University of Southern California Dissertations and Theses

Evaluation of P2X4 receptor modulation as a novel approach for treating Parkinson’s disease

(USC Thesis Other)

Evaluation of P2X4 receptor modulation as a novel approach for treating Parkinson’s disease

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
Evaluation of P2X4 Receptor Modulation as a Novel Approach for Treating Parkinson’s Disease

By

Alicia Marie Paiva Warnecke

A Dissertation Presented to the
FACULTY OF THE USC GRATUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CLINICAL AND EXPERIMENTAL THERAPEUTICS)

December 2020

Copyright 2020 Alicia Marie Paiva Warnecke
ii

ACKNOWLEDGEMENTS
First, I would like to recognize Dr. Davies, for serving as my advisor and giving me the
opportunity to work in his lab. He has supported and guided my research over the last four years
and helped me to develop into a confident scientist, by acknowledging the importance of my ideas
and research style.
Dr. Jakowec and Dr. Petzinger have been integral members of my committee. They
allowed me to work and participate in their lab, as if I was one of their own graduate students. Dr.
Jakowec taught me to “never let anything stop me” and pushed me to be a tough researcher
ready for any and all criticism. Dr. Petzinger opened my eyes to the world of clinical research and
helped me gain a newfound appreciation for the impacts of therapeutic interventions. They both
have shaped my understanding of Parkinson’s Disease and helped me to understand the
importance of always conducting research with patients in mind.
I would also like to thank Dr. Asatryan and Dr. Cadenas for being a part of my committee.
You have both given insightful feedback on my project design and my research itself. Dr. Asatryan
your expertise on purinergic receptors helped me to keep my research focused on P2X4 in all of
my studies. Dr. Cadenas your expertise on pathways helped me, early on, to better develop my
hypothesis and drove me to always come back to the importance of understanding the underlying
mechanisms.
To my family and friends, I would like to thank you for your support through this process.
Scott you have been a source of steady and calm in my life, you helped me keep my head in this
whole process. Mom you are the reason I made it this far in my educational career, you taught
me to be strong, independent and ready for anything. And finally thank you to my best friend,
Jules, you more than anyone have heard about all of my life, educational, and research woes.

iii

TABLE OF CONTENTS
ACKNOWLEDGEMENTS ........................................................................................................... ii
LIST OF TABLES ........................................................................................................................ v
LIST OF FIGURES .................................................................................................................... vi
ABSTRACT ............................................................................................................................... vii
INTRODUCTION ................................................................................................................ 1
Parkinson’s Disease (PD) ............................................................................................ 1
Purinergic Receptors ................................................................................................... 3
P2X4s .......................................................................................................................... 6
P2X4s in CNS Disorders/Diseases .............................................................................13
Dissertation Hypothesis ..............................................................................................19
CHAPTER 2 .......................................................................................................................22
Abstract .................................................................................................................................22
Introduction .................................................................................................................24
Methods ......................................................................................................................27
Results ........................................................................................................................30
Discussion ..................................................................................................................38
Conclusion ..................................................................................................................42
CHAPTER 3 .......................................................................................................................43
Introduction: ................................................................................................................43
Methods ......................................................................................................................45
iv

Results ........................................................................................................................51
Discussion ..................................................................................................................62
Conclusion ..................................................................................................................66
CHAPTER 4 .......................................................................................................................67
Introduction .................................................................................................................67
Methods ......................................................................................................................68
Results ........................................................................................................................71
Discussion ..................................................................................................................77
Conclusion ..................................................................................................................80
CHAPTER 5 .......................................................................................................................81
Conclusion ..................................................................................................................81
REFERENCES ..................................................................................................................86

v

LIST OF TABLES
Table 2.1 Average AMPH Rotations performed compared to averaged lesion percentages. .....31

vi

LIST OF FIGURES
Figure 1.1 Homology Model of the P2X4 .................................................................................... 4
Figure 1.2 Structure of Ivermectin .............................................................................................11
Figure 1.3 The potential mechanism via which P2X4 activation can increase DA release from a
presynaptic neuron. ..................................................................................................................19
Figure 2.1 6-OHDA behavioral timeline. ....................................................................................27
Figure 2.2 TH stains of MFB 6-OHDA lesioned and saline injected mice ..................................32
Figure 2.3 AMPH (5.0 mg/kg), and L-DOPA (5.0 mg/kg), rotations comparing male and female
mice ..........................................................................................................................................34
Figure 2.4 L-DOPA Rotations in male versus female mice ........................................................35
Figure 2.5 The effect of IVM and MOX doses on net contra-lateral rotations performed over 90
minutes in the presence of L-DOPA with error bars representing SEM. ....................................37
Figure 3.1 Average latency to fall of all 5 rotarod trials by 6-OHDA and MPTP lesioned mice. ..51
Figure 3.2 Performance on the Rotarod across all trials by 6-OHDA and MPTP lesioned mice .53
Figure 3.3 Performance on NOR testing by 6-OHDA and MPTP lesioned mice ........................55
Figure 3.4 The effect of IVM treatment on sucrose preference. .................................................56
Figure 3.5 Gene expression alterations after 6-OHDA lesioning in the dorsal striatum (DS) .....58
Figure 3.6 Gene expression alterations after 6-OHDA lesioning in the ventral striatum (VS) .....60
Figure 4.1 IVM decreases dopamine release in female mice ....................................................71
Figure 4.2 IVM induces changes in release kinetics of male mice .............................................72
Figure 4.3 L-DOPA increase DA release ...................................................................................74
Figure 4.4 L-DOPA + IVM interactions in females .....................................................................75
Figure 4.5 L-DOPA + IVM interactions in males ........................................................................76

vii

ABSTRACT
Dopamine (DA) is a key neurotransmitter within the brain that plays a role in the mesolimbic
pathway (associated with reward-based behavior) and the nigrostriatal pathway (associated with
motor control and reward-based cognition), both of which involve regions located within the
striatum. Building evidence supports the hypothesis that P2X4 receptors (P2X4s) play a role in
modulation of DA activity, suggesting P2X4s as a novel target for the treatment of dopaminergic
disorders including Parkinson’s disease (PD) and addiction. P2X4 modulators (e.g.,
Ivermectin/IVM; Moxidectin/MOX) significantly reduced alcohol consumption in male and female
C57Bl/6J mice. Notably, the degree of alcohol reduction by IVM and MOX was significantly less
in mouse P2rx4 gene knock-out (P2X4 KO) compared to littermate controls, supporting the
hypothesis that P2X4 positive modulators represent a novel class of drugs that can be developed
to decrease alcohol consumption. Recently, we found that IVM significantly enhanced the effects
of levodopa (L-DOPA) on motor systems in mice. Notably, IVM’s effect on L-DOPA was
significantly reduced in P2X4 KO mice linking P2X4 to DA motor activities. My dissertation tested
the hypothesis that presynaptic modulation of P2X4s can lead to changes in DA in the rodent
brain, with special focus on the striatum. Chapter 2 and 3 studies tested this hypothesis by
evaluating behavioral deficits linked to DA activity in a PD mouse model. For my investigations
on this topic, I used a 6-hydroxydopamine and a 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine
(MPTP) model to induce depletion of dopaminergic neurons. These models are routinely used to
screen and identify promising candidates for treatment of PD. After lesioning the mice, I tested
the ability of P2X4 modulators to beneficially alter behavioral deficits caused by the lesion.
Additionally, I compared the efficacy of MOX versus IVM in chapter 2 studies. Chapter 4 studies
incorporated fast scan cyclic voltammetry (FSCV) to test my hypothesis by evaluating DA currents
and concentration in the nigrostriatal pathway in the presence of a P2X4 modulator, IVM. FSCV
was used to screen IVM’s effect within regions associated with the mesolimbic and nigrostriatal
viii

pathways to determine the degree to which P2X4 modulation could alter DA activity and DA
currents. Chapter 2, 3, and 4 studies compared changes in activity in male and female mice to
gain insight into the role of P2X4s in mediating dopaminergic activity. Collectively, the findings
from my dissertation supported the hypothesis that positive P2X4 modulation increase DA linked
behaviors and presynaptic DA release in the rodent striatum and set the stage for future work that
will further focus on the development of P2X4 modulators as adjunct therapeutics for PD.
1

INTRODUCTION
Parkinson’s Disease (PD)
1.1.1 Clinical Description
First described in 1817 by Dr. James Parkinson, PD is a progressive neurodegenerative
disease caused by the death of dopamine (DA) neurons in the SNpc (Subtantia nigra pars
compacta) (Goetz, 2011). This in turn causes a loss of dopaminergic input to the striatum,
disrupting the balance of excitation and inhibition within the basal ganglia. This balance is
maintained, in normal conditions, by the indirect and direct pathways which input into the internal
globus pallidius (GPi). The direct pathway consists of γ-Aminobutyric acid (GABA)-ergic inputs to
the GPi. The indirect pathway has GABAergic inputs to the external GP (GPe) which suppresses
the glutamatergic outputs of the subthalamic nucleus; the subthalamic nucleus then inputs into
the GPi. With both pathways working in concert to enhance movement through the direct pathway
and diminish unwanted movement through the indirect pathway (Graybiel, 1996). In those
diagnosed with PD the indirect pathway has increased glutamatergic activity input to the GPi,
increasing the inhibition of motor movement (Gopalakrishna & Alexander, 2015).
There is currently no cure for PD and the symptoms of the disease include resting tremors,
bradykinesia, cognitive impairments and psychiatric alterations. While the motor symptoms of PD
are well known, the nonmotor symptoms can be just as debilitating, if not more. The nonmotor
symptoms of PD include loss of smell, sleep disturbances, dementia, and hypotension
(Gopalakrishna & Alexander, 2015). The exact cause of PD is unknown but risk for developing
PD is higher for biological males and those over the age of 60. Genetic mutations have been
correlated to PD, however most cases of PD are sporadic and appear to occur due to a mix of
both environmental and genetic factors (Gopalakrishna & Alexander, 2015). In the hopes of better
understanding PD, scientists have studied mitochondria dysfunction, inflammation, lysosomal
dysfunction, autophagy, and the transmission of abnormal proteins (Foltynie & Kahan, 2013). All
2

these factors are believed to contribute to PD pathogenesis and ongoing research looks to
evaluate the interventions that may hamper the progression of PD, and one day prevent it all
together.
1.1.2 Societal Impact and Cost
The National Institute of Health estimates over half a million people in the United States
are living with PD, and about 50,000 people are diagnosed with PD every year in the United
States. In the next 10 years the worldwide prevalence of PD is expected to double, as the world
population ages (Martinez-Martin et al., 2019). In 2010, it was estimated that the national
economic burden caused by PD was over $14 billion (Kowal et al., 2013; Rossi et al., 2018). This
burden comes from not only the medical cost associated with the disease, but also the lost income
of the patient and caregivers (caregiver’s lost productivity is due to mental and time strain)
(Martinez-Martin et al., 2019).
1.1.3 Treatment
When PD was first discovered therapeutic options were limited. Treatment options
consisted of bloodletting and induced inflammation in the hopes of diverting blood and
inflammation away from the brain (Goetz, 2011). Today, the gold standard of treatment for PD is
Levodopa in combination with Carbidopa (L-DOPA), approved for use by the Federal Drug
Administration in 1970 (Poewe et al., 2010). L-DOPA helps manage the motor and non-motor
disease symptoms, but after many years of use, L-DOPA therapy ultimately becomes less
effective and can cause a variety of negative side effects. These side effects include dyskinesia,
impulse control problems, akinesia, somnolence, edema, hallucinations, and gastrointestinal
upset (Ambani & Van Woert, 1973; Antonini et al., 2018; Blaszczyk et al., 2007; Fahn & Parkinson
Study, 2005; Foster & Hoffer, 2004; Poewe et al., 2010). Despite these problems, no other
therapies have been developed that offer better therapeutic outcomes, and efforts have been to
further optimize L-DOPA therapy, as seen in the current efforts to approve an intranasal version
3

of L-DOPA treatment (clinical trial identifier: NCT03541356) (Ambani & Van Woert, 1973; Antonini
et al., 2018; Blaszczyk et al., 2007; Fahn & Parkinson Study, 2005; Foster & Hoffer, 2004; Poewe
et al., 2010). DA agonist also offer another treatment option for PD patients. DA agonist target
postsynaptic neurons to help increase receptor activity and are most commonly used in the early
stages of PD and in combination with L-DOPA therapy during the later stages (Deleu et al., 2002;
Reichmann et al., 2006). While DA agonist have a lower risk for causing dyskinesia in patients,
side effects of DA agonist treatment include increased risk-taking behavior, hallucinations, heart
disease and sudden sleep attacks (Reichmann et al., 2006). In addition, deep brain stimulation
(DBS) offers an additional treatment option to decrease PD motor symptoms in PD patients with
limited success after drug treatment. DBS is a highly invasive procedure that requires implanting
electrodes in the patient’s brain and a stimulating device in the patient’s chest; the electrodes are
used to stimulate the brain, resulting in decreased tremors and rigidity (Malek, 2019). There is
inherent risk to DBS, especially during the surgical implantation where patients are at risk for
infection, foreign object intolerance, and hemorrhaging. After implantation side effects can include
dyskinesia, confusion, and decreased executive function rigidity (Malek, 2019). With no obvious
cure to PD in sight and the significant side effect of current PD therapies researchers continue to
evaluate new targets to improve PD treatment. Building upon evidence from the laboratories of
Dr. Davies and Jakowec/Petzinger suggest that purinergic receptors, specifically the P2X4
receptor, represent an understudied protein as a candidate to target in the modulation dopamine
(DA) activity.
Purinergic Receptors
The purinergic signaling hypothesis, the concept that adenosine 5' triphosphate (ATP) is
capable of acting as an extracellular signaling molecule, was first proposed in the 1970’s and
began to gain traction in the 1990’s, after purinergic receptors were cloned and characterized
(Burnstock et al., 2011). Purinergic receptors are a family of receptors activated by ATP.
4

Purinergic receptors are classified as either type 1 (P1) or type 2 receptors (P2). P1 receptors
have a higher affinity for adenosine and lower affinity for ATP, while P2 receptors have a higher
affinity for ATP and lower affinity for adenosine (Burnstock & Kennedy, 1985; Londos et al., 1980;
van Calker et al., 1979). P2 receptors are found in cells throughout the body, from epithelium to
neurons. Activation of P2 receptors occurs in the presence of their agonist: including triphosphate
and diphosphate nucleotides (ATP, adenosine diphosphate [ADP], uridine triphosphate [UTP] and
uridine diphosphate [UDP]). P2 receptors are further broken down into two main classifications
based on receptor type, P2Y and P2X receptors (Burnstock & Kennedy, 1985). P2Y receptors
are metabotropic receptors, while P2X receptors are ligand-gated ion channels. To date, there
are 8 different subtypes of P2Y receptors, classified by the ligands that activate them (e.g., ATP,
ADP, UTP, and UDP), and 7 different subtypes of P2X receptors, classified via their agonist (e.g.,
ATP, ADP, UTP, and UDP), antagonist and modulators, but all activated by ATP (Burnstock,
2018).
Figure 1.1 Homology Model of the P2X4
The structure of a rat P2X4, with the TM1 and TM2 domains labeled, the binding site for ATP and
a bound IVM. License # 4893190629878

5

P2X receptors all share a general topology with the N and C termini both on the
intracellular side of the lipid bilayer, two transmembrane segments (TM1 and TM2), and one
extracellular segment composed of amino acids that connect the two transmembrane segments
(Alves et al., 2014; Asatryan et al., 2010; Li et al., 2009) (Figure 1.1). TM1 and TM2 make up the
ion channel itself and contain binding sites for modulators, while the extracellular segment
contains binding sites for ATP and other modulators (Stokes et al., 2017). Activation of P2
receptors allows an influx and increased cellular concentrations of cations. Essentially, upon P2X
activation, there is a flow of cations through P2X receptors that results in changes in membrane
potential mediated by the flow of cations as a response to changes in extracellular ATP
concentration. While the general topology and phase gating is the same across the P2X
receptors, the response to ATP and other various agonists (UDP, ADP), antagonists
(suramine, pyridoxalphosphate-6-azophenyl-2′,4′-disulphonic acid (PPADS), and modulators
(ivermectin [IVM], zinc, copper),vary depending on the receptor subtype (Coddou, Yan, et al.,
2011)
Seven P2X subtypes have been defined by their amplitude in response to ATP,
permeability to cations, ability to uptake nucleic acid strains, rate of desensitization and
resensitization, ability to form complexes with other P2X receptors, and sensitivity to various
agonist, antagonists, and modulators (Li et al., 2009). The majority of P2X family members are
nonselective cation channels with high calcium (Ca
2+
) permeability with the degree of Ca
2+
current
varying based on the receptor subtype. P2X3 having the smallest percent Ca
2+
current (2.7±0.9%
in HEK 293 cells) and P2X4 have the highest percent Ca
2+
current (11.0±0.7% in HEK 293 cells)
(Egan & Khakh, 2004; Li et al., 2009).
There has been increasing scientific focus on P2X4s role in the CNS diseases and
disorders. This is due to several properties of P2X4s: 1) high Ca
2+
permeability of P2X4s; 2) their
wide-spread distribution throughout the central nervous system (CNS); 3) existing
pharmacological tools that allow for identification of native P2X4s. The latter includes ability for
6

positive allosteric modulation (PAMs) by IVM, and relative insensitivity to PPADS and suramine,
which act as strong antagonist for other P2X receptors (Buell et al., 1996; Khakh et al., 1999; Lalo
et al., 2007; Stokes et al., 2017).
P2X4s
1.3.1 Structure and Activity
The first identified P2X receptor crystal structure was that of P2X4 in 2009, which allowed
for the confirmation of the receptor topology and further exploration into binding sites for
modulators, agonists, and antagonists of the receptor (Kawate et al., 2009). P2X4s are capable
of undergoing rapid internalization, where they are sequestered into lysosomes and then able to
be reinserted into the plasma membrane later, a process dependent on dynamin (Coddou, Yan,
et al., 2011). P2X4s present on the plasma membrane have an EC50 (half-maximal effective
concentration) with 1-8µM of ATP (in humans, mice, and rats) and the activation time is decreased
by high (100µM) concentrations of ATP. P2X4s are also slow to desensitize (decrease in ionic
currents while ATP is still bound), and their deactivation (decrease in ionic current after ATP is no
longer bound) kinetics are independent of ATP concentration (Coddou, Yan, et al., 2011).
Additionally, P2X4s display increased Ca
2+
binding compared to other P2X receptors with human
homologues producing fractional calcium currents of 15.0±1.5% (hP2X1 produces the second
highest at 10.8±1.1%) (Egan & Khakh, 2004). P2X4 Ca
2+
permeability is actually higher than that
of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) or kainite receptors and rivals
that of N-methyl-D-aspartate (NMDA) receptors (Egan & Khakh, 2004; Pankratov et al., 2009).
P2X4s can contribute to Ca
2+
signaling ,a process that facilitates neurotransmitter (NT) release,
even when the membrane is at resting potential, as activation of P2X4 does not require or always
cause membrane depolarization (compared to NDMA receptors which require membrane
depolarization to allow calcium flux) (Abbracchio et al., 2009; Baxter et al., 2011).
1.3.2 Distribution of P2X4s in the CNS
7

Even before the structure of the P2X4 was identified, researchers began to evaluate
P2X4’s role in the CNS. P2X4s have a wide distribution throughout the brain and are present on
microglia and neurons. Within the brain, P2X4s have been identified in the dentate gyrus,
hippocampus, cerebellar cortex, pontine nucleus, arcuate nucleus, anterior pituitary, posterior
pituitary, retinal ganglia, spinal cord, and SN (Amadio et al., 2007; Bardoni et al., 1997; Rubio &
Soto, 2001; Soto, Garcia-Guzman, Gomez-Hernandez, et al., 1996; Stojilkovic et al., 2010;
Zemkova et al., 2010). Of note, although wide distribution of P2X4s throughout the brain is
reported, building evidence suggests that P2X4s are not present or if present, not functional on
astrocytes (Zhao et al., 2006). On the other hand, P2X4s may interact with astrocytes. That is,
astrocytes can release ATP, which may help to activate P2X4s that are expressed on microglia
and/or neurons. However, limited work has been done to evaluate the importance of microglia
P2X4 function (Asatryan et al., 2014; Gofman et al., 2014; Gofman et al., 2016). Finally, it appears
that P2X4s are also not expressed on oligodendrocytes (Guo et al., 2004; Tsuda et al., 2003;
Ulmann et al., 2013).
Studies to date indicate that P2X4s are expressed on microglia in the spinal cord and the
brain, P2X4 activity correlates to the concentration of brain-derived neurotrophic factor (BDNF)
and increased P2X4 expression corresponds to the activation of microglia (Gofman et al., 2014;
Matsumura et al., 2016; Tsuda, 2015; Verma et al., 2017; Zhang et al., 2007). Microglia serve as
the resident macrophages of the brain and make up about 10% of the total glial population (Dheen
et al., 2007). Notably, there is growing evidence suggesting that microglia play a key role in
degenerative, infectious, traumatic, and inflammatory CNS diseases (Brown & Kretzschmar,
1997; Brown et al., 1996; Carbonell & Grady, 1999; Engel et al., 2000; Engel et al., 1996;
Koshinaga et al., 2000; Kure et al., 1991; Lenzlinger et al., 2001; Loane & Kumar, 2016; Ramirez
et al., 2017; Rogers et al., 2007; Walker & Lue, 2005). In a healthy individual, microglia are found
throughout the brain and spinal cord. In response to injury or disease, activated microglia undergo
functional and morphological changes, which ultimately allow for the activation of various
8

signaling pathways, phagocytosis, and release of substances, such as cytokines (Dheen et al.,
2007). Evidence to date suggests that microglia can be both harmful and neuroprotective in the
CNS (Gomes-Leal, 2012; Harry & Kraft, 2008; Inoue & Tsuda, 2012; Suzumura, 2013, 2014).
P2X4s expressed on microglia have been associated with neuropathic pain, ischemia, hypoxia,
traumatic brain injury, and ethanol-mediated neurotoxicity (Asatryan et al., 2018; Gofman et al.,
2014; Gofman et al., 2016; Tsuda et al., 2003; Ulmann et al., 2013; Verma et al., 2017; Wixey et
al., 2009; Zabala et al., 2018). Overall, there is a strong connection between P2X4 positive
microglia and a proinflammatory cytokine response after neuronal insult/injury (Gofman et al.,
2014; Verma et al., 2017; Wixey et al., 2009; Zhang et al., 2007). Interestingly, there is a lack of
clarity on the benefit versus harm of increased P2X4 expression and neuroinflammation; research
suggests both neurotoxicity and/or neuroprotection due to increased inflammation (Srivastava et
al., 2020; Verma et al., 2017). Presently, there is no clear answer as to the effect of P2X4
activation on microglia and if their activation is beneficial or detrimental to the overall health of the
CNS.
P2X4s are found on pre and postsynaptic neurons in several different locations throughout
the brain. Neurons are cells within the CNS that are able to relay inputs via electrical signals via
action potentials. They can transmit and receive these inputs to/from other neurons, astrocytes,
nerve cells, muscles, or glands. The basic components of a neuron are the dendrites, axons, and
soma. The dendrites of the neurons receive incoming signals and relay them over to the soma.
From there, the signal, if capable of depolarizing the neuron, is sent from the soma to the axon,
which then transmits the signal to the axon terminals. The axon terminals are then able to pass
the signal along via NT release or release of co-NTs. This type of release is a marker of a chemical
synapse. In the case of a chemical synapse, the axon terminal that releases the NT is the
presynaptic neuron. Once released from the presynaptic neuron, the NT moves into the synaptic
cleft where it can act on receptors expressed on the dendrite or cell body of another neuron,
termed the postsynaptic neuron. The distinction of pre versus postsynaptic neuron is important
9

as presynaptic neuron facilitates NT release, while postsynaptic cells relay signals from the
synaptic cleft. This causes the postsynaptic neuron to induce an action potential and/or activate
downstream signaling pathways within the postsynaptic neuron (Lodish et al., 2000).
To date, P2X4s have been shown to be expressed in neurons of the prefrontal cortex,
dentate gyrus, hippocampus, cerebellar cortex, SN, striatum, hypothalamus, and anterior pituitary
(Abbracchio et al., 2009; Amadio et al., 2007; Burnstock, 2009, 2020; Coddou, Yan, et al., 2011;
Fountain & Burnstock, 2009; Soto, Garcia-Guzman, Karschin, et al., 1996; Surprenant & North,
2009; Suurväli et al., 2017) They have also been found on γ-Aminobutyric acid-ergic (GABAergic)
interneurons and medium spiny neurons (MSNs), cortical neurons, and trigeminal neurons
(Amadio et al., 2007; Lalo et al., 2007; Luo et al., 2006; Wheeler-Schilling et al., 2001). When
stimulated, P2X4s allow for Ca
2+
influx, prolactin release, and additional activation of downstream
pathways and signaling cascades (Coddou, Yan, et al., 2011). Evidence suggests P2X4s play a
role in neurotransmission and synaptic strengthening (Stokes et al., 2017). Additional effects of
P2X4 activation may come from crosstalk with γ-Aminobutyric acid type A (GABAA), nicotinic
acetylcholine (nACh), and NMDA receptors (Long et al., 2018; Popova et al., 2020; Rodriguez et
al., 2020; Stokes, 2013).
1.3.3 P2X4 Agonist, Antagonists, and Modulators
P2X4s are mainly activated by the neurotransmitter, ATP (Coddou, Yan, et al., 2011). To
activate the receptor, 3 molecules of ATP bind in the ectodomain of the receptor (Suurväli et al.,
2017). The key residues that ATP binds to, and not ADP or adenosine monophosphate (AMP),
on P2X receptors, are Lys70, Lys72, Lys 316, Asn296, Arg298, The189, Leu217, Ile232, and
specific the P2X4 is Leu191, which is thought to recognize the adenine base (Hattori & Gouaux,
2012). Other partial agonists for P2X4s are 2-meSATP (2-Methylthio-ATP), αβ-meATP
(methyleneATP), βγ-meATP, and Cytidine triphosphate (Coddou, Yan, et al., 2011).
Antagonists of the P2X4 are benzodiazepine derivative 5-(3-bromophenyl)-1,3-dihydro-
2H-benzofuro[3,2-e]-1, 4-diazepin-2-one (5-BDBD) and 2',3'-O-Trinitrophenyl-adenosine-5'-
10

triphosphate (TNP-ATP)(Coddou, Yan, et al., 2011). While PPADS is an antagonist for other P2X
receptors, it is a weak P2X4 antagonist. Suramin is another example of P2X4s distinct nature as
it serves as an antagonist for other P2X receptors, but is a poor antagonist for P2X4s Both of
these antagonists show varying levels of activity based upon the species the receptor is
expressed in (Coddou, Yan, et al., 2011).
In 2016, Matsumura et al. identified a novel P2X4 antagonist, NP-1815-PX (5-[3-(5-thioxo-
4H-[1,2,4]oxadiazol-3-yl)phenyl]-1H-naphtho[1,2-b][1,4]diazepine-2,4(3H,5H)-dione) with a 3-4
fold higher potency for the P2X4 compared to other P2X receptors (Coddou et al., 2009;
Matsumura et al., 2016).
Negative modulators of P2X4s identified include hydrogen dioxide, carbon monoxide, and
ethanol (EtOH). Of these negative modulators, EtOH has been extensively studied and has an
IC50 (half maximal inhibitory concentration) of 60mM, but inhibition of P2X4 starts at as low as
5mM (Coddou, Yan, et al., 2011; Popova et al., 2013). A specific set of residues, Asp338 and Met
336, identified in the TM2-ectodomain region of the P2X4 allows for EtOH effect (Popova et al.,
2010). EtOH is an open channel blocker for P2X4 and does not alter the rate of activation or
deactivation (Ostrovskaya et al., 2011). Furthermore, EtOH exerts its effect by decreasing ATP
induced currents (Davies et al., 2006). Therefore, when there are low concentrations of ATP,
EtOH inhibition is at its greatest, but high concentrations of ATP can abolish EtOH’s effect on
P2X4s (Woodward et al., 2004).

11

1.3.4 Ivermectin and Other Avermectins as Positive P2X4 Modulators
IVM has been used to help identify the P2X4 subtype based on the ability of IVM to act as
a PAM of P2X4, but not other P2X receptors (evidence suggests that human P2X7 receptors can
be potentiated by IVM but not murine P2X7 receptors (Nörenberg et al., 2012)]) (Khakh et al.,
1999). The origins of IVM can be traced back to a golf course in Kawana, Japan in 1970 where
Satoshi Ōmura collected soil samples and cultured a gram positive bacteria that went on to be
known as the Streptomyces, for which he was given a Nobel Prize in 2015 along with Tu Youyou
and William C. Campbell (Laing et al., 2017). Merck went on to develop IVM as an antiparasitic
drug to treat onchocerciasis. Ivermectin is a combination of the avermectin B1a and B1b where
the molecules are hydroxylated by their derivatives (Spinosa et al., 2002) (Figure 1.2). At the time
of IVM’s discovery it was believed to only have an effect on invertebrate systems, causing
excitotoxicity by inhibiting glutamate (GLU) gated Cl
-
channels (Dawson et al., 2000; Shan et al.,
2001). Initially it was thought that IVM could not accumulate in the vertebrate brain due to its
affinity for P-glycoprotein (Pgp), a protein present in the blood brain barrier (BBB) able to efflux
many substances out of the brain (Chandler, 2018). In vertebrate animals, IVM is capable of
positively modulating GABA and P2X4s, and may potentiate nACh receptors (Khakh et al., 1999;
Figure 1.2 Structure of Ivermectin
(Laing et al., 2017)
12

Spinosa et al., 2002). The residues necessary for IVM binding to P2X4s are Asn338, Ser341,
Gly342, Leu346, Gly347, Ala349, and Ile357 in the TM2 segment (Jelínkova et al., 2008;
Jelínková et al., 2006; Popova et al., 2013), and Trp46 and Trp50 in TM1 segment (Asatryan et
al., 2010; Popova et al., 2013). Ivermectin affects various behaviors in animal models. Most of
ivermectin’s behavioral effects have focused on generalized neurological, sexual, and alcohol
drinking behaviors (Asatryan et al., 2014; Crichlow & Crawford, 1988; Dawson et al., 2000; Kipp
et al., 1992; Spinosa et al., 2002). In light of IVM’s ability to modulate both GABAA and P2X4s,
studies of animal behavior may ultimately show effects mediated by both receptors. To further
determine which effects are due to P2X4 activity, the following techniques were used: knockout
(KO) mouse models and targeted lentiviral (LV) knockdown (Bortolato et al., 2013; Khoja et al.,
2019; Khoja, Huynh, Asatryan, et al., 2018; Khoja et al., 2016; Verma et al., 2017; Wyatt et al.,
2014; Wyatt et al., 2013). Other positive modulators of P2X4s include alflaxalone, alkaline
phosphatase, allotetrahydrodeoxycorticosterone, toluene, propfol, and other avermectins
(Asatryan et al., 2008; Asatryan et al., 2014; Coddou, Yan, et al., 2011; Davies et al., 2002;
Woodward et al., 2004). While there has been some work on these other molecules, IVM remains
the most commonly utilized P2X4 modulator. However, there have been some concerns regarding
the use of IVM in humans due to its potential neurotoxicity (i.e., beyond its current acute use as
an antiparasitic agent). With limited serious adverse events in human studies, this concern may
highlight specific physiological conditions, like that of deficient Pgp activity (Kipp et al., 1992;
Roche et al., 2016). Notably, moxidectin (MOX) a related macrocyclic lactone of IVM with weaker
Pgp and GABA affinity, has also been found act as a PAM of P2X4s (Huynh et al., 2017; Khoja,
Huynh, Warnecke, et al., 2018). Studies utilizing mice have also shown that MOX is capable of
exhibiting behavioral effects resembling that of IVM, but with improved potency and efficacy with
the onset of measurable outcomes reduced from 8 hours to 4 hours(Huynh et al., 2017) . Due to
MOX’s similar effect to IVM and decreased neurotoxic profile, MOX has begun to gain interest as
a P2X4 modulator.
13

P2X4s in CNS Disorders/Diseases
P2X4’s have been studied in a number of CNS disorders including, alcohol use disorder
(AUD), psychiatric disorders, and Alzheimer’s disease (AD). Work, to date, has investigated the
in vivo effects on related behaviors and disease markers in animal models, and ex vivo effects on
receptor expression and electrophysiologic effects in Xenopus oocytes, cell cultures, brain tissue
and brain slices. Some of the work performed was in the presence of modulators, like IVM, which
can have additional non-P2X4 effects. These non-P2X4 effects can include activation of other
receptors, such as GABAA receptors in the case of IVM. The research conducted evaluating the
role of P2X4’s in these disorders/diseases indicated the potential role of P2X4’s in DA linked
behaviors and neurodegenerative disorders. Setting the stage for the evaluation of P2X4s in PD,
a neurodegenerative disease in which DA plays a central role.
1.4.1 P2X4 in Neuropathology
1.4.1.1 Alcohol Use Disorder (AUD)
Over twenty years ago, the understanding of EtOH activity on P2X4s started gaining the
attention by the scientific community. Early investigations exposed important roles for P2XRs in
the action of EtOH (Li et al., 1993; Li et al., 1994, 1998; Weight et al., 1999). In particular, P2X4s
were found to be the most sensitive to EtOH activity among P2X receptors (Buell et al., 1996;
Soto, Garcia-Guzman, Gomez-Hernandez, et al., 1996). It was later established that this
sensitivity was due to EtOH’s ability to reduce ATP currents and ATP affinity on P2X4s (Xiong et
al., 2005; Xiong et al., 2000) and researchers were eager to determine if this activity could
potentially play a role in AUD and, on a broader level, drugs of abuse (Davies et al., 2006; Davies
et al., 2005; Davies et al., 2002). Subsequent investigations involving HXB/BXH recombinant
inbred rat strains identified P2X4 as a candidate gene for predisposition to EtOH intake, where a
reduction in P2X4s was correlated with increased EtOH consumption (Tabakoff et al., 2009).
Work done in Xenopus oocytes and cell culture had previously established EtOH’s ability to alter
14

P2X4 functions (Davies et al., 2006; Xiong et al., 2005; Xiong et al., 2000). These findings are
further supported by recent evidence showing that EtOH antagonizes the effect of ATP on P2X4s
regardless of reduced expression of P2X4s in the VTA of C57BL/6J mice (Rodriguez et al., 2020).
Furthermore, this effect is likely due to the interactions of EtOH and P2X4s interfering with DA-
dependent information processing (Khoja et al., 2019; Rodriguez et al., 2020). With these ongoing
investigations on the actions of EtOH on P2X4s, it was suggested that IVM, acting as PAM on
P2X4s, was able to significantly reduce the inhibitory effects of EtOH on ATP currents and thereby
pave the way for in vivo experimentation involving IVM pharmacological activity and AUD
(Asatryan et al., 2010). Preclinical investigations found that IVM from doses of 2.5 – 10 mg/kg
reduced EtOH consumption and preference in male and female C57BL/6J mice using an ad
libitum two-bottle choice study (Tabakoff et al., 2009). P2X4 involvement in drinking behavior was
further assessed in P2X4 KO mice, which displayed increased EtOH intake compared to wild type
(WT) littermates (Khoja et al., 2016). Additionally, the administration of IVM to P2X4 KO mice
resulted in reduced EtOH consumption, but these effects were significantly less than in WT
littermates (Wyatt et al., 2014). This work further supported the hypothesis that P2X4s were
important targets for IVM. Expansion of the avermectin compounds investigated as potential AUD
therapies, including selamectin and abamectin, in which IVM was found to be superior in
benefitting the reduction of EtOH intake and preference in rodent models (Asatryan et al., 2014;
Huynh et al., 2017; Khoja, Huynh, Warnecke, et al., 2018). Consequently, IVM has since made
great strides in its development for the treatment of AUD, resulting in studies that support the
safety of IVM administered orally at 30 mg and combined with an intoxicating dose of alcohol
(0.08 g/dl) in humans (Roche et al., 2016). Ultimately, these investigations have laid the
foundation for the identification of other avermectin compounds and P2X4 PAMs that produce
similar pharmacological effects on EtOH consumption. Similar to IVM, MOX has been found to
reduce drinking behavior in mice, have a lower potency for GABA A receptors, have a reduced
15

potential for neurotoxicity, and is a weaker Pgp substrate resulting in faster accumulation in the
CNS relative to IVM (Huynh et al., 2017; Huynh et al., 2019).
Beyond the activity of P2X4s on EtOH intake behavior, there exists a complex relationship
between P2X4s, microglia, and EtOH-mediated neurotoxicity. For instance, Gofman et al.
reported that EtOH increased the expression of P2X4s in embryonic stem cell-derived microglial
cells (ESdM) and resulted in decreased phagocytosis and microglial migration (Gofman et al.,
2014). The dependence of EtOH-induced reduction in microglial migration on P2X4 function was
later supported by Asatryan and colleagues (Asatryan et al., 2014). Subsequent studies by
Gofman and colleagues provided evidence to link EtOH to the suppression of microglial immune
activity by finding that the AKT (Protein Kinase B) and ERK (Extracellular Signal-regulated
Kinase) signaling cascades were inhibited by EtOH in a time-dependent and concentration-
dependent response (Gofman et al., 2016). Both of these pathways have been reported to be
activated by fibronectin stimulation, thereby resulting in increased P2X4 microglial activity through
receptor upregulation (Tsuda, 2015). Therefore, these identified pathways illustrate mechanistic
insights into the EtOH-induced alteration of P2X4 expression and a model of transcriptional
regulatory mechanisms underlying microglial function in response to EtOH-mediated immune
dysfunction. Findings from these studies highlight the complexity of the relationship between
P2X4s and EtOH and confirm the dynamic nature of these receptors and their mediated effects
on immune responses and behavior.
1.4.1.2 Psychiatric Disorders
Several investigations have identified potential anxiolytic effects of positively modulating
P2X4s and linked genetic alterations in P2X4 expression to anxiety. A study investigating markers
of anxiolysis found that male mice that were administered IVM before behavioral testing resulted
in decreased marble burying and increased entries to the open arms of the elevated plus maze,
both indicating a reduction in anxiety (Bortolato et al., 2013). In Wistar male rats given IVM testing
showed increased time spent in the open arms and entries into the open arms of the elevated
16

plus maze, similar to mice given diazepam, a known anxiolytic (Asatryan et al., 2008). While it
was initially concluded these effects were likely unrelated to IVM’s effect on P2X4s, a later study
performed on P2X4 KO mice indicated that KO mice display behaviors that are indicative of
increased anxiety (Wyatt et al., 2013). Additionally, in agreement with these findings, increased
P2X4 expression in cortical neurons resulted in decreased anxiety correlating to increased
surface expression of P2X4s (Bertin et al., 2020). The results of these studies add to the evidence
that IVM alters anxiolytic behaviors, partially mediated by P2X4s, in such a fashion that is
comparable to currently available anxiety medications.
A variety of psychiatric disorders are associated with deficits in sensorimotor gating,
including bipolar disorder, Tourette’s syndrome, autism spectrum disorders, and schizophrenia
(Geyer, 2006; Khoja et al., 2019). Sensorimotor gating is a process by which the brain
automatically filters out irrelevant sensory information in a stimulus laden environment. In animal
models, prepulse inhibition (PPI) deficits are traditionally produced by DA agonists, and deficits
in PPI are linked to deficits in sensorimotor gating. P2X4s were first noted to be involved in
sensorimotor gating in male mice who were given IVM at 10mg/kg. IVM had no effect on acoustic
startle, a basic test of sensorimotor gating, but decreased PPI, a more complex test whose
decreases are associated with deficits in sensorimotor gating (Bortolato et al., 2013; Geyer,
2006). Testing in P2X4 KO mice showed decreased acoustic startle amplitude and decreased
PPI. In the presence of IVM, P2X4 KO mice had increased acoustic startle response, but no
reduction in PPI was seen (Bortolato et al., 2013; Wyatt et al., 2013). This data indicated that
P2X4s were likely modulators of sensorimotor functioning. P2X4 KO mice given DA antagonists
showed increased PPI (Khoja et al., 2016). Further studies conducted in WT mice given DA
agonists or antagonists alongside IVM showed that a D1 and D2 antagonists could mediate the
decreases in PPI cause by IVM alone (Khoja et al., 2019). The effects of P2X4 positive modulation
and its mediation by DA antagonists indicate that P2X4s are exhibiting effects of a DA agonist,
strengthening the case for P2X4’s role in DA modulation.
17

1.4.1.3 Neurodegenerative Diseases
MS is an autoimmune disease characterized by immune cells attacking the myelin sheaths
of oligodendrocytes, resulting in demyelination. As the disease progresses, microglia and
macrophages play a large role in related neurodegeneration (Domercq et al., 2019). Research
performed on MS and P2X4s focuses on the role of P2X4 expressed in microglia, as studies
indicate there is an upregulation of P2X4 expression in the microglia of patients with MS
(Vazquez-Villoldo et al., 2014; Zabala et al., 2018). A 2013 study indicates P2X4 antagonism in
early stages of MS results in reduced cell death, and may result in reduced neuronal impairment
in early stage MS (Vazquez-Villoldo et al., 2014). However, further studies found that P2X4
activation in MS rodent models can lead to increased remyelination via P2X4’s ability to increase
BDNF (Huo & Chen, 2019; Verma et al., 2017; Zabala et al., 2018). This may occur due to BDNFs
ability to enhance oligodendrocyte differentiation and myelination, or via a paradoxical effect
where increased inflammation allows for a shift/increase in anti-inflammatory activity (Domercq et
al., 2019; Zabala et al., 2018). A variant haplotype, rs765866317:G>A [p.G135S], of the P2X4
was found in patients living with MS and studies performed in HEK293 cells indicated this
increased ATP induced currents and Ca
2+
response (Wiley et al., 2016). Disruption of
transmembrane cation channels is suggested to be a potential mechanism of MS disease
progression (Sadovnick et al., 2017). P2X4s may work to restore the disruption of cations to
homeostatic levels. Ultimately, the targeting of P2X4s via PAMs may help promote myelin repair
in MS (Domercq & Matute, 2019).
Several studies have been conducted to evaluate the purinergic receptors’ relationship to
the most prevalent neurodegenerative disease, AD, but very few studies have looked at P2X4’s
role in the disease. A recent study, in rats, suggested increased P2X4 expression led to learning
and memory deficits, implicating the receptor as a potential contributing factor to the pathology of
the disease (Metryka et al., 2019). In agreement with this interpretation, β-amyloid1-42 promotes
the accumulation of neuronal P2X4s, and increased expression of P2X4s in cell culture increased
18

the toxic effect of β-amyloid1-42 (Varma et al., 2009). Contradictory evidence reported a prion
protein that co-localized intracellularly with P2X4s resulting in decreased P2X4 expression,
suggesting that a decrease in P2X4s expression may be linked to AD (Carneiro et al., 2016). A
recent study evaluated the role of P2X4s found in memory-impaired diabetic rats, in which a
decrease in P2X4 hippocampal expression, agreeing with the findings that decreased P2X4
expression is correlated with deficits in learning and memory. In addition, differences between
healthy control rats and diabetic rats were observed, in which hippocampal P2X4s were
expressed mainly on microglia as opposed to neurons (Zhang et al., 2020). These studies suggest
that P2X4s present in both microglia and neurons may affect or be linked to AD pathology, with
correlations linking increased expression on neurons to AD and decreased microglial expression
to AD. Further studies are still necessary to determine the mechanistic role P2X4s play in AD.
19

Dissertation Hypothesis
1.5.1 P2X4 Modulation as a Druggable Target
Evidence from the laboratories of Davies and Jakowec/Petzinger suggests P2X4s
represent a novel candidate for DA modulation. P2X4s have been found to localize in striatal
MSNs and evidence has linked purinergic receptors and DAergic interactions (Khoja et al., 2016;
Pankratov et al., 2009). In addition, P2X4s have a wide distribution throughout the brain, i.e. the
striatum, hippocampus, spinal neurons, cerebral cortex, and hypothalamus, and located on both
postsynaptic and presynaptic neurons. Presynaptic P2X4s may increase the release of
neurotransmitters, such as DA, upon their activation through a number of potential mechanisms
(Figure 1.3) (Amadio et al., 2007; Pankratov et al., 2009). When activated, P2X4s increase
intracellular Ca
2+
, at levels comparable to AMPA receptor activation. Since P2X4s do not require
a change in membrane potential, they are able to contribute to Ca
2+
signaling at resting potential
Figure 1.3 The potential mechanism via which P2X4 activation can increase DA release from a
presynaptic neuron.
Increased activity is denoted by green arrows, black arrows show the flow of calcium, and blue arrows
denote potential pathways. P2X4 activation will lead to increased intracellular calcium levels. Once inside
the presynaptic neuron calcium can increase DA mobilization into vesicles(a.), increase the number of
vesicles ready for release(b.), and facilitates vesicle fusion and release(c.). Overall, increased calcium
via P2X4 activation results in increased DA in the synaptic cleft.

20

(Pankratov et al., 2009). This may help to prevent excessive Ca
2+
levels within neurons which can
contribute to mitochondria overload, ecotoxicity, and even cell death (Zaichick et al., 2017).
Suggesting one mode of action for P2X4 to change in DA activity could be via increase of
intracellular Ca
2+
in the presynaptic neurons (Figure 1.3).
Preliminary work in the Davies lab conducted with a PD mouse model, the 6-
hydroxydopamine (6-OHDA) model, indicates P2X4s are involved in alterations in motor behavior.
The 6-OHDA lesioning model is often used to model Parkinson’s in laboratory animals; this is
done by selectively depleting DA in targeted regions of the brain. By creating a unilateral medial
forebrain bundle (MFB), mice will exhibit rotational motor behavior, which can be influenced
through the administration of drugs such as L-DOPA (Boix et al., 2015). Khoja et al. tested mice
who had 6-OHDA MFB lesions with L-DOPA, L-DOPA + IVM, and IVM alone to evaluate the
effects of these drugs on the rotational behavior in mice. When L-DOPA was given to MFB 6-
OHDA lesioned mice, a contralateral, in respect to the lesioned side, rotational behavior was
observed. These contralateral rotations are considered anti-parkinsonian (Boix et al., 2015). In
the mice who were given IVM (5mg/kg IP, 8 hours prior to testing) in combination with L-DOPA
(5mg/kg subcutaneous, 5 minutes prior to testing) a significant increase in contralateral rotations
and an increase in the duration of the contralateral rotational behavior was observed, in
comparison to L-DOPA alone (5mg/kg subcutaneous, 5 minutes prior to testing). IVM on its own
did not significantly change the rotational behavior in the mice (Khoja et al., 2016). This data
suggests that, in the presence of L-DOPA, IVM can improve motor behavior in animal models of
Parkinson’s. However, the lack of IVM effect on its own suggests that ivermectin is likely unable
to affect motor behavior in models of DA depletion. L-DOPA increases the DA available (as DA
is lost due to the lesioning), without DA available IVM may no longer be able to exert its behavioral
effects on animals. The interaction between IVM and DA needs to be continually explored as it is
believed there is an interaction between the P2X4, positively modulated by IVM, and DA (Khoja
et al., 2016).
21

1.5.2 Hypothesis
Evidence supports the hypothesis that P2X4s represent a protein candidate that can
modulate DA activity. This is due, in part, to behavioral and expression studies identifying P2X4s
in the nigrostriatal pathway and mesolimbic pathways linked to DA. For example, presynaptic
P2X4s may increase calcium influx in neurons leading to increase in neurotransmitter release
including DA. Further, positive allosteric modulation of P2X4s by IVM and MOX decreases
drinking behavior in mice. The reduction may be linked to activity in the mesolimbic pathway
where DA is recognized as playing an important role. This information, coupled with investigations
reporting that P2X4s co-localize with DA neurons in the SNpc and GABAergic striatal neurons
suggests that P2X4s represent a novel treatment target for diseases with aberrantly functioning
DA systems (e.g., Parkinson’s disease). PD results from degeneration of neurons in the
nigrostriatal and mesolimbic pathways, and causes a variety of motor, behavioral and cognitive
impairment in patients. For those suffering from PD, there is no cure, and the discovery of new
molecules that could modify or improve current treatment options would represent a significant
improvement to the patient’s quality of life. The overarching hypothesis of my proposal is that
P2X4s represents a novel drug target for PD.
In that IVM and MOX are approved for use in humans, success of this proposal could lay
the groundwork for advancing these drugs to the clinic for PD patients. Over the course of my
research, I tested the hypothesis that presynaptic modulation of P2X4s lead to changes in DA in
the rodent brain, with special focus on the nigrostriatal and mesolimbic pathways.

22

CHAPTER 2
Chapter published: Warnecke, A.M.P., Kang, M.S., Jakowec, M.W., and Davies, D.L. (2020). The
macrocyclic lactones Ivermectin and Moxidectin show differential effects on rotational behavior in
the 6-hydroxydopamine mouse model of Parkinson's Disease. Behav Brain Res, 112804.

Abstract
Parkinson’s disease (PD) is a common neurodegenerative disease characterized by motor
and cognitive deficits, the result of dopamine (DA)-depletion within the basal ganglia. Currently,
DA replacement therapy in the form of Sinemet (L-DOPA plus Carbidopa) provides symptomatic
motor benefits and remains the “gold standard” for treatment. Several pharmacological
approaches can enhance DA neurotransmission including the administration of DA receptor
agonists, the inhibition of DA metabolism, and enhancing pre-synaptic DA release. DA
neurotransmission is regulated by several receptor subtypes including signaling through the
purinergic system. P2X4s (P2X4Rs) are a class of cation-permeable ligand-gated ion channels
activated by the synaptic release of extracellular adenosine 5'-triphosphate (ATP). P2X4Rs are
expressed throughout the central nervous system including the dopaminergic circuitry of the
substantia nigra, basal ganglia, and related reward networks. Previous studies have
demonstrated that P2X4Rs can modulate several DA-dependent characteristics including motor,
cognitive, and reward behaviors. Ivermectin (IVM) and moxidectin (MOX) are two macrocyclic
lactones that can potentiate P2X4Rs. In this study, we sought to investigate the role of P2X4Rs
in mediating DA neurotransmission by exploring their impact on DA-dependent behavior,
specifically rotation frequency in the unilateral 6-hydroxydopamine-lesioned mouse model of DA-
depletion. While we did not observe any differences in the degree of lesioning based on
immunostaining for tyrosine hydroxylase between sexes, male mice displayed a greater number
of rotations with L-DOPA compared to female mice. In contrast, we observed that IVM plus L-
DOPA increased the number of rotations in female, but not male mice. These findings highlight
23

the potential role of pharmacologically targeting the purinergic receptor system in modulating DA
neurotransmission as well as the importance of sex differences impacting outcome measures.
Keywords: dopamine, purine, ATP, adenosine, motor behavior, P2X4s
24

Introduction
Parkinson’s disease (PD) is a progressive and chronic neurodegenerative disorder
affecting 1% of the population over the age of 65 years. It is characterized by motor deficits,
including bradykinesia, postural instability, tremor, and gait disturbances, and by non-motor
deficits impacting cognition, memory, and learning (Ambani & Van Woert, 1973; Antonini et al.,
2018; Foster & Hoffer, 2004; Poewe et al., 2010). The primary pathological hallmarks of PD
include degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNpc) and
the ventral tegmental area (VTA), resulting in DA-depletion in the basal ganglia and its circuitry
(Fahn & Sulzer, 2004; S.R.W. Stott, 2013). Current treatment strategies are symptomatic,
involving dopamine (DA) replacement therapy with Sinemet, a combination of L-DOPA (the
precursor to DA) and Carbidopa (a peripheral DOPA decarboxylase inhibitor), or with DA receptor
agonists (Kowal et al., 2013; Rossi et al., 2018). Currently, there is no cure for PD and limitations
with DA-replacement therapies highlight the need for new therapeutic interventions.
Numerous pharmacological strategies have been utilized to increase DA
neurotransmission including the development of DA receptor agonists, central inhibitors of DA
metabolism, enhancement of DA vesicular release, and blocking of its uptake (Amadio et al.,
2007; Ambani & Van Woert, 1973; Antonini et al., 2018; Foster & Hoffer, 2004; Poewe et al.,
2010). While these therapies are focused on DA itself and DA receptors, limited breakthroughs
have been made in the pharmacological treatment of PD symptoms. To address this limitation,
other neurotransmitter systems reported to regulate DA neurotransmission need to be evaluated.
P2X receptors (P2XRs) are one such target to be considered. P2XRs are a family of cation-
permeable ligand-gated ion channels activated by synaptic release of extracellular adenosine-5'-
triphosphate (ATP). Specifically, the P2X4 receptor (P2X4R) subtype is expressed throughout the
central nervous system (CNS) including its co-localization to dopaminergic neurons in the SNpc
and with gamma-aminobutyric acid (GABA) containing projection neurons in the striatum (Xu et
25

al., 2016). P2X4Rs have been shown to regulate DA neurotransmission via DA release,
increasing the expression of DA receptors and DA transporter (DAT), and increasing biosynthesis
through the enzyme tyrosine hydroxylase (TH) (Asatryan et al., 2014; Burnstock et al., 2011;
Franklin et al., 2014; Khoja et al., 2016; Metryka et al., 2019; Xiao et al., 2008). Therefore,
targeting purinergic neurotransmission may enhance DA availability through a number of different
mechanisms. While no selective P2X4R agonists are currently available, the macrocyclic lactones
ivermectin (IVM) and moxidectin (MOX) act as positive modulators of P2X4Rs (Jelínková et al.,
2006; Zemkova et al., 2007). IVM results in a concentration-dependent increases in ATP
activation, and can decrease the desensitization rate of P2X4Rs resulting in a positive modulation
of currents (Franklin et al., 2014; Khakh et al., 1999).
In this study, we sought to further investigate the role of P2X4Rs in mediating DA
neurotransmission by exploring the impact of IVM and MOX on DA dependent behavior,
specifically rotation frequency in the unilateral 6-hydroxydopamine (6-OHDA) lesioned mouse
model of DA-depletion. Previous work in our laboratory has focused on the role of P2X4Rs in
mediating alcohol drinking behavior in mice. For example, genetic knock-out or shRNA mediated
knockdown of P2X4Rs leads to increased alcohol drinking behavior while pharmacological
application of the positive modulators of the P2X4R, IVM and MOX, can reduce alcohol preferring
drinking behavior (Asatryan et al., 2010; Franklin et al., 2014; Huynh et al., 2017; Khoja, Huynh,
Warnecke, et al., 2018; Yardley et al., 2012). Further, our findings support that, in part, the effects
of IVM and MOX to reduce drinking behavior are linked to the modulation of DA activity (Khoja,
Huynh, Asatryan, et al., 2018; Khoja, Huynh, Warnecke, et al., 2018; Khoja et al., 2016; Wyatt et
al., 2014; Yardley et al., 2014). These findings suggest close interactions between purinergic
neurotransmission, DA neurotransmission, the DA-dependent reward system, and reward-
dependent behaviors including alcohol drinking behaviors. However, precise details of the
underlying mechanisms remain unclear.
26

For these studies, we utilized a unilateral 6-OHDA mouse model of DA-depletion. By
targeting toxin to the medial fiber bundle (MFB) results in near complete depletion of striatal DA
in the ipsilateral hemisphere leaving the contralateral side intact (Khoja et al., 2016). Rotational
behavior induced by selective activation via increased pre-symptomatic release (by
amphetamine), over-activates the intake hemisphere leading to rotation towards the lesioned side
(termed ipsi-lateral rotation), while application of a DA agonist activates the lesioned side due to
hyper-sensitivity of the post-synaptic DA receptors resulting in rotation away from the lesioned
site (termed contra-lateral rotation). Thus, rotational behavior in the 6-OHDA-lesioned rodent
serves as an excellent model to explore DA-neurotransmission. By examining the profile of
rotations in this model, we analyzed the potential for IVM or MOX to enhance DA
neurotransmission, as reflected by changes in rotational behavior.
While the majority of these studies utilized male mice, we also included female mice to
begin investigation of potential differences in response, related to sex in our outcome measures.
Studies conducted in human and animal models have determined since there are data supporting
(i) sexual dimorphism of DA neurotransmission including metabolism and receptor expression, (ii)
there is an elevated male to female ratio in PD, (iii) sex hormones especially estrogen are
neuroprotective in animal models of DA-depletion, and (iv) therapeutic responses to PD treatment
can show sex differences (Baraka et al., 2011; Lee et al., 2019; Ullah et al., 2019). The purpose
of this study was not to explicitly evaluate the cause of sex differences in PD or the 6-OHDA
model, but to gain a better understanding of pharmacological differences that exist in the model
and if these differences are a factor in P2X4R targeted adjunct therapy. Overall, we found IVM to
induce a greater number of rotations compared to MOX and that the number of rotations differed
between male and female mice. In addition, we observed sex differences in these responses
highlighting the importance of taking into consideration the importance of including female groups
in these and similar pharmacological studies.
27

Methods
2.2.1 Animals
C57BL/6J mice male (n= 26) and female (n = 28) 6-8 weeks of age (Jackson Laboratories;
Bar Harbor, Maine, United States) were group housed 5 to a cage in a 12-hour light and 12-hour
dark cycle with ad libitum access to food and water. All experiments were conducted in
accordance with the NIH Guide for the Care and Use of Laboratory Animals (NIH Publication No.
80-23, revised 1996) and approved by the University of Southern California Institutional Animal
Care and Use Committee. All behavioral studies were carried out at the start of the dark cycle.
2.2.2 Stereotaxic Surgery with 6-OHDA
Stereotaxic surgery was carried out as previously reported [14]. Briefly, 30 minutes prior
to surgery mice were given desipramine hydrochloride (HCl) (25 mg/kg in 0.9% saline, I.P; cat.
No. D3900 Sigma-Aldrich, St. Louis, Missouri, United States) to prevent damage to the
noradrenergic pathways. Mice were anesthetized with 4% isoflurane plus O2 (400 mL/min). Once
completely anesthetized, isoflurane was reduced to 2% to allow steady anesthetization without
negative respiratory effects. The 6-OHDA (2 µL of 4 mg/mL in 0.2% ascorbic acid and 0.9% saline;
cat. no. H4381, Sigma-Aldrich, St. Louis, MO) or saline (0.9%) was delivered to the left medial
forebrain bundle (MFB) (AP:1.3mm, ML:1.1mm lateral, DV:5mm) at a rate of 0.5 µL/min. Following
6-OHDA delivery, the needle remained in place for 5 minutes and retracted at a rate of 0.1 mm
per 15 seconds.
2.2.3 Rotation Behavior
Figure 2.1 6-OHDA behavioral timeline.
The timeline of behavioral testing all mice were subject to after 6-OHDA lesioning.

28

6-OHDA lesions were allowed to stabilize for 4 weeks and the degree of ipsilateral
lesioning was assessed by determining the number of d-Amphetamine (AMPH) (5.0 mg/kg in
0.9%saline, I.P; cat. no. A-5880, Sigma-Aldrich, St. Louis, Missouri, United States) induced
ipsilateral rotations (Figure 2.1). Before testing each compound, all mice were subject to a
baseline rotation test for 10 minutes. Then AMPH was administered and the number of ipsilateral
rotations starting after injection and over a 120-minute period counted. Mice that displayed more
than 180 rotations in 120 minutes were considered lesioned and included in the study while those
failing achieve this threshold were excluded. Parameters of rotation data were documented to
assess behavior of the mice obtained following the 120-minute period including; (i) net rotations
per 10-minute bin, (ii) total net rotations. No mice displayed spontaneous rotations when injected
with saline. The total number of lesioned mice used in these studies was n=8 male and n=12
female.
Following a 7-day washout period, rotational behavior was assessed with test compounds.
Compounds used in rotational studies included L-DOPA (cat. no. PHR1271, Sigma-Aldrich, St.
Louis, Missouri, United States), benserazide (cat. no. B7283, Sigma-Aldrich. St. Louis, Missouri,
United States), moxidectin (MOX) (cat. no. NDC 0010-3841-02, Boehringer Ingelheim, Ingelheim,
Rhineland-Palatinate, Germany), and ivermectin (IVM) (cat. no. NDC 55529-012-01, Norbrook
laboratories, Ltd, Newry, North Ireland, United Kingdom). The parameters of rotation data were
documented to assess behavior of the mice obtained following the 90-minute period including; (i)
net rotations per 10-minute bin and (ii) total net rotations. The following tests were carried out: L-
DOPA (5.0 mg/kg with 1.25 mg/kg benserazide in 0.9% saline, S.C.), L- DOPA + MOX (2.5 mg/kg,
or 5 mg/kg in 0.9% saline, I.P), L- DOPA + IVM (1.25 mg/kg, 2.5 mg/kg, or 5.0 mg/kg in 0.9%
saline I.P). Due to the prolonged CNS penetrance of MOX and IVM [11,12], rotational behaviors
were determined 4 and 8 hours after initial injections, respectively, starting after L-DOPA injection.
A subset of mice were used for preliminary dose escalation studies after all other testing was
complete and were used for either MOX (n=3) or IVM (n=5) concentration escalation testing with
29

a minimum 72 hours washout between doses. Rotational behavior sessions were videotaped and
quantitated by researchers blinded to the treatment group.
2.2.4 Immunohistochemical Staining for Tyrosine Hydroxylase (TH)
The degree of 6-OHDA-lesioned was confirmed in all mice after completion of behavioral
testing. Mice were anesthetized with avertin (25 mg/kg, I.P.) and transcardial perfused with 4%
phosphate buffered saline (PBS), followed by 4% paraformaldehyde (PFA in PBS). Brains were
removed and immersed in 4% PFA in PBS overnight, followed by sinking in 20% sucrose in PB,
then flash frozen in isopentane on dry ice. Striatal slices at 25 µm thickness in the coronal
orientation were cut on a freezing microtome (CM1900, Leica, Wetzlar, Hesse, Germany) and
immersed in PBS solution. Sections were washed TBS solution, blocked in 4% normal goat serum
with TBS+Triton X-100 (0.2%), and exposed to tyrosine hydroxylase primary antibody (1:5000
dilution, cat. no. MAB318, Millipore, Burlington, Massachusetts, United States) in 2% normal goat
serum and TBS+Triton X-100 (0.2%) at 4°C for 48 hours. Following washes in TBS sections were
incubated in IRDye® 800CW secondary antibody (1:20000 dilution, Licor, Lincoln, Nebraska,
United States) in 2% normal goat serum plus TBS+Triton X-100 (0.05%) for 1 hour at room
temperature. Sections were washed with TBS-Triton X-100 (0.5%) then TBS and images captured
by scanning on a Licor Odyssey Imaging System (Lincoln, Nebraska, United States). The degree
of immunostaining in the dorsal striatum of each section was assessed using the imagine analysis
program Image J1.6 correcting for fluorescence background (Schneider et al., 2012). The degree
of 6-OHDA-lesioning was expressed as percent decline in immunostaining comparing the
ipsilateral and contralateral dorsal striata.
2.2.5 Statistical Analysis
Statistical analysis was performed using R (R Core Team (2013) R: A language and
environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
30

URL http://www.R-project.org/.) with packages dplyr, ggplot2, plyr, DescTools and ggsignif
installed. A two-way ANOVA with replication was used to assess effects of P2X4R modulation on
behavioral outcomes. For AMPH data we evaluated treatment (lesioned vs not lesioned) by sex
(male vs Female), and treatment (lesioned vs no lesioned) by time (in 10-minute bins from 0-120
minutes). For L-DOPA data we evaluated treatment (lesioned vs not lesioned) by sex (male vs
Female), and treatment (lesioned vs no lesioned) by time (in 10-minute bins from 0-90 minutes).
In the IVM and MOX data we separated out the male and female mice due to their significantly
different L-DOPA rotational behavior. We then analyzed treatment (L-DOPA only, L-Dopa+ IVM,
and L-DOPA+ MOX) by time (in 10-minute bins from 0-90 minutes). One-way ANOVAs were
conducted to evaluate the effects of treatment (L-DOPA only, L-Dopa+ IVM, and L-DOPA+ MOX)
on total rotations. The same format was followed for data collected on IVM at various doses and
MOX at various doses using two-way and one-way ANOVAs. A three-way ANOVA was not
conducted for any of the data set, as the authors felt it was not appropriate to compare
sex*treatment*time. Considering the baseline differences in L-DOPA rotations mice were
separated into two different data set for all L-DOPA, L-DOPA + IVM, or L-DOPA + MOX
comparison data sets. A between-subjects design was incorporated to determine if there were
any significant effects between the treated 6-OHDA animals versus untreated 6-OHDA animals,
as well as 6-OHDA injected versus saline injected animals. Significance was set at p < 0.05.
Results
2.3.1 Assessment of the Degree of 6-OHDA lesioning

31

Table 2.1 Average AMPH Rotations performed compared to averaged lesion percentages.
The total number of net ipsilateral rotations performed over the course of 120 and total striatal lesion with
the SEM listed after the average.

Treatment Gender
& number
AMPH Net Rotation
120 Min
Percent Lesioned
Lesioned M n=8
281.38±62.27 100.42±1.24
Lesioned F n=11
337.67±38.13 94.94±2.73

Targeting 6-OHDA to the MFB results in the near complete depletion of striatal TH
immunoreactivity (TH-ir) ipsilateral to the lesion (Figure 2.2). Collectively, in all mice, there was a
98.5% reduction in TH-ir. There was no significant difference in the degree of dorsal striatal TH-
ir depletion between male mice (100.4 ± 1.2% depletion, n=8) and female mice (94.9 ± 2.7%
depletion, n=11), F (11,7) = 7.29, p > 0.05 Welch Two sample t-test (Table 2.1). Saline injected
mice were not evaluated for TH staining as they displayed no rotational behavior. This behavior
is a surrogate marker for lesioning, and as such a lack or rotation indicates a lack of lesioning.
32

2.3.2 Female Mice Showed a Greater Number of AMPH-induced Rotations than Male
Mice
AMPH-induced ipsi-lateral rotational behavior was examined in male (n=8) and female
(n=12) mice for a 120-minute period before reverting to baseline levels (Figure 2.3). Female mice
showed a greater peak height in the number of total rotations in the first 20 minutes. There was a
statistically significant increase in the 10-20-minute bin comparing female mice (52.25 ± 6.82 net
rotations) to male mice (20.25 ± 5.95 net rotations), two-way ANOVA for sex*time (F (12,234)= 3.322
p < 0.01), with post hoc Tukey correction (p < 0.01) (Figure 2.3A). Over the entire 120-minute
period there was no statistically significant difference in the total number of net rotations between
female mice (338.08 ± 131.58 total net rotations) and male mice (281.38 ± 62.27 total net
rotations), two-way ANOVA for lesion*sex (F (1,36) = 0.128 p = 0.722) (Figure 2.3B).
Figure 2.2 TH stains of MFB 6-OHDA lesioned and saline injected mice
A) Saline injected, “nonlesioned”, male mouse. B) Male mouse with a MFB “lesion” C) Optical density of
TH in the nonlesioned hemisphere versus the lesioned hemisphere (98.5% decrease), normalized to the
nonlesioned hemisphere

33

2.3.3 Male Mice Showed Greater Number of L-DOPA-induced Rotations Compared to
Female Mice
L-DOPA-induced contra-lateral rotational behavior was examined for a 90-minute period
before reverting to baseline levels (Figure 2.3). There was a statistically significant effect of sex
(males n=8; females n=12, two-way ANOVA, F (9,180) = 26.27, p < 0.01, Tukey p < 0.01) but not a
significant sex*time interaction (Figure 2.3C). There was a statistically significant difference in net
contralateral rotations between male mice (309.75 ± 62.15 net rotations) and female mice (132.58
± 40.19 net rotations), two-way ANOVA, F (1,36) = 7.156, p < 0.05, Tukey p < 0.01) (Figure 2.3D).

34

2.3.4 IVM Increases L-DOPA-induced Rotational Behavior
Figure 2.3 AMPH (5.0 mg/kg), and L-DOPA (5.0 mg/kg), rotations comparing male and female mice
A) Graph of number of rotations performed per 10 minute bin over the course of 90 minutes after AMPH
administration (5.0 mg/kg) by males (n=8) versus female (n=12) 6-OHDA lesioned mice, with female mice
performing significantly more rotations at the 10-20 minute window( p<0.05), suggesting a sex difference in the
6-OHDA MFB model * indicates p<0.05. B) The difference in net ipsi-lateral APHM rotations over 120 minutes
in mice who were successfully lesioned with 6-OHDA (male mice n=8, female mice n=12), and “non-lesioned”
with saline (male mice n=10, female mice n=10). C) Graph of number of rotations performed per 10 minute bin
over the course of 90 after L-DOPA administration (5.0 mg/kg) minutes by males(n=8) versus female (n=12) 6-
OHDA lesioned mice with a significant sex effects, again suggesting a sex difference in the 6-OHDA MFB
model.* indicates p<0.05. D) The difference in net contra-lateral L-DOPA rotations of mice who were
successfully lesioned with 6-OHDA (male mice n=8, female mice n=12), and injected with saline (male mice
n=10, female mice n=10). * indicates p<0.05 between male and female lesioned mice.

35

The effect of IVM and MOX administration on L-DOPA-induced rotations was examined
in both male and female 6-OHDA-lesioned mice. In male mice (n=8 for each treatment group),
we compared the number of net rotations in groups treated with L-DOPA alone, L-DOPA + IVM,
and L-DOPA + MOX. Comparing rotations per 10-minute bin with a two-way ANOVA for
treatment*time, we found a significant impact of treatment (F (2,210) = 14.450, p < 0.01) with a post
hoc Tukey test determining a significant difference between L-DOPA + IVM vs. L-DOPA alone (p
< 0.01) and L-DOPA + IVM vs. L-DOPA + MOX (p < 0.01) (Figure 2.4A). There was no statistically
significant difference between L-DOPA alone and L-DOPA + MOX. For analysis of the total net
Figure 2.4 L-DOPA Rotations in male versus
female mice
A) Graph of number of rotations performed per 10
minutes over the course of 90 minutes after L-
DOPA only (5.0 mg/kg), L-DOPA + IVM (5.0
mg/kg), or L-DOPA + MOX(2.5mg/kg)
administration in male 6-OHDA lesioned mice with
bars representing SEM, n=8 for all treatment
groups. When comparing rotations per 10 minutes
with a two way ANOVA for treatment*time there
was a significant impact of treatment ( p<0.01) with
a post hoc Tukey test determining a significant
difference between L-DOPA+ IVM versus L-
DOPA(p<0.01) and L-DOPA+ IVM versus L-DOPA
+ MOX(p<0.01).There was no treatment*time
interaction. B) Graph of number of rotations
performed per 10 minutes over the course of 90
minutes after L-DOPA only (5.0 mg/kg), L-DOPA +
IVM (5.0 mg/kg), or L-DOPA + MOX (2.5 mg/kg)
administration in female 6-OHDA lesioned mice
with bars representing SEM, n=12 for all treatment
groups. There was a significant difference with
treatment*time interaction (p<0.01) at numerous
time points. * indicates p>0.05 versus L-DOPA
only rotations.

36

contralateral rotations, a one-way ANOVA was performed to compare L-DOPA alone, L-DOPA +
IVM, and L-DOPA + MOX groups. We found an effect of treatment (F (2,21) = 2.645, p < 0.1). A
post hoc Tukey test revealed a difference in total rotations in L-DOPA + IVM (498.1 ± 54.54) vs.
L-DOPA alone (309.8 ± 62.15) showing that IVM increases the number of rotations (p < 0.1).
In female mice (n=12 for each treatment groups, we compared the number of net rotations
in groups treated with L-DOPA alone, L-DOPA + IVM, and L-DOPA + MOX. As shown in Figure
2.4B, comparing rotation data with a two-way ANOVA for treatment*time there was a significant
impact of treatment*time (F (18,330) = 4.421, p < 0.01) with a post hoc Tukey test determining a
significant difference between L-DOPA + IVM vs. L-DOPA alone (p < 0.05) in every 10 minute bin
between 10 minutes and 60 minutes. Total rotations were evaluated with a one-way ANOVA to
compare L-DOPA alone, L-DOPA + IVM, and L-DOPA + MOX rotations and we found an effect
of treatment (F (2,33) = 16.54, p < 0.01) and a post hoc Tukey test revealed that total L-DOPA +
IVM rotations (973.17 ± 166.79) vs. L-DOPA alone (132.58 ± 40.19) (p < 0.01) were significantly
different.
In this study effects of IVM or MOX, per se, were not explicitly studied. This was due to
previous reporting that IVM alone had no effects on rotational behavior in the 6-OHDA MFB lesion
model (Khoja et al., 2016). Furthermore, at the start of the L-DOPA + IVM and L-DOPA + MOX,
0-minute time bin indicative of baseline rotations, there were no significant differences in number
of rotations. During this time window IVM and MOX would be pharmacologically active in the mice
without the presence of L-DOPA. Any behavioral effects of IVM or MOX on their own would be
captured at this time point.

37

2.3.5 Effect of Different Doses of MOX or IVM on L-DOPA-induced Rotational Behavior
We used a subset of 6-OHDA lesioned mice to preliminary examine the effect of different
doses of MOX (5.0 and 2.5 mg/kg) or IVM (1.25, 2.5, and 5.0 mg/kg) on the number of L-DOPA-
induced rotations in 6-OHDA-lesioend male mice and female mice (Figure 2.5). In male mice (n=3
for each treatment group) there was no significant treatment effect on total rotation with a one-
Figure 2.5 The effect of IVM and MOX doses on net contra-lateral rotations performed over 90 minutes in
the presence of L-DOPA with error bars representing SEM.
A) n=3 for L-DOPA alone and n=3 for all other treatment groups, no significant effect on rotations of different
MOX doses, 2.5 mg/kg and 5.0 mg/kg, on lesioned male mice B) n=5 for each treatment, no significant
effect on rotations of different IVM doses on lesioned male mice. C) n=3 for L-DOPA alone and n=3 for all
other treatment groups, no significant effect on rotations of different MOX doses, 2.5 mg/kg and 5.0 mg/kg,
on lesioned female mice. D) n=5 for each treatment, there was a significant treatment effect difference on
net contra-lateral L-DOPA rotations of female lesioned mice across all doses of IVM given compared to L-
DOPA alone. * indicates p<0.05 between compared to L-DOPA alone.

38

way ANOVA (F (2,6) = 0.064, p = 0.938) on the number of net total rotations comparing L-DOPA
alone (257.33 ± 90.23 net rotations), L-DOPA + MOX (2.5 mg/kg) (279.67 ± 119.83 net rotations),
and L-DOPA + MOX (5 mg/kg) (232.67 ± 56.77 net rotations) (Figure 2.5A). Also in male mice
(n=5 for each treatment group), there was no statistically significant treatment effect of IVM dose
on total rotations ( F (3,16) = 1.576, p = 0.234 ) for L-DOPA alone (341.2± 87.82 net rotations)
compared to L-DOPA + IVM (5 mg/kg) (570.2 ±6 5.32 net rotations), L-DOPA + IVM (2.5 mg/kg)
(646.4 ± 161.37), and L-DOPA + IVM (1.25 mg/kg) (569.8 ± 79.38) (Figure 2.5B).
In female mice (n=3 for each treatment group) there was a no statistically significant
treatment effect in the total number of net rotations (one-way ANOVA, F (6, 2) = 2.031, p =0.212)
comparing L-DOPA alone (165.67 ± 89.28 net rotations), L-DOPA + MOX (2.5 mg/kg) (238.00 ±
86.59 net rotations), and L-DOPA + MOX (5 mg/kg) (443.33 ± 123.19 net rotations) (Figure 2.5C).
Female mice (n= 5 for each treatment group) had a significant treatment effect on the number of
net total rotations with IVM (F(3,16) = 5.168, p< 0.05) comparing L-DOPA alone (172.6 ± 41.98 net
rotations) compared to L-DOPA + IVM (5 mg/kg) (663.2 ±132.11 net rotations), L-DOPA + IVM
(2.5 mg/kg) (662.0 ± 134.23 net rotations), and L-DOPA + IVM (1.25 mg/kg) (725.4 ± 118.14 net
rotations), all with p < 0.05 for post hoc Tukey test. Two-way ANOVA indicated that there were
no significant differences between the three different IVM dosing levels (Figure 2.5D).
Discussion
The goal of this study was to investigate the effects of two different macrocyclic lactones,
IVM and MOX on DA neurotransmission. The premise of this study is based on previous findings
showing that IVM could increase contralateral rotations in C57BL/6J male mice with MFB 6-OHDA
lesions (Khoja et al., 2016). Since its inception, the 6-OHDA-lesioned rodent model has been
instrumental in identifying pathophysiological changes in DA neurotransmission, and served as a
tool to characterize therapeutic treatments in Parkinson’s disease (PD) (Bagga et al., 2015;
Grandi et al., 2018; Henry et al., 1998; Tolwani et al., 1999; Ungerstedt, 1968; Yuan et al., 2005).
39

The MFB lesion model depletes DA in the dorsal and ventral striatum and leads to cell death in
both the SNpc and VTA. The destruction of both the mesolimbic and nigrostriatal pathways
induces rotational behavior (Dunnett, 2005; Koshikawa, 1994; Pycock & Marsden, 1978; Saigusa
et al., 1993). While rotation behavior is focused on dopamine receptor activation it is important to
also consider the potential role of other neurotransmitters and dopaminergic projections other
than the nigrostriatal pathway. Future studies may explore how the mesolimbic pathway can
influence rotation behavior by influencing motivation, fatigue, and reward. Additionally, the impact
of neurotransmitters, outside of DA, may also be involved in these pharmacological manipulations
including glutamatergic, GABA, serotonergic, and norepinephrine all of which have been shown
to influence dopamine release and dopamine neurotransmission(Matsuzaki et al., 2004;
Schwarting & Huston, 1996; Vegas-Suárez et al., 2020).
In agreement with previous work, we found that IVM significantly increased L-DOPA
induced rotational behavior. Unexpectedly, we found that administration of MOX did not
significantly affect L-DOPA rotational behavior. This was surprising in that, we had predicted MOX
would have increased rotational behavior since it and IVM have similar pharmacological targets.
This prediction was due to our previous alcohol studies, which found that MOX was more
efficacious, compared to IVM, in regard to the effective dose as well as time to onset, in reduction
of alcohol intake (Huynh et al., 2017). Additionally, AMPH and L-DOPA induced rotation behavior
occurred at different degrees in male versus female mice. L-DOPA + IVM altered DA related
behavior in female mice to a greater degree than in male mice based on rotation numbers.
We focused upon evaluating response to L-Dopa treatment to determine the potential benefits of
using a positive P2X4R modulator (i.e., IVM or MOX) as an adjunct therapy for PD (Asatryan et
al., 2010). In vivo, IVM and MOX were identified as candidates for DA modulation in studies that
reported drug mediated changes in drinking, depressive, anxious, locomotor, and sensorimotor
behavior (Bortolato et al., 2013; Khoja, Huynh, Warnecke, et al., 2018).
40

Despite similar structures, various macrocyclic lactones can have differential effects on
P2X4Rs in vivo and in vitro (Asatryan et al., 2014) . These differences, along with MOX’s ability
to decrease drinking behavior earlier and to a greater degree than IVM, originally lead us to
hypothesize MOX would increase rotations to a greater degree than IVM (Huynh et al., 2017).
Surprisingly, MOX did not have any significant impact on rotational behavior. Several factors may
explain why MOX can significantly ethanol intake but not significantly alter rotational behavior.
First, reduction in drinking behavior is due, in part, to the interactions between ethanol and MOX
or IVM binding to similar regions within the P2X4Rs (Asatryan et al., 2011; Asatryan et al., 2010;
Huynh et al., 2017; Ostrovskaya et al., 2011; Popova et al., 2010; Popova et al., 2020). This may
lead to a potential unique structural interaction on P2X4Rs between ethanol and MOX. Secondly,
while both IVM and MOX act as positive allosteric modulators of P2X4Rs (Asatryan et al., 2010;
Huynh et al., 2017), IVM has a stronger binding affinity than MOX (Asatryan et al., 2014; Khoja,
Huynh, Warnecke, et al., 2018; Popova et al., 2013). At lower doses (0.5 µM) IVM increased ATP
induced calcium currents over 20% from P2X4Rs while higher MOX concentrations (1µM) did not
reproduce even a 20% increase. In addition, IVM’s effect on rotation behavior was diminished in
P2X4RKO mice (Khoja et al., 2016). This suggests IVM’s effect on rotational behavior is in part
due to IVM’s interactions with P2X4Rs. Lastly, IVM is a strong positive allosteric modulator of γ-
Aminobutyric acid type A receptors (GABAARs), whereas MOX has a decreased ability to
produce GABAAR mediated GABA currents when compared to IVM (Huynh et al., 2017). These
different pharmacological features may explain the differences between IVM and MOX in our
experiments.
To further explore the pharmacology of P2X4R positive modulation, we utilized both male
and female mice, as sex differences are now recognized as a potential variable in experimental
therapeutics and drug discovery. In our experiments, the similarity of TH-ir depletion suggest that
parameters other than DA-depletion may underlie the observed sex-dependent differences, such
as differences in metabolism and DA signaling within the basal ganglia (Betancourt et al., 2017;
41

McEwen & Milner, 2017). Similarly, another 6-OHDA study conducted in rats reported TH
reduction was not significantly impacted by sex but did show altered motor behavior based on
sex; these differences may occur due to compensatory changes that differ in male versus female
mice (Field et al., 2006). Other reports on the effect of sex on DA-depletion, as a result of DA-
depleting agents, have described various degrees of TH depletion differences and behavioral
alterations based on sex (Bagga et al., 2015; Boix et al., 2015; Henry et al., 1998; Pienaar et al.,
2007; Tolwani et al., 1999). However, these studies are limited in number and have yet to evaluate
rotational behavior in female versus male mice in the MFB 6-OHDA model. Furthermore,
differences in the 6-OHDA lesion target, the amount of neurotoxin delivered, and the use of
different strain/specie of rodent used in other studies could account for absence of significant TH-
ir difference found in this study.
While no significant difference in DA depletion was found in this study, rotational behavior
was significantly impacted by sex. In our study the AMPH response varied biased upon sex and
suggests a possible alteration in presynaptic signaling, as AMPH alters presynaptic DA release
and reuptake (Bagga et al., 2015; Tolwani et al., 1999). Increased DA release or uptake on the
intact side of the female mouse brain could explain the increases in AMPH rotational behavior.
Estrogen promotes DA releasee in areas, including the striatum, and influences rotational
behavior when injected into the brain (McEwen & Milner, 2017). In the 6-OHDA model estrogen
is able to increase DA and its metabolites, potentially leading increases in DA uptake (Baraka et
al., 2011).
In response to L-DOPA alone, male mice were found to have increased rotational
behavior, suggesting increased DA receptor super-sensitivity in male mice (Vanhartesveldt &
Joyce, 1986). In humans, it is well documented that there are altered maximum concentrations
and bioavailability of L-DOPA in male versus female patients (Cerri et al., 2019; Mittur et al.,
2017). Varied pharmacological responses to L-DOPA by sex have been hypothesized to be the
result of altered aromatic L-amino acid decarboxylase (AADC) levels, different DA D1 receptor to
42

DA D2 receptor ratios, and/or varied calcium uptake capacity between the sexes (Cerri et al.,
2019; Mittur et al., 2017). Sex differences in response to L-DOPA treatment may provide a
potential explanation for the increased IVM treatment response found in female mice, as previous
studies conducted with IVM and MOX on ethanol consumption showed no effect of sex (Huynh
et al., 2017; Yardley et al., 2012).
IVM may work through several mechanisms, including increasing DA release and
decreasing decay kinetics, resulting in greater synaptic occupancy of DA. Additionally, there may
be differences in the degree of calcium uptake, where the capacity in males is greater than in
females (Cerri et al., 2019). In that P2X4Rs are able to flux calcium at levels similar to that of
NDMA receptors, increased calcium levels in females may, in turn, result in a mobilization of
intracellular DA via increased calcium (Zaichick et al., 2017). This increase may be a potential
mechanism via which IVM is able to increase rotational behavior in female mice. Future studies
are necessary to explore DA release and DA receptor expression patterns in both male and
female mice with DA-depleting lesions to identify either pre-synaptic or post-synaptic differences.
Overall, the sex-dependent differences identified in the present study reinforces the need for
studies in both male and female mice and may identify the need to consider sex differences in
the treatment of individuals with PD (Miller & Cronin-Golomb, 2010; Pankratov et al., 2009).
Conclusion
The present study found that IVM but not MOX significantly altered rotational behavior in
male and female mice using a mouse model of DA-depletion demonstrating significant differences
based on sex. The findings implicate the potential use of IVM as a lead candidate for use as a
novel adjunct therapy in combination with L-DOPA for PD patients. In addition, future
pharmacological studies are necessary to identify the mechanisms by which IVM impacts DA
neurotransmission and its behavioral outcome measures tacking into account differences in sex.
43

CHAPTER 3
Introduction:
The National Institute of Health estimates over half a million people in the United States
are living with Parkinson’s disease (PD), and about 50,000 people are newly diagnosed with PD
every year in the United States. In 2010, it was estimated that the national economic burden
caused by PD was over $14 billion (Kowal et al., 2013). PD is the second most common
neurodegenerative disease and to date there is no cure (Kowal et al., 2013; Rossi et al., 2018).
The degeneration of neurons in the substantia nigra pars compacta (SNpc) and the ventral
tegmental area (VTA), results in a loss of dopamine (DA), which is responsible for the motor and
nonmotor symptoms brought on by the disease (Fahn & Sulzer, 2004). DA plays a major role in
the mesolimbic pathway (associated with reward-based behavior), and the nigrostriatal pathway
(associated with motor control and reward-based cognition) (Fahn & Sulzer, 2004; S.R.W. Stott,
2013). The ability to modify dopaminergic activities within these pathways provides a potential
target for the treatment of dopaminergic disorders, including PD and addiction. The current gold
standard for PD treatment is levodopa (L-DOPA) treatment. L-DOPA helps patients manage their
motor and nonmotor disease symptoms but does not treat the disease and can cause a variety
of negative side effects including dyskinesia, impulse control problems, akinesia, somnolence,
edema, hallucinations and gastrointestinal upset (Ambani & Van Woert, 1973; Antonini et al.,
2018; Foster & Hoffer, 2004; Poewe et al., 2010). Due to these side effects and the limited break
throughs in PD drug discovery further efforts should be made to optimize L-DOPA therapy (Poewe
et al., 2010).
Recently, studies indicated that P2X4 receptor (P2X4) modulation was capable of altering
behavioral outcomes associated with DA linked disease/disorder, such as alcohol use disorder
(Bortolato et al., 2013; Khoja, Huynh, Warnecke, et al., 2018; Wyatt et al., 2014; Yardley et al.,
2012), anxiety (Bortolato et al., 2013; Khoja et al., 2019; Khoja et al., 2016), and PD (Khoja et al.,
44

2016; Warnecke et al., 2020). While the exact mechanistic effects of P2X4 modulation on the
DAergic system are not known, growing evidence suggest that: p2r4x gene deficient (P2X4 KO)
mice exhibit increased drinking behaviors (Khoja, Huynh, Asatryan, et al., 2018), P2X4 KO mice
have decreased anti-parkinsonian motor behavior in a PD model (Khoja et al., 2016), and P2X4
KO mice exhibit alterations post synaptic DA signaling markers in the striatum (Khoja et al., 2016).
Work by the Davies lab on the medial forebrain bundle (MFB) unilateral 6-hydroxydopamine (6-
OHDA) lesion, found P2X4 positive allosteric modulator (PAM), Ivermectin (IVM), was capable
of increasing rotational behavior in the presence of L-DOPA (Khoja et al., 2016; Warnecke et al.,
2020).
To better understand the therapeutic potential of positive P2X4 modulation, two commonly
used toxin models of PD were selected for use in this study, the 6-OHDA model and the 1-Methyl-
4-Phenyl-1,2,3,6-Tetrahydropyridine (MPTP) model. Both models have been used in rodents to
gain further scientific understanding about PD and to identify potential treatment options (Grandi
et al., 2018; Tolwani et al., 1999). The 6-OHDA model allows for the selective depletion of
dopaminergic neurons, via targeting with stereotaxic surgery, and for researchers to explore the
effects of selective DA lesioning. 6-OHDA lesioning highlights the importance of specific brain
regions in activities such as learning and memory or motor behavior (Carvalho et al., 2013; Iancu
et al., 2005; Schwarting & Huston, 1996). In contrast, MPTP can be systemically administered
and after conversion, in the brain, into 1-methyl-4-pyridinium (MPP
+
) causes nonselective death
of DAergic neurons throughout the brain. The MPTP model allows for researchers to study PD in
the rodent model that resembles similar features to human PD (Jakowec & Petzinger, 2004).
The goal of this study was to evaluate the benefit of L-DOPA + IVM therapy as opposed
to L-DOPA treatment on its own, while using two extensively researched mouse models of PD.
After lesioning, mice were subjected to rotarod testing (to determine deficits in motor coordination)
(Carvalho et al., 2013; Iancu et al., 2005) and novel object recognition testing (to evaluate deficits
learning and memory (Bortolato et al., 2013; Real et al., 2019; Santos et al., 2013; Subramaniam
45

et al., 2018). Additionally, sucrose preference (to measure anhedonia), and Real-Time
Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) (to analyze changes
in gene expression) tests were conducted on 6-OHDA mice. The qRT-PCR tests were conducted
to determine changes in gene expression of p2r4x, and other receptor/transporters involved in
DAergic neurotransmission (d1rd, d2rd, slc6a3, and slc18a2) (McArthur et al., 2007; Mulvihill,
2018; Pearson-Fuhrhop et al., 2013; Xu et al., 2005). For this study, I tested the hypothesis that
any behavioral deficits found in the models would be improved by adjunct treatment of IVM.
Overall, I found limited behavioral deficits in both models (though IVM was able to improve
performance on the rotarod) and found significant sex differences in almost all of the behaviors
tested except for sucrose preference.
Methods
3.2.1 Animals:
C57BL/6J mice male (n=32 6-OHDA, n=48 MPTP) and female (n=40 6-OHDA, n=48
MPTP) 6-8 weeks of age (Jackson Laboratories; Bar Harbor, Maine, United States) were group
housed 5 to a cage in a 12-hour light and 12-hour dark cycle with ad libitum access to food and
water. All experiments were conducted in accordance with the NIH Guide for the Care and Use
of Laboratory Animals (NIH Publication No. 80-23, revised 1996) and approved by the University
of Southern California Institutional Animal Care and Use Committee. All behavioral studies were
carried out at the start of the dark cycle.
3.2.2 6-OHDA Stereotaxic Surgery and Lesion Conformation by Rotational Behavior:
Stereotaxic surgery was carried out as previously reported (Khoja et al., 2016). Briefly, 30
minutes prior to surgery mice were given desipramine hydrochloride (HCl) (25 mg/kg in 0.9%
saline, I.P; cat. No. D3900 Sigma-Aldrich, St. Louis, Missouri, United States) to prevent damage
to the noradrenergic pathways. Mice were anesthetized with 4% isoflurane plus O 2 (400 mL/min).
Once completely anesthetized, isoflurane was reduced to 2% to allow steady anesthetization
46

without negative respiratory effects. The 6-OHDA (2 µL of 4 mg/mL in 0.2% ascorbic acid and
0.9% saline; cat. no. H4381, Sigma-Aldrich, St. Louis, MO) or saline (0.9%, these mice will be
referred to as “nonlesioned”) was delivered to the left medial forebrain bundle (MFB) (AP: 1.3mm,
ML: 1.1mm lateral, DV: 5mm) at a rate of 0.5 µL/min. Following 6-OHDA delivery, the needle
remained in place for 5 minutes and was then retracted at a rate of 0.1 mm per 15 seconds.
Rotation induced by d-Amphetamine was used as surrogate marker of degree lesioning
as described in chapter 2 (Warnecke et al., 2020). 6-OHDA lesions were allowed to stabilize for
4 weeks and then the degree of ipsilateral lesioning was assessed by determining the number of
d-Amphetamine (AMPH) (5.0 mg/kg in 0.9%saline, I.P; cat. no. A-5880, Sigma-Aldrich, St. Louis,
Missouri, United States) induced ipsilateral rotations. AMPH was administered and the number of
ipsilateral rotations over a 120-minute period, starting after injection, were counted. Mice that
displayed more than 180 net rotations in 120 minutes were considered lesioned and included in
the study while those failing to achieve this threshold were excluded. In previous experimentation,
this method successfully screened for striatal lesions of over 90% on the side ipsilateral to the 6-
OHDA injection (Warnecke et al., 2020). The total number of lesioned mice used in these studies
was n=14 male and n=18 female, and nonlesioned n=15 male and n=16 female.
3.2.3 MPTP Injection:
MPTP lesioning was performed as described by Kintz, Petzinger, and Jakowec with minor
modifications (Kintz et al., 2017). MPTP (20 mg/kg per injection, cat. No. M0896 Sigma Inc., St.
Louis, Missouri, United States) was administered in a series of four intraperitoneal injections at 2-
hour intervals for a total administration of 80 mg/kg; if a mouse had not recovered from the
previous injection an additional two hours were allowed to pass until the next injection. Mice were
given 1 week for lesion stabilization before behavioral experiments were conducted. The total
number of lesioned mice used in these studies was n=21 male and n=19 female, and n=8
nonlesioned males and females.
47

3.2.4 Treatments for Behavioral Testing:
A 7-day washout period was allowed between behavioral testing. Compounds used in
behavioral studies included L-DOPA (cat. no. PHR1271, Sigma-Aldrich, St. Louis, Missouri,
United States), benserazide (cat. no. B7283, Sigma-Aldrich. St. Louis, Missouri, United States),
moxidectin (MOX) (cat. no. NDC 0010-3841-02, Boehringer Ingelheim, Ingelheim, Rhineland-
Palatinate, Germany), and ivermectin (IVM) (cat. no. NDC 55529-012-01, Norbrook Laboratories,
Ltd, Newry, North Ireland, United Kingdom). Behavioral tests were carried out with the following
treatment groups: L-DOPA (5.0 mg/kg with 1.25 mg/kg benserazide in 0.9% saline, S.C.), IVM
(5.0 mg/kg in 0.9% saline I.P), L-DOPA + IVM, and saline (0.9%). Due to the prolonged CNS
penetrance of IVM (Yardley et al., 2012), behavioral testing was carried out 8 hours after initial
injections. L-DOPA injection was carried out 90 minutes before behavioral testing to limit the
motoric effects of L-DOPA, as rotational behavior is no longer observed after 90 minutes
(Warnecke et al., 2020). All behavioral testing was videotaped and analyzed after testing had
concluded by researchers blind to lesions and treatments.
3.2.5 Rotarod:
Rotarod testing was used to evaluate motor coordination. Rotarod acclimation occurred
over two days and on the third day mice were subjected to rotarod testing. All testing and
acclimation occurred on the rotarod (Columbus Instruments, Columbus, Ohio, USA). Before
acclimation to the rotarod or testing, mice were brought into the room for 30 minutes to allow for
acclimation to the room. On day one, in the morning the mice were brought in and allowed to
acclimate to the room and returned to their normal housing location after 30 minutes; in the
afternoon the mice were acclimated and then introduced to the rotarod for 90 seconds at 5rpm.
On day two, in the morning mice were placed on the rotarod for 120 seconds at a speed of 10
rpm; in the afternoon mice were placed on the rotarod for 120 seconds at a speed of 15 rpm. On
the third day, mice were placed on the rotarod until the mouse fell off the rotarod, or for 200
48

seconds (which ever was shorter) and the duration was recorded. The rotarod was set to alternate
forward and reverse rotations every 30 seconds, with the speed increasing from 0-30 rpm over
this 30 second period, this reversal occurred for the entire 200 second trial. After falling off the
rotarod or completion of the 200 seconds, mice were returned to their home cage for 90 seconds.
Mice then repeated the trial 4 more times.
3.2.6 Novel Object Recognition
NOR testing was used to evaluate alterations in learning and memory. On day one, mice
were placed into a white box with bedding for 5 min. On day two, mice were placed back into the
box with two copies of the same object, either a glass beaker or a large blue Lego, and allowed
to explore the box for 10 minutes while being recorded on a video camera. If a mouse did not
explore the object for 20 seconds, they were removed from the analysis. 24 hours later, the mice
were placed into a box with one Lego and one beaker. The sides of the familiar versus novel
object were alternated and randomized, mice were allowed to explore the box for 10 min.
3.2.7 Sucrose Preference:
Sucrose preference testing was performed to measure anhedonic behavior. On day zero,
two 25 ml water bottles were introduced to the home cage. On days one and two, the bottles were
refilled with water as needed and monitored for leaking. On the night after day two, all fluids were
removed from the cage. On the morning of day three, mice were moved into single house cages
with two 25-ml bottles, one containing water and the other containing 2% sucrose in water. The
mice were allowed to drink over the next 4 hours. At the end of the 4 hours, the amount of fluid
consumed from each bottle was recorded. The location of the sucrose bottle (on the right or left
side of the cage) was alternated to minimize side preferences. Sucrose preference was calculated
as a percentage of total fluid intake.
3.2.8 Tissue Dissection:
49

After behavioral testing was completed, mice underwent cervical dislocation and their
brains were immediately removed for dissection. Fresh tissue was dissected from following
sections (left and right): the dorsal striatum (from bregma AP: 1-0.7ML: 1-2.5 DV: (-)2.4-4) and
the ventral striatum (from bregma AP: 1-0.7ML: 1-2.5 DV: (-)4-5) (Allen Mouse Brain Atlas (2004)).
After dissection, tissue was flash frozen on dry ice and then stored at -80°C.
3.2.9 qRT-PCR:
Tissue collected was analyzed as described previously (Lundquist et al., 2019). A
separate cohort of 6-OHDA lesioned mice were utilized for tissue dissection and were not part of
the behavioral tests conducted (female: n=4 for 6-OHDA and nonlesioned mice; males: n= 4 for
6-OHDA and nonlesioned mice). Briefly, RNA was isolated and purified using a Quick-RNA
Miniprep Kit (Zymo Research, Irvine, California, United States) following manufacturer’s
suggested protocol. RNA concentration and purity were analyzed at a 1:10 dilution using a
BioPhotometer (Eppendorf, Hamburg, Hamburg, Germany). cDNA synthesis was performed
using a qPCR cDNA synthesis kit (PCR Biosystems, London, England, United Kingdom) and the
reaction product was stored at −20°C for downstream qPCR applications. Samples were
processed on an Eppendorf realplex2 Mastercycler and analyzed using realplex software
(Eppendorf, Hamburg, Hamburg, Germany). Gene expression of ACTB (β-actin, housekeeping
gene) (5′- GGCTGTATTCCCCTCCATCG, 3′- CCAGTTGGTAACAATGCCATG); p2rx4 (5′-
CTGGTGTGCCAACGAGGAATA, 3′- AGACGGAATATGGGGCAGAAG); drd1 (Dopamine
Receptor D1) (5′- GGTGCTGAAGATTGAAGATCCA, 3′- CGTCCTGACACATGCTGTTATAG);
slc18a2 (Synaptic Vesicle Monoamine Transporter 2 [VMAT2]) (5′-
ATGCTGCTCACCGTCGTAG, 3′- GGACAGTCGTGTTGGTCACAG); drd2 (Dopamine Receptor
D2) (5′- ACCTGTCCTGGTACGATGATG, 3′- GCATGGCATAGTAGTTGTAGTGG); and slc6a3
(DA Transporter [DAT]) 5′-TTCATGGTTATTGCCGGGATG, 3′-
TGTAGAAGAAGCCCACGTAGAA) were analyzed with the qPCRBIO SyGreen Mix Lo-ROX
50

(PCR Biosystems, London, England, United Kingdom). All qPCR data was analyzed using the 2^
(– delta delta CT) method (Livak & Schmittgen, 2001).
3.2.10 Statistical Analysis:
Statistical analysis was performed using R (R Core Team (2013) R: A language and
environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
URL http://www.R-project.org/.) with packages dplyr, ggplot2, plyr, DescTools and ggsignif
installed. A three-way ANOVA was conducted on rotarod data to determine the interaction of
sex*treatment*trial number. A one-way ANOVA was conducted to evaluate the effects of
treatment on sucrose preference of WT mice (L-DOPA, L-DOPA + IVM, IVM, and saline). All other
behavioral data was evaluated using a two-way ANOVA with replication to assess effects of P2X4
modulation and sex. A between-subjects design was incorporated to determine if there were any
significant effects between the treated 6-OHDA animals versus untreated 6-OHDA animals, as
well as 6-OHDA injected versus saline injected animals. Significance was set at p<0.05.
51

Results
3.3.1 Rotarod Performance Declines are Ameliorated by L-DOPA +IVM Treatment in
Female 6-OHDA Mice
The average performance across all trials performed by 6-OHDA lesioned mice (females:
n=3 nonlesioned, n=4 L-DOPA, n=4 saline, n=5 L-DOPA + IVM; males: n=3 L-DOPA + IVM, n=3
nonlesioned, n=4 saline, n=4 L-DOPA) was compared via a two-way ANOVA for treatment*sex
interactions. There was a significant treatment*sex effect (F(3,43)= 2.618, p<0.05) on average
latency to fall, but not a sex (F(1,43)= 0.006, p>0.05) effect or a treatment effect (F(3,43)= 2.048). The
post hoc Tukey test revealed an effect (p<0.07) of lesioning on female mice (41.600 ± 11.536)
that resulted in decreased average performance on the rotarod compared to nonlesioned female
mice (182.267 ± 11.182).
The average performance across all trials of MPTP mice with treatment (females: n=4
IVM, n=4 L-DOPA + IVM, n=5 L-DOPA, n=6 saline n=8 saline; males: n=5 L-DOPA, n=5 IVM,
n=5 L-DOPA + IVM, n=6 saline, n=8 nonlesioned) was compared via a two-way ANOVA for
Figure 3.1 Average latency to fall of all 5 rotarod trials by 6-OHDA and MPTP lesioned mice.
A) Graph of average latency to fall between each 6-OHDA treatment group, with 6-OHDA lesioned
females falling off the rotarod faster than nonlesioned female mice (p<0.07)(n=3 nonlesioned females
and males; n=3 L-DOPA + IVM males; n=4 L-DOPA and saline, females and males, n=5 L-DOPA + IVM
females). B Graph of average latency to fall between each MPTP treatment group (n=4 IVM and L-DOPA
+ IVM females, n=5 IVM females and males, n=5 saline females, n=5 L-DOPA and L-DOPA + IVM males,
n=6 saline males, n=8 nonlesioned males and females).

52

treatment*sex interactions. There was a significant sex effect (F(1,45)= 6.837, p<0.05) on average
latency to fall, but not a treatment (F(4,45)= 0.828, p>0.05) effect or a treatment*sex effect (F(4,45)=
0.247).
The latency to fall of 6-OHDA mice on each trial was then analyzed to determine if the
latency to fall was altered based on the trials number, using the same n’s reported for average
latency to fall. When performing a three-way ANOVA for treatment*lesion*trial*sex there was a
significant treatment*sex effect (F(3,110)=8.936, p<0.05) with lesioned males performing
significantly better than lesioned females (Tukey p<0.05). There was also a significant treatment
effect (F(3,110)= 6.991, p<0.05), but not a significant treatment*trial*sex effect (F(12,110)= 0.302,
p<0.05). Due to small n’s in each group and the significant treatment*sex difference, all further
tests conducted were two-way ANOVAs for treatment*trial with the male and female data
separated.
53

In female 6-OHDA mice, there was a significant difference in the latency to fall (s) between
control and treated mice (two-way ANOVA, F(3,60)= 16.447, p<0.05, Tukey p<0.05), with 6-OHDA
saline females (41.600 ± 6.275) staying on the rotarod for a shorter time than nonlesioned females
(182.267 ± 13.385) and L-DOPA + IVM (110.320 ± 15.038) treated females (Figure 2A). When
comparing treatment*trial by a two way ANOVA (F(12,60)= 0.702, p>0.05) there was no significant
effect, nor was there a significant trial effect (F(4,60)= 0.440, p>0.05).
Figure 3.2 Performance on the Rotarod across all trials by 6-OHDA and MPTP lesioned mice
A) The performance of female 6-OHDA mice on trials 1-5, with saline females performing worse than L-
DOPA + IVM treated females and nonlesioned females (p>0.05). B) The performance of male 6-OHDA
mice on trials 1-5, with saline males having a longer latency to fall than L-DOPA treated males (p>0.05). C)
The performance of MPTP treated female mice on trials 1-5. D) Graph of the performance of male MPTP
treated mice with a trend for increased latency to fall as the trial number increased (p<0.055).
54

In male 6-OHDA mice, there was a trend in the difference in the latency to fall(s) between
male mice treated with L-DOPA and untreated 6-OHDA males (two-way ANOVA, F(3,50)=16.447,
p<0.05, Tukey p<0.05), with 6-OHDA saline males (135.500 ± 15.549) staying on the rotarod
longer than L-DOPA treated male mice (68.350 ± 15.610) (Figure 2B). When comparing
treatment*trial by a two way ANOVA (F(12,50)= 0.401, p>0.05) there was no significant effect, nor
was there a significant trial effect (F(4,60)= 1.361, p>0.05).
The latency to fall on each trial of MPTP lesioned mice was also analyzed. When
preforming a three-way ANOVA for treatment*lesion*trial*sex there was a significant sex effect
(F(1,225)= 16.002, p<0.05) and a significant trial effect (F(4,225)= 3.112, p<0.05), but not a significant
treatment*trial*sex effect (F(24,295)= 0.945, p<0.05). As with the 6-OHDA data all further tests
conducted were two-way ANOVAs for treatment*trial with the male and female data separated.
In female mice, there was no significant difference in the latency to fall(s) between control
and treated mice when comparing treatment*trial by a two way ANOVA (F(16,105)= 0.969, p>0.05),
nor was there a significant trial (F(4,105)= 1.259, p>0.05) or treatment effect (F(4,105)= 1.597, p>0.05)
(Figure 2C).
In male mice, there was a trend of a trial effect (two way ANOVA, F(4,120)= 2.399, p<0.055),
with latency to fall increasing as the trial number increased (Figure 2D). There was no significant
treatment*trial effect difference (two-way ANOVA, F(16,120)= 0.883, p>0.05) or a significant
treatment effect (F(4,120)=0.883, p>0.05) (Figure 2D).
55

3.3.2 Novel Object Recognition Performance is Not Altered by 6-OHDA or MPTP
Lesioning
To evaluate performance on the NOR test across the 6-OHDA treatment groups (females:
n=3 L-DOPA, n=3 nonlesioned, n=5 saline, n=5 L-DOPA + IVM; males: n=3 L-DOPA, n=3 L-
DOPA + IVM, n=3 nonlesioned, n=5 saline), the total time spent with all objects (to evaluate
overall interest in objects) and the percent of time spent with the novel object were all analyzed.
Interestingly, a two-way ANOVA for sex*treatment revealed there was a trend for a sex effect on
Figure 3.3 Performance on NOR testing by 6-OHDA and MPTP lesioned mice
A) Graph of the total time spent with novel and familiar objects by 6-OHDA and nonlesioned mice with a
trend for increased time spent with objects for female mice compared to male mice (p<0.06)(n=3 L-DOPA
and nonlesioned females and males; n=3 L-DOPA + IVM males; n=5 saline males and females; n= 5 L-
DOPA + IVM females). B) Graph of the relative time spent with the novel object by 6-OHDA and
nonlesioned mice (n=3 L-DOPA and nonlesioned females and males; n=3 L-DOPA + IVM males; n=5 saline
males and females; n= 5 L-DOPA + IVM females). C) Graph of the total time spent with novel and familiar
objects with a significant increase in time spent with objects for male mice compared to female mice
(p<0.05)( n=4 L-DOPA, IVM, L-DOPA + IVM and nonlesioned for female mice; n=5 L-DOPA, IVM, and L-
DOPA + IVM for male mice; n=6 saline females and males; n=4 nonlesioned males). D) Graph of the
relative time spent with the novel object by MPTP lesioned and nonlesioned mice (n=4 L-DOPA, IVM, L-
DOPA + IVM and nonlesioned for female mice; n=5 L-DOPA, IVM, and L-DOPA + IVM for male mice; n=6
saline females and males; n=4 nonlesioned males).
56

total time spent with objects (F(1,22)= 3.6929, p<0.06) with females spending more time with the
object than males (Figure 3.3A). There were no significant treatment (F(3,22) =0.831, p>0.05) or
sex*treatment (F(3,22)= 1.191, p>0.05) effects. Percent time spent with the novel object also did
not indicate any significant differences in a two-way ANOVA for treatment*sex (treatment F(3,22)=
0.298, p>0.05; sex F(1,22)= 0.775, p> 0.05; treatment*sex F(3,22)= 1.930, p>0.05) (Figure 3.3B).
Performance was then evaluated by MPTP lesioned mice (females: n=4 L-DOPA, n=4
IVM, L-DOPA + IVM, n=4 nonlesioned, n=6 saline; males: n=5 L-DOPA, n=5 IVM, n=5 L-DOPA
+ IVM; n=6 saline; n= 5 nonlesioned) under the same parameters. A two-way ANOVA for
sex*treatment revealed there was a significant sex effect on total time spent with objects (F(1,37)=
16.277, p<0.05) with males spending more time with objects than females (Figure 3.3C). There
were no significant treatment (F(4,37)= 1.010, p>0.05) or sex*treatment (F(4,37)= 1.404, p>0.05)
effects on total time with objects. Percent time spent with the novel object also did not indicate
any significant differences in a two-way ANOVA for treatment*sex treatment (F(4,37)= 0.367,
p>0.05; sex F(1,37)= 0.343, p>0.05; treatment*sex F(4,37)= 0.313, p> 0.05) (Figure 3.3D).
3.3.3 3.3 IVM Reduced Sucrose Preference in Nonlesioned Male Mice
Figure 3.4 The effect of IVM treatment on sucrose preference.
A) Percent sucrose drank by 6-OHDA lesioned and non-lesioned mice treated with L-DOPA, L-DOPA +
IVM or saline (females: n=3 L-Dopa, n=3 nonlesioned L-DOPA, n=3 nonlesioned L-DOPA + IVM, n=3
nonlesioned saline n=5 saline, n=6 L-DOPA + IVM; males: n=3 L-DOPA, n=3 L-DOPA + IVM, n=3
nonlesioned saline, n=4 nonlesioned L-DOPA, n=4 nonlesioned L-DOPA + IVM, n=5 saline). B) Graph of
nonlesioned mice given L-DOPA (n=23), IVM (n=12), L-DOPA + IVM (n=12) or saline (n=23). IVM
significantly reduced relative sucrose drank compared to mice treated with saline or L-DOPA (p<0.05). *
indicates p<0.05.
57

A two-way ANOVA conducted to evaluate the effect of 6-OHDA surgery and treatment
(females: n=3 L-Dopa, n=3 nonlesioned L-DOPA, n=3 nonlesioned L-DOPA + IVM, n=3
nonlesioned saline n=5 saline, n=6 L-DOPA + IVM; males: n=3 L-DOPA, n=3 L-DOPA + IVM, n=3
nonlesioned saline, n=4 nonlesioned L-DOPA, n=4 nonlesioned L-DOPA + IVM, n=5 saline) on
sucrose preference and determined there was no treatment (F(5,35)= 1.081, p>0.05), sex (F(1,35)=
0.266, p>0.05), or treatment*sex (F(5,35)= 0.757, p>0.05) effect on percent sucrose drank (Figure
4A). While not statistically significant, male nonlesioned mice given L-DOPA+IVM were the only
group of mice who did not drink more sucrose than water, drinking only 44.8% ± 15.1. There was
no significant difference on the total fluid drank across the treatment groups (two-way ANOVA,
F(5,35)= 0.799, p>0.05) or treatment*sex effect (two-way ANOVA, F(5,35)=0.492, p>0.05), but there
was a significant sex effect (two-way ANOVA, F(1,35)= 4.330, p<0.05) with females drinking more
fluid than males.
To further investigate the decreased sucrose consumption seen in nonlesioned mice after
dosing with IVM (5mg/kg) we conducted a study in wild type (WT) male mice comparing the effects
of IVM (5mg/kg), L-DOPA (5mg/kg) and IVM+L-DOPA (both at 5mg/kg). A one-way ANOVA
conducted to determine the treatment effect on percent sucrose drank found a significant
treatment effect (F(3,66) =6.925, p<0.05). The post hoc Tukey analysis revealed IVM (51.885% ±
0.032) significantly decreased percent sucrose drank (p<0.05) (Figure 3.4B) compared to controls
(70.661% ± 0.085), IVM also decreased percent sucrose drank compared to L-DOPA (75.605%
± 0.040). The Tukey test also found a significant decrease in percent sucrose consumed by
IVM+L-DOPA (57.732% ± 0.022) dosed mice compared to L-DOPA mice (75.605% ± 0.040).
There was no significant difference on the total fluid drank across the treatment groups (one-way
ANOVA, F(3,66)= 0.61, p>0.05).
58

3.3.4 6-OHDA Lesioning Increased D1 Expression in the Dorsal Striatum of Females but
Not Males
In the lesioned hemisphere of the dorsal striatum there was a significant sex effect on the
fold change on the targeted genes (two-way ANOVA for treatment*sex, F(1,76)= 11.987, p<0.05),
and to account for this effect all data reported on the normalized changes in gene expression
were separated out by sex. In female mice there was a trend for increased P2X4 expression after
6-OHDA surgery (1.690 ± 0.297, Welch’s t-test t= 2.018, df= 4.766, p<0.11), and a significant
increase in D1 expression in 6-OHDA lesioned female mice (1.564 ± 0.157, Welch’s t-test t=
A
C
A
B
D
Figure 3.5 Gene expression alterations after 6-OHDA lesioning in the dorsal striatum (DS)
A) Graph of the changes in gene expression on the lesioned side of the striatum in female mice (n=4 for
each group) with D1 expression increasing significantly (p<0.05) and a trend for increased expression of
P2X4 (p<0.11).* indicates p<0.05. B Graph of the changes in gene expression on the nonlesioned side of
the striatum in female mice (n=4 for each group) C) Graph of the changes in gene expression on the
lesioned side of the striatum in male mice (n=4 for each group) D) Graph of the changes in gene expression
on the nonlesioned side of the striatum in male mice (n=4 for each group)
59

2.761, df= 5.793, p<0.05) (Figure 3.5A). For male mice Welch’s t-test did not reveal any significant
differences in gene expression (Figure 3.5C).
In the nonlesioned hemisphere of the dorsal striatum there was a significant sex effect on
the fold change of the targeted genes (two-way ANOVA for treatment*sex, F(1,76)= 8.432, p<0.05),
and to account for this effect all data reported on the normalized changes in gene expression
were separated out by sex. There were no significant differences in gene expression when
analyzed via Welch’s t-test for the female or male mice (Figures 3.5B&D).
3.3.5 6-OHDA Lesioning Increased D1 and D2 Expression in the Ventral Striatum of
Females but Not Males
In the lesioned hemisphere, in the ventral striatum, there was a significant sex effect on
the fold change of targeted genes (two-way ANOVA for treatment*sex, F(1,76)= 22.373, p<0.05),
and to account for this effect, all data reporting on the normalized changes in gene expression
were separated out by sex. There were no significant differences in gene expression when
analyzed via Welch’s t-test for female or male mice (Figures 3.6A&C).
60

In the nonlesioned hemisphere, in the ventral striatum, there was a significant sex effect
on the percent fold change of targeted genes (two-way ANOVA for treatment*sex, F(1,76)= 11.330,
p<0.05), and to account for this effect all data reporting on the normalized changes in gene
expression were separated out by sex. In female mice the Welch’s t-test revealed a trend for
increased VMAT2 (2.237 ± 0.431) gene expression (t= 2.833, df= 3.146, p<0.07), and a significant
increase in D2 (1.632 ± 0.154; t= 2.820, df= 5.978, p<0.05) and D1 (4.030 ± 0.106; t= 6.768, df=
Figure 3.6 Gene expression alterations after 6-OHDA lesioning in the ventral striatum (VS)
A) Graph of the changes in gene expression on the lesioned side of the striatum in female mice (n=4
for each group). B) Graph of the changes in gene expression on the nonlesioned side of the striatum
in female mice (n=4 for each group) with D1 expression increasing significantly (p<0.05), D2
expression increasing significantly (p<0.05) and a trend for increased expression of VMAT2
(p<0.07). * indicates p<0.05. C) Graph of the changes in gene expression on the lesioned side of
the striatum in male mice (n=4 for each group). D) Graph of the changes in gene expression on the
nonlesioned side of the striatum in male mice (n=4 for each group).
61

3.357, p<0.05) (Figure 3.6B). There were no significant differences in gene expression when
analyzed via Welch’s t-test for male mice (Figure 3.6D).

62

Discussion
To determine the impacts and potential benefit of adjunct L-DOPA therapy with a P2X4
PAM on behavioral outcomes and gene expression, we used both 6-OHDA and MPTP mice to
determine if there was a difference in treatment response between the two models. It was
hypothesized that adjunct therapy with IVM would improve behavioral deficits seen in both models
and that the 6-OHDA model would be more sensitive to motoric deficits, while the MPTP model
would be more sensitive to tasks that involved learning and memory. Between the two models,
neither indicated any lesion effect on learning and memory performance, but female 6-OHDA
lesioned mice did show a decrease in performance on motoric behavior that was recovered by L-
DOPA + IVM treatment. Additionally, the sucrose preference test conducted revealed that while
6-OHDA lesioned mice did not alter their consumption of sucrose, WT male mice dosed with
IVM+L-DOPA saw decreased sucrose consumption. It was also hypothesized that P2X4s may be
upregulated in the 6-OHDA model of PD. Molecular testing on 6-OHDA mice did not show any
significant alterations in P2X4 gene expression but did indicate sex specific differences in receptor
expression and found D1 receptor, D2 receptor and VMAT2 expression to be altered by 6-OHDA
lesioning.
The unilateral MFB 6-OHDA lesion model used is known for the rotational motor behavior
it causes and is also used to test additional motoric deficits, including motor coordination on the
rotarod (Bagga et al., 2015; Boix et al., 2018; Carvalho et al., 2013; Dziewczapolski et al., 1997;
Yuan et al., 2005). In line with deficits previously reported, female 6-OHDA lesioned mice
performed poorly during rotarod testing. This performance was improved with treatment of L-
DOPA + IVM but not L-DOPA alone. This result supports previous experiment’s findings that
adjunct IVM therapy could increase anti-parkinsonian rotation in the same model (Warnecke et
al., 2020). Though the male mice did not see this same effect, it is possible the low n’s used in
these experiments were not sensitive enough to pick up on the motor deficits in male mice.
63

Potentially, the control 6-OHDA group were outliers in terms of performance (as the male 6-OHDA
group, who was predicted to perform the worst on rotarod testing, was able to stay on the rotarod
for even longer than the control, nonlesioned, group). In both female and male mice given MPTP
lesions, no significant differences were seen in rotarod performance. This again could be due to
a lack of sensitivity in the testing, with MPTP lesioned mice needing a more challenging motoric
test to allow for the observation of motor deficits. Other studies have also found acute (as used in
this study) and even subacute MPTP lesions as insensitive to motor deficits, despite DA depletion,
or that deficits appear 3-4 weeks after lesioning as striatal DA is restored (Ayton et al., 2013;
Zhang et al., 2017). Our results indicate MFB 6-OHDA lesioning is sensitive to rotarod testing,
but the acute MPTP lesioning is not. Neither model was shown to be sensitive to NOR testing and
the selection of lesion models that impact the prefrontal cortex, and/or other regions implicated in
learning, are needed to determine the potential effect of adjunct IVM therapy on improving
learning and memory in PD.
Sucrose preference testing in rodents is utilized to determine a reduction in pleasure, in
which DA is known to play an important role (Scheggi et al., 2018). We did not detect a reduction
in sucrose preference in the MFB 6-OHDA lesioned mice but did notice a trend of decreased
sucrose preference in control male mice given L-DOPA +IVM. To determine if IVM was driving
decreased sucrose preference, we repeated the study with wild type mice and found that IVM on
its own was significantly decreasing sucrose preference. This confirmed previously found
evidence that IVM decreased saccharine preference in male and female mice (Yardley et al.,
2012). IVM’s ability to decrease sucrose preference and decrease ethanol consumption suggests
that IVM, on its own, may be able to alter pleasure (Bortolato et al., 2013; Khoja, Huynh,
Warnecke, et al., 2018). This result is important to note, as a decrease in pleasure would be a
potential negative side effect of the use of IVM. However, when given in conjunction with L-DOPA,
IVM did not decrease sucrose preference; indicating that L-DOPA may mitigate the anhedonic
effects of IVM. As the study of IVM continues, monitoring of potential depressive and anhedonic
64

behaviors is needed to determine if increased risk of depression may be potential side effect of
IVM treatment in PD patients.
In PD receptors, protein and gene expression is altered. Loss of DAergic inputs to the
striatum can cause compensatory changes in expression to occur (Xu et al., 2005). Under
homeostatic conditions, D1 and D2 receptors maintain a balance of excitation and inhibition within
the mesolimbic system, and in PD an imbalance occurs as striatal neurons lose DAergic inputs
(Hisahara & Shimohama, 2011; Mishra et al., 2018; Pearson-Fuhrhop et al., 2013). In the striatum
of female mice, we saw an increase in D1 receptor expression in the dorsal striatum of the
lesioned side, and in the ventral striatum of the nonlesioned side we found an increase in D1, D2,
and a trend of an increase in VMAT2 expression. These increases were absent in male mice,
potentially explaining the differences in rotation behavior reported in the MFB 6-OHDA model. It
has been reported that PD patients’ D1:D2 ratios differ depending on their biological sex, and that
in rotational models D1 and D2 stimulation are important for the generation of rotational behavior
(Dziewczapolski et al., 1997; Pollack & Thomas, 2010; Ullah et al., 2019). Female mice were
found to have increased rotational response to AMPH administration and decreased rotational
response to L-DOPA, which could be caused by the increased receptor and VMAT2 expression
on the nonlesioned side (Warnecke et al., 2020). The sex difference reported in D1 expression
also agree with a study the reported increased D1 expression only lesion site of female mice,
potentially indicating D1 upregulation after 6-OHDA surgery is correlated to sex (Freund et al.,
2014). While no change in gene expression was reported in male mice, this may be due to the
length of time elapsed between lesioning and tissue dissection. A study found that one week after
6-OHDA surgery changes in gene expression were detectable, but by 4 weeks after surgery
changes in gene expression had largely dissipated (Na et al., 2010). To further understand
changes in gene expression, an earlier time point of tissue collection may be needed. Additional
studies utilizing Western blotting will further assist in the determination of changes in protein
65

expression that occurs in the 6-OHDA model. Testing of qRT-PCR and Western blotting in the
MPTP model may also illuminate other sex linked, or model dependent changes in expression.
For this study we also chose to evaluate potential P2X4 gene expression changes. IVM is
a PAM of P2X4s and in the absence of the P2X4 there is evidence of diminished IVM behavioral
response (Khoja, Huynh, Asatryan, et al., 2018; Khoja et al., 2016; Wyatt et al., 2014).
Furthermore, P2X4s are upregulated after events such as stroke and spinal cord injury. This
upregulation is thought to be linked to an increase in adenosine triphosphate (ATP) (a P2X4
agonist) occurring as a part of the inflammatory process (Inoue & Tsuda, 2012; Long et al., 2018;
Mapplebeck et al., 2018; Srivastava et al., 2020; Verma et al., 2017). Inflammation is a key part
of the maturation of the 6-OHDA lesion, and in turn, could contribute to an increase in ATP that
results in upregulation of P2X4s (Na et al., 2010). In this study, there were no significant changes
in P2X4 gene expression, but the ventral striatum of female and male mice did indicate (non-
significant) increases in P2X4 expression. Changes may not have been detected due to the small
number of animals used in the study and/or the timepoint at which tissue samples were collected.
Collecting tissue throughout the course of lesion progress may show increase in P2X4 gene
expression soon after 6-OHDA injection and provide information on how P2X4 changes can occur
over time in PD models. Use of Western blotting to determine the expression of the P2X4 itself
may also highlight changes in receptor level not captured during qRT-PCR.
In nearly every test, sex as a biological variable was found to significantly impact the
behavioral and molecular results. This indicates that scientific conclusions that were drawn from
studies conducted on only males cannot be extrapolated to females. Even with relatively small
numbers of subjects per treatment group, female and male mice exhibited different behavioral
outcomes from an experiment that tested an array of behaviors. Future studies should include
both males and females, and those studies that have only been conducted in males should be
repeated in females.
66

Conclusion
The differences in behavioral outcome reported in this study emphasize the importance of
appropriate model selection for the detection of behavioral deficits during the non-clinical phase
of drug development. To better improve clinical outcome researchers should continue to focus on
the development and use of models that produce deficits in the behaviors research wish to affect.
Ultimately many models of the same disease are necessary for successful drug development.
Additionally, these results further support the use of IVM as an adjunct therapy in PD for the
treatment of motor symptoms and indicate further testing will need to be conducted to determine
if IVM is able to alter learning and memory deficits in PD.

67

CHAPTER 4
Introduction
Parkinson’s Disease (PD) is the second most common neurodegenerative disease and its
symptoms include bradykinesia, postural instability, depression, and respiratory difficulties(Goetz,
2011; Starkstein et al., 2012). PD is caused by a loss of dopaminergic input to the substantia
nigra pars compacta (SNpc), and results in decreased dopamine (DA) in the striatum. To date
there is no intervention to prevent or stop the loss of DA. Since the 1970’s the gold standard of
treatment for PD has been levodopa (L-DOPA) therapy. L-DOPA is able to decrease motor
symptoms, but over time treatment efficacy is reduced and negative side effects such as
dyskinesia begin to appear and worsen (Kalinderi et al., 2019; Poewe et al., 2010). The symptoms
of PD impact not only the lives of the patients but their caregivers as well; losses in productivity
by more than 1 million Americans live who live PD and their caregivers contribute to the over $50
billion annual economic cost of PD (Yang et al., 2020). Therapies that reduces the symptoms of
PD are needed to improve PD patients’ quality of life and the reduced the economic impact of the
disease.
Differences in sex plays has been shown to play an important role in PD, as the disease
occurs in 50% more men than women. The exact reason behind this increased risk is not known,
but scientist have hypothesized sex difference could be caused by sex hormones with particular
emphasis on estrogen’s ability to alter DA release in the basal ganglia (Baraka et al., 2011;
Betancourt et al., 2017; Miller & Cronin-Golomb, 2010; Vanhartesveldt & Joyce, 1986). L-DOPA
therapy response is also thought to be altered between males and female, with females having
increased bioavailability of L-DOPA (Cerri et al., 2019; Dahodwala et al., 2016). Due to differences
in risk and treatment new PD therapies should look to evaluate sex-related outcomes and efficacy.
A recent study published highlighted the behavioral differences between male and female
mice in a PD mouse model and showed that male mice had increase behavioral response to L-
68

DOPA treatment compared to female mice (Warnecke et al., 2020). The use of an adjunct therapy,
Ivermectin (IVM), was then shown to improve the motor behavior of female mice to a greater
degree than male mice (Warnecke et al., 2020). Treatment with L-DOPA + IVM may prove to be
a novel therapy for the treatment of PD, with the potential for treatment tailoring based on
biological sex. However, while IVM has been able to affect a number of DA linked behaviors,
including ethanol consumption, anxiety, sensorimotor deficits, and sociocommunicative behavior
(Franklin et al., 2014; Khoja et al., 2019; Khoja, Huynh, Warnecke, et al., 2018; Khoja et al., 2016;
Wyatt et al., 2013; Yardley et al., 2012), no studies have been conducted to determine if IVM is
able to alter DA release .
The goal of this study was to determine the ability of IVM, a positive allosteric modulator
(PAM) of P2X4s, to alter presynaptic DA release. Previous studies conducted have shown that
IVM is able to cause increased anti-parkinsonian behavior in the context of DA depletion, but have
yet to determine if IVM is able to directly alter DA neurotransmission (Khoja et al., 2016; Warnecke
et al., 2020). Therefore, fast scan cyclic voltammetry (FSCV) was used to measure effects of IVM
on synaptic DA release, and the effect of L-DOPA+IVM interactions on DA release.
Methods
4.2.1 Animal Subjects
Female and male C57BL/6 mice (>30-d-old) were bred and cared for in accordance with
the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Animals were
housed on a reverse 12:12 h light/dark cycle (lights on from 8 PM to 8 AM) in groups of 2–5/cage
and given ad libitum access to food and water. Experimental protocols were approved by the
Brigham Young University Institutional Animal Care and Use Committee according to National
Institutes of Health Guide for the care and use of laboratory animals.
4.2.2 Brain Slice Preparation
69

Coronal brain slices were obtained as previously described (Yorgason et al., 2017).
Briefly, animals were anesthetized with isoflurane (5%), decapitated, and brains were rapidly
dissected and sectioned into 220 μm slices in artificial cerebrospinal fluid (ACSF) cutting solution:
oxygenated at 95% O2/5% CO2 and consisting of (in mM) 126 NaCl, 2.5 KCl, 1.2 NaH 2PO4, 1.2
MgCl2, 21.4 NaHCO3, and 11 glucose. The solution was maintained at ~36 °C with a pH of ~7.3.
Cutting solution also contained either ketamine (100 µM) to block ionotropic glutamate receptors
for slice health. Slices were transferred to a recording chamber with continuous ACSF flow (2.0
mL/min) maintained at 34–36 °C. The dorsal striatum was visualized at the level of the dorsal
horn under low magnification with Nikon Diaphot inverted microscopes in the transmitted light
mode and Olympus X51 microscopes with transmitted infrared Dodt gradient contrast imaging.
4.2.3 Fast Scan Cyclic Voltammetry Recordings
Electrically evoked DA release was obtained using FSCV. Carbon fiber electrodes (CFEs)
were Nafion coated using a 1.5V 90s electrodeposition pretreatment (Qi et al., 2016). Electrodes
were positioned at an angle, ~ 75 μm below the surface of the slice in the DS. DA release was
electrically evoked every 2 min by monophasic stimulation, utilizing an alternating single pulse/ 5
pulse protocol (0.5 msec pulse, 350 μA, 20 Hz) from an ACSF-filled micropipette placed 100–200
μm from the CFE. The CFE potential was linearly scanned from −0.4 to 1.2 V and back to −0.4 V
vs Ag/AgCl (scan rate = 400 V/s). Cyclic voltammograms were recorded every 100 msec (10 Hz)
with ChemClamp potentiometers (Dagan Corporation, Minneapolis, MN, USA). Recordings were
performed and analyzed using LabVIEW (National Instruments, Austin, TX, USA) based Demon
Voltammetry software (Yorgason et al., 2011). Results were determined from maximum oxidation
peak values for DA experiments. The maximum amplitude of the DA signal (peak nA value) was
measured and analyzed for DA experiments.
4.2.4 Drug Preparation and Administration
70

L-DOPA (cat. no. PHR1271, Sigma-Aldrich, St. Louis, Missouri, USA) and IVM (cat. no.
NDC 55529-012-01, Norbrook Laboratories, Ltd, Newry, North Ireland, UK) were dissolved in
stock solutions and then diluted into ACSF at specified concentrations (10µM L-DOPA, IVM
100nM-10µM). These drugs were administered to the brain slice using both a gravity-based flow
system and peristaltic pumps (1-2ml/min).
4.2.5 Statistical Analysis
To compare across multiple animals and slices, the DA release (in nA) was averaged
across the last three 1 pulse or 5 pulse baseline (BL) recordings to normalize DA release. This
was done to provide the mean of three consecutive samples obtained before any pharmacological
manipulation. The normalized data for each slice was compared to the peak DA release after
each treatment in the same slice.
Statistical analysis was performed using R (R Core Team (2013) R: A language and
environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
URL http://www.R-project.org/.) with packages dplyr, ggplot2, plyr, DescTools and ggsignif
installed. A two-way ANOVA with replication was used to assess effects of sex and treatment in
all experiments (except for the additional 1 pulse L-DOPA + IVM experiments which were only
conducted in females). For IVM dosing data, we evaluated the relationship of treatment (IVM
across 4 concentrations and after administration) and potential for sex interaction. For L-DOPA
only data, we evaluated the effects of treatment with L-DOPA alone and post L-DOPA treatment
in combination with potential sex interaction. When evaluating L-DOPA+IVM data, only 5 pulse
data was analyzed by two-way ANOVA to evaluate the treatment*sex interaction. Some 1 pulse
data was obtained in female mice only and was analyzed via a one-way ANOVA. Significance for
all tests was set at p < 0.05.
71

Results
4.3.1 IVM’s Effect on DA Release Differed Between Males and Females
IVM was applied to slices across a range of four concentrations (100nM, 500nM, 1 µM,
and 10µM) in the dorsal striatum when 1 pulse of 20Hz or 5pulses of 20Hz of electrical current
was applied. For data collected after 1 pulse stimulation there was a significant sex effect (Figure
4.1, females: BL n=4, 100nM n=4, 500nM n=4, 1 µM n=4, 10 µM n=4, Post IVM n=4; males: BL
n=5, 100nM n=3, 500nM n=4, 1 µM n=3, 10 µM n=3, Post IVM n=4; two-way ANOVA
F(1,34)=12.123, p< 0.05) and treatment (two-way ANOVA F(5,34)=3.164, p< 0.05, Tukey p<0.05)
effect on 1 pulse peak height. Treatment with 10µM of IVM significantly decreased 1 pulse peak
height (compared to baseline). There was trend for treatment*sex effect (two-way ANOVA
F(5,34)=2.164, p< 0.09) that releveled significant differences (Tukey p< 0.05) in response to 500nM
of IVM between male (1.13 ± 0.07) and female mice (0.59 ± 0.16) (Figure 4.1). Rise time did not
significantly differ (two-way ANOVA, sex F(1,34)=2.963, p> 0.05; treatment; F(5,34)=0.647, p> 0.05;
or sex*treatment F(5,34)=0.710, p> 0.05) and there was no significant effect on normalized tau (two-
Figure 4.1 IVM decreases dopamine release in female mice
A) Graph comparing the normalized 1 pulse DA released at baseline (BL) ( n= 4 females, 5 males )in the
presence of IVM across a range of concentrations:100nM (n= 4 females, 5males) , 500nM (n=4 females
and males), 1µM (n=4 females, 3 males), 10 µM (n=4 females, 3 males). ** indicates a p<0.05 for females
at 500nm vs males at 500nM and females at 500nM compared to BL B) Graph comparing the normalized
1 pulse DA released at 10 µM (n=4 females, 3 males).and after the application of IVM had ceased (Wash)
(n=4 females and males).
72

way ANOVA, sex F(1,27)=0.158, p> 0.05; treatment; F(5,27)=2.330, p> 0.05; or sex*treatment
F(5,27)=0.311, p> 0.05).
Overall, IVM treatment after 5 pulse stimulation showed a significant sex difference and
decreased DA release after IVM treatment (Figure 4.2). For 5 pulse peak height there was a
significant sex effect (females: BL n=4, 100nM n=4, 500nM n=4, 1 µM n=4, 10 µM n=4, Post IVM
n=4; males: BL n=6, 100nM n=3, 500nM n=5, 1 µM n=3, 10 µM n=3, Post IVM n=3; two-way
ANOVA F(1,35)=7.113, p< 0.05) and a significant treatment effect (F(5,35)=6.886, p< 0.05, Tukey p<
Figure 4.2 IVM induces changes in release kinetics of male mice
A)Graph comparing the normalized 5 pulse DA released at baseline (BL) (n= 4 females, 6 males )in the
presence of IVM across a range of concentrations:100nM (n= 4 females, 3males) , 500nM (n=4 females, 5
males), 1µM (n=4 females, 3 males), 10 µM (n=4 females, 3 males). B) Graph comparing the normalized 5
pulse DA released at 10 µM (n=4 females, 3 males).and after the application of IVM had ceased (Wash)
(n=4 females, 3 males). C) Graph comparing the normalized 5:1 pulse DA released at BL (n= 4 females, 5
males) in the presence of IVM across a range of concentrations:100nM (n= 4 females, 3males) , 500nM (n=4
females and males), 1µM (n=4 females, 3 males), 10 µM (n=4 females, 3 males).D) Graph comparing the 5
pulse normalized Tau at baseline (BL) (n= 4 females, 6 males )in the presence of IVM across a range of
concentrations:100nM (n= 4 females, 3males) , 500nM (n=4 females, 5 males), 1µM (n=4 females, 3 males),
10 µM (n=4 females, 3 males). E) Graph comparing the 5 pulse normalized rise time in seconds (s) at
baseline (BL) (n= 4 females, 6 males )in the presence of IVM across a range of concentrations:100nM (n= 4
females, 3males) , 500nM (n=4 females, 5 males), 1µM (n=4 females, 3 males), 10 µM (n=4 females, 3
males).
73

0.05) effect, but not a significant sex*treatment interaction(F(5,35)=1.483, p> 0.05) (Figure 2) .
Treatment with 500nM (0.75 ± 0.08), 10µM (0.65 ± 0.09), and Post IVM (0.68 ± 0.07) significantly
decreased 5 pulse peak height compared to baseline. IVM at 10µM and post IVM significantly
decreased peak heights compared to 100nM IVM (1.01 ± 0.05). The Ratio of 5 pulse to 1 pulse
peak height was not significantly affected by gender (two-way ANOVA F 1,33)=1.370, p> 0.05) or
treatment (two-way ANOVA F5,33)=1.250, p> 0.05) (Figure 4.2). Rise time for 5 pulse peaks was
significantly affected by gender (two-way ANOVA F1,35)=7.208, p< 0.05). With male mice having
significantly longer rise times compared to female mice (Figure 2). There was also a significant
sex difference on normalized tau (two-way ANOVA F5,33)=11.484, p< 0.05).
74

4.3.2 L-DOPA Increased DA Release in Males and Females
When L-DOPA was applied to slices and there was no significant sex effect (females: BL
n=8, L-DOPA n=8, Post L-DOPA n=7; males: BL n=8, L-DOPA n=8, Post L-DOPA n=8) two-way
ANOVA F(1,41)=0.639, p> 0.05) or sex*treatment effect (two-way ANOVA F(1,41)=0.639, p> 0.05),
but there is a significant treatment effect for L-DOPA and post L-DOPA (two-way ANOVA
F(2,41)=6.817, p< 0.05, Tukey p<0.05) on 5 pulse peak height (Figure 3). L-DOPA increased DA
peak height during (1.33 ± 0.07) and after application (1.38 ± 0.12), compared to baseline. There
was a significant gender effect on the 5 pulse rise time (two-way ANOVA F(1,41)=49.136, p< 0.05)
with females having increased rise times and compared to males. There was also a significant
Figure 4.3 L-DOPA increase DA release
A) Graph comparing the normalized 5 pulse DA released at baseline (BL) (n= 8 females and males) and
with L-DOPA (10 µM, n= females and males). * indicated p<0.05 for L-DOPA treatment compared to BL.
B) Graph comparing the normalized 5 pulse DA released at baseline (BL) (n= 8 females and males) and
with after application of L-DOPA (post L-DOPA) (n= 8 females, 7 males).C) Graph comparing the 5 pulse
rise time in seconds (s) at baseline (BL) (n= 8 females and males) and post L-DOPA (n= 8 females, 7
males).D) Graph comparing the 5 pulse normalized Tau at baseline (BL) (n= 8 females and male) and post
L-DOPA (n= 8 females, 7 males).

A
B
D
C
75

treatment effect (two-way ANOVA F(2,41)=3.723, p< 0.05, Tukey p< 0.05) on rise time, with rise
time increasing post L-DOPA (Figure 3). There was no significant sex effect (two-way ANOVA
F(2,36)=1.945, p> 0.05) on normalized tau, but there was a treatment effect (two-way ANOVA
F(2,36)=3.831, p< 0.05, Tukey p< 0.05) with L-DOPA increasing normalized tau (1.47 ± 0.17)
compared to baseline (Figure 3).
4.3.3 L-DOPA + IVM Increased DA release
The effect of IVM ( females n=4, males n=5), L-DOPA (females and males n=8), and L-
DOPA + IVM (females n=4, males n=5) was evaluated in the dorsal striatum after 5 pulse
stimulation(Figure 4 & 5). There was a significant treatment effect (two-way ANOVA
F(6,84)=14.154, p< 0.05) on normalized peak height and a trend for sex effect, (two-way ANOVA
Figure 4.4 L-DOPA + IVM interactions in females
A) Graph comparing the normalized 1 pulse DA released at baseline (BL) (n= 16), L-DOPA (n= 8), L-
DOPA + IVM (n=4) and IVM (n= 4). * indicated p<0.05 for L-DOPA +I VM treatment compared to BL and
IVM compared with L-DOPA + IVM and L-DOPA. B) Graph comparing the 1 pulse rise time at baseline
(BL) (n= 16), L-DOPA (n= 8), L-DOPA + IVM (n=4) and IVM (n= 4). C) Graph comparing the normalized 5
pulse DA released at baseline (BL) (n= 16), L-DOPA (n= 8), L-DOPA + IVM (n=4) and IVM (n= 4). *
indicated p<0.05 for IVM compared with L-DOPA + IVM and L-DOPA. D) Graph comparing the 5 pulse
rise time at baseline (BL) (n= 16), L-DOPA (n= 8), L-DOPA + IVM (n=4) and IVM (n= 4). E) Graph
comparing the 5 pulse rise time at baseline (BL) (n= 16), post L-DOPA (n= 7), post L-DOPA + IVM (n=4)
and post IVM (n= 4). * indicated p<0.05 post L-DOPA compared to BL.
76

F(1,84)=3.251, p< 0.08), but no treatment*sex effect (two-way ANOVA F (6,84)=0.529, p> 0.05).
Baseline recordings were significantly increased by application of L-DOPA + IVM (1.59 ± 0.16,
Tukey p< 0.001) and L-DOPA alone (1.33 ± 0.07, Tukey p< 0.05). The Tukey test also reviled L-
DOPA + IVM (1.53 ± 0.16) treatment was significantly greater (p< 0.001) than treatment with IVM
alone (0.76 ± 0.08). There was no significant impact on rise time (two-way ANOVA; sex
F(6,84)=0.787, treatment F (6,84)=1.582, sex*treatment F(6,84)=1.869, all p> 0.05).
To further evaluate the effect of IVM on female mice the effect of IVM (n=4), L-DOPA
(n=8), and L-DOPA + IVM (n=4) was evaluated in the dorsal striatum with 1 pulse stimulation
there was a significant treatment effect (one-way ANOVA F(6,40)=9.841, p> 0.05, Tukey p> 0.05)
when comparing IVM (0.59 ± 0.16) and L-DOPA + IVM (1.42 ± 0.17) treatment to baseline, but
not a significant L-DOPA effect (1.29 ± 0.05) compared to baseline (Figure 4). Additionally, there
was an IVM treatment effect (Tukey p< 0.05) versus L-DOPA +IVM effect, but not a significant
IVM versus L-DOPA. There was no significant difference in rise time (one-way ANOVA
F(6,40)=1.49, p> 0.05).

Figure 4.5 L-DOPA + IVM interactions in males
A) Graph comparing the normalized 5 pulse DA released at baseline (BL) (n= 18), L-DOPA (n= 8), L-DOPA
+ IVM (n=5) and IVM (n= 5). * indicated p<0.05 for L-DOPA +I VM treatment compared to BL and IVM
compared with L-DOPA + IVM. B) Graph comparing the 5 pulse rise time at baseline (BL) (n= 18), L-DOPA
(n= 8), L-DOPA + IVM (n=5) and IVM (n= 5).

77

Discussion
The present study tested the hypothesis that IVM, when combined with L-DOPA, would
increase pre-synaptic DA release compared to baseline DA release in the dorsal striatum of mice.
We accomplished this goal using fast scan cyclic voltammetry to measure changes in DA release
caused by presynaptic changes induced by IVM on DA release, on its own and in combination
with L-DOPA. We found that IVM administration to female brain slices isolated from mice resulted
in a significant reduction in DA release compared to baseline. This change was not observed in
brain slices tested in male mice. When L-DOPA was applied in slice there was a significant
difference in rise time between male and female mice, but there was not a significant sex
difference in the increased DA release (after the application of L-DOPA). When IVM was applied
in combination with L-DOPA, DA release increased compared to baseline, to a greater degree
than L-DOPA alone.
Although the primary goal of this study was to determine the presynaptic effects of IVM on
DA release, we also investigated the role of sex on IVM’s molecular outcomes. The use of FSCV
allows for the determination of changes in DA release with high temporal and spatial resolution
(Ferris et al., 2013). The use of FSCV in slice allowed for the detection of a more robust signal,
highly accurate region targeting, and for the application of multiple IVM concentrations on the
same slice to quickly determine electrophysiological outcomes (Ferris et al., 2013). However, in
slice there are known physiological barriers, such as metabolism or flux, and work conducted in
slice only gives a snapshot of what may be happening in vivo. Future studies conducted in vivo
will provide insight on DA alterations by IVM in the presence of the blood brain barrier and
additional physiological systems which may impact IVM’s effect. These studies will be crucial to
our understanding of IVM, especially as IVM is a p-glycoprotein substate allowing it to be readily
fluxed out of the brain (Edwards, 2003; Silva et al., 2020; Yardley et al., 2012).
78

Previous studies conducted on the effect of IVM in a mouse PD model showed that L-
DOPA + IVM was capable of altering DA motor behavior to a greater extent than L-DOPA on its
own (Khoja et al., 2016; Warnecke et al., 2020). IVM’s effects have been linked to IVM activity as
a PAM of P2X4s and γ-aminobutyric acid type A (GABAA) receptors (Bortolato et al., 2013;
Coddou, Stojilkovic, et al., 2011; Crichlow & Crawford, 1988; Dawson et al., 2000; Diggs et al.,
1990; Jelínková et al., 2006; Khoja et al., 2016; Wyatt et al., 2014; Yardley et al., 2012). Notably,
in P2X4 knock out (P2X4 KO) mice behavioral effects, such as decreased drinking and increased
motor behavior, of IVM have been diminished (Khoja et al., 2016; Wyatt et al., 2014). This
reduction in effect suggests that P2X4s are mediators of IVMs effect on behavioral outcomes.
The effects of IVM on GABAA receptors are also important as GABAA increases in striatal GABA
activity can decrease DA activity (Exposito et al., 1999), and future studies will need to determine
if the effects observed in this study are altered when GABA activity is inhibited. The current study
conducted was designed to determine if the behavioral outcomes reported in mouse models of
PD were caused by alterations in presynaptic DA release. The results of this study suggest that
the behavioral effects seen in PD mouse models were linked to L-DOPA + IVM’s ability to
significantly increase DA activity to a greater degree than L-DOPA on its own. Future FSCV
studies conducted on P2X4 KO mice are needed to confirm the role of P2X4s in IVMs reduction
of DA concentration.
Based on our previous work, where we identified a sex dependent difference in some IVM
activities, but not in others, we utilized both male and female mice in this study. The behavioral
effects of IVM, in relation to sex, were previously studied in models of alcohol use disorder (AUD)
and PD. Interestingly, the studies conducted on AUD in mice did not show any significant
differences between male and female mice. That is, we found that IVM significantly reduced
drinking behavior to a similar degree in both male and female mice (Silva et al., 2020; Yardley et
al., 2012). In contrast, in my recent investigations, I found a significant difference in IVM efficacy
in female mice in response to treatment with L-DOPA + IVM using a PD mouse model of DA
79

depletion, that was not seen in male mice (Warnecke et al., 2020). Surprisingly, we found IVM
alone reduced stimulated DA release in female, but not male, mice. Decreased DA release by
IVM was surprising in that behavioral studies found no effect of IVM on its own in behavior linked
to the dorsal striatum (Khoja et al., 2016). L-DOPA + IVM treatment was able to increase DA
release, more so than L-DOPA alone, and provides a potential mechanistic explanation for the
increase anti-parkinsonian behavior observed in mice treated with L-DOPA + IVM (Khoja et al.,
2016; Warnecke et al., 2020).
Thus far, despite the sexually dysmorphic nature of DA systems and the importance of DA
transmission in PD pathology, limited research has been conducted using female animals in PD
models, with the bulk of research conducted using only males. Differences in hormones and
development between males and females are cited as reasons for differences in PD prevalence
and severity between female and males (Ullah et al., 2019; Yoritaka et al., 2020). Sex differences
are also an important factor in PD treatment; when L-DOPA is given to PD patients there have
been reports indicating females have increased dyskinesia frequency and increased L-DOPA
bioavailability (Cerri et al., 2019; Dahodwala et al., 2016; Mittur et al., 2017). In this study, L-
DOPA increased DA release at a similar level in both male and female mice. L-DOPA given in
combination with IVM also did not indicated a sex or sex*treatment effect on DA release. This
information in combination with the lack of sex differences in response to L-DOPA treatment alone
indicate presynaptic alterations in DA are unlikely to be responsible for sex difference seen in the
DA depletion study. Other potential factors to explain the sex differences in DA behavioral
response are decreased D2 receptor expression in females, increased ratio of D1:D2 receptor
expression in females, and/or altered release kinetics (Cerri et al., 2019; Walker et al., 2000).
Additionally, sex difference may be altered or become more pronounced in a DA depleted model
due to the lesion itself or compensatory mechanisms (Blesa et al., 2017). Future studies utilizing
brain slices obtained from 6-OHDA lesioned mice will help elucidate the effects of L-DOPA and
L-DOPA + IVM.
80

Limited studies have been conducted on release kinetics, such as rise time (Ferris et al.,
2013; Ford et al., 2010; Rice et al., 2011), but the increased rise time exhibited by males after
application of IVM suggests one potential reason for differences seen in behavioral studies.
Interestingly, females had increased rise times post L-DOPA application, but when IVM was
applied in combination with L-DOPA the rise time was no longer increased. It has been shown, in
vivo, that L-DOPA may cause delayed inhibition of DA release kinetics in the dorsal striatum
(Harun et al., 2015; Harun et al., 2016). While rise time was not explicitly reported in this study,
the delayed rise time may be an early marker for eventual inhibition of DA release, which may
occur at a sooner time point in females compared to males. The application of IVM with L-DOPA
diminished this effect, indicating IVM may increase L-DOPA’s effect by delaying or altering L-
DOPA’s latent effect of DA inhibition.
Conclusion

This study provided novel information about the effects of IVM on DA release in slice and
further support the investigation of IVM as an adjunct therapy for PD. Additionally, the sex effects
of L-DOPA were explored in this study and provided novel evidence of sex differences in rise
time, but not the amount of DA released. Future studies are needed to determine if DA depletion,
via pharmacological inhibition or premortem surgery, alters the effects of L-DOPA, IVM, and their
combination.
81

CHAPTER 5
Conclusion
Over the course of my dissertation, I explored the positive modulation of P2X4s as a novel
adjunct therapeutic for the treatment of PD, utilizing IVM as my model drug in combination with
L-DOPA. I explored my hypothesis, positive P2X4 modulation increased presynaptic DA release
utilizing in vivo behavioral test (chapters 2 & 3) and evaluation of in slice FSCV (chapter 4).
5.1.1 Summary of Overall Findings
5.1.2 IVM and Not MOX Improves Motor Behavior in a PD Model
When evaluating the effects of IVM and MOX in the 6-OHDA model, in chapter 1, I was
surprised to find MOX was unable to alter rotational behavior. Previous research conducted by
the Davies lab found MOX was able to decrease EtOH drinking behavior at an earlier time point
than IVM (4 hours for MOX and 8 hours for IVM) and to a degree that was greater than IVM
(Huynh et al., 2017). Furthermore, MOX is a macrocyclic lactone, like IVM, and has decreased
affinity for GABA and Pgp receptors, compared to IVM (Huynh et al., 2017; Khoja, Huynh,
Warnecke, et al., 2018). This caused me to originally hypothesize that MOX would have a similar
behavior effect as IVM in the 6-OHDA model with decreased onset to effect and decreased risk
of neurotoxicity (a concern for IVM dosing as patients deficient in Pgp receptors may be at risk
for neurotoxicity at otherwise well tolerated doses) (Silva et al., 2020). However, when tested as
an adjunct treatment with L-DOPA, MOX was unable to alter rotational behavior. In the same
cohort of mice, in agreement with previous research (Khoja et al., 2016), IVM was able to increase
rotational behavior when given in combination with L-DOPA. The results of this experiment may
be due to IVM’s stronger affinity for P2X4s, compared to MOX, and potential GABAergic effects
of IVM (Asatryan et al., 2014; Khoja, Huynh, Warnecke, et al., 2018; Popova et al., 2013). The
GABAergic effects of IVM alone are unlikely to be the only factor contributing to the difference in
MOX and IVM’s effect, as P2X4 KO mice showed decreased behavioral response to IVM in the
82

6-OHDA model (implicating P2X4s mediate the effect) (Khoja et al., 2016). The results of chapter
1 lead me to move forward with IVM as our investigational adjunct therapy for PD and all further
experimentation was carried out using IVM.
5.1.3 Female and Male Mice Have Different Behavioral Outcomes
Throughout my dissertation I evaluated outcomes using both female and male mice.
Originally, I did not hypothesize that biological sex would impact IVM’s behavioral outcomes,
because previous studies using female mice in EtOH studies failed to indicated a sex impact on
drinking behavior (Yardley et al., 2012). Interestingly, in almost every behavioral outcome tested
(chapters 2& 3) there was a significant sex effect. The sex differences in lesioned mice could be
a result of differences in compensatory mechanism that appear after lesioning, such as differential
upregulation of dopaminergic receptor (Betancourt et al., 2017; McArthur et al., 2007; Rivera-
Garcia et al.; Zappia et al., 2005). Chapter 2 studies indicated female and male mice responded
differently to known DA modifiers AMPH and L-DOPA. Female mice had a greater rotational
response to AMPH administration and male mice had greater rotational responses to L-DOPA
administration. The difference in response to AMPH (relying on DA release from the nonlesioned
striatum) and L-DOPA (involving activation of the lesioned striatum) indicate that compensatory
changes differ between sexes on both the lesioned and nonlesioned striatum in 6-OHDA
unilaterally lesioned mice. Further qRT-PCR testing (chapter 3) supports this hypothesis, in that
female and male mice showed different changes in gene expression after lesioning. When
additional behavioral tests were observed, in chapter 3, I found a sex effect on the behavioral
outcomes of rotarod and novel object performance. While this may be due to sex differences
brought about due to DA depletion, nonlesioned mice also showed differences in object
exploration during the NOR test (chapter 3). This data is in agreement with previously reported
differences across a variety of animals, which report sex related differences in NOR outcome
measures (Cost et al., 2012; Frick & Gresack, 2003; Lucon-Xiccato & Dadda, 2016). Though I did
83

not originally set out to investigate the sex differences in PD models and treatment, the results of
my dissertation reveal the importance of using males and females during research.
5.1.4 IVM’s Effect on DA Differs in the Presence of L-DOPA
To determine if the behavioral effects seen in chapter 2 and 3 were due to IVM’s ability to
alter presynaptic DA release, I evaluated the effects of IVM in slice. Chapter 4 studies used brain
slices collected from male and female mice and tested the effect of IVM, across a range of
concentrations, on DA release in the dorsal striatum. 500nM IVM applied to female brain slices
decreased DA. However, this same dose had no effect on male mice. It was anticipated that IVM,
on its own, would have limited to no effect on DA release, because IVM on its own was not found
to affect rotational behaviors in previous studies or studies conducted in chapter 2 (Khoja et al.,
2016). While unexpected, if this same effect is found to occur in the ventral striatum (involved in
addiction), this result would indicate a mechanism by which IVM decreases EtOH and
sucrose/saccharine consumption. As decreased DA levels would diminish the sensitivity of mice
to normally rewarding substances, such as EtOH and sucrose (Muscat & Willner, 1989; Volkow
et al., 2004).
When L-DOPA + IVM was applied to slices, there was a significant increase in DA, and
DA increased to a higher degree than with L-DOPA on its own in both female and male mice.
These results may explain the increase in rotational behavior seen in chapter 2 studies, as L-
DOPA + IVM is able to elicit a greater release of DA, causing increased activation on the lesioned
side. Surprisingly, there was no sex difference in the degree of DA release in the presence of L-
DOPA + IVM. Chapter 2 studies found a significant increase in rotational behavior after L-DOPA
+IVM treatment in female compared to male mice. However, it is important to note that all chapter
4 FSCV studies were conducted in WT mice. In the context of lesioning or DA depletion, effects
of L-DOPA and L-DOPA + IVM may be altered.
In addition, differences in release kinetics between males and females in the presence of
L-DOPA (alone) and IVM (alone), and differences in DA release from IVM (alone) further
84

emphasize the importance of biological sex as a variable. Numerous studies conducted report
differences in DA activity due to development and sex hormone influences, but the vast majority
of non-clinical studies have utilized only male mice (Betancourt et al., 2017; Cunningham et al.,
2011; Dahodwala et al., 2016; Freund et al., 2014; Lee et al., 2019; Lopes-Ramos et al., 2020;
Miller & Cronin-Golomb, 2010; Rivera-Garcia et al.; Ullah et al., 2019; Walker et al., 2000). Moving
forward, electrophysiological studies must continue to recognize the importance of biological sex
and design experiments utilizing both male and female animals/tissue.
5.1.5 Future Directions
The research conducted for my dissertation indicates that positive P2X4 modulation, by
IVM, is capable of altering presynaptic DA release in the dorsal striatum. Evidence for this
conclusion comes from behavioral (chapter 2 & 3) and electrophysiological data (chapter 4). In
addition, mounting evidences from my doctoral research show that P2X4s represent promising
novel targets for the adjunct treatment of PD. In that IVM is already approved for use in humans,
and has been shown to be well tolerated in humans when dosed daily (Roche et al., 2016), clinical
trials beginning to investigate IVM as adjunct therapy for PD in patients could occur at a far faster
rate than that of a novel therapy never before tested in humans.
IVM was identified as the representative drug to target P2X4s while producing behaviorally
relevant outcomes. To further develop IVM for use in the treatment of PD, future studies need to
be conducted in models of PD that cause non-motoric deficit or additional deficits in conjunction
with motor deficits, such as learning, memory, and depression. Use of animals with more
advanced brains, e.g. rats, may be useful in identifying these deficits and characterizing the
therapeutic profile of L-DOPA + IVM. To further understand the role of P2X4 versus GABAA
receptors in IVM treatment, the application of GABAA antagonist in FSCV studies will be needed.
The use of P2X4 KO and DA depleted mice in FSCV experiments are also need to fully determine
the role of P2X4’s on DA release and kinetics. Understanding these mechanisms will help elicit
IVM’s mechanism of action.
85

Finally, all studies going forward in the evaluation of P2X4s and their modulation must
include female and male mice. While all of IVM’s effects may not differ between sexes, the failure
to detect a significant sex difference during early non-clinical studies could drastically alter the
ability of future clinical trials to move forward. If one sex has an unexpected, and greatly
disproportionate, response compared to what is expected, a potential for adverse side effects
arises. Conversely, if one sex fails to respond at the selected clinical dose of treatment, that is
efficacious in the other sex, the drug may appear less efficacious than it truly is. As I learned early
during my graduate career, personalized medicine plays an important role in our current and
future drug development.

86

REFERENCES
Abbracchio, M. P., Burnstock, G., Verkhratsky, A., & Zimmermann, H. (2009). Purinergic signalling in the
nervous system: an overview [Review]. Trends in Neurosciences, 32(1), 19-29.
https://doi.org/10.1016/j.tins.2008.10.001
Alves, L. A., da Silva, J. H., Ferreira, D. N., Fidalgo-Neto, A. A., Teixeira, P. C., de Souza, C. A., Caffarena,
E. R., & de Freitas, M. S. (2014).
Structural and molecular modeling features of P2X receptors. Int J Mol Sci, 15(3), 4531-4549.
https://doi.org/10.3390/ijms15034531
Amadio, S., Montilli, C., Picconi, B., Calabresi, P., & Volonté, C. (2007). Mapping P2X and P2Y receptor
proteins in striatum and substantia nigra: An immunohistological study. Purinergic Signal, 3(4), 389-
398. https://doi.org/10.1007/s11302-007-9069-8
Ambani, L. M., & Van Woert, M. H. (1973). Start hesitation--a side effect of long-term levodopa therapy. N
Engl J Med, 288(21), 1113-1115. https://doi.org/10.1056/NEJM197305242882108
Antonini, A., Moro, E., Godeiro, C., & Reichmann, H. (2018). Medical and surgical management of
advanced Parkinson's disease. Mov Disord, 33(6), 900-908. https://doi.org/10.1002/mds.27340
Asatryan, L., Nam, H. W., Lee, M. R., Thakkar, M. M., Saeed Dar, M., Davies, D. L., & Choi, D. S. (2011).
Implication of the purinergic system in alcohol use disorders. Alcohol Clin Exp Res, 35(4), 584-594.
https://doi.org/10.1111/j.1530-0277.2010.01379.x
Asatryan, L., Ostrovskaya, O., Lieu, D., & Davies, D. L. (2018). Ethanol differentially modulates P2X4 and
P2X7 receptor activity and function in BV2 microglial cells [Article]. Neuropharmacology, 128, 11-
21. https://doi.org/10.1016/j.neuropharm.2017.09.030
Asatryan, L., Popova, M., Perkins, D., Trudell, J. R., Alkana, R. L., & Davies, D. L. (2010). Ivermectin
Antagonizes Ethanol Inhibition in Purinergic P2X4 Receptors [Article]. Journal of Pharmacology
and Experimental Therapeutics, 334(3), 720-728. https://doi.org/10.1124/jpet.110.167908
Asatryan, L., Popova, M., Woodward, J. J., King, B. F., Alkana, R. L., & Davies, D. L. (2008). Roles of
ectodomain and transmembrane regions in ethanol and agonist action in purinergic P2X2 and P2X3
receptors [Article]. Neuropharmacology, 55(5), 835-843.
https://doi.org/10.1016/j.neuropharm.2008.06.044
Asatryan, L., Yardley, M. M., Khoja, S., Trudell, J. R., Hyunh, N., Louie, S. G., Petasis, N. A., Alkana, R. L.,
& Davies, D. L. (2014). Avermectins differentially affect ethanol intake and receptor function:
implications for developing new therapeutics for alcohol use disorders. Int J
Neuropsychopharmacol, 17(6), 907-916. https://doi.org/10.1017/S1461145713001703
Ayton, S., George, J. L., Adlard, P. A., Bush, A. I., Cherny, R. A., & Finkelstein, D. I. (2013). The effect of
dopamine on MPTP-induced rotarod disability. Neurosci Lett, 543, 105-109.
https://doi.org/10.1016/j.neulet.2013.02.066
87

Bagga, V., Dunnett, S. B., & Fricker, R. A. (2015). The 6-OHDA mouse model of Parkinson's disease -
Terminal striatal lesions provide a superior measure of neuronal loss and replacement than median
forebrain bundle lesions. Behavioural Brain Research, 288, 107-117.
https://doi.org/10.1016/j.bbr.2015.03.058
Baraka, A. M., Korish, A. A., Soliman, G. A., & Kamal, H. (2011). The possible role of estrogen and selective
estrogen receptor modulators in a rat model of Parkinson's disease. Life Sciences, 88(19-20), 879-
885. https://doi.org/10.1016/j.lfs.2011.03.010
Bardoni, R., Goldstein, P. A., Lee, C. J., Gu, J. G., & MacDermott, A. B. (1997). ATP P2X receptors mediate
fast synaptic transmission in the dorsal horn of the rat spinal cord. J Neurosci, 17(14), 5297-5304.
Baxter, A. W., Choi, S. J., Sim, J. A., & North, R. A. (2011). Role of P2X4 receptors in synaptic strengthening
in mouse CA1 hippocampal neurons. Eur J Neurosci, 34(2), 213-220.
https://doi.org/10.1111/j.1460-9568.2011.07763.x
Bertin, E., Deluc, T., Pilch, K. S., Martinez, A., Pougnet, J. T., Doudnikoff, E., Allain, A. E., Bergmann, P.,
Russeau, M., Toulme, E., Bezard, E., Koch-Nolte, F., Seguela, P., Levi, S., Bontempi, B., Georges,
F., Bertrand, S. S., Nicole, O., & Boue-Grabot, E. (2020). Increased surface P2X4 receptor
regulates anxiety and memory in P2X4 internalization-defective knock-in mice. Molecular
Psychiatry. https://doi.org/10.1038/s41380-019-0641-8
Betancourt, E., Wachtel, J., Michaelos, M., Haggerty, M., Conforti, J., & Kritzer, M. F. (2017). THE IMPACT
OF BIOLOGICAL SEX AND SEX HORMONES ON COGNITION IN A RAT MODEL OF EARLY,
PRE-MOTOR PARKINSON'S DISEASE [Article]. Neuroscience, 345, 297-314.
https://doi.org/10.1016/j.neuroscience.2016.05.041
Blaszczyk, J. W., Orawiec, R., Duda-Kiodowska, D., & Opala, G. (2007). Assessment of postural instability
in patients with Parkinson's disease [Article]. Experimental Brain Research, 183(1), 107-114.
https://doi.org/10.1007/s00221-007-1024-y
Blesa, J., Trigo-Damas, I., Dileone, M., Del Rey, N. L., Hernandez, L. F., & Obeso, J. A. (2017).
Compensatory mechanisms in Parkinson's disease: Circuits adaptations and role in disease
modification. Exp Neurol, 298(Pt B), 148-161. https://doi.org/10.1016/j.expneurol.2017.10.002
Boix, J., Padel, T., & Paul, G. (2015). A partial lesion model of Parkinson's disease in mice--characterization
of a 6-OHDA-induced medial forebrain bundle lesion. Behav Brain Res, 284, 196-206.
https://doi.org/10.1016/j.bbr.2015.01.053
Boix, J., von Hieber, D., & Connor, B. (2018). Gait Analysis for Early Detection of Motor Symptoms in the
6-OHDA Rat Model of Parkinson's Disease. Front Behav Neurosci, 12, 39.
https://doi.org/10.3389/fnbeh.2018.00039
Bortolato, M., Yardley, M. M., Khoja, S., Godar, S. C., Asatryan, L., Finn, D. A., Alkana, R. L., Louie, S. G.,
& Davies, D. L. (2013). Pharmacological insights into the role of P2X(4) receptors in behavioural
regulation: lessons from ivermectin [Article]. International Journal of Neuropsychopharmacology,
16(5), 1059-1070. https://doi.org/10.1017/s1461145712000909
88

Brown, D. R., & Kretzschmar, H. A. (1997). Microglia and prion disease: a review. Histol Histopathol, 12(3),
883-892.
Brown, D. R., Schmidt, B., & Kretzschmar, H. A. (1996). Role of microglia and host prion protein in
neurotoxicity of a prion protein fragment. Nature, 380(6572), 345-347.
https://doi.org/10.1038/380345a0
Buell, G., Lewis, C., Collo, G., North, R. A., & Surprenant, A. (1996). An antagonist-insensitive P2X receptor
expressed in epithelia and brain. EMBO J, 15(1), 55-62.
Burnstock, G. (2009). Purines and sensory nerves. Handb Exp Pharmacol(194), 333-392.
https://doi.org/10.1007/978-3-540-79090-7_10
Burnstock, G. (2018). Purine and purinergic receptors. Brain Neurosci Adv, 2, 2398212818817494.
https://doi.org/10.1177/2398212818817494
Burnstock, G. (2020). Introduction to Purinergic Signalling in the Brain. Adv Exp Med Biol, 1202, 1-12.
https://doi.org/10.1007/978-3-030-30651-9_1
Burnstock, G., & Kennedy, C. (1985). IS THERE A BASIS FOR DISTINGUISHING 2 TYPES OF P2-
PURINOCEPTOR. General Pharmacology, 16(5), 433-440. https://doi.org/10.1016/0306-
3623(85)90001-1
Burnstock, G., Krugel, U., Abbracchio, M. P., & Illes, P. (2011). Purinergic signalling: From normal
behaviour to pathological brain function [Review]. Progress in Neurobiology, 95(2), 229-274.
https://doi.org/10.1016/j.pneurobio.2011.08.006
Carbonell, W. S., & Grady, M. S. (1999). Regional and temporal characterization of neuronal, glial, and
axonal response after traumatic brain injury in the mouse. Acta Neuropathol, 98(4), 396-406.
https://doi.org/10.1007/s004010051100
Carneiro, M. V., Americo, T. A., Guimaraes, M. Z. P., & Linden, R. (2016). The prion protein selectively
binds to and modulates the content of purinergic receptor P2X4R. Biochemical and Biophysical
Research Communications, 472(2), 293-298. https://doi.org/10.1016/j.bbrc.2016.02.122
Carvalho, M. M., Campos, F. L., Coimbra, B., Pêgo, J. M., Rodrigues, C., Lima, R., Rodrigues, A. J., Sousa,
N., & Salgado, A. J. (2013). Behavioral characterization of the 6-hydroxidopamine model of
Parkinson's disease and pharmacological rescuing of non-motor deficits. Mol Neurodegener, 8, 14.
https://doi.org/10.1186/1750-1326-8-14
Cerri, S., Mus, L., & Blandini, F. (2019). Parkinson's Disease in Women and Men: What's the Difference?
Journal of Parkinsons Disease, 9(3), 501-515. https://doi.org/10.3233/jpd-191683
Chandler, R. E. (2018). Serious Neurological Adverse Events after Ivermectin-Do They Occur beyond the
Indication of Onchocerciasis? Am J Trop Med Hyg, 98(2), 382-388.
https://doi.org/10.4269/ajtmh.17-0042
89

Coddou, C., Codocedo, J. F., Li, S., Lillo, J. G., Acuña-Castillo, C., Bull, P., Stojilkovic, S. S., & Huidobro-
Toro, J. P. (2009). Reactive oxygen species potentiate the P2X2 receptor activity through
intracellular Cys430. J Neurosci, 29(39), 12284-12291. https://doi.org/10.1523/JNEUROSCI.2096-
09.2009
Coddou, C., Stojilkovic, S. S., & Huidobro-Toro, J. P. (2011). Allosteric modulation of ATP-gated P2X
receptor channels. Rev Neurosci, 22(3), 335-354. https://doi.org/10.1515/RNS.2011.014
Coddou, C., Yan, Z. H., Obsil, T., Huidobro-Toro, J. P., & Stojilkovic, S. S. (2011). Activation and Regulation
of Purinergic P2X Receptor Channels. Pharmacological Reviews, 63(3), 641-683.
https://doi.org/10.1124/pr.110.003129
Cost, K. T., Williams-Yee, Z. N., Fustok, J. N., & Dohanich, G. P. (2012). Sex differences in object-in-place
memory of adult rats. Behav Neurosci, 126(3), 457-464. https://doi.org/10.1037/a0028363
Crichlow, E. C., & Crawford, R. D. (1988). EFFECTS OF IVERMECTIN ON SEIZURES INDUCED BY
ANTIGABAERGIC CONVULSANTS IN GENETICALLY EPILEPTIC CHICKENS. Faseb Journal,
2(5), A1067-A1067.
Cunningham, R. L., Macheda, T., Watts, L. T., Poteet, E., Singh, M., Roberts, J. L., & Giuffrida, A. (2011).
Androgens exacerbate motor asymmetry in male rats with unilateral 6-hydroxydopamine lesion
[Article]. Hormones and Behavior, 60(5), 617-624. https://doi.org/10.1016/j.yhbeh.2011.08.012
Dahodwala, N., Pei, Q. L., & Schmidt, P. (2016). Sex Differences in the Clinical Progression of Parkinson's
Disease. Jognn-Journal of Obstetric Gynecologic and Neonatal Nursing, 45(5), 749-756.
https://doi.org/10.1016/j.jogn.2016.05.002
Davies, D. L., Asatryan, L., Kuo, S. T., Woodward, J. J., King, B. F., Alkana, R. L., Xiao, C., Ye, J. H., Sun,
H., Zhang, L., Hu, X. Q., Hayrapetyan, V., Lovinger, D. M., & Machu, T. K. (2006). Effects of ethanol
on adenosine 5'-triphosphate-gated purinergic and 5-hydroxytryptamine receptors. Alcohol Clin
Exp Res, 30(2), 349-358. https://doi.org/10.1111/j.1530-0277.2006.00023.x
Davies, D. L., Kuo, S. T., & Alkana, R. L. (2005). Differential effects of propofol and ethanol on P2X4
receptors expressed in Xenopus oocytes. Int Congr Ser, 1283, 285-287.
https://doi.org/10.1016/j.ics.2005.07.090
Davies, D. L., Machu, T. K., Guo, Y., & Alkana, R. L. (2002). Ethanol sensitivity in ATP-gated P2X receptors
is subunit dependent. Alcohol Clin Exp Res, 26(6), 773-778.
Dawson, G. R., Wafford, K. A., Smith, A., Marshall, G. R., Bayley, P. J., Schaeffer, J. M., Meinke, P. T., &
McKernan, R. M. (2000). Anticonvulsant and adverse effects of avermectin analogs in mice are
mediated through the gamma-aminobutyric acid(A) receptor. J Pharmacol Exp Ther, 295(3), 1051-
1060.
Deleu, D., Northway, M. G., & Hanssens, Y. (2002). Clinical pharmacokinetic and pharmacodynamic
properties of drugs used in the treatment of Parkinson's disease. Clin Pharmacokinet, 41(4), 261-
309. https://doi.org/10.2165/00003088-200241040-00003
90

Dheen, S. T., Kaur, C., & Ling, E. A. (2007). Microglial activation and its implications in the brain diseases.
Curr Med Chem, 14(11), 1189-1197. https://doi.org/10.2174/092986707780597961
Diggs, H. E., Feller, D. J., Crabbe, J. C., Merrill, C., & Farrell, E. (1990). EFFECT OF CHRONIC
IVERMECTIN TREATMENT ON GABA RECEPTOR FUNCTION IN ETHANOL WITHDRAWAL-
SEIZURE PRONE AND RESISTANT MICE. Laboratory Animal Science, 40(1), 68-71.
Domercq, M., & Matute, C. (2019). Targeting P2X4 and P2X7 receptors in multiple sclerosis. Current
Opinion in Pharmacology, 47, 119-125. https://doi.org/10.1016/j.coph.2019.03.010
Domercq, M., Zabala, A., & Matute, C. (2019). Purinergic receptors in multiple sclerosis pathogenesis. Brain
Research Bulletin, 151, 38-45. https://doi.org/10.1016/j.brainresbull.2018.11.018
Dunnett, S. B. (2005). Chapter V Motor function(s) of the nigrostriatal dopamine system: Studies of lesions
and behavior (S. B. Dunnett, M. Bentivogoli, A. Björklund, & T. Hökfelt, Eds. Vol. 21). Elsevier.
https://doi.org/10.1016/S0924-8196(05)80009-0
Dziewczapolski, G., Mora, M. A., Menalled, L. B., Stefano, F. J. E., Rubinstein, M., & Gershanik, O. S.
(1997). Threshold of dopamine content and D-1 receptor stimulation necessary for the expression
of rotational behavior induced by D-2 receptor stimulation under normo and supersensitive
conditions. Naunyn-Schmiedebergs Archives of Pharmacology, 355(1), 30-35.
Edwards, G. (2003). Ivermectin: does P-glycoprotein play a role in neurotoxicity? Filaria J, 2 Suppl 1, S8.
https://doi.org/10.1186/1475-2883-2-S1-S8
Egan, T. M., & Khakh, B. S. (2004). Contribution of calcium ions to P2X channel responses. J Neurosci,
24(13), 3413-3420. https://doi.org/10.1523/JNEUROSCI.5429-03.2004
Engel, S., Schluesener, H., Mittelbronn, M., Seid, K., Adjodah, D., Wehner, H. D., & Meyermann, R. (2000).
Dynamics of microglial activation after human traumatic brain injury are revealed by delayed
expression of macrophage-related proteins MRP8 and MRP14. Acta Neuropathol, 100(3), 313-
322. https://doi.org/10.1007/s004019900172
Engel, S., Wehner, H. D., & Meyermann, R. (1996). Expression of microglial markers in the human CNS
after closed head injury. Acta Neurochir Suppl, 66, 89-95.
Exposito, I., Del Arco, A., Segovia, G., & Mora, F. (1999). Endogenous dopamine increases extracellular
concentrations of glutamate and GABA in striatum of the freely moving rat: Involvement of D1 and
D2 dopamine receptors. Neurochemical Research, 24(7), 849-856.
https://doi.org/10.1023/a:1020901929419
Fahn, S., & Parkinson Study, G. (2005). Does levodopa slow or hasten the rate of progression of
Parkinson's disease? [Article; Proceedings Paper]. Journal of Neurology, 252, 37-42.
https://doi.org/10.1007/s00415-005-4008-5

91

Fahn, S., & Sulzer, D. (2004). Neurodegeneration and neuroprotection in Parkinson disease. NeuroRx :
the journal of the American Society for Experimental NeuroTherapeutics, 1(1), 139-154.
https://doi.org/ [10.1602/neurorx.1.1.139]
Ferris, M. J., Calipari, E. S., Yorgason, J. T., & Jones, S. R. (2013). Examining the complex regulation and
drug-induced plasticity of dopamine release and uptake using voltammetry in brain slices. ACS
Chem Neurosci, 4(5), 693-703. https://doi.org/10.1021/cn400026v
Field, E. F., Metz, G. A., Pellis, S. A., & Whishaw, I. Q. (2006). Sexually dimorphic postural adjustments
during vertical behaviour are altered in a unilateral 6-OHDA rat model of Parkinson's disease.
Behavioural Brain Research, 174(1), 39-48. https://doi.org/10.1016/j.bbr.2006.07.004
Foltynie, T., & Kahan, J. (2013). Parkinson's disease: an update on pathogenesis and treatment. J Neurol,
260(5), 1433-1440. https://doi.org/10.1007/s00415-013-6915-1
Ford, C. P., Gantz, S. C., Phillips, P. E. M., & Williams, J. T. (2010). Control of Extracellular Dopamine at
Dendrite and Axon Terminals [Article]. Journal of Neuroscience, 30(20), 6975-6983.
https://doi.org/10.1523/jneurosci.1020-10.2010
Foster, H. D., & Hoffer, A. (2004). The two faces of L-DOPA: benefits and adverse side effects in the
treatment of Encephalitis lethargica, Parkinson's disease, multiple sclerosis and amyotrophic lateral
sclerosis. Med Hypotheses, 62(2), 177-181. https://doi.org/10.1016/S0306-9877(03)00318-9
Fountain, S. J., & Burnstock, G. (2009). An evolutionary history of P2X receptors [Review]. Purinergic
Signalling, 5(3), 269-272. https://doi.org/10.1007/s11302-008-9127-x
Franklin, K. M., Asatryan, L., Jakowec, M. W., Trudell, J. R., Bell, R. L., & Davies, D. L. (2014). P2X4
receptors (P2X4Rs) represent a novel target for the development of drugs to prevent and/or treat
alcohol use disorders. Front Neurosci, 8, 176. https://doi.org/10.3389/fnins.2014.00176
Freund, N., MacGillivilray, H. T., Thompson, B. S., Lukkes, J. L., Stanis, J. J., Brenhouse, H. C., &
Andersen, S. L. (2014). Sex-dependent changes in ADHD-like behaviors in juvenile rats following
cortical dopamine depletion [Article]. Behavioural Brain Research, 270, 357-363.
https://doi.org/10.1016/j.bbr.2014.05.024
Frick, K. M., & Gresack, J. E. (2003). Sex differences in the behavioral response to spatial and object
novelty in adult C57BL/6 mice. Behav Neurosci, 117(6), 1283-1291. https://doi.org/10.1037/0735-
7044.117.6.1283
Geyer, M. A. (2006). The family of sensorimotor gating disorders: comorbidities or diagnostic overlaps?
Neurotox Res, 10(3-4), 211-220. https://doi.org/10.1007/bf03033358
Goetz, C. G. (2011). The History of Parkinson's Disease: Early Clinical Descriptions and Neurological
Therapies. Cold Spring Harbor Perspectives in Medicine, 1(1), Article a008862.
https://doi.org/10.1101/cshperspect.a008862
92

Gofman, L., Cenna, J. M., & Potula, R. (2014). P2X4 receptor regulates alcohol-induced responses in
microglia. J Neuroimmune Pharmacol, 9(5), 668-678. https://doi.org/10.1007/s11481-014-9559-8
Gofman, L., Fernandes, N. C., & Potula, R. (2016). Relative Role of Akt, ERK and CREB in Alcohol-Induced
Microglia P2X4R Receptor Expression. Alcohol Alcohol, 51(6), 647-654.
https://doi.org/10.1093/alcalc/agw009
Gomes-Leal, W. (2012). Microglial physiopathology: how to explain the dual role of microglia after acute
neural disorders? Brain Behav, 2(3), 345-356. https://doi.org/10.1002/brb3.51
Gopalakrishna, A., & Alexander, S. A. (2015). Understanding Parkinson Disease: A Complex and
Multifaceted Illness [Article]. Journal of Neuroscience Nursing, 47(6), 320-326.
https://doi.org/10.1097/jnn.0000000000000162
Grandi, L. C., Di Giovanni, G., & Galati, S. (2018). Animal models of early-stage Parkinson's disease and
acute dopamine deficiency to study compensatory neurodegenerative mechanisms (Reprint form
journal of neuroscience methods vol 308, pg 205-218, 2018) [Reprint]. Journal of Neuroscience
Methods, 310, 75-88. https://doi.org/10.1016/j.jneumeth.2018.10.031
Graybiel, A. M. (1996). Basal ganglia: New therapeutic approaches to Parkinson's disease [Article]. Current
Biology, 6(4), 368-371. https://doi.org/10.1016/s0960-9822(02)00497-9
Guo, L. H., Trautmann, K., & Schluesener, H. J. (2004). Expression of P2X4 receptor in rat C6 glioma by
tumor-associated macrophages and activated microglia. J Neuroimmunol, 152(1-2), 67-72.
https://doi.org/10.1016/j.jneuroim.2004.04.005
Harry, G. J., & Kraft, A. D. (2008). Neuroinflammation and microglia: considerations and approaches for
neurotoxicity assessment. Expert Opin Drug Metab Toxicol, 4(10), 1265-1277.
https://doi.org/10.1517/17425255.4.10.1265
Harun, R., Grassi, C. M., Munoz, M. J., Torres, G. E., & Wagner, A. K. (2015). Neurobiological model of
stimulated dopamine neurotransmission to interpret fast-scan cyclic voltammetry data. Brain Res,
1599, 67-84. https://doi.org/10.1016/j.brainres.2014.12.020
Harun, R., Hare, K. M., Brough, E. M., Munoz, M. J., Grassi, C. M., Torres, G. E., Grace, A. A., & Wagner,
A. K. (2016). Fast-scan cyclic voltammetry demonstrates that L-DOPA produces dose-dependent,
regionally selective bimodal effects on striatal dopamine kinetics in vivo. J Neurochem, 136(6),
1270-1283. https://doi.org/10.1111/jnc.13444
Hattori, M., & Gouaux, E. (2012). Molecular mechanism of ATP binding and ion channel activation in P2X
receptors. Nature, 485(7397), 207-U291. https://doi.org/10.1038/nature11010
Henry, B., Crossman, A. R., & Brotchie, J. M. (1998). Characterization of enhanced behavioral responses
to L-DOPA following repeated administration in the 6-hydroxydopamine-lesioned rat model of
Parkinson's disease. Exp Neurol, 151(2), 334-342. https://doi.org/10.1006/exnr.1998.6819
93

Hisahara, S., & Shimohama, S. (2011). Dopamine receptors and Parkinson's disease. Int J Med Chem,
2011, 403039. https://doi.org/10.1155/2011/403039
Huo, J. F., & Chen, X. B. (2019). P2X4R silence suppresses glioma cell growth through BDNF/TrkB/ATF4
signaling pathway. Journal of Cellular Biochemistry, 120(4), 6322-6329.
https://doi.org/10.1002/jcb.27919
Huynh, N., Arabian, N., Naito, A., Louie, S., Jakowec, M. W., Asatryan, L., & Davies, D. L. (2017). Preclinical
development of moxidectin as a novel therapeutic for alcohol use disorder. Neuropharmacology,
113, 60-70. https://doi.org/10.1016/j.neuropharm.2016.09.016
Huynh, N., Khoja, S., Asatryan, L., Jakowec, M. W., & Davies, D. L. (2019). Chapter 68 - The Avermectin
Family as Potential Therapeutic Compounds for Alcohol Use Disorder: Implications for Using P2X4
Receptor as a Drug-Screening Platform**Nhat Huynh and Sheraz Khoja are equally contributed as
co-first authors. In P. V. R (Ed.), Neuroscience of Alcohol (pp. 661 - 670).
https://doi.org/https://doi.org/10.1016/B978-0-12-813125-1.00068-4
Iancu, R., Mohapel, P., Brundin, P., & Paul, G. (2005). Behavioral characterization of a unilateral 6-OHDA-
lesion model of Parkinson's disease in mice. Behav Brain Res, 162(1), 1-10.
https://doi.org/10.1016/j.bbr.2005.02.023
Inoue, K., & Tsuda, M. (2012). Purinergic systems, neuropathic pain and the role of microglia. Exp Neurol,
234(2), 293-301. https://doi.org/10.1016/j.expneurol.2011.09.016
Jakowec, M. W., & Petzinger, G. M. (2004). 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-lesioned model
of parkinson's disease, with emphasis on mice and nonhuman primates. Comp Med, 54(5), 497-
513.
Jelínkova, I., Vávra, V., Jindrichova, M., Obsil, T., Zemkova, H. W., Zemkova, H., & Stojilkovic, S. S. (2008).
Identification of P2X(4) receptor transmembrane residues contributing to channel gating and
interaction with ivermectin. Pflugers Arch, 456(5), 939-950. https://doi.org/10.1007/s00424-008-
0450-4
Jelínková, I., Yan, Z., Liang, Z., Moonat, S., Teisinger, J., Stojilkovic, S. S., & Zemková, H. (2006).
Identification of P2X4 receptor-specific residues contributing to the ivermectin effects on channel
deactivation. Biochem Biophys Res Commun, 349(2), 619-625.
https://doi.org/10.1016/j.bbrc.2006.08.084
Kalinderi, K., Papaliagkas, V., & Fidani, L. (2019). Pharmacogenetics and levodopa induced motor
complications [Review]. International Journal of Neuroscience, 129(4), 384-392.
https://doi.org/10.1080/00207454.2018.1538993
Kawate, T., Michel, J. C., Birdsong, W. T., & Gouaux, E. (2009). Crystal structure of the ATP-gated P2X(4)
ion channel in the closed state. Nature, 460(7255), 592-598. https://doi.org/10.1038/nature08198
Khakh, B. S., Proctor, W. R., Dunwiddie, T. V., Labarca, C., & Lester, H. A. (1999). Allosteric control of
gating and kinetics at P2X(4) receptor channels. Journal of Neuroscience, 19(17), 7289-7299.
https://doi.org/10.1523/jneurosci.19-17-07289.1999
94

Khoja, S., Asatryan, L., Jakowec, M. W., & Davies, D. L. (2019). Dopamine Receptor Blockade Attenuates
Purinergic P2X4 Receptor-Mediated Prepulse Inhibition Deficits and Underlying Molecular
Mechanisms. Front Cell Neurosci, 13, 331. https://doi.org/10.3389/fncel.2019.00331
Khoja, S., Huynh, N., Asatryan, L., Jakowec, M. W., & Davies, D. L. (2018). Reduced expression of
purinergic P2X4 receptors increases voluntary ethanol intake in C57BL/6J mice [Article]. Alcohol,
68, 63-70. https://doi.org/10.1016/j.alcohol.2017.09.004
Khoja, S., Huynh, N., Warnecke, A. M. P., Asatryan, L., Jakowec, M. W., & Davies, D. L. (2018). Preclinical
evaluation of avermectins as novel therapeutic agents for alcohol use disorders [Review].
Psychopharmacology, 235(6), 1697-1709. https://doi.org/10.1007/s00213-018-4869-9
Khoja, S., Shah, V., Garcia, D., Asatryan, L., Jakowec, M. W., & Davies, D. L. (2016). Role of purinergic
P2X4 receptors in regulating striatal dopamine homeostasis and dependent behaviors. Journal of
Neurochemistry, 139(1), 134-148. https://doi.org/10.1111/jnc.13734
Kintz, N., Petzinger, G. M., & Jakowec, M. W. (2017). Treadmill exercise modifies dopamine receptor
expression in the prefrontal cortex of the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-lesioned
mouse model of Parkinson's disease. Neuroreport, 28(15), 987-995.
https://doi.org/10.1097/WNR.0000000000000865
Kipp, W., Burnham, G., & Kamugisha, J. (1992). IMPROVEMENT IN SEIZURES AFTER IVERMECTIN.
Lancet, 340(8822), 789-790. https://doi.org/10.1016/0140-6736(92)92329-e
Koshikawa, N. (1994). Role of the nucleus accumbens and the striatum in the production of turning
behaviour in intact rats. Rev Neurosci, 5(4), 331-346.
https://doi.org/10.1515/revneuro.1994.5.4.331
Koshinaga, M., Katayama, Y., Fukushima, M., Oshima, H., Suma, T., & Takahata, T. (2000). Rapid and
widespread microglial activation induced by traumatic brain injury in rat brain slices. J Neurotrauma,
17(3), 185-192. https://doi.org/10.1089/neu.2000.17.185
Kowal, S. L., Dall, T. M., Chakrabarti, R., Storm, M. V., & Jain, A. (2013). The current and projected
economic burden of Parkinson's disease in the United States [Article]. Movement Disorders, 28(3),
311-318. https://doi.org/10.1002/mds.25292
Kure, K., Llena, J. F., Lyman, W. D., Soeiro, R., Weidenheim, K. M., Hirano, A., & Dickson, D. W. (1991).
Human immunodeficiency virus-1 infection of the nervous system: an autopsy study of 268 adult,
pediatric, and fetal brains. Hum Pathol, 22(7), 700-710. https://doi.org/10.1016/0046-
8177(91)90293-x
Laing, R., Gillan, V., & Devaney, E. (2017). Ivermectin - Old Drug, New Tricks? Trends Parasitol, 33(6),
463-472. https://doi.org/10.1016/j.pt.2017.02.004
Lalo, U., Verkhratsky, A., & Pankratov, Y. (2007). Ivermectin potentiates ATP-induced ion currents in
cortical neurones: evidence for functional expression of P2X4 receptors? Neurosci Lett, 421(2),
158-162. https://doi.org/10.1016/j.neulet.2007.03.078
95

Lee, J., Pinares-Garcia, P., Loke, H., Ham, S., Vilain, E., & Harley, V. R. (2019). Sex-specific
neuroprotection by inhibition of the Y-chromosome gene, SRY, in experimental Parkinson's
disease. Proceedings of the National Academy of Sciences of the United States of America,
116(33), 16577-16582. https://doi.org/10.1073/pnas.1900406116
Lenzlinger, P. M., Hans, V. H., Jöller-Jemelka, H. I., Trentz, O., Morganti-Kossmann, M. C., & Kossmann,
T. (2001). Markers for cell-mediated immune response are elevated in cerebrospinal fluid and
serum after severe traumatic brain injury in humans. J Neurotrauma, 18(5), 479-489.
https://doi.org/10.1089/089771501300227288
Li, C., Aguayo, L., Peoples, R. W., & Weight, F. F. (1993). Ethanol inhibits a neuronal ATP-gated ion
channel. Mol Pharmacol, 44(4), 871-875.
Li, C., Peoples, R. W., & Weight, F. F. (1994). Alcohol action on a neuronal membrane receptor: evidence
for a direct interaction with the receptor protein. Proc Natl Acad Sci U S A, 91(17), 8200-8204.
https://doi.org/10.1073/pnas.91.17.8200
Li, C., Peoples, R. W., & Weight, F. F. (1998). Ethanol-induced inhibition of a neuronal P2X purinoceptor
by an allosteric mechanism. Br J Pharmacol, 123(1), 1-3. https://doi.org/10.1038/sj.bjp.0701599
Li, Z., Harris, S., & Egan, T. M. (2009). P2X Receptor. In L. R. Squire (Ed.), Encyclopedia of Neuroscience
(pp. 349-354). Academic Press. https://doi.org/https://doi.org/10.1016/B978-008045046-9.01246-
8
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25(4), 402-408.
https://doi.org/10.1006/meth.2001.1262
Loane, D. J., & Kumar, A. (2016). Microglia in the TBI brain: The good, the bad, and the dysregulated. Exp
Neurol, 275 Pt 3, 316-327. https://doi.org/10.1016/j.expneurol.2015.08.018
Lodish , H., Berk , A., Zipursky , S. L., Matsudaira , P., Baltimore , D., & Darnell, J. (2000). Overview of
Neuron Structure and Function. In Molecular Cell Biology (4th ed.). W.H. Freeman and Company.
Londos, C., Cooper, D. M., & Wolff, J. (1980). Subclasses of external adenosine receptors. Proc Natl Acad
Sci U S A, 77(5), 2551-2554. https://doi.org/10.1073/pnas.77.5.2551
Long, T., He, W., Pan, Q., Zhang, S., Zhang, Y., Liu, C., Liu, Q., Qin, G., Chen, L., & Zhou, J. (2018).
Microglia P2X4 receptor contributes to central sensitization following recurrent nitroglycerin
stimulation. J Neuroinflammation, 15(1), 245. https://doi.org/10.1186/s12974-018-1285-3
Lopes-Ramos, C. M., Chen, C. Y., Kuijjer, M. L., Paulson, J. N., Sonawane, A. R., Fagny, M., Platig, J.,
Glass, K., Quackenbush, J., & DeMeo, D. L. (2020). Sex Differences in Gene Expression and
Regulatory Networks across 29 Human Tissues [Article]. Cell Reports, 31(12), 16, Article Unsp
107795. https://doi.org/10.1016/j.celrep.2020.107795
96

Lucon-Xiccato, T., & Dadda, M. (2016). Guppies Show Behavioural but Not Cognitive Sex Differences in a
Novel Object Recognition Test. PLoS One, 11(6), e0156589.
https://doi.org/10.1371/journal.pone.0156589
Lundquist, A. J., Parizher, J., Petzinger, G. M., & Jakowec, M. W. (2019). Exercise induces region-specific
remodeling of astrocyte morphology and reactive astrocyte gene expression patterns in male mice.
Journal of Neuroscience Research, 97(9), 1081-1094. https://doi.org/10.1002/jnr.24430
Luo, J., Yin, G. F., Gu, Y. Z., Liu, Y., Dai, J. P., Li, C., & Li, Z. W. (2006). Characterization of three types of
ATP-activated current in relation to P2X subunits in rat trigeminal ganglion neurons. Brain Res,
1115(1), 9-15. https://doi.org/10.1016/j.brainres.2006.07.084
Malek, N. (2019). Deep Brain Stimulation in Parkinson's Disease. Neurol India, 67(4), 968-978.
https://doi.org/10.4103/0028-3886.266268
Mapplebeck, J. C. S., Dalgarno, R., Tu, Y., Moriarty, O., Beggs, S., Kwok, C. H. T., Halievski, K., Assi, S.,
Mogil, J. S., Trang, T., & Salter, M. W. (2018). Microglial P2X4R-evoked pain hypersensitivity is
sexually dimorphic in rats. Pain, 159(9), 1752-1763.
https://doi.org/10.1097/j.pain.0000000000001265
Martinez-Martin, P., Macaulay, D., Jalundhwala, Y. J., Mu, F., Ohashi, E., Marshall, T., & Sail, K. (2019).
The long-term direct and indirect economic burden among Parkinson's disease caregivers in the
United States. Movement Disorders, 34(2), 236-245. https://doi.org/10.1002/mds.27579
Matsumura, Y., Yamashita, T., Sasaki, A., Nakata, E., Kohno, K., Masuda, T., Tozaki-Saitoh, H., Imai, T.,
Kuraishi, Y., Tsuda, M., & Inoue, K. (2016). A novel P2X4 receptor-selective antagonist produces
anti-allodynic effect in a mouse model of herpetic pain. Sci Rep, 6, 32461.
https://doi.org/10.1038/srep32461
Matsuzaki, S., Ikeda, H., Akiyama, G., Sato, M., Moribe, S., Suzuki, T., Nagase, H., Cools, A. R., &
Koshikawa, N. (2004). Role of mu- and delta-opioid receptors in the nucleus accumbens in turning
behaviour of rats. Neuropharmacology, 46(8), 1089-1096.
https://doi.org/10.1016/j.neuropharm.2004.02.003
McArthur, S., Murray, H. E., Dhankot, A., Dexter, D. T., & Gillies, G. E. (2007). Striatal susceptibility to a
dopaminergic neurotoxin is independent of sex hormone effects on cell survival and DAT
expression but is exacerbated by central aromatase inhibition [Article]. Journal of Neurochemistry,
100(3), 678-692. https://doi.org/10.1111/j.1471-4159.2006.04226.x
McEwen, B. S., & Milner, T. A. (2017). Understanding the Broad Influence of Sex Hormones and Sex
Differences in the Brain. Journal of Neuroscience Research, 95(1-2), 24-39.
https://doi.org/10.1002/jnr.23809
Metryka, E., Gutowska, I., Kupnicka, P., Tarnowski, M., Tkacz, M., Listos, J., Talarek, S., Barczak, K.,
Chlubek, D., & Baranowska-Bosiacka, I. (2019). The expression of purinergic P2X4 and P2X7
receptors in selected mesolimbic structures during morphine withdrawal in rats [Article]. Brain
Research, 1719, 49-56. https://doi.org/10.1016/j.brainres.2019.05.025
97

Miller, I. N., & Cronin-Golomb, A. (2010). Gender differences in Parkinson's disease: clinical characteristics
and cognition. Mov Disord, 25(16), 2695-2703. https://doi.org/10.1002/mds.23388
Mishra, A., Singh, S., & Shukla, S. (2018). Physiological and Functional Basis of Dopamine Receptors and
Their Role in Neurogenesis: Possible Implication for Parkinson's disease. J Exp Neurosci, 12,
1179069518779829. https://doi.org/10.1177/1179069518779829
Mittur, A., Gupta, S., & Modi, N. B. (2017). Pharmacokinetics of Rytary (R), An Extended-Release Capsule
Formulation of Carbidopa-Levodopa. Clinical Pharmacokinetics, 56(9), 999-1014.
https://doi.org/10.1007/s40262-017-0511-y
Mulvihill, K. G. (2018). Presynaptic regulation of dopamine release: Role of the DAT and VMAT2
transporters. Neurochem Int, 122, 94-105. https://doi.org/10.1016/j.neuint.2018.11.004
Muscat, R., & Willner, P. (1989). Effects of dopamine receptor antagonists on sucrose consumption and
preference. Psychopharmacology (Berl), 99(1), 98-102. https://doi.org/10.1007/BF00634461
Na, S. J., DiLella, A. G., Lis, E. V., Jones, K., Levine, D. M., Stone, D. J., & Hess, J. F. (2010). Molecular
Profiling of a 6-Hydroxydopamine Model of Parkinson's Disease [Article]. Neurochemical Research,
35(5), 761-772. https://doi.org/10.1007/s11064-010-0133-3
Nörenberg, W., Sobottka, H., Hempel, C., Plötz, T., Fischer, W., Schmalzing, G., & Schaefer, M. (2012).
Positive allosteric modulation by ivermectin of human but not murine P2X7 receptors. Br J
Pharmacol, 167(1), 48-66. https://doi.org/10.1111/j.1476-5381.2012.01987.x
Ostrovskaya, O., Asatryan, L., Wyatt, L., Popova, M., Li, K., Peoples, R. W., Alkana, R. L., & Davies, D. L.
(2011). Ethanol is a fast channel inhibitor of P2X4 receptors. J Pharmacol Exp Ther, 337(1), 171-
179. https://doi.org/10.1124/jpet.110.176990
Pankratov, Y., Lalo, U., Krishtal, O. A., & Verkhratsky, A. (2009). P2X receptors and synaptic plasticity.
Neuroscience, 158(1), 137-148. https://doi.org/10.1016/j.neuroscience.2008.03.076
Pearson-Fuhrhop, K. M., Minton, B., Acevedo, D., Shahbaba, B., & Cramer, S. C. (2013). Genetic variation
in the human brain dopamine system influences motor learning and its modulation by L-Dopa. PLoS
One, 8(4), e61197. https://doi.org/10.1371/journal.pone.0061197
Pienaar, I. S., Schallert, T., Russell, V. A., Kellaway, L. A., Carr, J. A., & Daniels, W. M. U. (2007). Early
pubertal female rats are more resistant than males to 6-hydroxydopamine neurotoxicity and
behavioural deficits: A possible role for trophic factors [Review]. Restorative Neurology and
Neuroscience, 25(5-6), 513-526.
Poewe, W., Antonini , A., Zijlmans , J. C., Burkhard , P. R., & Vingerhoets , F. (2010). Levodopa in the
treatment of Parkinson’s disease: an old drug still going strong. Clinical Interventions in Aging(5),
229–238.
98

Pollack, A. E., & Thomas, L. I. (2010). D1 priming enhances both D1-and D2-mediated rotational behavior
and striatal Fos expression in 6-hydroxydopamine lesioned rats [Article]. Pharmacology
Biochemistry and Behavior, 94(3), 346-351. https://doi.org/10.1016/j.pbb.2009.09.016
Popova, M., Asatryan, L., Ostrovskaya, O., Wyatt, L. R., Li, K., Alkana, R. L., & Davies, D. L. (2010). A point
mutation in the ectodomain-transmembrane 2 interface eliminates the inhibitory effects of ethanol
in P2X4 receptors. J Neurochem, 112(1), 307-317. https://doi.org/10.1111/j.1471-
4159.2009.06460.x
Popova, M., Rodriguez, L., Trudell, J. R., Nguyen, S., Bloomfield, M., Davies, D. L., & Asatryan, L. (2020).
Residues in Transmembrane Segments of the P2X4 Receptor Contribute to Channel Function and
Ethanol Sensitivity. Int J Mol Sci, 21(7). https://doi.org/10.3390/ijms21072471
Popova, M., Trudell, J., Li, K. X., Alkana, R., Davies, D., & Asatryan, L. (2013). Tryptophan 46 is a site for
ethanol and ivermectin action in P2X4 receptors. Purinergic Signalling, 9(4), 621-632.
https://doi.org/10.1007/s11302-013-9373-4
Pycock, C. J., & Marsden, C. D. (1978). The rotating rodent: a two component system? Eur J Pharmacol,
47(2), 167-175. https://doi.org/10.1016/0014-2999(78)90388-6
Qi, L., Thomas, E., White, S. H., Smith, S. K., Lee, C. A., Wilson, L. R., & Sombers, L. A. (2016). Unmasking
the Effects of L-DOPA on Rapid Dopamine Signaling with an Improved Approach for Nafion Coating
Carbon-Fiber Microelectrodes. Anal Chem, 88(16), 8129-8136.
https://doi.org/10.1021/acs.analchem.6b01871
Ramirez, A. I., de Hoz, R., Salobrar-Garcia, E., Salazar, J. J., Rojas, B., Ajoy, D., López-Cuenca, I., Rojas,
P., Triviño, A., & Ramírez, J. M. (2017). The Role of Microglia in Retinal Neurodegeneration:
Alzheimer's Disease, Parkinson, and Glaucoma. Front Aging Neurosci, 9, 214.
https://doi.org/10.3389/fnagi.2017.00214
Real, C. C., Doorduin, J., Kopschina Feltes, P., Vállez García, D., de Paula Faria, D., Britto, L. R., & de
Vries, E. F. (2019). Evaluation of exercise-induced modulation of glial activation and dopaminergic
damage in a rat model of Parkinson's disease using [J Cereb Blood Flow Metab, 39(6), 989-1004.
https://doi.org/10.1177/0271678X17750351
Reichmann, H., Bilsing, A., Ehret, R., Greulich, W., Schulz, J. B., Schwartz, A., & Rascol, O. (2006).
Ergoline and non-ergoline derivatives in the treatment of Parkinson's disease. J Neurol, 253 Suppl
4, IV36-38. https://doi.org/10.1007/s00415-006-4009-z
Rice, M. E., Patel, J. C., & Cragg, S. J. (2011). DOPAMINE RELEASE IN THE BASAL GANGLIA [Review].
Neuroscience, 198, 112-137. https://doi.org/10.1016/j.neuroscience.2011.08.066
Rivera-Garcia, M. T., McCane, A. M., Chowdhury, T. G., Wallin-Miller, K. G., & Moghaddam, B. Sex and
strain differences in dynamic and static properties of the mesolimbic dopamine system [Article;
Early Access]. Neuropsychopharmacology, 8. https://doi.org/10.1038/s41386-020-0765-1
99

Roche, D. J., Yardley, M. M., Lunny, K. F., Louie, S. G., Davies, D. L., Miotto, K., & Ray, L. A. (2016). A
Pilot Study of the Safety and Initial Efficacy of Ivermectin for the Treatment of Alcohol Use Disorder.
Alcohol Clin Exp Res, 40(6), 1312-1320. https://doi.org/10.1111/acer.13064
Rodriguez, L., You, C., Brodie, M. S., & Davies, D. L. (2020). Ethanol antagonizes P2X4 receptors in ventral
tegmental area neurons. Neuroreport. https://doi.org/10.1097/WNR.0000000000001504
Rogers, J., Mastroeni, D., Leonard, B., Joyce, J., & Grover, A. (2007). Neuroinflammation in Alzheimer's
disease and Parkinson's disease: are microglia pathogenic in either disorder? Int Rev Neurobiol,
82, 235-246. https://doi.org/10.1016/S0074-7742(07)82012-5
Rossi, A., Berger, K., Chen, H. L., Leslie, D., Mailman, R. B., & Huang, X. M. (2018). Projection of the
Prevalence of Parkinson's Disease in the Coming Decades: Revisited [Article]. Movement
Disorders, 33(1), 156-159. https://doi.org/10.1002/mds.27063
Rubio, M. E., & Soto, F. (2001). Distinct Localization of P2X receptors at excitatory postsynaptic
specializations. J Neurosci, 21(2), 641-653.
S.R.W. Stott, S.-L. A. (2013). The Generation of Midbrain Dopaminergic Neurons. In P. R. John L.R.
Rubenstein (Ed.), Patterning and Cell Type Specification in the Developing CNS and PNS (pp. 435-
453). Academic Press. https://doi.org/https://doi.org/10.1016/B978-0-12-397265-1.00099-X.
Sadovnick, A. D., Gu, B. J., Traboulsee, A. L., Bernales, C. Q., Encarnacion, M., Yee, I. M., Criscuoli, M.
G., Huang, X., Ou, A., Milligan, C. J., Petrou, S., Wiley, J. S., & Vilarino-Guell, C. (2017). Purinergic
receptors P2RX4 and P2RX7 in familial multiple sclerosis. Human Mutation, 38(6), 736-744.
https://doi.org/10.1002/humu.23218
Saigusa, T., Koshikawa, N., Kitamura, M., & Kobayashi, M. (1993). Reevaluation of the two-component
hypothesis for turning behaviour by manipulating activities in the striatum and the nucleus
accumbens of intact rats. Eur J Pharmacol, 237(2-3), 161-168. https://doi.org/10.1016/0014-
2999(93)90264-i
Santos, J. R., Cunha, J. A., Dierschnabel, A. L., Campêlo, C. L., Leão, A. H., Silva, A. F., Engelberth, R.
C., Izídio, G. S., Cavalcante, J. S., Abílio, V. C., Ribeiro, A. M., & Silva, R. H. (2013). Cognitive,
motor and tyrosine hydroxylase temporal impairment in a model of parkinsonism induced by
reserpine. Behav Brain Res, 253, 68-77. https://doi.org/10.1016/j.bbr.2013.06.031
Scheggi, S., De Montis, M. G., & Gambarana, C. (2018). Making Sense of Rodent Models of Anhedonia.
Int J Neuropsychopharmacol, 21(11), 1049-1065. https://doi.org/10.1093/ijnp/pyy083
Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. (2012). NIH Image to ImageJ: 25 years of image
analysis. Nat Methods, 9(7), 671-675. https://doi.org/10.1038/nmeth.2089
Schwarting, R. K., & Huston, J. P. (1996). The unilateral 6-hydroxydopamine lesion model in behavioral
brain research. Analysis of functional deficits, recovery and treatments. Prog Neurobiol, 50(2-3),
275-331. https://doi.org/10.1016/s0301-0082(96)00040-8
100

Shan, Q., Haddrill, J. L., & Lynch, J. W. (2001). Ivermectin, an unconventional agonist of the glycine receptor
chloride channel. J Biol Chem, 276(16), 12556-12564. https://doi.org/10.1074/jbc.M011264200
Silva, J., Khoja, S., Asatryan, L., Pacifici, E., & Davies, D. L. (2020). A novel pharmacotherapy approach
using P-glycoprotein (PGP/ABCB1) efflux inhibitor combined with ivermectin to reduce alcohol
drinking and preference in mice. Alcohol, 86, 1-8. https://doi.org/10.1016/j.alcohol.2020.03.013
Soto, F., Garcia-Guzman, M., Gomez-Hernandez, J. M., Hollmann, M., Karschin, C., & Stühmer, W. (1996).
P2X4: an ATP-activated ionotropic receptor cloned from rat brain. Proc Natl Acad Sci U S A, 93(8),
3684-3688. https://doi.org/10.1073/pnas.93.8.3684
Soto, F., Garcia-Guzman, M., Karschin, C., & Stühmer, W. (1996). Cloning and tissue distribution of a novel
P2X receptor from rat brain. Biochem Biophys Res Commun, 223(2), 456-460.
https://doi.org/10.1006/bbrc.1996.0915
Spinosa, H. D., Stilck, S., & Bernardi, M. M. (2002). Possible anxiolytic effects of ivermectin in rats.
Veterinary Research Communications, 26(4), 309-321.
Srivastava, P., Cronin, C. G., Scranton, V. L., Jacobson, K. A., Liang, B. T., & Verma, R. (2020).
Neuroprotective and neuro-rehabilitative effects of acute purinergic receptor P2X4 (P2X4R)
blockade after ischemic stroke. Exp Neurol, 329, 113308.
https://doi.org/10.1016/j.expneurol.2020.113308
Starkstein, S. E., Brockman, S., & Hayhow, B. D. (2012). Psychiatric syndromes in Parkinson's disease.
Current Opinion in Psychiatry, 25(6), 468-472. https://doi.org/10.1097/YCO.0b013e3283577ed1
Stojilkovic, S. S., Yan, Z., Obsil, T., & Zemkova, H. (2010). Structural insights into the function of P2X4: an
ATP-gated cation channel of neuroendocrine cells. Cell Mol Neurobiol, 30(8), 1251-1258.
https://doi.org/10.1007/s10571-010-9568-y
Stokes, L. (2013). Rab5 regulates internalisation of P2X4 receptors and potentiation by ivermectin.
Purinergic Signal, 9(1), 113-121. https://doi.org/10.1007/s11302-012-9336-1
Stokes, L., Layhadi, J. A., Bibic, L., Dhuna, K., & Fountain, S. J. (2017). P2X4 Receptor Function in the
Nervous System and Current Breakthroughs in Pharmacology. Front Pharmacol, 8, 291.
https://doi.org/10.3389/fphar.2017.00291
Subramaniam, S. R., Magen, I., Bove, N., Zhu, C., Lemesre, V., Dutta, G., Elias, C. J., Lester, H. A., &
Chesselet, M. F. (2018). Chronic nicotine improves cognitive and social impairment in mice
overexpressing wild type α-synuclein. Neurobiol Dis, 117, 170-180.
https://doi.org/10.1016/j.nbd.2018.05.018
Surprenant, A., & North, R. A. (2009). Signaling at Purinergic P2X Receptors. In Annual Review of
Physiology (Vol. 71, pp. 333-359). Annual Reviews.
https://doi.org/10.1146/annurev.physiol.70.113006.100630
101

Suurväli, J., Boudinot, P., Kanellopoulos, J., & Rüütel Boudinot, S. (2017). P2X4: A fast and sensitive
purinergic receptor. Biomed J, 40(5), 245-256. https://doi.org/10.1016/j.bj.2017.06.010
Suzumura, A. (2013). Neuron-microglia interaction in neuroinflammation. Curr Protein Pept Sci, 14(1), 16-
20. https://doi.org/10.2174/1389203711314010004
Suzumura, A. (2014). [Microglia in neurodegenerative disorders and neuroinflammation]. Rinsho
Shinkeigaku, 54(12), 1119-1121. https://doi.org/10.5692/clinicalneurol.54.1119
Tabakoff, B., Saba, L., Printz, M., Flodman, P., Hodgkinson, C., Goldman, D., Koob, G., Richardson, H. N.,
Kechris, K., Bell, R. L., Hübner, N., Heinig, M., Pravenec, M., Mangion, J., Legault, L., Dongier, M.,
Conigrave, K. M., Whitfield, J. B., Saunders, J., Grant, B., Hoffman, P. L., & Alcoholism, W. I. S. o.
S. a. T. M. o. (2009). Genetical genomic determinants of alcohol consumption in rats and humans.
BMC Biol, 7, 70. https://doi.org/10.1186/1741-7007-7-70
Tolwani, R. J., Jakowec, M. W., Petzinger, G. M., Green, S., & Waggie, K. (1999). Experimental models of
Parkinson's disease: Insights from many models. Laboratory Animal Science, 49(4), 363-371.
Tsuda, M. (2015). Mechanisms underlying the pathogenesis of neuropathic pain revealing by the role of
glial cells. Japanese Journal of Neuropsychopharmacology, 35(1), 1-4.
Tsuda, M., Shigemoto-Mogami, Y., Koizumi, S., Mizokoshi, A., Kohsaka, S., Salter, M. W., & Inoue, K.
(2003). P2X4 receptors induced in spinal microglia gate tactile allodynia after nerve injury. Nature,
424(6950), 778-783. https://doi.org/10.1038/nature01786
Ullah, M. F., Ahmad, A., Bhat, S. H., Abu-Duhier, F. M., Barreto, G. E., & Ashraf, G. M. (2019). Impact of
sex differences and gender specificity on behavioral characteristics and pathophysiology of
neurodegenerative disorders. Neuroscience and Biobehavioral Reviews, 102, 95-105.
https://doi.org/10.1016/j.neubiorev.2019.04.003
Ulmann, L., Levavasseur, F., Avignone, E., Peyroutou, R., Hirbec, H., Audinat, E., & Rassendren, F. (2013).
Involvement of P2X4 receptors in hippocampal microglial activation after status epilepticus [Article].
Glia, 61(8), 1306-1319. https://doi.org/10.1002/glia.22516
Ungerstedt, U. (1968). 6-HYDROXY-DOPAMINE INDUCED DEGENERATION OF CENTRAL
MONOAMINE NEURONS [Note]. European Journal of Pharmacology, 5(1), 107-+.
https://doi.org/10.1016/0014-2999(68)90164-7
van Calker, D., Müller, M., & Hamprecht, B. (1979). Adenosine regulates via two different types of receptors,
the accumulation of cyclic AMP in cultured brain cells. J Neurochem, 33(5), 999-1005.
https://doi.org/10.1111/j.1471-4159.1979.tb05236.x
Vanhartesveldt, C., & Joyce, J. N. (1986). EFFECTS OF ESTROGEN ON THE BASAL GANGLIA.
Neuroscience and Biobehavioral Reviews, 10(1), 1-14. https://doi.org/10.1016/0149-
7634(86)90029-1
102

Varma, R., Chai, Y., Troncoso, J., Gu, J., Xing, H., Stojilkovic, S. S., Mattson, M. P., & Haughey, N. J.
(2009). Amyloid-beta Induces a Caspase-mediated Cleavage of P2X4 to Promote Purinotoxicity.
Neuromolecular Medicine, 11(2), 63-75. https://doi.org/10.1007/s12017-009-8073-2
Vazquez-Villoldo, N., Domercq, M., Martin, A., Llop, J., Gomez-Vallejo, V., & Matute, C. (2014). P2X4
Receptors Control the Fate and Survival of Activated Microglia. Glia, 62(2), 171-184.
https://doi.org/10.1002/glia.22596
Vegas-Suárez, S., Pisanò, C. A., Requejo, C., Bengoetxea, H., Lafuente, J. V., Morari, M., Miguelez, C., &
Ugedo, L. (2020). 6-hydroxydopamine lesion and levodopa treatment modify the effect of buspirone
in the substantia nigra pars reticulata. Br J Pharmacol. https://doi.org/10.1111/bph.15145
Verma, R., Cronin, C. G., Hudobenko, J., Venna, V. R., McCullough, L. D., & Liang, B. T. (2017). Deletion
of the P2X4 receptor is neuroprotective acutely, but induces a depressive phenotype during
recovery from ischemic stroke [Article]. Brain Behavior and Immunity, 66, 302-312.
https://doi.org/10.1016/j.bbi.2017.07.155
Volkow, N. D., Fowler, J. S., Wang, G. J., & Swanson, J. M. (2004). Dopamine in drug abuse and addiction:
results from imaging studies and treatment implications. Mol Psychiatry, 9(6), 557-569.
https://doi.org/10.1038/sj.mp.4001507
Walker, D. G., & Lue, L. F. (2005). Investigations with cultured human microglia on pathogenic mechanisms
of Alzheimer's disease and other neurodegenerative diseases. J Neurosci Res, 81(3), 412-425.
https://doi.org/10.1002/jnr.20484
Walker, Q. D., Rooney, M. B., Wightman, R. M., & Kuhn, C. M. (2000). Dopamine release and uptake are
greater in female than male rat striatum as measured by fast cyclic voltammetry. Neuroscience,
95(4), 1061-1070. https://doi.org/10.1016/s0306-4522(99)00500-x
Warnecke, A. M. P., Kang, M. S., Jakowec, M. W., & Davies, D. L. (2020). The macrocyclic lactones
Ivermectin and Moxidectin show differential effects on rotational behavior in the 6-
hydroxydopamine mouse model of Parkinson's Disease. Behav Brain Res, 112804.
https://doi.org/10.1016/j.bbr.2020.112804
Weight, F. F., Li, C., & Peoples, R. W. (1999). Alcohol action on membrane ion channels gated by
extracellular ATP (P2X receptors). Neurochem Int, 35(2), 143-152. https://doi.org/10.1016/s0197-
0186(99)00056-x
Wheeler-Schilling, T. H., Marquordt, K., Kohler, K., Guenther, E., & Jabs, R. (2001). Identification of
purinergic receptors in retinal ganglion cells. Brain Res Mol Brain Res, 92(1-2), 177-180.
https://doi.org/10.1016/s0169-328x(01)00160-7
Wiley, J. S., Gu, B. J., Huang, X., Ou, A., Sadovnick, A. D., Traboulsee, A. L., & Vilarino-Guell, C. (2016).
A P2X7-P2X4 haplotype with near absent P2X7 surface expression impairs phagocytosis in familial
multiple sclerosis. Multiple Sclerosis Journal, 22, 176-176.
103

Wixey, J. A., Reinebrant, H. E., Carty, M. L., & Buller, K. M. (2009). Delayed P2X4R expression after
hypoxia-ischemia is associated with microglia in the immature rat brain. J Neuroimmunol, 212(1-
2), 35-43. https://doi.org/10.1016/j.jneuroim.2009.04.016
Woodward, J. J., Nowak, M., & Davies, D. L. (2004). Effects of the abused solvent toluene on recombinant
P2X receptors expressed in HEK293 cells. Brain Res Mol Brain Res, 125(1-2), 86-95.
https://doi.org/10.1016/j.molbrainres.2004.03.005
Wyatt, L. R., Finn, D. A., Khoja, S., Yardley, M. M., Asatryan, L., Alkana, R. L., & Davies, D. L. (2014).
Contribution of P2X4 Receptors to Ethanol Intake in Male C57BL/6 Mice [Article]. Neurochemical
Research, 39(6), 1127-1139. https://doi.org/10.1007/s11064-014-1271-9
Wyatt, L. R., Godar, S. C., Khoja, S., Jakowec, M. W., Alkana, R. L., Bortolato, M., & Davies, D. L. (2013).
Sociocommunicative and sensorimotor impairments in male P2X4-deficient mice.
Neuropsychopharmacology, 38(10), 1993-2002. https://doi.org/10.1038/npp.2013.98
Xiao, C., Zhou, C. Y., Li, K. X., Davies, D. L., & Ye, J. H. (2008). Purinergic type 2 receptors at GABAergic
synapses on ventral tegmental area dopamine neurons are targets for ethanol action [Article].
Journal of Pharmacology and Experimental Therapeutics, 327(1), 196-205.
https://doi.org/10.1124/jpet.108.139766
Xiong, K., Hu, X. Q., Stewart, R. R., Weight, F. F., & Li, C. (2005). The mechanism by which ethanol inhibits
rat P2X4 receptors is altered by mutation of histidine 241. Br J Pharmacol, 145(5), 576-586.
https://doi.org/10.1038/sj.bjp.0706192
Xiong, K., Li, C., & Weight, F. F. (2000). Inhibition by ethanol of rat P2X(4) receptors expressed in Xenopus
oocytes. Br J Pharmacol, 130(6), 1394-1398. https://doi.org/10.1038/sj.bjp.0703439
Xu, J., Bernstein, A. M., Wong, A., Lu, X. H., Khoja, S., Yang, X. W., Davies, D. L., Micevych, P., Sofroniew,
M. V., & Khakh, B. S. (2016). P2X4 Receptor Reporter Mice: Sparse Brain Expression and Feeding-
Related Presynaptic Facilitation in the Arcuate Nucleus. J Neurosci, 36(34), 8902-8920.
https://doi.org/10.1523/JNEUROSCI.1496-16.2016
Xu, Z., Cawthon, D., McCastlain, K. A., Slikker, W., & Ali, S. F. (2005). Selective alterations of gene
expression in mice induced by MPTP. Synapse, 55(1), 45-51. https://doi.org/10.1002/syn.20089
Yang, W. Y., Hamilton, J. L., Kopil, C., Beck, J. C., Tanner, C. M., Albin, R. L., Dorsey, E. R., Dahodwala,
N., Cintina, I., Hogan, P., & Thompson, T. (2020). Current and projected future economic burden
of Parkinson's disease in the U.S [Article]. Npj Parkinsons Disease, 6(1), 9, Article 15.
https://doi.org/10.1038/s41531-020-0117-1
Yardley, M. M., Neely, M., Huynh, N., Asatryan, L., Louie, S. G., Alkana, R. L., & Davies, D. L. (2014).
Multiday administration of ivermectin is effective in reducing alcohol intake in mice at doses shown
to be safe in humans [Article]. Neuroreport, 25(13), 1018-1023.
https://doi.org/10.1097/wnr.0000000000000211

104

Yardley, M. M., Wyatt, L., Khoja, S., Asatryan, L., Ramaker, M. J., Finn, D. A., Alkana, R. L., Huynh, N.,
Louie, S. G., Petasis, N. A., Bortolato, M., & Davies, D. L. (2012). Ivermectin reduces alcohol intake
and preference in mice [Article]. Neuropharmacology, 63(2), 190-201.
https://doi.org/10.1016/j.neuropharm.2012.03.014
Yorgason, J. T., España, R. A., & Jones, S. R. (2011). Demon voltammetry and analysis software: analysis
of cocaine-induced alterations in dopamine signaling using multiple kinetic measures. J Neurosci
Methods, 202(2), 158-164. https://doi.org/10.1016/j.jneumeth.2011.03.001
Yorgason, J. T., Zeppenfeld, D. M., & Williams, J. T. (2017). Cholinergic Interneurons Underlie
Spontaneous Dopamine Release in Nucleus Accumbens. J Neurosci, 37(8), 2086-2096.
https://doi.org/10.1523/JNEUROSCI.3064-16.2017
Yoritaka, A., Shimo, Y., Hatano, T., & Hattori, N. (2020). Motor/Nonmotor Symptoms and Progression in
Patients with Parkinson's Disease: Prevalence and Risks in a Longitudinal Study [Article].
Parkinsons Disease, 2020, 13, Article 2735361. https://doi.org/10.1155/2020/2735361
Yuan, H., Sarre, S., Ebinger, G., & Michotte, Y. (2005). Histological, behavioural and neurochemical
evaluation of medial forebrain bundle and striatal 6-OHDA lesions as rat models of Parkinson's
disease. J Neurosci Methods, 144(1), 35-45. https://doi.org/10.1016/j.jneumeth.2004.10.004
Zabala, A., Vazquez-Villoldo, N., Rissiek, B., Gejo, J., Martin, A., Palomino, A., Perez-Samartin, A.,
Pulagam, K. R., Lukowiak, M., Capetillo-Zarate, E., Llop, J., Magnus, T., Koch-Nolte, F.,
Rassendren, F., Matute, C., & Domercq, M. (2018). P2X4 receptor controls microglia activation and
favors remyelination in autoimmune encephalitis. Embo Molecular Medicine, 10(8), Article UNSP
e8743. https://doi.org/10.15252/emmm.201708743
Zaichick, S. V., McGrath, K. M., & Caraveo, G. (2017). The role of Ca2+ signaling in Parkinson's disease
[Review]. Disease Models & Mechanisms, 10(5), 519-535. https://doi.org/10.1242/dmm.028738
Zappia, M., Annesi, G., Nicoletti, G., Arabia, G., Annesi, F., Messina, D., Pugliese, P., Spadafora, P.,
Tarantino, P., Carrideo, S., Civitelli, D., De Marco, E. V., Ciro-Candiano, I. C., Gambardella, A., &
Quattrone, A. (2005). Sex differences in clinical and genetic determinants of levodopa peak-dose
dyskinesias in Parkinson disease - An exploratory study [Article]. Archives of Neurology, 62(4),
601-605. https://doi.org/10.1001/archneur.62.4.601
Zemkova, H., Kucka, M., Li, S., Gonzalez-Iglesias, A. E., Tomic, M., & Stojilkovic, S. S. (2010).
Characterization of purinergic P2X4 receptor channels expressed in anterior pituitary cells. Am J
Physiol Endocrinol Metab, 298(3), E644-651. https://doi.org/10.1152/ajpendo.00558.2009
Zemkova, H., Yan, Z., Liang, Z., Jelinkova, I., Tomic, M., & Stojilkovic, S. S. (2007). Role of aromatic and
charged ectodomain residues in the P2X(4) receptor functions. J Neurochem, 102(4), 1139-1150.
https://doi.org/10.1111/j.1471-4159.2007.04616.x
Zhang, P. A., Sun, Q., Li, Y. C., Weng, R. X., Wu, R., Zhang, H. H., & Xu, G. Y. (2020). Overexpression of
Purinergic P2X4 Receptors in Hippocampus Rescues Memory Impairment in Rats with Type 2
Diabetes. Neurosci Bull. https://doi.org/10.1007/s12264-020-00478-7
105

Zhang, Q. S., Heng, Y., Mou, Z., Huang, J. Y., Yuan, Y. H., & Chen, N. H. (2017). Reassessment of
subacute MPTP-treated mice as animal model of Parkinson's disease. Acta Pharmacol Sin, 38(10),
1317-1328. https://doi.org/10.1038/aps.2017.49
Zhang, Z. Y., Zhang, Z. R., Artelt, M., Burnet, M., & Schluesener, H. J. (2007). Dexamethasone attenuates
early expression of three molecules associated with microglia/macrophages activation following rat
traumatic brain injury. Acta Neuropathologica, 113(6), 675-682. https://doi.org/10.1007/s00401-
007-0195-8
Zhao, Y., Rivieccio, M. A., Lutz, S., Scemes, E., & Brosnan, C. F. (2006). The TLR3 ligand polyI : C
downregulates connexin43 expression and function in astrocytes by a mechanism involving the
NF-kappa B and P13 kinase pathways. Glia, 54(8), 775-785. https://doi.org/10.1002/glia.20418

Abstract (if available)

Abstract Dopamine (DA) is a key neurotransmitter within the brain that plays a role in the mesolimbic pathway (associated with reward-based behavior) and the nigrostriatal pathway (associated with motor control and reward-based cognition), both of which involve regions located within the striatum. Building evidence supports the hypothesis that P2X4 receptors (P2X4s) play a role in modulation of DA activity, suggesting P2X4s as a novel target for the treatment of dopaminergic disorders including Parkinson’s disease (PD) and addiction. P2X4 modulators (e.g., Ivermectin/IVM

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Exploration and expansion of novel therapeutic strategies targeting brain metabolism in neurodegenerative diseases

PDF

The preclinical evaluation of moxidectin as a platform for drug development for alcohol use disorder

PDF

Role of purinergic P2X4 receptors in regulation of dopamine homeostasis in the basal ganglia and associated behaviors

PDF

The role of ivermectin on P2X4 receptors in regulating behavior responses in the Parkinson’s disease model

PDF

Development of dihydromyricetin (DHM) as a novel therapy for alcoholic liver disease (ALD) and alcohol use disorder (AUD)

PDF

Evaluating the effects of dihydromyricetin on dopamine mediated behaviors using a Parkinson's disease model

PDF

The effect of treadmill running on dendritic spine density in two neurodegenerative disorders: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson’s disease and CAG₁₄₀ kn...

PDF

Investigation into the role of the intestinal microbiome on ethanol consumption behaviors

PDF

Development of ivermectin as a platform for the treatment and/or prevention of alcohol use disorders

PDF

From risk mitochondrial and metabolic phenotype towards a precision medicine approach for Alzheimer's disease

PDF

Experience-dependent neuroplasticity of the dorsal striatum and prefrontal cortex in the MPTP-lesioned mouse model of Parkinson’s disease

PDF

The therapeutic effects of dihydromyricetin (DHM) on anxiety disorders

PDF

Sodium butyrate prevents antibiotic-induced increase in ethanol drinking in C57BL/6J mice by modulating neuroinflammatory response

PDF

RPE secretome for the treatment of retinal degeneration in the RCS rat

PDF

Perimenopausal transition increases blood brain permeability: implications for neurodegenerative diseases

PDF

Neuroinflammation and ApoE4 genotype in at-risk female aging: implications for Alzheimer's disease

PDF

Small molecule lipoxin analogue for prevention of retinal degeneration

PDF

Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

PDF

Development of glycine and GABAA ultra-sensitive ethanol receptors (USERs) as novel tools for alcohol and brain research

PDF

Regulation of ethanol intake by purinergic P2X4 receptors

Asset Metadata

Creator Warnecke, Alicia Marie Paiva (author)

Core Title Evaluation of P2X4 receptor modulation as a novel approach for treating Parkinson’s disease

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Clinical and Experimental Therapeutics

Publication Date 11/29/2020

Defense Date 09/25/2020

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag 6-OHDA,Dopamine,ivermectin,OAI-PMH Harvest,sex difference

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Davies, Daryl (committee chair), Asatryan, Liana (committee member), Cadenas, Enrique (committee member), Jakowec, Michael (committee member), Petzinger, Giselle (committee member)

Creator Email awarnecke22@gmail.com,warnecke@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-c89-402127

Unique identifier UC11668767

Identifier etd-WarneckeAl-9163.pdf (filename),usctheses-c89-402127 (legacy record id)

Legacy Identifier etd-WarneckeAl-9163.pdf

Dmrecord 402127

Document Type Dissertation

Rights Warnecke, Alicia Marie Paiva

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the a...

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA