University of Southern California Dissertations and Theses

Characterization of osteoclast-specific cytokines during bone repair

(USC Thesis Other)

Characterization of osteoclast-specific cytokines during bone repair

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

Characterization of Osteoclast-specific
Cytokines during Bone Repair

by
Xuan Xie

Advisor: Francesca Mariani
Committee Members: Amy Merrill-Brugger, Ruchi Bajpai

Program: Biochemistry and Molecular Biology
Master of Science
Department of Biochemistry and Molecular Medicine
Keck School of Medicine
University of Southern California

December 2018

2

Table of Contents
Acknowledgements .................................................................................................................. 4
List of Figures .......................................................................................................................... 5
List of Tables ............................................................................................................................ 6
Abbreviations ........................................................................................................................... 7
Abstract .................................................................................................................................. 10
Chapter 1 Introduction ......................................................................................................... 11
1.1 Dilemma of Bone Fracture and Clinical Treatments ..................................................... 11
1.2 Biological Processes of Bone Healing and Relevant Molecules ................................... 13
1.3 Interplay of Osteoclasts and Osteoblasts during Bone Healing..................................... 17
1.3.1 Various Cell Types Participating in Bone Healing................................................. 17
1.3.2 Significance of Osteoblasts and Osteoclasts .......................................................... 19
1.4 Objectives of This Thesis .............................................................................................. 23
Chapter 2 Methods and Results ........................................................................................... 25
2.1 Preliminary Results of Translational Profiling .............................................................. 25
2.1.1 Injury & Regeneration Assay ................................................................................. 25
2.1.2 Ribosome Profiling ................................................................................................. 25
2.1.3 RNA Seq ................................................................................................................. 26
2.2 Analysis of Genes Candidates List ................................................................................ 28
2.3 TOPO Cloning ............................................................................................................... 29
2.3.1 PCR ........................................................................................................................ 30
2.3.2 E. coli Transfection ................................................................................................ 37
2.3.3 Colony PCR ............................................................................................................ 38
Chapter 3 Discussion ............................................................................................................. 41
3.1 Basic Aspects of MMPs and Mmp14 ............................................................................ 41
3.2 Conclusion and Future Perspectives .............................................................................. 45
3

References .............................................................................................................................. 48

4

Acknowledgements
This thesis would not have been possible without the support of many people.
First of all, I would like to express my sincere gratitude to my advisor, Prof. Francesca
Mariani from the Eli and Edythe Broad CIRM Center for Regenerative Medicine and Stem
Cell Research at USC, who read my numerous revisions and helped make some sense of
the confusion with patience and kindness. When I was facing the difficult situation about
changing the lab, she kindly gave me the opportunity to stay in her lab to continue
researching study. This experience would definitely become one of my treasures in my
future.
I would also like to thank my committee members, Prof. Amy Merrill-Brugger and Prof.
Ruchi Bajpai, both from Center for Craniofacial Molecular Biology, who continued
offering guidance and support in this year. I am gratefully indebted to them for their
valuable comments on this thesis.
I would also like to acknowledge In Kyoung Mah for her work for this research project.
Without her great contribution for preliminary data, our project would not be able to move
on further. And my lab mates, Neel Hegde, Ashlie Muñoz, Jessica Espinoza, Zeferino
Reyna, Divya Patel, Adrian Wang and Jason Hsieh, I really appreciate their instructions
and opinions about my experiments as well as their encouragement and comforting.
Finally, I would like to thank my parents not only for their financial support in these two
years but also for their total understanding of my personal choices on my future
development. And I would not forget to express my profound thankfulness to my boyfriend
Pai and numerous friends as well, since they have been provided me with unfailing support
and continuous encouragement throughout my years of study and through the process of
researching and writing this thesis. This accomplishment would not have been possible
without them. Thank you.

5

List of Figures
Figure Page
Figure 1 Role of Immune Cells during Fracture Repair. 12
Figure 2 TGF-β Family Signaling in Osteoblasts Differentiation 13
Figure 3 Models of Fracture and the Cellular Participants. 16
Figure 4 Phase Model of Bone Remodeling. 18
Figure 5 RNA Seq. 25
Figure 6 TOPO PCR Cloning. 27
Figure 7 PCR Results of Last Testing. 34
Figure 8 Colony PCR Results of 4 Pairs of Primers. 36
Figure 9 Sequencing Results Showing the Insertion of Mmp14. 37
Figure 10 MMPs General Structure. 38
Figure 11 Propeptide interaction with the catalytic domain through a
conserved cysteine residue (C) and the Zn2+ ion in the catalytic pocket (the
so-called cysteine switch).
39
Figure 12 Crystal Structure of the Catalytic Domain of Mmp14. 39

6

List of Tables
Table Page
Table 1 Potential Coupling Factors Produced by Osteoclasts 20
Table 2 Genes Candidates List for OC Specific Cytokines Characterization 26
Table 3 Primer List 27
Table 4 Five Groups of Primers Tested 31
Table 5 PCR Reaction Assembly 32
Table 6 Primers Available after Testing 33
Table 7 Reaction Assembly 35

7

Abbreviations
Abbreviation Explanation
Acp5 Acid phosphatase 5
Atp6v0d2 ATPase, H+ transporting lysosomal V0 subunit D2
BMP Bone morphogenetic protein
BMU Basic multicellular unit
C1qb Complement component 1, q subcomponent, beta polypeptide
C1qtnf C1q and tumor necrosis factor related protein
CC3a Complement component 3a
Ccl Chemokine (C-C motif) ligand
c-Fms Colony stimulating factor 1 receptor
c-Kit Tyrosine-protein kinase Kit (CD117)
COX-2 Cyclooxygenase-2
CT-1 Cardiotrophin 1
CTHRC1 Collagen triple helix repeat containing 1
Ctsk Cathepsin K
Cxcl Chemokine (C-X-C motif) ligand
CXCR4 Chemokine receptor type 4
ECM Extracellular matrix
EphB4 Ephrin type-B receptor 4
FGF Fibroblast growth factor
Fstl1 Follistatin like 1
GP130 Glycoprotein 130
GPC4 Glypican 4
Gsdmd Gasdermin D
HGF Hepatocyte growth factor
8

IFN Interferon
IGF Insulin-like growth factor
IL interleukin
LIF Leukemia inhibitory factor
LIF-R Leukemia inhibitory factor receptor (CD118)
LIPUS Low-intensity pulsed ultrasound
LRP5 Low density lipoprotein receptor-related protein 5
Mim-1 Myeloid protein-1 precursor
MIP Monocyte chemotactic protein
MMP Matrix metallopeptidase
MSC mesenchymal stem cell, multipotent mesenchymal stromal cell
MT-MMP Membrane-type matrix metalloproteinase
Mx1 MX dynamin-like GTPase 1
Nid1 Nidogen 1
OCIL Osteoclast inhibitory lectin
OPG Osteoprotegerin
OSCAR Osteoclast-associated receptor
PDGF Platelet-derived growth factor
PEMF Pulsed electromagnetic fields
PMN Neutrophil
Postn Periostin, osteoblast specific factor
PTH Parathyroid hormone
PTH1R Parathyroid hormone receptor 1
Ptn Pleiotrophin
RANKL Receptor activator of nuclear factor kappa-B ligand
RUNX2 Runt-related transcription factor 2
S1P Sphingosine 1-phosphate
9

SDF-1 Stromal cell-derived factor 1
SEMA 4D Semaphorin 4D
SGF Skeletal growth factor
SLF Steel factor; stem cell factor, SCF; mast cell growth factor, MGF
TGF-β Transforming growth factor β
Thbs4 Thrombospondin 4
TIMP Inhibitors of metalloproteinase
TNF-α Tumor necrosis factor α
TRAP Tartrate-resistant acid phosphatase
TRIP-1 TGF-β receptor-interacting protein
VEGF Vascular endothelial growth factor
Wnt Wingless-type

10

Abstract
Bone fracture is one of the most common orthopedic conditions. The incidence of non-
or delayed union with limited therapy for fracture has been increasing over the world.
During bone repair, osteoclasts are suggested to not only participate in bone resorption but
also have potential ability to secrete osteoclasts-specific cytokines to promote bone
regeneration at early phases. To identify these osteoclasts-specific cytokines, I established
a gene candidate list based on preliminary study of translational profiling and attempted to
characterize novel cytokines and their roles in bone healing.
In total, 21 genes were chosen, and 2 pairs of PCR primers were designed and tested for
each gene using cDNA templates. Genes successfully amplified were then cloned into E.
coli using the TOPO cloning Kit. Four genes with positive results were sent for sequencing,
among which Mmp14 was shown to be possible target even with imperfect insertion. To
continue this project, RNA in situ hybridization and further identifying methods would be
conducted after improvement of previous experiments in the future.

11

Chapter 1 Introduction
1.1 Dilemma of Bone Fracture and Clinical Treatments
Bone fracture, a partial or complete break in the continuity of the bone, is one of the
most common orthopedic conditions. An estimated 5-10% of all fractures show impaired
healing, leading to delayed union, or non-union, the permanent failure of healing following
a broken bone
[1]
. According to epidemiological study, it is estimated that 100,000 fractures
go on to non-union each year in the United States
[2]
, and about 5%~10% long-bone fracture
cases per year end up with non-union due to inappropriate treatment or other factors around
the world
[3]
. The incidence of delayed union and/or non-union following fractures is
assumed to be increasing. Nevertheless, this has been also attributed to the advanced
medical conditions that greatly improved the survival rates of patients with multiple
injuries. Since these patients tended to quickly lose their lives in the past, recovery data
failed included in the statistics
[4]
. Considering its increasing incidence, non-union and/or
delayed union, is still a challenging obstacle in clinical bone fracture therapy.
Under some conditions like massive traumatic bone loss or primary tumor resection, the
injured bone would fail to repair even though the bone is capable of some self-regeneration.
For such critical-sized defects, additional material and method like autogenous bone
grafting is necessary and recommended to be utilized to fill the gap
[5]
. Autogenous bone
grafts are osteogenic, osteoinductive and osteoconductive, so it is considered the current
gold standard for critical-sized defects. Because of the limited availability of autogenous
bone grafts, the cadaver bone or allograft are usually served as the alternatives. Meanwhile,
to fully solve the supply problem, the use of synthetic bone scaffolds is under development.
The materials of synthetic scaffolds with different characteristics include inorganic bone
substitutes (metals, ceramics, bio-glasses) and organic ones (polymers)
[5]
. Apart from these,
the contribution of the mechanical component cannot be underestimated.
12

Overall, typical approaches used in the clinical setting to promote or boost bone
regeneration include distraction osteogenesis, bone transport, free fibula vascularized graft,
the use of a number of bone grafts (autologous bone, allografts, bone graft substitutes),
growth factors, cellular therapies, and other methods such as the induced membrane
technique, titanium cages and non-invasive modalities of biophysical stimulation, such as
low-intensity pulsed ultrasound (LIPUS) and pulsed electromagnetic fields (PEMF)
[4]
.
Their clinical efficacy and further development are largely based on the understanding of
biological events underlying bone regeneration, which is an area of active research
currently.
Studies over the last several decades report that nutrient, age, smoking, hormone,
osteoporosis, bone type, physical therapy, pre-existing bone pathology and other
environmental factors are all related to the level of bone healing
[6]
. Of all the factors, the
interplay of different cytokines and chemokines in the signaling pathway may be the most
fundamental. In 1960s, Urist et al.
[7]
discovered a growth factor named bone
morphogenetic protein (BMPs, which we now know are members of the TGF-β
superfamily) out of the bone extracts with “morphogenetic property” and confirmed its
ability to stimulate bone formation in a variety of tissues (e.g., subcutaneous tissue, brain,
spinal cord, tendon, peritoneum) but not others (e.g., thyroid, thymus, spleen, liver, kidney).
BMPs can facilitate the bone healing by promoting the proliferation and differentiation of
the undifferentiated cells in the mesenchymal lineage to the osteo- or chondroprogenitor
pathway. In 1982, the significance of skeletal growth factors (SGFs) to stimulate bone
formation and modulate the balance of bone formation-absorption was verified by Farley
and Baylink
[8, 9]
. Other osteoinductive molecules
[10]
act in synergy with BMPs contain
platelet-derived growth factors (PDGFs)
[11]
, the transforming growth factor β (TGF-β),
insulin-like growth factor (IGF) and the acidic and basic fibroblast growth factors (FGFs) .
These discoveries gradually drew the attention of bone regeneration study to osteogenesis,
the study of mesenchymal cells and their differentiation into osteoblastic cell lines.
13

Nowadays, the molecular mechanism of these physiological processes is one of the hot
topics in basic research of regenerative medicine.
1.2 Biological Processes of Bone Healing and Relevant Molecules
The essence of bone healing is a continuous process of bone absorption and regeneration.
Being capable of post-natal self-reconstruction, bone tissue can undergo remodeling with
the regulations of specific cells, the extracellular matrix (ECM) and distinct growth factors
[12]
. Normally, bone healing can be divided into primary healing and secondary healing.
Primary healing, or direct healing, can occur without callus formation if the correct
anatomical reduction is conducted
[12]
. Secondary healing, or indirect healing, is the most
common way and usually involves endochondral ossification.
Following the initial break, the fracture hematoma forms as a temporary scaffold, and
an acute inflammatory response including the production and release of several important
molecules (tumor necrosis factor α (TNF-α)
[13]
, TGF-β, IGF, BMPs, PDGFs, FGFs,
different kinds of interleukins such as IL-1
[14]
and IL-6
[15]
) is activated by phagocytes
migrating to the blood clot via new blood vessels.
This post-fracture inflammatory process is necessary for the success of bone healing.
After treatment of anti-inflammatory drug like cyclooxygenase-2 (COX-2) inhibitor,
obvious impairment in fracture healing was found
[16]
. COX-2 is a key enzyme participating
in the conversion of arachidonic acid into various prostaglandins that are responsible to
induce inflammation. Figure 1 demonstrates the roles of different immune cells involved
in the inflammation response during bone repair. Neutrophils (PMNs) are the first cell type
to arrive at the fracture site after injury
[17]
. They can rapidly accumulate within first hours
to clean the broken area, which may be triggered by IL-1, IL-6, TNF-α and other
chemokines like CXCL (chemokine (C-X-C motif) ligand) 1, 2, 3, and CCL2
[18]
, released
by platelets.
CCL2 (chemokine (C-C motif) ligand 2, also referred to as monocyte chemotactic
14

protein 1(MCP 1)) is one of the first and most highly expressed chemokines in response to
fracture in both animal models and human fractures
[17]
. There is also evidence showing it
plays roles in the regulation of PMN migration
[19]
, angiogenesis, macrophage infiltration
[20, 21]
and later bone remodeling
[22]
.

Figure 1 Role of Immune Cells during Fracture Repair. Bone fracture healing can be divided
into four stages. Immune cells such as neutrophils and macrophages play important roles
throughout these process as majority of their activity occurs during early stages, the inflammatory
phase (modified after [23]).

TNF-α is a central mediator in this inflammatory response, whose abnormal physiology
is involved in poor bone healing of some diseases such as osteoporosis and diabetes
[13]
. It
is reported that TNF-α can stimulate CCL2 production to promote the recruitment of
neutrophil and monocytes
[24]
. Human monocyte-derived IL-1 is a large cytokines family
primarily associated with innate immunity (inflammation) as well as IL-6. Closely linked
to damaging inflammation, IL-1 and IL-6 are shown to promote formation of callus and
15

blood vessels after injury by recruiting the monocytes to the site of injury
[18]
. IL-1 and
TNF-α are potent inducers of IL-6, and IL-6 inversely regulates TNF-α expression
[25]
.
The TGF-β family includes TGF-βs (TGF-β1, TGF-β2, TGF-β3), activins, inhibins,
BMPs and other functional factors, sharing conserved structural motifs and signal through
similar mechanisms
[26]
. These members are assumed to be responsible for lineage
commitment and progression in differentiation of undifferentiated mesenchymal stem cells
(MSCs) into osteoblasts, myoblasts, adipocytes, chondrocytes, tenocytes and other
precursors (progression to osteoblasts is shown in Figure 2)
[27]
. TGF-βs are released from
platelets, bone and cartilage extracellular matrix. Martin et al. demonstrated that exogenous
TGF-β has the ability to enhance fracture healing in rabbit tibiae by increasing the bending
strength and callus size
[28]
. BMPs are released from osteoprogenitor cells, osteoblasts and
bone extracellular matrix. The specific functions vary among different BMPs. Most BMPs
are reported to participate in the promotion of the chondrogenic and osteogenic
differentiation of MSCs in vitro and bone repair and formation in vivo
[29-31]
. However,
BMP-3, whose expression is regulated by canonical wingless-type (Wnt) signaling, inhibits
osteoblast differentiation as shown in Figure 2
[32-34]
. Wnt proteins are glycoproteins known
for affecting normal limb development and playing critical roles in early fracture healing
as well
[6]
. BMP-3
(-/-)
mice have an increase of 50% more trabecular bone than wild mice
[35]
, and overexpression of BMP-3 in transgenic mice leads to low bone mass and
spontaneous fractures in utero
[36]
confirming the repressing effect of BMP-3 together with
the finding in cell culture
[35]
. Among other BMPs, BMP-2 is shown to be essential for bone
repair by numerous animal and clinical studies
[37, 38]
, while BMP-7 (also termed OP-1)
may be more relevant to the recruitment of progenitor cells
[39]
. In addition, BMPs signaling
depends on the interplay with other pathways including those activated by Wnt, TGF-β,
FGF and TNF-α
[40]
.
16

Figure 2 TGF-β Family Signaling in Osteoblasts Differentiation (modified after [27]).

FGFs, released from macrophages, MSCs, chondrocytes and osteoblasts, are mitogenic
for MSCs, chondrocytes and osteoblasts. IGF, released from bone matrix, osteoblasts and
chondrocytes, promotes proliferation and differentiation of osteoprogenitors cells. PDGFs,
released from platelets and osteoblasts, are mitogenic for MSCs and osteoblasts and
responsible for macrophage chemotaxis. Much of the understanding of their function has
been gained from studying their expressions at fracture sites in vivo and their effects on
bone formation in vitro
[1, 10, 11, 41]
.
PMNs can also secrete CCL2 and IL-6 for macrophage recruitment. Inflammatory
macrophages recruited to the site of injury have a particular influence on endochondral
ossification, since the conversion from cartilage to bone is delayed after reducing the
number of macrophage in mice
[42]
. While osteomacs, the resident macrophage cell
population locating on the endosteal and periosteal surfaces in close proximity to bone
lining cells of healthy unfractured bone (with possible exception of cartilage), seem to be
pivotal for intramembranous bone formation during fracture healing
[43-46]
. Lots of studies
show that osteomacs promote osteoblastogenesis and matrix deposition in vitro and bone
anabolism in vivo
[47, 48]
. It is shown that macrophages can produce oncostatin m, an
inflammatory cytokine to support intramembranous bone healing in a genetically modified
mouse model of tibia injury
[49]
. Actually, limited direct evidence implicates the osteomacs
17

in ongoing bone regeneration via remodeling due to the experimental challenges associated
with depicting osteomacs versus osteoclast functions both in vitro and in vivo. Since
osteoclasts and osteomacs are mature cells of the myeloid lineage, osteoclasts are
considered to be a resident tissue macrophage subpopulation in the broader immunology
field, and they share progenitors, growth factors and overlapping functional capabilities
[50,
51]
. Expression of tartrate-resistant acid phosphatase (TRAP)
[46]
and cathepsin K
[52]
is one
feature of osteoclasts to be relatively distinguished from macrophages. However, TRAP
[53]

and cathepsin K are also reported to be expressed in macrophages under certain conditions
as well
[54]
. Lymphocytes then migrate into the fracture callus and initiate the adaptive
immune response. This whole inflammation can be completed within 7 days after fracture.
The recruitment of mesenchymal stem cells and fibroblasts then successfully displaces
the hematoma and forms the soft callus (primary cartilaginous callus). Undergoing
revascularization and calcification, the soft callus will gradually turn to hard callus and is
eventually remodeled to a normal bone structure. This is a long-time continuous process,
which can take about 3-9 years to fully complete in the human body. During the repairing
process, hyaline cartilage and woven bone in the soft callus unite and be replaced by the
trabecular bone via endochondral ossification. Events of endochondral ossification occur
adjacent to the fracture site and span a period of up to 28 days. Meanwhile, osteoclasts
resorb the dead bone; osteogenic cells become active, divide, and differentiate into
osteoblasts. Remodeling is finished when the trabecular bone is completely substituted
with compact bone.
1.3 Interplay of Osteoclasts and Osteoblasts during Bone Healing
1.3.1 Various Cell Types Participating in Bone Healing
Bone regeneration represents an elaborate arrangement of biological events including
cellular recruitment, proliferation and differentiation modulated by critical cytokines and
18

growth factors. These biologically active molecules are secreted by different cell types.
Generally regarded as a biologically optimized process, bone healing largely relies on the
well-organized interplay of various cells including endothelial cells, platelets, macrophages,
monocytes and mesenchymal stem cells.
Mesenchymal stem cells, i.e., multipotent mesenchymal stromal cells are believed to
mediate the bone regeneration as ancestors of osteoprogenitors. MSCs are used in bone
repair applications since they have the direct ability to generate osteoprogenitors and
osteoblasts and can also differentiate into fibroblasts, chondrocytes, myoblasts and
adipocytes. The repairing of critical-sized bone defects requires the MSC culture-
expansion to give rise to enough MSCs for large scaffolds populating as well. In fracture
repair, however, where defects are often small and host factors are significant, novel in situ
approaches for the enhancement of local responses by host MSCs appear to be more
practical and cost-effective
[55]
. Stromal cell-derived factor 1 (SDF-1, also known as
CXCL12) is one of the key chemokines produced by bone vascular endothelial and marrow
stromal cells, which binds to osteoclast precursors expressing the chemokine receptor type
4 (CXCR4). SDF-1 mediates the recruitment of MSCs both from local and systemic
sources
[56, 57]
. It is reported that stromal SDF-1 chemotactic gradients could affect
migration patterns of both injected and host MSCs
[58, 59]
. Targeted delivery of SDF-1 can
be applied to trigger the migration of host MSCs instead of injecting exogenous MSCs. In
addition, injection of autologous MSCs into fracture hematoma may have benefit as they
may facilitate the transition from the inflammatory phase to the callus formation stages of
fracture repair
[59]
.
At the site of injury, the extracellular matrix provides the natural scaffold for all the
cellular events and interactions. Cell adhesion, migration, proliferation and differentiation
are examples of biological processes influenced by the composition and structural
organization of surrounding extracellular matrices.
19

Figure 3 Models of Fracture and the Cellular Participants. (A) Four-stage model of fracture
healing. (B) Anabolic/catabolic model of fracture repair. (C) Cellular contributors to the healing
showing the participation of several important cell types (modified after [60]).
1.3.2 Significance of Osteoblasts and Osteoclasts
Among the coordinately participating cells, osteoblasts and osteoclasts are considered to
be highly significant to the function and maintaining of the skeletal system. Osteoblasts,
the bone synthesizing cells, are developed from osteogenic cells that are derived from
mesenchymal stem cells in the periosteum and endosteum sharing precursors with other
cells of the osteoblast lineage such as stromal cells, bone lining cells, osteoprogenitors,
preosteoblasts and osteocytes. However, osteoclasts, the bone absorbing cells, are
developed from monocytes that are derived from hematopoietic stem cells in bone marrow,
sharing precursors with macrophages. With diverse origins, they are both involved in bone
remodeling on the endosteal and periosteal bone surfaces.
20

The intercellular communications between osteoblasts and osteoclasts involve cell-cell
contact, diffusible paracrine factors and cell-bone matrix interactions
[61]
, serving as the
quintessential mechanism in bone remodeling, a vital step of bone healing. It is established
that osteoblasts can produce various cytokines to promote osteoclastogenesis. This
osteoblast-osteoclast communication, which can be divided into initiation, transition and
termination phases, occurs in a basic multicellular unit (BMU) (shown in Figure 4). The
influence from osteoblasts to osteoclasts can be represented in the initiation phase. At the
initiation phase, hematopoietic precursors are recruited to the BMU. These precursors
express cell surface receptors including c-Fms, RANK and co-stimulatory molecules, such
as osteoclast-associated receptor (OSCAR), and differentiate into osteoclasts following
cell-cell contact with osteoblasts, which express ligands such as RANKL. In addition,
emerging investigations have identified that estrogens can regulate RANKL membrane
association to antagonize RUNX2-mediated osteoblast-driven osteoclastogenesis, partly
explaining the observation that loss of estrogens leads to bone loss and osteoporosis in
human body
[62]
.

Figure 4 Phase Model of Bone Remodeling. Cells in osteoclast (red) and osteoblast (blue)
21

lineages are shown. Osteocytes (star-shaped) and canaliculi (blue lines) are also shown in bone
(gray). Initiation starts with recruitment of hematopoietic precursors. Osteoclast differentiation is
induced by osteoblast lineage cells expressing osteoclastogenic ligands such as RANKL.
Osteoclasts become multinucleated and resorb bone. The transition is marked by switching from
bone resorption to formation via coupling factors, possibly including diffusible factors (yellow
pentagons), membrane bound molecules (yellow lollipops), and factors embedded in bone matrix
(yellow triangles). The termination phase ensures that the resorbed lacuna is refilled due to the
bone-forming activity of osteoblasts, and osteoblasts flatten to form a layer of lining cells over new
bone (modified after [61]).

After the initiation phase, the bone remodeling gradually enters the transition (from
resorption to formation) and termination phases. This accomplishment relies on the
osteoblastogenesis mediated by osteoclast-derived coupling factors in the callus. However,
on the other side, the signaling in the reverse direction directing the differentiation and
activation of osteoblasts in resorbed lacunae to refill it with new bone has been recognized
but with limited studies. Potential osteoclast-derived molecules that may play an important
role in the control of osteoblastic growth, differentiation and function include sclerostin,
hepatocyte growth factor (HGF), platelet-derived growth factor BB (PDGF BB), myeloid
protein-1 precursor (Mim-1), BMP-2 and TGF-β
[63]
.
Sclerostin is an osteoclast-derived molecule that may have a specific paracrine mode of
action on osteoblastic cells. Its loss-of-function mutation would attribute to Sclerosteosis,
an autosomal-recessive and inherited disease characterized by abnormal hardening and
thickening of developmental bone tissue. This progressive bone overgrowth is related to
the sclerostin sequence similar to the BMP antagonists. Sclerostin is primarily produced by
osteocytes in young animals. However, it is also demonstrated that osteoclasts from aged
mice can produce it in quantities that may contribute to the age-related impairment in bone
formation
[64]
. Mim-1 was shown to induce the proliferation of osteoblastic precursor cells.
22

HGF has the ability to promote DNA synthesis and cellular proliferation in osteoblasts and
osteoclasts, since both these two cell types have the HGF receptor. PPDF BB is well
characterized in bone remodeling and has been shown to have a mitogenic affect, mainly
on osteoblasts and osteoblast-like cells
[11]
. Apart from this, it is illustrated that bidirectional
signaling generated by interaction between ephrinB2 on osteoclasts and EphB4 on
osteoblast precursors facilitates the transition phases. Potential coupling factors produced
by osteoclasts is shown in Table 1.

Table 1 Potential Coupling Factors Produced by Osteoclasts (modified after [61], [65], [66])
OSTEOCLAST OSTEOBLAST EFFECTS ON OSTEOCLAST EFFECTS ON OSTEOBLAST
TGF- β (matrix)
a
→ TGF Receptor Various Enhances bone formation
BMP (matrix)
a
→ BMP Receptor Unknown Enhances bone formation
IGF-2 (matrix)
a
→ IGF Receptor Unknown Enhances bone formation
Cathepsin K → Unknown Unknown Enhances/inhibits bone
formation
TRAP → GPC4 homolog,
TRIP-1
Unknown Enhances differentiation
Atp6v0d2 → Unknown Fusion Suppresses bone formation
Sphingosine 1-phosphate (S1P) → S1P receptor Attenuates differentiation (intracellular
S1P)
Stimulates migration and
survival, induction of RANKL
(secreted S1P)
mim-1 → Unknown Unknown Induces proliferation
PDGF BB → PDGF Receptor Inhibits differentiation by OPG Suppresses differentiation
HGF → HGF Receptor Stimulates migration and DNA replication Stimulates DNA synthesis and
proliferation
Wnt10B → Frizzled, LRP5 Unknown Enhances differentiation
OCIL → ? Unknown Inhibits differentiation
23

CTHRC1 → ？ Unknown Enhances osteoblastic bone
formation
Semaphorin (SEMA) 4D → Plexin-B1 Unknown Inhibits bone formation
CT-1 → GP130, LIF-R Unknown Stimulate bone formation
during remodeling
Sclerostin (in osteoclasts from
aged mice)
→ ? Unknown Inhibits bone formation
Complement Component 3a
(CC3a)
→ CC3a receptor (CC3Ar) Unknown Enhances differentiation
? ← OCIL Inhibits differentiation Unknown
c-Kit ← SLF
(membrane bound)
Suppresses differentiation Enhances bone formation
ephrinB2 ↔ EphB4 Inhibits differentiation Enhances differentiation
Connexin ↔ Connexin Regulates differentiation Enhances differentiation and
bone formation
→, signals from osteoclasts to osteoblasts. ←, from osteoblasts to osteoclasts. ↔, bidirectional.
a
Embedded in bone matrix.
1.4 Objectives of This Thesis
The remodeling based on the coupling between osteoclasts and osteoblasts during bone
repair is a highly regulated and complex event, with especially unclear signaling pathway
from osteoclasts to osteoblasts. Confronted with this limited situation, it is meaningful and
indispensable to figure out the novel osteoclast-derived specific cytokines and their roles
in bone homeostasis and repair (including the timepoint of expression and the cellular
locations).
Also, it is widely accepted that many metabolic bone diseases are associated with the
24

disruption of the communication between osteoclasts and osteoblasts. These diseases can
range from giant cell tumor of bone and other osteolytic bone tumor, osteoporosis,
osteopetrosis, osteogenesis imperfecta, Paget’s disease, periodontitis to osteoarthritis and
aseptic loosening
[33]
. The understanding of osteoclast-derived factors that have the
potential to control osteoblastic growth and function specifically during repair is not only
significant for future bone fracture therapy, but also enlightening in other bone diseases
mentioned above.
In this thesis, we first select the gene candidates based on RNA-Seq results with the
RNA collected from two transgenic mice lines using CRE-mediated translational profiling
method. In Kyoung Mah contributed to a significant part of the work to generate the RNA-
Seq data sets. Two types of transgenic mouse lines carrying TrapCre or Mx1Cre with a
conditional RiboTag (CRE-inducible L10a-eGFP version) were generated and tissue was
collected 1 week after injury for ribosome pull-down assays. Since Mx1Cre and TrapCre
are monocyte and osteoclast-specific respectively, it is practicable to isolate the RNA that
is mostly specific to the pre-osteoclasts and osteoclasts. The choose of CRE-mediated
translational profiling method can avoid the cell damage due to unusual mechanical forces
caused by FACS. To improve the specificity of gene candidates, we preferentially selected
extracellular and secreted upregulated genes overlapping in both RNA-Seq data sets from
the two transgenic mouse experiments. With the candidates list, we are moving on to RNA
in situ hybridization to determine when and in which cells these genes may be expressed
during repair.
25

Chapter 2 Methods and Results
2.1 Preliminary Results of Translational Profiling
2.1.1 Injury & Regeneration Assay
Two types of dual transgenic mice were generated; one expressed TrapCre and a
conditional RiboTag (L10a-eGFP version), and the other one carried the Mx1Cre;L10a
transgenes as TrapCre is not strictly specific to osteoclasts. Under sedation, a 2-cm skin
incision is made below the 10
th
rib exposing the 8, 9 or 10
th
rib for surgery. Periosteum was
kept intact to be compared with the non-periosteum group with respect to rib regeneration.
Resected samples from the transgenic mice were collected at 1 and 2 weeks after
resection. Tissue was collected from the region just outside the lesion where periosteally
located osteoclasts are found as well as the repairing callus.
2.1.2 Ribosome Profiling
To induce Mx1Cre expression, two days of serial Polyinosinic-polycytidylic acid (Sigma,
P9582-5MG) injections were administered 3-4 days prior to sample collection. Rib repair
callus from two or three resected mice were removed. 16-20 ribs from an unresected mouse
of the corresponding genotype were also removed for control experiments. On the first day,
the tissue is quickly removed and homogenized. The sample is then centrifuged to create a
post-mitochondrial supernatant and incubated with Streptavidin/ProteinL/GFPantibody
beads overnight. The following morning, the tube is placed in a magnetic rack causing the
magnetic beads, now bound to the ribosome-associated cell-type-specific mRNAs, to move
to the side and the supernatant is removed. High salt washes are repeated three times and
then a low salt buffer is used to elute. RNA is purified with a Qiagen RNeasy kit and RNA
integrity analyzed on a Bioanalyzer 2100. In more detail, the tissue was immediately
26

homogenized on ice in 1ml lysis buffer. Monoclonal Htz-GFP19F7 and Htz-GFP-19C8
antibodies (Monoclonal Antibody Core Facility, Memorial Sloan-Kettering Cancer Center)
were bound to MyOne T1Dynabeads (ThermoFisher Scientific, 65601) and antibody
conjugated beads were added to a post-mitochondrial supernatant of rib lysates.
Supernatant and beads were incubated at 4°C overnight in a rotator. After several washes
with high salt wash buffer, the beads were resuspended in RNA lysis buffer of Absolutely
RNA Nanoprep Kit (Agilent, 400753), RNA was isolated, and DNA was removed. The
quality of RNA was examined using an RNA nano-chip on an Agilent 2100 Bioanalyzer.
While RNA isolated from other tissues (i.e. liver) had typical QC readings (peak size at
4kb with a majority of RNAs of larger sizes), RNA isolated from rib repair tissues typically
had lower peak values (1kb). Fortunately, the majority of RNA was found to be larger than
this peak. In addition, the profiles were very consistent in our hands. 45ng (for V2 kit) or
220ng (for FFPE system) RNA was used to generate cDNA using Ovation RNA-seq system
V2 (NuGEN, 7102- 08) or Ovation RNA-seq FFPE system (NuGEN, 7150-08) and the
integrity of generated cDNA was assessed using an RNA nano-chip on an Agilent 2100
Bioanalyzer.
2.1.3 RNA Seq
RNA expression was compared in biological triplicate (and in some cases quadruplicate)
to mRNA from unresected rib to specifically identify osteoclast genes that are upregulated
in response to injury. When done in biological triplicate, at least 3 (2 healing time points,
1 unresected) x 3 samples (12 total) were collected.
RNA libraries were prepared according to the manufacturer’s instructions for the NuGen
Ovation RNASeq V2 or FFPE Systems. In brief, first strand cDNA was generated from
total RNA using DNA/RNA chimeric primers and reverse transcriptase, creating a
cDNA/RNA hybrid. The second strand cDNA was then synthesized containing a
DNA/RNA duplex. The resulting double-stranded cDNA molecule was amplified by Single
27

Primer Isothermal Amplification (SPIAR) using a chimeric SPIA primer, DNA polymerase,
and RNase H (NuGen). Following amplification, the products were modified by random
priming and extension to create double-stranded products that were suitable for generating
libraries for sequencing. Unique indexes were incorporated for each sample. The double-
stranded products then underwent blunt-end repair. Adapter molecules were ligated to the
5’ and 3’ ends of each fragment to facilitate PCR amplification of the fragments to produce
the final library. The concentration and size distribution of the resulting libraries was
determined on an Agilent Bioanalyzer DNA 1000 chip (Santa Clara, CA). Unique indexes
were incorporated at the adaptor ligation phase for multiplex sample loading on the flow
cells. Libraries were loaded onto single or paired end flow cells at concentrations of 8-10
pM to generate cluster densities of 700,000/mm
2
following Illumina’s standard protocol
using the Illumina cBot. The flow cells were sequenced as 75 single or paired end reads on
an Illumina HiSeq 2000 using TruSeq SBS sequencing kit version 3 and SCS version 1.4.8
data collection software. Base calling was performed using Illumina’s RTA version
1.12.4.2. We achieved a sequencing depth of ~25 million reads per sample. Raw data from
wild-type samples was analyzed to generate candidate gene lists in consultation with the
team using packaged software but also using our custom package. Data was subsampled
for secreted proteins for enhanced comparison power.
Study design and analysis was done in consultation with USC’s Epigenome center and
based on current understanding of the parameters
[37]
. In brief, an initial pilot RNA-seq test
was run with low depth to determine of the number of biological replicates needed, depth
of read, and which parameters to randomize. After collecting raw data from the main run
(in triplicate), we decide to proceed and collected reads at a depth of ~25 million.
The flow chart is shown in Figure 5.

28

Figure 5 RNA Seq.
2.2 Analysis of Genes Candidates List
We finally chose the overlap of genes between two transgenic mice RNA-Seq output to
set as the gene candidates for further analysis (shown in Table 2).
It is clear that our screen did not identify all the factors in Table 1 since the cytokine
released during bone repair may be different from those released during homeostasis. The
outcome only shows the upregulated data of injured groups compared to the uninjured
groups. As a result, some non-upregulated cytokines that are shown to be released for
homeostasis would not be counted into the list. It might be also relevant to the timepoint
(7 days after resection) of sample collecting where the callus still remained soft and
osteoclasts primarily work during remodeling. In addition, Trap is mostly expressed in
mature osteoclasts, so we may lose some potential genes by focusing on only overlapping
genes. In spite of this, we still found out some genes such as Nid1 whose study regarding
the relation to bone repair is not well developed.
29

Table 2 Genes Candidates List for OC Specific Cytokines Characterization
Growth Factors Cytokines Peptidases
Igf2
Igf1
Ptn
Fstl1
Ccl7
Cxcl2
Ccl8
Cxcl16
Ccl9
Mmp12
Mmp2
Mmp14
C1qb
In OC, macrophages and
cartilage callus
OC genes Others
Postn
Nid1
Acp5
Ctsk
C1qtnf3
C1qtnf6
Thbs4
Gsdmd
2.3 TOPO Cloning
We chose TOPO cloning as it is simple and time-saving by just combining the PCR
product and a TOPO cloning vector in the provided reaction buffer, waiting 5 minutes, then
transforming an E. coli strain (shown in Figure 6 from instructions of Invitrogen
®
Zero
Blunt TOPO PCR Cloning Kit).

Figure 6 TOPO PCR Cloning.
30

2.3.1 PCR
2.3.1.1 PCR Primers Design
Primers were designed using the NCBI tool Primer Blast
(https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Two pairs of primers amplifying over
700 bp PCR fragment size for mostly each gene on the candidate list were chosen. Size of
genes like Ccl8 is even smaller than 700bp, so not every pairs of primers can fulfill this
requirement. In addition, conserved sequence binding was avoided as much as possible.

Table 3 Primer List
Genes Primers Tm (℃, 50mM NaCl)
Growth Factors
Igf2 F 1 : C G G C T T C T A C T T C A G C A G G C
R 1 : A G G G C A C T G A A G C A A T G A C A
F 2 : G C C G T A C T T C C G G A C G A C T T
R 2 : G A A G A A A G A G T T T G G G C G G C
58
57
60
57
Igf1 F1: TGACCGCACCTGCAATAAAGA
R 1: GAG CTA CG TGGG AAGA GGTG
F 2 : G A C C G C A C C T G C A ATA A A G A
R 2 : G C T T G A G C TA C G T G G G A A G A
57
57
56
57
Ptn F 1 : ATA A G C C G A G C TAT G G A C C C
R 1 : G C A C T C A G C T C C A A A C T G C T
F2: GGGAGGGGGAGAAAAACATGG
R 2 : T T T G A C T C C G C T T G A G G C T
57
58
58
57
31

Fstl1 F 1 : G G A T G G A C G C T C A G G C T A T C
R 1 : A G C A G A A G A G G A A T G T G G G C
F 2 : T C A A G T G C C T C A A C C C A T C C
R 2 : T A A C T A G T T G G G C G G C T G T G
58
58
57
57
In OC, macrophages and cartilage callus
Postn F 1 : C C A C G G A G A G C C A G T C AT TA
R1: TACCAACTCTGCAGTAATTCTCTT
F2 : C AAAA CGGAA GGA CC TGCAA
R2: AGTTTTCTGAATTACCAACTCTGC
57
54
56
54
Nid1 F 1 : A G C A G C A G T T C A G C G G TAT T
R 1 : AT T C AT C C A C G T C T C G G C A G
F 2 : C T G C T G T G G T T G G T T T C A G C
R 2 : TA A A C T C G C C C C C A G T G AT G
57
57
57
57
Cytokines
Ccl7 F1: GAAGCCAGCTCTCTCACTCTC
R1: AGTAAAAATGGGGAAAGGGGG
F2: T GAAGCCAGCTCTCTCACTC T
R2: AAAGTAAAAATGGGGAAAGGGGG
57
55
58
56
Cxcl2 F 1 : C A G G C TA C A G G G G C T G T T G T
R1: TGAACATGCACACTCCTTCCAT
F2 : C C A A C C A C C A G G C TA C A G G G
R2: ATGAAAGCCATCCGACTGCAT
60
57
60
57
Ccl8 F1: AGCTGTGGTTTTCCAGACCAA
R 1: G AT GA GAA AA CA CG CA GC CC
F2: CATGGAAGCTGTGGTTTTCCA
R2: TGCCTGGAGAAGATTAGGGGA
57
57
56
57
Cxcl16 F 1 : T T G G A C C C T T G T C T C T T G C G 58
32

R 1 : TA C C A G A G C T G C A A A C C T G C
F 2 : G G G C T T T G G A C C C T T G T C T C
R 2 : G C G C TA G G G T C T T G G T T C A A
58
58
58
Ccl9 F1: CCAGATCACACATGCAACAGAG
R 1 : A A A AT C C G C T G G G A A A C C G A
F2 : C C G G G C AT C AT C T T TAT C A G C
R 2 : T G G C T TA C T G AT G G A G G G G T
56
57
56
58
Peptidases
Mmp12 F 1 : AT T T G C T G A A G G T T C C C A G C
R 1: G TC ATC AG CAGA GA GG CGA A
F 2 : G C A G A A A C C T G G C T G C ATA C
R2: CTTCCACCAGAAGAACCAGTCT
56
57
57
56
Mmp2 F1: C C C C ATG AA GCC T TG T TTAC C
R 1 : G G T C A G T G G C T T G G G G TAT C
F 2 : T C G C C C AT C AT C A A G T T C C C
R2: GTAAACAAGGCTTCATGGGGG
56
58
57
56
Mmp14 F 1 : C G C G C T C TA G G A AT C C A C AT
R1: GTGACCCTGACTTGCTTCCATA
F2: TGTCTTCAAGGAGCGATGGTT
R 2 : G C C T T C A G A G G C A A A G T C C T
57
57
56
57
C1qb F1: TA AA GG GGG AGA AA GGG C TC
R 1 : G T C T G G G T T T C A G G C A G T C A
F2: CCATACACAGGAAGCCCCTGA
R 2 : G T G A A G AT G C T G T T G G C A C C
56
57
59
57
OC genes
Acp5 F 1 : G A C C C A C C G C C A A G AT G G AT
R 1 : C A C A C C G T T C T C G T C C T G A A
60
57
33

F 2 : A C C C A C C G C C A A G AT G G A
R 2 : C A C ATA G C C C A C A C C G T T C T
60
57
Ctsk F 1 : G C A C C C T TA G T C T T C C G C T C
R 1 : A A C T T T C AT C C T G G C C C A C A
F 2 : TA G C C A C G C T T C C TAT C C G A
R 2: G C T C T CT C CC CA G C TG T T TT T
58
57
58
58
Others
C1qtnf3 F1: CTAATAAAGCGGTGGCCAGGA
R 1 : G C T C C ATA A A G A A C C C C C G A
F2: GAGAGAGCAGAGCCAAGCTAA
R2: AATTGCCCCCAAAGTGGAGAT
57
57
57
57
C1qtnf6 F 1 : G G A A G C C A G G G T C T T T G T G A
R 1: G G AC C CA GT C TA GA GG AG CA
F2: TCCTAAAGGGTGACAAAGGGG
R 2 : A A G G C C T G A G A C C AT G T G A G
57
58
57
57
Thbs4 F1 : G C C A C A A G C A C A G G A G A C T T
R 1 : C A C A G A C ATA G C C G T C A C C A
F 2 : C T T G T T T C C G A G G T G T C C G A
R 2 : C A C AT C C G A C T G G T TA G G G T
58
57
57
57
Gsdmd F1: CATGAAAGGCACCTTCAGCAGC
R 1 : G G G T G C T C T G T T C C A A G A C G
F2: GCATGAAAGGCACCTTCAGCAG
R2: CTGTTCCAAGACGTGCTTCAC
59
58
59
56
2.3.1.2 PCR
The designed primers were divided into 5 groups based on the annealing temperature
(first set as 5 ℃ lower than Tm for test). The groups are shown in Table 4. PCR was then
34

performed using the following protocol. Templates were cDNA from the rib callus samples
(7 days after injury) of mice. Electrophoresis was carried out under 110-120V for 20-30
minutes.

Table 4 Five Groups of Primers Tested
Annealing
Temperature (℃)
Primers (Gene Name_Pair No.) Product Size (bp)
49 Postn_P1
Postn_P2
888
993
50 Ccl7_P1 611
51 Ccl7_P2
Ccl8_P2
Ccl9_P1
Ccl9_P2
Igf1_P2
Mmp2_P1
Mmp2_P2
Mmp12_P1
Mmp12_P2
Gsdmd_P2
Fstl1_P1
614
184
827
822
923
855
749
728
875
838
940
52 Ccl8_P1
Cxcl2_P1
Cxcl2_P2
Igf1_P1
Igf2_P1
Igf2_P2
225
712
700
920
1032
881
35

Ptn_P1
Ptn_P2
Nid1_P1
Nid1_P2
Acp5_P1
Acp5_P2
Ctsk_P1
C1qb_P1
C1qb_P2
Mmp14_P1
Mmp14_P2
C1qtnf3_P1
C1qtnf3_P2
C1qtnf6_P1
C1qtnf6_P2
Thbs4_P1
Thbs4_P2
Fstl1_P2
843
985
816
897
779
787
705
700
759
993
800
961
826
1000
981
748
968
777
53 Cxcl16_P1
Cxcl16_P2
Ctsk_P2
Gsdmd_P1
703
736
956
844

Table 5 PCR Reaction Assembly
Components Volume (μL)
AccuStart
TM
II GelTrack
TM
PCR SuperMix (2X)
Nuclease-free water
6 μL
3.75 μL
36

Forward primer
Reverse primer
DNA template
0.75 μL
0.75 μL
0.75 μL
Total V olume 12 μL

Reaction Protocol:
Initial denaturation: 94℃, 1 min
PCR cycling (35 cycles): 94℃, 30s
55 – 65℃, 15s
68 – 72℃, 1 min per kb of product length
Hold 4℃ until processed for analysis

The testing based on Table 4 generated nonspecific results with several bands visiable
on the gel for each reaction. Additional tests were then conducted by gradually increasing
the annealing temperature using a gradient (in case, lower temperature was considered as
well) and/or changing the PCR reagents to increase the specificity. Finally, 4 pairs of
primers were shown to be useful after testing (shown in Table 6). Considering the
possibility that the target gene may not be fully amplified, genes shown with one clear and
obvious band were counted regardless of the improper size (shown in Figure 7).

Table 6 Primers Available after Testing
Annealing Temperature (℃) Primers (Gene Name_Pair No.)
55 Ccl7_P2
Gsdmd_P1
60 Mmp14_P2
Cxcl16_P1

37

Figure 7 PCR Results of Last Testing. Given the fact that other primers remained unavailable or
unspecific after several adjustments including changing cDNA templates sources, PCR reagents
and annealing temperature, 7 pairs of primers (1-Ccl7_P2, 2-Thbs4_P2, 3-Gsdmd_P1, 4-Ptn_P1,
5-Ccl8_P2, 6-Cxcl16_P1, 7-Mmp14_P2) were used for final testing and followed-up with gel
extraction and cloning. Bands from lanes 1-Ccl7_P2 and 3-Gsdmd_P1 were also collected as they
showed an obvious band (even with improper size). 2-Thbs4_P2 and 5-Ccl8_P2 showed faint
results on contrary to previous positive results, which deserves later re-confirming. 4-Ptn_P1
remained ambiguous for several tests, so it was finally not accepted. 6-Cxcl16_P1 and 7-
Mmp14_P2 are positive results with correct size and practicable repeat. G: GADPH, positive control;
M: 100bp Ladder.
2.3.2 E. coli Transfection
Transfection via TOPO Cloning Reaction was carried out following the product
instructions. The PCR product was collected by gel extraction.

38

1. A 6 μL TOPO
®
Cloning reaction:

Table 7 Reaction Assembly
Reagent Volume (μL)
Fresh PCR Product
Sterile water
Salt Solution
pCR
TM
-Blunt II-TOPO
®

0.5 -4 μL
Add to a total volume of 6 μL
1 μL
1 μL
Total V olume 6 μL

2. Mix gently and incubate for 5 minutes at room temperature.
3. Place tubes on ice.

One Shot
®
Chemical Transformation
1. Thaw 1 vial of E. coli cells (DH5α) on ice for each transformation.
2. Add 2 μL of the TOPO
®
Cloning reaction to each vial of E. coli cells to be transformed
and mix gently.
3. Incubate the vials on ice for 5–30 minutes.
4. Heat-shock the cells for 30 seconds at 42°C without shaking.
5. Add 250 μL of room temperature LB to the cells.
6. Cap the tubes and shake them at 37°C for 1 hour.
7. Spread 10–50 μL from each transformation on pre-warmed LB plates containing 50
μg/mL kanamycin.
8. Incubate plates overnight at 37°C.
2.3.3 Colony PCR
After overnight incubation at 37°C, all plates showed growing colonies. Ten colonies for
39

each plate were picked and transplanted to new culture medium overnight for further
proliferation. Colony PCR was conducted using the same protocol as testing one. Results
are shown in Figure 8.

Figure 8 Colony PCR Results of 4 Pairs of Primers. Sample 2 & 3 of Ccl7_ P2, sample 2, 6 & 7
of Gsdmd_P1, sample 3, 6 & 8 of Cxcl16_P1 and sample 1 of Mmp14_P2 are assumed to be
potentially positive clones. Colonies showing positive results were then picked into 5 mL LB to be
shaken overnight for plasmid extraction. G: GADPH, positive control; M: 100bp Ladder.

Plasmid was then extracted using the Qiagen plasmid extraction kit followed by
sequencing. Sequencing results demonstrate a non-perfect insertion of Mmp14 PCR
products into pCR-Blunt II-TOPO vector (shown in Figure 9). Other samples sent for
sequencing show either unknown or non- insertion. The colony of sample 1 of Mmp14_P1
was picked into 5 mL LB for another proliferation, mixed with glycerol in the ratio of 1:1
and kept in -80 °C for reservation.

40

Figure 9 Sequencing Results Showing the Insertion of Mmp14. Two fragments (demonstrated
in yellow and purple) of Mmp14 cDNA are shown to be inserted into pCR-Blunt II-TOPO vector with
limited mutations (in red rectangles). There is an unknown fragment between these two fragments.
Since these two fragment sequences locate exactly on different exons next to each other, this
unknown interval sequence seems to be intronic, indicating contamination of genomic DNA in the
cDNA used as a template. Blatsn results show that this 323bp fragment has high similarity to
Mmp14 genomic DNA (location 54,440,021…54,440,338), exactly matching the intron (location
54,440,021…54,440,340) between exon 9 and exon 10 and together explaining the product size
shown in the previous PCR. Unfortunately, this unpredicted insertion means that the future
application of this clone for RNA in situ hybridization may need adjustment, but Mmp14 is still worth
continuing study in the future.

41

Chapter 3 Discussion
3.1 Basic Aspects of MMPs and Mmp14
In spite of the disappointing insertion, matrix metalloproteinase-14 (Mmp14, also known
as membrane type 1 MMP (MT1-MMP)) is the only one with positive sequencing results
out of the gene candidates list so far. Matrix metalloproteinases (MMPs) are a group of
Zn
2+
-dependent endopeptidases responsible for the degradation of most extracellular
matrix proteins during organogenesis. The catalytic domain of all MMPs contains a Zn
2+

ion that is coordinated by a tris(histidine) motif followed by a conserved methionine
residue. So far, the MMP family contains 26 structurally and functionally related members
in mammals. In bone tissue, MMPs and tissue inhibitors of metalloproteinases (TIMPs)
not only regulate matrix degradation and migration and survival of bone cells but are also
known to be involved in various physiological processes affecting bone and cartilage, such
as osteoporosis and rheumatoid arthritis. The biosynthesis of MMPs and TIMPs is
regulated by local and systemic hormones and factors
[67]
.
MMPs can be classified in different ways. Based on the historical assessment of the
substrate specificity, MMPs can be categorized into collagenases, gelatinases, stromelysins
and others
[68]
. MMPs can also be divided into two types according to the cellular locations:
secreted and membrane-associated. Actually, most MMPs are secreted into the
extracellular matrix. A few membrane-associated MMPs including MMP14 have been
described as membrane-type matrix metalloproteinases (MT-MMPs).

42

Figure 10 MMPs General Structure (modified after [68]).

Figure 11 Propeptide interaction with the catalytic domain through a conserved cysteine
residue (C) and the Zn
2+
ion in the catalytic pocket (the so-called cysteine switch) (modified
after [68]).

43

Figure 12 Crystal Structure of the Catalytic Domain of Mmp14. MMP14 consists of globular
catalytic domain that is approximately 177 residues in length, and a common core architecture
characterized by a long Zn
2+
-binding consensus motif, HEXXHXXGXX(H/D) and a methionine-
containing Met-turn. The catalytic Zn
2+
ion (brown balls) is located near the protein surface, with
the cleft above the metal site allowing binding of substrate peptides. In its resting state, the Zn
2+

ion is coordinated by three His residues (His239, His243, His249 for Mmp14) and at least one water
molecule serving as the nucleophile during substrate hydrolysis. (modified after [69], [70])

Synthesized by mature osteoblasts and osteoclasts, Mmp14 is membrane-associated
whose substrates include type I, II III collagens, gelatin, casein, fibronectin, vitronectin,
entactin, laminin and proteoglycans
[71, 72]
. Recently, interest in Mmp14 has increased with
observations that high expression levels of Mmp14 are also associated with tumor
progression and metastasis. More than 50 MMP inhibitors have been investigated in
clinical trials in various cancers. However, the lack of inhibitor specificity and insufficient
knowledge about the complexity of the disease biology eventually resulted in the failure of
these trials
[70]
.
44

According to previous studies, the expression of Mmp14 in osteoblastic cells is
stimulated by estrogen and progesterone
[73, 74]
. Mmp14 expression varies during osteoblast
differentiation, and it peaks in mature nodule forming osteoblasts
[56]
. Parathyroid hormone
(PTH) has been shown to inhibit Mmp14 expression in osteoblast-like MG-63 cells
[75]
.
However, it is also reported that Mmp14 expression is increased in bones from mice with
genetic constitutive activation of the PTH receptor 1 (PTH1R) in osteocytes and in bones
from mice exposed to elevated PTH levels but not in conditional knockout mice. Moreover,
PTH is shown to upregulate Mmp14 in human bone cultures, thus stimulating osteoclast
differentiation and resorption via increasing soluble RANKL production
[76]
.
Mmp14 may coordinate actions of other MMPs in the skeletal tissue regulating collagen
degradation and osteoblasts differentiations, like Mmp2/Mmp13/Mmp14 proteolytic
cascade is shown to participate in the mechanical forces-induced human osteoblasts
differentiations
[77]
. On the contrary, Mmp14 deficiency would therefore impair the
collagenolytic activity and osteogenic potential of osteoblastic cells and disrupts both
intramembranous and endochondral ossification
[78]
. Working as an activator of the latent
form of TGF-β, Mmp14 regulates osteoblast survival during transdifferentiating into
osteocytes
[79]
. Lack of Mmp14 causes increased apoptosis of osteocytes. In addition,
disruption of collagen cleavage in Mmp14 null mice interferes with normal development
and maintenance of osteocyte processes
[80]
. Mice lacking Mmp14 develop severe
connective tissue growth and remodeling abnormalities, such as dwarfism, osteopenia,
fibrosis of soft tissue, arthritis and skeletal dysplasia. Adult Mmp14 deficient mice have
increased bone resorption leading to progressive osteopenia
[77]
.
Loss-of-function of Mmp14 would cause mutant phenotypes like skeletal remodeling
defects
[78, 80-82]
and angiogenesis defects
[83]
. In bone tissue, since osteoclasts are unable to
attach to the bone surface, MMPs would be utilized to remove the osteoid layer covering
the mineralized bone matrix
[67]
. Therefore, it is crucial for osteoclasts to have normal
MMPs releasing during bone resorption. In addition, angiogenesis is necessary at the
45

inflammatory phase for cellular migration and callus formation. Mmp14 deficiency may
be detrimental even at the initiation of bone healing.
Apart from Mmp14, Mmp12 and Mmp2 in the list also deserve further investigation,
since they have potential interaction with Mmp14 during bone repair. Mmp12 is already
shown to interplay with Mmp14
[77]
, so it still remains the possibility to figure out and
reconfirm other signaling underlying the MMPs network. Besides, most MMP-deficient
mice do not show an obvious phenotypic abnormality in unstimulated conditions except
for Mmp14- and Mmp20-deficient mice
[70]
. Due to the unavailability of tissue-specific
knockout mice, the knowledge on the spatiotemporal activities of MMPs in vivo is still
insufficient. In addition, is not yet known if these proteins are specifically upregulated by
osteoclasts or their pre-cursors during injury or if they are required for an injury response.
In summary, Mmp14 is an essential enzyme for normal bone development and
remodeling. It is widely involved in most events such as osteoblasts differentiations,
osteoblasts survival maintenance and osteogenic development.
3.2 Conclusion and Future Perspectives
This project aims at deciphering the mysteries of osteoclasts-derived specific growth
factors that are involved in the bone remodeling after injury as well as their signaling
pathway and molecular mechanism of interactions. Since osteoclasts are mostly known for
its resorption ability covered with the impression of destruction, it is not easy to imagine
its critical roles in bone repair or regeneration. In this project, what’s more, it was observed
that osteoclasts were recruited to the injury site weeks before remodeling, the phase that
osteoclasts are assumed to mostly exert influences on. This finding implies the possibility
that osteoclasts may play their roles even at the early phases of bone repair particularly in
pre-osteoclasts stages. Relevant study focusing on its roles at early phases is one of the
blind spots in bone repair research. With the development of relevant new studies, it may
turn out that osteoclasts not only participate in bone remodeling but also serve as the
46

indispensable participant in bone repair. Osteoclasts may secrete cytokines to recruit
osteoblast lineage cells in addition to its function in bone absorption. Given the limited
understanding of osteoclasts-specific cytokines during bone repair, there is a need to
identify and explain their roles in both cellular and molecular levels.
The work in this thesis partly establishes the basis for following experiments. It confirms
the feasibility and time-saving feature of TOPO cloning. Using the RNA probes made from
the successful cloning, we can conduct RNA in-situ hybridization to further observe the
way Mmp14 or other factors facilitate the bone repair in the callus. Due to the limited
success of PCR and insertion, we had trouble continuing most of the rest of work. However,
it still shows the possibility that we can move on to identify many potential osteoclasts-
specific cytokines by revising the protocols and attempting alternative methods. The
original design of the experiments is simple and practicable, but could use improvement,
such as the re-design of the primers via different designing tools and changing DNA
template sources. Besides NCBI Primer Blast, primer designing software and online tools
like Primer3 and Oligo7 are available. NCBI Primer Blast is based on Primer3 and user-
friendly, but its actual application in this thesis did not show operational value. In addition,
the existing primers can be still checked for its GC% or conformation. The quality of the
cDNA library may be another reason causing the difficulty of PCR. Given the fact that
intron displays in the later cloning, it would be wiser to examine the cDNA library way
before the subsequent procedures.
To identify clastokines capable of influencing bone repair, we can make use of
conditional knock-out mice whose target genes would be specifically silenced in the
osteoclasts lineage to observe the angiogenesis and remodeling. Since Mmp14 works as an
enzyme that removes surface layer of bone, we can measure bone resorption rate by
overexpression or protein injection of Mmp14. Other approaches include competitive
inhibiting the extracellular domain of the enzyme using corresponding substrates. As for
other potential clastokines, we can observe osteoblastogenesis activity in medium with the
47

purified proteins from the other candidate genes.
Other genes like chemokine (C-X-C motif) ligand 16 (Cxcl16) and thrombospondin 4
(Thbs4) are recommended to be investigated following Mmp14 and other MMPs. Cxcl16
and Thbs4 have shown positive PCR results several times but failed in repeating or
insertion. Therefore, it is possible that Cxcl16 and Thbs4 was able to successfully be cloned
by conquering original difficulties. Cxcl16 is responsible for osteogenesis stimulation with
BMP2
[84]
. It is shown that TGF-β1 can induce Cxcl16 and leukemia inhibitory factor (LIF)
expression in osteoclasts to modulate migration of osteoblast progenitors to restore the
bone lost during the resorptive phase of bone turnover
[85]
. The Thbs4 family include
adhesive glycoproteins mediating cell-to-cell and cell-to-matrix interactions. Skeletal
growth or bone mass acquisition in Thbs4-deficient mice are not altered but they do display
a transient reduction in articular cartilage thickness
[86]
. The role of these proteins during
bone repair remains unknown, however clues for their role may come from studies about
Cxcl16 in renal fibrosis
[87]
and Thbs4 in both cancer progression and cardiovascular
diseases
[88]
.
With further investigation and development of this project, our knowledge concerning
the basic research and clinical application of bone repair could be greatly increased.

48

References
1. Westerhuis, R.J., R.L. van Bezooijen, and P. Kloen, Use of bone morphogenetic
proteins in traumatology. Injury, 2005. 36(12): p. 1405-12.
2. Hak, D.J., et al., Delayed union and nonunions: epidemiology, clinical issues, and
financial aspects. Injury, 2014. 45 Suppl 2: p. S3-7.
3. Tzioupis, C. and P.V . Giannoudis, Prevalence of long-bone non-unions. Injury,
2007. 38: p. S3-S9.
4. Giannoudis, P.V ., E. Jones, and T.A. Einhorn, Fracture healing and bone repair.
Injury, 2011. 42(6): p. 549-50.
5. Lichte, P., et al., Scaffolds for bone healing: concepts, materials and evidence.
Injury, 2011. 42(6): p. 569-73.
6. Sathyendra, V . and M. Darowish, Basic science of bone healing. Hand clinics, 2013.
29(4): p. 473-481.
7. Urist, M.R., A morphogeneric matrix for differentiation of bone tissue. Calcified
tissue research, 1970. 4(1): p. 98-101.
8. Farley, J.R. and D.J. Baylink, Purification of a skeletal growth factor from human
bone. Biochemistry, 1982. 21(14): p. 3502-3507.
9. Farley, J.R., et al., Human skeletal growth factor: characterization of the mitogenic
effect on bone cells in vitro. Biochemistry, 1982. 21(14): p. 3508-3513.
10. Phillips, A.M., Overview of the fracture healing cascade. Injury, 2005. 36 Suppl 3:
p. S5-7.
11. Kubota, K., et al., Platelet ‐derived growth factor BB secreted from osteoclasts acts
as an osteoblastogenesis inhibitory factor. Journal of bone mineral metabolism,
2002. 17(2): p. 257-265.
12. Marsell, R. and T.A. Einhorn, The biology of fracture healing. Injury, 2011. 42(6):
p. 551-555.
49

13. Karnes, J.M., S.D. Daffner, and C.M. Watkins, Multiple roles of tumor necrosis
factor-alpha in fracture healing. Bone, 2015. 78: p. 87-93.
14. Dinarello, C.A., Overview of the IL-1 family in innate inflammation and acquired
immunity. Immunol Rev, 2018. 281(1): p. 8-27.
15. Kishimoto, T. and T. Tanaka, Interleukin 6, in Encyclopedia of Inflammatory
Diseases. 2014. p. 1-8.
16. Cottrell, J. and J.P. O’Connor, Effect of non-steroidal anti-inflammatory drugs on
bone healing. Pharmaceuticals, 2010. 3(5): p. 1668-1693.
17. Förster, Y ., et al., Microdialysis sampling from wound fluids enables quantitative
assessment of cytokines, proteins, and metabolites reveals bone defect-specific
molecular profiles. PloS one, 2016. 11(7): p. e0159580.
18. Edderkaoui, B., Potential Role of Chemokines in Fracture Repair. Front Endocrinol
(Lausanne), 2017. 8: p. 39.
19. Johnston, B., et al., Chronic inflammation upregulates chemokine receptors and
induces neutrophil migration to monocyte chemoattractant protein-1. The Journal
of clinical investigation, 1999. 103(9): p. 1269-1276.
20. Arakaki, R., et al., CCL 2 as a potential therapeutic target for clear cell renal cell
carcinoma. Cancer medicine, 2016. 5(10): p. 2920-2933.
21. Wang, J., et al., Co-culture of bone marrow stem cells and macrophages indicates
intermediate mechanism between local inflammation and innate immune system in
diabetic periodontitis. Experimental therapeutic medicine, 2016. 12(2): p. 567-572.
22. Ishikawa, M., et al., MCP/CCR2 signaling is essential for recruitment of
mesenchymal progenitor cells during the early phase of fracture healing. PLoS One,
2014. 9(8): p. e104954.
23. Baht, G.S., L. Vi, and B.A. Alman, The Role of the Immune Cells in Fracture
Healing. Curr Osteoporos Rep, 2018. 16(2): p. 138-145.
24. Chan, J.K., et al., Low ‐ dose TNF augments fracture healing in normal and
50

osteoporotic bone by up ‐regulating the innate immune response. EMBO molecular
medicine, 2015: p. e201404487.
25. Akira, S., et al., Biology of multifunctional cytokines: IL 6 and related molecules
(IL 1 and TNF). The FASEB journal, 1990. 4(11): p. 2860-2867.
26. MacFarlane, E.G., et al., TGF-β family signaling in connective tissue and skeletal
diseases. Cold Spring Harbor perspectives in biology, 2017: p. a022269.
27. Grafe, I., et al., TGF-β family signaling in mesenchymal differentiation. Cold
Spring Harbor perspectives in biology, 2017: p. a022202.
28. Lind, M., et al., Transforming growth factor-β enhances fracture healing in rabbit
tibiae. Acta Orthopaedica Scandinavica, 1993. 64(5): p. 553-556.
29. Welch, R.D., et al., Effect of recombinant human bone morphogenetic protein ‐2 on
fracture healing in a goat tibial fracture model. Journal of Bone Mineral Research,
1998. 13(9): p. 1483-1490.
30. Tsiridis, E., et al., Effects of OP ‐1 and PTH in a new experimental model for the
study of metaphyseal bone healing. Journal of orthopaedic research, 2007. 25(9): p.
1193-1203.
31. Hollinger, J.O., et al., Recombinant human bone morphogenetic protein ‐2 and
collagen for bone regeneration. Journal of biomedical materials research, 1998.
43(4): p. 356-364.
32. Kokabu, S., et al., BMP3 suppresses osteoblast differentiation of bone marrow
stromal cells via interaction with Acvr2b. Molecular endocrinology, 2012. 26(1): p.
87-94.
33. Matsumoto, Y ., et al., Bone morphogenetic protein-3b (BMP-3b) inhibits osteoblast
differentiation via Smad2/3 pathway by counteracting Smad1/5/8 signaling.
Molecular cellular endocrinology, 2012. 350(1): p. 78-86.
34. Kokabu, S. and V . Rosen, BMP3 expression by osteoblast lineage cells is regulated
51

by canonical Wnt signaling. FEBS open bio, 2018. 8(2): p. 168-176.
35. Daluiski, A., et al., Bone morphogenetic protein-3 is a negative regulator of bone
density. Nature genetics, 2001. 27(1): p. 84.
36. Gamer, L.W., et al., Overexpression of BMP3 in the developing skeleton alters
endochondral bone formation resulting in spontaneous rib fractures.
Developmental dynamics: an official publication of the American Association of
Anatomists, 2009. 238(9): p. 2374-2381.
37. Tsuji, K., et al., BMP2 activity, although dispensable for bone formation, is required
for the initiation of fracture healing. Nature genetics, 2006. 38(12): p. 1424.
38. Jones, A.L., et al., Recombinant human BMP-2 and allograft compared with
autogenous bone graft for reconstruction of diaphyseal tibial fractures with cortical
defects: a randomized, controlled trial. JBJS, 2006. 88(7): p. 1431-1441.
39. Bais, M.V ., et al., BMP2 is essential for post natal osteogenesis but not for
recruitment of osteogenic stem cells. Bone, 2009. 45(2): p. 254-266.
40. Luo, K., Signaling cross talk between TGF-β/Smad and other signaling pathways.
Cold Spring Harbor perspectives in biology, 2016: p. a022137.
41. Lieberman, J.R., A. Daluiski, and T.A. Einhorn, The role of growth factors in the
repair of bone: biology and clinical applications. The Journal Of Bone And Joint
Surgery, 2002. 84(6): p. 1032-1044.
42. Schlundt, C., et al., Macrophages in bone fracture healing: their essential role in
endochondral ossification. Bone, 2015.
43. Miron, R.J. and D.D. Bosshardt, OsteoMacs: Key players around bone
biomaterials. Biomaterials, 2016. 82: p. 1-19.
44. Batoon, L., et al., Osteomacs and bone regeneration. Current osteoporosis reports,
2017. 15(4): p. 385-395.
45. Michalski, M.N. and L.K. McCauley, Macrophages and skeletal health.
Pharmacology & Therapeutics, 2017. 174: p. 43-54.
52

46. Alexander, K.A., et al., Osteal Macrophages Promote In Vivo Intramembranous
Bone Healing in a Mouse Tibial Injury Model. Journal of Bone and Mineral
Research, 2011. 26(7): p. 1517-1532.
47. Chang, M.K., et al., Osteal tissue macrophages are intercalated throughout human
and mouse bone lining tissues and regulate osteoblast function in vitro and in vivo.
Journal of Immunology, 2008. 181(2): p. 1232-1244.
48. Cho, S.W., et al., Osteal macrophages support physiologic skeletal remodeling and
anabolic actions of parathyroid hormone in bone. Proceedings of the National
Academy of Sciences of the United States of America, 2014. 111(4): p. 1545-1550.
49. Guihard, P., et al., Oncostatin M, an Inflammatory Cytokine Produced by
Macrophages, Supports Intramembranous Bone Healing in a Mouse Model of Tibia
Injury. American Journal of Pathology, 2015. 185(3): p. 765-775.
50. Hume, D.A., et al., The mononuclear phagocyte system revisited. Journal of
Leukocyte Biology, 2002. 72(4): p. 621-627.
51. Jenkins, S.J. and D.A. Hume, Homeostasis in the mononuclear phagocyte system.
Trends in Immunology, 2014. 35(8): p. 358-367.
52. Li, Y .P. and W. Chen, Characterization of mouse cathepsin K gene, the gene
promoter, and the gene expression. Journal of Bone and Mineral Research, 1999.
14(4): p. 487-499.
53. Hayman, A.R., Tartrate-resistant acid phosphatase (TRAP) and the
osteoclast/immune cell dichotomy. Autoimmunity, 2008. 41(3): p. 218-223.
54. Hou, W.S., et al., Comparison of cathepsins K and S expression within the
rheumatoid and osteoarthritic synovium. Arthritis and Rheumatism, 2002. 46(3): p.
663-674.
55. Jones, E. and X. Yang, Mesenchymal stem cells and bone regeneration: current
status. Injury, 2011. 42(6): p. 562-8.
56. Bielby, R., E. Jones, and D. McGonagle, The role of mesenchymal stem cells in
53

maintenance and repair of bone. Injury, 2007. 38(1): p. S26-S32.
57. Xu, L. and G. Li, Circulating mesenchymal stem cells and their clinical
implications. Journal of Orthopaedic Translation, 2014. 2(1): p. 1-7.
58. Kitaori, T., et al., Stromal cell–derived factor 1/CXCR4 signaling is critical for the
recruitment of mesenchymal stem cells to the fracture site during skeletal repair in
a mouse model. Arthritis Rheumatism: Official Journal of the American College of
Rheumatology, 2009. 60(3): p. 813-823.
59. Granero ‐Molt ó, F., et al., Regenerative effects of transplanted mesenchymal stem
cells in fracture healing. Stem cells, 2009. 27(8): p. 1887-1898.
60. Schindeler, A., et al., Bone remodeling during fracture repair: The cellular picture.
Semin Cell Dev Biol, 2008. 19(5): p. 459-66.
61. Matsuo, K. and N. Irie, Osteoclast-osteoblast communication. Arch Biochem
Biophys, 2008. 473(2): p. 201-9.
62. Martin, A., et al., Estrogens antagonize RUNX2-mediated osteoblast-driven
osteoclastogenesis through regulating RANKL membrane association. Bone, 2015.
75: p. 96-104.
63. Xu, J., T.C. Phan, and M.H. Zheng, Intercellular communication of osteoblast and
osteoclast in bone diseases, in Current Topics In Bone Biology. 2005, World
Scientific. p. 95-123.
64. Ota, K., et al., Sclerostin is expressed in osteoclasts from aged mice and reduces
osteoclast ‐mediated stimulation of mineralization. Journal of cellular biochemistry,
2013. 114(8): p. 1901-1907.
65. Han, Y ., et al., Paracrine and endocrine actions of bone-the functions of secretory
proteins from osteoblasts, osteocytes, and osteoclasts. Bone Res, 2018. 6: p. 16.
66. Chen, X., et al., Osteoblast-osteoclast interactions. Connect Tissue Res, 2018.
59(2): p. 99-107.
67. Varghese, S., Matrix metalloproteinases and their inhibitors in bone: an overview
54

of regulation and functions. Front Biosci, 2006. 11(2949): p. 66.
68. Sekton, B., Matrix metalloproteinases - an overview. Research and Reports in
Biology, 2010.
69. Decaneto, E., et al., Solvent water interactions within the active site of the
membrane type I matrix metalloproteinase. Physical Chemistry Chemical Physics,
2017. 19(45): p. 30316-30331.
70. Vandenbroucke, R.E. and C. Libert, Is there new hope for therapeutic matrix
metalloproteinase inhibition? Nat Rev Drug Discov, 2014. 13(12): p. 904-27.
71. Sato, T., et al., Identification of the membrane-type matrix metalloproteinase MT1-
MMP in osteoclasts. Journal of Cell Science, 1997. 110(5): p. 589-596.
72. Filanti, C., et al., The Expression of Metalloproteinase ‐2,− 9, and− 14 and of
Tissue Inhibitors ‐1 and− 2 Is Developmentally Modulated During Osteogenesis In
Vitro, the Mature Osteoblastic Phenotype Expressing Metalloproteinase ‐ 14.
Journal of bone mineral research, 2000. 15(11): p. 2154-2168.
73. Liao, E., et al., Membrane-type matrix metalloproteinase-1 (MT1-MMP) is down-
regulated in estrogen-deficient rat osteoblast in vivo. Journal of endocrinological
investigation, 2004. 27(1): p. 1-5.
74. Luo, X. and E. Liao, Progesterone differentially regulates the membrane-type
matrix metalloproteinase-1 (MT1-MMP) compartment of proMMP-2 activation in
MG-63 cells. Hormone Metabolic Research, 2001. 33(7): p. 383-388.
75. Luo, X.-h., et al., Parathyroid hormone inhibits the expression of membrane-type
matrix metalloproteinase-1 (MT1-MMP) in osteoblast-like MG-63 cells. Journal of
bone mineral metabolism, 2004. 22(1): p. 19-25.
76. Delgado-Calle, J., et al., MMP14 is a novel target of PTH signaling in osteocytes
that controls resorption by regulating soluble RANKL production. The FASEB
Journal, 2018. 32(5): p. 2878-2890.
55

77. Barthelemi, S., et al., Mechanical forces ‐induced human osteoblasts differentiation
involves MMP ‐2/MMP ‐13/MT1 ‐MMP proteolytic cascade. Journal of cellular
biochemistry, 2012. 113(3): p. 760-772.
78. Holmbeck, K., et al., MT1-MMP-deficient mice develop dwarfism, osteopenia,
arthritis, and connective tissue disease due to inadequate collagen turnover. Cell,
1999. 99(1): p. 81-92.
79. Karsdal, M.A., et al., Matrix metalloproteinase-dependent activation of latent
transforming growth factor-β controls the conversion of osteoblasts into osteocytes
by blocking osteoblast apoptosis. Journal of Biological Chemistry, 2002. 277(46):
p. 44061-44067.
80. Holmbeck, K., et al., The metalloproteinase MT1-MMP is required for normal
development and maintenance of osteocyte processes in bone. J Cell Sci, 2005.
118(1): p. 147-156.
81. Zhou, Z., et al., Impaired endochondral ossification and angiogenesis in mice
deficient in membrane-type matrix metalloproteinase I. Proceedings of the National
Academy of Sciences, 2000. 97(8): p. 4052-4057.
82. Holmbeck, K., et al., MT1-MMP–dependent, apoptotic remodeling of
unmineralized cartilage: a critical process in skeletal growth. J cell biol, 2003.
163(3): p. 661-671.
83. Oblander, S.A., et al., Distinctive functions of membrane type 1 matrix-
metalloprotease (MT1-MMP or MMP-14) in lung and submandibular gland
development are independent of its role in pro-MMP-2 activation. Developmental
biology, 2005. 277(1): p. 255-269.
84. He, L., et al., Novel Bone-growth Factors from the Blood: Cxcl16 and Others
Benchmarked to BMP2. ORS 2017 Annual Meeting Paper, 2017.
85. Ota, K., et al., Transforming growth factor beta 1 induces CXCL16 and leukemia
inhibitory factor expression in osteoclasts to modulate migration of osteoblast
56

progenitors. Bone, 2013. 57(1): p. 68-75.
86. Jeschke, A., et al., Deficiency of Thrombospondin-4 in Mice Does Not Affect
Skeletal Growth or Bone Mass Acquisition, but Causes a Transient Reduction of
Articular Cartilage Thickness. Plos One, 2015. 10(12).
87. Chen, G., et al., CXCL16 Recruits Bone Marrow-Derived Fibroblast Precursors in
Renal Fibrosis. Journal of the American Society of Nephrology, 2011. 22(10): p.
1876-1886.
88. Palao, T., et al., Thrombospondin-4 mediates cardiovascular remodelling in
angiotensin ll-induced hypertension. Cardiovascular Pathology, 2018. 35: p. 12-19.

Abstract (if available)

Abstract Bone fracture is one of the most common orthopedic conditions. The incidence of non- or delayed union with limited therapy for fracture has been increasing over the world. During bone repair, osteoclasts are suggested to not only participate in bone resorption but also have potential ability to secrete osteoclasts-specific cytokines to promote bone regeneration at early phases. To identify these osteoclasts-specific cytokines, I established a gene candidate list based on preliminary study of translational profiling and attempted to characterize novel cytokines and their roles in bone healing. ❧ In total, 21 genes were chosen, and 2 pairs of PCR primers were designed and tested for each gene using cDNA templates. Genes successfully amplified were then cloned into E. coli using the TOPO cloning Kit. Four genes with positive results were sent for sequencing, among which Mmp14 was shown to be possible target even with imperfect insertion. To continue this project, RNA in situ hybridization and further identifying methods would be conducted after improvement of previous experiments in the future.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The role of Hedgehog signaling in Sox9 expressing progenitors during large scale bone repair

PDF

The role of Runx2 in the development of the tendon-bone attachment unit

PDF

In vitro generation of chondrocyte-osteoblast hybrid cells through differentiation of ATDC5 cells

PDF

Skeletal cell fate plasticity in zebrafish bone development and regeneration

PDF

Understanding the role of APP and DYRK1A in human brain pericytes

PDF

RUNX2 stimulates osteoblast-driven osteoclastogenesis by RANKL presentation

PDF

The role of Fgfr2 within Scx-expressing cells of the hair follicle

PDF

Utilizing zebrafish and mouse models to uncover the underlying genetics of human craniofacial anomalies

PDF

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

PDF

Preosteoblast-specific RUNX2 promotes RANKL membrane association: antagonism by sex steroids through a non-genomic mechanism

PDF

Derivation, expansion and characterization of human hippocampal primordial cells from normal and diseased iPSCs

PDF

Nuclear fibroblast growth factor receptor 2 regulates skeletal development and joint formation

PDF

Rib resection and healing in the mouse: a new model of bone repair

PDF

Protein arginine methyltransferases in murine skull development

PDF

Regulation of Aurora kinase B and its effect on phosphorylation of G9a/GLP

PDF

Characterization of a new chromobox protein 8 (CBX8) antagonist in a model of human colon cancer

PDF

Determining the necessity of nuclear matrix metalloproteinase-2 (MMP-2) activity for proficient skeletal muscle differentiation

PDF

Do ZFX and ZNF711 regulate the same genes in HEK293T cells?

PDF

Relationship of buccal bone plate thickness and healing of extraction sockets with or without alveolar ridge preservation: a systematic review

PDF

Tracking human acute lymphoblastic leukemia cell clones in xenograft mouse models

Asset Metadata

Creator Xie, Xuan (author)

Core Title Characterization of osteoclast-specific cytokines during bone repair

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Publication Date 10/08/2018

Defense Date 08/09/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag bone repair,cytokine,OAI-PMH Harvest,osteoclast

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Mariani, Francesca (committee chair), Bajpai, Ruchi (committee member), Merrill-Brugger, Amy (committee member)

Creator Email dervilia1358@outlook.com,xuanxie@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-75266

Unique identifier UC11671818

Identifier etd-XieXuan-6794.pdf (filename),usctheses-c89-75266 (legacy record id)

Legacy Identifier etd-XieXuan-6794.pdf

Dmrecord 75266

Document Type Thesis

Format application/pdf (imt)

Rights Xie, Xuan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA