Cell non-autonomous control of proliferation in tissues of elevated cancer risk in BRCA1 mutation carriers

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Request accessible transcript

Transcript (if available)

Content

1
Cell Non-autonomous Control of Proliferation in Tissues of Elevated Cancer Risk in BRCA1
Mutation Carriers

by

Hongjie Wu

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
Master of Science
(EXPERIMENTAL AND MOLECULAR PATHOLOGY)

December 2018

Copyright 2018 Hongjie Wu

2
ACKNOWLEDGEMENTS
I would like to thank my mentor Dr. Louis Dubeau for providing the precious opportunity
to study in his laboratory. It is his patience, encouragement, and motivation that helps me insist
on overcoming all difficulties I encountered. Without his inspiration and guidance, I am not able
to make big progresses during these years. I am really appreciated and feel very fortune to have
him as my mentor.
I would also like to thank my committee members: Dr. Florence Hofman and Dr. Robert
Maxson for their insightful comments and suggestions. They always try to help me, listen to my
problems, and figure out the solutions with me. It has been a pleasure having them on my
committee.
Furthermore, I genuinely thank my previous and present members in our lab. They are
not only smart and easygoing, providing a home-like environment, but also teach me all the
scientific things that I should know and learn. Dr. Ying Liu and Dr. Theresa Austria, without you
two, I can not imagine whether I am still capable of fulfilling the degree successfully.
I would give special thanks to the USC Norris Cancer Hospital Pathology Core and USC
Vivaria for helping me doing thesis.
Finally, to my parents and my friends, thank you for encouragement, unconditional love
and support over the years

Hongjie Wu

3
TABLE OF CONTENTS

Acknowledgements 2
Abstract 4
Introduction 5
Materials and Methods 13
Results 15
Conclusions and Discussion 19
Future Studies 19
References 21

4
ABSTRACT
The menstrual cycle activity is a significant risk factor for ovarian cancer predisposition
and is controlled by hormones such as estrogen and progesterone which are secreted by the
granulosa cells. A BRCA1 mutation in those cells causes prolongation of the proestrus phase in
mice (same as the follicular phase in women’s menstrual cycle) leading to unopposed stimulation
and elevation of circulating estrogen level. However, the association between the hormonal
changes and the consequences of BRCA1 mutation on cancer risk is not fully understood. We
sought to test the hypothesis that these hormonal consequences of the BRCA1 mutation causes
increased proliferation in the fallopian tubes, one of the tissue s with an elevated cancer risk in
BRCA1 mutation. Here we showed that mice lacking a functional BRCA1 protein in ovarian
granulosa cells indeed exhibited increased cell proliferation in the epithelial lining of the distal
fallopian tubes, supporting the idea of cell-nonautonomous mechanism of cancer predisposition
BRCA1 mutation carriers.

5
INTRODUCTION
In the United States, Ovarian cancer ranks fifth in cancer death among women, which accounts
for more deaths than any other cancer of the female reproductive system. According to the statistics
made by American Cancer Society in 2018, the chance of getting ovarian cancer is 1 in 78, and
the chance of dying from it is about 1 in 108. Because of the high death rate, attempting to identify
ovarian cancer precursor lesions as early as possible would have a profound impact on the
diagnosis and prognosis of this disease. However, for decades of study, the pathology is still less
understood and debatable because researchers are not able to determine the exact tissue origin.
Challenges to the formulation of a theory about the exact site of ovarian carcinoma
During the last decades of the 20
th
century, it was broadly believed that ovarian epithelial
tumors arise in the coelomic epithelium of ovary, nevertheless, Dr. Dubeau has debated about this
theory for many years. Considering about more and more epidemiological and molecular
biological findings, he claims that the ovarian epithelial tumors could arise from derivatives of the
Müllerian ducts instead. Our lab has already reported the evidence of the embryological linkage
between the Müllerian ducts and coelomic epithelium. (Dubeau, 1999). This is significant view
and helps us understand tumorigenesis of ovarian carcinoma. Nevertheless, there are still debates
about the exact tumor cell origin (Dubeau 2008)
A) Morphological arguments:
There is a single layer called coelomic epithelium that covers the ovary, however, any of these
cells consist of ovarian epithelial tumors. Our lab previously has proved that the ovarian epithelial
neoplasms are much more related to epithelial cells derived from extra-ovarian sites in the female
reproductive tract. For instance, the morphology of serous ovarian carcinoma shows the feature of
the fallopian tube; Endometrioid and mucinous ovarian carcinomas are congruent with the

6
endometrium carcinoma and endocervix carcinoma. Via utilizing histology methods, it is hard to
distinguish ovarian epithelial tumors with other neoplasms occur outside the ovary.
B) Embryological arguments:
Several years ago, one theory which was widely accepted maintained that the single layer cells
of ovarian surface consist of pluripotent cells. Those cells will finally differentiate to all cell lines
of ovary like cortex, germ, and follicular cells, and the epithelium was given a term “germinal
epithelium”. But right now, this notion seems to be incorrect because a lot of evidence has
demonstrated that germline cells and follicular cells are not originated from coelomic epithelium,
yet from mesonephron instead (Rodriguez and Dubeau, 2001).
Owing to the morphological similarity between of ovarian epithelial tumors and the tumors
arising in the endometrium, endocervix or fallopian tube, we conclude that the embryological
origin of the tumor cells probably is derived from Müllerian ducts. Müllerian ducts (also called
paramesonephric ducts) is unique embryological structure during female fetal development, it will
be inhibited in male by a hormone called Müllerian inhibiting substance (MIS) secreted by testes
(Josso et al., 2001). The two Müllerian ducts eventually fuse in their distal part and then develop
into the upper third of vagina, cervix, and uterus, meanwhile, the proximal part remain separated
and gradually become fallopian tubes. The most intriguing discovery is that ovary itself does not
embryologically belong to the Müllerian ducts system, however, the ovarian tumor cells do.
C) Molecular biological arguments:
Some researchers, for example, in 2005, Cheng et al. asserted that almost all EOC cancer cells
will express the same cohort of HOX genes in the epithelial cells of fallopian tubes, endometrium,
and endocervix. We just consider this as another strong support that those tumor cells may be the
derivatives of Mullerian ducts other than coelomic epithelium.

7
Current theories about the cell of origin of EOC
Admittedly, although many researchers still maintain that the ovarian epithelial tumor cells
originate from the coelomic epithelium, Dr. Dubeau and our lab keep questioning about this notion
because of the real situation. The primary original place which is also related with Müllerian site,
apparently, is the fallopian tube. However, Dr. Scully asserts in 1995 that not all ovarian
carcinomas involve the fallopian tube including serous ovarian carcinoma. A large amount of data
proved that microscopic cancers within small serous intra-ovarian cysts do not connect with
fallopian tube. Moreover, the BRCA gene mutation carriers will still be prone to ovarian serous
carcinoma, although they have already done prophylactic salpingo-oophorectomy (Finch et al.,
2006; Levine et al., 2003; Olivier et al., 2004).
Furthermore, in a mature female body, not only the epithelial cells of the endocervix,
endometrium and fallopian tube are not the only derivatives of the Müllerian ducts, as structures
such as endosalpingiosis, endomeriosis, and endovervicosis are also derived from these ducts. For
example, those cells can even be observed at the deep part of the ovarian cortex, and Dr. Lauchlan
called them “secondary Müllerian system” in 1994. All the findings provide us an idea that the
secondary Müllerian system can be the source of different cell types that consist of the ovarian
epithelial tumor.
Histological types of ovarian cancer
Although many theories were proposed, ovarian cancer types are ordinarily classified
based on histological features. There are 3 subtypes of ovarian carcinoma according to the
tissue origin: germ cell tumor, epithelial ovarian tumor, and sex cord-stromal cell tumor. Firstly,
the majority is the epithelial ovarian tumor (EOC), which is about 90% of all ovarian cancer.

8
It is certainly challenging to detect at early phase because EOC is not a single disease entity,
thus, the patterns of histology are heterogeneous. The most common histological subtype of
EOC is serous, accounting for 50% of EOC. Endometrioid and mucinous carcinoma constitute
15-20% and 10%, respectively. Clear-cell and transitional cell (Brenner) tumors are also two
EOC subtypes but very rare.
Screening for ovarian cancer
Screening test will be important to detect cancer early before clinically obvious since the
chance of cure is highest, especially for ovarian cancer. However, most of ovarian cancer cases
show asymptomatic feature, and it increase the difficulty to develop a reliable and accurate test.
Currently, CA125 blood test combined with transvaginal ultrasound should be a choice for
general population.
A) CA125 blood test
CA125 is an ovarian cancer marker which will show level in female patients’ blood (Bast
et al., 1983; Helzlsouer Kj, 1993). Nevertheless, this test will become inaccurate at some
situations: During menstrual cycle or pregnancy, CA125 could be higher than normal level.
According to the Mann’s studies in 1988, only about 85% pf patients showed higher CA125
level, and only 23%-50% stage 1 patients showed increased CA125 level preoperatively.
B) Transvaginal Ultrasound
Transvaginal ultrasound is a scanning test which also helps doctors to diagnose. The
advantage is that it will provides us a much clearer picture of the size and texture of the
ovaries compared to the ultrasound over the abdomen, especially when identifying late
stage tumors. The disadvantage is that the abnormal features are shared by other pelvic
diseases. Moreover, only 25%-50% of the cases can be detected.

9
Familiar and sporadic ovarian cancer related risk factors
Since there is no absolutely reliable screening test to detect ovarian cancer, figuring out the
risk factors to prevent the cancer will make a big difference. According to the article published by
Lacey in 2002, 10% ovarian cancer cases show strong family history, but 90% are sporadic. The
differences between these two types have already been revealed.
A) Familial ovarian cancer
The majority of familial ovarian cancer has been proved to be related with BRCA1 and BRCA2
gene mutation. Based on analysis of women who harbor BRCA1 or BRCA 2 mutation, the
lifetime risk of developing ovarian cancer is 40% and 27% respectively.
In 2002, De Palo also indicated that some cases of ovarian cancer are related with Li-Fraumini
Syndrome which caused by P53 mutations in the germline. however, the most interesting thing
is that these genetic risk factors only account for 15% of cancer development, hormonal factors
such as menstrual cycle activity and hormone replacement therapy are proved to be more
important.
B) Sporadic ovarian cancer
In 1971, Fathalla firstly raised the hypothesis that incessant menstrual cycle activity will
contribute to spontaneous mutations in tumor suppressor gene or proto-oncogene because the
repeated rupture of ovarian surface epithelium followed by rapid cell proliferation at the
ovulation sites.
Moreover, low parity, late menopause, early menarche, infertility will increase the risk as well
(Cramer, 1983). Franceschi also claimed in 1991 that continual ovulation which is not interrupted
by pregnancy probably causes predisposition of ovarian cancer. Besides, other risk factors have
been found by researchers, for instance, body mass index (BMI), hormone replacement therapy

10
(HRT), talc use, fertility treatment, tubal ligation, breastfeeding, ovarian cyst, endometriosis, and
smoking.

Table 1: Influence of Parity and Oral Contraceptive Use on Ovarian Cancer Risk
Precursors: Epidemiology, Detection, and Prevention; Springer 2001

Mouse models for ovarian tumors
For decades, it is not easy for researchers to create a perfect mouse model for studying ovarian
cancer, the main reason is that we do not know which genetic pathway to target. The first major
mouse model in this filed was invented by Dr. Orsulic (Orsulic et al., 2002). They systematically
introduced oncogenes like C-MYC, K-RAS, or AKT in either p53
+/+
or p53
-/-
background mice
and proved that p53 deficiency in combination with three oncogenes will be able to form tumors
with long latency. Then in 2003, two ovarian cancer-related mice models have been created. The
firstly one was via utilizing Cre-loxP system to conditionally knock out p53 and Rb gene. Deletion

11
of these two genes significantly promotes epithelial ovarian carcinoma development. The other
mice model was reported by Dr. Connolly, which is also transgenic mice with the Mis2r promoter.
According to statistics, around half of these mice were observed with various ovarian carcinomas
at 7 months old and have similar features with the human tumors. The latest mice model is based
on the identification of Pten/PI3K and Kras pathways. The two pathways are proved to be
associated with high-grade and low-grade serous adenocarcinomas Development (Bast et al., 2009;
Fan et al., 2009; Network, 2011). Our lab previously reported a mice model which conditionally
inactivation of the BRCA1 gene in ovarian granulosa cells by using follicle stimulating hormone
receptor (Fshr) Cre; BRCA1
flox/flox
system, and two thirds of mutant mice developed benign
epithelial tumors and cysts either in the ovarian hilum, oviducts, or on the external surface of
uterine horns.
Cell non-autonomous mechanism
There is always a question that why human with somatic BRCA mutation only predispose to
the triple negative breast carcinoma and high-grade serous ovarian carcinoma, not any other
cancers. Dr. Dubeau suspected that it may be the consequences aroused by hormonal factors
regulated remotely by hormone-secreted cells, for example, ovarian granulosa cells which are
responsible for producing estrogen and progesterone. This hypothesis was called “cell non-
autonomous” mechanism. When those granulosa cells harbor the genetic mutation like BRCA1,
the hormone regulation or circulatory factors may be changed and make the target cells become
cancerous.
In 2005, Dr. Rajas Chodankar proved that by utilizing the Cre-lox system to inactive the
BRCA1 gene in the ovarian granulosa cells, the mutant mice developed tumors in the ovaries and

12
uterine horns due to the effectors derived from the changed granulosa cells, indicating that the cell
non-autonomous regulation did exist. Moreover, our lab reported that the mutant mice had
augmented estrogen stimulation unopposed by progesterone due to higher circulating levels of
estradiol and a prolonged pro-estrus phase during estrus cycle as well, this resembles the follicular
phase in menstrual cycle changes of mutation carriers (Hong et al., 2010). In addition, the
consequences of elongated proestrus phase and higher estrogen level were found in 2012. Dr. Hai-
Yun Yen claimed that under the condition of lacking Brca1 protein, the cell proliferation of
endometrium was higher in mutant mice than in the wild type, the bone density and bone length
were also increased, and all these target organs are known to be regulated by hormones especially
estrogen.
Not merely in the mice model, but human mutation carriers showed the similar features. For
examples, Dr. Martin Widschendter proved in 2013 that compared with non-BRCA1 mutation
carriers, the endometrium of mutation carriers was thicker. It is a significant evidence of increased
cell proliferation due to the higher titers of estrogen level in human. Dr. Norquist also provided
the evidences in 2010, via using different biomarkers of cancer to stain the human fallopian tube
epithelium sections from mutation carriers and controls, she asserted that loss of BRCA1 allele led
to increase the proliferation of tubal epithelial cells in women. On the contrary, in 20112 and 2014,
Dr. Sophia H. L. George published two papers about human BRCA1 mutation carriers and claimed
that there was no significant increase in the proliferation of the fallopian tube epithelial cells either
in the ampulla or fimbriated ends of the tube during, rather than stimulated the leukocytes involved
immune response, which seemed to oppose with other studies.
According to the data they offered, none of these papers tested the effect of cell-
nonautonomous effects on proliferation. Besides, there are some weaknesses about their

13
experiments design. Firstly, proliferation during menstrual cycle activity should be separately
observed. Secondly, they only observed the proliferation on random days during menstrual cycle.
Thirdly, many unavoidable variations among the human studies made it intricate to interpret, for
examples, age, exact day of menstrual cycle (including within a specific phase), environment
exposures, endogenous hormonal and genetic factors. Such heterogeneity in study subjects can be
minimized if using inbred and age-matched mouse lines carefully synchronized in their estrus
cycle.
All the facts enlightened us that the predisposition may probably be driven by a cell non-
autonomous mechanism, which can be mediated by hormone and other circulatory factors via cell
surface receptors. It probably provides us with novel potential therapeutic targets to treat cancer in
the future.
I utilized Fshr-Cre; BRCA1
flox/flox
mice model in my thesis work and the principal aim of the
research is to show at least some evidence that will help us understand the biology of ovarian
epithelial tumors. The objectives of this research are as following:
• To prove that BRCA1 mutation in ovarian granulosa cells will contribute to higher cell
proliferation of oviducts
• To lead the idea of a cell-nonautonomous mechanism of cancer predisposition in BRCA1
mutation carriers
MATERIALS AND METHODS
Ethics Statement
All studies with experimental animals were approved by and performed under supervision
of University of Southern California Institutional Animal Care and Use Committee.
Source and Handling of Experimental Animals

14
Animals were housed in a pathogen-free environment at the Vivaria facility of the USC
Health Science campus. All facilities received daily monitoring and care from Vivaria staff under
the supervision of a veterinarian. A maximum of 5 mice were housed per cage. Assignment to each
experimental group was based on genotype. Euthanasia was achieved by cervical dislocation after
the mice were made unconscious from exposure to CO2.
Source and Characterization of Transgenic Mice and Constructs
The generation of transgenic mice was described earlier (Chodanker et al., 2005). This
mouse is available from Jackson laboratory mouse repository (JAX Stock 24926, B6; D2-Tg (Fshr-
Cre)1Ldu/J). Primers used for documenting the presence of the transgene were reported
(Chodankar et al., 2005). Pups were analyzed for the presence of the Cre transgenic construct by
PCR amplification of tail DNA using 5’-CTCTGGTGTAGCTGATGATC-3’ as the forward
primer and 5’-TAATCGCCATCTTCCAGCAG-3’ as reverse primer. For detection of the
unrearranged floxed BRCA1 alleles, we use a forward primer sequence: 5’-
CTGGGTAGTTTGTAAGCATCC-3’ and a reverse primer which is
5´−CAATAAACTGCTGGTCTCAGGC−3’. Signal to noise ratio and tissue-specific expression
were evaluated and compared in the various lines. The one with the highest level of tissue-specific
transgene expression was selected. Distribution of promoter activity was similar in transgenic lines
generated independently from the same transgenic constructs.
Estrus Cycle Synchronization Using Hormonal Inoculations
The proestrus phase was achieved by intraperitoneal inoculation of 5 IU of pregnant mare
serum gonadotropin (PMSG, Biovendor, catalog No. RP1782721000) for 48h.
BrdU Incorporation Assay

15
4-6-month-old mice were given three intraperitoneal injections of 5-Bromo-2’-
deoxyuridine (BrdU, Invitrogen, Lot No. 1846217A) (1ml/100g of body weight) for 24h, and 8h
during each injection. Oviducts were fixed in 10% paraformaldehyde for 24h, then fixed with 70%
ethanol. The tissue was embedded in formalin and sectioned with 5 μm thickness. BrdU signals
were detected using a kit purchased from EMD Millipore (Burlington, MA, USA; catalog No.
2750).
Statistical Analyses
As the oviducts parameters of interest were clearly not normally distributed, we calculated
levels of statistical significance (P-values). The data were analyzed by QuickCalcs of GraphPad
Prism software using Fisher’s and chi-square All P-values quoted are two-sided.
RESULTS
Examination of Mice Genotype Status by PCR
In this study, 4-6-month-old mice were analyzed for the presence of the two transgenes:
Fshr-Cre and unrearranged floxed Brca1 alleles by PCR amplification of tail DNA. The Fshr-Cre
transgenic mice were crossed with mice which carried a floxed Brca1allele to generate either Brca1
homozygous or heterozygous knockout mice as previously published. Genomic DNA from mice
tail was amplified by PCR with primers. The PCR products were resolved on ethidium bromide
agarose gel and observed under UV. The expected size of the unrearranged BRCA1 allele is 530
bp, and the wild type allele is 470 bp. The expected size of the Cre sequence is 330 bp.

16

Figure 1 Recombination of Floxed BRCA1 Alleles and Genotype Status of the mice.
(A) The top diagram shows Cre sites and loxP sites Flanking exon 11 of the Brca1gene. (B and
C) We use the primers to amplify the floxed Brca1 Allele that did not undergo Cre-mediated
recombination. Genomic DNA was amplified by PCR and visualized by agarose gels. The lanes
represent the genotyping of each mouse sample.
Optimization of BrdU Incorporation Assay
When mice grew to 4-6 months old, I gave the mice 1 IP inoculation of PMSG for 24h and
1 inoculation of BrdU solution 2h before sacrifice, but there was littile incorporation in oviducts
compared with uterus (Figure 2). Since the mouse oviduct is a small organ, it may require more
A
B
C

17
BrdU and longer exposure time. Finally, I decided to give mice 3 inoculations instead of 1, with
each inoculation separated by 8h. The results became promising.

Figure 2 Less BrdU incorporation in oviduct compared with the uterus. (A) suggested that not
enough BrdU only showed highly positive staining result in uterus rather than oviducts; however,
the majority of endometrial epithelial cells are positive. (B) is another sample showed the proximal
oviducts with just one inoculation BrdU for 24h at low magnification.
Short-term effects of increased estrogen stimulation on the cell proliferation of oviduct in
mice lacking a functional Brac1 protein in their granulosa cells
Our lab has previously showed that the mice that harbor Brca1 in granulosa cells exhibited
prolonged proestrus phase during the estrus cycle and increased circulating estrogen level. This
phase, which corresponds to the proliferative phase of the human menstrual cycle, is identified by
endometrial cell proliferation driven by hormones like estrogen. I hypothesized that this might also
result in increasing oviduct cell proliferation and investigate that by using BrdU incorporation
assay. Since most of human germline BRCA1 mutation carriers are heterozygous, thus we utilized
the mice that carried not only heterozygous mutation but also homozygous mutation to maximize
C

18
the inactivation of Brca1, and the wild-type mice were control samples. Firstly, we used PMSG to
synchronize the proestrus phase for 48 hours, then give the mice three inoculations of BrdU
labeling reagent to mice and incorporate for 24 hours. Next, we obtained the paraffin embedded
tissue section and performed IHC. The results showed in Figure 2, the average percentage of the
BrdU-positive cells of total cells in the wild-type is 6.78% (N=7), 8.71% in the heterozygous(N=7),
and 23.13% in homozygous(N=2). (two-sided Pcontrol-heterozygous =0.2859; two-sided Pcontrol-homozygous
= 0.0001, Fisher’s exact test). The homozygous mutant showed more cell proliferation than the
heterozygous and the wild type.

Figure 2. Oviduct cell proliferation in heterozygous and homozygous versus wild-type mice
synchronized in early proestrus phase. All mice were injected with 5IU of pregnant mare serum
A
B
C
D

19
gonadotropin (PMSG) and three times of BrdU (5-bromo-2’-deoxyuridine), then sacrificed after
48h. The paraffin embedded tissue section slides were stained with anti-BrdU. (A) is wild type,
and (B) is heterozygous, and (C) is homozygous. (D) is the bar graph to illustrate the average
percentage of positive cell of all samples.
CONCLUSIONS AND DISCUSSION
My whole experiments were based on the fact that specifically Brca1 knockout mice exhibited
increased hormone stimulation because of prolonged proestrus phase during the menstrual cycle.
My experiments mainly aimed to examine whether loss of Brca1function also contributed to
increasing the oviduct cells proliferation and becoming a potential original site of cancer. The
results proved indeed, oviduct cells proliferation, a consequence of elongated proestrus phase, was
increased in homozygous mutant mice.
According to the data, I found that there are no significant differences between the wild-type
and the heterozygous mutant. I suggested that it may be the reason that the BrdU exposure time
was a little bit short. Only a time window was observed other than the entire proestrus phase.
Perhaps the heterozygous mutant samples may probably show significantly increase as well just
because of the prolonged proestrus phase.
In conclusion, an understanding of the pathology of BRCA1 mutation caused ovarian cancer
will significantly and profoundly promote the approaches to prevention, detection, and treatment.
FUTURE STUDIES
Here we mentioned “increase” does not mean the cell proliferation rate, but the total number
of mitosis. The more extended proliferative phase lasts, the more cells divided. Since all the cells
lost the normal function of Brca1 protein, it increases the possibility of natural genetic mutation.

20
Besides, all these data should be repeated and refined before publishing. Firstly, more wild-
type and mutant mice are required to repeat the experiments, currently, the number of homozygous
mutant mice are not enough to obtain a convincing conclusion within the limited time. Secondly,
the whole proestrus phase and even metestrus phase may need to be observed to examine the
overall effect of the Brca1 mutation on cell proliferation of the Müllerian system.

21
REFERENCES
1. Dubeau, L. (1999). The cell of origin of ovarian epithelial tumors and the ovarian
surface epithelium dogma: does the emperor have no clothes? Gynecol Oncol 72,
437-442.
2. Dubeau, L. (2008). The cell of origin of ovarian epithelial tumors. Lancet Oncol 9,
1191-1197.
3. Rodriguez, M., and Dubeau, L. (2001). Ovarian tumor development: insights from
ovarian embryogenesis. Eur J Gynaecol Oncol 22, 175-183.
4. Josso, N., di Clemente, N., and Goué dard, L. (2001). Anti-Mü llerian hormone and its
receptors. Mol Cell Endocrinol 179, 25-32.
5. Cheng, W., Liu, J., Yoshida, H., Rosen, D., and Naora, H. (2005). Lineage infidelity
of epithelial ovarian cancers is controlled by HOX genes that specify regional identity
in the reproductive tract. Nat Med 11, 531-537.
6. Scully, R.E. (1995). Pathology of ovarian cancer precursors. J Cell Biochem Suppl
23, 208-218.
7. Finch, A., Beiner, M., Lubinski, J., Lynch, H.T., Moller, P., Rosen, B., Murphy, J.,
Ghadirian, P., Friedman, E., Foulkes, W.D., et al. (2006). Salpingo-oophorectomy
and the risk of ovarian, fallopian tube, and peritoneal cancers in women with a
BRCA1 or BRCA2 Mutation. JAMA 296, 185-192.
8. Levine, D.A., Argenta, P.A., Yee, C.J., Marshall, D.S., Olvera, N., Bogomolniy, F.,
Rahaman, J.A., Robson, M.E., Offit, K., Barakat, R.R., et al. (2003). Fallopian tube
and primary peritoneal carcinomas associated with BRCA mutations. J Clin Oncol
21, 4222-4227.

22
9. Olivier, R.I., van Beurden, M., Lubsen, M.A., Rookus, M.A., Mooij, T.M., van de
Vijver, M.J., and van't Veer, L.J. (2004). Clinical outcome of prophylactic
oophorectomy in BRCA1/BRCA2 mutation carriers and events during follow-up. Br
J Cancer 90, 1492-1497.
10. Lauchlan, S.C. (1994). The secondary mü llerian system revisited. Int J Gynecol
Pathol 13, 73-79.
11. Bast, R.C., Hennessy, B., and Mills, G.B. (2009). The biology of ovarian cancer: new
opportunities for translation. Nat Rev Cancer 9, 415-428.
12. Helzlsouer Kj, B.T.L.A.A.J.B.K.Z.H.C.G.W. (1993). PRospective study of serum ca-
125 levels as markers of ovarian cancer. JAMA 269, 1123-1126.
13. Mann, W.J., Patsner, B., Cohen, H., and Loesch, M. (1988). Preoperative Serum CA-
125 Levels in Patients With Surgical Stage I Invasive Ovarian Adenocarcinoma.
Journal of the National Cancer Institute 80, 208-209.
14. Lacey, J.J.V.M.P.J.L.J.H., and et al. (2002). Menopausal hormone replacement
therapy and risk of ovarian cancer. JAMA 288, 334-341.
15. De Palo, G., Mariani, L., Camerini, T., Marubini, E., Formelli, F., Pasini, B., Decensi,
A., and Veronesi, U. (2002). Effect of Fenretinide on Ovarian Carcinoma Occurrence.
Gynecologic Oncology 86, 24-27.
16. Cramer, D.W. (1983). Mumps, menarche, menopause, and ovarian cancer. American
journal of obstetrics and gynecology 147, 1-6.
17. Franceschi, S. (1991). Pooled analysis of 3 European case-control studies of epithelial
ovarian cancer: III. Oral contraceptive use. International journal of cancer 49, 61-65.

23
18. Fathalla, M. (1971). INCESSANT OVULATION—A FACTOR IN OVARIAN
NEOPLASIA? The Lancet, 298(7716), 163–163. doi:10.1016/S0140-6736(71)92335-
X
19. Orsulic, S., Li, Y., Soslow, R.A., Vitale-Cross, L.A., Gutkind, J.S., and Varmus, H.E.
(2002). Induction of ovarian cancer by defined multiple genetic changes in a mouse
model system. Cancer Cell 1, 53-62.
20. Connolly, D.C., Bao, R., Nikitin, A.Y., Stephens, K.C., Poole, T.W., Hua, X., Harris,
S.S., Vanderhyden, B.C., and Hamilton, T.C. (2003). Female mice chimeric for
expression of the simian virus 40 TAg under control of the MISIIR promoter develop
epithelial ovarian cancer. Cancer Res 63, 1389-1397.
21. Flesken-Nikitin, A., Choi, K.C., Eng, J.P., Shmidt, E.N., and Nikitin, A.Y. (2003).
Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse
ovarian surface epithelium. Cancer Res 63, 3459-3463.
22. Fan, H.Y., Liu, Z., Paquet, M., Wang, J., Lydon, J.P., DeMayo, F.J., and Richards,
J.S. (2009). Cell type-specific targeted mutations of Kras and Pten document
proliferation arrest in granulosa cells versus oncogenic insult to ovarian surface
epithelial cells. Cancer Res 69, 6463-6472.
23. Network, C.G.A.R. (2011). Integrated genomic analyses of ovarian carcinoma.
Nature 474, 609-615.
24. Chodankar, R., Kwang, S., Sangiorgi, F., Hong, H., Yen, H.Y., Deng, C., Pike, M.C.,
Shuler, C.F., Maxson, R., and Dubeau, L. (2005). Cell-nonautonomous induction of
ovarian and uterine serous cystadenomas in mice lacking a functional Brca1 in
ovarian granulosa cells. Curr Biol 15, 561-565.

24
25. Hong, H., Yen, H.Y., Brockmeyer, A., Liu, Y., Chodankar, R., Pike, M.C., Stanczyk,
F.Z., Maxson, R., and Dubeau, L. (2010). Changes in the mouse estrus cycle in
response to BRCA1 inactivation suggest a potential link between risk factors for
familial and sporadic ovarian cancer. Cancer Res 70, 221-228.
26. Yen, H.Y., Gabet, Y., Liu, Y., Martin, A., Wu, N.L., Pike, M.C., Frenkel, B.,
Maxson, R., and Dubeau, L. (2012). Alterations in Brca1 expression in mouse ovarian
granulosa cells have short-term and long-term consequences on estrogen- responsive
organs. Lab Invest 92, 802-811.
27. Widschwendter, M., Rosenthal, A., Philpott, S., Rizzuto, I., Fraser, L., Hayward, J.,
Intermaggio, M., et al. (n.d.). The sex hormone system in carriers of BRCA1/2
mutations: a case-control study. The Lancet Oncology, 14(12), 1226–1232.
doi:10.1016/S1470-2045(13)70448-0
28. Norquist, B., Garcia, R., Allison, K., Jokinen, C., Kernochan, L., Pizzi, C., Barrow,
B., et al. (n.d.). The Molecular Pathogenesis of Hereditary Ovarian
Carcinoma. Cancer, 116(22), 5261–5271. doi:10.1002/cncr.25439
29. Sophia HL George, & Patricia Eshaw. (n.d.). BRCA and early events in the
development of high grade serous ovarian cancer. Frontiers in Oncology, 4, 5.
doi:10.3389/fonc.2014.00005
30. George, S., Milea, A., & Shaw, P. (n.d.). Proliferation in the normal FTE is a
hallmark of the follicular phase, not BRCA mutation status. Clinical cancer research
an official journal of the American Association for Cancer Research, 18(22), 6199–
207. doi:10.1158/1078-0432.CCR-12-2155

Asset Metadata

Creator Wu, Hongjie (author)

Core Title Cell non-autonomous control of proliferation in tissues of elevated cancer risk in BRCA1 mutation carriers

Contributor Electronically uploaded by the author (provenance)

School Keck School of Medicine

Degree Master of Science

Degree Program Experimental and Molecular Pathology

Publication Date 10/17/2018

Defense Date 08/30/2018

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag BRCA1,BrdU incorporation assay,cell nonautonomous mechanism,OAI-PMH Harvest,ovarian cancer

Format application/pdf (imt)

Language English

Advisor Dubeau, Louis (committee member), Hofman, Florence (committee member), Maxson, Robert (committee member)

Creator Email hongjiew@usc.edu,wuhongjie727@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-81727

Unique identifier UC11671414

Identifier etd-WuHongjie-6858.pdf (filename),usctheses-c89-81727 (legacy record id)

Legacy Identifier etd-WuHongjie-6858.pdf

Dmrecord 81727

Document Type Thesis

Format application/pdf (imt)

Rights Wu, Hongjie

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Abstract (if available)

Abstract The menstrual cycle activity is a significant risk factor for ovarian cancer predisposition and is controlled by hormones such as estrogen and progesterone which are secreted by the granulosa cells. A BRCA1 mutation in those cells causes prolongation of the proestrus phase in mice (same as the follicular phase in women’s menstrual cycle) leading to unopposed stimulation and elevation of circulating estrogen level. However, the association between the hormonal changes and the consequences of BRCA1 mutation on cancer risk is not fully understood. We sought to test the hypothesis that these hormonal consequences of the BRCA1 mutation causes increased proliferation in the fallopian tubes, one of the tissue s with an elevated cancer risk in BRCA1 mutation. Here we showed that mice lacking a functional BRCA1 protein in ovarian granulosa cells indeed exhibited increased cell proliferation in the epithelial lining of the distal fallopian tubes, supporting the idea of cell-nonautonomous mechanism of cancer predisposition BRCA1 mutation carriers.