DKaiR1D receptors. NMDA application reduced the frequency of calcium signal
responses after photo-uncaging from over 75% to below 20% (Fig. 5F). We also
genetically validated that these calcium transients consistently fail to be evoked in
DKaiR1D mutant synapses (Fig. 5D,F). Together, these experiments demonstrate that
endogenous DKaiR1D receptors are capable of passing calcium in response to
extracellular glutamate near presynaptic active zones at the Drosophila NMJ.

43
Acute pharmacological blockade of DKaiR1D disrupts the expression, but not
induction, of PHP
Heterologous expression of DKaiR1D was recently achieved, where DKaiR1D was
determined to form homomeric channels, to be activated by glutamate, and to be
calcium permeable (Li et al., 2016). Interestingly, NMDA, an agonist for NMDA-type
vertebrate glutamate receptors, was found to be a reversible antagonist of DKaiR1D
channels (Li et al., 2016). We therefore tested whether NMDA could serve as an acute
pharmacological antagonist of DKaiR1D activity in vivo using the semi-intact
Drosophila NMJ preparation. Importantly, we sever the motor nerve from the cell
body prior to application of NMDA in this preparation. Thus, acute blockade of
DKaiR1D by NMDA would provide conclusive insight into whether this receptor was
functioning in the dendrites or presynaptic terminals of motor neurons during
baseline synaptic transmission and homeostatic plasticity, and resolve whether
DKaiR1D had developmental roles or was necessary for the acute induction and/or
expression of PHP.
We previously observed a substantial reduction in baseline EPSP amplitude in
0.2 mM extracellular calcium in DKaiR1D mutant synapses (Fig. 2). If NMDA is indeed
an antagonist of DKaiR1D in vivo, we reasoned that acute application of NMDA to a
wild-type preparation in similar conditions should reduce EPSP amplitudes to
DKaiR1D mutant levels. While acute application of NMDA to wild-type synapses did
not affect mEPSP amplitude (Fig. 6C and Fig. S5), EPSP amplitudes were reduced to
similar levels as observed in DKaiR1D mutants at low calcium (0.2 mM) (Fig. 6A,B).
We went on to test whether the acute blockade of DKaiR1D by NMDA, after severance
44
of the motor nerve, disrupts the expression of PHP. At moderate extracellular calcium
(0.4 mM), application of NMDA had no effect on baseline transmission in wild-type
synapses, as expected (Fig. 6D). However, following incubation with PhTx, NMDA
completely disrupted the expression of PHP in wild-type synapses (Fig. 6D,E). NMDA
application had no impact on DKaiR1D mutants in this condition (PHP was blocked
with no additional changes, Fig. 6E). Finally, we specifically tested whether DKaiR1D
activity was needed for the induction and/or expression of PHP. First, we applied
NMDA to semi-intact preparations before, during, and following PhTx application,
then washed out NMDA and recorded mEPSP and EPSP values. PHP was restored to
control levels within 2 mins of NMDA washout (Fig. 6F), demonstrating that DKaiR1D
activity is not necessary for the acute induction of PHP. To test the reversibility and
necessity of DKaiR1D for the expression of PHP, we applied NMDA to wild-type
synapses after PhTx application, recorded reduced EPSP values, then washed out
NMDA and found EPSP values returned to baseline levels, restoring PHP expression
(Fig. 6G). Together, this demonstrates that DKaiR1D activity at presynaptic terminals
is necessary for the acute and rapid expression, but not induction, of presynaptic
homeostatic potentiation.
We went on to perform several controls for the specificity of DKaiR1D
pharmacology. First, application of NMDA at moderately elevated extracellular
calcium (1 mM) had no effect on baseline transmission (Fig. S5C), as expected, while
PHP expression was greatly diminished (Fig. S5E). In addition, DKaiR1D heterozygous
mutants exhibited an increased sensitivity to NMDA over a range of concentrations
compared with wild type (Fig. S5D), consistent with DKaiR1D being a specific target
45
of NMDA in vivo at the larval NMJ. Notably, AP5 also functions as an antagonist of
DKaiR1D (Li et al., 2016), and we found that acute application of AP5 indeed disrupts
PHP expression, with DKaiR1D heterozygous mutants exhibiting an increased
sensitivity to AP5 (Fig. S5F-H). The blockade of DKaiR1D by both NMDA and AP5
excludes any possibility of NMDA receptors influencing synaptic physiology at the
Drosophila NMJ in our assay, since one is an NMDA receptor agonist and the other is
a competitive antagonist. We did observe that AP5 was less effective at disrupting
homeostatic plasticity than NMDA, consistent with NMDA being a more potent
antagonist in vitro (Li et al., 2016). However, we find that both NMDA and AP5 are
effective at lower concentrations in vivo than might be expected from their actions in
vitro, suggesting there are pharmacological differences for DKaiR1D receptors in vivo
compared to in vitro. Thus, NMDA is a specific antagonist of DKaiR1D receptors in
vivo.

Calcium permeability through DKaiR1D is necessary for baseline transmission
but not PHP expression
The unedited versions of vertebrate kainate and AMPA receptors are calcium
permeable (Lerma and Marques, 2013; Pinheiro and Mulle, 2008) and DKaiR1D
forms calcium permeable channels when expressed in heterologous cells (Li et al.,
2016). We therefore tested the importance of calcium influx through DKaiR1D in
driving baseline presynaptic release as well as presynaptic homeostatic potentiation.
To accomplish this, we engineered a Q604R mutation in DKaiR1D that renders this
channel calcium impermeable in heterologous cells (Li et al., 2016). This calcium
46
impermeable DKaiR1D transgene (referred to as DKaiR1D
R
) was tested for the ability
to rescue baseline and homeostatic synaptic function compared with the native,
calcium permeable DKaiR1D
Q
transgene when expressed in motor neurons of
DKaiR1D mutants.
We first tested baseline synaptic release at 0.2 mM extracellular
calcium. First, we confirmed that overexpression of DKaiR1D
Q
and DKaiR1D
R

transgenes in motor neurons display similar expression and localization (data not
shown). Expression of the calcium permeable DKaiR1D
Q
transgene in motor neurons
of the DKaiR1D mutant restored wild-type EPSP amplitudes, while expression of
DKaiR1D
R
had no effect on reduced EPSP amplitudes (Fig. 7A,B). This demonstrates
that calcium permeability through DKaiR1D is necessary for proper baseline
presynaptic release. We then performed the same experiment in elevated
extracellular calcium (0.4 mM) following PhTx application to test whether calcium
permeability through DKaiR1D was similarly necessary for the homeostatic
potentiation of presynaptic release. Following PhTx application, PHP expression was
rescued when DKaiR1D
Q
was expressed in DKaiR1D mutants. Surprisingly, PHP was
also fully restored following DKaiR1D
R
expression in motor neurons (Fig. 7C,D).
Importantly, this demonstrates that expression of DKaiR1D
R
is functional, in that it
can fully restore PHP expression to similar levels as observed with DKaiR1D
Q
expression. These results suggest that calcium influx through DKaiR1D serves to
potentiate presynaptic release in low extracellular calcium conditions, but that
calcium influx through DKaiR1D is not necessary to enable the expression of PHP.

47
2.4 Discussion
We have revealed a role for presynaptic glutamatergic signaling modulating baseline
and homeostatic neurotransmitter release at the Drosophila NMJ. This unexpected
role for iGluRs in sensing glutamate at presynaptic terminals indicates an autocrine
mechanism that responds to glutamate release to adaptively modulate presynaptic
activity at individual active zones.

Autocrine mechanisms for iGluRs in modulating presynaptic neurotransmitter
release
Glutamate receptors have diverse functions in modulating presynaptic excitability
and short term plasticity in addition to their established roles in postsynaptic
excitation (Lerma and Marques, 2013). Similar to what we observe with DKaiR1D at
the Drosophila NMJ, rodent iGluRs also localize to presynaptic active zone, are
activated by high concentrations of glutamate, and can modulate release during single
action potentials (McGuinness et al., 2010; Pinheiro et al., 2007; Schmitz et al., 2000).
This suggests conserved autocrine modulatory mechanisms shared between these
systems.
Rodent autoreceptors are known to modulate presynaptic activity on rapid
time scales (Kamiya, 2002; Schmitz et al., 2000), including potentiating release during
single action potentials (McGuinness et al., 2010; Scott et al., 2008). Activation of
presynaptic iGluRs can modulate presynaptic voltage and calcium influx in less than
3.5 milliseconds (McGuinness et al., 2010; Scott et al., 2008). In these cases, most of
the impact on release is likely to derive from a calcium store-dependent mechanism,
48
or from modulation of the action potential during the repolarization phase, when
most of the calcium influx that drives vesicle release occurs (Schneggenburger and
Rosenmund, 2015). In a similar fashion, activation of presynaptic DKaiR1D during a
single action potential could lead to a rapid additional source of presynaptic calcium
influx from DKaiR1D itself and/or through modulation of presynaptic membrane
potential to drive increased vesicle release (Fig. S4). Voltage imaging at the Drosophila
NMJ has found the half width of the action potential waveform to be ~5 milliseconds
(Ford and Davis, 2014), sufficient time to be modulated through such a mechanism.
Therefore, dynamic changes in voltage or calcium influx at or near active zones could,
in principle, drive additional vesicle release during a single action potential. This
modulation may be restricted to nearby active zones and compartments relative to
the site of glutamate release. Indeed, presynaptic kainate autoreceptors have the
capacity to confer short-range, synapse-specific modulation to synaptic transmission
(Scott et al., 2008), while presynaptic ligand-gated ion channels in C. elegans can also
rapidly modulate synaptic transmission (Takayanagi-Kiya et al., 2016). Local
activation of DKaiR1D could, therefore, subserve a powerful and flexible means of
tuning presynaptic efficacy at or near individual release sites.

Rapid, synapse-specific modulation during presynaptic homeostatic plasticity
How does DKaiR1D promote the expression of presynaptic homeostatic plasticity? In
contrast to the role of DKaiR1D in baseline release discussed above, our data indicates
that the DKaiR1D-dependent mechanism that drives presynaptic homeostatic
potentiation is calcium independent. This implies two changes to DKaiR1D
49
functionality that are unique to homeostatic adaptation compared to baseline
transmission. First, because presynaptic release is acutely potentiated following
application of PhTx, the activity, levels, and/or localization of DKaiR1D receptors
must change to acquire a novel influence on neurotransmitter release following PHP
induction. The activity of synaptic glutamate receptors can change through
associations with additional subunits and auxiliary factors such as Neto (Kim et al.,
2012; Straub et al., 2011). Furthermore, various forms of plasticity are expressed
through dynamic changes in the levels and localization of glutamate receptors
trafficking between active zones and endosome pools or extra-synaptic membrane
(Anggono and Huganir, 2012; Kneussel and Hausrat, 2016; Yan et al., 2013). Indeed,
when DKaiR1D is overexpressed in motor neurons, it rescues baseline transmission
and PHP expression while localizing to heterogenous puncta of varying distances
relative to active zones. Notably, there is evidence that DKaiR1D interacts with other
glutamate receptor subunits in vivo (Karuppudurai et al., 2014), which may
contribute to the pharmacological differences observed in this study compared with
the in vitro characterization (Li et al., 2016), and may also be targets of modulation
during PHP.
Second, calcium signaling through DKaiR1D differentially drives baseline
release and homeostatic plasticity. Therefore, mechanisms distinct from calcium
permeability of the channel must contribute to PHP expression. One possibility is that
DKaiR1D signals through an undefined metabotropic mechanism during PHP
(Petrovic et al., 2017; Rozas et al., 2003; Rutkowska-Wlodarczyk et al., 2015), which
might contribute to the ability of the calcium impermeable DKaiR1D
R
transgene, with
50
reduced conductance (Li et al., 2016), to rescue PHP expression. Alternatively, an
attractive possibility is that following PHP induction, glutamate released from nearby
active zones may dynamically modulate the presynaptic membrane potential and/or
action potential waveform to promote additional synaptic vesicle release. Indeed,
small, sub-threshold depolarizations of the presynaptic resting potential, as small as
5 mV, are sufficient to induce a two-fold increase in presynaptic release (Awatramani
et al., 2005). The timescale of this activity could occur within a few milliseconds as
discussed above, and studies at the Drosophila NMJ have revealed that glutamate is
released from single synaptic vesicles over time scales of milliseconds (Pawlu et al.,
2004). Interestingly, ENaC channels have been proposed to enable PHP expression
through changes in the presynaptic membrane potential (Younger et al., 2013), and
such a mechanism could be shared by DKaiR1D, but gated by glutamate release at
individual active zones. Thus, DKaiR1D may serve to homeostatically modulate
presynaptic release through modulation of presynaptic voltage and, intriguingly, with
active zone specificity.

Glutamate signaling and homeostatic synaptic plasticity
Our characterization of DKaiR1D has revealed the first role for presynaptic
glutamate signaling in homeostatic plasticity. In the mammalian central nervous
system, glutamate signaling drives the adaptive regulation of postsynaptic AMPA
receptor insertion and removal, known as homeostatic scaling (Turrigiano, 2008).
Further, kainate receptors were recently demonstrated to regulate postsynaptic
homeostatic scaling (Yan et al., 2013). Together with our present study, these results
51
demonstrate that glutamatergic signaling through kainate receptors orchestrate the
potent and adaptive homeostatic control of synaptic strength on both sides of the
synapse. Future studies will reveal the integration between synaptic glutamate
signaling and other forces that modulate synaptic strength to enable robust, flexible,
and stable neurotransmission.

2.5 Methods
Fly Stocks
Drosophila stocks were raised at 25°C on standard molasses food. The w
1118
strain is
used as the wild-type control unless otherwise noted, as this is the genetic
background of the transgenic lines and other genotypes used in this study. The
following fly stocks were used: GluRIIA
SP16
(Petersen et al., 1997), UAS-vGlut (Daniels
et al., 2004), OK6-Gal4 (Aberle et al., 2002), OK371-Gal4 (Mahr and Aberle, 2006), and
G14-Gal4 (Aberle et al., 2002). The DKaiR1D mutant stocks DKaiR1D
1

(PBac{WH}CG3822
f03502
) and DKaiR1D
2
(Mi{ET1}CG3822
MB01010
) as well as the
DKaiR1D deficiency (Df(3R)BSC819) were obtained from the Bloomington Drosophila
Stock Center. Standard second and third chromosome balancers and genetic
strategies were used for all crosses and for maintaining mutant lines.

Molecular Biology
We obtained an EST (RE06730) encoding the entire DKaiR1D open reading frame
from the Berkeley Drosophila Genome Project (www.fruitfly.org). We inserted the
DKaiR1D cDNA into the pACU2 vector (Han et al., 2011) using the following forward
52
and reverse primers to PCR amplify the DKaiR1D open reading frame: F: 5'
agctcgaattaccggtacgcaaaATGCGGTCGAGTGGAGTT 3’ and R: 5’
aggactagttaacatatgctTCATTCGTTCAGTATCGCG 3’. The Gibson Assembly Cloning Kit
(New England Biolabs Inc., E5510S) was used to generate the final construct. We
engineered the DKaiR1D
R
transgene by mutating the 604
th
amino acid Glutamine to
Arginine using the primers F: 5’ gccattggatcgctgatgcgccaaggatgtgact 3’ and R:
5’CTAGGACTAGTGCCATATGCT
CTAGtcattcgttcagtatcg 3’ and cloned this fragment into the pACU2 vector as described
above. Constructs were sequenced to confirm sequence fidelity and orientation.
These constructs were sent to BestGene Inc. (Chino Hill, CA) for recombination-
mediated targeted insertion into the VK18 recombination site on the second
chromosome (Venken et al., 2006).
The region coding for the Brp-short sequence, corresponding to amino acids
473-1226 of the full length Bruchpilot protein (Schmid et al., 2008), was PCR
amplified from genomic DNA extracted from transgenic flies expressing full length
BRP cDNA (Wagh et al., 2006) and subcloned into the pACU2 vector (Han et al., 2011)
using standard methods. Next, we obtained the construct pGP-CMV-GCaMP6s
(plasmid #40753, Addgene) containing the sequence encoding the GCaMP6s calcium
indicator (Chen et al., 2013). We PCR amplified the region corresponding to the
GCaMP6s open reading frame using primers: F: TATCATATGAGCGGGATCTGTACGA
and R: CATACTAGTTCACTTCGCTGTCATC. Lastly, the mCherry sequence was PCR
amplified from genomic DNA of transgenic flies containing UAS-mCherry
(Christiansen et al., 2011) using the following sequences: F:
53
CTGGAGAAGGCGCAAATGGGTTctggtggtGTGAGCAAGGGCGAGGAGGATAAC and R:
CAGATCCCGGCCATATGCTCTAGCTCCCTTGTACAGCTCGTCCATGCC. The Gibson
Assembly Cloning Kit was used to insert the mCherry sequence between the Brps and
GCaMP6s sequences of the pACU2::Brps::GCaMP6s vector to generate the final
construct pACU2-Brps::mCherry::GCaMP6s. This construct was sequenced to confirm
sequence fidelity and orientation and was sent to BestGene for standard P-element
mediated insertion into w
1118
embryos.

Immunochemistry
Third-instar larvae were dissected in ice cold 0 Ca
2+
HL-3 and immunostained as
described (Chen et al., 2017). Briefly, larvae were fixed in either Bouin’s fixative
(Sigma, HT10132-1L) or 4% paraformaldehyde in PBS (Sigma, F8775). Larvae were
washed with PBS containing 0.1% Triton X-100 (PBST) for 30 min, followed by
overnight incubation in primary antibodies at 4°C, washed in PBST, incubation in
secondary antibodies for 2 hours, washed again in PBST, and equilibrated in 70%
glycerol in PBST. Samples were mounted in VectaShield (Vector Laboratories). The
following antibodies were used: mouse anti-Synapsin, 3C11 (1:10; Developmental
Studies Hybridoma Bank; DSHB); mouse anti-Bruchpilot (BRP), (nc82; 1:100; DSHB);
affinity-purified rabbit anti-GluRIII (1:2000; (Marrus et al., 2004)); rabbit anti-GFP
(1:1000; A-11122; Invitrogen) and rat anti-DKaiR1D (1:1000). To generate
polyclonal antibodies against DKaiR1D, we engineered a recombinant protein
consisting of amino acids 31-219 and an N-terminal 10X-His tag. Recombinant
protein was injected into 3 rats by PrimmBiotech, Inc. (Boston, MA), and polyclonal
54
antibodies were affinity purified. Donkey anti-mouse, anti-rat, and anti-rabbit Alexa
Fluor 488-, Cy3, and Rhodamine Red X secondary antibodies (Jackson
ImmunoResearch) were used at 1:400 and Alexa Fluor 647-conjugated goat anti-HRP
(Jackson ImmunoResearch) were used at 1:200.

Whole-mount mRNA in situ hybridization
DKaiR1D mRNA was detected using a protocol based on the “96-well plate RNA in situ
protocol” available at the Berkeley Drosophila Genome Project (BDGP; web site
(http://www.fruitfly.org). In short, mixed-stage embryos were collected, fixed in
3.7% formaldehyde/1×PBS, and prepared for incubation with SP6 or T7 polymerase
generated digoxigenin (DIG)-labeled nucleotide probes. To generate probes, a 1,000
base pair fragment of the DKaiR1D gene was amplified by PCR and TA cloned into the
pGEM-T Easy vector (Promega). The resulting product was used as a template for
T7/SP6 DIG-labeled RNA probe synthesis (Roche). After removal of excess probe,
embryos were incubated with alkaline-phosphatase-conjugated anti-DIG Fab
fragments (Roche). Excess Fab fragments were removed by washing, and a NBT/BCIP
developing reaction was performed.

Western Blotting
Third-instar larval brain and muscle tissue extracts (50 animals of each genotype)
were homogenized in ice cold lysis buffer (10 mM HEPES + 150 mM NaCl, pH 7.4)
mixed with EDTA-free protease inhibitor cocktail (Roche) and run on 4-12% Bis Tris
Plus gels (Invitrogen). After blotting onto PVDF membrane (Novex) and incubation
55
with 5% nonfat milk in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween 20) for
60 min, the membrane was washed once with TBST and incubated with antibodies
against DKaiR1D (1:1000) and α-Tubulin (1:2000; JLA20, DSHB), at 4⁰C overnight.
Membranes were washed three times and incubated with a 1:5000 dilution of
horseradish peroxidase-conjugated anti-rat or anti-mouse secondary antibodies
(Jackson ImmunoResearch) for 2 h. Blots were washed with TBST and developed with
the ECL Plus Western Blotting system (HyGLO).

Confocal imaging and analysis
Samples were imaged using a Nikon A1R Resonant Scanning Confocal microscope
equipped with NIS Elements software and a 100x APO 1.4NA oil immersion objective
using separate channels with laser lines 488 nm, 561 nm, and 637 nm. For
fluorescence quantifications, z-stacks were obtained using identical settings for all
genotypes within an experiment and optimized for detection without saturation of
the signal. Both type 1b and 1s boutons were counted using Synapsin and HRP-
stained NMJ terminals on muscle 6/7 and muscle 4 of segment A3, considering each
Synapsin puncta to be a bouton. The general analysis toolkit in the NIS Elements
software was used to quantify BRP and DKaiR1D puncta, density, and intensity by
applying the same intensity thresholds and filters to binary layers on each of the three
channels for each genotype compared. BRP and DKaiR1D puncta were counted within
a synapse area labeled by HRP. BRP and DKaiR1D intensities were normalized to the
HRP signal intensity, then normalized to wild-type values. Density and intensity
56
measurements based on confocal images were taken from at least twelve synapses
acquired from at least six different animals.
For Ca
2+
imaging experiments, third-instar larvae were dissected and
incubated in ice-cold HL3 containing 2 mM Ca
2+
and 10 mM MNI-caged glutamate
(#1490, Tocris, resuspended in H2O) in the absence or presence of 1 mM NMDA
(Abcam). Control experiments were performed in 0 mM Ca
2+
saline. GCaMP and
mCherry signals were measured at mCherry-positive active zones of type-1b and 1s
boutons synapsing onto muscle 6/7 of abdominal segments A2/A3. Live imaging was
performed using a Nikon A1R Resonant Scanning Confocal microscope equipped with
NIS Elements software. A 60x NIR Apo 1.0W water-dipping objective was used with
laser lines 405 nm, 488 nm and 561 nm. Band scanning at a resonance frequency of
113 fps (512 x 86 pixels) was performed across the field of view. One synapse (4–12
boutons) was imaged each session. Measurements based on calcium imaging were
taken from at least 12 synapses (approximately 100 boutons) from at least 6 animals.
The mCherry-labeled active zones were used as a region of interest (ROI) for photo-
stimulation. Uncaging of MNI-caged glutamate was achieved with 405 nm laser
stimulation for 2 seconds at 1 fps scan speed across an ROI. Data was acquired and
analyzed using the general analysis toolkit in the NIS Elements software.
Fluorescence changes were quantified as ΔF/F = (F(t) — F(baseline)/(F(baseline)),
where F(t) is the fluorescence ratio of GCaMP6s/mCherry in an ROI, and F(baseline)
is the average mean fluorescence ratio of GCaMP6s/mCherry from a 500 ms period
preceding the stimulus.

57
Electron microscopy
EM analysis was performed as described (Chen et al., 2017). Wandering third-instar
larvae were dissected in Ca
2+
-free HL-3 saline and fixed in 2.5%
paraformaldehyde/5.0% glutaraldehyde/0.06% Picric Acid/0.1M cacodylate buffer
for ~18 hours at room temperature. Fillets were rinsed three times for twenty
minutes in 0.1M cacodylate buffer. The larval pelts were then placed in 1% osmium
tetroxide/potassium ferrocyanide mix buffer (1% OsO4,1.5% K4[Fe(CN)6] in water)
for 1 hour at room temperature. After rinsing and dehydration in an Ethanol series,
samples were cleared in propylene oxide and infiltration with half propylene oxide
and half TAAB resin overnight at 4⁰C. The following day, samples were embedded in
fresh TAAB resin. EM sections were obtained on a JEOL 1200EX microscope. The 6/7
muscle region was located by taking 0.5 μm sections, and the bouton regions were
located by taking 90 nm sections until boutons were identified. The blocks were then
trimmed and serial sectioned at 60 nm thickness for approximately 240 sections. The
sections were mounted on Formvar coated single slot grids and viewed at a 25,000x
magnification. Measurements were taken to scale with 10x lupe/micrometer. Images
were analyzed blind to genotype using ImageJ (NIH).

Electrophysiology
All dissections and recordings were performed in modified HL-3 saline (Dickman et
al., 2005; Stewart et al., 1994) containing (in mM): 70 NaCl, 5 KCl, 10 MgCl2, 10
NaHCO3, 115 Sucrose, 5 Trehelose, 5 HEPES, and 0.4 CaCl2 (unless otherwise
specified), pH 7.2. Neuromuscular junction sharp electrode recordings (electrode
58
resistance between 10-35 MΩ) were performed on muscles 6 and 7 of abdominal
segments A2 and A3 in wandering third-instar larvae. Larvae were dissected and
loosely pinned; the guts, trachea, and ventral nerve cord were removed from the
larval body walls with the motor nerve cut, and the preparation was perfused several
times with HL-3 saline. Recordings were performed on an Olympus BX61 WI
microscope using a 40x/0.80 water-dipping objective. Recordings were acquired
using an Axoclamp 900A amplifier, Digidata 1440A acquisition system, and pClamp
10.5 software (Molecular Devices). Electrophysiological sweeps were digitized at 10
kHz and filtered at 1 kHz. Data were analyzed using Clampfit (Molecular devices),
MiniAnalysis (Synaptosoft), Excel (Microsoft), GraphPad Prism, and SigmaPlot
(Systat) software.
Miniature excitatory postsynaptic potentials (mEPSPs) were recorded in the
absence of any stimulation, and cut motor axons were stimulated with a duration of
3 msec to elicit excitatory postsynaptic potentials (EPSPs). An ISO-Flex stimulus
isolator (A.M.P.I.) was used to modulate the amplitude of stimulatory currents.
Intensity was adjusted for each cell, set to consistently elicit responses from both
neurons innervating the muscle segment, but avoiding overstimulation. Average
mEPSP, EPSP, and quantal content were calculated for each genotype with and
without corrections for nonlinear summation (Martin, 1955). Muscle input resistance
(Rin) and resting membrane potential (Vrest) were monitored during each experiment.
Recordings were rejected if the Vrest was above -60 mV, if the Rin was less than 5 MΩ,
or if either measurement deviated by more than 10% during the course of the
experiment. Larvae were incubated with or without philanthotoxin-433 (Sigma; 20
59
μM) and resuspended in HL-3 for 10 mins, as described (Dickman and Davis, 2009;
Frank et al., 2006). Larvae were also incubated with or without NSTX-3 (Enzo Life
Sciences; 20 μM in 0.1% acetic acid) and resuspended in HL-3 for 15 mins, as
described (Frank et al., 2006). For the acute blockade of DKaiR1D by NMDA or AP5,
larvae were dissected and following 10 min incubation with PhTx, the central nervous
system was removed and the larvae were incubated with 1 mM NMDA (Abcam,
ab120052, resuspended in dH20) or 5 mM AP5 (ab120003, resuspended in dH20) for
5 mins, with recordings performed in the continued presence of NMDA or AP5.
The readily releasable pool (RRP) size was estimated by examining cumulative
EPSC amplitudes while recording using a two-electrode voltage clamp (TEVC)
configuration (Muller et al., 2012; Schneggenburger et al., 1999; Weyhersmuller et al.,
2011). Muscles were clamped to -70 mV and EPSCs were evoked with a 60 Hz, 30
stimulus train while recording in 3 mM Ca
2+
HL-3. EPSC amplitudes were calculated
as the difference between peak and baseline before stimulus onset of a given EPSC. A
line fit to the linear phase (stimuli #18-30) of the cumulative EPSC data was back-
extrapolated to time 0. The RRP value was estimated by normalizing the ratio of the
EPSC value at time 0 and the relative change in mEPSP amplitude between respective
genotypes and wild type. The sucrose-sensitive vesicle pool was measured by
recording mEPSPs following application of high sucrose saline (420 nM for 3s) via a
glass pipette at the anterior end of the synapse at muscle 6/7, as described (Muller
and Davis, 2012; Rosenmund and Stevens, 1996).

60
Statistical Analysis
All data are presented as mean +/-SEM. Data were compared using either a one-way
ANOVA, followed by Tukey’s multiple-comparison test, or using a Student’s t-test
(where specified), analyzed using Graphpad Prism or Microsoft Excel software, and
with varying levels of significance assessed as p<0.05 (*), p<0.01 (**), p<0.001 (***),
ns=not significant. See Table S1 for further statistical details and values.

2.6 References
Anggono, V., and Huganir, R.L. (2012). Regulation of AMPA receptor trafficking and
synaptic plasticity. Curr Opin Neurobiol 22, 461-469.
Awatramani, G.B., Price, G.D., and Trussell, L.O. (2005). Modulation of transmitter
release by presynaptic resting potential and background calcium levels. Neuron 48,
109-121.
Baines, R.A., and Bate, M. (1998). Electrophysiological development of central
neurons in the Drosophila embryo. J Neurosci 18, 4673-4683.
Baines, R.A., Robinson, S.G., Fujioka, M., Jaynes, J.B., and Bate, M. (1999). Postsynaptic
expression of tetanus toxin light chain blocks synaptogenesis in Drosophila. Curr Biol
9, 1267-1270.
Bouvier, G., Bidoret, C., Casado, M., and Paoletti, P. (2015). Presynaptic NMDA
receptors: Roles and rules. Neuroscience 311, 322-340.
61
Chen, T.W., Wardill, T.J., Sun, Y., Pulver, S.R., Renninger, S.L., Baohan, A., Schreiter, E.R.,
Kerr, R.A., Orger, M.B., Jayaraman, V., et al. (2013). Ultrasensitive fluorescent proteins
for imaging neuronal activity. Nature 499, 295-300.
Chen, X., Ma, W., Zhang, S., Paluch, J., Guo, W., and Dickman, D.K. (2017). The BLOC-1
Subunit Pallidin Facilitates Activity-Dependent Synaptic Vesicle Recycling. eNeuro 4.
Chittajallu, R., Vignes, M., Dev, K.K., Barnes, J.M., Collingridge, G.L., and Henley, J.M.
(1996). Regulation of glutamate release by presynaptic kainate receptors in the
hippocampus. Nature 379, 78-81.
Daniels, R.W., Collins, C.A., Gelfand, M.V., Dant, J., Brooks, E.S., Krantz, D.E., and
DiAntonio, A. (2004). Increased expression of the Drosophila vesicular glutamate
transporter leads to excess glutamate release and a compensatory decrease in
quantal content. The Journal of neuroscience : the official journal of the Society for
Neuroscience 24, 10466-10474.
Daniels, R.W., Gelfand, M.V., Collins, C.A., and DiAntonio, A. (2008). Visualizing
glutamatergic cell bodies and synapses in Drosophila larval and adult CNS. J Comp
Neurol 508, 131-152.
Davis, G.W., and Goodman, C.S. (1998). Synapse-specific control of synaptic efficacy at
the terminals of a single neuron. Nature 392, 82-86.
Davis, G.W., and Muller, M. (2015). Homeostatic control of presynaptic
neurotransmitter release. Annual review of physiology 77, 251-270.
Dickman, D.K., and Davis, G.W. (2009). The schizophrenia susceptibility gene
dysbindin controls synaptic homeostasis. Science 326, 1127-1130.
62
Ford, K.J., and Davis, G.W. (2014). Archaerhodopsin voltage imaging: synaptic calcium
and BK channels stabilize action potential repolarization at the Drosophila
neuromuscular junction. J Neurosci 34, 14517-14525.
Frank, C.A. (2013). Homeostatic plasticity at the Drosophila neuromuscular junction.
Neuropharmacology.
Frank, C.A., Kennedy, M.J., Goold, C.P., Marek, K.W., and Davis, G.W. (2006).
Mechanisms underlying the rapid induction and sustained expression of synaptic
homeostasis. Neuron 52, 663-677.
Gavino, M.A., Ford, K.J., Archila, S., and Davis, G.W. (2015). Homeostatic synaptic
depression is achieved through a regulated decrease in presynaptic calcium channel
abundance. eLife 4.
Han, C., Jan, L.Y., and Jan, Y.N. (2011). Enhancer-driven membrane markers for
analysis of nonautonomous mechanisms reveal neuron-glia interactions in
Drosophila. Proc Natl Acad Sci U S A 108, 9673-9678.
Kamiya, H. (2002). Kainate receptor-dependent presynaptic modulation and
plasticity. Neurosci Res 42, 1-6.
Karuppudurai, T., Lin, T.Y., Ting, C.Y., Pursley, R., Melnattur, K.V., Diao, F., White, B.H.,
Macpherson, L.J., Gallio, M., Pohida, T., et al. (2014). A hard-wired glutamatergic
circuit pools and relays UV signals to mediate spectral preference in Drosophila.
Neuron 81, 603-615.
Kim, Y.J., Bao, H., Bonanno, L., Zhang, B., and Serpe, M. (2012). Drosophila Neto is
essential for clustering glutamate receptors at the neuromuscular junction. Genes
Dev 26, 974-987.
63
Kneussel, M., and Hausrat, T.J. (2016). Postsynaptic Neurotransmitter Receptor
Reserve Pools for Synaptic Potentiation. Trends Neurosci 39, 170-182.
Lerma, J., and Marques, J.M. (2013). Kainate receptors in health and disease. Neuron
80, 292-311.
Li, Y., Dharkar, P., Han, T.H., Serpe, M., Lee, C.H., and Mayer, M.L. (2016). Novel
Functional Properties of Drosophila CNS Glutamate Receptors. Neuron 92, 1036-
1048.
Marrus, S.B., Portman, S.L., Allen, M.J., Moffat, K.G., and DiAntonio, A. (2004).
Differential localization of glutamate receptor subunits at the Drosophila
neuromuscular junction. J Neurosci 24, 1406-1415.
McGuinness, L., Taylor, C., Taylor, R.D., Yau, C., Langenhan, T., Hart, M.L., Christian, H.,
Tynan, P.W., Donnelly, P., and Emptage, N.J. (2010). Presynaptic NMDARs in the
hippocampus facilitate transmitter release at theta frequency. Neuron 68, 1109-1127.
Muller, M., and Davis, G.W. (2012). Transsynaptic control of presynaptic Ca(2)(+)
influx achieves homeostatic potentiation of neurotransmitter release. Curr Biol 22,
1102-1108.
Muller, M., Liu, K.S., Sigrist, S.J., and Davis, G.W. (2012). RIM controls homeostatic
plasticity through modulation of the readily-releasable vesicle pool. The Journal of
neuroscience : the official journal of the Society for Neuroscience 32, 16574-16585.
Newman, Z.L., Hoagland, A., Aghi, K., Worden, K., Levy, S.L., Son, J.H., Lee, L.P., and
Isacoff, E.Y. (2017). Input-Specific Plasticity and Homeostasis at the Drosophila Larval
Neuromuscular Junction. Neuron 93, 1388-1404 e1310.
64
Pawlu, C., DiAntonio, A., and Heckmann, M. (2004). Postfusional control of quantal
current shape. Neuron 42, 607-618.
Petersen, S.A., Fetter, R.D., Noordermeer, J.N., Goodman, C.S., and DiAntonio, A.
(1997). Genetic analysis of glutamate receptors in Drosophila reveals a retrograde
signal regulating presynaptic transmitter release. Neuron 19, 1237-1248.
Petrovic, M.M., Viana da Silva, S., Clement, J.P., Vyklicky, L., Mulle, C., Gonzalez-
Gonzalez, I.M., and Henley, J.M. (2017). Metabotropic action of postsynaptic kainate
receptors triggers hippocampal long-term potentiation. Nat Neurosci 20, 529-539.
Pinheiro, P.S., and Mulle, C. (2008). Presynaptic glutamate receptors: physiological
functions and mechanisms of action. Nat Rev Neurosci 9, 423-436.
Pinheiro, P.S., Perrais, D., Coussen, F., Barhanin, J., Bettler, B., Mann, J.R., Malva, J.O.,
Heinemann, S.F., and Mulle, C. (2007). GluR7 is an essential subunit of presynaptic
kainate autoreceptors at hippocampal mossy fiber synapses. Proc Natl Acad Sci U S A
104, 12181-12186.
Pozo, K., and Goda, Y. (2010). Unraveling mechanisms of homeostatic synaptic
plasticity. Neuron 66, 337-351.
Rohrbough, J., and Broadie, K. (2002). Electrophysiological analysis of synaptic
transmission in central neurons of Drosophila larvae. J Neurophysiol 88, 847-860.
Rozas, J.L., Paternain, A.V., and Lerma, J. (2003). Noncanonical signaling by ionotropic
kainate receptors. Neuron 39, 543-553.
Rutkowska-Wlodarczyk, I., Aller, M.I., Valbuena, S., Bologna, J.C., Prezeau, L., and
Lerma, J. (2015). A proteomic analysis reveals the interaction of GluK1 ionotropic
kainate receptor subunits with Go proteins. J Neurosci 35, 5171-5179.
65
Schmid, A., Hallermann, S., Kittel, R.J., Khorramshahi, O., Frolich, A.M., Quentin, C.,
Rasse, T.M., Mertel, S., Heckmann, M., and Sigrist, S.J. (2008). Activity-dependent site-
specific changes of glutamate receptor composition in vivo. Nat Neurosci 11, 659-666.
Schmitz, D., Frerking, M., and Nicoll, R.A. (2000). Synaptic activation of presynaptic
kainate receptors on hippocampal mossy fiber synapses. Neuron 27, 327-338.
Schneggenburger, R., Meyer, A.C., and Neher, E. (1999). Released fraction and total
size of a pool of immediately available transmitter quanta at a calyx synapse. Neuron
23, 399-409.
Schneggenburger, R., and Rosenmund, C. (2015). Molecular mechanisms governing
Ca(2+) regulation of evoked and spontaneous release. Nat Neurosci 18, 935-941.
Scott, R., Lalic, T., Kullmann, D.M., Capogna, M., and Rusakov, D.A. (2008). Target-cell
specificity of kainate autoreceptor and Ca2+-store-dependent short-term plasticity at
hippocampal mossy fiber synapses. J Neurosci 28, 13139-13149.
Straub, C., Hunt, D.L., Yamasaki, M., Kim, K.S., Watanabe, M., Castillo, P.E., and Tomita,
S. (2011). Distinct functions of kainate receptors in the brain are determined by the
auxiliary subunit Neto1. Nat Neurosci 14, 866-873.
Takayanagi-Kiya, S., Zhou, K., and Jin, Y. (2016). Release-dependent feedback
inhibition by a presynaptically localized ligand-gated anion channel. Elife 5.
Turrigiano, G.G. (2008). The self-tuning neuron: synaptic scaling of excitatory
synapses. Cell 135, 422-435.
Weyhersmuller, A., Hallermann, S., Wagner, N., and Eilers, J. (2011). Rapid active zone
remodeling during synaptic plasticity. The Journal of neuroscience : the official
journal of the Society for Neuroscience 31, 6041-6052.
66
Wondolowski, J., and Dickman, D. (2013). Emerging links between homeostatic
synaptic plasticity and neurological disease. Front Cell Neurosci 7, 223.
Yan, D., Yamasaki, M., Straub, C., Watanabe, M., and Tomita, S. (2013). Homeostatic
control of synaptic transmission by distinct glutamate receptors. Neuron 78, 687-699.
Yao, C.K., Liu, Y.T., Lee, I.C., Wang, Y.T., and Wu, P.Y. (2017). A Ca2+ channel
differentially regulates Clathrin-mediated and activity-dependent bulk endocytosis.
PLoS Biol 15, e2000931.
Younger, M.A., Muller, M., Tong, A., Pym, E.C., and Davis, G.W. (2013). A presynaptic
ENaC channel drives homeostatic plasticity. Neuron 79, 1183-1196.

67
Figure 2.1: DKaiR1D, a neural kainate-type glutamate receptor subunit, is
required in motor neurons for the acute and long term expression of
presynaptic homeostatic potentiation. (A) Diagram of two transposon insertions
in the DKaiR1D locus (DKaiR1D
1
and DKaiR1D
2
),

and a deficiency that removes this
entire locus (DKaiR1D
Df
; Df(3R)BSC819). (B) in situ hybridization of Drosophila
embryos reveals that DKaiR1D is expressed in the central nervous system, with no
apparent expression in other tissues. Sense strand DNA probe is used as the control.
(C) Immunoblot analysis confirms nervous system expression of DKaiR1D protein
and demonstrates that both mutant alleles are protein nulls. (D) Representative EPSP
and mEPSP traces from electrophysiological recordings of wild type (w
1118
) and
DKaiR1D mutant synapses (DKaiR1D
2
: w
1118
;Mi{ET1}CG3822
MB01010
) before and after
PhTx application at 0.4 mM extracellular Ca
2+
. EPSP amplitude fails to return to
baseline levels in DKaiR1D mutants following PhTx application because there is no
homeostatic increase in presynaptic release (quantal content). (E) Quantification of
mEPSP amplitude and quantal content values after PhTx treatment, normalized to
baseline values of the same genotype. (F) Representative EPSP and mEPSP traces of
motor neuron rescue (MN rescue: w;OK6-Gal4/UAS-DKaiR1D;DKaiR1D
2
) and muscle
rescue (muscle rescue: w;G14-Gal4/UAS-DKaiR1D;DKaiR1D
2
) by tissue-specific
expression of DKaiR1D in the DKaiR1D
2
mutant background following PhTx
application at 0.4 mM extracellular Ca
2+
. (G) Quantification of mEPSP and quantal
content values normalized to baseline values of the same genotype. (H) The chronic
expression of PHP, induced by loss of the postsynaptic GluRIIA receptor subunit,
requires DKaiR1D, and can be restored by presynaptic expression of DKaiR1D.
68
Quantification of mEPSP amplitude and quantal content values at 0.4 mM
extracellular Ca
2+
in the indicated mutant genotypes (w;GluRIIA
SP16
and
w;GluRIIA
SP16
;DKaiR1D
2
)

and MN rescue (w;OK6-Gal4,GluRIIA
SP16
/UAS-DKaiR1D,
GluRIIA
SP16
;DKaiR1D
2
). (I) Representative EPSP and mEPSP traces of wild type and
DKaiR1D mutant synapses incubated with NSTX-3, another neurotoxin that targets
Drosophila postsynaptic glutamate receptors. NSTX-3 was either applied alone or
together with PhTx at 0.4 mM extracellular Ca
2+
. Note that while NSTX-3 induces PHP
at wild-type NMJs, PHP fails to be expressed in DKaiR1D mutants. (J) Quantification
of mEPSP amplitude and quantal content after NSTX-3 application (as well as with
and without PhTx), normalized to baseline values of the same genotype. No
significant differences were observed between NSTX-3 and PhTx treatments in wild
type or DKaiR1D mutant synapses. Error bars indicate ±SEM. Asterisks indicate
statistical significance using one-way analysis of variance (ANOVA), followed by
Tukey’s multiple-comparison test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not
significant. Detailed statistical information for represented data (mean values, SEM,
n, p) is shown in Table S1.

69

70
Figure 2.2: Altered calcium cooperativity and short term plasticity in DKaiR1D
mutant synapses. (A) Representative electrophysiological recordings at 0.2 mM
extracellular Ca
2+
reveals reduced baseline transmission in DKaiR1D
2
mutants. (B)
Quantal content in wild type, DKaiR1D
1
, and DKaiR1D
2
mutants plotted as a function
of extracellular Ca
2+
concentration on logarithmic scales. Note that DKaiR1D mutants
have increased apparent slopes (wild type= 1.002; DKaiR1D
1
=2.248 (***), and
DKaiR1D
2
=2.126 (***)). (C) Increased short term facilitation is observed in DKaiR1D
2
mutants. EPSP values at each stimulus are normalized to the starting EPSP value
during a train of 50 stimuli at 20 Hz. (D) Representative traces of homeostatically
depressed synapses induced by presynaptic overexpression of the vesicular
glutamate transporter alone (vGlut-OE: w;OK371-Gal4/UAS-vGlut) or in combination
with the DKaiR1D mutation (DKaiR1D+vGlut-OE: w;OK371-Gal4/UAS-
vGlut;DKaiR1D
2
). Note the increased mEPSP amplitude but normal EPSP amplitude,
indicating a homeostatic decrease in quantal content. (E) Quantification of mEPSP
amplitude and quantal content values normalized as a percentage of wild-type values.
(F) Representative mEPSP and EPSP traces of the indicated genotypes at 0.2 mM
extracellular Ca
2+
concentrations. Note the large reduction in EPSP amplitude in
DKaiR1D+vGlut-OE. Error bars indicate ±SEM. Asterisks indicate statistical
significance using one-way analysis of variance (ANOVA), followed by Tukey’s
multiple-comparison test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not significant.
Detailed statistical information for represented data (mean values, SEM, n, p) is
shown in Table S1.

71

72
Figure 2.3: Elevated extracellular Ca
2+
restores PHP expression in DKaiR1D
mutants. (A) Representative EPSC traces of the indicated genotypes. Although PHP
is blocked in DKaiR1D mutants at lower extracellular calcium (0.4 mM), PHP
expression is restored in high calcium (3 mM). (B) Quantification of EPSC amplitudes
in the indicated genotypes. (C) Representative EPSC traces of 30 stimuli at 60 Hz. (D)
Estimated RRP sizes for the indicated genotypes under baseline and in GluRIIA
mutant backgrounds. (E) Recordings from wild type and DKaiR1D mutants using high
sucrose (420 nM for 3s, red bar) to evoke vesicle release. (F) Quantification of mEPSP
events per second as a measure of the hypertonic sucrose-sensitive vesicle pool. Error
bars indicate ±SEM. Asterisks indicate statistical significance using one-way analysis
of variance (ANOVA), followed by Tukey’s multiple-comparison test: (*) p<0.05; (**)
p<0.01; (***) p<0.001; (ns) not significant. Detailed statistical information for
represented data (mean values, SEM, n, p) is shown in Table S1.
73

74
Figure 2.4. Endogenous DKaiR1D receptors localize to synaptic neuropil and to
presynaptic terminals when overexpressed. Representative images of the ventral
nerve cord (VNC) in wild type (A) and DKaiR1D mutants (B) immunostained with
anti-DKaiR1D and anti-BRP. DKaiR1D is enriched in synapse-rich areas of the
neuropil (highlighted by BRP signal), and is absent in DKaiR1D mutants. (C) DKaiR1D
puncta are observed near BRP positive active zones at presynaptic NMJ terminals
when overexpressed in motor neurons (DKaiR1D-OE: w;OK6-Gal4/UAS-DKaiR1D)
and immunostained with anti-DKaiR1D and anti-BRP. Quantification of BRP and
DKaiR1D puncta density in DKaiR1D-OE (D), percent BRP puncta co-localized with
DKaiR1D puncta in wild-type synapses and DKaiR1D-OE (E), and fluorescence
intensities of BRP and DKaiR1D puncta normalized to wild type backgrounds (F).
Error bars indicate ±SEM. Asterisks indicate statistical significance using t-test: (*)
p<0.05; (**) p<0.01; (***) p<0.001; (ns) not significant. Detailed statistical
information for represented data (mean values, SEM, n, p) is shown in Table S1.

75

76
Figure 2.5: Glutamate uncaging induces calcium influx through DKaiR1D
receptors at active zones. (A) Schematic illustrating the design of the
BRPs::mCherry::GCaMP6s active zone calcium indicator. (B) mCherry and GCaMP6s
(immunostained with anti-GFP) localize to BRP-positive active zones
(immunostained with anti-BRP) when this indicator is expressed in motor neurons
(w;OK6-Gal4/UAS-BRPs::mCherry::GCaMP6s). (C) Glutamate uncaging at motor
neuron terminals expressing BRPs::mCherry::GCaMP6s reveals a GCaMP signal at
individual active zones (visualized with mCherry fluorescence) in 2 mM extracellular
calcium. No change in the GCaMP signal is observed when glutamate is uncaged in the
presence of the DKaiR1D antagonist NMDA (1 mM). (D) Quantification of GCaMP and
mCherry fluorescence intensities (ΔF/F) at individual active zones following
glutamate photo-uncaging in 2 mM extracellular Ca
2+
, 0 mM extracellular Ca
2+
, 2 mM
Ca
2+
plus NMDA (1 mM extracellular NMDA), and 2 mM Ca
2+
in DKaiR1D
2
mutants. (E)
Quantification of GCaMP6s/mCherry fluorescence ratios at 2 mM and 0 mM
extracellular Ca
2+
. (F) Quantification of the percentage of synapses responding to
glutamate photo uncaging (+405 nm) imaged in 2 mM extracellular Ca
2+
with and
without 1 mM NMDA and in DKaiR1D
2
mutants. Error bars indicate ±SEM. Asterisks
indicate statistical significance using one-way analysis of variance (ANOVA), followed
by Tukey’s multiple-comparison test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not
significant. Detailed statistical information for represented data (mean values, SEM,
n, p) is shown in Table S1.
77

78
Figure 2.6: Acute pharmacological blockade of DKaiR1D disrupts the
expression but not induction of PHP. (A) NMDA application to wild-type NMJs
reduces baseline transmission in 0.2 mM extracellular calcium, but has no effect on
DKaiR1D mutants in this condition. Representative mEPSP and EPSP traces in wild
type and DKaiR1D
2
mutants recorded in baseline or 1 mM NMDA

added to 0.2 mM
Ca
2+
saline. Quantification of EPSP (B) and mEPSP (C) amplitudes in the conditions
indicated. (D) NMDA application to wild-type NMJs blocks PHP expression.
Representative mEPSP and EPSP traces recorded in 1 mM NMDA and 0.4 mM Ca
2+
in
wild type and DKaiR1D mutants with or without PhTx application. (E) Quantification
of mEPSP and quantal content values following PhTx application in the indicated
genotypes and conditions. (F) DKaiR1D is not required for the induction of PHP.
Representative traces and quantification of wild-type NMJs incubated in NMDA
before rapidly washing out NMDA and recording. (G) Reversible blockade of PHP
expression by NMDA. Representative traces and quantification of wild-type NMJs
following PhTx application and NMDA washout. Note that the motor axon is severed
and the central nervous system is removed before all recordings. Error bars indicate
±SEM. Asterisks indicate statistical significance using one-way analysis of variance
(ANOVA), followed by Tukey’s multiple-comparison test: (*) p<0.05; (**) p<0.01;
(***) p<0.001; (ns) not significant. Detailed statistical information for represented
data (mean values, SEM, n, p) is shown in Table S1.

79

80
Figure 2.7: Calcium permeability through DKaiR1D receptors is necessary for
baseline transmission but not for PHP expression. (A) Calcium permeability
through DKaiR1D is necessary to potentiate baseline release at low extracellular
calcium. Representative mEPSP and EPSP traces in indicated genotypes. Motor
neuron rescue with DKaiR1D
Q
(w;OK6-Gal4/UAS-DKaiR1D
Q
; DKaiR1D
2
)

or DKaiR1D
R

(w;OK6-Gal4/UAS-DKaiR1D
R
;DKaiR1D
2
) transgenes expressed in DKaiR1D
2
mutant
backgrounds. (B) Quantification of EPSP amplitudes in indicated genotypes. (C)
Calcium permeability through DKaiR1D is not required for PHP expression.
Representative traces of indicated genotypes. (D) Quantification of indicated
genotypes following PhTx application. Error bars indicate ±SEM. Asterisks indicate
statistical significance using one-way analysis of variance (ANOVA), followed by
Tukey’s multiple-comparison test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not
significant. Detailed statistical information for represented data (mean values, SEM,
n, p) is shown in Table S1.

81

82
CHAPTER 3

AN AUXILIARY GLUTAMATE RECEPTOR SUBUNIT NECESSARY FOR SYNAPTIC
EFFICACY AND HOMEOSTATIC PLASTICITY

3.1 Summary
Kainate-type glutamate receptors (KARs) have crucial functions in modulating
synaptic function and plasticity. Recently, KARs have been demonstrated to operate
on both sides of the synapse to orchestrate the homeostatic control of synaptic
strength. However, the molecules and physiological mechanisms that regulate KAR
trafficking, expression, and function during homeostatic plasticity is not known.
Through a targeted forward genetic screen in Drosophila, we have identified a novel
auxiliary KAR subunit with homology to the neto family, which we named neto-like
(neli). Here, we show that neli is necessary in the presynaptic neuron for robust levels
of synaptic strength and is absolutely required for the retrograde, homeostatic
potentiation of presynaptic release following loss of postsynaptic neurotransmitter
receptor functionality at the neuromuscular junction (NMJ). We find neli is
exclusively expressed in the nervous system and has no apparent roles in
postsynaptic muscle. Further, we demonstrate that neli requires the activity of neural
KAR DKaiR1D to promote presynaptic release. Interestingly, this neli-mediated, KAR-
dependent potentiation of release occludes the expression of homeostatic
potentiation when combined at a single synapse. We show that neli levels promote
delivery and stabilization of KAR DKaiR1D to active zones for basal release and
83
homeostatic potentiation. Finally, we demonstrate that other neto family proteins
might have conserved functions in presynaptic KAR trafficking. Together, we define
neli as an auxiliary KAR subunit that controls synaptic strength by modulating KAR
expression, localization, and/or function at individual active zones to homeostatically
tune neurotransmitter release during adaptive plasticity.

84
3.2 Introduction
The nervous system has potent and adaptive homeostatic signaling systems that
maintain stable synaptic function despite the myriad changes that occur during
neural development, maturation, and aging. At synapses, perturbations that enhance
or inhibit synaptic activity result in compensatory changes in postsynaptic ion
channels or presynaptic efficacy that restores baseline levels of activity, a
phenomenon called homeostatic synaptic plasticity (Davis and Muller, 2015;
Turrigiano, 2012; Turrigiano, 2008). Precedent evidence suggests that a global
homeostat scales all synapses of a neuron to a fixed set point of activity (Turrigiano,
2008). Nevertheless, there is also evidence for heterogeneity in presynaptic efficacy
and release probability within the synapses of a single neuron (Dobrunz and Stevens,
1997; Holderith et al., 2012). Therefore, it is not known how individual synapses with
differing properties respond to such global homeostatic signals. Remarkably,
individual mature synapses are shown to autonomously detect changes in their
activity levels, independent of the neighboring synapses, and homeostatically
compensate for the change in activity by utilizing the early immediate gene arc
(Beique et al., 2011). However, how individual synapses are modulated by such
homeostatic systems, especially in short time scales, and the molecular mechanisms
underlying for such rapid, synapse specific adaptation still remain largely unknown.
A powerful model of presynaptic homeostatic plasticity has been established
at the Drosophila neuromuscular junction (NMJ). Here, genetic and pharmacological
manipulations that reduce postsynaptic (muscle) glutamate receptor function trigger
a trans-synaptic, retrograde feedback signal to the neuron that increases presynaptic
85
release to precisely compensate for this perturbation (Frank, 2013; Frank et al., 2006;
Petersen et al., 1997). Thus, while the postsynaptic response to the release of
neurotransmitter from individual synaptic vesicles is reduced (mEPSP amplitude or
quantal size), overall muscle excitation (EPSP amplitude) is maintained at normal
physiological levels because of this compensatory increase in presynaptic release
(quantal content). This form of plasticity is achieved through an increase in
presynaptic efficacy and is therefore referred to as presynaptic homeostatic
potentiation (PHP). Here, PHP signaling is compartmentalized at the terminals of a
single motor neuron and is orchestrated at specific presynaptic terminals (Li et al.,
2018). Interestingly, we previously demonstrated that DKaiR1D is a presynaptic
kainate-type glutamate autoreceptor that is required for PHP expression. It is
localized at or near presynaptic release sites with the capacity to modulate release
with active zone specificity (Kiragasi et al., 2017). However, it is not clear how
DKaiR1D promotes the expression of presynaptic homeostatic plasticity. What is
changing in DKaiR1D to acquire a novel influence on release at individual release sites
following the induction of homeostatic plasticity?
The activity, levels, and/or localization of synaptic glutamate receptors
(GluRs) can change through associations with subunits that alter functionality during
synaptic plasticity (Chater and Goda, 2014; Lerma and Marques, 2013). Intriguingly,
auxiliary subunits play a critical role in the facilitation and regulation of GluR receptor
trafficking and function during adaptation of synaptic function (Sheng et al., 2015;
Straub et al., 2011; Tomita, 2010). Indeed, in vivo functional mature glutamate
receptors require an auxiliary subunit for ER exit and surface expression (Tomita et
86
al., 2003). At mammalian synapses, kainate receptors require auxiliary subunit neto
for modulation of receptor levels and activity (Straub et al., 2011). However, it is not
known whether KAR DKaiR1D interacts with an auxiliary subunit. In Drosophila,
there is a single neto gene, necessary for postsynaptic glutamate receptor trafficking
and function in the somatic muscle (Kim et al., 2012); however, it is unknown whether
it has a presynaptic function in the nervous system, specifically in PHP.
Here, in search of an auxiliary subunit for the Drosophila kainate receptor DKaiR1D,
we identified a novel gene, which we named neto-like (neli), that is necessary for PHP
expression. This auxiliary GluR subunit requires presynaptic KAR DKaiR1D to
promote glutamate release. Further, neli can traffic and/or modulate DKaiR1D
activity at individual active zones to potentiate neurotransmission during synaptic
plasticity, suggesting a new synapse-specific molecular mechanism underlying
modulations in homeostatic plasticity at distinct synapses. Finally, our study suggests
that KAR auxiliary subunits from other species might have conserved functions in
regulating presynaptic GluR trafficking and function, indicating a universal
mechanism for compartmentalized homeostatic control of synaptic function at
individual release sites.

87
3.3 Results

No evidence for neural metabotropic or ionotropic GluR function, other than
DKaiR1D, in PHP.
Previously, in the course of an electrophysiology-based, forward genetic screen to
isolate genes necessary for PHP, we identified and characterized DKaiR1D, an
ionotropic kainate-type glutamate receptor subunit, that is required in motor neuron
terminals to homeostatically increase presynaptic release following acute application
of Philanthotoxin-433 (PhTx), a drug that specifically blocks postsynaptic glutamate
receptors at the Drosophila NMJ (Frank et al., 2006; Kiragasi et al., 2017). Vertebrate
GluR subunits form homomeric as well as heteromeric functional receptor complexes
(Ayalon and Stern-Bach, 2001). It has been shown that DKaiR1D can function as
homomers in vitro (Li et al., 2016). However, it is unknown, in vivo, whether DKaiR1D
heteromerizes in complexes with other pore-forming subunits to maintain
homeostatic adaptation of synaptic strength. Indeed, there are 9 other GluR genes in
the Drosophila genome predicted to encode ionotropic pore-forming GluR subunits
(Fig.1A) and their role in PHP has not been investigated. Therefore, we performed a
targeted electrophysiology-based genetic screen to test if other ionotropic GluR
subunits are also needed for PHP. At wild type synapses, within 10 mins following
application of PhTx, mEPSP amplitudes are reduced but EPSP amplitudes are
maintained at baseline values because of a homeostatic increase in presynaptic
release (Frank et al., 2006). Similarly, all the putative mutants of other GluRs also
showed a homeostatic increase in quantal content after PhTx application (Fig.1B).
88
Although those were not demonstrated null mutations, we found no evidence for
heteromeric receptor function in PHP.
Further, kainate receptors are shown to have non-canonical metabotropic
activity in synaptic function (Petrovic et al., 2017; Rozas et al., 2003). Therefore, we
considered the possibility that KAR DKaiR1D might utilize metabotropic signaling in
PHP. In order to examine the role of metabotropic signaling, we first blocked G
protein activity in motor neurons by expressing Gi/o protein inhibitor Pertussis toxin
(Mangmool and Kurose, 2011). This toxin had no impact on baseline mEPSP or EPSP
amplitudes, and after the application of PhTx, quantal content increased, suggesting
that Pertussis toxin-sensitive G Protein signaling is not involved in PHP (Fig.1B).
Finally, we tested the role of the single metabotropic glutamate receptor subunit
mGLuRA in PHP, and found no evidence that it is involved in potentiation of release
(Fig.1B). Together, these results suggest that DKaiR1D is the only pore-forming KAR
subunit involved in homeostatic potentiation and metabotropic GluR activity is not
required in PHP signaling.

Neuronal neto expression promotes baseline neurotransmitter release but is
dispensable for PHP expression.
Auxiliary subunits play a critical role in the facilitation and regulation of GluR
receptor trafficking and function during synaptic plasticity (Chater and Goda, 2014;
Tomita, 2010). Indeed, in vivo functional AMPA and kainate receptors are suggested
to always associate with at least one auxiliary subunit (Haering et al., 2014; Tomita et
al., 2003). However, it is unknown whether KAR DKaiR1D similarly interacts with an
89
auxiliary subunit when modulating presynaptic release at the NMJ. KARs interact
with auxiliary subunit Neto (Straub et al., 2011); therefore, Drosophila Neto (dNeto)
is an obvious candidate for DKaiR1D. In fact, dNeto is essential in muscle, necessary
for the trafficking and function of postsynaptic GluRs in baseline function (Kim et al.,
2012). Nevertheless, it is unclear whether it has a neuronal function in release,
specifically in PHP. Therefore, we sought to test if dNeto is necessary, presynaptically,
for homeostatic potentiation of release.
We took a genetic approach to generate neto mutant animals that are null
everywhere but the muscle tissue. First, we generated a null mutation in neto gene,
named neto
BY1
, using CRiSPR Cas-9 strategy and confirmed that neto
BY1
is
homozygous lethal due to essential function of neto in muscle (Kim et al., 2012)
(Fig.1C). We next rescued lethality by expressing Neto cDNA postsynaptically in
muscle in neto
BY1
background (neto
BY1
+ muscle > NetoA), which ensured normal
postsynaptic Neto activity and normal mEPSC amplitudes (Fig.1D,E). However,
surprisingly, EPSC amplitudes were reduced in this presynaptic null condition
(Fig.1F), with a corresponding decrease in quantal content (Fig.1G), suggesting that
neto, presynaptically, might promote baseline release. Further, in order to test its role
in PHP, we applied PhTx onto these animals and observed a reduction in mEPSC
values as expected (Fig.1D,E); however, EPSC amplitudes stayed the same (Fig.1F),
with an increase in quantal content (Fig.1G,H), indicating intact PHP. In addition, we
confirmed that over-expression of neto in muscle did not affect mEPSC, EPSC
amplitudes and PHP expression in wild type animals (Fig.1D-G). Overall, these results
90
suggest that although neto in motor neuron terminals seems to promote basal
release, it is dispensable for homeostatic synaptic potentiation.

The auxiliary glutamate receptor neto-like (neli) is necessary for PHP
expression.
Auxiliary subunits play a critical role in the facilitation and regulation of GluR
receptor trafficking and function during synaptic plasticity (Chater and Goda, 2014;
Tomita, 2010) Indeed, in vivo functional AMPA and kainate receptors are suggested
to always associate with at least one auxiliary subunit (Haering et al., 2014; Tomita et
al., 2003). However, it is unknown whether KAR DKaiR1D similarly interacts with an
auxiliary subunit when modulating presynaptic release at the NMJ. Importantly, the
identified homolog of auxiliary KAR subunit neto in Drosophila has postsynaptic
functions in the somatic muscle with no obvious presynaptic role in PHP ((Kim et al.,
2012) and Fig.1G)). Therefore, we considered the possibility that an unidentified
subunit could instead interact with DKaiR1D in neurons to assist them in basal
release and PHP. Indeed, there are 4 other genes in the Drosophila genome, predicted
to encode GluR auxiliary subunits, especially one with close homology to neto due to
the presence of signature CUB domain structures (Fig.2A). In the course of a genetic
screen on the putative mutants of those genes, we identified a mutant that failed to
homeostatically increase presynaptic release following PhTx application (Fig.2B).
This mutation contained a MiMIC cassette insertion into an intronic region of a gene
called, CG34402, predicted to encode an auxiliary GluR subunit (Fig.2C). This is an
uncharacterized gene in Drosophila with no known molecular function or ortholog
91
reported in vertebrates. Phylogenetic analysis revealed the presence of CUB domains
in this gene and a resulting structural similarity to neto protein family (Fig.2A,B);
therefore, we named it neto-like (neli).
Next, we sought to validate the requirement of neli for PHP and generated two
null mutations in neli, neli
BK1
and neli
BK2
, using CRiSPR/Cas9 genome editing
technology (Gratz et al., 2013). These mutations encode a frameshift mutation,
predicted to generate a stop codon at position 23 and 41 respectively, truncating the
protein right after the signal peptide and before the first CUB domain (Fig.3C). Neto
auxiliary proteins function with kainate receptors that contribute to both
postsynaptic currents and presynaptic facilitation (Straub et al., 2011). Indeed,
C.elegans ortholog of neli is called Sol1 (suppressor of lurcher 1) and is demonstrated
to be an auxiliary subunit of postsynaptic AMPA-type glutamate receptors that drive
baseline neurotransmission (Zheng et al., 2006; Zheng et al., 2004). Therefore, we
characterized baseline synaptic function in addition to homeostatic potentiation in
neli mutants. We found no significant change in mEPSP amplitudes; however, baseline
EPSP amplitudes were significantly reduced in neli mutants (Fig.2D). Moreover,
following acute inhibition of postsynaptic glutamate receptors by application of PhTx,
mEPSP values were reduced, and EPSP values were reduced further down, indicating
no homeostatic increase in presynaptic release in either mutant allele alone, or in
mutant alleles in trans to each other and to a deficiency that removes the entire neli
locus (Fig.2D,E). Finally, we recorded mEPSC and EPSCs in two-voltage clamp method
as well and validated neli to be necessary for homeostatic increase in presynaptic
92
release in addition to a potential function in driving basal synaptic strength at the
NMJ.

Neuronal expression of neli is required to promote baseline neurotransmission
and PHP.
Vertebrate GluR auxiliary subunits have tissue specific expression and function in the
mammalian CNS (Haering et al., 2014; Menuz et al., 2008). We putatively identified
neli as an auxiliary GluR subunit in neurotransmission and homeostatic potentiation;
however, the expression pattern of neli is not known. Since it is predicted to be a
glutamate receptor auxiliary subunit, we hypothesized it requires a GluR complex
with pore forming domains to interact with. Therefore, we considered two possible
places for neli to function. On one hand, it might work with postsynaptic GluRs, like
neto, in the somatic muscle and mediate postsynaptic responsiveness to glutamate
and perhaps involved in the induction of PHP. However, we did not observe a change
in mEPSP or mEPSC amplitudes ( Fig.2D,F) or kinetics in neli mutants that would
suggest such a role. In addition, postsynaptic glutamate receptors were expressed
and localized at normal levels in neli mutants.
On the other hand, neli might function on the presynaptic terminals,
potentially with the presynaptic KAR receptor DKaiR1D. In order to see if neli is
expressed in the nervous system or in the somatic muscle, we cloned the region 4 kb
upstream of the neli start codon, that would presumably include neli gene regulatory
elements including the promoter, before the yeast transcription activator protein
Gal4 sequence and generated neli-Gal4. First, we drove the expression of GFP under
93
neli-Gal4 and observed GFP signal in the brain, including motor neuron axons and
terminals, with no signal detected in the postsynaptic muscle (Fig.3A). Therefore,
neli-Gal4 expression pattern suggests that neli is exclusively expressed in the nervous
system. Second, we tested functionality of neli-Gal4 and checked if neli cDNA
expression functionally rescues the baseline function and PHP in neli mutant
synapses. We observed that expressing neli using neli-Gal4 did not have an impact on
mEPSCs, as expected (Fig.3B,C); and restored baseline synaptic strength to wild type
amplitudes, whereas baseline EPSC stayed reduced to neli mutant levels when neli is
expressed in muscle (Fig.3B,D). Importantly, neli expression in neurons, not in
muscle, also rescued the block in PHP (Fig.3B,E). Together, these results suggest that
neli is expressed and required in neurons, not in the postsynaptic muscle, to promote
baseline neurotransmission and PHP.

Neli and DKaiR1D together promote basal presynaptic neurotransmitter
release.
We have previously shown that presynaptic kainate receptor DKaiR1D is required for
PHP in motor neurons at or near the active zones (Kiragasi et al., 2017). Further,
calcium influx through DKaiR1D is required for tuning of baseline release as
evidenced by a reduction in baseline transmission in DKaiR1D mutants at limiting
calcium concentrations (Kiragasi et al., 2017). Therefore, we hypothesized that neli
might be promoting release together with DKAiR1D at presynaptic terminals. In
order to test that, we probed baseline synaptic function at low calcium in DKaiR1D
and neli single mutant synapses as well as in synapses where the two mutations are
94
combined. If presynaptic DKaiR1D and neli regulate synaptic strength in the same
genetic pathway, we predicted that double mutant synapses would not exhibit an
additional reduction in baseline neurotransmission. First, we observed that EPSC
values at low calcium concentrations (0.3 mM) are severely reduced in neli mutants,
similar to EPSC levels in DKAiR1D mutant synapses. Interestingly, when recorded
from the neli + DKaiR1D double mutant condition, EPSC amplitude and quantal
content is reduced to the same level as single mutants (Fig.4A-D), consistent with the
hypothesis that neli and DKaiR1D function together in the same genetic pathway to
promote baseline neurotransmission.
Moreover, NMDA has been shown to be an antagonist of DKaiR1D homomers
in vitro (Li et al., 2016). Also, we have previously demonstrated that, in vivo, NMDA
blocks PHP and also reduces baseline release by inhibiting DKaiR1D receptors
(Kiragasi et al., 2017). Therefore, we applied NMDA onto neli mutant synapses to
acutely block the DKAiR1D activity to examine if neli and DKaiR1D are also in the
same molecular pathway. First, we confirmed that acute application of NMDA reduces
baseline release in wild type to DKaiR1D mutant levels, with no effect on mEPSCs.
Second, application of NMDA onto DKaiR1D mutant synapses did not impact the
reduction in release, as expected; since they lack the endogenous target receptors
(Fig.4E-H). Finally, we observed that acute aplication of NMDA onto neli mutant
synapses did not impact EPSC amplitudes any further, with no effect on mEPSCs
(Fig.4E-H), all consistent with the hypothesis that neli and DKaiR1D promote baseline
release together.

95
DKaiR1D is necessary for neli to promote presynaptic neurotransmitter
release.
Loss of neli at the presynaptic terminals reduces synaptic strength and inhibits
homeostatic potentiation, suggesting that its function is required for promoting
robust levels of synaptic transmission despite perturbations. Next, we wanted to test
if high levels of neli at presynaptic terminals perhaps modulate release in a similar
manner. Therefore, we over-expressed neli in motor neurons using a high expression
enhancer trap, ok6-Gal4 (wild type + neli OE) and examined the electrophysiology at
the NMJ. In this neli gain of function synapse, mEPSC amplitudes were similar to wild
type levels, suggesting that neli overexpression did not affect postsynaptic glutamate
receptor functionality (Fig.5A,B). However, strikingly, we observed a significant
increase in EPSC amplitudes (Fig.5A,C) in neli OE synapses and a corresponding
increase in quantal content (almost by 100%) (Fig.5A,D), suggesting that gain of
function in neli in motor neurons induces an enhancement in presynaptic release to
the levels observed in PHP.
Next, we asked if, like PHP, neli-mediated enhancement of release requires
presynaptic KAR DKaiR1D activity. In order to test that, we first overexpressed neli
at DKaiR1D mutant synapses. DKaiR1D mutants show a significant reduction in EPSC
amplitudes (Fig.5A,C). If DKaiR1D activity is not necessary for neli-mediated
potentiation, we expected that over-expressing neli in DKaiR1D mutant synapses
(DKaiR1D + neli OE) should rescue the reduction in baseline to neli OE levels.
Nevertheless, we observed that DKaiR1D + neli OE synapses still have a severe
reduction in EPSC amplitudes and quantal content, and that is not significantly
96
different from DKaiR1D mutants alone (Fig.5A-D). Therefore, it suggests that
DKaiR1D is genetically needed for neli-induced and mediated enhancement of
presynaptic release. Since these perturbations are expressed throughout the
development, we considered that lack of DKaiR1D in motor neurons might somehow
disable the presynaptic terminal to potentiate release in response to neli OE due to
secondary developmental effects. Therefore, we next blocked DKaiR1D activity
acutely in a neli-potentiated synapse by application of DKaiR1D antagonist NMDA to
the neli OE preparation (neli OE + NMDA). We observed that NMDA had no effect on
mEPSCs, as expected, (Fig.5A,B); however, it significantly reduced EPSCs (Fig.5A,C)
and quantal content (Fig.5A,D), to the levels of wild type synapses with DKaiR1D
blokade by NMDA application (wild type + NMDA). Overall, these results suggest that
neli promotes presynaptic release similar to PHP levels and acute activity of DKaiR1D
is necessary both for neli-mediated promotion of presynaptic neurotransmitter
release and for PHP.

Neli-induced potentiation occludes PHP expression downstream of BRP
remodeling.
Although both PhTx application and neli overexpression induce a similar
enhancement in presynaptic release and both require DKaiR1D activity, it is not
known whether they use a shared postsynaptic induction mechanism and retrograde
signaling system. Moreover, apart from the common requirement of presynaptic
DKaiR1D in both processes, to what extend they utilize distinct or shared presynaptic
modulations at the motor neuron terminal is also not known. Importantly, it has been
97
recently shown that different induction mechanisms can converge onto a retrograde
signaling and ultimately utilize shared presynaptic modulations to drive the
enhancement of presynaptic release at the Drosophila NMJ (Goel et al., 2017).
Therefore, we next wanted to examine whether separate or shared molecular
signaling operates at the NMJ in PhTx- and neli-induced potentiation.
We first determined whether an additional enhancement in presynaptic
release could occur when the two manipulations are combined at a single synapse.
An additional increase in release would then suggest that separate molecular
signaling systems drive release independently at synaptic terminals. First, we applied
PhTx to a wild type synapse and observed an expected reduction in mEPSC amplitude,
but EPSC amplitude is maintained at baseline level due to an increase in quantal
content (Fig.6A,B). Second, we applied PhTx to a neli OE synapse which has normal
baseline mEPSC and increased EPSC amplitudes with enhanced basal quantal release
(Fig.6A,B). PhTx application led to a decrease in mEPSC amplitudes in neli OE
synapses. However, surprisingly, it also resulted in a reduction in EPSC amplitudes
and no change was observed in quantal content (Fig.6A,B). This demonstrates that
synapses potentiated by neli are incapable of further potentiating release after PhTx
application. Third, we applied PhTx to neli OE synapses lacking DKaiR1D receptors
(DKaiR1D + neli OE) and as expected we observed both a reduction in baseline EPSCs
and same levels of quantal content after PhTx, since DKaiR1D is required for
potentiation of release by either manipulation (Fig.6A,B).
Together, these results suggest that neli-induced potentiation occludes PHP
when combined at a single synapse. One possibility is that neli- and PhTx-induced
98
potentiation utilize the same postsynaptic induction and presynaptic expression
mechanisms; therefore, PHP cannot be induced and/or expressed at a neli
potentiated synapse. Alternatively, they employ different molecular signaling
systems until they ultimately converge onto DKaiR1D receptors, that are perhaps
operating at a maximum level at the active zones in a neli potentiated synapse;
therefore, this occludes further potentiation upon arrival of PhTx-induced retrograde
signal. In order to differentiate between these models, we went onto look at pre- and
postsynaptic molecular markers that are modulated during PHP.
Postsynaptically, there is genetic evidence that muscle CamKII plays a role in
PHP at the Drosophila NMJ (Haghighi et al., 2003). Specifically, recent work reports a
local decrease in phosphorylated CamKII levels at postsynaptic densities during
PhTx-induced acute and long term PHP (Goel et al., 2017; Newman et al., 2017).
Therefore, we examined if neli utilizes the same CamKII-dependent mechanism to
potentiate release. We first confirmed a reduction in pCamKII immunostaning in wild
type postsynaptic densities after 10 min of PhTx application (Fig.6C,D). Next, we
found that in both neli OE and DKaiR1D + neli OE synapses, baseline pCamKII levels
were similar to wild type levels (Fig.6C,D), suggesting that presynaptic neli does not
share the postsynaptic modulations in PHP to promote release. Further, pCamKII
levels decreased after the application of PhTx in both neli OE and DKaiR1D + neli OE
postsynaptic densities (Fig.6C,D), demonstrating that PHP was postsynaptically
induced but not expressed presynaptically at these NMJs. Therefore, we decided to
finally probe the presynaptic modifications involved in PHP expression.
99
Presynaptically, it has been shown that the active zone scaffold protein
bruchpilot (BRP) levels increase following PHP induction by PhTx, suggesting that the
active zone is enhanced in PHP (Goel et al., 2017; Weyhersmuller et al., 2011).
Importantly, GluRIIA and Tor induced potentiation mechanisms also utilize BRP
enhancement, suggesting that it is a shared presynaptic modulation and perhaps a
biomarker for labeling potentiated synaptic terminals (Goel et al., 2017). Therefore,
in order to test if neli utilizes the same presynaptic active zone remodeling, we looked
at BRP levels in neli OE synapses. First, we immunostained wild type synapses against
BRP and confirmed a significant increase in BRP puncta sum intensity after PhTx
application (Fig.6E,F). Second, we went onto measure BRP puncta intensity in neli OE
synapses and, surprisingly, found that BRP puncta sum intensity was
indistinguishable from that of wild type synapses (Fig.6E,F), suggesting that neli,
unlike other induction mechanisms, bypasses active zone scaffold remodeling when
potentiating release. Third, we wanted to test if PhTx application could still elevate
BRP levels in neli OE synapses. Interestingly, BRP intensity is increased in neli OE
after application of PhTx, suggesting that even though the synapses do not show a
further potentiation, presynaptic modulations involved in PHP could still happen in
the double manipulation. Therefore, these results demonstrate that neli-induced
potentiation occludes PHP downstream of BRP scaffold remodeling.
Finally, it is not known whether the presynaptic active zone remodeling takes
place in the homeostatic mutants that block PHP. Do the required presynaptic
molecules together orchestrate BRP remodeling to enhance the active zone function
as a final step in promoting release? In order to test that, we looked at BRP
100
immunostaining in DKaiR1D + neli OE mutants that fail to potentiate release.
Although baseline BRP intensity was similar to wild type values, after application of
PhTx, BRP levels partially increased in DKaiR1D + neli OE synapses, suggesting
DKaiR1D receptors, like neli, participate in potentiation of release downstream of
BRP remodeling at the active zone.

Neli promotes delivery and stabilization of DKaiR1D to AZs to potentiate
release.
How does auxiliary subunit neli potentiate presynaptic release together with KAR
DKaiR1D? Auxiliary subunits can alter surface expression of GluRs as well as their
single channel properties when co-expressed in heterologous cell systems (Nicoll et
al., 2006; Zhang et al., 2009). Moreover, there is evidence that neto, when mutated,
can modulate in vivo KAR kinetics and trafficking postsynaptically (Straub et al.,
2011). Therefore, we considered the possibility that neli at presynaptic terminals of
NMJs, similarly, might be altering DKaiR1D receptor levels or kinetics at or near the
active zones during homeostatic potentiation.
In order to examine synaptic DKaiR1D levels during PHP, we sought to
perform immunohistochemistry at the NMJ after the application of PhTx using a
polyclonal antibody against DKaiR1D. We previously detected specific DKaiR1D
puncta immunostaining at or near active zones when it is over-expressed at the NMJ
(Kiragasi et al., 2017). However, DKaiR1D receptor levels after the application of PhTx
or in a neli mutant synapse have not been investigated. Since over-expression of
DKaiR1D receptors are required for visualizing the receptors, we first wanted to
101
investigate if basal presynaptic release or PHP expression is altered in this condition
(DKaiR1D OE or 1D OE). When recorded from DKaiR1D OE synapses, mEPSCs, EPSCs
and quantal content were indistinguishable from wild type (Fig.7A-C), suggesting that
over-expressed receptors by themselves were not functional to the levels that have
an effect on basal release. Second, after the application of PhTx, DKaiR1D OE synapses
had reduced mini amplitudes and normal EPSC values with an increase in quantal
content (Fig.7A-C), indicating that PHP is being induced and expressed at this
synapse.
Next, we immunostained NMJs to determine whether DKaiR1D levels and/or
localization differ at presynaptic terminals before and after PhTx. As expected,
following over-expression of DKaiR1D in motor neurons, we observed a punctate
signal at presynaptic NMJ terminals, which localized at or near active zones labeled
by BRP (Fig. 7D,E). Interestingly, only a subset of BRP positive active zones (22%) co-
localized with DKaiR1D puncta (Fig.7F,G), revealing a heterogeneity of DKaiR1D
presence and position relative to individual active zones. Remarkably, after 10 min
PhTx treatment, we observed an increase in sum intensity of DKaiR1D puncta signal
(~200%, Fig.7D,E) as well as higher DKaiR1D puncta density at presynaptic terminals
(Fig.7F). Importantly, after application of PhTx, more active zones co-localized with
DKaiR1D puncta (~40%, Fig.7G), suggesting that additional active zones are perhaps
recruited by DKaiR1D when modulating release at NMJs. We did not observe any
significant difference in size and intensity of BRP puncta labeled with DKaiR1D.
Overall, NMJs upregulate synaptic DKaiR1D levels during PHP, with more BRP
102
positive active zones harboring DKaiR1D receptors at close proximity when
potentiating release.
How is DKaiR1D delivered to presynaptic terminals and stabilized at release
sites during PHP? One hypothesis is that neli traffics and supports DKaiR1D at
synaptic terminals for PHP. We tested this possibility by over-expressing DKaiR1D
receptors in mutant synapses with no endogenous neli subunit (1D OE + neli
BK1
).
Electrophysiologically, DKaiR1D over-expression did not have any functional impact
on neli mutants, with mEPSC, EPSC amplitudes and quantal content indistinguishable
from neli mutant NMJs by themselves and PHP was blocked, as expected (Fig.7A-C).
There is no functional phenotype associated with 1D overexpression. Thus, we
considered the possibility that DKaiR1D could still be delivered to the terminals by
means other than neli at such levels that are electrophysiologically not relevant, yet
visually observable by immunostaining. Therefore, we stained 1D OE + neli
BK1
synapses to examine DKaiR1D levels before and after PhTx. Surprisingly, we did not
detect any DKaiR1D puncta at NMJs of neli mutants, suggesting that neli is required
for the delivery and stabilization of over-expressed DKaiR1D at the synaptic
terminals under baseline conditions. Further, the increase in DKaiR1D puncta
intensity after the application of PhTx was completely abolished in this condition
(Fig.7D,E). Therefore, these results suggest that synaptic DKaiR1D levels are
upregulated at terminals during PHP, and neli is required for the trafficking and
anchoring of DKaiR1D to the presynaptic terminals, specifically near the active zones,
for promoting baseline release and PHP.
103
We next wanted to test if excess neli is capable of delivering more DKaiR1D to
the terminals. Neli potentiates baseline release when over-expressed at presynaptic
terminals (Fig.5). This process seems to be induced and expressed by distinct
molecular mechanisms from PHP (Fig.6). Nevertheless, both processes require acute
function of DKaiR1D in promoting release. Therefore, in order to examine DKaiR1D
levels in neli-induced potentiation (neli OE), we co-overexpressed neli and DKaiR1D
in a single synapse (1D OE + neli OE). We considered the possibility that in this
condition overexpressed DKaiR1D receptors might be trafficked to terminals by
excess neli to electrophysiologically distinguishable levels. Therefore, first we probed
if the double manipulation altered baseline synaptic function. Neli OE single
manipulation resulted in an increase in EPSC amplitudes and quantal content,
potentiating release as expected (Fig.7A-C). Intriguingly, 1D OE + neli OE synapses
had a further increase in EPSC amplitudes and quantal content (Fig. 7A-C), providing
first example of DKaiR1D modulating synaptic function when over-expressed.
Second, we went onto determine synaptic DKaiR1D levels in the double manipulation.
Sum intensity of DKaiR1D puncta increased when neli is overexpressed (Fig.7D,E).
However, DKaiR1D puncta density and the number of BRP positive active zones co-
localized with DKaiR1D puncta stayed the same (Fig.7F,G), indicating that already
existing receptor complexes selectively have more DKaiR1D receptors incorporated
by neli, distinct from an overall increase in DKaiR1D at terminals, observed during
PHP.
Finally, we wondered if DKaiR1D levels can further be modulated in 1D OE +
neli OE synapses by the application of PhTx. First, similar to neli OE, 1D OE + neli OE
104
synapses occluded the expression of PHP, with a quantal content similar to its
baseline levels (Fig.7A-C). Second, when immunostained, DKaiR1D levels stayed the
same after PhTx application. Further, no change is observed in DKaiR1D puncta
density (Fig.7D-G), suggesting that in 1D OE + neli OE, DKaiR1D levels are
upregulated to its maximum limit and no additional receptors are incorporated after
the application of PhTx.

Neto family proteins have conserved functions in presynaptic receptor
trafficking.
Even though different AMPA auxiliary subunits are expressed in distinct tissues in the
mammalian brain, they can substitute each other’s function when heterologously
mis-expressed in another tissue, suggesting a redundancy between different auxiliary
subunit families (Menuz et al., 2008; Tomita et al., 2003). Therefore, we wondered if
this could also be conserved at the Drosophila NMJ in promoting presynaptic function.
Neli promotes release when over-expressed in motor neurons. We investigated if
Drosophila neto, essential in muscle (Kim et al., 2012), could also modulate release
when mis-expressed in motor neurons. When neto isoform A expression is driven
under ok6-gal4 in motor neurons (dNetoA OE), we detected no change in mEPSCs
(Fig.8A,B); however, EPSC amplitudes (Fig.8A,C) and quantal content (Fig.8D)
increased to the levels observed in neli OE, suggesting neto and neli, the two CUB
domain proteins in Drosophila, could have conserved functions in promoting
presynaptic release. Moreover, similar to dNeto, we tested if auxiliary subunits from
other species could substitute neli function as well. Interestingly, rat neto over-
105
expression in motor neurons also resulted in a significant increase in EPSC values and
quantal content, with no impact on mEPSC amplitudes (Fig.8A-D). These results
suggest that neto family proteins could have conserved redundant functions in
modulating presynaptic release likely through presynaptic receptor trafficking.
Finally, we investigated if presynaptic KAR DKaiR1D activity is required for
the increase in presynaptic release mediated by different neto family proteins. In wild
type and neli OE synapses, baseline release is reduced to DKaiR1D mutant levels in
the presence of NMDA, an antagonist of DKaiR1D receptors. We next probed the
synaptic function in dNeto OE and rat neto OE synapses when incubated with NMDA.
Intriguingly, when recorded, mEPSC values stayed normal; however, EPSC
amplitudes and the quantal content significantly dropped (Fig.8D-F), suggesting that
different neto family proteins have conserved function in modulating DKaiR1D to
promote presynaptic release.

3.4 Discussion
We have revealed a novel molecular mechanism for auxiliary subunits underlying
presynaptic glutamatergic signaling modulating baseline neurotransmission and
homeostatic plasticity at the Drosophila NMJ. This unexpected role for auxiliary GluR
subunits in modulating the levels and function of iGluRs sensing glutamate at
presynaptic terminals indicates an autocrine system that responds to glutamate and
adaptively modulate presynaptic activity at distinct individual release sites marked
by auxiliary subunit activity.

106
Specific, compartmentalized presynaptic modulation of release at discrete
synapses by GluRs
We found that kainate-type glutamate receptor DKaiR1D and auxiliary subunit neli
are necessary together for baseline synaptic function and homeostatic potentiation
of release. We further show that neli is required for trafficking of DKaiR1D to specific,
individual active zones.
How is neli and DKaiR1D-dependent homeostatic modulation in synaptic
function regulated at specific, distinct release sites? One suggested idea is that active
zones themselves are functional units and act as local substrates for homeostatic
modulation by different presynaptic effector molecules (Li et al., 2018). In fact, there
is evidence that the active zone scaffold BRP, along with other active zone
components undergo remodeling during potentiation (Goel et al., 2017;
Weyhersmuller et al., 2011). Nevertheless, DKaiR1D-neli complex seems to localize
to a subset of active zones with certain heterogeneity. Where does this heterogeneity
come from? Indeed, not all active zones are created equal. There is evidence for
diversity in active zones participating in synaptic function (Melom et al., 2013; Peled
et al., 2014; Walter et al., 2014). Interestingly, it has been speculated that naïve active
zones participate more in spontaneous release whereas mature ones are
preferentially involved in action potential-induced vesicle release (Walter et al.,
2014). Moreover, it has been suggested that only a subset of active zones participate
in homeostatic potentiation and some silent ones can be ‘awakened’ by this process
(Li et al., 2018; Newman et al., 2017; Weyhersmuller et al., 2011). Therefore, one
attractive possibility is that DKaiR1D-neli receptor complex could be a biomarker for
107
the active zones that are ‘awakened’ to undergo homeostatic potentiation. We found
that after the application of PhTx, more active zones have DKaiR1D-neli complexes in
close proximity, supporting the possibility that they are recruited by DKaiR1D
presence. There is also evidence from cerebellar neurons that auxiliary GluRs
involved in synaptic plasticity traffic specific GluRs to distinct synaptic compartments
(Jackson and Nicoll, 2011). Finally, it has been suggested that individual ‘synaptic
nanocolumns’ exist between presynaptic sites and postsynaptic receptors, perhaps
maintaining compartmentalized transduction of retrograde signal and synapse-
specific regulation of homeostatic plasticity (Biederer et al., 2017; Tang et al., 2016).
Therefore, DKaiR1D-neli could serve as a biomarker and a building block for such a
nanocolumn, maintaining the plasticity necessary for distinct synapses to flexibly
adapt to perturbations.

Mechanisms for auxiliary GluR subunits in modulating presynaptic release
We previously showed that calcium permeable DKaiR1D could enhance basal
release under the conditions where extracellular calcium is limited. Indeed, activation
of presynaptic iGluRs in other systems can modulate presynaptic voltage and calcium
influx in less than 3.5 milliseconds (McGuinness et al., 2010; Scott et al., 2008). As
such, a calcium store-dependent mechanism, or modulation of the action potential
during the repolarization phase could have an effect on release (Schneggenburger
and Rosenmund, 2015). In a similar fashion, we speculate that activation of
presynaptic DKaiR1D during a single action potential could lead to a rapid additional
source of presynaptic calcium influx from DKaiR1D itself and/or through modulation
108
of presynaptic membrane potential to induce more vesicle release. As suggested by
neli-mediated DKaiR1D localization at or near a subgroup of active zones, this
regulation may be restricted by auxiliary subunit neli to individual active zones with
different intrinsic release efficacy to provide an additional layer of fine tuning to the
baseline release.
How does DKaiR1D promote the expression of presynaptic homeostatic
plasticity? We show that DKaiR1D levels are upregulated by neli during PHP. We
previously demonstrated, unlike baseline release, that calcium permeability through
DKaiR1D is not needed for homeostatic potentiation. Therefore, it is unlikely that
DKaiR1D-neli directly contributes to presynaptic calcium influx. An alternative
possibility is that increased amounts of synaptic DKaiR1D could modulate
presynaptic membrane depolarization, in turn affecting the function of voltage-gated
calcium channels. Indeed, small, sub-threshold depolarizations of the presynaptic
resting potential, as small as 5 mV, are sufficient to induce a two-fold increase in
presynaptic release (Awatramani et al., 2005). Therefore, it is possible DKaiR1D-neli
contribute to PHP by changing presynaptic membrane potential.
Lastly, how does neli modulate DKaiR1D localization, trafficking and/or
function during synaptic plasticity? Neli seems to promote delivery and stabilization
of DKaiR1D receptors to the neuronal membrane during presynaptic potentiation.
There is evidence that KAR auxiliary subunit neto could increase surface expression
of postsynaptic KARs (Copits et al., 2011). However, we cannot rule out the possibility
that, in addition to increasing synaptic DKaiR1D levels, neli could also change the
single channel kinetics of DKaiR1D. Indeed, KAR auxiliary subunit neto is also known
109
to slow down the desensitization phase of decay kinetics, a unique characteristic of
KARs (Straub et al., 2011). Moreover, auxiliary subunits can dynamically interact with
GluRs, to modulate GluR delivery as well as cycling at synapses (Tomita et al., 2004).
Therefore, a possible dynamic interaction between neli and DKaiR1D at synapses
could add another layer of complexity in regulation of GluR function and localization
during synaptic plasticity.

Conserved and redundant auxiliary GluR function
Our study reveals a conserved and perhaps redundant role for different
auxiliary proteins in presynaptic trafficking of GluRs. In addition to neli, both
Drosophila and rat neto could potentiate release when mis-expressed at the terminals
of motor neurons. Moreover, all these neto proteins seem to require endogenous
DKaiR1D activity to enhance presynaptic release. Perhaps, the common presence of
CUB domain structures, despite the difference in numbers of CUB domains, could
structurally enable neto family proteins functionally and molecularly interact with
DKaiR1D and play a redundant role in synaptic plasticity. Indeed, there is precedent
evidence for redundancy in auxiliary subunits and their functions (Menuz et al.,
2008). This unexpected conservancy among neto proteins suggest a common
mechanism for regulating GluRs in synaptic plasticity.

110
3.5 Methods

Fly Stocks
Drosophila stocks were raised at 25°C on standard molasses food. The w
1118
strain is
used as the wild-type control unless otherwise noted, as this is the genetic
background of the transgenic lines and other genotypes used in this study. The
following fly stocks were used in the study: OK6-Gal4 (Aberle et al., 2002), G14-Gal4
(Aberle et al., 2002), UAS-CD4-GFP, UAS-PTX
16
, DKaiR1D
2
(Mi{ET1}CG3822
MB01010
)
(Kiragasi et al., 2017), neli deficiency, mGluRA (Bogdanik et al., 2004). The following
mutant stocks and RNAi lines were obtained from the Bloomington Drosophila Stock
Center for the genetic screen: clumsy
LacW
(BL29498), DKaiR1C
MB05324
(BL24332),
Ekar
MB00001
(BL22661), DGluR1A
PBac
(BL18860), DGluR1B
TRIP
(BL40908),
NMDAR1
EP331
(BL17112), NMDAR2
TRIP
(BL40846). GluCl RNAi (VDRC54) was
obtained from Vienna Drosophila Resource Center. Standard first, second and third
chromosome balancers and genetic strategies were used for all crosses and for
maintaining mutant lines.

Molecular Biology
Neto
BY1
, neli
BK1
and neli
BK2
mutants were generated using a CRiSPR/Cas9 genome
editing strategy as described (Gratz et al., 2013). Shortly, a target Cas-9 cleavage site
was selected early in the first exon of the neto gene without obvious off-target
sequences in the Drosophila genome (guide RNA sequence: 5’
CAAAATCAAAGGTTAATCCCCGG 3’, PAM sequence: underlined, off targets: 0,
111
strand:+). An oligo with this sequence was synthesized and cloned into the pattB-U6
vector with tracer RNA sequence to generate the sgRNA. Similarly, neli
BK1
and neli
BK2

CRiSPR mutants were generated following a similar strategy by choosing an early
target site for Cas-9 cleavage in the first exon of the neli gene locus (guide RNA
sequence: 5’ CTTGGCTCTGGGATTAACCGTGG 3’, PAM sequence: underlined, off
targets: 0, strand:+) that is cloned into the pattB-U6 vector. Next, these constructs
were sent to BestGene Inc. (Chino Hill, CA) for recombination-mediated targeted
insertion into the VK18 recombination site on the second chromosome (Venken et al.,
2006). Flies with the corresponding sgRNA suquences were crossed to a Cas9-Gal4
line on the second chromosome to induce active CRiSPR mutagenesis and 10 lines for
each gene were screened for successful mutagenesis. This led to 4 independent and
homozygous lethal deletions or insertions that caused a frameshift in the neto gene,
and the line with the earliest stop codon (M24STOP) was chosen for further analysis
and named neto
BY1
. Similarly, we identified 6 independent lines with deletions or
insertions that caused a frameshift in the neli gene, and two lines which produced the
earliest stop codons (L23STOP and Q41STOP) were chosen for further analysis and
named neli
1
and neli
2
, respectively.
We obtained an EST (IP10972) encoding the entire neli open reading frame
from the Berkeley Drosophila Genome Project (www.fruitfly.org). We inserted the
neli cDNA into the pACU2 vector (Han et al., 2011) using the following forward and
reverse primers to PCR amplify the neli open reading frame: F: 5’
ATTGGTACCCAAATGCCGGCCGCATC 3’ and R: 5’ CCCGCTCTAGATTAAACATAAGATTG
3’ using KpnI and XbaI restriction eznymes. Similarly, we obtained an EST (GH11189)
112
encoding the open reading frame of the neto alpha isoform from the Berkeley
Drosophila Genome Project (www.fruitfly.org). We inserted the NetoA cDNA into the
pACU2-smGFP10XFlag vector (Han et al., 2011) using the following forward and
reverse primers to PCR amplify the neli open reading frame: F: 5’
AGAGGTACCCAAAATGCGAAGAAGAGGAAG 3’ and R: 5’
ATCGCTAGCCTAGATGATTTTGTGCAGGAACTTGAGG 3’ using KpnI and NdeI
restriction eznymes. Finally, we PCR amplified the region 4 kb upstream of the neli
start codon using the following primers F: 5’
CACCCATAGCGTCCATACTGACTCAGGTAC 3’ and R: 5’
GAGACTGTGAAGCTGGATTCCATTATC 3’. The PCR product is cloned into the Gal4
expression vector using TOPO Gateway system. Constructs were sequenced to
confirm sequence fidelity and orientation. All these constructs were sent to BestGene
Inc. (Chino Hill, CA) for recombination-mediated targeted insertion into the VK18
recombination site on the second chromosome (Venken et al., 2006).

Immunochemistry
Third-instar larvae were dissected in ice cold 0 Ca
2+
HL-3 and immunostained as
described (Kiragasi et al., 2017). Briefly, larvae were fixed in either Bouin’s fixative
(Sigma, HT10132-1L) or 4% paraformaldehyde in PBS (Sigma, F8775). Larvae were
washed with PBS containing 0.1% Triton X-100 (PBST) for 30 min, blocked for 1 hour
in 5% Normal Donkey Serum (NDS) followed by overnight incubation in primary
antibodies at 4°C, washed in PBST, incubation in secondary antibodies for 2 hours,
washed again in PBST, and equilibrated in 70% glycerol in PBST. Samples were
113
mounted in VectaShield (Vector Laboratories). The following antibodies were used:
mouse anti-GFP (8H11; 1:100; Developmental Studies Hybridoma Bank (DSHB)),
affinity-purified rabbit anti-GluRIII (1:2000; (Marrus et al., 2004)),
tetramethylrhodamine (TRITC)-conjugated phalloidin (R415; Thermo Fisher),
mouse anti-GLuRIIA (8B4D2; 1:100; DSHB), rabbit anti-GluRIIB (1:1000; (Perry et al.,
2017)), guinea pig anti-GluRIID (1:1000; (Perry et al., 2017)), mouse anti-Bruchpilot
(BRP), (nc82; 1:100; DSHB); rabbit anti-GFP (1:1000; A-11122; Invitrogen), guinea
pig anti-vglut (1:2000; Chen et al., 2017)), mouse anti-pCamKII (MA1-047; 1:100;
Invitrogen) and rat anti-DKaiR1D (1:1000, (Kiragasi et al., 2017)). Donkey anti-
mouse, anti-rat, anti-guinea pig, and anti-rabbit Alexa Fluor 488-, Cy3, and
Rhodamine Red X secondary antibodies (Jackson ImmunoResearch) were used at
1:400 and Alexa Fluor 647-conjugated goat anti-HRP (Jackson ImmunoResearch)
were used at 1:200.

Confocal imaging and analysis
Samples were imaged using a Nikon A1R Resonant Scanning Confocal microscope
equipped with NIS Elements software and a 100x APO 1.4NA oil immersion objective
using separate channels with laser lines 488 nm, 561 nm, and 637 nm. Z-stacks were
obtained using identical settings for all genotypes within an experiment and
optimized for detection without saturation of the signal. Fluorescent intensity
measurements were taken on muscle 6/7 and muscle 4 of segment A3 of at least ten
synapses acquired from at least 6 different animals. For fluorescence quantifications
of the GluR subunits, the general analysis toolkit in the NIS Elements software was
114
used as the binary for GluRIIA to measure values in GluRIIB and GluRIID channels. As
a measure of synaptic growth, both type 1b and 1s boutons were counted using vglut
and HRP- and dlg-stained NMJ terminals on muscle 6/7 and muscle 4 of segment A3,
considering each vglut puncta to be a bouton. The general analysis toolkit in the NIS
Elements software was used to quantify BRP puncta number, size, and intensity by
applying the same intensity thresholds and filters to binary layers on each of the three
channels for each genotype compared. For the analysis of total integrated pCamKII
intensity levels per NMJ, 1b and 1s regions were identified using DLG and HRP on
muscle 6/7 of segment A2 and only the pCamKII pixels that co-localized with DLG and
HRP were summated to get total pCamKII intensity levels for an NMJ. For the
DKaiR1D analysis, BRP and DKaiR1D puncta were counted within a synapse area
labeled by HRP. BRP and DKaiR1D intensities were normalized to the HRP signal
intensity, then normalized to wild-type values. Density and intensity measurements
based on confocal images were taken from at least twelve synapses acquired from at
least six different animals.

Electrophysiology
All dissections and recordings were performed in modified HL-3 saline (Dickman et
al., 2005; Stewart et al., 1994) containing (in mM): 70 NaCl, 5 KCl, 10 MgCl2, 10
NaHCO3, 115 Sucrose, 5 Trehelose, 5 HEPES, and 0.4 CaCl2 (unless otherwise
specified), pH 7.2.
Neuromuscular junction sharp electrode recordings (electrode resistance between
10-35 MΩ) were performed on muscles 6 and 7 of abdominal segments A2 and A3 in
115
wandering third-instar larvae. Larvae were dissected and loosely pinned; the guts,
trachea, and ventral nerve cord were removed from the larval body walls with the
motor nerve cut, and the preparation was perfused several times with HL-3 saline.
Recordings were performed on an Olympus BX61 WI microscope using a 40x/0.80
water-dipping objective. Recordings were acquired using an Axoclamp 900A
amplifier, Digidata 1440A acquisition system, and pClamp 10.5 software (Molecular
Devices). Electrophysiological sweeps were digitized at 10 kHz and filtered at 1 kHz.
Data were analyzed using Clampfit (Molecular devices), MiniAnalysis (Synaptosoft),
Excel (Microsoft), GraphPad Prism, and SigmaPlot (Systat) software.
Miniature excitatory postsynaptic currents (mEPSCs) were recorded in the
absence of any stimulation from muscles clamped at -70 mV, and cut motor axons
were stimulated with a duration of 0.3 msec to elicit excitatory postsynaptic currents
(EPSCs) in the two-electrode voltage clamp configuration. An ISO-Flex stimulus
isolator (A.M.P.I.) was used to modulate the amplitude of stimulatory currents.
Intensity was adjusted for each cell, set to consistently elicit responses from both
neurons innervating the muscle segment, but avoiding overstimulation. Average
mEPSC, EPSC, and quantal content were calculated for each genotype. Muscle input
resistance (Rin) and resting membrane potential (Vrest) were monitored before and
during each experiment. Recordings were rejected if the Vrest was above -60 mV, if the
Rin was less than 5 MΩ, or if either measurement deviated by more than 10% during
the course of the experiment. Larvae were incubated with or without philanthotoxin-
433 (Sigma; 20 μM) and resuspended in HL-3 for 10 mins, as described (Frank et al.,
2006). For the acute blockade of DKaiR1D by NMDA, larvae were dissected and
116
following 10 min incubation with PhTx, the central nervous system was removed and
the larvae were incubated with 1 mM NMDA (Abcam, ab120052, resuspended in
dH20) for 5 mins, with recordings performed in the continued presence of NMDA.

Statistical Analysis
All data are presented as mean +/-SEM. Data were compared using either a one-way
ANOVA, followed by Tukey’s multiple-comparison test, or using a Student’s t-test
(where specified), analyzed using Graphpad Prism or Microsoft Excel software, and
with varying levels of significance assessed as p<0.05 (*), p<0.01 (**), p<0.001 (***),
ns=not significant. See Table S1 for further statistical details and values.

3.6 References

Aberle, H., Haghighi, A.P., Fetter, R.D., McCabe, B.D., Magalhaes, T.R., and Goodman,
C.S. (2002). wishful thinking encodes a BMP type II receptor that regulates synaptic
growth in Drosophila. Neuron 33, 545-558.
Awatramani, G.B., Price, G.D., and Trussell, L.O. (2005). Modulation of transmitter
release by presynaptic resting potential and background calcium levels. Neuron 48,
109-121.
Ayalon, G., and Stern-Bach, Y. (2001). Functional assembly of AMPA and kainate
receptors is mediated by several discrete protein-protein interactions. Neuron 31,
103-113.
117
Beique, J.C., Na, Y., Kuhl, D., Worley, P.F., and Huganir, R.L. (2011). Arc-dependent
synapse-specific homeostatic plasticity. Proc Natl Acad Sci U S A 108, 816-821.
Biederer, T., Kaeser, P.S., and Blanpied, T.A. (2017). Transcellular Nanoalignment of
Synaptic Function. Neuron 96, 680-696.
Bogdanik, L., Mohrmann, R., Ramaekers, A., Bockaert, J., Grau, Y., Broadie, K., and
Parmentier, M.L. (2004). The Drosophila metabotropic glutamate receptor DmGluRA
regulates activity-dependent synaptic facilitation and fine synaptic morphology. J
Neurosci 24, 9105-9116.
Chater, T.E., and Goda, Y. (2014). The role of AMPA receptors in postsynaptic
mechanisms of synaptic plasticity. Front Cell Neurosci 8, 401.
Copits, B.A., Robbins, J.S., Frausto, S., and Swanson, G.T. (2011). Synaptic targeting and
functional modulation of GluK1 kainate receptors by the auxiliary neuropilin and
tolloid-like (NETO) proteins. J Neurosci 31, 7334-7340.
Davis, G.W., and Muller, M. (2015). Homeostatic control of presynaptic
neurotransmitter release. Annu Rev Physiol 77, 251-270.
Dickman, D.K., Horne, J.A., Meinertzhagen, I.A., and Schwarz, T.L. (2005). A Slowed
Classical Pathway Rather Than Kiss-and-Run Mediates Endocytosis at Synapses
Lacking Synaptojanin and Endophilin. Cell 123, 521-533.
Dobrunz, L.E., and Stevens, C.F. (1997). Heterogeneity of release probability,
facilitation, and depletion at central synapses. Neuron 18, 995-1008.
118
Frank, C.A. (2013). Homeostatic plasticity at the Drosophila neuromuscular junction.
Neuropharmacology.
Frank, C.A., Kennedy, M.J., Goold, C.P., Marek, K.W., and Davis, G.W. (2006).
Mechanisms underlying the rapid induction and sustained expression of synaptic
homeostasis. Neuron 52, 663-677.
Goel, P., Li, X., and Dickman, D. (2017). Disparate Postsynaptic Induction Mechanisms
Ultimately Converge to Drive the Retrograde Enhancement of Presynaptic Efficacy.
Cell Rep 21, 2339-2347.
Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M.,
Wildonger, J., and O'Connor-Giles, K.M. (2013). Genome engineering of Drosophila
with the CRISPR RNA-guided Cas9 nuclease. Genetics 194, 1029-1035.
Haering, S.C., Tapken, D., Pahl, S., and Hollmann, M. (2014). Auxiliary subunits:
shepherding AMPA receptors to the plasma membrane. Membranes (Basel) 4, 469-
490.
Haghighi, A.P., McCabe, B.D., Fetter, R.D., Palmer, J.E., Hom, S., and Goodman, C.S.
(2003). Retrograde control of synaptic transmission by postsynaptic CaMKII at the
Drosophila neuromuscular junction. Neuron 39, 255-267.
Han, C., Jan, L.Y., and Jan, Y.N. (2011). Enhancer-driven membrane markers for
analysis of nonautonomous mechanisms reveal neuron-glia interactions in
Drosophila. Proc Natl Acad Sci U S A 108, 9673-9678.
119
Holderith, N., Lorincz, A., Katona, G., Rozsa, B., Kulik, A., Watanabe, M., and Nusser, Z.
(2012). Release probability of hippocampal glutamatergic terminals scales with the
size of the active zone. Nat Neurosci 15, 988-997.
Jackson, A.C., and Nicoll, R.A. (2011). Stargazin (TARP gamma-2) is required for
compartment-specific AMPA receptor trafficking and synaptic plasticity in cerebellar
stellate cells. J Neurosci 31, 3939-3952.
Kim, Y.J., Bao, H., Bonanno, L., Zhang, B., and Serpe, M. (2012). Drosophila Neto is
essential for clustering glutamate receptors at the neuromuscular junction. Genes
Dev 26, 974-987.
Kiragasi, B., Wondolowski, J., Li, Y., and Dickman, D.K. (2017). A Presynaptic
Glutamate Receptor Subunit Confers Robustness to Neurotransmission and
Homeostatic Potentiation. Cell Rep 19, 2694-2706.
Lerma, J., and Marques, J.M. (2013). Kainate receptors in health and disease. Neuron
80, 292-311.
Li, X., Goel, P., Chen, C., Angajala, V., Chen, X., and Dickman, D.K. (2018). Synapse-
specific and compartmentalized expression of presynaptic homeostatic potentiation.
Elife 7.
Li, Y., Dharkar, P., Han, T.H., Serpe, M., Lee, C.H., and Mayer, M.L. (2016). Novel
Functional Properties of Drosophila CNS Glutamate Receptors. Neuron 92, 1036-
1048.
120
Mangmool, S., and Kurose, H. (2011). G(i/o) protein-dependent and -independent
actions of Pertussis Toxin (PTX). Toxins (Basel) 3, 884-899.
Marrus, S.B., Portman, S.L., Allen, M.J., Moffat, K.G., and DiAntonio, A. (2004).
Differential localization of glutamate receptor subunits at the Drosophila
neuromuscular junction. J Neurosci 24, 1406-1415.
McGuinness, L., Taylor, C., Taylor, R.D., Yau, C., Langenhan, T., Hart, M.L., Christian, H.,
Tynan, P.W., Donnelly, P., and Emptage, N.J. (2010). Presynaptic NMDARs in the
hippocampus facilitate transmitter release at theta frequency. Neuron 68, 1109-1127.
Melom, J.E., Akbergenova, Y., Gavornik, J.P., and Littleton, J.T. (2013). Spontaneous
and evoked release are independently regulated at individual active zones. J Neurosci
33, 17253-17263.
Menuz, K., O'Brien, J.L., Karmizadegan, S., Bredt, D.S., and Nicoll, R.A. (2008). TARP
redundancy is critical for maintaining AMPA receptor function. J Neurosci 28, 8740-
8746.
Newman, Z.L., Hoagland, A., Aghi, K., Worden, K., Levy, S.L., Son, J.H., Lee, L.P., and
Isacoff, E.Y. (2017). Input-Specific Plasticity and Homeostasis at the Drosophila Larval
Neuromuscular Junction. Neuron 93, 1388-1404 e1310.
Nicoll, R.A., Tomita, S., and Bredt, D.S. (2006). Auxiliary subunits assist AMPA-type
glutamate receptors. Science 311, 1253-1256.
Peled, E.S., Newman, Z.L., and Isacoff, E.Y. (2014). Evoked and spontaneous
transmission favored by distinct sets of synapses. Curr Biol 24, 484-493.
121
Perry, S., Han, Y., Das, A., and Dickman, D. (2017). Homeostatic plasticity can be
induced and expressed to restore synaptic strength at neuromuscular junctions
undergoing ALS-related degeneration. Hum Mol Genet 26, 4153-4167.
Petersen, S.A., Fetter, R.D., Noordermeer, J.N., Goodman, C.S., and DiAntonio, A.
(1997). Genetic analysis of glutamate receptors in Drosophila reveals a retrograde
signal regulating presynaptic transmitter release. Neuron 19, 1237-1248.
Petrovic, M.M., Viana da Silva, S., Clement, J.P., Vyklicky, L., Mulle, C., Gonzalez-
Gonzalez, I.M., and Henley, J.M. (2017). Metabotropic action of postsynaptic kainate
receptors triggers hippocampal long-term potentiation. Nat Neurosci 20, 529-539.
Rozas, J.L., Paternain, A.V., and Lerma, J. (2003). Noncanonical signaling by ionotropic
kainate receptors. Neuron 39, 543-553.
Schneggenburger, R., and Rosenmund, C. (2015). Molecular mechanisms governing
Ca(2+) regulation of evoked and spontaneous release. Nat Neurosci 18, 935-941.
Scott, R., Lalic, T., Kullmann, D.M., Capogna, M., and Rusakov, D.A. (2008). Target-cell
specificity of kainate autoreceptor and Ca2+-store-dependent short-term plasticity at
hippocampal mossy fiber synapses. J Neurosci 28, 13139-13149.
Sheng, N., Shi, Y.S., Lomash, R.M., Roche, K.W., and Nicoll, R.A. (2015). Neto auxiliary
proteins control both the trafficking and biophysical properties of the kainate
receptor GluK1. Elife 4.
122
Stewart, B.A., Atwood, H.L., Renger, J.J., Wang, J., and Wu, C.F. (1994). Improved
stability of Drosophila larval neuromuscular preparations in haemolymph-like
physiological solutions. J Comp Physiol A 175, 179-191.
Straub, C., Hunt, D.L., Yamasaki, M., Kim, K.S., Watanabe, M., Castillo, P.E., and Tomita,
S. (2011). Distinct functions of kainate receptors in the brain are determined by the
auxiliary subunit Neto1. Nat Neurosci 14, 866-873.
Tang, A.H., Chen, H., Li, T.P., Metzbower, S.R., MacGillavry, H.D., and Blanpied, T.A.
(2016). A trans-synaptic nanocolumn aligns neurotransmitter release to receptors.
Nature 536, 210-214.
Tomita, S. (2010). Regulation of ionotropic glutamate receptors by their auxiliary
subunits. Physiology (Bethesda) 25, 41-49.
Tomita, S., Chen, L., Kawasaki, Y., Petralia, R.S., Wenthold, R.J., Nicoll, R.A., and Bredt,
D.S. (2003). Functional studies and distribution define a family of transmembrane
AMPA receptor regulatory proteins. J Cell Biol 161, 805-816.
Tomita, S., Fukata, M., Nicoll, R.A., and Bredt, D.S. (2004). Dynamic interaction of
stargazin-like TARPs with cycling AMPA receptors at synapses. Science 303, 1508-
1511.
Turrigiano, G. (2012). Homeostatic Synaptic Plasticity: Local and Global Mechanisms
for Stabilizing Neuronal Function. Csh Perspect Biol 4.
Turrigiano, G.G. (2008). The self-tuning neuron: synaptic scaling of excitatory
synapses. Cell 135, 422-435.
123
Venken, K.J., He, Y., Hoskins, R.A., and Bellen, H.J. (2006). P[acman]: a BAC transgenic
platform for targeted insertion of large DNA fragments in D. melanogaster. Science
314, 1747-1751.
Walter, A.M., Haucke, V., and Sigrist, S.J. (2014). Neurotransmission: spontaneous and
evoked release filing for divorce. Curr Biol 24, R192-194.
Weyhersmuller, A., Hallermann, S., Wagner, N., and Eilers, J. (2011). Rapid active zone
remodeling during synaptic plasticity. J Neurosci 31, 6041-6052.
Zhang, W., St-Gelais, F., Grabner, C.P., Trinidad, J.C., Sumioka, A., Morimoto-Tomita, M.,
Kim, K.S., Straub, C., Burlingame, A.L., Howe, J.R., et al. (2009). A transmembrane
accessory subunit that modulates kainate-type glutamate receptors. Neuron 61, 385-
396.
Zheng, Y., Brockie, P.J., Mellem, J.E., Madsen, D.M., Walker, C.S., Francis, M.M., and
Maricq, A.V. (2006). SOL-1 is an auxiliary subunit that modulates the gating of GLR-1
glutamate receptors in Caenorhabditis elegans. Proc Natl Acad Sci U S A 103, 1100-
1105.
Zheng, Y., Mellem, J.E., Brockie, P.J., Madsen, D.M., and Maricq, A.V. (2004). SOL-1 is a
CUB-domain protein required for GLR-1 glutamate receptor function in C. elegans.
Nature 427, 451-457.

124
Figure 3.1: Neuronal neto expression promotes baseline neurotransmitter
release but is dispensable for PHP expression. (A) A phylogenetic tree of
Drosophila glutamate receptor (GluR) subunit genes. (B) Quantification of mEPSP
amplitude and quantal content values after PhTx treatment, normalized to baseline
values of the same genotype. There is a homeostatic increase in presynaptic release
(quantal content) in all GluR putative mutants tested except DKaiR1D. (C) Predicted
protein structure of two wild type neto isoforms, NetoA and NetoB, and a null CRiSPR
mutant, Neto
BY1
, that abolishes both isoforms. (D) Representative EPSC and mEPSC
traces from electrophysiological recordings of wild type (w
1118
), muscle
overexpression of NetoA (wild type + muscle > netoA: w;G14-Gal4/UAS-NetoA-smFP),
and muscle rescue of NetoA in null Neto
BY1
mutants (Neto
BY1
+ muscle > netoA: Neto
BY1
;
G14-Gal4/UAS-NetoA-smFP) before and after PhTx application at 0.5 mM extracellular
Ca
2+
. EPSC amplitude returns to baseline levels in Neto
BY1
+ muscle > netoA synapses
following PhTx application despite defective baseline release. Quantification of
absolute mEPSC amplitude (E), EPSC amplitude (F), and quantal content (G) values
before and after PhTx treatment. (H) Quantification of percent change in mEPSC
amplitude and quantal content after PhTx, normalized to baseline values of the same
genotype. Error bars indicate ±SEM. Asterisks indicate statistical significance using
one-way analysis of variance (ANOVA), followed by Tukey’s multiple-comparison
test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not significant.
125

126
Figure 3.2: The auxiliary glutamate receptor neto-like (neli) is necessary for
PHP expression. (A) Protein structures of 5 genes in Drosophila, predicted to encode
auxiliary GluR subunits. (B) Quantification of mEPSP amplitude and quantal content
values after PhTx treatment, normalized to baseline values of the same genotype. A
putative neto-like mutant fails to increase quantal content. (C) Predicted structure of
wild type neto-like protein and two CRiSPR null mutants. (D) Representative EPSP
and mEPSP traces from electrophysiological recordings of wild type (w
1118
) and neli
mutant synapses (w;neli
BK1
) before and after PhTx application at 0.5 mM extracellular
Ca
2+
. EPSC amplitude fails to return to baseline levels in neli mutants following PhTx
application because there is no homeostatic increase in presynaptic release. (E)
Quantification of mEPSP amplitude and quantal content values after PhTx treatment,
normalized to baseline values of the same genotype. (F) Representative EPSC and
mEPSC traces from electrophysiological recordings using two-electrode voltage
clamp (TEVC) of wild type and neli mutant synapses before and after PhTx application
at 0.5 mM extracellular Ca
2+
. (G) Quantification of mEPSC amplitude and quantal
content values in TEVC after PhTx treatment, normalized to baseline values of the
same genotype. Error bars indicate ±SEM. Asterisks indicate statistical significance
using one-way analysis of variance (ANOVA), followed by Tukey’s multiple-
comparison test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not significant.

127

128
Figure 3.3: Neuronal expression of neli is required to promote baseline
neurotransmission and PHP. (A) Representative images of the ventral nerve cord
(VNC) and the neuromuscular junction (NMJ) expressing UAS-GFP under neli
promoter Gal4 driver, immunostained with anti-GFP and anti-GluRIII. Neli is
exclusively expressed in the nervous system. (B) Representative EPSC and mEPSC
traces from electrophysiological recordings using two-electrode voltage clamp
(TEVC) of wild type, neli mutant, neli rescue by expressing neli using either its own
promoter (neli>neli rescue: w;neli-Gal4/UAS-neli;neli
BK1
), or a muscle specific
promoter (muscle>neli rescue: w;G14-Gal4/UAS-neli; neli
BK1
) in neli mutant
background before and after PhTx application at 0.5 mM extracellular Ca
2+
.
Quantification of absolute mEPSC amplitude (C), EPSC amplitude (D), and quantal
content (E) values before and after PhTx treatment. (F) Quantification of percent
change in mEPSC amplitude and quantal content after PhTx, normalized to baseline
values of the same genotype. Error bars indicate ±SEM. Asterisks indicate statistical
significance using one-way analysis of variance (ANOVA), followed by Tukey’s
multiple-comparison test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not significant.

129

130
Figure 3.4: Neli and DKaiR1D together promote basal presynaptic
neurotransmitter release. (A) Representative electrophysiological recordings at
0.3 mM extracellular Ca
2+
in wild type, single neli (w;neli
BK1
) and DKaiR1D
(w;DKaiR1D
2
) mutants, and when the two mutants are combined together
(w;neli
BK1
,DKaiR1D
2
). Note that baseline transmission is reduced to the same levels

in
all mutant combinations. Quantification of absolute mEPSC amplitude (B), EPSC
amplitude (C), and quantal content (D) values in the indicated genotypes. (E)
Representative mEPSC and EPSC traces at 0.3 mM extracellular Ca
2+
in wild type, neli
and DKaiR1D mutant synapses recorded in the presence of 1 mM NMDA, an
antagonist of DKaiR1D. Quantification of absolute mEPSC amplitude (F), EPSC
amplitude (G), and quantal content (H) values in the indicated conditions. Error bars
indicate ±SEM. Asterisks indicate statistical significance using one-way analysis of
variance (ANOVA), followed by Tukey’s multiple-comparison test: (*) p<0.05; (**)
p<0.01; (***) p<0.001; (ns) not significant.

131

132
Figure 3.5: DKaiR1D is necessary for neli to promote presynaptic
neurotransmiter release. (A) Neli expression in motor neurons using high
expression enhancer trap Ok6-Gal4 enhances release in wild type but not in DKaiR1D
mutants. Representative mEPSC and EPSC traces in wild type and DKaiR1D mutants
with or without neli expression in motor neurons recorded in 0.5 mM Ca
2+
, and in
wild type synapses in the presence of 1 mM NMDA. Quantification of absolute mEPSC
amplitude (B), EPSC amplitude (C), and quantal content (D) values in the indicated
conditions. Error bars indicate ±SEM. Asterisks indicate statistical significance using
one-way analysis of variance (ANOVA), followed by Tukey’s multiple-comparison
test: (*) p<0.05; (**) p<0.01; (***) p<0.001; (ns) not significant.

133

134
Figure 3.6: Neli-mediated potentiation occludes PHP expression downstream of
BRP remodeling. (A) Neli overexpression in wild type motor neurons block PHP
expression. Representative mEPSC and EPSC traces recorded in 0.5 mM Ca
2+
in wild
type, neli OE and neli OE in DKaiR1D mutant background with or without PhTx
application. (B) Quantification of mEPSC and quantal content values following PhTx
application in the indicated genotypes and conditions. (C) Representative images of
individual boutons from muscle 6&7 NMJs immunostained with an antibody against
the active phosphorylated form of CamKII (pCamKII, green) in the indicated
genotypes. (D) Quantification of total pCamKII intensity reveals a reduction in all
genotypes after PhTx treatment. (E) Representative images of individual boutons
immunostained with an antibody against the presynaptic active zone scaffold BRP
(white), demonstrating an increase in individual puncta size and intensity following
PhTx application in indicated genotypes. (F) Quantification of BRP puncta sum
intensity.

135

136
Figure 3.7: Neli promotes delivery and stabilization of DKaiR1D to AZs to
potentiate release. (A) Neither basal release nor PHP expression is affected by
DKaiR1D overexpression in motor neurons; however, DKaiR1D enhances basal
release when co-expressed with neli. Representative EPSC traces in wild type, neli
mutants and neli with or without DKaiR1D overexpression in motor neurons
recorded in 0.5 mM Ca
2+
in the absence or presence of PhTx. Quantification of EPSC
values (B) and quantal content (C) in the indicated genotypes and conditions. (D) neli
is required to deliver DKaiR1D to presynaptic terminals during PHP. Representative
images of individual boutons from muscle 6&7 NMJs immunostained with an
antibody against DKaiR1D (green) and BRP (magenta) in the indicated genotypes.
Quantification of DKaiR1D puncta sum intensity reveals an increase in wild type with
PhTx application or neli overexpression but not in neli mutants (E). DKaiR1D puncta
density (F) and percentage of BRP positive active zones co-localized with DKaiR1D
(G) only increases during PHP.
137

138
Figure 3.8: Neto family proteins have conserved function in presynaptic
receptor trafficking. (A) Both Drosophila and rat neto enhances presynaptic release
in motor neuron terminals. Representative mEPSC and EPSC traces in wild type, neli,
neto and rat neto overexpression in motor neurons recorded in 0.5 mM Ca
2+
.
Quantification of EPSC values (B) and quantal content (C) in the indicated genotypes.
(D) Both Drosophila and rat neto requires DKaiR1D activity to promote release.
Representative mEPSC and EPSC traces in wild type, neli, neto and rat neto
overexpression in motor neurons recorded in 0.5 mM Ca
2+
in the presence of 1 mM
NMDA. Quantification of EPSC values (E) and quantal content (F) in the indicated
genotypes and conditions.

139

140
CHAPTER 4

CONCLUSION

Understanding of KARs and auxiliary subunits
The understanding of the molecular and physiological properties of kainate receptors
has advanced significantly with the development of in vivo knock out models and the
discovery of auxiliary subunits. A number of studies implicated kainate receptors as
presynaptic mediators of the actions of glutamate, in addition to their postsynaptic
roles; however, the mechanisms underlying these presynaptic effects were largely a
topic of debate. Mainly, in mammalian systems, lack of a genetically and molecularly
defined synapse with kainate receptors only on the presynaptic side has impaired the
research on the specific functions of these receptors.
Using Drosophila NMJ as a genetically, experimentally and
electrophysiologically tractable model system to study the roles of presynaptic
kainate receptors, I have revealed a novel unexpected role for autocrine
glutamatergic signaling in synaptic function and plasticity. First, I have discovered a
kainate receptor that is only expressed at terminals of the presynaptic motor neuron.
Second, my work revealed DKaiR1D as a presynaptic glutamate autoreceptor that
promotes synaptic stregth at individual active zones. Importantly, DKaiR1D also
mediates the homeostatic potentiation of presynaptic release with active zone
specificity. Nevertheless, the physiological mechanisms that regulate DKaiR1D during
this process have remained enigmatic.
141
Further, in the past, homomeric and heteromeric kainate receptors had
puzzling physiological properties in vivo when compared with in vitro studies. The
discrepancies between native kainate receptors and functionally resconstituted ones
have been resolved with the discovery of auxiliary subunits.
Neto auxiliary proteins have been found to modulate KAR function and trafficking to
the postsynaptic compartments. However, it was not known whether these auxiliary
subunits had any effect on the presynaptic KARs involved in synaptic plasticity.
Towards this end, in an effort to identify the DKaiR1D auxiliary subunit through a
targeted forward genetic screen in Drosophila, my work discovered a novel auxiliary
KAR subunit with homology to the neto family, named neto-like (neli). Neli promotes
the delivery and stabilization of DKaiR1D to the presynaptic membrane to promote a
homeostatic increase in synaptic vesicles being released during synaptic plasticity.
However, it still remains unknown how neli regulates DKaiR1D trafficking.
One possibility is that when associated with the receptor, perhaps in the ER, neli
might cover the ER retention signal on the homomers that results in promotion of
DKaiR1D exit from the ER. Alternatively, neli might associate with the naked
receptors on the presynaptic membrane and act as a localization signal to promote
accumulation of otherwise diffused receptors to specific release sites. All these
intriguing ideas and questions remain to be answered by further recombinant protein
interaction studies in combination with imaging and electrophysiological
experiments. In addition to receptor trafficking, functional reconstitution of DKaiR1D
with its auxiliary subunit neli in heterologous systems is crucial to further investigate
the contribution of neli to DKaiR1D ion channel physiology.
142

Understanding the synapse specific regulation of homeostatic plasticity
We found that KAR DKaiR1D and auxiliary subunit neli are necessary together for
baseline synaptic function and homeostatic potentiation of release with active zone
specificity. However, how neli and DKaiR1D-dependent homeostatic modulation in
synaptic function is regulated at specific, distinct release sites remains to be
investigated further. If the active zones themselves are functional units and act as
local substrates for homeostatic modulation by DKaiR1D-neli complex, it is important
to further characterize the properties of DKaiR1D-positive active zones functionally
as well as structurally.
Our work revealed two subpopulations of active zones labeled by DKaiR1D at
the Drosophila NMJ. First, DKaiR1D-neli promotes baseline release at approximately
20% of the active zones labeled by DKaiR1D immunostaining. Do these active zones
share similar functional properties? Do they participate more in spontaneous release
or evoked activity? In vivo calcium imaging experiments at DKaiR1D-positive active
zones could help us understand the shared and distinct functional properties,
therefore the heterogeneity between them. Second, during homeostatic plasticity,
another 20% of the active zones begin to co-localize with DKaiR1D, suggesting that
perhaps those are recruited to participate in potentiation. Considering the idea that
only a subset of active zones participate in homeostatic potentiation and some silent
ones can be ‘awakened’ by this process, it would be crucial to investigate their
functionality using in vivo calcium imaging at individual active zones. Finally, super
143
resolution imaging of key active zone scaffold proteins such as Bruchpilot could also
reveal structural features specific to DKaiR1D-positive active zones.
To conclude, the molecular mechanisms underlying KAR-auxiliary subunit
mediated modulation of synaptic function as well as the heterogeneity of active zones
participating in this process still remain to be investigated further. To this end, a
combination of techniques such as heterologous reconstitution of receptors, super
resolution imaging, functional calcium imaging, as well as electrophysiology will help
us understand the mechanisms governing this remarkable process of homeostatic
potentiation of presynaptic release.

Abstract (if available)

Abstract The nervous system has the ability to reliably adapt to changes in neural activity in order to keep the baseline synaptic function stable. Synapses are prone to a variety of perturbations that can cause impaired function and result in, for example, learning and memory defects and brain diseases such as autism and schizophrenia. Nevertheless, they are endowed with molecular machines that homeostatically restore baseline synaptic activity within a certain time despite the perturbations to synaptic strength. Yet, despite the demonstration of robust homeostatic signaling in diverse systems, the genes and molecular mechanisms that govern these processes are largely unknown. As a glutamatergic synapse, Drosophila neuromuscular junction has been established in investigating the homeostatic mechanisms that enhance presynaptic release in response to a perturbation to postsynaptic receptor function. Importantly, the orchestration of this complex and fundamental signaling system has been shown to be synapse specific. However, to date, no roles for glutamate receptors or other factors have been found to differentially enable the modulation of release efficacy at individual synapses. To this extent, I have discovered 2 new glutamate receptor subunits that revealed an unexpected autocrine mechanism to adaptively modulate presynaptic activity at specific, individual active zones. ❧ Kainate-type glutamate receptors (KARs) are known to be involved in mediating both pre- and postsynaptic actions of glutamate at vertebrate synapses. Moreover, they have been implicated in the short and long term modulation of presynaptic release. However, the study in KARs field, unlike other receptors, has suffered a lot due to the limitations of pharmacology. Indeed, to date, the presynaptic functions of KARs have only been assessed indirectly. Given the genetic and experimental tractability of Drosophila, encoding uncharacterized glutamate receptor genes

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Engineering genetic tools to illustrate new insights into the homeostatic control of synaptic strength

PDF

Dual genetic screens for mutants in synaptic homeostatic plasticity and a characterization of insomniac as a regulator for retrograde homeostatic signaling

PDF

Translational regulation and endosomal trafficking in synaptic adaptation to stress

PDF

Molecular mechanisms underlying the bi-directional control of presynaptic homeostatic plasticity

PDF

An orchestra of glutamate receptors and transporters in synaptic transmission, plasticity and excitotoxicity

PDF

Uncovering cell type-specific roles of proteins involved in glutamatergic synapse regulation

PDF

Synaptic plasticity during neurodegeneration and axonal injury

PDF

Uncovering synapse-specific roles of proteins implicated in complex brain disorders via novel and targeted approaches

PDF

The role of a novel integrin activator in the maintenance of stem cell niche and activity-induced synaptic structural modifications in Drosophila

PDF

Synaptic transmission, nutrient sensors, and aging in Drosophila melanogaster

PDF

The role of RhoGEFs in glutamatergic synapse development and human cognitive disorders

PDF

Computational investigation of glutamatergic synaptic dynamics: role of ionotropic receptor distribution and astrocytic modulation of neuronal spike timing

PDF

The role of Rho-GEF signaling in synapse function and autism-related disorders

PDF

Neuroplasticity of the basal ganglia in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson's disease

PDF

The role of Schwann cells in the development of the neuromuscular junction

PDF

Characterizing the hippocampal synaptic and sleep abnormalities of a mouse model of human chromosome 16p11.2 microdeletion

PDF

The structural and functional configurations of glutamate, GABA, and catecholamine pre-synaptic terminals in the parvicellular neuroendocrine part of the paraventricular nucleus of the hypothalamus

PDF

Nebula/DSCR1 upregulation preserves axonal transport and memory function in a Drosophila model for Alzheimer's disease

PDF

Synaptic integration in dendrites: theories and applications

PDF

Synaptic second wind: phosphene fading of the Argus II and glutamate secretion in the inner retina

Asset Metadata

Creator Kiragasi, Beril (author)

Core Title Presynaptic glutamate receptors and auxiliary subunits in neurotransmission and homeostatic potentiation

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Neuroscience

Publication Date 08/02/2018

Defense Date 06/19/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Drosophila,glutamate signaling,homeostasis,neuromuscular junction,OAI-PMH Harvest,synaptic function,synaptic plasticity

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Herring, Bruce (committee chair), Chang, Karen (committee member), Dickman, Dion (committee member)

Creator Email kiragasi@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-47761

Unique identifier UC11671951

Identifier etd-KiragasiBe-6615.pdf (filename),usctheses-c89-47761 (legacy record id)

Legacy Identifier etd-KiragasiBe-6615.pdf

Dmrecord 47761

Document Type Dissertation

Format application/pdf (imt)

Rights Kiragasi, Beril

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA