University of Southern California Dissertations and Theses

Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

(USC Thesis Other)

Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content 1

Establishing the non-coding RNA LINC00261 as a tumor
suppressor in lung adenocarcinoma

by
Zhengmin Cong, B.S.
A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(Biochemistry and Molecular Medicine)

August 2019

2

Dedication

To my dearest parents Lianzhu Cong and Qinghong Wu for
their selfless support.

3

Acknowledgements:
I would like to thank all my committee members for their valuable advice and kind
guidance during my whole project. I would like to thank Dr. Marconett first for her patient
mentorship and unreserved support. And I would also like to thank Dr. Offringa and Dr.
Zhou for their support and suggestions about my work.

I would like to express my deepest thanks to all members of Marconett/Offringa lab for
their kindly support: Jonathan Castillo, Chunli Yan, Evelyn Tran, Daniel Mullen, Lane St
Pierre, Anusha Muralidhar, Gopika Nandagopal, Tuo Shi, and Arthur Sefiani. I would
like to give my special thanks to Jonathan Castillo for his great support and kind advice
as a senior lab member, and to omniscient Chunli Yan for her precious technical
support in all of my experiment.

I would also like to express my thanks to Dr. Borok/Zhou’s lab members: Hua Shen and
Yanbin Ji for their valuable support and advice for the in vivo xenograft experiment. I
wouldn’t have been able to generate such valuable data without their selfless help.

4

Contents
Abstract ........................................................................................................................... 6
CHAPTER 1 Introduction ................................................................................................ 7
1.1 Lung Cancer....................................................................................................... 7
1.2 Long non-coding RNA ........................................................................................ 9
1.3 CRISPR and dox-inducible system .................................................................. 11
1.4 Preliminary data ............................................................................................... 13
CHAPTER 2 Characterizing the tumor suppressor function of LINC00261 in vivo ........ 16
2.1 Introduction .......................................................................................................... 16
2.2 Materials and Methods ......................................................................................... 17
2.2.1 Mice preparation ............................................................................................ 17
2.2.2 Cell culture ..................................................................................................... 17
2.2.3 Xenograft implantation ................................................................................... 18
2.2.4 Tumor collection and procession ................................................................... 18
2.2.5 Immunofluorescence staining ........................................................................ 18
2.3 Results ................................................................................................................. 20
2.3.1 Verification of LINC00261 expression in H522-CMV-LINC00261 and CMV-
NEO cell lines prior to injection into athymic mice. ................................................. 20
2.3.2 LINC00261 inhibits tumor growth in vivo........................................................ 21
2.3.3 CD31 staining shows no visible difference between H522-CMV-LINC00261-
derived tumors and H522-CMV-NEO controls. ....................................................... 23
2.4 Discussion ............................................................................................................ 25
CHAPTER 3 Construction of an inducible epigenetic toggle switch to selectively repress
LINC00261 in vitro......................................................................................................... 26
3.1 Introduction .......................................................................................................... 26
3.2 Materials and Methods ......................................................................................... 29
3.2.1 Total RNA extraction ...................................................................................... 29
3.2.2 Quantitative real-time PCR (qPCR) ............................................................... 30
3.2.3 Plasmid cloning, purification and transformation ............................................ 30
3.2.4 Mammalian Cell Transfection ........................................................................ 35
3.2.5 Luciferase assay ............................................................................................ 36
3.3 Results ................................................................................................................. 37
5

3.3.1 Transient transfection of dcas9-Krab plasmid decreases LINC00261
expression .............................................................................................................. 37
3.3.2 Transient transfection of dox-inducible dcas9-Krab plasmid decreases
LINC00261 expression ........................................................................................... 39
3.4 Discussion ............................................................................................................ 41
Chapter 4: SUMMARY .................................................................................................. 43
CHAPTER 5: FUTURE DIRECTIONS ........................................................................... 45
References .................................................................................................................... 47
SUPPLEMENTAL DATA ............................................................................................... 50

6

Abstract
Lung adenocarcinoma (LUAD) is the most common histological subtype of lung cancer
and the most common lung cancer in ex- and never smokers. Although many studies of
LUAD focus on oncogenic mutations, around 30% of LUAD cases show no significant
LUAD-related mutations (1, 2). My thesis project focused on the molecular role in lung
adenocarcinoma for long non-coding RNAs, a newly discovered class of RNA with a
diverse set of regulatory functions that can influence the development of cancer. By
profiling lncRNA expression in LUAD cell lines and comparing those gene signatures with
alveolar epithelial cells, the purported cell of origin for LUAD, we determined that the
lncRNA LINC00261 was a candidate tumor suppressor whose expression levels
correlated with patient survival. Our lab’s previous work showed reintroduction of
LINC00261 into LUAD cells inhibited cellular migration and slowed proliferation by
inducing a G2/M cell cycle arrest (3). To determine if LINC00261 functions as tumor
suppressor in vivo, tumor xenografts of H522-CMV-LINC00261 and H522-CMV-NEO cell
lines on nude mice were performed. Overall, tumors derived from LINC00261 ectopic
expression cell lines were significantly smaller than the control group, which is consistent
with LINC00261 acting as a tumor suppressor. In order to functionally characterize the
effect loss of LINC00261 in vivo has on lung adenocarcinoma growth and proliferation, I
have designed an epigenetic toggle switch utilizing CRISPR technology to reversibly
ablate LINC00261 expression. Taken together, I have established that LINC00261
functions as a tumor suppressor in lung adenocarcinoma.

7

CHAPTER 1 Introduction
1.1 Lung Cancer
Lung cancer is a malignant tumor characterized by uncontrolled cell growth in tissues of
the lung and bronchus. Although lung cancer is the second most commonly diagnosed
cancer in both men (14%) and women (13%), it is the leading cause of cancer-related
death (4). The number of patients killed by lung cancer greatly surpasses the second
lethal cancer type in both men (lung cancer 27% vs. prostate cancer 8%) and women
(lung cancer 26% vs breast cancer 14%). Moreover, the American five ‐year relative
survival rate for lung cancer is currently ~14% (4) (Figure 1). Therefore, further
research is urgently needed to define the molecular origins and potential treatments for
lung cancer.

Lung cancers are subclassified into two categories, small cell lung cancer (SCLC,
accounts ~15% of total lung cancer) and non-small cell lung cancer (NSCLC, accounts
~85% of total lung cancer). Lung adenocarcinoma comprises ~50% of total NSCLC
cases (5). Although many transcription factors that regulate distinct metastatic
phenotypes have been identified, such as KRAS and EGFR (6), and EGFR mutations
targeted therapy has showed a positive response to tyrosine kinase inhibitors, relapse
due to drug resistance is a common occurrence (7-8).
8

Figure 1 Ten Leading Cancer Types for the Estimated New Cancer Cases and Deaths by Sex,
United States, 2016 (Siegel RL et al., 2016).

9

1.2 Long non-coding RNA
Long non-coding RNAs (lncRNAs) are RNAs greater than 200 nucleotides in length with
no discernable protein coding function. Thousands of differentially expressed lncRNAs
are identified in multiple cancer types by The Cancer Genome Atlas (TCGA), but there
is no ascribed function for the vast majority of them (12). The HOX transcript antisense
RNA (HOTAIR) was one of the first trans-acting lncRNAs to be identified (9), which
binds to PRC2 and the LSD1-CoREST/REST and reinforces PRC2 repression by
catalyzing the demethylation of the active H3K4me2 histone mark (10). Besides
functioning at the epigenetic level to regulate mRNA expression, lncRNAs can also play
important roles in transcriptional/post-transcription regulation and miRNA regulation
(11). Accordingly, research into the mechanistic role lncRNAs play in cancer
development has surged in recent years (Figure 2) (3).

10

11

Figure 2. Loss of LINC00261 expression is correlated with decreased survival in lung
adenocarcinoma. A. Stratification of LINC00261 expression of 515 LUAD samples from TCGA
(29) dataset by stage. “Adj. NTL” = Adjacent non-tumor lung. ANOVA tested all groups,
difference is significant between normal and stages 1, 2, and 3. Stage 4 = ns (TANRIC) (30). B.
Overall survival of patients stratified by expression level of LINC00261 derived from KMplot
(31). Red = high LINC00261 expression, Black = low LINC00261 expression.

C. qRT-PCR of
LINC00261 expression in LUAD cell lines and primary AEC. D. Stratification of LINC00261
expression in multiple TCGA (29) datasets (lncRNAtor) (32). See TCGA website for acronym
definitions https://cancergenome.nih.gov.

1.3 CRISPR and dox-inducible system
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), is a family of
DNA sequences found within the genomes of prokaryotic organisms which enables
them to recognize the viruses and eliminate foreign gene fragments. The CRISPR
element is a specialized region of DNA with two components: nucleotide repeats and
spacers. Nucleotide repeats are distributed throughout a CRISPR region, where
spacers are bits of DNA that are interspersed among these repeated sequences.
Spacers are responsible for foreign nucleotide detecting and eliminating, and in the
case of bacteria they are taken from previous viral infections. Similar to the human
immune system, an echo of the viral pathogen preserved as nucleotides will be
recorded and preserved as a “memory” for a period of time, which allows the bacteria to
respond quickly and efficiently should re-exposure occur.

CRISPR-associated protein 9 (Cas9) is an enzyme that utilizes CRISPR sequences as
a guide to recognize and cleave specific strands of DNA that are complementary to the
12

CRISPR sequence. To fulfill its function, it needs to bind to two RNA components:
CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The former is
transcribed from the CRISPR locus, and the latter base pairs with the crRNA to form a
functional guide RNA (gRNA). Cas9 uses the tracrRNA portion of the guide as a handle,
while the crRNA spacer sequence directs the complex to a matching viral
sequence. The cooperation of CRISPR derived sequences and Cas9 enzymes form the
basis of the CRISPR-Cas9 gene editing system (13). This editing process has now
been widely applied in a variety of biological systems (33-34).

In this study, we utilized a cleavage-dead version of the Cas9 protein, dCas9, fused to
the KRAB epigenetic repression domain under the inducible control of the tetracycline-
responsive promoter element. Complexing guide RNAs specific for the LINC00261
promoter region with this TET-inducible dCas9-KRAB fusion will allow for inducible
knockdown of LINC00261, to study in vivo effects of LINC00261 loss as well as mitigate
long-term effects that occur from loss of a tumor suppressor (Figure 3).

13

Figure 3 The mechanism of dcas9-Krab knock-down system. After binding to gRNA, the dcas9-
Krab complex will be able to bind to the target region and repress the gene expression
(Addgene https://www.addgene.org/crispr/interfere/).

1.4 Preliminary data
Our lab has previously performed transcriptome-wide bioinformatic analysis coupled
with molecular characterization of candidates to determine the lncRNAs with potential
therapeutic applications in LUAD. We chose to functionally characterize LINC00261 for
two reasons: Expression of LINC00261 was significantly correlated to patient survival,
and the gene encoding LINC00261 lies adjacent to the pioneering transcription factor
FOXA2 that plays a critical role in lung alveolar development. To further study the
function of LINC00261, we chose the human LUAD cell line H522 that has no
endogenous LINC00261 expression. We then transfected the H522 cells with a plasmid
14

containing the LINC00261 gene under control of a CMV promoter, alongside empty
vector controls. We found that overexpression of LINC00261 inhibited cell growth and
slowed down cellular migration. We also performed flow cytometry to determine if
LINC00261 plays a role in progression of the cell cycle. The result showed that cells
accumulate in the G2/M phase when LINC00261 is ectopically expressed, as compared
to the control H522 cell line, indicating that LINC00261 functions in regulating the G2/M
cell cycle checkpoint arrest (Figure 4).

15

Figure 4 The identification of LINC00261’s tumor suppression function. A) Volcano plot of
differential analysis for lncRNA expression. B) Generation of stable H522 LINC00261
overexpression cell line with CMV-LINC00261 contained plasmid. Stable cell line was verified
by qRT-PCR qPCR for LINC00261. C) Quantification of cell proliferation of H522-CMV-
LINC00261 and H522-CMV-NEO controls using trypan blue staining. D) Scratch assay of H522-
CMV-LINC00261 cells compared to CMV-NEO vector control. Performed in 3 separate stable
cell lines and technical quadruplicates (N=4). Representative image shown. E) Propidium Iodide
(PI) staining and FACS analysis of CMV-LINC00261 and CMV-NEO controls. Population was
analyzed using FlowJo v10.1. N=3 (≥10,000 cells per sample). The arrows indicate the G2/M
phase.
H522 Cell line
A B
C
D
E
16

CHAPTER 2 Characterizing the tumor suppressor function
of LINC00261 in vivo
2.1 Introduction
Patient-derived xenograft (PDX) models have been used extensively in cancer
research. By implanting patient-derived cancer cells into immune-compromised animals,
such as mice and rats, we are able to study human tumor biology in vivo. Patient-
derived xenografts have expanded our understanding in malignant tumors (25),
including pancreatic cancer (21) and colorectal cancer (22). Notably, immune-
compromised animals have to be utilized for this experiment, of the host animal immune
system would recognize the cells of human origin and direct an immune response to kill
the cells independent of the tumorigenic capacity being studied (26).

Previous work has shown that LINC00261’s exhibits tumor supression function in vitro.
By introducing LINC00261 in H522 cell lines which have no endogenous LINC00261
expression, cell proliferation and migration are both decreased (3). However, in vivo
analysis was still necessary to estblish LINC00261 as a tumor suppressor. By
implanting H522-CMV-LINC00261 cells and H522-CMV-NEO controls into athymic
nude mice, we were able to measure xenograft tumor size over time. Tumor length (l)
and width (w) were measured 3 times a week after tumor implantation, and tumor
volume (V) was calculated through V = lw
2
/2 (16). All animal studies were performed in
compliance with the University of Southern California Institutional Animal Care and Use
Committee guidelines.

17

2.2 Materials and Methods
2.2.1 Mice preparation
Twenty-two (22) female athymic nude mice (Foxn1
nu
, JAX stock #002019) that were 7
weeks old were purchased from Jackson Laboratories (Bar Harbor, ME) and raised in
IACUC registered mice room several weeks for acclimation (Protocol #20633). The ear
punch method was used to label the mice and 1 ear punch at maximum was applied on
each mouse in accordance with AAALAC standards. The ear punch was applied to
either left or right ear, in either the upper or lower position, so the mice were labeled
according to their cage number and the position of ear punch. The mice were checked
for anxiety and distress when measuring the tumor size, and all mice are euthanized at
the end of the experiment, six (6) weeks after tumor implantation.

2.2.2 Cell culture
Both H522-CMV-LINC00261 and H522-CMV-NEO cell lines were previously generated
(3). Both cell lines were cultured in RPMI-1640 (Corning) media with 10% fetal bovine
serum (FBS) and 1% penicillin streptomycin (P/S). Puromycin with a concentration of
0.625ug/ml, was also used to apply long-term selection pressure. Selection media was
refreshed at minimum every 72 hours. Both cell lines underwent genotype
authentication to verify their identity as the H522 cell line, and both underwent qPCR
verification for the expression of LINC00261 and the lack of mycoplasma contamination.

18

2.2.3 Xenograft implantation
The cells were grown to 80-90% confluence (in exponential growth phase) and
harvested using complete RPMI+FBS medium into a sterile centrifuge tube. Cells were
pelleted at 1000 rpm for 3 min, and then resuspended homogeneously with PBS. Cells
were then counted to ensure uniformity across injections, and then the cell suspension
was mixed with Matrigel (Corning Matrigel matrix, Cat: # 356234) at ratio 1:1 and cell and
reach final concentration 1.33*10^7/ml to ensure each injection (150ul) contains 1
million cells. The Matrigel-cell suspension mixture was then injected subcutaneously
into the dorsal flank of the recipient athymic mice.

2.2.4 Tumor collection and procession
Euthanasia was performed using euthasol (Vetone) injection followed by cervical
dislocation in order to ensure mice death. The xenograft tumors were then excised,
measured and weighted. For each group of mice, 3 tumors were randomly selected for
follow-up immunofluorescence and immunohistochemistry analysis, with the rest stored
in liquid nitrogen for further analysis. For the tumors for IF/IHC analysis, they were all
processed by 4%PFA overnight and undergo embedding either with OCT or paraffin.

2.2.5 Immunofluorescence staining
Based on our preliminary finding that the tumors from the H522-CMV-NEO control
group were more reddish in color and larger in size compared to the tumor from H522-
CMV-LINC00261 group, we decided to test the angiogenic capacity of the tumors in
19

both groups by immunofluorescence staining for markers of angiogenesis.
Immunofluorescence staining (IF staining) is a commonly used method to detect the
location of target proteins within a tissue, therefore we set out to detect the
angiogenesis by comparing the size and density of blood vessel formation between two
groups.

The IF staining reagents and protocol were both obtained from Dr. Hong’s lab (27). The
xenograft tumors underwent 4%PFA fixation overnight and then were sent to the USC
pathology core facility to cut the frozen sections. After sectioning, the tumor slides were
washed 3 x 10 minutes with PBS to stop fixation. Next, slides were permeabilized in
PBST (0.1% Triton X-100) for 20 minutes and blocked in blocking buffer (PBST with 5%
goat serum) for 2 hours. The primary antibody CD31 (BD pharmingen Purified Rat anti-
mouse CD31, cat # 553370 from Dr.Hong’s lab, 1:500 dilution) was next mounted to the
slides and all the slides were incubated at 4C overnight to allow the antibody to bind.
Subsequently, the slides were first washed 3 times with PBS for 10 minutes each and
then incubated with donkey anti-Rat IgG (H+L) secondary antibody with Alexa Fluor 488
conjugation (Thermo Fisher scientific, 1:50 dilution) for 2 hours. After the incubation of
secondary antibody, a drop of mounting media (ProLong™ Gold Antifade Mountant with
DAPI, Invitrogen, LOT1990459) was added to each slide and all slides were sealed with
nail polish. The fluorescence signal was checked using the 100X and 400X
fluorescence microscope with 1000ms exposure time (ECHO).

20

2.3 Results
2.3.1 Verification of LINC00261 expression in H522-CMV-LINC00261 and CMV-NEO
cell lines prior to injection into athymic mice.
For the purpose of preparing enough cells for LINC00261 expression verification and
tumor cell implantation, we first verified that LINC00261 expression occurred solely in
the H522 CMV-LINC00261 cell line, and not the H522-CMV-NEO controls. The qPCR
result showed that the expression level of LINC00261 was significantly higher in H522-
CMV-LINC00261 cell line comparing to H522-CMV-NEO cell line (Figure 5, A), and the
mycoplasma test was negative in our cells, therefore we were able to proceed with
tumor implantation (Figure 5, B).

Figure 5 Cell line preparation before mice xenograft. A) LINC00261 expression of both H522-
CMV-LINC00261 and H522-CMV-NEO cell lines were verified by qRT-PCR one day before
injection (**, p<0.01). B) Mycoplasma test for the injected cell lines. There is no mycoplasma
detected in H522 cell lines compared to mycoplasma infected cell.

A B
21

2.3.2 LINC00261 inhibits tumor growth in vivo
We set out to determine if the presence of LINC00261 altered tumor growth in vivo.
Tumors were measure three times weekly throughout the course of the 6-week
experiment. The LINC00261 ectopic expression group (H522-CMV-LINC00261) grew
slower than the control H522-CMV-NEO group over time (Figure 6, A, *p<0.05). After
mice euthanasia, all tumors were excised and weighed. Overall, the average weight of
tumors with LINC00261 present was less than the CMV-NEO control group (Figure 6,
B, *p<0.05). This indicated the ectopic expression of LINC00261 also inhibited tumor
growth.

Upon excision, we observed that the LINC00261 ectopic expression tumors were less
reddish than the control group (Figure 6, C). This has now been published in Shahabi
et al., 2019 (3). This could due to intertumoral hemorrhage or increased angiogenesis,
the physiological process of the formation of new blood vessels, and so I set out to test
whether we saw a difference in blood vessel formation between the two groups.

22

Figure 6 Plots of xenograft tumor size and weight. Sample size: H522-CMV-NEO: 8 tumors,
H522-CMV-LINC00261: 5 tumors. A) Size of xenograft tumors were measured over time.
Significance was determined by a paired T-test between test conditions at each time point
showed (*, p<0.05). B) Average weight of H522 xenograft tumors after tumor removel. C)
Images of tumors of H522 CMV-NEO and H522 CMV-LINC00261 origin. Original images of
tumors from CMV-NEO controls are showed on the left, tumors from H522 CMV-LINC00261 on
the right. Center panel consists of 3x magnifications alongside ruler for size comparison

A
B
C
23

2.3.3 CD31 staining shows no visible difference between H522-CMV-LINC00261-
derived tumors and H522-CMV-NEO controls.
Angiogenesis is the physiological process whereby new blood vessels are formed, and
it is a critical step in malignant transformation as it is required to prevent hypoxia and
necrosis within the tumor. Due to the visible difference between the CMV-LINC00261-
derived tumors and CMV-NEO controls we utilized a common marker for angiogenesis,
platelet endothelial cell adhesion molecule (PECAM-1), also known as cluster of
differentiation 31 (CD31).

Immunofluorescence staining using CD31 was performed and the intensity and
distribution of CD31 were compared between H522-CMV-LINC00261 and H522-CMV-
NEO controls. We observed no significant difference in number or size of blood vessels
(Figure 7).

24

A B
C D
25

Figure 7 The Immunofluorescence staining of CD31 in tumor samples. A) The IF staining of
H522-CMV-NEO xenograft tumor. B) The IF staining of H522-CMV-LINC00261 xenograft tumor.
C) Negative staining of xenograft tumor samples, no primary antibody was used. D) Positive
staining of healthy lung section.

2.4 Discussion
Long non-coding RNAs are a novel class of regulatory molecules which play important
roles in LUAD development. In our previous work, we had already verified LINC00261’s
in vitro inhibitory role on LUAD cell proliferation migration. The previous in vitro
experiments indicated that LINC00261 was a likely tumor suppressor, however the gold
standard for establishing whether a candidate gene functions as a tumor suppressor or
oncogene is in vivo tumor formation. We have now established that LINC00261
functions as a tumor suppressor in LUAD in vivo.

By doing the xenograft of the H522-CMV-LINC00261 and H522-CMV-NEO cell lines on
nude mice, we found that the ectopic expression of LINC00261 significantly inhibited
tumor development. This was consistent to our previous in vitro work that LINC00261
could lead to G2/M cell cycle checkpoint arrest (3). Multiple lncRNAs have previously
been shown to possess tumor suppressor properties in LUAD, including MEG3 (35).
These lncRNAs has mainly been ascribed roles in epigenomic maintenance (36). Our
results point to regulation of the DNA damage response by a tumor suppressive
lncRNA. To our knowledge, this is the first report of a lncRNA directly affecting the DNA
damage signaling pathway that results in tumor suppressive activity in vivo.
26

Moreover, considering that the genome instability is a common feature shared by many
types of cancer cells (28), and the fact that some members of the DNA damage repair
machinery, including ATM and topoisomerase 2A (TOP2A), has altered expression in
the presence of LINC00261 (3), we also believe LINC00261 could be potential gene
therapy target for cancer treatment.

CHAPTER 3 Construction of an inducible epigenetic
toggle switch to selectively repress LINC00261 in vitro
3.1 Introduction
Previous work in the lab utilized the A549 cell line, which express LINC00261
endogenously, and generated a stably knocked-down LINC00261 by transfecting a
short hairpin RNAs targeting LINC00261. By doing the proliferation and migration assay
on stably selcted clones of A549-shLINC00261, we found that LINC00261 knock-down
in A549 cells (known as A549-shLINC00261) showed increased growth and migratiory
capability, which supported our hypothesis that LINC00261 functions as tumor
suppressor (3). However, the A549-shLINC00261 cell line lost repression over many
passages in culture (Figure 8) and that those stable clones that did not loose
expression died off after becoming hyperaneuploid (3).
27

Figure 8 Comparison of LINC00261 expression levels in the same knockout monoclonal cell
line cultured for varying lengths of time. A) Passage 3 post shLINC00261 transfection, B)
Passage 9 C) Passage 13, respectively. Bars represent LINC00261 levels normalized to
GAPDH levels and shScrambled 2^(-delta delta Ct). All qPCR were done in in technical
triplicates in three independent biological replicates. Error bars represent the standard deviation
(*, p<0.05 **, p<0.01).

In order to overcome the progressive degeneration of our knock-down model, we
decided to utilize the CRISPR-Cas9 system. The Cas9 protein was previously mutated
to remove the DNA backbone cutting activity, henceforth called dCas9 (23). By fusing
dCas9 with the repressive chromatin modifier domain Krü ppel associated box (known
as Krab) we are able to harness the locus-targeting specificity of CRISPR with efficient
epigenetic silencing of transcription (19). The Krab domain silences promoters by
causing histone H3 deacetylation, H3 lysine 9 trimethylation, RNA Pol II recruitment
inhibition and transcriptional initiation blockade (18).

Guide RNA (gRNA) targeting the LINC00261 promoter was cloned into the dCas9-
KRAB vector, driven off a secondary U6 promoter. The combination of both gRNA and
dCas9-KRAB construct driven off the same plasmid backbone avoided any issues
related to co-transfection of dual plasmids. I was able to verify the efficiency of this
A B C
28

dcas9-Krab knock-down system transiently, and a stable transfection of the plasmid
was done next. However, when doing stable selection of the transfection on A549 lung
adenocarcinoma cell lines with dcas9-Krab plasmid targeting LINC00261 promoter
region, there were no colonies formed. We were able to rule out technical issues with
the transfection, as the control plasmid targeting dCas9-KRAB to another location
formed many colonies. Therefore, we implemented an inducible epigenetic toggle
switch that would be stably integrated into the genome, yet allow for rapid on/off of
LINC00261 expression.

We accomplished this by using the doxycycline-inducible TRE promoter, a 19
nucleotide tetracycline operator (tetO) sequence that is repeated in tandem 7 times, that
allows for binding of the reversible tetracycline repressor (tetR). Because our cells do
not express tetracycline-binding proteins, we utilized the reverse tetracycline-
controlled transactivator (rtTA) which is a fusion of the TetR protein with virion protein
16 (VP16), a transcriptional activation domain from herpes simplex virus (HSV) (Figure
9). When tetracycline is present, it binds to the constitutively-translated rTTA protein
and directs it toward binding of the dCas9-KRAB domain, silencing the downstream
gRNA target LINC00261.

29

Figure 9 The mechanism of tet-on system. With the existence of doxycycline, the rtTA will be
able to bind to the TRE promoter region and activate the transcription.
(https://www.addgene.org/tetracycline/)

3.2 Materials and Methods
3.2.1 Total RNA extraction
Upon reaching 80%-90% confluence, culture media was aspirated and A549 cells and
immediately washed with PBS. A549 cells were then collected into 1.5mL tubes by
scraping. RNA was isolated by using the Aurum™ Total RNA Mini Kit (Bio-rad,
Hercules, CA) according to the manufactures protocol. In brief, the cells were first
centrifuged for 3000rpm for 2min, and then resuspended with 350ul lysis solution. After
cell dispersion, 350ul of 70% ethanol was added to denature the protein fraction and
then passed through a 21-gauge needle attached to a 3mL syringe 10 times. The
mixture was transferred to the binding column and washed with 600ul low stringency
wash solution, 600ul high stringency wash solution and 600ul low stringency wash
solution successively with highest spinning speed for 30 seconds each. To elude the
30

total RNA, pre-warmed 40ul elution buffer was used to saturate the column and
centrifugation was done to extract the eluted RNA.

3.2.2 Quantitative real-time PCR (qPCR)
Complementary DNA (cDNA) was prepared using the iScript cDNA Synthesis
Kit (Bio-Rad). For a 20ul volume reactions, 1 μg total RNA, 4ul 5x iScript reaction mix, 1
μL reverse transcriptase and nuclease-free water were used. The reaction mix was then
incubated for 5 minutes at 25° C, 30 minutes at 42° C, and 5 minutes at 85° C
successively by the MJ Mini Thermocycler (Bio-Rad). cDNA libraries were diluted 1:5 by
adding 80ul water prior to qPCR set up.

For each well of qPCR run, 6.25ul Cybrgreen, 0.375ul 10uM forward/reverse primer and
5ul cDNA were used for a total volume of 12ul. For each PCR cycle, the temperature
setting was: 30 seconds at 95° C for DNA unwinding, 30 seconds at 57° C for primers
annealing, 30 seconds at 72° C for taq extension. A melting curve was performed after
each run to ensure proper amplification of primers.

3.2.3 Plasmid cloning, purification and transformation
The plasmid that contained both the dcas9-Krab fusion and gRNA region was first
purchased from Addgene (Addgene # 71237) (Supplemental figure 1) (23). In order to
apply it to this experiment, the gRNA fragment was required to be added to the
backbone after enzyme digestion. The previously purchased plasmid backbone was
31

digested with BsmBI (New England Biolabs, Ipswitch, MA) in a 50ul digestion reaction
system that contained: 2ul BsmBI enzyme, 10ug plasmid, 1XNEB buffer and water to
50ul in 55°C for 1 hour. PCR purification was done next to remove the residual enzyme.
For 1 volume of reaction mix, 5 volumes of PB were added and mixed. Then, the
mixture was transferred to a MinElute column (Qiagen) and centrifuged for 1 minute.
The column was washed with 750ul buffer PE and centrifuged 2 minutes to remove
residual reagent. The column was then saturated with 40ul elution buffer for 10 minutes
and centrifuged for 2 minutes for plasmid elution.

After getting the purified plasmid digestion products, ligation was performed. Since the
insert fragments’ size was relatively small, the single stranded DNA oligonucleotide
(Supplemental Table 1) were ordered from IDT and underwent annealing before ligation.
The 20ul ligation reaction contained: 2ul T4 ligation buffer (10X), 0.02pmol plasmid,
0.06pmol insert fragment, which was the guide RNA ordered from IDT, 1ul T4 DNA
ligase (New England Biolabs, Ipswitch, MA) and distilled-water to a total volume of 20ul.
They were mixed by pipetting up and down several times and incubated overnight at
16° C.

The ligation reaction mix was purified again and subjected to transformation reactions.
In order to amplify plasmids longer than 10kb, we utilized NEB® 10-beta Competent E.
coli (New England Biolabs, Ipswitch, MA) as the host bacteria. To do the transformation,
32

10ng of plasmid mix was added into 50ul host bacteria and incubated on ice for 30
minutes, and then underwent 42°C heat shock for 35 seconds. 350ul pre-warmed SOC
media (New England Biolabs, Ipswitch, MA) was added to the mixture, then the tube
was moved to the incubator under vigorous rotation for 1 hour to encourage optimal
growth. 50ul of the bacterial suspension was then spread onto LB agar plates with
ampicillin for colony formation overnight at 37° C using sterile technique.

For the purpose of generating the dox-inducible plasmid, the previously generated
dcas9-Krab plasmid with gRNA expression directing to LINC00261 promoter was used
as the backbone. The promoter of the dcas9-Krab region, hUbC promoter, was replaced
by a puromycin selection gene for transfection selection and a TRE promoter to
implement the dox-inducible system. To this end, 3 fragments, one containing the
puromycin selection gene with its promoter, another containing the TRE promoter
region, and lastly the plasmid backbone were required. The puromycin contained
fragment was cloned out from the ShScramble plasmid (Supplemental Figure S2) and
the TRE element was cloned out from the pSBtet-Bla plasmid (Addgene # 60510)
(Supplemental Figure S3) (24), and the plasmid backbone (Supplemental Figure S1) was
digested by 2 enzymes to create the insertion site (Figure 10). All plasmids were
linearized and purified before the cloning step to increase yield ratio, and cloning
products were loaded on agarose gel followed by gel extraction.

33

Figure 10 The cloning preparation for Gibson assembly. A. The cloning of puromycin anti-
selection gene with SV40 promoter from previous ShScramble_tGFP plasmid. B. The cloning of
TRE promoter region from pSBtet-Bla plasmid. C. The digestion of pLV hU6-sgRNA hUbC-
dcas9-KRAB-T2a-Puro plasmid backbone by BaeI and XbaI enzymes.
ShScramble_tGFP
7637 bp
SV40 promoter
Puromycin Resistant gene
Forward primer
Reverse primer
pSBtet-Bla
7037 bp
TRE promoter
Forward primer
Reverse primer
pLV hU6-sgRNA hUbC-dcas9-KRAB-T2a-
Puro
14,900 bp
BaeI
XbaI
A
B
C
34

In order to merge the fragments cloned from different source of plasmid together,
Gibson assembly was used. Gibson assembly is a novel molecular cloning method to
join multiple DNA fragments together when each fragment’s base pair overlap to
adjacent DNA fragments in a single, isothermal reaction (20), and the fragments cloning
mentioned above followed this rule and all primers were designed to have the overhang
that overlap to adjacent DNA fragments (Figure 11).

Figure 11 The Gibson assembly mechanism. 2 insertion fragments and the digested plasmid
backbone were merged together using Gibson Assembly Master Mix (New England Biolabs,
Ipswitch, MA).
SV40 promoter
Puromycin Resistant gene
TRE promoter
Digested plasmid backbone
Fragment 1 Fragment 2
(Fragment 3)
35

3.2.4 Mammalian Cell Transfection
All transfection conditions were based on the empirically optimized protocol from
previous lab members. Several changes were made due to the large size of the final
U6-gRNA-LINC00261: TRE-dCas9-KRAB plasmid. For the stable transfection, plasmids
were first linearized by enzymatic digestion with MluI-HF (New England Biolabs,
Ipswitch, MA) and column purified to generate linearized plasmid for enhanced
integration. All transfected cells were plated in antibiotic and penicillin/streptomycin free
culture media one day before transfection. Different transfection conditions were used
according to the surface area and cell number being transfected as follows: For the 24-
well plate, 70,000 cells were seeded into each well, and 500ug of plasmid were
transfected into each well. The transfection was done by using FugeneHD (Promega,
Madison, WI) and its protocol. The plasmid was first mixed with FugeneHD for the ratio
1ug:3ul and the Opti-Mem (Gibco, Gaithersburg, MD) media (100ul/well). The mixture
was incubated at room temperature for 15 minutes, and then added to each well. The
regular culture media (RPMI 1640, 1% penicillin/streptomycin, 0.1% fetal bovine serum)
(RMBIO, Missula, MT) was added after 1.5 hours. Selection media (RPMI 1640+1%
penicillin/streptomycin+0.1% fetal bovine serum with 0.625ug/ml puromycin) was added
24 hours after transfection with the. Media was refreshed every 48 hours. When isolated
colonies (more than 100 cells) with similar morphology to the wild type cell line were
found in the plate, colonies were picked using a sterile pipette tip and transferred to a
new 24-well plate for monoclonal expansion. The cells were then transferred to 6-well
plate and subsequently to a 10 cm dish to expand the monoclonal cell line. All
transfected cell lines were verified by qPCR before storage in liquid nitrogen.
36

For the transient transfection the plasmids were not required to be linearized by
enzymatic digestion. Similar to stable transfection, transient transfection followed the
same cell seeding and transfection steps. However, cells were collected after 48 hours
to ensure maximal levels of transfected dCas9-KRAB fusion and therefore repression of
LINC00261.

3.2.5 Luciferase assay
Luciferase assays were used to test the efficiency of TRE promoter response to
doxycycline, and Renilla controls were also used to account for the variable transfection
efficiency in each well. A549 wild type cells were seeded in a 96-plate at a density of
10,000 cells/well, and they were co-transfected with CMV-Renilla plasmids and TRE-
luciferase reporter plasmids by using Fugene reagent (Promega, Madison, WI). A dose
response of 0.2ug/ul and 1ug/ul doxycycline dissolved in culture media, as well as a
culture media vehicle control, were added for different treatment group one day after
transfection and all the experiment was done in the dark as doxycycline is light-
sensitive. Cells were harvested at 24 hours after doxycycline treatment. Luciferase
activities were determined by using the dual-luciferase assay kit (Promega Madison,
WI) following protocol provided by the manufacturer. 3 technical replicates per assay
and 3 biological replicates were performed for each group.

37

3.3 Results
3.3.1 Transient transfection of dcas9-Krab plasmid decreases LINC00261 expression
In order to optimize the knock-down efficiency of the dCas9-Krab fusion protein, we
designed multiple gRNAs spanning the promoter and exons of LINC00261. In addition
to designing two gRNAs that targeted the promoter region of LINC00261, we also
designed gRNA that targeting the exon 4 region, which contains 93% of the mature
LINC00261 transcribed region (Figure 12, A). For the control plasmid, we inserted a
scramble gRNA that had no target in the A549 cell line. The knock down efficiency was
verified by transient transfection of the plasmid into the A549 wild type cell line in 12-
well plate, where 1ug of plasmid was used for each well. I observed a decrease in
LINC00261 expression under transient transfection and DOX- exposure conditions via
qPCR (Figure 12, B).

38

Figure
12 The schematic of primer selection and qPCR result for transient transfection. A) The
schematic of LINC00261 gene and the relative positions of the gRNA. P indicated the primer
targeting promoter region of the gene, while E4 indicated the primer targeting the largest exon
of the gene. B) The qPCR result of for transient transfection of A549 wild type cell line with of
pLV hU6-sgRNA hUbC-dcas9-KRAB-T2a-Puro plasmid with gRNA targeting either the promoter
region or exon4. The targeting regions were showed in (A).

Next, we undertook generation of stably transfected monoclonal lines by introducing the
U6-gRNA-Scramble:hUbC-dCas9-KRAB and gRNA-promoterLINC00261:hUbC-dCas9-
KRAB into A549 wild type cell line. Both plasmids were first linearized by MluI, and then
underwent column purification to remove the remnant restriction enzyme from the
reaction mix. Unfortunately, no colonies were formed in wells with promoter targeting
dcas9-Krab plasmid transfection, but a lot of colonies were found in wells with scramble
< < < < < < < Exon 4 Exon 1
A
B
39

dcas9-Krab plasmid transfection. Considering the transient transfection results had
showed the effectiveness of the plasmid and relatively low transfection efficiency, we
hypothesized the knock down efficiency was so high that it could affect cell viability.
Therefore, we designed a strategy that attached the dcas9-KRAB system to an
inducible promoter.

3.3.2 Transient transfection of dox-inducible dcas9-Krab plasmid decreases LINC00261
expression
Because reverse tetracycline-controlled transactivator (rtTA) expression is essential for
activation of the dox-inducible system, an A549 cell line with stable expression of rtTA
was first generated. The rtTA expression sequence with the negative selection marker
blasticidin was collected from pSBtet-Bla plasmid (Addgene # 60510) (Supplemental
figure 3) by AvrII and EcoNI co-digestion followed by purification, and empirically
determined blasticidin concentration of 4ug/mL was used for selection. Four rtTA cell
lines were generated and verified by qPCR (Supplemental figure 4), and clone2 was
chosen for further studies.

A preliminary experiment was also done to test the efficiency of the TRE promoter. The
rtTA expression A549 cell line was transient transfected with both TRE-luciferase and
CMV-Renilla plasmid, and the luciferase assay was done to see whether the
introduction of doxycycline would activate the TRE promoter. The CMV-Renilla plasmid
served as a control for transfection and the mass ratio of TRE-luciferase to CMV-Renilla
40

plasmid was 9:1. The relative fluorescence unit was measured for both firefly and
Renilla, the normalized luciferase intensity was calculated by dividing firefly intensity
with Renilla intensity. The luciferase assay showed the introduction of doxycycline
successfully activated the TRE promoter by increasing the expression of luciferase
gene (Supplemental Table 2).

To optimize the doxycycline concentration for the maximum knock down efficiency,
transient transfection of rtTA into the A549 cell line with dox-inducible plasmid was done
in 12 well plate format, with 1ug of plasmid used for each well. The doxycycline
concentration gradient was set to 1ug/ml, 0.2ug/ml, 0.04ug/ml and 0.008ug/ml, and was
performed in the dark as doxycycline is light-sensitive. The cells were harvested 24
hours after doxycycline induction, and subsequent qPCR was done to test LINC00261
expression levels in each well. The result showed that 0.02ug/ml doxycycline was the
most effective dose to reduce LINC00261 expression (Figure 13).
41

Figure 13 The qPCR result of
LINC00261 expression rtTA expression A549 with different doxycycline concentration.
LINC00261 expression was significantly decreased at the doxycycline concentration 0.04ug/ml
and 0.02ug/ml.

3.4 Discussion
We had previously generated a LINC00261 knock-down A549 cell line using shRNA
that targeted the LINC00261 RNA. However, we ran into technical issues relating to
long term propagation of this modified cell line. To combat this, we engineered the dox-
inducible epigenetic toggle switch targeting LINC00261 so that we can switch rapidly
between activated and repressed gene expression with exceptionally high efficiency.
Doxycycline has been used in vitro and in vivo for decades (37), therefore this construct
will allow us to study the effect of LINC00261 repression in vivo when introduced into
mouse models of tumorigenesis. In addition, the inducible epigenetic toggle switch
42

allows us to determine the effect endogenous LINC00261 expression has on the DNA
mutational burden in cancer in a highly controlled manner.

43

Chapter 4: SUMMARY
Lung cancer is the most prevalent and the most lethal cancer in America, and lung
adenocarcinoma (LUAD) is the most common subtype. In order to better understand the
genomic mechanism leading to LUAD development and potential to develop targeted
treatments, we interrogated the molecular mechanisms of long non-coding RNAs on the
etiology of LUAD. Previously published research had determined that the lncRNA
LINC00261 was a candidate tumor suppressor that whose expression levels correlated
with patient survival (3). Besides studying its influence on cell proliferation and migration
through LINC00261 knock-in/knock-down cell lines, we also found that LINC00261
induces G2/M cell cycle arrest.

To establish if LINC00261 acted as a tumor suppressor in vivo, we utilized patient-
derived xenograft models and implanted H522-CMV-LINC00261 and H522-CMV-NEO
cell lines into athymic nude mice. The resultant tumors were measured 3 times a week
until 6 weeks past injection. At the experimental end point, tumors were removed and
measured. The result showed that LINC00261 resulted in decreased tumor weight as
well as tumor growth ratio compared to NEO controls and this established that
LINC00261 has a suppressor function in vivo. By comparing the xenograft tumor
harvest from each group, we surprisingly found the LINC00261 overexpression tumors
were less reddish than the tumor from control group. Considering the angiogenesis is
the hallmark of malignant tumor, we hypothesized the LINC00261 may also play a role
in angiogenesis. IF staining of the xenograft tumor samples with CD31, was also done
to detect the angiogenesis. However, the CD31 staining showed that there was no
44

measurable difference in the number or size of blood vessels. Because of this, we
thought maybe we can rather use a different primary antibody that targeting more
upstream proteins, like VEGFR or CD105, to mark tumor-specific endothelial growth.

Since genome instability is a shared common feature of many types of cancer (28),
together with our previous finding that some DNA damage repair machinery members
have altered expression in the presence of LINC00261 (3), LINC00261 could be a
promising breakthrough to enable us to learn the regulatory pathway of cell cycle from a
novel perspective. Although the study of long non-coding RNAs never ceases and our
understanding towards them are growing rapidly, there is still a lot unknown region
waiting to be explored. As a series of RNAs that play many important roles in regulatory
pathway, the study of long non-coding RNAs may open up the possibilities for
developing novel chemotherapeutic agents targeting to treat deadly disease.

45

CHAPTER 5: FUTURE DIRECTIONS
Although the IF staining of CD31 showed no huge difference in the blood vessels
number between H522-CMV-LINC00261 and H522-CMV-NEO derived xenograft
tumors, tumor secretion of VEGF or endotheila presentation of CD105 could still be
altered in the presence of LINC00261. As a result, staining of the remnant xenograft
tumors will continue. As for the selection of staining methods, there were two commonly
used methods to visualize molecular markers of angiogenesis. One is
immunohistochemical (IHC) analysis of the paraffin-embedded sample, the other was to
do immunofluorescence (IF) staining of the frozen-section sample.

I have demonstrated that the dcas9-Krab epigenetic toggle switch is active and able to
silence endogenous LINC00261 expression in our cells. However, in order to
functionally characterize the effect loss of LINC00261 in vivo, the generation of stable
A549 LINC00261 knock down cell lines is necessary.

What’s more, I determined empirically that it was better lab practice to isolate the
dCas9-KRAB plasmids from minipreps, instead of maxipreps. The plasmid backbone I
use was 14kb long and contains virus component, so an appropriate bacteria host was
needed for its duplication. Considering this, NEB® Stable Competent E. coli (High
Efficiency), which contains T1 phage resistance (fhuA), was used. However, it could be
a burden for the bacteria to carry such a large plasmid and I usually got no plasmid from
46

maxiprep even though I could harvest pretty much plasmid in miniprep. Therefore, I
recommend multiple minipreps to obtain enough plasmid.

47

References
1. Network CGAR. Comprehensive molecular profiling of lung adenocarcinoma. Nature.
2014;511(7511):543-50.
2. Seo JS, Ju YS, Lee WC, Shin JY, Lee JK, Bleazard T, et al. The transcriptional landscape
and mutational profile of lung adenocarcinoma. Genome Res. 2012;22(11):2109-19.
3. Shahabi S, Kumaran V, Castillo J, Cong Z, Nandagopal G, Mullen DJ, Alvarado A, Ramos-
Correa M, Saizan A, Goel R, Bhat A, Lynch SK, Zhou B, Borok Z, Marconett CN.
LINC00261 is an epigenetically-regulated tumor suppressor that is essential for activation
of the DNA damage response. Can. Res., 2019 PMID 30796052
4. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016;66:7–30.
doi: 10.3322/caac.21332.
5. Kenfield, S., Wei, E., Colditz, G., Stampfer, M. and Rosner, B., 2006, June. Comparison
of aspects of smoking among four histologic types of lung cancer. In AMERICAN
JOURNAL OF EPIDEMIOLOGY (Vol. 163, No. 11, pp. S108-S108). JOURNALS DEPT,
2001 EVANS RD, CARY, NC 27513 USA: OXFORD UNIV PRESS INC.
6. Cheng L, Alexander RE, Maclennan GT, Cummings OW, Montironi R, Lopez-Beltran A,
et al. Molecular pathology of lung cancer: key to personalized medicine. Mod Pathol.
2012;25(3):347-69.
7. Hata A, Katakami N, Yoshioka H, Fujita S, Kunimasa K, Nanjo S, et al. Erlotinib after
gefitinib failure in relapsed non-small cell lung cancer: clinical benefit with optimal patient
selection. Lung Cancer. 2011;74(2):268-73.
8. Kobayashi S, Boggon TJ, Dayaram T, Jä nne PA, Kocher O, Meyerson M, et al. EGFR
mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med.
2005;352(8):786-92.
9. J.L. Rinn, M. Kertesz, J.K. Wang, S.L. Squazzo, X. Xu, S.A. Brugmann, L.H.
Goodnough, J.A. Helms, P.J. Farnham, E. Segal, H.Y. Chang, Functional demarcation
of active and silent chromatin domains in human HOX loci by noncoding RNAs, Cell 129
(2007) 1311–1323.
10. R.A. Gupta, N. Shah, K.C. Wang, J. Kim, H.M. Horlings, D.J. Wong, M.C. Tsai, T. Hung,
P. Argani, J.L. Rinn, Y. Wang, P. Brzoska, B. Kong, R. Li, R.B. West, M.J. van de Vijver,
S. Sukumar, H.Y. Chang, Long non-coding RNA HOTAIR reprograms chromatin state to
promote cancer metastasis, Nature 464 (2010) 1071–1076.
11. Li, X., Wu, Z., Fu, X. and Han, W., 2014. lncRNAs: insights into their function and
mechanics in underlying disorders. Mutation Research/Reviews in Mutation
Research, 762, pp.1-21.
12. Brunner AL, Beck AH, Edris B, Sweeney RT, Zhu SX, Li R, et al. Transcriptional profiling
of long non-coding RNAs and novel transcribed regions across a diverse panel of
archived human cancers. Genome Biol. 2012;13(8):R75.
13. Zhang, F., Wen, Y. and Guo, X., 2014. CRISPR/Cas9 for genome editing: progress,
implications and challenges. Human molecular genetics, 23(R1), pp.R40-R46.
14. Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W. and Bujard, H., 1995.
Transcriptional activation by tetracyclines in mammalian cells. Science, 268(5218),
pp.1766-1769.
15. Győrffy B, Surowiak P, Budczies J, Lánczky A. Online survival analysis software to
assess the prognostic value of biomarkers using transcriptomic data in non-small-cell
lung cancer. PLoS One. 2013;8(12):e82241.
48

16. Kinkade R, Dasgupta P, Carie A, Pernazza D, Carless M, Pillai S, et al. A small
molecule disruptor of Rb/Raf-1 interaction inhibits cell proliferation, angiogenesis, and
growth of human tumor xenografts in nude mice. Cancer Res 2008;68:3810-8
17. Benton, G., Kleinman, H.K., George, J. and Arnaoutova, I., 2011. Multiple uses of
basement membrane ‐like matrix (BME/Matrigel) in vitro and in vivo with cancer
cells. International journal of cancer, 128(8), pp.1751-1757.
18. Groner, A.C., Meylan, S., Ciuffi, A., Zangger, N., Ambrosini, G., Dé nervaud, N., Bucher,
P. and Trono, D., 2010. KRAB–zinc finger proteins and KAP1 can mediate long-range
transcriptional repression through heterochromatin spreading. PLoS genetics, 6(3),
p.e1000869.
19. Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar,
N., Brandman, O., Whitehead, E.H., Doudna, J.A. and Lim, W.A., 2013. CRISPR-
mediated modular RNA-guided regulation of transcription in eukaryotes. Cell, 154(2),
pp.442-451.
20. Gibson, D.G., 2011. Enzymatic assembly of overlapping DNA fragments. In Methods in
enzymology (Vol. 498, pp. 349-361). Academic Press.
21. Tignanelli, C.J., Herrera Loeza, S.G. and Yeh, J.J., 2014. KRAS and PIK3CA mutation
frequencies in patient-derived xenograft models of pancreatic and colorectal cancer are
reflective of patient tumors and stable across passages. The American Surgeon, 80(9),
pp.873-877.
22. Seol, H.S., Kang, H., Lee, S.I., Kim, N.E., Im Kim, T., Chun, S.M., Kim, T.W., sik Yu, C.,
Suh, Y.A., Singh, S.R. and Chang, S., 2014. Development and characterization of a
colon PDX model that reproduces drug responsiveness and the mutation profiles of its
original tumor. Cancer letters, 345(1), pp.56-64.
23. Thakore, P.I., D'ippolito, A.M., Song, L., Safi, A., Shivakumar, N.K., Kabadi, A.M.,
Reddy, T.E., Crawford, G.E. and Gersbach, C.A., 2015. Highly specific epigenome
editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature
methods, 12(12), p.1143.
24. Kowarz, E., Lö scher, D. and Marschalek, R., 2015. Optimized Sleeping Beauty
transposons rapidly generate stable transgenic cell lines. Biotechnology journal, 10(4),
pp.647-653.
25. Lai, Y., Wei, X., Lin, S., Qin, L., Cheng, L. and Li, P., 2017. Current status and
perspectives of patient-derived xenograft models in cancer research. Journal of
hematology & oncology, 10(1), p.106.
26. Morton, C.L. and Houghton, P.J., 2007. Establishment of human tumor xenografts in
immunodeficient mice. Nature protocols, 2(2), p.247.
27. Kim, J., Park, D.Y., Bae, H., Kim, D., Lee, C.K., Song, S., Chung, T.Y., Lim, D.H.,
Kubota, Y., Hong, Y.K. and He, Y., 2017. Impaired angiopoietin/Tie2 signaling
compromises Schlemm’s canal integrity and induces glaucoma. The Journal of clinical
investigation, 127(10), pp.3877-3896.
28. Yao, Y. and Dai, W., 2014. Genomic instability and cancer. Journal of carcinogenesis &
mutagenesis, 5.
29. Network CGAR. Comprehensive molecular profiling of lung adenocarcinoma. Nature.
2014;511(7511):543-50.
30. Li J, Han L, Roebuck P, Diao L, Liu L, Yuan Y, et al. TANRIC: An Interactive Open Platform
to Explore the Function of lncRNAs in Cancer. Cancer Res. 2015;75(18):3728-37.
49

31. Győrffy B, Surowiak P, Budczies J, Lánczky A. Online survival analysis software to assess
the prognostic value of biomarkers using transcriptomic data in non-small-cell lung cancer.
PLoS One. 2013;8(12):e82241.
32. Park C, Yu N, Choi I, Kim W, Lee S. lncRNAtor: a comprehensive resource for functional
investigation of long non-coding RNAs. Bioinformatics. 2014;30(17):2480-5.
33. Hsu, P.D., Lander, E.S. and Zhang, F., 2014. Development and applications of CRISPR-
Cas9 for genome engineering. Cell, 157(6), pp.1262-1278.
34. Ma, D. and Liu, F., 2015. Genome editing and its applications in model
organisms. Genomics, proteomics & bioinformatics, 13(6), pp.336-344.
35. Castillo J, Stueve TR, Marconett CN. Intersecting transcriptomic profiling technologies and
long non-coding RNA function in lung adenocarcinoma: discovery, mechanisms, and
therapeutic applications. Oncotarget. 2017.
36. Morlando, M. and Fatica, A., 2018. Alteration of epigenetic regulation by long noncoding
RNAs in cancer. International journal of molecular sciences, 19(2), p.570.
37. Brouillard, J.E., Terriff, C.M., Tofan, A. and Garrison, M.W., 2006. Antibiotic selection and
resistance issues with fluoroquinolones and doxycycline against bioterrorism
agents. Pharmacotherapy: The Journal of Human Pharmacology and Drug
Therapy, 26(1), pp.3-14.

50

SUPPLEMENTAL DATA
Table 1 List of Primers used for PCR, fragment clone and sequencing
List of Primers used for PCR and qRT-PCR
Primer Name Primer Sequence
LINC00261 exon junction qPCR forward GGATAAAGACCAGCTCAACCA
LINC00261 exon junction qPCR reverse CTCCAAGACAAAGAAGAGTAGG
GAPDH exon junction qPCR forward GGTGAAGGTCGGAGTCAACG
GAPDH exon junction qPCR reverse GTTGAGGTCAATGAAGGGGTC
LINC00261 promoter-target sequence
forward
CACCGACATTCTAGATCCGAATTCCA
LINC00261 promoter-target sequence
reverse
AAACTGGAATTCGGATCTAGAATGTC
LINC00261 exon4-target sequence forward CACCGCCTGGTGTGAAGGGACGCATA
LINC00261 exon4-target sequence reverse AAACTATGCGTCCCTTCACACCAGGC
LINC00261 non-target(scramble) sequence
forward CACCGCAAAATACTCCAATTGGCGAA
LINC00261 non-target(scramble) sequence
reverse AAACTTCGCCAATTGGAGTATTTTGC
rtTA expression verification forward AGCAAAGTCATAAACGGCG
rtTA expression verification reverse TTCTTCACGTGCCAGTACAG

AF (for A. laidlawii only) forward GGAATCCCGTTTGAAGATAGGA
PF (for M. pirum only) forward GGAAAATGTTATTTTGACGGAACCT
MF (for six species of mycoplasma) forward TCTGAAT(C/T)TGCCGGGACCACC
Reverse primer for all mycoplasma CTTTCC(A/C)TCAC(G/T)GTACT(A/G)GTTCACT

Puromycin region cloning forward CCGCTGCTCATAAGACTGCTTTTTTGAAGCTTGTCG
Puromycin region cloning reverse CCCCTTACCTTTATCGATGCATGGGGTC
TRE promoter region cloning forward ACTTTACAGGGTAAGGGGTCCGCTATCTAGACG
TRE promoter region cloning reverse TTGTAGTCCATGGTGGCTTTGGCTCCAGGCGATCTGAC
Gibson assembly verification sequence-
puromycin TCGTATATGCAAATATGAAG
Gibson assembly verification sequence-TRE
promoter forward AGGGTAAGGGGTCCGCTAT
Gibson assembly verification sequence-TRE
promoter reverse GTACTTCTTGTCCATTCCGC

51

Table 2 The luciferase intensity for TRE promoter test
Luciferase plasmid
- + +
Doxycycline
- - +
Luciferase intensity 365.667 287855 2000104
Renilla Intensity 665 8928 11358
Normalized luciferase
intensity
0.550 32.242 176.096

52

Figure S1 The pLV hU6-sgRNA hUbC-dcas9-KRAB-T2a-Puro plasmid sequence and
enzyme cutting sites. A. The sequence of pSBtet-Bla plasmid with puromycin anti-
selection marker. B. The enzyme cutting sites for Gibsom assembly, the plasmid has
beed digested with BaeI followed by XbaI . Unlike regular single-cut endonuclease, BaeI
has one recognition site and makes double-cuts.

A
B
53

Figure S2 The shScramble_tGFP plasmid sequence and cloning region. A. The
sequence of pSBtet-Bla plasmid with puromycin anti-selection marker. B. The
schematic of clone region, puromycin anti-selection marker and its promoter, and the
primers position.

A
B
54

Figure S3 The pSBtet-Bla plasmid sequence and cloning region. A. The sequence of
pSBtet-Bla plasmid with blasticidin anti-selection marker. B. The schematic of clone
region, TRE promoter region, and the primers position.

A
B
55

Figure S4 The qPCR result of rtTA expression A549 cell line, and RPBSA promoter
was used to increase rtTA expressionrt (***, p<0.001).

Abstract (if available)

Abstract Lung adenocarcinoma (LUAD) is the most common histological subtype of lung cancer and the most common lung cancer in ex- and never smokers. Although many studies of LUAD focus on oncogenic mutations, around 30% of LUAD cases show no significant LUAD-related mutations. My thesis project focused on the molecular role in lung adenocarcinoma for long non-coding RNAs, a newly discovered class of RNA with a diverse set of regulatory functions that can influence the development of cancer. By profiling lncRNA expression in LUAD cell lines and comparing those gene signatures with alveolar epithelial cells, the purported cell of origin for LUAD, we determined that the lncRNA LINC00261 was a candidate tumor suppressor whose expression levels correlated with patient survival. Our lab’s previous work showed reintroduction of LINC00261 into LUAD cells inhibited cellular migration and slowed proliferation by inducing a G2/M cell cycle arrest. To determine if LINC00261 functions as tumor suppressor in vivo, tumor xenografts of H522-CMV-LINC00261 and H522-CMV-NEO cell lines on nude mice were performed. Overall, tumors derived from LINC00261 ectopic expression cell lines were significantly smaller than the control group, which is consistent with LINC00261 acting as a tumor suppressor. In order to functionally characterize the effect loss of LINC00261 in vivo has on lung adenocarcinoma growth and proliferation, I have designed an epigenetic toggle switch utilizing CRISPR technology to reversibly ablate LINC00261 expression. Taken together, I have established that LINC00261 functions as a tumor suppressor in lung adenocarcinoma.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

Generation of an epigenetic toggle switch to test LINC00261 function on lung adenocarcinoma cellular response to the chemotherapeutics oxaliplatin and carboplatin

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

Evaluating the impact of long non-coding RNAs on tumor mutational burden in cancer

PDF

LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

PDF

Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

Elucidating the cellular origins of lung adenocarcinoma

PDF

Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

PDF

Investigating the function and epigenetic regulation of ABCA3, a novel LUAD tumor suppressor gene

PDF

In vitro lineage tracing of immortalized human alveolar epithelial cells

PDF

DNA methylation changes in the development of lung adenocarcinoma

PDF

Tight junction protein CLDN18.1 attenuates malignant properties and related signaling pathways of human lung adenocarcinoma in vivo and in vitro

PDF

Long-term expansion of human alveolar epithelial cells as a novel model system to study lung disease progression in vitro

PDF

Do ZFX and ZNF711 regulate the same genes in HEK293T cells?

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

Development of immunotherapy for small cell lung cancer using novel modified antigens

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

Studies on the role of a novel protein, TMEM 56 in tumorigenic growth for MCF-7 cells

PDF

TLR8-transferred miR-192 acts as a tumor suppressor in neuroblastoma by inhibiting CTCF

PDF

Application of tracing enhancer networks using epigenetic traits (TENET) to identify epigenetic deregulation in cancer

Asset Metadata

Creator Cong, Zhengmin (author)

Core Title Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 07/28/2019

Defense Date 06/20/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag dox-inducible CRISPR knock down,long non-coding RNA,lung adenocarcinoma,OAI-PMH Harvest,xenograft

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Marconett, Crystal (committee chair), Offringa, Ite (committee member), Zhou, Beiyun (committee member)

Creator Email congzhen@usc.edu,czm610031651@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-196300

Unique identifier UC11662702

Identifier etd-CongZhengm-7657.pdf (filename),usctheses-c89-196300 (legacy record id)

Legacy Identifier etd-CongZhengm-7657.pdf

Dmrecord 196300

Document Type Thesis

Format application/pdf (imt)

Rights Cong, Zhengmin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA