University of Southern California Dissertations and Theses

Vpr-binding protein negatively regulates p53 by site-specific phosphorylation through intrinsic kinase activity

(USC Thesis Other)

Vpr-binding protein negatively regulates p53 by site-specific phosphorylation through intrinsic kinase activity

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Vpr-Binding Protein Negatively Regulates p53 by Site-Specific
Phosphorylation Through Intrinsic Kinase Activity

By

Roasa Mehmood

A Thesis Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfilment of the Requirements for the Degree
MASTER OF SCIENCE
(Biochemistry and Molecular Medicine)

August 2019

Copyright 2019 Roasa Mehmood
2
DEDICATION

To my Mother

- for being the guide in my life as a
strong, confident woman. For putting
my needs before yours. For having more
faith in me than I have in myself. I love
you with all my heart and soul.

To my Father - for being my life coach. For always
strengthening me and making me a
fighter in tough times by instilling in me
that the seeds of ultimate successes are
abundantly watered by failures, loss,
and rejections.

To my Twinster
- for being my confidant, my partner-in-
crime, my adventure buddy. For always
being there for me since our day one.

To my Little Brother
- for being an attentive listener of my
endless talks. For offering me your
shoulder to cry on during those sensitive
moments, but never leaving me before
wiping my tears dry.

To my Baby Brother

- for being the source of my laughters.
For making light of situations and
reminding me that life doesn’t always
have to be taken so seriously.
3
ACKNOWLEDGEMENTS

ﺑ
ِ ﺴ ْ ﻢ
ِ ﷲ
ِ ا ﻟ ﺮ ﱠ ﺣ ْ ﻤ ٰ ﻦ
ِ ا ﻟ ﺮ ﱠ ﺣ ِ ﯿ ْ ﻢ
ِ
In the name of Allah, the Most Beneficent, the Most Merciful.
With His grace, I impart USC as a more competent researcher and scientist, a stronger
individual and a better human being.

My deepest gratitude goes towards my mentor, Dr. Nikhil Ghate. His guidance and support were
imperative to the work presented in this thesis and beyond. From inception to completion of each
research project, he made sure I had a thorough understanding and mastery of the subject matters.

Thank you to Dr. Yonghwan Shin for his overall support and encouragement through the course
of time I worked with him.

A heartfelt thank you to my Principal Investigator, Professor Woojin An, for not only accepting
me as his student but also for critiquing my lab works, writings and presentations. His insights
provided during the planning and execution of research projects have been pivotal in cultivating
my mind to think as a medical scientist.

And, of course, thank you to Dr. Judd Rice and Professor Michael Stallcup for sparing time for me
from their busy schedules to review my thesis for a successful defense. Their advice and support
is greatly appreciated as it has been vital for me to see my work through different lenses.

4
ABSTRACT
HIV-1 Viral protein r-Binding Protein (VprBP) is a large nuclear protein implicated in
cellular processes such as cell-cycle progression, DNA replication and telomerase regulation.
Work from our lab has established VprBP as a negative regulator of the cell-cycle inhibition,
emanating from its intrinsic kinase activity that executes site-specific phosphorylation of histone
H2A at Threonine 120 (T120). This function results in repression of chromatin transcription and
impairment of tumor suppression. In similar regards, the expression and function of tumor
suppressor p53 are also mis-regulated by VprBP-mediated phosphorylation. Depletion of VprBP
in cancer cells and incorporation of a single-point mutation at Lysine 194 (K194) in the kinase
domain of VprBP obstruct phosphorylation of p53. Mass spectrometry analysis further reveals
that VprBP phosphorylates p53 at Serine 367 (S367), which has been validated by site-directed
mutagenesis of amino acid 367 to Alanine. Having established that VprBP function is linked to
the progression of cancer, we seek to resolve the structure of VprBP kinase domain (VPKD) for
the development of highly specific VprBP inhibitors that would function to suppress
tumorigenesis.

5
TABLE OF CONTENTS

Chapter 1: Establishing VprBP-p53 Kinase-to-Substrate Relationship Ex-Vivo

1.1 Introduction ......................................................................................................................... 7
Vpr – Binding Protein ........................................................................................................ 7
p53 Tumor Suppressor Protein .......................................................................................... 8

1.2 Materials and Methods ..................................................................................................... 10
Plasmid Cloning and Confirmation ................................................................................. 10
Polymerase Chain Reaction (PCR) ..................................................................... 10
Restriction Digestion and Ligation ...................................................................... 10
Bacterial Transformation .................................................................................... 11
Colony PCR ......................................................................................................... 11
Overnight Bacterial Culture and Miniprep Plasmid Isolation ............................ 11
Sequencing and Midiprep Plasmid Isolation ....................................................... 12
Site-Directed Mutagenesis ............................................................................................... 12
Substitution Mutation Primer Design .................................................................. 12
PCR, Kinase-Ligase-DpnI (KLD) Treatment and Transformation ..................... 12
Sequencing and Plasmid Isolation ....................................................................... 13
Cell Culture ...................................................................................................................... 13
Transient Transfections of Mammalian Cell Lines .......................................................... 13
Protein Isolation and Western Blot .................................................................................. 15
Immunofluorescence ........................................................................................................ 15
Lentivirus Production ....................................................................................................... 16
Generation of Stable Cell Lines Depleted of VprBP ....................................................... 16
Total RNA to cDNA Synthesis for Quantitative Real-Time PCR (qRT-PCR) ............... 17
Cell Proliferation Colorimetric Assay ............................................................................. 17
Generation of Stable Cell Lines Overexpressing WT or K194R VprBP ........................ 18
Treating Stable Cell Lines with Etoposide ...................................................................... 18

1.3 Results ................................................................................................................................. 19
Western Blot Analyses of Transiently Transfected Cell Lines ........................................ 23
Immunofluorescence Staining Analysis of HT1376 Cancer Cells .................................. 24
Immunofluorescence Staining Analysis of H1299 Cancer Cells ..................................... 25
qRT-PCR Analysis of p21 Gene Expression in H1299 Cells .......................................... 26
Western Blot and qRT-PCR Analyses of DU145 Depleted of VprBP ............................ 27
Western Blot and qRT-PCR Analyses of U2OS Depleted of VprBP .............................. 28
Western Blot and qRT-PCR Analyses of HT1376 Depleted of VprBP .......................... 29
Western Blot Analysis of Stable Cell Lines Expressing WT or K194R VprBP ............. 30
Western Blot and qRT-PCR Analyses of Etoposide Treated U2OS Stable Cell Lines ... 31
Western Blot and qRT-PCR Analyses of Etoposide Treated HT1376 Stable Cell Lines 32
Cell Proliferation Assessment of Stable Cell Lines Depleted of VprBP ......................... 33

1.4 Discussion ........................................................................................................................... 34

6
Chapter 2: Expressing and Purifying Segmented Kinase Domains of VprBP

2.1 Introduction ....................................................................................................................... 36
VprBP Kinase Domain (VPKD) ...................................................................................... 36
Protein Expression Systems ............................................................................................. 37

2.2 Materials and Methods ..................................................................................................... 39
Designing DNA Inserts for Bacterial Protein Expression ............................................... 39
Competent Cells and Bacterial Inoculant Media Conditions ........................................... 39
Plasmid Cloning for GST-tag Protein .............................................................................. 39
Expression and Batch Purification of GST-tag Fusion Protein ....................................... 40
Native GST-tag Protein Purification Protocol .................................................... 40
Partially Denatured GST-tag Protein Purification Protocol .............................. 41
Plasmid Cloning for His-tag Protein ................................................................................ 42
Expression and Batch Purification of His-tag Fusion Protein ......................................... 42
Native His-tag Protein Purification Protocol ...................................................... 42
Partially Denatured His-tag Protein Purification Protocol with Sarcosyl .......... 43
Denatured His-tag Protein Purification Protocol with Imidazole ....................... 44
Dialyzing and Concentrating Proteins .............................................................................. 45
In-Vitro Kinase Assay ...................................................................................................... 45

2.3 Results and Discussion ..................................................................................................... 46
GST-tag VPKD Batch Protein Purification Methods ...................................................... 48
GST-tag Protein SDS-PAGE Analysis ............................................................................ 49
His-tag VPKD Batch Protein Purification Methods ........................................................ 50
His-tag Protein SDS-PAGE Analyses .............................................................................. 51
In-Vitro Kinase Assay and Western Blot Analysis .......................................................... 52

Bibliography ................................................................................................................................ 53

7
Chapter 1: Establishing VprBP-p53 Kinase-to-Substrate Relationship Ex-Vivo

1.1 INTRODUCTION
Vpr – Binding Protein
Viral protein r-Binding Protein (VprBP) is a 1,507 amino acid nuclear protein that was
first identified interacting with HIV-1 Viral Protein R (HIV-1 Vpr) by a co-immunoprecipitation
assay [2, 12, 13, 16, 24]. Upon further research, it was reported that VprBP acts as an
intermediary between HIV-1 Vpr and Cullin 4-DDB1 ubiquitin ligase to form a complex that
elicits G2 phase cell cycle arrest in virus-infected cells [2, 8, 13]. Although its exact roles remain
unclear, VprBP has been implicated to regulate a number of cellular processes, including DNA
replication, cell cycle progression and telomere maintenance [12, 13, 16]. More recent findings
illustrate that VprBP has intrinsic kinase activity that phosphorylates histone H2A at T120,
which consequently results in the repression of chromatin and gene transcription in cancer cell
lines. The kinase activity of VprBP is reported to be abrogated when either of three highly
conserved residues – Lysine 194 (K194), Aspartic Acid 361 (D361) and Lysine 363 (K363) – are
mutated. As an effect of VprBP mutants, a gradual decrease in cancer cell proliferation was
exhibited. Consistent with this observation, depleting VprBP also impaired the viability of cancer
cells [13]. These findings highlight the role of VprBP in cancer development and progression.
In an attempt to better understand the pro-oncogenic function of VprBP, immuno-
histochemical analyses of tissue microarrays were performed on 16 cancer samples and their
normal counterparts. Results demonstrated that VprBP staining is strong in a majority of the
tumor samples and weak in most normal tissues [13]. These findings are in agreement with the
concept that VprBP generates an oncogenic environment by maintaining tumor suppressor genes
in their inactive state. This observation was further corroborated by results indicating that VprBP
regulates the expression of p53 target genes involved in DNA damage responses. VprBP
overexpression in human cancer cell lines reduced DNA damage-induced apoptotic cell death,
while VprBP depletion increased DNA damage-induced growth arrest and apoptosis. Such
findings suggest that VprBP tempers the p53 signaling pathways and p53 target gene
transcription to carry out oncogenic functions [13]. To gain a more in-depth understanding of
VprBP kinase function on a molecular level, we test the hypothesis that the expression and
8
function of tumor suppressor p53 are mis-regulated by VprBP-mediated phosphorylation in
multiple forms of cancer.

p53 Tumor Suppressor Protein
Often referred to as the Guardian of the Genome, p53 transcription factor is a 53 kD
protein encoded by the TP53 gene located on chromosome 17p13.1 to regulate cellular responses
to stress [9, 10]. A multitude of stress stimuli such as oncogene expression, DNA damage,
nutrient deprivation, and hypoxia activate the
signaling pathway of p53 (Figure 1). Upon
activation, p53 triggers target genes to induce
apoptosis, senescence, or temporary cell-
cycle arrest for DNA repair in an attempt to
restrict tumor development and maintain
genomic stability [3, 4, 11]. The exact fate of
the cell is dictated by what target gene(s) p53
activates (or represses) based upon cell types
and severity of cellular stresses [4]. As stress
signals dissipate, murine double minute 2
(MDM2), an E3 ubiquitin ligase, negatively regulates p53 by binding to it and promoting its
degradation. Through MDM2-mediated ubiquitylation of p53, the levels of p53 are maintained at
a low level to prevent inappropriate cellular activity [3, 4, 19, 21]. In essence, p53 serves as a
tumor suppressor to safeguard cells, and, in a larger context, the host organism, from stress by
intricately regulating transcription of multiple target genes.
One of the first identified p53-target genes was p21, a cyclin-dependent kinase (CDK)
inhibitor that has been deemed to be a major mediator of p53 tumor suppressor activity. p21
functions to induce G1 phase cell cycle arrest and trigger senescence in response to DNA damage
by inhibiting the activities of CDK-cyclin complexes and Proliferating Cell Nuclear Antigen
(PCNA), or by suppressing transcriptional activities of certain genes [1, 3, 4, 6]. In addition, p21
blocks DNA replication/synthesis to keep cells stable by maintaining the integrity of the genome.
Because p53-induced p21 is the major cell cycle regulator, it can be described as a critical
Figure 1: Map illustrating the roles p53 plays in
protecting cells from adverse external factors [3].

9
determinant of tumor suppressor activity by p53 [1, 3]. Consequently, it is oftentimes one of the
crucial p53 target genes studied when tumor suppressor p53 mis-functions.
While p53 is critical for the regulation of organism viability under normal physiology,
decades of research on p53 also report that it is the most frequently modified protein that
contributes to the development of cancers. More than half of all human tumorigenesis manifest
inactive or mutant p53 [3, 4, 9]. Post-transcriptional modifications (PTMs) often alter the
expression or activity of p53, which subsequently mis-regulate downstream target gene
functions. As a result, mutant p53 is unable to prevent cellular damage, leading to the onset of
cancer. As compared to the 20-minute lifespan of wild-type p53, mutant p53 can live anywhere
for up to 12 hours [19]. Because of its oncogenic potential, persistent expression of mutant p53
can be detrimental for the well-being of an organism if affected
cells are not eliminated through cancer treatments in a timely
manner.
Typically, cancers are often treated with
chemotherapeutic drugs in combination with other treatments such
as surgery or radiation therapy to attenuate abnormal cell growth
and division. Etoposide, derived from podophyllotoxin, is a potent
anti-cancer drug commonly used to treat numerous human cancer
types, including testicular carcinoma, lung cancer and breast cancer (Figure 2) [7, 17]. By
covalently binding to DNA and topoisomerase II, etoposide induces DNA damage by increasing
single- and double-strand DNA breaks. As a result, the growth and division of cancer cells is
inhibited as cell cycle progression ceases [7, 15, 17, 18].
In this report, we build upon recent advances and establish a direct kinase-to-substrate
relationship between oncogene VprBP and the most commonly modified tumor suppressor gene
p53 through multiple ex-vivo experiments. We demonstrate that the expression of p53 is
negatively regulated by VprBP-mediated phosphorylation in cancer cells and unveil the effects
that a single-point mutation at Lysine 194 in VprBP has on its kinase activity and nuclear
localization. We also reveal how a single-point mutation at Serine 367 in p53 impacts VprBP
kinase activity and the effects this has on the transactivation of p53 target genes.

Figure 2: Chemical Structure
of Etoposide [18].

10
1.2 MATERIALS AND METHODS
Plasmid Cloning and Confirmation
Full-length wild-type (WT) VprBP was subcloned
into mammalian expression vector, pIRES-1-NEO,
between the restriction endonuclease cut sites,
NotI and EcoRI [Figure 1]. Construct of pIRES-1-
NEO-WT-p53 was already available [12].

Polymerase Chain Reaction (PCR)
PCR reaction was performed in a final volume of
50 µL that consisted of 5 µL 2.5 µM forward and
reverse primers (Integrated DNA Technologies)
[Table 1], 25 µL Platinum SuperFi Green PCR
Master Mix (Invitrogen), nuclease-free H2O and
~0.1 µg template DNA. The following
thermocycling parameters were applied: 4 minutes initial denaturation at 95°C, followed by 30
cycles of 95°C denaturation for 30 seconds, 53°C annealing for 30 seconds, 72°C extension for 4
minutes and 4°C infinite hold. PCR products (PCR inserts) were separated by electrophoresis on
a 0.5% agarose gel and visualized under UV transilluminator. DNA fragments were purified with
GeneJET Gel Extraction Kit (Thermo Scientific) according to the manufacturer’s protocol.

Restriction Digestion and Ligation
Purified PCR inserts and pIRES-1-NEO vector were digested for 3 hours in a 37°C water bath in
50 µL reaction that consisted of 1 µL of each NotI and EcoRI restriction enzymes (NEB), 5 µL
NEBuffer 3.1 (NEB) and H2O. The digested products were separated by electrophoresis on a
0.5% agarose gel and purified with GeneJET Gel Extraction Kit (Thermo Scientific) according to
the manufacturer’s protocol. Ligation for plasmid DNA was performed at room temperature for
Primer Sequence
Forward 5’ GTATTAGCGGCCGCACTACAGTAGTGGTACATGT 3’
Reverse 5’ CGCTCCGAATTCCTCATTCAGAGATAAGATGAT 3’
Figure 3: Plasmid map of pIRES-1-NEO
showing FLAG and HA tags.

Table 1: Sequences of forward and reverse primers used to perform PCR amplification
for molecular cloning with restriction enzyme recognition sequences highlighted.

11
20 minutes in 10 µL ligation mix consisting of vector and insert at a 1:4 ratio, 2x T4 DNA
Ligase Buffer and T4 DNA Ligase (Enzymatics).

Bacterial Transformation
Total ligation reaction mixes were gently pipetted into 25 µL DH5-a competent cells, which
were then incubated on ice for 20 minutes. DNA was heat-shocked into entering cells for 1
minute 15 seconds in a 42°C shaking water bath before quickly being placed on ice for 2
minutes. 900 µL Luria broth (LB) media was added and samples were incubated at room
temperature for 5 minutes before being incubated in a 37°C shaking water bath for 1 hour 30
minutes. The cells were plated on LB agar plates containing appropriate antibiotics and
incubated overnight (16 hours) at 37°C.

Colony PCR
Colonies from each plate were screened to confirm successful ligation. PCR reaction was
performed in a final volume of 20 µL that consisted of 2 µL 2.5 µM forward and reverse primers
(Integrated DNA Technologies) [Table 2], 10 µL PCR Master Mix (Promega) and 6 µL
nuclease-free H2O. The following thermocycling parameters were applied: 2 minutes initial
denaturation at 98°C, followed by 25 cycles of 98°C denaturation for 30 seconds, Tm minus 2°C
annealing for 1 minute/kb, 72°C extension for 5 minutes and 4°C infinite hold. The PCR
products were separated by electrophoresis on a 0.7% agarose gel and bands were visualized
under a UV transilluminator.

Overnight Bacterial Culture and Miniprep Plasmid Isolation
Colonies were inoculated in 5-6 mL LB + 100 µg/mL Ampicillin and incubated overnight on a
shaking 37°C incubator for bacterial growth. Efficient bacteria growth was determined by the
turbidity of the liquid culture before the plasmid was isolated and purified according to the
protocol provided by Plasmid Miniprep Kit (Bioland Scientific LLC).
Primer Sequence
FLAG F 5’ GACTACAAGGACGACGATGACAAG 3’
VprBP EcoR1 R 5’ GCCGTCGAATTCTCACTCATTCAGAGATAAGATG 3’
Table 2: Sequences of forward and reverse primers used to perform colony PCR with
restriction enzyme recognition sequence highlighted.

12
Sequencing and MidiPrep Plasmid Isolation
Sanger sequencing was performed by submitting the cloned plasmid to the company named
GENEWIZ, Inc. and results were analyzed through Clustal Omega – Multiple Sequence
Alignment tool (https://www.ebi.ac.uk/Tools/msa/clustalo/). After confirmation, liquid cultures
from glycerol stocks were incubated overnight on a shaking 37°C incubator for bacterial growth
in 5-6 mL LB + 100 µg/mL Ampicillin. Plasmids were isolated and purified using PureLink
HiPure Plasmid Midiprep Kit (Invitrogen) according to the manufacturer’s protocol, and DNA
concentrations were measured at an absorbance of 260 nm on a spectrophotometer (NanoDrop
ND-1000 spectrophotometer).

Site-Directed Mutagenesis
Substitution Mutation Primer Design
Mutagenic primers for single base-pair
change were designed according to
NEBaseChanger, an online design
software, via sequences provided by NCBI
nucleotide accession #: XM_011534274.2
(VprBP) and accession #: AB082923.1
(p53). Lysine 194 was changed to Arginine
in VprBP and Serine 367 was changed to
Alanine in p53 [Figure 4].

PCR, Kinase-Ligase-DpnI (KLD) Treatment and Transformation
Point mutations were made in WT VprBP-pIRES-1-NEO and WT p53-pIRES-1-NEO constructs
using the Q5

Site-Directed Mutagenesis Kit (NEB) according to manufacturer’s protocol. PCR
reaction contained 12.5 µL Q5 Hot Start HiFi 2x Master Mix, 1.25 µL 10 µM forward and
reverse primers (Integrated DNA Technologies) [Table 2], nuclease-free H2O and 20 ng pIRES-
full-length p53 or VprBP for a total volume of 25 µL. The following thermocycling parameters
were applied: 2 minutes initial denaturation at 98°C, followed by 25 cycles of 98°C denaturation
for 10 seconds, Tm minus 2°C annealing for 1 minute/kb, 72°C extension for 10 minutes and 4°C
infinite hold. KLD reaction consisted of 1 µL PCR product, 5 µL 2x KLD Reaction Buffer, 1 µL
Figure 4: A) Site-directed mutagenesis in VprBP
kinase domain, Lysine 194 to Arginine. B) Site-directed
mutagenesis in p53, Serine 367 to Alanine.
B)
A)
13
10x KLD Enzyme Mix and nuclease-free H2O for a final volume of 10 µL. 5 minute room
temperature incubation was given before 5 µL of reaction mix was transformed into 50 µL
NEB5-a Competent E. coli cells and plated on LB+Amp plates for overnight incubation at 37°C.

Primer Sequence
VprBP K194R F 5’ CAGGAAAACAGGCGTCCCAGT 3’
VprBP K194R R 5’ CCGCAAAGCCACTTCCTG 3’
p53 S367A F 5’ CTGGTCCCCCCTGGCTCC 3’
p53 S367A R 5’ GGCTCACTCCGCCCACCTGAAGTCCAAAAAGGG 3’
Sequencing and Plasmid Isolation
The plates were examined for colony formation the next day. Select colonies were inoculated
overnight in LB + 100 µg/mL Ampicillin and plasmids, isolated by Plasmid Miniprep Kit
(Bioland Scientific LLC), were sequenced to confirm mutations. After confirmation, plasmids
were isolated by PureLink HiPure Plasmid Midiprep Kit (Invitrogen).

Cell Culture
Mammalian prostate (DU145), osteosarcoma (U2OS), bladder (HT1376) cancer cell lines and
human embryonic kidney (HEK293T) cell line were plated in tissue culture dishes in Dulbecco's
Modified Eagle Medium (DMEM) growth media supplemented with 10% fetal bovine serum
(FBS) and penicillin/streptomycin. Mammalian lung cancer cell line (H1299) was plated in
tissue culture dish in Roswell Park Memorial Institute 1640 (RPMI) growth media supplemented
with 10% fetal bovine serum (FBS) and penicillin/streptomycin. All cells were incubated in a
37°C humidified CO2 incubator.

Transient Transfections of Mammalian Cell Lines
DU145, H1299 and HT1376 cells were seeded and cultured overnight (12-16 hours) in 6-well
plates (2.5 x 10
5
cells/well) under sterile conditions prior to transfection. Transient transfection
was performed according to the instructions provided by Lipofectamine 3000 Transfection Kit
(Invitrogen). The cells were washed with 1 mL Phosphate Buffer Saline (PBS) and supplemented
with 1750 µL fresh growth media before the prepared transfection mix containing 250 µL
Table 3: Sequences of forward and reverse primers used to perform site-directed mutagenesis

14
growth media (OptiMEM), 9 µL Lipofectamine 3000, Reagent 3000 double the volume of
plasmid, and 1-2.5 µg plasmid of interest was added drop-by-drop to each well [Table 4]. The
cells were then incubated at 37°C in a CO2 incubator for 3 hours before 1 mL 20% DMEM or
RPMI, respective to cell line, was added to each and incubated for an additional 48 hours. Cells
were dislodged in 0.5% Trypsin and given three 1x PBS washes.

4A DU145 Prostate Cancer Cell Line
Control
2.5 µg
WT p53
2.5 µg
WT VprBP

4B DU145 Prostate Cancer Cell Line
Control
1.5 µg
WT p53
1.5 µg
WT VprBP

4C HT1376 Bladder Cancer Cell Line
Control
1 µg
WT VprBP
2.5 µg
WT VprBP
1 µg
K194R VprBP
2.5 µg
K194R VprBP

4D H1299 Lung Cancer Cell Line
Control WT p53
WT p53 +
1 µg WT VprBP
WT p53 +
2.5 µg WT VprBP
WT p53 +
1 µg K194R VprBP
WT p53 +
2.5 µg K194R VprBP

4E H1299 Lung Cancer Cell Line
Control S367A p53
S367A p53 +
1 µg WT VprBP
S367A p53 +
2.5 µg WT VprBP
S367A p53 +
1 µg K194R VprBP
S367A p53 +
2.5 µg K194R VprBP

4F H1299 Lung Cancer Cell Line
Control WT p53 S367A p53

Table 4: Plasmid concentrations used in different cell lines for transient transfection experiments.

15
Protein Isolation and Western Blot
Total protein lysates were obtained using M-PER Mammalian Protein Extraction Reagent
(Thermo Scientific) containing PMSF and run on 7.5% sodium dodecyl sulfate-polyacrylamide
gel (SDS-PAGE) at 220 V for 45 minutes followed by electrophoretic transfer onto
nitrocellulose membrane for 1 hour 10 minutes at 45 V. The membranes were Ponceau stained to
ensure protein transfer and blocked in 5% nonfat dry milk (NFDM) in 1X Phosphate Buffered
Saline (PBS) for 3 hours at room temperature. After blocking, the membranes were incubated
overnight at 4°C on shaker with relevant primary antibodies prepared in 5% NFDM with 1X
PBS at a dilution of 1:2000 – anti-HA-tag rabbit polyclonal antibody (Proteintech), anti-p53
mouse monoclonal 1gG antibody (Santa Cruz Biotechnology), and anti-B-actin mouse
monoclonal antibody (Proteintech). Following incubation, the membrane was given four 5-
minute washes with 1X PBS with 0.1% Tween 20 (PBS-T). Alexa Fluor 680 goat anti-mouse
IgG (H+L) or Alexa Fluor 680 goat anti-rabbit IgG (H+L) secondary antibody (Invitrogen)
prepared in 0.1% PBS-T with 5% NFDM + 1% SDS at a dilution of 1:10000 were added and left
to shake for 1 hour at room temperature. The membranes were given four 5-minute washes with
1X PBS-T and two 5-minute washes with 1X PBS before being imaged with Odyssey Infrared
Imaging System (LI-COR Biosciences).

Immunofluorescence
H1299 and HT1376 cells were seeded on cover slips in 12-well plates and cultured overnight
(1.0 x 10
5
cells/well) before being transfected with WT VprBP or K194R VprBP [Table 5]. The
cells were fixed in 4% paraformaldehyde in PBS and then permeabilized with 0.2% Triton-X
100 in PBS, both for 10 minutes at room temperature. One hour incubation was given in
blocking buffer consisting of 22.5 mg/mL glycine in 1% Bovine Serum Albumin (BSA) + PBS-
T. Blocking buffer was washed off with PBS and the cells were incubated in a humidified
chamber at room temperature for one hour with anti-HA-tag rabbit polyclonal antibody
(Proteintech) and/or anti-p53 mouse monoclonal 1gG antibody (Santa Cruz Biotechnology)
prepared in 1% BSA PBS-T at a dilution of 1:50. Slides were given three 5-minute washes with
PBS before the cells were incubated in the dark at room temperature for one hour with Alexa
Fluor 488 goat anti-rabbit IgG (H+L) and/or Alexa Fluor 594 goat anti-mouse IgG (H+L)
secondary antibodies (Invitrogen) prepared in 1% BSA PBS-T at a dilution of 1:1200. Slides
16
were given three 5-minute washes with PBS and cells were stained with VECTASHIELD
Antifade Mounting Medium with DAPI (Vector Laboratories) before being visualized under a
fluorescence microscope (ZEISS Axio Imager.Z1 ApoTome). Data analysis was done using
AxioVision Rel. 4.8 software.

Lentivirus Production
HEK293T cells were seeded and cultured
overnight in 100 mM tissue culture plates
(2.0 x 10
5
cells/well) before
polyethyenimine (PEI) transfection was
performed for lentivirus production. Old
media was replaced with fresh 10 mL
DMEM media supplemented with 10% fetal bovine serum (FBS) and Penicillin/Streptomycin.
DNA transfection mix, consisting of 5 µg PCDNLBH packaging vector 1, 5 µg PCMVSVG
packaging vector 2, 5 µg of plasmids (sh1/sh2/sh3 VprBP [Table 6], K194R VprBP, WT
VprBP), 2 mg/mL PEI transfection reagents 3 times the DNA plasmid concentration in 1 mL
DMEM w/out FBS + antibiotics, was slowly added to cells drop-by-drop. After incubation at
37°C in a CO2 incubator for 24 hours, the media was interchanged with fresh media. After 48
hours of additional incubation, the harvested media containing virus was filtered using a 33 mm
diameter gamma sterilized Millex-HP Syringe Filter Unit with 45 µm pore size hydrophilic
Polyethersulfone (PES) membrane (Millipore Sigma).

Generation of Stable Cell Lines Depleted of VprBP
DU145, U2OS, and HT1376 cells were seeded and cultured overnight in 6-well plates (3.0 x 10
5

cells/well). Cells were infected with 750 µL lentivirus expressing short hairpin RNAs (shRNAs)
+ 750 µL media + 5 µl Polybrene and incubated for 24 hours. Selection was done for one-two
H1299
Control
2 µg WT
VprBP
2 µg K194R
VprBP

HT1376
Control
2 µg WT
VprBP
2 µg K194R
VprBP

shRNA Sequence
sh1 VprBP 5’ AATCACAGAGTATCTTAGA 3’
sh2 VprBP 5’ TGCAATTGGAAGACCTATTAT 3’
sh3 VprBP 5’ GCTGAGAATACTCTTCAAGAA 3’
Table 5: Plasmid concentrations used for transient transfection.

Table 6: Oligonucleotide sequences encoding
shRNAs for VprBP knockdown.

17
weeks with puromycin with the following concentrations provided in 2 mL supplemented
DMEM: 1.5 µg/mL (U2OS), 1.5 µg/mL (HT1376) and 1 µg/mL (DU145). Cells were sub-
cultured to medium plates, grown to 80-90% confluency and harvested. Equal amounts of
protein per condition were run on 7.5% SDS-PAGE gel. After transfer, the nitrocellulose
membrane was subjected to anti-VprBP rabbit polyclonal antibody (Proteintech), anti-p53 mouse
monoclonal IgG antibody (Santa Cruz Biotechnology), and anti-B-actin mouse monoclonal
antibody (Proteintech) at a dilution of 1:2000 to confirm under-expression of VprBP.

Total RNA to cDNA Synthesis for Quantitative Real-Time PCR (qRT-PCR)
Total RNA was isolated from all cell lines using the RNeasy Plus Mini Kit (Qiagen) and 2 µg of
RNA was reverse-transcribed into single-stranded cDNA using the RevertAid H-minus First
Strand cDNA Synthesis Kit (Thermo Scientific) according to the manufacturers’ instructions.
The PCR reaction mix consisted of 2 µL of 1:10 diluted cDNA, 0.4 µL of 2.5 µmol/L forward
and reverse primers [Table 7], 9.2 µL H2O and 8 µL SYBR Green Master Mix (Bio-Rad) for a
total volume of 20 µL. qRT-PCR was performed using IQ5 real-time cycler (Bio-Rad) with
following thermocycling conditions: 2 minutes initial denaturation at 98°C, followed by 45
cycles of 98°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for
30 seconds. All reactions were run in triplicates, and the averages of three individual experiments
are represented in the data.

Primer Sequence
VprBP F 5’ TGAGGGTGGCATTCTTGTCC 3’
VprBP R 5’ TCCCAATATAGCTGCGCTGG 3’
p53 F 5’ TGAAGCTCCCAGAATGCCAG3’
p53 R 5’ GCTGCCCTGGTAGGTTTTCT3’
p21 F 5’ ATGGAACTTCGACTTTGTCAC 3’
p21 R 5’ AGGCACAAGGGTACAAGACAGT 3’
B-actin F 5’ GCAGGAGTATGACGAGTCCG 3’
B-actin R 5’ GCCTAGAAGCATTTGCGGTG 3’
Cell Proliferation Colorimetric Assay
DU145, U2OS, and HT1376 control and sh1-VprBP depleted cells were seeded and cultured
overnight in 24-well plates (1.0 x 10
4
cells/well). Cell proliferation was measured by a
Table 7: Sequences of forward and reverse primers used to perform qRT-PCR

18
colorimetric assay for six consecutive days at 460 nm. Cells were incubated at 37°C in 15 µL
Cell Proliferation Reagent WST-1 (Sigma-Aldrich) + 300 µL DMEM media supplemented with
10% fetal bovine serum (FBS) and Penicillin/Streptomycin one hour before each triplicate
reading.

Generation of Stable Cell Lines Overexpressing WT or K194R VprBP
DU145, U2OS, and HT1376 cells were seeded and cultured overnight in 6-well plates (3.0 x 10
5

cells/well). Cells were infected with 1.5 µL virus + 5 µL polybrene and incubated for 24 hours.
Selection was done for one-two weeks with hygromycin with following concentrations
provided in 2 mL supplemented DMEM media: 75 µg/mL (U2OS), 200 µg/mL (HT1376), and
300 µg/mL (DU145). Cells were sub-cultured to medium plates, grown to 80-90% confluency,
and harvested. Equal amounts of protein per condition were run on 7.5% SDS-PAGE gel. After
transfer, the nitrocellulose membrane was subjected to anti-FLAG mouse monoclonal antibody
(Sigma-Aldrich), anti-p53 mouse monoclonal IgG antibody (Santa Cruz Biotechnology), and
anti-B-actin mouse monoclonal antibody (Proteintech) at a dilution of 1:2000 to confirm over-
expression of WT/K194R VprBP.

Treating Stable Cell Lines with Etoposide
U2OS and HT1376 cells line expressing WT or K194R VprBP were seeded and cultured
overnight in 10-cm tissue culture plates (2.0 x 10
6
cells/well) – two plates per condition for
treated and untreated experimental conditions. Old media was replaced with 9 mL fresh DMEM
media supplemented with 10% fetal bovine serum (FBS) and Penicillin/Streptomycin after 12-
hour incubation. U2OS and HT1376 cells were treated with 50 µM and 450 µM etoposide,
respectively. All plates were incubated at 37°C for 24 hours before cells were collected for
subsequent western blot and qRT-PCR analyses.

19
1.3 RESULTS
To determine whether the expression of tumor suppressor p53 is regulated by VprBP-
mediated phosphorylation ex-vivo, DU145, HT1376 and H1299 human cancer cell lines were
transiently transfected with either WT VprBP or kinase-dead VprBP (K194R VprBP) at varying
concentrations [Table 4A-D]. H1299 cells (null-p53) were additionally transfected with WT p53
[Table 4D]. Subsequent Western blot analyses revealed that as the transient expression of WT
VprBP increases, endogenous and exogenous p53 levels inversely decrease in HT1376 and
H1299 cells, respectively. However, the levels of p53 do not change when either of the two
cancer cell types express any amount of K194R VprBP [Figures 5A and 5B]. Our attempts to
study the VprBP-p53 kinase-to-substrate relationship in DU145 cells were inconclusive as the
transiently transfected cells would die within 24 hours despite DNA concentration optimization
[Table 4A and 4B]. It may be that the foreign plasmids were too toxic for the DU145 cells to
take in, and therefore they did not remain viable. In spite of this negative data, we were able to
establish an inverse relationship between VprBP and p53 that was further elucidated by
immunofluorescence staining of HT1376 cells transiently expressing WT or K194R VprBP
[Figure 6]. Consistent with our Western blot findings, immunofluorescence data depicted that
cells, when expressing WT VprBP but not kinase-dead VprBP, have reduced levels of p53
[Figures 6G-I]. However, when the cancer cells transcribed K194R VprBP, no change in the
levels of p53 is exhibited. Given that the levels of p53 remain unchanged in the presence of
kinase-dead VprBP implies that mutated VprBP is not phosphorylating p53. These findings
indicate WT VprBP has kinase activity for p53 that is abolished when Lysine 194 on VprBP is
mutated to Arginine.
Provided that VprBP has kinase activity for p53, data acquired through mass
spectrometry of in-vitro studies suggests WT VprBP phosphorylates p53 at Serine 367 (data not
shown). We therefore explored the effects on the levels of p53 in cancer cells by introducing a
single-point mutation on p53 at the VprBP phosphorylation site identified. We transfected
H1299 cells with Serine 367 to Alanine mutated p53 (S367A p53) that were simultaneously
expressing WT VprBP or K194R VprBP [Table 4E]. Western blot analysis revealed that when
cells expressed S367A p53, the levels of p53 did not change, irrespective of whether the cells
were transcribing WT VprBP or K194R VprBP [Figure 5C]. This finding not only validated the
mass spectrometry results that define Serine 367 of p53 to be the site of VprBP-mediated
20
phosphorylation, but further delineated a direct kinase-substrate relationship between VprBP and
tumor suppressor p53.
Although the results obtained from the ex-vivo experiments imply that mutation at Lysine
194 abrogates the kinase activity of VprBP, we reasoned that another possible mechanism for the
lack of p53 phosphorylation may be due to the translocation of VprBP to another compartment
of the cell, induced by the mutation. That is, given that WT VprBP has been defined as a nuclear
protein, K194R VprBP may be unable to phosphorylate p53 due to it being translocated to the
cytoplasm for degradation [12]. To test this, we localized K194R VprBP through
immunofluorescence staining experiments performed on H1299 cancer cells that transiently
express WT or K194R VprBP. Results revealed that VprBP remains inside the nucleus even
when mutated at Lysine 194 and does not relocate to the cytoplasm for degradation [Figure 7H-
I]. This evidence confirms that K194R VprBP remains in the vicinity of p53 but is unable to
phosphorylate it.
Given that transactivation, or the stimulation of gene transcription, can be triggered
through biological or artificial expression of an intermediate protein, we wanted to clarify
whether S367A p53 affects the transactivation of p53 target genes. To assess this, H1299 cells
were transiently transfected with WT p53 or S367A p53, and the relative expression of one of
p53 target genes, p21, was quantified through qRT-PCR [Table 4E, Figure 8]. Results showed
that although p21 gene expression is definitely transactivated by both WT and S367A p53, the
fold-change between the relative expression of p21 is not significant, regardless of whether cells
express functional or mutated p53. Thus, it is conceivable from these observations that there is
no change in the transactivation of p21 when p53 is mutated at Serine 367.
To further elucidate the VprBP-p53 kinase-to-substrate relationship, we generated stable
DU145 (mutant p53), U2OS (wild-type p53) and HT1376 (mutant p53) cancer cell lines depleted
of VprBP or overexpressing WT/K194R VprBP. Before proceeding, it is worth noting that
VprBP protein and mRNA expression data do not correlate for some of the cell lines [Figures 9,
10, and 11]. This may be because the tissue origin of the cell lines vary: DU145, U2OS, and
HT1376 cells are derived from metastatic brain, primary bone and primary urinary bladder
cancers, respectively. Therefore, some shRNA may be knocking down a different gene than
anticipated due to nonspecific targets. However, because post-transcriptional modifications, such
21
as phosphorylation by kinases, occur at the protein level, we emphasize the findings obtained in
the Western blot analyses over qRT-PCR data.
As anticipated, p53 levels increase as VprBP is depleted, but only in DU145 cells. In case
of U2OS and HT1376 cells, p53 levels decrease and remain unchanged, respectively [Figures 9,
10, and 11]. Although p53 levels decrease in U2OS cells when WT VprBP is overexpressed,
slight changes in p53 levels are detected in DU145 and HT1376 cells. As expected, p53 levels
also remain unchanged in DU145 and HT1376 cells when kinase-dead VprBP is overexpressed
[Figure 12]. This is consistent with the results observed when kinase-dead VprBP and
WT/S367A p53 are transiently expressed in HT1376 and H1299 cells [Figure 5]. However, p53
levels decrease as kinase-dead VprBP is overexpressed in U2OS cells [Figure 12]. These
findings are at odds with the nature of the relationship established between VprBP and p53 in the
transiently transfected cells expressing WT/K194R VprBP or WT/S367A p53.
Since the results in our stable cell line experiments showed inconsistency, we studied the
behavior of stably overexpressed WT and kinase-dead VprBP towards p53 under etoposide-
induced DNA-damaged conditions in U2OS and HT1376 cancer cells [Figures 13 and 14].
Protein and total RNA from these cancer cells treated with and without etoposide were analyzed
through Western Blot and qRT-PCR, respectively. We observed that p53 levels significantly
changed in all etoposide-treated U2OS cells as compared to those not treated by etoposide in
both protein and mRNA expression [Figures 13]. Although a notable change was similarly
observed in the levels of p21 mRNA expression in etoposide-treated U2OS cells, the results were
only significant in cells transcribing kinase-dead VprBP [Figure 13B]. Our findings in HT1376
cell lines, however, differ from those observed in U2OS cells. As expected, when HT1376 cells
were treated or untreated with etoposide, no significant change in the levels of p53 was exhibited
between all conditions [Figures 14]. Results observed here are consistent with the Western blot
data of HT1376 cells transiently expressing WT and kinase-dead VprBP [Figure 5A]. Moreover,
even though p21 gene expression was observed to increase in all cells treated with etoposide, the
fold-difference was not significant in any of the conditions. Observing that VprBP regulation of
p53 and the subsequent effects on p21 expression differ in the two cancer cell lines, implies that
there may be variation in the biological factor within each cell type promoting different
outcomes.
22
To determine how cancer cell proliferation changes when cells are depleted of VprBP, we
performed a colorimetric cell proliferation assay. We first investigated the knockdown efficiency
of VprBP in the cancer cells by lentiviral transduction of three shRNA constructs. As is evident
by Western blot and qRT-PCR analyses, sh1 RNA, in comparison with sh2 and sh3 RNAs,
repeatedly demonstrated to be the most effective construct at depleting VprBP in all cell types
[Figures 9, 10, 11]. Therefore, for our investigation, we decided to use cell lines depleted of
VprBP with sh1 RNA to determine how cancer cell proliferation is affected. We observed that
the loss of VprBP resulted in decreased growth rates of all cancer cell types [Figure 15]. This
observation in cell viability after VprBP knockdown further confirms that VprBP is needed for
oncogenic growth of cancer cells regardless of p53 status.

23
Western Blot Analyses of Transiently Transfected Cell Lines

FIGURE 5. WT VprBP, but not K194R VprBP, has kinase activity for p53 at S367. Protein expressions
were evaluated by Western blot with anti-p53 and anti-HA-tag antibodies for HT1376 and H1299 cancer cell
lines. Changes in WT and S367A p53 levels were assessed in relation to the varying concentrations of WT and
K194R VprBP.
5A
5B
5C
24
Immunofluorescence Staining Analysis of HT1376 Cancer Cells

FIGURE 6. Level of p53 Decreases in Presence of WT VprBP but remains unchanged when VprBP
is mutated at K194. Transiently transfected WT and K194R VprBP as well as p53 expressions were
detected in HT1376 cells through immunofluorescence staining using anti-FLAG and anti-p53 antibodies.
The nuclei were stained with DAPI [blue] (A-C), VprBP with FIT-C [green] (D-F) and p53 with DSred
[red] (G-I).

25
Immunofluorescence Staining Analysis of H1299 Cancer Cells

FIGURE 7. WT and K194R VprBP are Both Localized Inside the Nucleus. Transiently transfected
WT and K194R VprBP were detected in H1299 cells through immunofluorescence staining using anti-
FLAG antibody. The nuclei were stained with DAPI [blue] (A-C) and VprBP with FIT-C [green] (D-F).
Presence of green staining for FLAG-VprBP in control, but not in experimental conditions, demonstrates
successful transfection (D-F).

26
qRT-PCR Analysis of p21 Gene Expression in H1299 Cells

FIGURE 8. Mutation in p53 does not affect the expression of target gene p21. Relative
expression of p21 gene is quantified with qRT-PCR after WT and S367A p53 were transiently
transfected into H1299 cells.

27
Western Blot and qRT-PCR Analyses of DU145 Depleted of VprBP

9A
9B
FIGURE 9. DU145 Stable Cell Line depleted of VprBP is Generated Using Lentiviral shRNA
Vectors. DU145 cells were infected with lentiviruses expressing sh1, sh2 or sh3 RNAs to deplete VprBP.
Lentivirus expressing sh1 RNA reduced VprBP most effectively. Success of VprBP depletion was
evaluated by Western blot analysis with anti-VprBP antibody (A). VprBP and p53 expression were
quantified by qRT-PCR of total RNA. Expression levels were normalized to ß-actin and were arbitrarily
assigned a value of 1 (B).

28
Western Blot and qRT-PCR Analyses of U2OS Depleted of VprBP

10A
10B
FIGURE 10. U2OS Stable Cell Line depleted of VprBP is Generated Using Lentiviral shRNA
Vectors. U2OS cells were infected with lentiviruses expressing sh1, sh2 or sh3 RNAs to deplete
VprBP. Lentivirus expressing sh1 RNA reduced VprBP most effectively. Success of VprBP depletion
was evaluated by Western blot analysis with anti-VprBP antibody (A). VprBP and p53 expression were
quantified by qRT-PCR of total RNA. Expression levels were normalized to ß-actin and were
arbitrarily assigned a value of 1 (B).

29
Western Blot and qRT-PCR Analyses of HT1376 Depleted of VprBP

11A
11B
FIGURE 11. HT1376 Stable Cell Line depleted of VprBP is Generated Using Lentiviral shRNA
Vectors. HT1376 cells were infected with lentiviruses expressing sh1, sh2 or sh3 RNAs to deplete
VprBP. Lentivirus expressing sh1 RNA reduced VprBP most effectively. Success of VprBP depletion
was evaluated by Western blot analysis with anti-VprBP antibody (A). VprBP and p53 expression
were quantified by qRT-PCR of total RNA. Expression levels were normalized to ß-actin and were
arbitrarily assigned a value of 1 (B).
30
Western Blot Analysis of Stable Cell Lines Expressing WT or K194R VprBP

FIGURE 12. Stable Cancer Cell Lines Overexpressing WT and K194R VprBP Reflects an
Apparent Discrepancy in the VprBP-p53 Relationship. DU145, U2OS, and HT1376 cell
lines were infected with lentiviruses expressing WT or K194R VprBP. Success of WT and
K194R VprBP expression were evaluated by Western blot analysis with anti-FLAG antibody.
Lack of FLAG-VprBP bands in controls, but not experimental conditions, verify successful
protein expression.

31
Western Blot and qRT-PCR Analyses of Etoposide Treated U2OS Stable Cell Lines

FIGURE 13B. VprBP Kinase Activity Regulates p53 and Indirectly Effects p21 Expression in U2OS
Cells. RNA was isolated for qRT-PCR of VprBP, p53 and p21 genes. Expression levels were normalized to
ß-actin and were arbitrarily assigned a value of 1.

13A
13B
FIGURE 13A. Etoposide-treated U2OS Cells Increase Levels of
p53. Protein expressions of untreated and etoposide-treated U2OS
cells were evaluated by Western blot using anti-FLAG and anti-p53
antibodies.

32
Western Blot and qRT-PCR Analyses of Etoposide Treated HT1376 Stable Cell Lines

FIGURE 14B. VprBP Regulates p53 in HT1376 Cells but has no Effect on p21 Expression. Total RNA
was isolated for qRT-PCR of VprBP, p53 and p21 genes. Expression levels were normalized to ß-actin and
were arbitrarily assigned a value of 1.
14A
14B
FIGURE 14A. WT VprBP has Negative Effect on p53 Expression
Upon Etoposide Treatment. Protein expressions of untreated and
etoposide-treated HT1376 cells were evaluated by Western blot using
anti-FLAG and anti-p53 antibodies.
33
Cell Proliferation Assessment of Stable Cell Lines Depleted of VprBP

FIGURE 15. VprBP-depleted Cancer Cells Exhibit Slow Growth as Compared to Control Cells. Cell
proliferation assays were performed on DU145, U2OS, and HT1376 control shNS (scrambled targeting
sequence) and sh1-VprBP knockdown cell lines. Cell growth was observed over a period of 6 days through
daily absorbance (460 nm) readings.
34
1.4 DISCUSSION
Through this work, we demonstrate that there exists an inverse kinase-to-substrate
relationship between VprBP and p53 in multiple cancer types. We demonstrate through ex-vivo
studies that WT VprBP, but not Lysine 194-mutated VprBP, can mis-regulate the expression and
function of p53 through site-directed phosphorylation. This finding coincides with our previous
studies that have established VprBP as a negative regulator of tumor suppressor genes through its
intrinsic kinase activity toward Threonine 120 of histone H2A [13]. In our case, however, we
were able to show that VprBP directly mis-regulates tumor suppressor p53 by phosphorylating it
at Serine 367. Moreover, we found that by blocking VprBP-mediated phosphorylation site on
p53 through a single-point mutation, both WT VprBP and kinase-dead VprBP were unable to
affect the levels of p53. These results verify our mass spectrometry data, but also imply that
VprBP, regardless of whether it is in wild-type or K194-mutated conformation, is unable to
regulate the activity and function of S367-mutated p53. Altogether, these findings constitute a
powerful argument that VprBP is able to inactivate p53 through post-transcriptional modification
(PTM), further establishing the role of VprBP as an oncogene and rooting its function as a
negative regulator of tumor suppressor p53.
While discrepancy between the VprBP-p53 kinase to substrate relationship was initially
observed in cancer cell lines stably overexpressing WT VprBP and kinase-dead VprBP,
subsequent studies of cancer cells under etoposide-induced DNA damaged conditions provided a
better understanding of how WT/K194R VprBP has detectable effects on p53 activity. We were
able to establish that when cancer cells U2OS and HT1376 undergo extreme cellular stress,
VprBP regulates p53 by increasing its transcription. Intriguingly, we also observed that VprBP,
by transactivating p53, indirectly effects p21 expression, but only in U2OS cells. Although
VprBP regulates p53 in HT1376 cells, the expression of p21 remains unaffected. A likely reason
for the varying results from both cell lines may be due to the fact that HT1376 cells express
mutated p53 while U2OS cells express wild-type p53. Considering this fact in conjunction with
the results, we can infer that the expression of mutated p53 in HT1376 cells is still being
activated due to the increase of stress stimuli brought upon by DNA damage. In this regard, we
also speculate that because p53 is nonfunctional, it fails to transactivate its target genes. This is
in accordance with the data obtained from H1299 cells, where the expression of S367-mutated
p53 was unable to activate its target gene p21. Thus, regardless of its increased activation,
35
mutated p53 is unable to rectify cellular damage. Taken together, these results still uphold the
VprBP-p53 relationship, however the downstream effects on target gene activation vary
depending on p53 type.
Having elucidated that VprBP kinase mediates site-specific phosphorylation of p53, we
next try to understand the implications the kinase-to-substrate interaction may have in cancer and
towards drug development. Numerous oncology studies highlight that abnormal PTMs of p53
and cancer-derived p53 mutants have distinct functional effects, promoting tumorigenesis and
leading to the development of aggressive cancers [10, 14, 19]. When kinases are not tightly
regulated or are overexpressed, there is increased risk for development of cancer [20]. Our data
also demonstrates that oncogene VprBP knockdown and overexpression have direct effects on
VprBP catalytic activity, and thus cancer cell growth. Therefore, VprBP is an ideal drug target
for anticancer therapy development. Considering that mutation at Lysine 194 of VprBP renders
this protein kinase inactive, there is potential in developing a more precise and specific kinase
inhibitor for targeted drug development. Plausibly, development of an inhibitor against K194 on
VprBP may prevent it from dysregulating p53 and may mitigate the effects VprBP has towards
cancer development.

36
Chapter 2: Expressing and Purifying Segmented Kinase Domains of VprBP

2.1 INTRODUCTION

VprBP Kinase Domain (VPKD)
Protein kinases regulate most aspects of biological functions by modifying proteins
through phosphorylation, a process by which a kinase catalyzes the transfer of a phosphate from
ATP to its substrate. This can be reversed by phosphatases that function to remove phosphate
groups from proteins [14]. Abnormalities in
kinase activity can cause various diseases,
including cancer, largely due to the fact that
kinases are crucial for diverse intracellular
and extracellular signaling pathways [5, 20].
Structure determination of kinase domains
often allows for a better understanding of
how kinase proteins function inside cells,
what biomolecules they interact with and
which signaling pathways they influence.
By extension, structural analysis provides a
deeper insight on how protein kinases
contribute to disease and what implications
they can have in the field of drug discovery.
VprBP has been recognized as a bono fide histone kinase and has been reported to play a
pivotal role in the development and progression of multiple cancers [12, 13]. Unlike other
histone kinases, which lack the ability to phosphorylate nucleosomal histones, VprBP is
classified as an effective nucleosomal histone kinase due to its ability to phosphorylate histone
H2A on Threonine 120 (T120) [13]. More recent in-vitro and ex-vivo studies reveal VprBP to
also possesses intrinsic kinase activity for tumor suppressor p53 at Serine 367 (S367). While
VprBP has been established as a kinase for histone H2A and p53, VprBP-mediated
phosphorylation has been reported to be blocked when mutations exist at phosphorylation sites
of these substrates. The catalytic activity of VprBP has also been found to be completely
abolished when specific mutations are harbored within its kinase domain [13]. Essentially,
Figure 16: Sequence alignment of VprBP against
human kinases reveals putative kinase domain [13].
37
VprBP kinase-to-substrate activities provided here are known exhibit a direct effect on cancer
cell proliferation and tumorigenesis progression.
Although VprBP has been defined as an effective kinase protein, the three-dimensional
(3D) structure of the kinase domain has not yet been resolved. Through sequence alignment of
VprBP against common human kinases, CK1 and Mut9p, eight of 12 conserved protein kinase
subdomains have been identified in the N-terminal region of VprBP. By this revelation, the
putative full-length kinase domain of VprBP is between amino acids 141 – 500 (Figure 16).
Although much can be learned about protein characteristics through sequence homology
analysis, 3D structure determination through x-ray crystallography, cryogenic electron
microscopy (cryo-EM) or Nuclear Magnetic Resonance spectroscopy (NMR) often provides a
better understanding of protein folding patterns and function(s). Moreover, structural
determination allows for structure-based drug design of target proteins. Hence, a high-resolution
structure of the kinase domain of VprBP may offer a foundation for structure-guided efforts to
developing potent VprBP kinase inhibitors as anti-cancer agents.

Protein Expression Systems
In order to resolve proteins through x-ray crystallography or NMR structural studies, a
large quantity of purely functional protein is required. To acquire usable protein samples,
rigorous and robust protein purification protocols are necessary. Depending on the nature of the
protein and purpose of the study, proteins can be prepared in bacteria, yeast, or baculovirus
expression systems using insect or mammalian cells [22, 23]. Escherichia coli (E. coli) is a
commonly used host bacteria for expression and large-scale production of recombinant proteins,
however a shortcoming of this host system is that some recombinant proteins may form insoluble
inclusion bodies after expression due to misfolding [23]. Thus, the recovery yields of insoluble
proteins tend to be low in comparison to yields of soluble proteins [23].
Due to the challenges in isolating recombinant proteins in active and native forms
without producing aggregates, a commonly used strategy is to incorporate an exploitable
polypeptide epitope tag to one of the terminal-ends of the target protein through vector design.
Glutathione-S-transferase- (GST) and 6X Histidine residues (His) and are two common fusion
tags used to purify expressed proteins by use of ligands that have affinity for the epitope tags
[22]. These tags are also known to considerably increase solubility, promoting proper folding
38
and preventing aggregation [23]. Once purified, the individual proteins can be used for antibody
analysis, assays and structural studies.
Because the kinase activity of VprBP has been discovered to contribute towards
tumorigenesis progression, resolving the structure of VPKD by NMR is essential for the
conceptualization, design and development of novel, potentially more selective, VprBP
inhibitors. However, protein NMR has a restricted size limitation of about 20 kDa, and the
molecular size of the putative VPKD is 40 kDa, making VPKD elucidation by NMR almost
impossible. Therefore, in an attempt to address this challenge, we try to decipher at how many
amino acid truncations does VPKD lose its ability to phosphorylate H2A. Here, we report on
efforts taken to successfully isolate and purify fragmented segments of VPKD for subsequent
functional tests and downstream structural analysis.

39
2.2 MATERIALS AND METHODS
Designing DNA Inserts for Bacterial Protein Expression
Primers were designed for different truncations of putative VprBP kinase domain at varying
lengths for GST-tag and His-tag recombinant proteins. The truncated fragments of VprBP were
made between amino acids 141 – 440, 141 – 460, 141 – 480, 101 – 500 and 121 – 520. Insert for
the full-length VprBP kinase domain between amino acids 141 – 500 was already available.

Competent Cells and Bacterial Inoculant Media Conditions
E. coli DH5-a competent cells were used for cloning application and sequence confirmation. E.
coli BL21 and E. coli Rosetta 2(DE3) pLysS competent cells (Novagen) were used to express
recombinant proteins for downstream GST-tag and His-Tag protein purification. 1 mL of 1 M
Ampicillin per 1 L LB media was used to inoculate colonies expressed in DH5-a and BL21. 1
mL of 1 M Ampicillin and 1 mL of 1 M Chloramphenicol per 1 L LB media was used to
inoculate colonies expressed in Rosetta 2(DE3) pLysS cells.

Plasmid Cloning for GST-tag Protein
VprBP kinase domain truncated fragments (VPKD) were subcloned into mammalian expression
vector, pGEX-4T-1, between cut sites EcoR1 and Xho1 [Figure 17]. For PCR amplification,
the following thermocycling parameters were applied: 4 minutes initial denaturation at 95°C,
Primer Sequence
VPKD 141 Ecor1 F 5’ GCAGCAGAATTCCAACCATTGAGGACATATTC 3’
VPKD 440 Xho1 R 5’ GAATCACTCGAGATCAGACAGAACATTGTG 3’
VPKD 460 Xho1 R 5’ TAGGTCCTCGAGAGCATGGCAGCATCCTGA 3’
VPKD 480 Xho1 R 5’ GATGTCCTCGAGATAGCGGTCAAAGAGCTC 3’
VPKD 141 Nde1 F 5’GCAGCACATATGCAACCATTGAGGACATATTC 3’
VPKD 440 BahmH1 R 5’ GACGCAGGATCCATCAGACAGAACATTGTG 3’
VPKD 460 BahmH1 R 5’ TAGGTCGGATCCAGCATGGCAGCATCCTGA 3’
VPKD 480 BahmH1 R 5’ GATGACGGATCCATAGCGGTCAAAGAGCTC 3’
VPKD 101 NdeI F 5’ GCAGCACATATGTTAAACACTGCAGCTTGCA 3’
VPKD 500 BamHI R 5’ GTCGCAGGATCCATCTTCCAAATTTAGAATCTC 3’
VPKD 121 NdeI F 5’ GCAGCACATATGGTCTTTCAAGAAAAGGAGGGA 3’
VPKD 520 BamHI R 5’ GTCGCAGGATCCGGTATGTTTCCCAGTTTGG 3’
Table 5: Sequences of forward and reverse primers used to perform PCR with restriction
enzyme recognition sequences highlighted.

40
followed by 25 cycles of 95°C denaturation for 30 seconds, Tm minus 2°C annealing for 1
minute/kb, 72°C extension
for 5 minutes and 4°C infinite
hold. After confirming
recombinant plasmid through
Sanger sequencing, plasmid
DNA was purified and
transformed into B21 and
Rosetta cells. The
transformants were plated on
LB agar plates containing
relevant antibiotics and
incubated overnight at 37°C
for colony formation.

Expression and Batch Purification of GST-tag Fusion Protein
Native GST-tag Protein Purification Protocol
Single colonies from each plate were inoculated in 20 mL LB medium containing relevant
antibiotics and incubated overnight (~16 hours) in a 37°C incubator while shaking. The saturated
cultures were expanded in 1 L fresh LB medium + antibiotics for an additional 6 hours and the
proteins were induced with 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) during the
last 3 hours of growth. From here on forward, all steps were done at 4°C to prevent proteins from
degrading. The cells were harvested by centrifugation for 10 minutes at 4100 rpm and washed
once with 1X Tris-Buffered Saline (TBS) before being pelleted for 5 minutes at 7000 rpm. The
cell pellets were re-suspended in 50:50 1X TBS:B-PER Pierce Bacterial Protein Extraction
Reagent (Thermo Scientific) and incubated on ice for 30 minutes with intermittent vortexing.
The insoluble cell debris were pelleted for 30 minutes at 13000 rpm, after which, the
supernatants containing the proteins were loaded onto Glutathione Sephrose 4B (GE Healthcare
Life Sciences). The mixture was incubated with gentle agitation on a tube rotator for 30 minutes
to allow maximal binding of the GST-tagged proteins. Beads were pelleted and washed 10 times
with B-PER Pierce Bacterial Protein Extraction Reagent (Thermo Scientific), each for 1 minute
Figure 17: Plasmid map of pGEX-4T-1 showing GST-tag and Thrombin site.

41
at 3000 rpm, to remove non-specific proteins. 5-10 µL of 1 M Dithiothreitol (DTT) was added to
beads and samples were boiled for 30 minutes before gel loading. The proteins were resolved on
10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and ran on
vertical electrophoresis cell for 20 minutes at 300 V. Bands were visualized after a 20-minute
Coomassie Brilliant Blue R-250 (Amresco) and overnight destaining.

Partially Denatured GST-tag Protein Purification Protocol
STE Buffer Wash Buffer 10% Triton X-100 Elution Buffer (pH 8)
10 mM Tris-HCl
150 mM NaCl
1 mM EDTA
Cocktail of Protease Inhibitors

5% glycerol in STE Buffer 1 mL Triton X-100 in 9 mL STE Buffer

0.03 g 10 mM Reduced Glutathione
9.5 mL autoclaved H2O
500 µL 50 mM Tris-HCl
20 µL 1 M DTT
Cocktail of Protease Inhibitors
*Adjust volumes with autoclaved DI water after pH adjustments

Single colonies from each plate were inoculated in 20 mL LB medium containing relevant
antibiotics and incubated overnight (~16 hours) in a 37°C incubator while shaking. The saturated
cultures were expanded in 1 L fresh LB medium + antibiotics for an additional 6 hours and the
proteins were induced with 0.1 mM IPTG during the last 3 hours of growth. From here on
forward, all steps were done at 4°C to prevent proteins from degrading. The cells were pelleted
by centrifugation for 10 minutes at 4100 rpm and resuspended in STE Buffer followed by a 20-
minute ice incubation. DTT to final concentration of 5 µM and then Sarcosyl to final
concentration of 1.5% were added: mixture was vortexed for 5 seconds. Samples were sonicated
on/off ice until turbidity was reduced. The insoluble cell debris were pelleted for 30 minutes at
13000 rpm after which the supernatants containing the proteins were collected in fresh tubes and
10% Triton X-100 was added to a final concentration of 3%. After a 5-second vortex, the
mixture was loaded onto Glutathione Sephrose 4B (GE Healthcare Life Sciences) and incubated
with gentle agitation on a tube rotator for 1 hour to allow maximal binding of the GST-tagged
proteins. Beads were pelleted and washed 6 times with 10 mL Wash Buffer + 100 µL 10%
Triton X-100, each for 1 minute at 1500 rpm, to remove non-specific proteins. Proteins were
eluted from beads with addition of elution buffer and gentle agitation on a tube rotator for 15
minutes at room temperature before centrifugation for 2 minutes at 3000 rpm per eluate. A small
volume of each eluate was prepared in 3X Laemmli Sample Buffer (Bio-Rad) with DTT. The
proteins were resolved on 7.5% SDS-PAGE and ran on vertical electrophoresis cell for 20
42
minutes at 300 V. Bands were visualized after a 20-minute Coomassie Brilliant Blue R-250
(Amresco) and overnight destaining.

Plasmid Cloning for His-tag Protein
VprBP kinase domain truncations (VPKD) were subcloned into mammalian expression vector,
pET-15b, between cut sites Nde1 and BamH1 [Figure 18]. For PCR amplification, the
following thermocycling parameters were
applied: 4-minute initial denaturation at
95°C, followed by 34 cycles of 95°C
denaturation for 30 seconds, Tm minus 2°C
annealing for 1 minute/kb, 72°C extension
for 1 minute and 4°C infinite hold. After
confirming recombinant plasmid through
Sanger sequencing, plasmid DNA was
purified and transformed into B21 and
Rosetta cells. The transformants were
plated on LB agar plates containing
relevant antibiotics and incubated
overnight at 37°C for colony formation.

Expression and Batch Purification of His-tag Fusion Protein
Native His-Tag Protein Purification Protocol
Single colonies from each plate were inoculated in 20 mL LB medium containing relevant
antibiotics and incubated overnight (~16 hours) in a 37°C incubator while shaking. The saturated
cultures were expanded in 1 L fresh LB medium + antibiotics for an additional 6 hours and the
proteins were induced with 0.1 mM IPTG during the last 3 hours of growth. From here on
forward, all steps were done at 4°C to prevent proteins from degrading. The cells were harvested
by centrifugation for 10 minutes at 4100 rpm and washed once with 1X TBS before being
pelleted for 5 minutes at 7000 rpm. The cell pellets were re-suspended in 50:50 1X TBS:B-PER
Pierce Bacterial Protein Extraction Reagent (Thermo Scientific) and incubated on ice for 30
minutes with intermittent vortexing. The insoluble cell debris were pelleted for 30 minutes at
Figure 18: Plasmid map of pET-15b showing His-tag.

43
13000 rpm after which the supernatants containing the proteins were loaded onto HisPur Ni-
NTA Resin (Thermo Scientific). The mixture was incubated with gentle agitation on a tube
rotator for 30 minutes to allow maximal binding of the His-tagged proteins. Beads were pelleted
and washed 10 times with 1X TBS + B-PER Pierce Bacterial Protein Extraction Reagent
(Thermo Scientific), each for 1 minute at 3000 rpm, to remove non-specific proteins. 5-10 µL of
1 M DTT was added to beads and samples were boiled for 30 minutes before gel loading. The
proteins were resolved on 10% SDS-PAGE and ran on vertical electrophoresis cell for 20
minutes at 300 V. Bands were visualized after a 20-minute Coomassie Brilliant Blue R-250
(Amresco) and overnight destaining.

Partially Denatured His-tag Protein Purification Protocol with Sarcosyl
STE Buffer (pH 8) 10% Sarkosyl 10% Triton X-100 Elution Buffer (pH 8)
50 mM Tris-HCl
150 mM NaCl
100 mM EDTA
Cocktail of Protease Inhibitors

1 gm Sarkosyl dissolved
in 10 mL STE Buffer
1 mL Triton X-100 in 9 mL
STE Buffer

50 mM Tris-HCl
150 mM NaCl
300 mM Imidazole
Cocktail of Protease Inhibitors
*Adjust volumes with autoclaved DI water after pH adjustments

Single colonies from each plate were inoculated in 20 mL LB medium containing relevant
antibiotics and incubated overnight (~16 hours) in a 37°C incubator while shaking. The saturated
cultures were expanded in 1 L fresh LB medium + antibiotics for an additional 6 hours and the
proteins were induced with 0.1 mM IPTG during the last 3 hours of growth. From here on
forward, all steps were done at 4°C to prevent proteins from degrading. The cells were pelleted
by centrifugation for 10 minutes at 4100 rpm and resuspended in STE Buffer followed by a 20-
minute ice incubation. DTT to final concentration of 5 µM and then Sarcosyl to final
concentration of 1.5% were added: mixture was vortexed for 5 seconds. Samples were sonicated
on/off ice until turbidity was reduced. The insoluble cell debris were pelleted for 30 minutes at
13000 rpm after which the supernatants containing the proteins were collected in fresh tubes and
10% Triton X-100 to final concentration of 3% was added. After a 5-second vortex, the mixture
was loaded onto HisPur Ni-NTA Resin (Thermo Scientific) and incubated with gentle agitation
on a tube rotator for 1 hour to allow maximal binding of the His-tagged proteins. Beads were
pelleted and washed 6 times with 10 mL Wash Buffer + 100 µL 10% Triton X-100, each for 1
minute at 1500 rpm, to remove non-specific proteins. Proteins were eluted from beads with
44
addition of elution buffer and gentle agitation on a tube rotator for 15 minutes at room
temperature before centrifugation for 2 minutes at 4°C and 3000 rpm per eluate. A small volume
of each eluate was prepared in 3X Laemmli Sample Buffer (Bio-Rad) with DTT. The proteins
were resolved on 7.5% SDS-PAGE and ran on vertical electrophoresis cell for 20 minutes at 300
V. Bands were visualized after a 20-minute Coomassie Brilliant Blue R-250 (Amresco) staining
and overnight destaining.

Denatured His-tag Protein Purification Protocol with Imidazole
Lysis Buffer (pH 8) Wash Buffer (pH 8) Elution Buffer (pH 8)
100 mM NaH2PO4
10 mM Tris
6 M Guanidine HCl
10 mM Imidazole
Cocktail of Protease Inhibitors
50 mM NaH2PO4
300 mM NaCl
20 mM Imidazole
8 M Urea
Cocktail of Protease Inhibitors

50 mM NaH2PO4
300 mM NaCl
300 mM Imidazole
8 M Urea

*Adjust volumes with autoclaved DI water after pH adjustments

Single colonies from each plate were inoculated in 20 mL LB medium containing relevant
antibiotics and incubated overnight (~16 hours) in a 37°C incubator while shaking. The saturated
cultures were expanded in 1 L fresh LB medium + antibiotics for an additional 6 hours and the
proteins were induced with 0.1 mM IPTG during the last 3 hours of growth. From here on
forward, all steps were done at 4°C to prevent proteins from degrading. The cells were pelleted
by centrifugation for 10 minutes at 4100 rpm and resuspended in Lysis Buffer followed by a 20-
minute ice incubation with intermittent inverting. The insoluble cell debris were pelleted for 15
minutes at 13000 rpm, after which the supernatants containing the proteins were loaded onto
HisPur Ni-NTA Resin (Thermo Scientific) and incubated with gentle agitation on a tube rotator
for 2 hours to allow maximal binding of the His-tagged proteins. Beads were pelleted and
washed 6 times with Wash Buffer + 100 µL 10% Triton X-100, each for 1 minute at 1500 rpm,
to remove non-specific proteins. Proteins were eluted from beads with addition of elution buffer
and gentle agitation on a tube rotator for 15 minutes before centrifugation for 2 minutes at 3000
rpm per elute. A small volume of each elute was prepared in 3X Laemmli Sample Buffer (Bio-
Rad) with DTT. The proteins were resolved on 7.5% SDS-PAGE and ran on vertical
electrophoresis cell for 20 minutes at 300 V. Bands were visualized after a 20-minute Coomassie
Brilliant Blue R-250 (Amresco) staining and overnight destaining.

45
Dialyzing and Concentrating Proteins
Dialysis Buffer for Denatured Protein Dialysis Buffer for Partially Denatured Proteins
50 mM NaH2PO4, pH 8
150 mM NaCl
100 µL β-Mercaptoethanol
Cocktail of Protease Inhibitors

50 mM Tris, pH 8
150 mM NaCl
2 mM DTT
Cocktail of Protease Inhibitors

*Adjust volumes to 1 L with autoclaved DI water

Protein samples were loaded into Spectra/Por 2 Dialysis Membrane 12000 to 14000 Dalton
MWCO (Spectrum Laboratories) and dialyzed overnight in 1 L of appropriate dialysis buffer at
4°C with a rotating magnet. The dialyzed protein fractions were concentrated with Amicon Utra
Centrifugal Filters (Millipore Sigma) according to the manufacturer’s instructions.

In-Vitro Kinase Assay
Kinase Assay Buffer (pH 7.5)
50 mM Tris-HCl
20 mM EGTA
10 mM MgCl2
1 mM DTT
1 mM B-glycerophosphate

*Adjust volume with autoclaved DI water after pH adjustment

In-Vitro kinase reaction was prepared in a final volume of 20 µL that consisted of 1 µg of
VprBP protein, 1 µg H2A Substrate, 10 mM ATP and kinase buffer, and incubated for 1 hour at
30°C. After addition of 10 µL 4x Laemmli Sample Buffer (Bio-Rad), the mixture was run on
12% SDS-PAGE gel at 220 V for 45 minutes followed by electrophoretic transfer onto
nitrocellulose membrane for 40 minutes at 45 V. The membranes were blocked in 3% BSA for 1
hour at room temperature. The blots were then incubated for 2 hour with anti-H2AT120ph rabbit
polyclonal antibody (Active Motif) prepared at a dilution factor of 1:2000 followed by three 5-
minute washes with PBS-T. Alexa Fluor 680 goat anti-rabbit IgG (H+L) secondary antibody
(Invitrogen) was added and left to shake for 1 hour at room temperature. The membranes were
given two 5-minute washes with 1X PBS-T and one 5-minute wash with 1X PBS. Odyssey
Infrared Imaging System (LI-COR Biosciences) was used for imaging.

46
2.3 RESULTS AND DISCUSSION
The initial goal of this project was to determine how many amino acids could be
truncated from the C-terminal end of known VprBP kinase domain (VPKD) without losing
VprBP’s ability to phosphorylate histone H2A at T120 (H2AT120p). Once the minimum length
of VPKD showing the full enzymatic activity were to be identified, the goal for our next project
phase was to determine the structure of active VPKD by NMR spectroscopy through the
preparation of recombinant VPKD using bacterial expression systems. However, we encountered
significant challenges in expressing VPKD using E. coli as the expression host, mainly due to the
high molecular weight of VPKD (~40 kDa). Here, we show multiple approaches addressing
those challenges. We delineate protocols for the expression and purification of GST-tag and His-
tag fused VPKD proteins using 2 strains of E. coli [BL21 and Rosetta 2(DE3) pLysS] in native,
partially denatured, and denatured forms [Figures 19 and 21]. In essence, our discussion includes
the advantages and disadvantages of each protocol, and some optimization steps taken to get the
largest recovery of highly purified VPKD proteins.
Our first few attempts at purifying native and partially denatured GST-tag VPKD
generated unsatisfying results. Utilizing the native protein purification protocol consistently gave
poor recovery in the elutes for all VPKD proteins we tried to prepare. Although we got a
reasonable yield of GST and VPKD 141 – 440 proteins using the partially denatured purification
protocol, VPKD 141 – 460 and VPKD 141 – 480 proteins would either continue to remain bound
to the beads or precipitate on the beads before the elution step [Figure 20]. The latter occurrence
is highly likely due to the formation of insoluble protein aggregates (non-crystalline structures in
form of inclusion bodies), which are known to be produced in bacteria [23]. To address this
limitation, we attempted to optimize several steps in the protocol that would allow the proteins to
remain unbound from the beads and also not precipitate. We tried to cleave the protein off from
the beads through use of Thrombin and used higher concentrations of reduced glutathione
ranging from 0.03 g to 0.09 g with longer elution times. We also tried to elute proteins at
different salt concentrations and with more basic elution buffers. Despite all these attempts, the
target proteins continued to aggregate and form inclusion bodies while remaining bound to the
beads.
Since GST-tag purification methods continued to generate the problem of inclusion
bodies, we opted for protocols used in the preparation of His-tag fusion proteins. To purify
47
VPKD protein under native conditions, we initially tried the protocol similar to that used for the
purification of GST-tagged proteins. However, just as previously observed with GST-tagged
proteins, we obtained a poor yield for His-tagged proteins. Therefore, we attempted to prepare
VPKD proteins under denaturing conditions. Because urea, as a strong denaturant, allows for
extraction of inclusion body proteins from pellets, we used it to solubilize our proteins [23].
Remarkably, we were able to successfully elute VPKD proteins, but with the caveat that the urea
from eluted proteins needed to be removed through dialysis for the subsequent in-vitro kinase
and functional experiments. Dialysis of the denatured proteins failed to refold the proteins to
their native states, and as a result of misfolding, precipitated into inclusion bodies. This
occurrence may possibly be due to the fact that the recombinant protein would start
insolubilizing due to misfolding while urea was being removed during the dialysis process [22].
The small fraction of VPKD proteins that would get dialyzed without precipitation would get lost
when attempted to be concentrated.
Notably, it wasn’t until we tried a His-tag partially denatured protocol that we were able
to successfully purify various fragments of the kinase domain [Figure 22]. Not only were we able
to purify the proteins, but we also could concentrate them for a kinase functional test.
Unexpectedly, however, we were unable to detect kinase activity using any of the truncated
versions of VPKD proteins in our in-vitro assays with H2A substrates. Activity with the full-
length VprBP was only detected in our control reactions [Figure 23]. Although not yet proven,
one possible explanation for these negative results is that VPKD proteins are not folding back to
their native forms during the dialysis-based denaturation process. If such were the case, the
kinase activity of VprBP protein would be lost due to misfolding. Moreover, it is also possible
that the kinase domain of VprBP requires some other domain to fold into native/active
conformation as well as to recognize histone H2A substrates for efficient phosphorylation. Thus,
for future work, it may be worth the effort to explore the latter concept to determine whether
VPKD has an internally interacting domain assisting it in performing kinase activity.

48
GST-tag VPKD Batch Protein Purification Methods

FIGURE 19 GST-tag Protein Purification Flow Chart. Schematic diagram of the two methods used to
express and purify native and partially denatured GST-tagged VPKD proteins.

49
GST-tag Protein SDS-PAGE Analysis

20A
20B
FIGURE 20. Protein Gels showing Successful Purification of GST and VPKD 141 – 440. GST
control at ~26 kDa (A) and VPKD 141 – 440 at ~66 kDa (B) show successful protein elution using
the partially denatured protein purification protocol. A large amount protein still remains bound to
beads for VPKD 141 – 440 (B). VPKD 141 – 460 and 141 – 480 gave blank gels and are not shown.

50
His-tag VPKD Batch Protein Purification Methods

FIGURE 21. His-tag Protein Purification Flow Chart. Schematic diagram of the three methods
used to express and purify native, partially denatured, and denatured His-tagged VPKD proteins.

51
His-tag Protein SDS-PAGE Analysis

FIGURE 22. Protein Gels Showing Successful Purification of Partially Denatured HIS-Tag
VPKD Proteins. All fragmented segments of VPKD [141 – 480, 141 – 460, 141 – 440 (shown) and
141 – 500, 101 – 500, and 121 – 520 (not shown)] gave high protein yield with the partially
denatured protein purification protocol.

52
In-Vitro Kinase Assay and Western Blot Analyses

FIGURE 23. Kinase Activity is Observed in Presence of Full-length VprBP but not Full-
length VPKD or Fragments Segments of VPKD Proteins. In-Vitro kinase assay results in
no kinase activity for histone H2A by the putative versions of VPKD proteins.

53
BIBLIOGRAPHY
1. Abbas, Tarek, and Anindya Dutta. “p21 in Cancer: Intricate Networks and Multiple Activities.” Nature
Reviews. Cancer vol. 9, no. 6 (2009): 400-14. doi:10.1038/nrc2657

2. Belzile, Jean-Philippe, et al. “HIV-1 Vpr-Mediated G2 Arrest Involves the DDB1-CUL4A
VPRBP
E3
Ubiquitin Ligase.” PLoS Pathogens, vol. 3, no. 7 (2007). doi:10.1371/journal.ppat.0030085

3. Bieging, Kathryn T, and Laura D Attardi. “Deconstructing p53 Transcriptional Networks in Tumor
Suppression.” Trends in Cell Biology, vol. 22, no. 2 (2011): 97-106. doi:10.1016/j.tcb.2011.10.006

4. Brady, C. A., and L. D. Attardi. “p53 At a Glance.” Journal of Cell Science, vol. 123, no. 15 (2010): 2527–
2532. doi:10.1242/jcs.064501

5. Cohen, Philip. “The Origin of Protein Phosphorylation.” Nature Cell Biology, vol. 4, no. 5 (2002):127-130.
doi:10.1038/ncb0502-e127

6. Georgakilas, Alexandros G., et al. “p21: A Two-Faced Genome Guardian.” Trends in Molecular Medicine,
vol. 23, no. 4 (2017): 310–319. doi:10.1016/j.molmed.2017.02.001.

7. Hande, Kenneth R. “Etoposide: Four Decades of Development of a Topoisomerase II Inhibitor.” European
Journal of Cancer, vol. 34, no. 10 (1998): 1514-1521. doi:10.1016/S0959-8049(98)00228-7

8. Hrecka, Kasia, et al. “Lentiviral Vpr Usurps Cul4-DDB1[VprBP] E3 Ubiquitin Ligase to Modulate Cell
Cycle.” Proceedings of the National Academy of Sciences, vol. 104, no. 28 (2007): 11778–11783.
doi:10.1073/pnas.0702102104

9. Ingaramo, María Clara, et al. “Regulation and Function of p53: A Perspective from Drosophila Studies.”
Mechanisms of Development, vol. 154 (2018): 82–90. doi:10.1016/j.mod.2018.05.007

10. Kastenhuber, Edward R, and Lowe, Scott W. “Putting p53 in Context.” Cell, vol. 170, no. 6 (2017): 1062-
1078. doi:10.1016/j.cell.2017.08.028

11. Kim, Hyunjung, et al. “p53 Requires an Intact C-terminal Domain for DNA Binding and
Transactivation.” Journal of Molecular Biology, vol. 415, no. 5 (2011): 843-54.
doi:10.1016/j.jmb.2011.12.001

12. Kim, Kyunghwan, et al. “Vpr-binding Protein Antagonizes p53-mediated Transcription via Direct
Interaction With H3 Tail.” Molecular and Cellular Biology, vol. 32, no. 4 (2012): 783-96.
doi:10.1128/MCB.06037-11

13. Kim, Kyunghwan, et al. “VprBP has Intrinsic Kinase Activity Targeting Histone H2A and Represses Gene
Transcription.” Molecular Cell, vol. 52, no. 3 (2013): 459-67. doi:10.1016/j.molcel.2013.09.017

14. Meek, David W, and Carl W Anderson. “Posttranslational Modification of p53: Cooperative Integrators of
Function.” Cold Spring Harbor perspectives in biologyvol, vol. 1, no. 6 (2009):
doi:10.1101/cshperspect.a000950

15. Montecucco, Alessandra, and Biamonti, Giuseppe. “Cellular Response to Etoposide Treatement.” Cancer
Letters, vol. 252, no. 1 (2007): 9-18. doi:10.1016/j.canlet.2006.11.005

16. Nakagawa, Tadashi et al. “VprBP (DCAF1): a promiscuous substrate recognition subunit that incorporates
into both RING-family CRL4 and HECT-family EDD/UBR5 E3 ubiquitin ligases.” BMC Molecular
Biology, vol. 14, no. 22 (2013): doi:10.1186/1471-2199-14-22
54

17. Nemade, Harshal et al. “Cell Death Mechanisms of the Anti-cancer drug Etoposide on Human
Cardiomyocytes Isolated from Pluripotent Stem Cells.” Archives of Toxicology, vol. 92, no. 4 (2018): 1507-
1524. doi:10.1007/s00204-018-2170-7

18. Newton, Herbert B. "Clinical Pharmacology of Brain Tumor Chemotherapy." Handbook of Brain Tumor
Chemotherapy. Elsevier/Academic, 2006. 21-43. doi:10.1016/B978-012088410-0/50040-8

19. Ozaki, Toshinori, and Akira Nakagawara. “Role of p53 in Cell Death and Human Cancers.” Cancers, vol.
3, no. 1 (2011): 994-1013. doi:10.3390/cancers3010994

20. Shchemelinin, I, Šefc, L, and Nečas, E. “Protein Kinases, their Function and Implication in Cancer and
Other Diseases.” Folia Biologica, vol. 52, no. 3 (2006):81-100

21. Sullivan, Kelly D, et al. “Mechanisms of Transcriptional Regulation by p53.” Cell Death and
Differentiation, vol. 25, no. 1 (2017):133–143. doi:10.1038/cdd.2017.174

22. Trimpin, Sarah, and Bill Brizzard. “Analysis of Insoluble Proteins.” BioTechniques, vol. 46, no. 5 (2009):
321–326. doi:10.2144/000113135

23. Wingfield, Paul T. “Overview of the Purification of Recombinant Proteins.” Current Protocols in Protein
Science, vol. 80, no 1 (2015): 1-35. doi:10.1002/0471140864.ps0601s80

24. Zhang, Shangao, et al. "Cytoplasmic Retention of HIV-1 Regulatory Protein Vpr by Protein-protein
Interaction with a Novel Human Cytoplasmic Protein VprBP." Gene, vol. 263, no. 1 (2001): 131-40.
doi:10.1016/S0378-1119(00)00583-7

Abstract (if available)

Abstract HIV-1 Viral protein r-Binding Protein (VprBP) is a large nuclear protein implicated in cellular processes such as cell-cycle progression, DNA replication and telomerase regulation. Work from our lab has established VprBP as a negative regulator of the cell-cycle inhibition, emanating from its intrinsic kinase activity that executes site-specific phosphorylation of histone H2A at Threonine 120 (T120). This function results in repression of chromatin transcription and impairment of tumor suppression. In similar regards, the expression and function of tumor suppressor p53 are also mis-regulated by VprBP-mediated phosphorylation. Depletion of VprBP in cancer cells and incorporation of a single-point mutation at Lysine 194 (K194) in the kinase domain of VprBP obstruct phosphorylation of p53. Mass spectrometry analysis further reveals that VprBP phosphorylates p53 at Serine 367 (S367), which has been validated by site-directed mutagenesis of amino acid 367 to Alanine. Having established that VprBP function is linked to the progression of cancer, we seek to resolve the structure of VprBP kinase domain (VPKD) for the development of highly specific VprBP inhibitors that would function to suppress tumorigenesis.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Identification of two negative regulators of p53: H1.2 complex and VprBP

PDF

Regulation of Aurora kinase B and its effect on phosphorylation of G9a/GLP

PDF

PRMT1 controls subcellular localization of p53 via PARP1

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Studies on the role of a novel protein, TMEM 56 in tumorigenic growth for MCF-7 cells

PDF

Examination of the effect of the ecPlexin-B1 on MDA-MB-231 cells

PDF

Multiple functions of the PR-Set7 histone methyltransferase: from transcription to the cell cycle

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

Asset Metadata

Creator Mehmood, Roasa (author)

Core Title Vpr-binding protein negatively regulates p53 by site-specific phosphorylation through intrinsic kinase activity

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Publication Date 08/01/2019

Defense Date 06/20/2019

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag HIV-1 viral protein r-binding protein (VprBP),intrinsic kinase activity,nuclear protein,OAI-PMH Harvest,oncogene,p53,site-specific phosphorylation,tumor suppressor,VprBP kinase domain (VPKD)

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor An, Woojin (committee chair), Rice, Judd (committee member), Stallcup, Michael (committee member)

Creator Email mehmood@usc.edu,roasamood@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-203419

Unique identifier UC11662939

Identifier etd-MehmoodRoa-7721.pdf (filename),usctheses-c89-203419 (legacy record id)

Legacy Identifier etd-MehmoodRoa-7721.pdf

Dmrecord 203419

Document Type Thesis

Format application/pdf (imt)

Rights Mehmood, Roasa

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA