University of Southern California Dissertations and Theses

Investigation of two distinct chromatin events: H3 tail-mediated factor recruitment and H2A.X exchange

(USC Thesis Other)

Investigation of two distinct chromatin events: H3 tail-mediated factor recruitment and H2A.X exchange

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
INVESTIGATION OF TWO DISTINCT CHROMATIN EVENTS:
H3 TAIL-MEDIATED FACTOR RECRUITMENT
AND H2A.X EXCHANGE

by

Kyu Heo

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

May 2007

Copyright 2007 Kyu Heo
ii
ACKNOWLEDGEMENTS

First of all, I thank God for all these achievements. Then, I would like to thank
my mentor Dr. Woojin An for giving me the opportunity to study histones in his
laboratory. I am deeply indebted to Dr. An for his patience, positive attitude,
support, guidance, and endless encouragement. His steady hand, cordial, and
supportive manner empowered me to continue moving forward, pursuing for
better, and reminding my priorities by keeping myself focused in the process.
Also, I would like to thank my previous mentors Drs. Yi Zhao and Jeongdong
Bahk for helping me to establish a strong basement to enable to do all these
works.
I also offer my sincere appreciation to Dr. Louis Dubeau, Dr. Judd Rice, and Dr.
Michael Stallcup for serving on my dissertation committee and being supportive
of this research effort. I would also like to thank my colleagues, Dr. Jongkyu
Choi, Kyunghwan Kim, Hyunjung Kim, and Dr. Yuxia Zhan. I wish to thank
Hyunjung Kim for her valuable input and spirit of cooperation. Gratefully, I did
not go through this educational process alone. The completion of my doctoral
program would not have been possible without the friendships (Dr. Jeonghoon
Kim, Kwangho Lee, Siho Choi, Dr. Jeongim Woo, and Unnati Jariwala).
Finally, I thoroughly thank my parents (Jonghae Heo and Malhee Kim), brother
(Ouk Heo), sister-in-law (Kyungha Kim), and nephew (Junekyung Heo), for
their unconditional love, constant praying, and support through every step of my
life. I dedicate this thesis to them with all my appreciation.
iii
TABLE OF CONTENTS

Acknowledgements………………….………………….………………………ii
List of Figures………………….………………….……………………………iv
Abstract………………….………………….………………….………………..v
Chapter 1: Introduction………………….………………….………..………..1
Chapter 2: Isolation and characterization of proteins associated with
histone H3 tails in vivo……………………………………………12

Chapter 3: FACT-mediated exchange of histone variant H2A.X
regulated by phosphorylation of H2A.X and
ADP-ribosylation of Spt16……………………………….…........44

Chapter 4: Involvement of Niemann-Pick Type C2 Protein
in Hematopoiesis Regulation………….……………………........ 70

Chapter 5: Concluding remarks………………….……………………………94
Bibliography………………….………………….…………………………….100

iv
LIST OF FIGURES

Fig. 1-1. Nucleosome core particle………………………………………….. .2
Fig. 1-2. Human SET-domain proteins………………………………………. 5
Fig. 1-3. Canonical core histones and their variants………………………… 7
Fig. 2-1. Purification of H3 tail-associated proteins…………………………16
Fig. 2-2. Composition of H3 tail-associated proteins………………………..18
Fig. 2-3. Cellular modifications of ectopic H3 tails………………………… 20
Fig. 2-4. HMT activities of H3 tail-associated proteins…………………….. 23
Fig. 2-5. Transcription analysis of H3 tail-associated proteins……………... 30
Fig. 3-1. Purification of H2A.X-associated complex……………………….. 47
Fig. 3-2. H2A.X-H2B dimer integration by FACT complex……………….. 51
Fig. 3-3. Phosphorylation effect of H2A.X for H2A.X-H2B
dimer dissociation…………………………………………………..56
Fig. 3-4. Inhibition of H2A.X-H2B dimer dissociation through ADP-
ribosylation of Spt16 by PARP1…………………………………....60
Fig. 3-5. Model for steps involved in action of H2A.X during
DSB repair process………………………………………………....64
Fig. 4-1. NPC2 protein expression, purification and characterization……… 72
Fig. 4-2. NPC2 effects in CFC assays………………………………………..75
Fig. 4-3. NPC2 function relies on MPR but is independent
of cholesterol binding……………………………………………….78
Fig. 4-4. Anti-apoptosis effect of NPC2 protein in MO7e cells……………...81
Fig. 4-5. Anti-differentiation effect of NPC2 in MO7e cells………………... 83
Fig. 4-6. NPC2 up-regulates HIF-1 α level in MO7e cells…………………... 84

v
ABSTRACT
Posttranslational modifications of histones, ATP-dependent chromatin
remodeling, and incorporation of histone variants are three major events to
regulate DNA dependent processes in chromatin context.
Histones are the major protein components within chromatin, and epigenetic
modifications of these proteins play a vital role in transcription. Acetylation and
methylation of core histones are two major modifications, which are introduced
by histone acetyltransferases (HATs) and histone methyltransferases (HMTs).
Albeit the mechanism of action has not been identified, it has been proposed that
these two modifications regulate gene transcription through facilitating
recruitment of regulatory factors to the target genes. As a first step to investigate
recruitment-based contribution of histone tails and their modifications in
transcription, I have generated HeLa cell lines that stably express H3 tails for the
biochemical purification of H3 tail-associated complex. The purified complex
contains multiple chromatin-modifying activities which induce a dramatic boost
of p53-dependent, p300-mediated transcription. A further analysis of protein
complexes purified from cell lines expressing K9/K27-mutated H3 tails clearly
confirmed the requirement of methylation of these sites for the association of
repressive factors.
Besides histone tails and their modifications, histone variants also regulate
transcription and other cellular processes. Although histone variant H2A.X is
known to play a critical role in DNA repair process, how exchange between
H2A.X and H2A is accomplished in nucleosome is not well understood. I
vi
purified H2A.X-associated complex from a human cell line and show that two
components, Spt16 and SSRP1 or facilitate chromatin transcription (FACT)
complex, facilitate exchange of H2A.X with H2A within nucleosomes.
Phosphorylation of H2A.X induces conformational change of chromatin to
accelerate dissociation of H2A.X from nucleosomes. During DNA repair, ADP-
ribosylation of Spt16 by poly ADP-ribose polymerase 1 (PARP1), which is
another component of H2A.X-associated complex, significantly stabilizes
nucleosomal H2A.X. These results reveal previously unrecognized role for
FACT complex in H2A.X exchange and maintenance within chromatin context
which are regulated by phosphorylation of H2A.X and ADP-ribosylation of
Spt16.

1
CHAPTER 1: INTRODUCTION

Chromatin structure and function
In Eukaryotes, genomic DNA is organized into chromatin structure to store a
large amount of DNA into a small volume of nucleus. Embedding genomic DNA
into chromatin is correlated with repressive state of gene transcription. Therefore,
understanding how transcription is regulated in chromatin context is very
important to regulate various signaling processes in human cells.

A typical eukaryotic chromatin is composed of nucleosome which contains
double stranded DNA (dsDNA) and proteins called histones (McGhee et al.,
1980). The crystal structure (Luger et al., 1997) of mononucleosome has
identified approximately 146 base pairs (bp) of dsDNA wrapped around two
copies of each of H2A, H2B, H3, and H4 (Fig. 1-1). 14 contact points between
histones and DNA make the nucleosome one of the most stable protein-DNA
complexes under physiological conditions.

The fundamental roles of the repeating nucleosomes within the nucleus are
compaction of DNA (on the order of meters) and regulation of gene transcription.
In the nucleus, DNA is packaged into chromatin by several levels of compaction.
The most relaxed chromatin structure is called “Beads-on-a-string” structure.
The next level of compaction by internucleosomal interaction allows the
formation of 30 nm fiber structure. The interaction between 30 nm fibers further

2

Fig. 1-1. Nucleosome core particle. Ribbon traces for the 146-bp DNA
phosphodiester backbones (brown and turquoise) and eight histone protein main
chains (blue: H3; green: H4; yellow: H2A; red: H2B). The views are down the
DNA superhelix axis for the left particle and perpendicular to it for the right
particle. For both particles, the pseudo-twofold axis is aligned vertically with the
DNA centre at the top. This figure is adopted from (Luger et al., 1997).

3
package into the 300-500 nm chromatin fiber which we see in non dividing cell
nucleus nucleosome. Although the nucleosome was originally thought to be just
a structural unit of chromatin, recent studies confirmed that it can also function
as a transcriptional regulatory unit. For example, chromatin remodeling factors
can alter the accessibility of nucleosomal DNA. Therefore, understanding the
mechanism to regulate nucleosome positioning and stability that may take a
critical role for gene regulation and for other specific chromosome functions will
lead to better understanding of transcriptional regulation in eukaryotic cells.

Histone modifications and transcriptional regulation
N-termini of core histones are one of the most critical factors in the process that
modulate nucleosome structure as well as the level of gene transcription. N
termini can be modified posttranslationally by acetylation, methylation,
phosphorylation, ubiquitination, ribosylation, and so on. Some of these
modifications alter the charge distribution on N-termini in which acetylation
neutralizes positive charge of lysine residues in N-terminal region while
phosphorylation introduced a negative charge at serine residues. Neutralization
of these amino acid residues alter the charge interaction between negatively
charged DNA backbone and the histone tails (Workman and Kingston, 1998).
Although the functions of these post-translational modifications are still poorly
understood, the evidences gathered to date point out the role(s) of these
modifications such as lysine acetylation and methylation in transcription
regulation. For instance, lysine acetylation correlates with chromatin
accessibility and transcription activity whereas lysine methylation can give
4
different functions depending on the modified residues and the status of the
modification. An et al. have well-illustrated the critical role of H3 and H4 tails of
the core histones, especially major lysine substrates, in transcription regulation
using in vitro transcription assays showing that acetylation of H3 and H4 N-
termini is prerequisite for p53 mediated transcription (An et al., 2002).

Histone methylation is another major post-translational modification recognized
in the core histones that can also regulate transcription. Although histone
methylation has not been characterized as much as histone acetylation, a number
of methyltransferases have been discovered (Fig. 1-2), proteins that recognize
the methyl-lysine code have been identified, and interplay between methylation
and different covalent modifications of the core histones tails have been reported.
For instance, methylation of histone H3 lysine 4 (H3K4) and H3 lysine 36 is
associated with transcribed chromatin. In contrast, methylation of H3 lysine 9
(H3K9), H3 lysine 27 (H3K27), and H4 lysine 20 (H4K20) generally correlate
with repression (Kouzarides, 2002). Most importantly, these methylations are
recognized as binding sites by many different histone methylation recognition
proteins (such as HP1) and cause either repressive or active events. Based on the
information that there are many different methyltransferases for the same
targeting sites (Fig.1-2), different functional processes depending of the status of
methylation ( mono-, di-, tri-), and variability in recognition proteins for the
same methylation sites, methylation seems to be a much more specific modifying
process than histone acetylation.

5

Fig. 1-2. Human SET-domain proteins. A dendogram showing the relationship
between some of the more characterized human SET-domain proteins. The
comparison is based on the homology within the SET-domain. The Clustal W
program was used to generate the figure. On the right are the four families
defined by the homologues. This figure is adopted from (Kouzarides, 2002).

6
Even though the whole chromatin is made with core histones in a repeating unit
of nucleosome, not all histones are targeted for modification. In other words, all
of these modifications are specifically targeted and regulated precisely to avoid
unnecessary modifications. Therefore, the most important issue here is to
understand how these modification processes themselves are regulated, why
there are numbers of different enzymes for the same modification targeting sites,
how to interpret these histone codes, and most importantly, how each of these
histone modification have an effect(s) on gene regulation.

Histone variants
Besides the core histones, H2A, H2B, H3, and H4, there are subtypes called
histone variants, although, variants for H2B and H4 have not been discovered so
far. Eukaryotic cells contain variants of histones H2A and H3 that can be
distinguished from the major histones by small or large differences in their
amino acid sequence (Fig. 1-3). Unlike the major histones that are tightly
regulated during the cell cycle and mainly incorporated during DNA replication
process, these variants are synthesized and assembled into nucleosomes
independently throughout the cell cycle (Sarma and Reinberg, 2005) which
indicate that these variants have evolved for diverse functions such as epigenetic
silencing, gene expression, centromere function, and DNA repair however, the
exact function of each variant is still poorly understood (Malik and Henikoff,
2003). Four H2A variants have been discovered so far – H2AX, H2AZ,
macroH2A, and H2A –bar-body-deficient (H2ABBD). Each of these variants
takes a diverse role in the cellular system. Especially, H2AZ and H2AX are
7
Fig. 1-3. Canonical core histones and their variants. The major core histones
contain a conserved histone-fold domain (HFD). In addition, they contain N- and
C-terminal tails that harbor sites for various post-translational modifications. For
simplicity, only well-established sites for lysine methylation (red flags) and
serine phosphorylation (green circles) are shown (other types of modifications,
such as ubiquitination, are not shown). In the histone H3.3 variant, the residues
that differ from the major histone H3 (also known as H3.1) are highlighted in
yellow. Three of these residues are contained in the globular domain and one
resides in the N terminus. This N-terminal residue (Ser31) has been speculated to
be a potential site for phosphorylation on H3.3. The centromeric histone CENPA
has a unique N terminus, which does not resemble other core histones. Two sites
of phosphorylation have been identified in this region, of which Ser7
phosphorylation has been shown to be essential for completion of cytokinesis.
The region in the globular domain that is required for targeting CENPA to the
centromere is highlighted in light blue. Histone H2A variants differ significantly
from the major core H2A in their C terminus. The C terminus of H2AX harbors
a conserved serine residue (Ser139), the phosphorylation of which is an early
event in response to DNA double-strand breaks. A short region in the C terminus
of H2AZ is essential for viability in Drosophila melanogaster. MacroH2A has
an extended C-terminal macro domain, the function of which is unknown.
Finally, the H2ABBD is the smallest of the H2A variants and contains a distinct
N terminus, which lacks all of the conserved modification sites that are present
in H2A. The C terminus is also truncated and lacks the docking domain that is
found in other H2A species. The histones H4 and H2B are also shown, including
8
Fig. 1-3. Continued.
their known methylation and phosphorylation sites. The proposed functions of
the variants are listed. This figure is adopted from (Sarma and Reinberg, 2005).

9
Fig. 1-3. Continued.

10
found in species ranging from Saccharomyces cerevisiae to human (Jin et al.,
2005) which indicate the fundamental functions of these variants in the
eukaryotic nuclear processes.

H2AX histones share high similarity in amino acid sequence with canonical H2A
histones except that H2AZ contains an extra long C-terminus, which includes a
conserved phosphorylation site at Serine 139. Upon DNA double-strand breaks
(DSBs), Ser 139 in the unique C-terminal region is phosphorylated and often
recognized as an early marker in the response to DNA damage in the cell. The
critical role of H2AX in DNA repair has been demonstrated in gene knockout
studies, in which mouse embryonic stem cells lacking H2AX were sensitive to
ionizing radiation and prone to genomic instability (Bassing et al., 2002) and
H2AX knock out mice also showed radiation sensitivity as well as chromosomal
abnormalities (Celeste et al., 2003; Celeste et al., 2002). Gathering these
evidences to date, H2AX seem to take a critical role in maintaining genomic
stability upon DNA damage. However, the detailed processes on how or why
phosphorylation of H2AX is responsible for DNA repair process are still
unknown. In addition, mechanisms on how this variant is incorporated into the
chromatin is also illusive.

The goal of this thesis is to identify and characterize H3 tail and histone variant
H2A.X-associated factors. To accomplish this, I purified H3 tail-associated
proteins from HeLa cells that stably express epitope-tagged H3 tails. This
approach resulted in the identification of multiple histone methyltransferase
11
(HMT) activities and transcription regulatory factors that are specifically
associated with expressed H3 tail domains. Point mutations of K9 and K27 to
block cellular modifications of the tail domains completely abolished the
association of specific factors including HP1 and several repressors. Importantly,
transcription analysis revealed that the purified factors can significantly stimulate
p300-mediated transcription from chromatin templates. These results implicate
that H3 tail, when accessible in relaxed chromatin, acts as a transcriptional
regulator by mediating recruitment of specific sets of cofactors. I also purified
H2A.X-associated complex from HeLa cell and found that Spt16 and SSRP1
(also named FACT complex) of the purified complex play a major role in
exchanging H2A with H2A.X. H2A.X dissociation from nucleosome by FACT
complex is facilitated by H2A.X phosphorylation that induces conformational
changes of the nucleosome. Finally, I found that ADP-ribosylation of Spt16 by
PARP1, which is another component of the complex, inhibits dissociation of
H2A.X-H2B dimer from nucleosome during DNA damage. These findings will
contribute to understand how chromatin structure and functions can be regulated.

12
CHAPTER 2: Isolation and characterization of proteins associated with
histone H3 tails in vivo

INTRODUCTION

The nucleosome is a basic unit of chromatin in eukaryotic cells, consisting of an
octamer of four core histones wrapped by 146 bp of DNA (Kornberg and Lorch,
1999; Van Holde, 1989; Vignali and Workman, 1998). The most dynamic parts
of the nucleosome are amino terminal domains of core histones, that are directly
involved in transcriptional regulation (Cosgrove and Wolberger, 2005). The most
important feature of these tail domains is their reversible modifications by
acetylation, methylation, phosphorylation, and ubiquitination, among others
(Berger, 2002). The complexity and dynamic character of histone tails and their
modifications present a challenge for detailed studies on how DNA within
chromatin structure could be accessible to regulatory factors. Noting that the H3-
H4 tetramers organize the central part of the nucleosome, while the H2A-H2B
dimers organize the more peripheral part of nucleosomes, H3-H4 tails appear to
play a major role in transcriptional regulation (Luger et al., 1997). Indeed, in
recent transcription analysis using recombinant chromatin templates with
selected tail mutations, it was shown that the H3 and H4 tails and their
modifications are required for transcriptional regulation whereas the H2A and
H2B tails are dispensable (An et al., 2002). Although these results confirm the
importance of H3 and H4 tails, the underlying mechanism(s) involved in
transcriptional regulation by these tail domains still remain to be elucidated.
13
H3 and H4 tails have been shown to be an important determinant of
internucleosomal interactions within chromatin, which are critical for regulating
chromatin compaction and structure (Hansen, 2002; Zheng and Hayes, 2003).
However, in addition, histone tails are found to act as a protein interaction
module to facilitate the recruitment of factors that will establish a specific
functional domain in chromatin. It is also evident that distinct patterns of histone
modifications play a critical role in binding of particular chromatin-regulating

factors to specific chromatin domains. This selectivity of histone modifications
led to the “histone code” hypothesis (Jenuwein and Allis, 2001; Strahl and Allis,
2000; Turner, 2002), which proposes that histone modifications serve as a
cognate mark for the recruitment of specific proteins to specify unique
downstream functions. For example, methylations of H3 at K9 and K27 have
been linked to transcriptional repression, because of their recognition by
heterochromatin protein HP1 and polycomb, respectively (Bannister et al., 2001;
Cao et al., 2002; Lachner et al., 2001; Nakayama et al., 2001; Sims et al., 2003).
In contrast, methylation of H3 at K4 creates binding sites for WDR5, which is a
component of MLL1/2 and Set1 HMT complexes, and Chd1, which is
chromodomain containing protein in the SAGA and SLIK complexes (Pray-
Grant et al., 2005; Wysocka et al., 2005). Recent studies also demonstrated that
specific acetylations of H3 and H4 create marks for the binding of
bromodomains present in many transcriptional regulators such as GCN5, PCAF
and TAFII250 (Zeng and Zhou, 2002). Thus H3 and H4 tails should be the initial
player to accommodate chromatin remodeling signals during gene activation.

14
To define the specific roles of H3 tails in the transcription process, we have
established HeLa cell

lines stably expressing epitope-tagged H3 tails for the
purification of H3

tail-interacting proteins. Our results underscored the
interaction of H3 tails with multiple cellular components with activities which
significantly boost p300-mediated transcription from chromatin templates,
supporting the role of H3 tails as a key factor in establishing a specific
transcriptional environment. Importantly, blocking repressive methylations of K9
and K27 of expressed H3 tails significantly antagonizes the association of known
repressive factors, confirming these modifications to act major regulatory marks
in the recruitment process.

RESULTS

Purification of H3 tail binding proteins from HeLa-derived cell line. To gain
mechanistic insight into recruitment-based action of H3 tails in transcription, we
generated HeLa cell lines that stably express double (FLAG and HA)-tagged
histone H3 tails for the purification of tail-interacting proteins by a combination
of conventional and immunoaffinity chromatographies. Specifically, the N-
terminal tail cDNA sequence encoding residues 1-40 of human H3 was PCR-
amplified and inserted, as eight tandem repeats, into a mammalian expression
vector that has been modified to include the FLAG and HA epitope coding
sequences (Fig. 2-1A). Amino acids 39-43 of H3 pass between the gyres of the
DNA superhelix through channels formed by the minor grooves

of the DNA
terminus and the central turn near the dyad axis (Luger et al., 1997), hence we
15
employed residues 1-40 of H3 excluding other parts of H3 embedded within the
nucleosome particles. This approach allows us to identify proteins capable of
binding specifically to H3 tails in vivo. Since a single copy of the tail was highly
inefficient for our detection and purification (data not shown), we put eight
copies of the tails for more efficient/concentrated preparation of the associated
proteins. The tail fragments span the regions encoding a nuclear localization
signal (NLS) (Mosammaparast et al., 2002), thus allowing accumulation of
expressed tails in the HeLa nucleus (Fig. 2-1A). Indeed our Western analysis
confirmed that major fractions of expressed tails were transported from the
cytoplasm into the nucleus (Fig. 2-1B).

In addition to wild type H3 tails, we also expressed H3 tails with specific
mutations at K9 and K27 to block their cellular methylations. Methylations of
K9 and K27 are known to be repressive marks (Martin and Zhang, 2005) which
could antagonize the formation of an active histone H3 tail complex. Therefore
mutations at K9 and K27 will cause the release of proteins that recognize these
repressive modifications, allowing effective purification of proteins specifically
recognizing active tail modifications. To obtain highly purified tail interacting
proteins from the nuclear extract, we first fractionated the extract on a
Phosphocellulose P11 column. We found that the H3 tail-associated factors were
efficiently eluted in 1.0 and 1.5 M KCl fractions (P11 1.0/1.5) (Fig. 2-1A). Pools
of P11 1.0/1.5 fractions were further purified by M2 agarose affinity
chromatography under stringent conditions (300 mM KCl, 0.1% NP-40) (Fig. 2-
1A). Analysis of the H3 tail-associated complex on SDS-PAGE revealed 13
16
Fig. 2-1. Purification of H3 tail-associated proteins
(A) Schematic diagram of purification of H3 tail-associated proteins. “A”, “M”
and “P” indicate sites of acetylation, methylation and phosphorylation of H3 tails,
respectively. Nuclear extracts from HeLa-derived H3 tail expressing cells were
fractionated over P11 ion exchange column and step eluted with BC buffer as
indicated. A pool of 1.0 and 1.5 M KCl elutes was subjected to M2 agarose
affinity purification. Control purification was conducted in parallel with similar
fractions derived from HeLa cells. Western blotting was performed with anti-
HA and anti-Flag monoclonal antibodies as indicated. Lane 1, mock-purified
fraction from control HeLa nuclear extract; lane 2, proteins purified with wild
type H3 tails; lane 3, proteins purified with H3 tails mutated at K9 and K27.
(B) Nuclear localization of ectopic H3 tails. Nuclear and cytoplasmic extracts
were prepared and analyzed by Western blotting with FLAG antibody. α-Tubulin
and Lamin-A/C were used as markers for cytoplasmic and nuclear fractions,
respectively. Lanes 1 and 3, wild type H3 tails; lanes 2 and 4, K9/27R mutated
H3 tails.

A B
17
major bands that copurified with ectopic H3 tails and were not detectable with
normal HeLa nuclear extract (Fig. 2-2A). Taken together, these results document
the success of purification of H3 tail-interacting proteins directly from cells.

Identification of H3 tail-associated factors. After two step purification of tail-
associated proteins, the complex purified with wild type H3 tails was subjected
to mass spectrometry analysis to identify individual components. Results are
summarized in Figure 2-2A (lane 2). Implying the chromatin specific activity of
the complex, our analysis revealed the presence of histone methyltransferases
(ASH1, CARM1, EuHMT, G9a and MLL3), a histone demethylase (JMJD2C)
and histone deacetylases (HDAC5 and HDAC9) in the complex. We also
detected a stable association of nucleolin and FACT (Spt16 and SSRP1) within
the complex. Since FACT and nucleolin both have been shown to assist transient
release and redeposition of H2A-H2B dimers from nucleosome during
transcription (Angelov et al., 2006; Belotserkovskaya et al., 2003), our results
raise the possibility that H3 tails play a role in initial association of these
activities to facilitate transcription through the nucleosome. Our results also
indicated the association of several factors that have been linked to
transcriptional regulation (SAP130, SAP145, SAP155, Mi-2b, TRAP150, and
TIF1 β). Notably, the identification of SAP130, SAP145 and SAP155, which are
key subunits of splicing factor SF3b, as components of the H3 tail-associated
complex support the possibility of functional linkage between the chromatin
remodeling process and co-transcriptional splicing (Brand et al., 2001; Martinez
et al., 2001). As expected from recent studies, we also identified the association
18
Fig. 2-2. Composition of H3 tail-associated proteins
(A) Mass spectrometric identification of H3 tail-bound polypeptides. After H3
tail-associated proteins were resolved by 4-20% gradient SDS-PAGE, bands
were excised and subjected to mass spectrometric analysis. Proteins associated
with only wild type H3 tails are underlined. Protein size markers (in kilodalton)
are indicated on the left. Lane 1, mock-purified fraction from control HeLa
nuclear extract; lane 2, proteins purified with wild type H3 tails; lane 3, proteins
purified with H3 tails mutated at K9 and K27. Asterisks indicate proteins that
non-specifically interact with FLAG antibody.
(B) Immunoblots of H3 tail-interacting proteins. Purified H3 tail-interacting
proteins were separated by 4-20% gradient SDS-PAGE, and selected
components were analyzed by Western blotting using the indicated antibodies.
Lane 1, mock-purified control; lane 2, wild type H3 tail-associated proteins; lane
3, mutant H3 tail-associated proteins.

A B
19
of three histone binding proteins (HP1 α, HP1 β and HP1 γ) to expressed H3 tails.
We assume that these interactions are established by cellular di- and tri-
methylation of K9 of expressed H3 tails (see below). Our data also revealed the
association of H3 tail with HMGB1, H1 and PARP1 that have been shown to
interact with nucleosomes (Bianchi and Agresti, 2005; Bustin et al., 2005; Kim
et al., 2004). Since it has been proposed that HMGB1, H1 and PARP1 can
compete with each other for their binding to nucleosomes (Kim et al., 2004;
Zlatanova and van Holde, 1998), H3 tails localized at the entry and exit points of
nucleosomal DNA could function as a regulator for their stable association to
nucleosomes. Authenticity of the proteins identified by mass spectrometry was
confirmed by immunoblot using available antibodies (Fig. 2-2B, lane 2). Taken
together, we conclude that H3 tail domains expressed outside of chromatin can
act as a binding motif for recruitment of multiple factors which can regulate
chromatin competency.

Cellular modifications of ectopic H3 tails. Since very little is known about
prominent histone modifying activities in HeLa cell, we determined whether
ectopically expressed H3 tails are subjected to any cellular modifications by
Western blot analysis. We first checked the acetylation status of the H3 tails with
antibodies specifically recognizing each of four acetylation sites (K9, K14, K18
and K23) in the H3 tails. We detected acetylation of ectopic H3 tails at all four
lysine substrates (Fig. 2-3A, lane 2). We next investigated methylation of the H3
tails using antibodies specific to methylated K4, K9, K27 and K36 of H3 (Fig. 2-
3D, lanes 2, 5 and 8). Since the ε-amino group of lysine residues may be mono-,
20

Fig. 2-3. Cellular modifications of ectopic H3 tails
(A) Acetylation of ectopic H3 tails. After the H3 tail-associated proteins were
fractionated by 10 % SDS-PAGE, acetylation status of the expressed tails was
analyzed by Western blot analysis with antibodies recognizing each acetylation
site (K9, K14, K18 and K23) of H3. Lane 1, mock-purified control; lane 2,
wild type H3 tails; lane 3, mutant H3 tails.
(B) Phosphorylation of ectopic H3 tails. Western analysis was identical to Figure
3A except that antibody specific for phosphorylated S10 was used. Lane 1,
mock-purified control; lane 2, wild type H3 tails; lane 3, mutant H3 tails.
(C) Arginine methylation of ectopic H3 tails. Western analysis was identical to
Figure 3A except that antibody specific for di-methylation of R17 was used.
Lane 1, mock-purified control; lane 2, wild type H3 tails; lane 3, mutant H3 tails.
(D) Lysine methylation of ectopic H3 tails. Western analysis was identical to
Figure 3A except that antibodies recognizing mono-/di-/tri-methylation of K4,
K9, K27 and K36 were used. Lanes 1, 4, and 7, mock-purified control; lanes 2, 5,
and 8, wild type H3 tails; lanes 3, 6, and 9, mutant H3 tails.

21
Fig. 2-3. Continued.

A
B
C
D
22
di- or tri-methylated, we examined all possible methylation status. Our analysis
revealed di- and tri-methylation of K4 in ectopically expressed H3 tails, which
are linked to transcriptional activation, but the same analysis showed no
detectable mono-methylation of K4. We also observed significant levels of di-
and tri-methylation of K9 and mono-methylation of K27, which are generally
correlated with transcriptional repression. Similar analysis using antibodies
specific to methylated K36 also confirmed mono- and tri-methylation at K36, the
latter of which is linked to active transcription. In further analysis, we also
detected steady-state levels of phosphorylation at S10 (Fig. 2-3B, lane 2) and di-
methylation of R17 (Fig. 2-3C, lane 2). Thus these results clearly indicate that
specific patterns of modifications can be introduced onto free H3 tails within
living cells.

Histone modifying activities of H3 tail-associated factors. Since we found that
H3 tails are associated with factors that could modulate chromatin state, we next
determined histone modifying activities present in the H3 tail-associated
complex. As shown in Figure 2-4A, the purified complex contains stimulatory
activities to preferentially methylate H3 in equimolar mixtures of all four core
histones (lane 2). To determine the substrate specificity of HMT activities in the
complex, H3 methylation was further characterized by Western-blot analysis
using highly specific antibodies that discriminate mono-, di- and tri-methylation
states of K4, K9, K27 and K36 (Fig. 2-4C, lanes 2, 5 and 8). Consistent with the
mass spectrometry results indicating the stable association of HMTs for K4 and
K9 methylations (Fig. 2-2), our analysis with antibodies recognizing
23

Fig. 2-4. HMT activities of H3 tail-associated proteins
(A) Histone methylation by H3 tail-associated proteins. The H3 tail-associated
proteins were subjected to HMT assays with recombinant core histones and [
3
H]
S-Adenosyl Methionine (SAM) as recently described (An et al., 2004). The
samples were analyzed by 15% SDS-PAGE and fluorography. Lane 1, mock-
purified control; lane 2, proteins purified with wild type H3 tails; lane 3, proteins
purified with H3 tails mutated at K9 and K27.
(B) Arginine specific methylation by H3 tail-associated proteins. HMT assays
were identical to Figure 4A except that recombinant H3 protein and unlabeled
SAM were used for each reaction. Western analysis was performed with
antibody specific for methylated R17 of H3 as described in Figure 3C. Lane 1,
mock-purified control; lane 2, proteins purified with wild type H3 tails; lane 3,
proteins purified with H3 tails mutated at K9 and K27.
(C) Lysine specific methylation by H3 tail-associated factors. HMT assays were
identical to Figure 4B. Western analysis was performed with antibodies
specific for methylated K4, K9, K27 and K36 of H3 as described in Figure 3D.
Lanes 1, 4 and 7, mock-purified control; lanes 2, 5 and 8, proteins purified with
wild type H3 tails; lanes 3, 6 and 9, proteins purified with H3 tails mutated at K9
and K27.

24
Fig. 2-4. Continued.

A B
C
25
methylations of K4 and K9 confirmed the presence of HMT activities specific
for di- and tri-methylation of K4 and mono- and di-methylation of K9. Parallel
experiments with antibodies specific for methylated K27 and K36 revealed the
presence of HMT activities capable of mono-methylation of K27 and tri-
methylation of K36. These results are somewhat surprising since no known
HMT (e.g., EZH2) for K27 methylation could be detected in our mass
spectrometry results (see Figure 2-2A) and human HMT specific for K36 has not
yet been discovered. Therefore, future studies should identify which proteins in
the complex retain enzymatic activities for these modifications. It is also possible
that a certain HMT shows broader specificities when associated with other
proteins within the complex.

Consistent with the presence of CARM1 in the H3 tail complex, additional
analysis showed di-methylation of R17 by the purified complex (Fig. 2-4B, lane
2). Interestingly, although expressed H3 tails are highly acetylated at K14 and
K18 and phosphorylated at S10 (Fig. 2-3A and 3B), we could not detect any
HAT and kinase activities in the purified complex (data not shown). The absence
of these activities argues for the dynamic action of HAT and kinase via their
highly transient interactions with ectopic H3 tails. Taken together, these results
show that H3 tail domain can act as a binding domain for multiple HMT
activities.

Purification and identification of mutant H3 tail-associated factors. The
above results revealed multiple cellular modifications of ectopic H3 tails (Fig. 2-
26
3), raising the possibility that each of the observed modifications may influence
the association of specific factors directly or indirectly. Some of the observed
modifications are generally associated with active chromatin states (e.g.,
acetylations at K9, K14, K18 and K23 and methylations at K4 and K36),
whereas other observed modifications are generally associated with repressed
chromatin states (e.g., methylations at K9 and K27). To assess the contributions
of only activating H3 tail modifications on factor binding, we mutagenized K9
and K27 of ectopic H3 tail to block their cellular methylations. Using this
approach, we could determine if disruption of these repressive methylation
signals in ectopic H3 tail domain would antagonize association of any specific
factors that could have negative effects on transcription. Although K9 can be
either methylated or acetylated, recent mass spectrometry analysis identified
abundant di-methylation at K9 in major population of H3 (Thomas et al., 2006);
thus we assumed that our mutation of K9 will mainly block cellular methylation
of K9.

We first checked the modification status of the expressed mutant H3 tails. As
expected, Western analysis revealed that mutations at K9 and K27 did not affect
acetylations of expressed H3 tails at K14, K18 and K23 (Fig. 2-3A, lane 3), but
completely abolished methylation at K9 and K27 (Fig. 2-3D, lanes 3, 6 and 9).
Our analysis also confirmed remarkable effects of mutations on di-methylation at
K4 and mono-methylation at K36, but little or no effect on tri-methylations at K4
and K36 (Fig. 2-3D, lanes 3, 6 and 9) and phosphorylation at S10 (Fig. 2-3B,
lane 3). Unexpectedly, a similar analysis with antibody specific for di-
27
methylated R17 (Fig. 2-3C, lane 3) revealed that mutations at K9 and K27
significantly reduced R17 methylation. Notably, Western analysis with the
antibody for acetylated K9 generated a false-positive result (even with K9
mutated to R) (Fig. 2-3A, lane 3), indicating that the antibody does not solely
react with acetyl-lysine epitope, but also interacts with other part or modification
of the H3 tails.

To identify the proteins associated with mutant H3 tails, the purified complex
was again subjected to mass spectrometry analysis (Fig. 2-2A, lane 3).
Significantly, our results confirmed the absence of all HP1 proteins ( α, β, and γ)
that are known to be associated with K9-methylated H3 in the purified complex.
In a more surprising finding, mutations of ectopic H3 tails also abolished the
binding of Mi-2b, HDAC5, HDAC9 and TIF1 β which have been shown to play
roles in transcription repression (Ayyanathan et al., 2003; Yang and Seto, 2003;
Zhang et al., 1998) and two uncharacterized proteins (FLJ12800, FLJ13639).
However, mass spectrometry analysis could identify within the mutant H3 tail-
associated complex all other proteins found in the wild type H3 tail-associated
complex (Fig. 2-2A, compare lane 3 with lane 2). Again, the mass spectrometry
results were confirmed by immunoblot analysis with available antibodies (Fig. 2-
2B, lane 3). Interestingly, although G9a and CARM1 were identified in both
wild type and mutant H3 tail-associated complexes by mass spectrometry, our
Western blot analysis demonstrated that the mutations significantly inhibit
association of G9a and CARM1 with ectopic H3 tail (Fig. 2-2B). Consistent with
these results, the proteins associated with mutant H3 tails showed reduced HMT
28
activities for mono- and di-methylation of K9 which probably caused by G9a
(Fig. 2-4C, lanes 3 and 6) and di-methylation of R17 which was by CARM1 (Fig.
4B, lane 3). Moreover, although mono-methylation of K27 was slightly
decreased (Fig. 2-4C, lane 3), other HMT activities for di- and tri-methylation of
K4 and tri-methylation of K36 (Fig. 2-4C, lanes 6 and 9) were not significantly
affected by these mutations. Therefore, our results provide direct evidence that
methylations at K9 and K27 play an important role in the interaction of H3 tails
with specific proteins, supporting highly selective recognition/retention of
proteins by a certain modification mark within H3 tail domain. These results also
confirm the feasibility of our approach to purify H3 tail-associated factors and to
identify factors associated with specific H3 tail modifications, setting the stage
for more detailed analysis with differentially mutated tails in our future studies.

Effects of H3 tail-associated factors on chromatin transcription. To
characterize the function of the H3 tail-associated factors in transcription, we
next assessed the ability of the complex to regulate transcription from chromatin
or DNA templates. Since regulatory activities known for both transcriptional
activation and repression were purified by using ectopic H3 tails, we were
particularly interested in examining selective action of the complex in p300-
medited chromatin transcription. Transcription assays

with recombinant
chromatin templates containing p53 response elements

upstream of core
promoter sequences were carried out as described

previously (An et al., 2004),
except that the H3 tail-associated complex was added together

with p300 and
acetyl-CoA (Fig. 2-5A). As previously reported (An et al., 2004; An et al.,
29
2002), transcription from chromatin template was

completely dependent upon
p53, p300, and

acetyl-CoA (Fig. 2-5B, lanes 5-8), whereas DNA transcription
showed a dependency only on the activator p53 (Fig. 2-5B, lanes 1-4).
Significantly, addition of the H3 tail-associated complex resulted in a distinct
boost of p300-mediated transcription from chromatin template (Fig. 2-5C, lanes
13-15), whereas similar experiments in the absence of p300 and acetyl-CoA
showed no effect of the H3 tail-associated complex in transcription (lanes 16-18).
In parallel experiments with free DNA, H3 tail-associated complex showed no
effect in transcription (lanes 1-6). These results suggest that the effect of H3 tail-
associated factors depends on the prior action of p300 on chromatin template.
Since blocking repressive methylations at K9 and K27 inhibited the binding of
several repressors (HP1, G9a and TIF1 β) to expressed H3 tails (Figure 2-2), we
next checked if the mutant tail-associated complex differentially contributed to
the observed transcriptional effects. Interestingly, the factors purified with
mutant tails stimulated transcription similarly to that observed with the wild type
tail complex (Fig. 2-5C lanes 19-21). Although HP1 and G9a have been
implicated in activation as well as repression (Hediger and Gasser, 2006; Lee et
al., 2006), it is important to note that our analysis was restricted to acetylation-
mediated transcription without including any HMT and SAM. Therefore, our
future studies will determine if isolated complexes differentially contribute to
transcription depending on the methylation state of chromatin template.

30

Fig. 2-5. Transcription analysis of H3 tail-associated proteins
(A) Schematic summary of transcription protocol to study the effect of H3 tail-
associated proteins.
(B) Transcription from DNA and chromatin templates. Chromatin templates (40
ng) reconstituted with recombinant histone and naked DNA (40 ng) were
transcribed with p53 (15 ng), p300 (20 ng) and/or acetyl-CoA (10 µM) as
summarized in figure 2-5A and as recently described (An et al., 2004).
(C) Transcription was performed as in Figure 5B but the purified H3 tail-
associated proteins were added together with p300 and acetyl-CoA as indicated.

A B
C
31
DISCUSSION

Recent biochemical and cellular analyses have implicated that H3 tail and its
modification play an important role in recruiting transcription regulatory factors
to chromatin-associated target genes. In this article we purified, identified and
characterized proteins associated with H3 tails in intact cells. Our results
demonstrate (i) specific association of sets of histone modifying and
transcriptional regulatory factors with H3 tails, (ii) critical requirement of
methylations at K9 and K27 for the association of repressive factors with H3
tails, and (iii) positive effects of H3 tail-associated factors in p300-mediated
chromatin transcription. The contribution of these results to our understanding
of the role of H3 tail in transcriptional regulation is discussed below.

Recruitment-based action of H3 tail in chromatin transcription. Previous
experiments performed with recombinant chromatin templates have
demonstrated the requirement of H3 tails in transcription of relaxed chromatin
templates (An et al., 2004; An et al., 2002). Thus comparing the level of
transcription from intact chromatin versus H3 tailless chromatin shows a
significant repression of transcription by deletion of H3 tail. Albeit these results
bear an important implication on the critical role of H3 tails in chromatin
function, how H3 tails regulate transcription is unclear. According to a widely
accepted model, H3 tails can serve as physical interaction surfaces for the
recruitment of specific regulatory factors to modulate downstream transcription
activities (Cosgrove and Wolberger, 2005; de la Cruz et al., 2005; Jenuwein and
32
Allis, 2001; Strahl and Allis, 2000; Turner, 2002). Previous results showing that
H3 tails are highly accessible in trypsin digestion of nucleosomal arrays (Ausio
et al., 1989; Marion et al., 1983) also imply its possible role in factor recruitment.
Furthermore post-translational modifications of H3 tails regulate physical
interaction of tail domains with modification-specific binding

domains (such as
bromo- and chromo-domains) which will significantly specify the tail-mediated
recruitment of regulatory factors (Cosgrove and Wolberger, 2005; de la Cruz et
al., 2005; Jenuwein and Allis, 2001; Strahl and Allis, 2000; Turner, 2002). In
fact, to screen proteins

capable of binding to H3 tail, recent studies applied
affinity columns prepared with

either unmodified or specifically modified H3 tail
peptides (Macdonald et al., 2005; Santos-Rosa et al., 2003; Schneider et al.,
2004; Zegerman et al., 2002). These peptide affinity

columns have successfully
been used to identify the tail-binding proteins from

HeLa nuclear extract.
However a major drawback of these affinity purifications

is that the purification
is dependent on a specific modification, and thus possible effects of other
modifications and multiple modifications in factor association would not be
identified.

In this regard, our

unbiased approach of purifying

tail-associated
proteins directly from cells by expressing H3 tail domains is more suitable for
identifying tail-interacting factors than these in vitro purification methods.

The significant feature of the present study is the identification and
characterization of H3 tail-interacting factors that positively regulate chromatin
transcription. Our analysis to examine cellular modifications of expressed H3
tails has confirmed acetylation, methylation, and phosphorylation of the tail
33
domains at major modification sites (Fig. 2-3). However, the purified complex
only showed HMT activities mainly acting on H3 (Fig. 2-4), indicating that
acetylation and phosphorylation of ectopic H3 tails arise from transient actions
of cellular HATs and kinases. Consistent with these results, our mass
spectrometry analysis identified several HMTs (G9a, CARM1, EuHMT, MLL3,
ASH1) but no known HAT or histone kinase among H3 tail-associated factors
(see below). Importantly, our transcription assays showed that the H3 tail-
associated factors significantly up-regulate p300-mediated transcription from
chromatin template (Fig. 2-5C, lanes 13-15). The inability of H3 tail- associated
factors to enhance transcription in the absence of p300 and acetyl-CoA (lanes
16-18) indicates that chromatin acetylation (mediated by p300) is prerequisite for
the action of the H3 tail-associated complex. The most likely interpretation of
our results is that ectopic H3 tail-bound factors interact with activators to
selectively recognize p300-mediated acetylation at promoter region of chromatin
template. This promoter localization of the factors will further induce relief of
nucleosome-mediated repression at the promoter to facilitate the formation of
preinitiation complex. Thus further characterization of the H3 tail- associated
complex with various histone modifying cofactors such as HMT and histone
kinase will facilitate our understanding of the molecular details for transcription
regulation by H3 tail.

Selective recognition of H3 tail by regulatory factors. Our mass spectrometry
results indicate that ectopic H3 tails are stably associated with 30 proteins
including several HMTs, chromatin specific proteins and transcription factors.
34
Consistent with HMT activities of the complex specific for K4 and K9, we
identified MLL3, G9a, ASH1 and EuHMT. However, albeit the complex can
methylate K27 and K36, we could not detect any factors that are responsible for
these modifications. Although we do not have a clear explanation, it is possible
that MLL3, G9a, ASH1 and/or EuHMT in the complex can methylate K27
and/or K36 together with other associated factors. It is also possible that
K27/K36-specific activities stem from unknown or other associated proteins in
the complex. To resolve these uncertainties, we are currently checking for the
possible methyltransferase activities of other components of the complex. Our
results also have shown that H3-K9 specific demethylase JMJD2C is associated
with H3 tails. Since JMJD2C appears to preferentially demethylate tri-methyl K9
of H3 at low concentration (Cloos et al., 2006), we assume that mono- and di-
methylation of K9 by H3 complex is accomplished by repressive action of
JMJD2C on K9 tri-methylation by G9a, ASH1 and/or EuHMT. Consistent with
recent observation of its interaction with acetylated H3 tail (Daujat et al., 2002),
H3-R17 specific methyltransferase CARM1 was also identified in the purified
complex. Since acetylations of H3 tails (at K18 and K23) were shown to increase
the affinity of CARM1 to H3 tails in vitro (Daujat et al., 2002), it will be of
interest to check if similar acetylations of ectopic H3 tails are required for
cellular association of CARM1 with the expressed H3 tails. Moreover, although
we have not checked in current studies, it is likely that CARM1 in the complex
may have positive effects on p300-mediated transcription in the presence of
SAM by acting synergistically with p300 (An et al., 2004; Lee et al., 2002). We
also note that HDAC5 and HDAC9 are present in the tail-associated complex.
35
Although these HDACs have been generally implicated as co-repressors, there
are an increasing number of cases where HDAC activities are required for
transcription (Kato et al., 2004; Qiu et al., 2006; Wang et al., 2002). This
function of HDACs as a positive regulator of transcription appears to arise from
active deacetylation of a nonspecific acetylation which is an important
component of the activation of the promoter to very high transcription rates; thus
it is also possible that HDACs in the complex may play a positive role in p300-
mediated transcription by modulating the level of untargeted acetylation.

Consistent with chromatin specific activities of the complex, we also found
FACT, a heterodimer of Spt16 and SSRP1, and nucleolin which have a positive
effect on chromatin transcription by acting as a histone chaperone for removal of
H2A/H2B dimer (Belotserkovskaya et al., 2003). Since the recent study showed
that Spt16 and SSRP1 bind to H2A-H2B dimers and H3-H4 tetramers,
respectively, we assume that direct interaction of SSRP1 with H3 tails facilitates
indirect association of Spt16 in the purified complex (Belotserkovskaya et al.,
2003). Considering that nucleolin is able to activate the remodeling of both
conventional and macroH2A nucleosomes (Angelov et al., 2006), it will also be
of interest to check if the H3- associated complex can assist the activation of
chromatin containing macroH2A and other histone variants.

Identification of SAP155/145/130 subunits of the splicing factor 3b (SF3b) in the
tail-associated complex also supports the possible role of H3 tail and its
modification in regulation of co-transcriptional splicing processes. Indeed recent
36
studies identified SAP130 in GCN5L-containing STAGA and TFTC complexes
(Brand et al., 2001; Martinez et al., 2001) which recognize and acetylate H3 tails.
Moreover, several subunits of the SWI/SNF complex including BRG1, BAF155
and SNF5 were co-purified with SAP130 (Underhill et al., 2000). Thus our
observations bear an important implication on a possible coupling between H3
tail-mediated chromatin remodeling and alternative splicing. We also detected all
three subtypes of HP1 proteins as components of the wild type H3 tail-associated
complex, but not of the K9/27R tail complex. Given their general linkage to K9-
methylation-induced heterochromatic gene silencing, it is unexpected to see that
the HP1-containing wild type tail complex could activate chromatin transcription.
However, it is notable that we only study the effect of the tail complex on
acetylation-mediated transcription, and thus HP1 proteins of the tail complex
will have a minimal effect in transcription. Therefore we are currently
investigating a possible effect of the complex in chromatin transcription
repressed by H3-K9 methylation.

Another interesting finding is the presence of linker histone H1 and non-histone
chromatin protein HMGB1 in the tail-associated complex. Although the precise
position of these proteins on nucleosome is not clearly determined, it appears
that these proteins are mainly anchored onto the vicinity of the

end of the DNA
and the two major grooves flanking the nucleosomal

dyad axis (Van Holde,
1989; Vignali and Workman, 1998; Zlatanova and van Holde, 1998) where the
H3 tails are also positioned (Luger et al., 1997). Therefore, it is not unlikely that
H3 tails play a role in stable bindings of H1 and HMGB1 to nucleosomes. These
37
results also point to a previously unrecognized contribution of H3 tail to the
control of gene transcription, possibly through an effect on H1/HMGB1-induced
changes in chromatin structure. Another important point with respect to our mass
spectrometry analysis is that the H3 tail-associated complex is devoid of
bromodomain-containing factors (e.g. PCAF, TAFII250, BRG1) that have been
shown to interact with acetylated H3 tails (Zeng and Zhou, 2002). Although it
needs to be determined, it may be that other modifications such as K9/K27
methylation and S10 phosphorylation within expressed H3 tails inhibit stable
association of bromodomains with acetylated H3 tails; thus it would be of
considerable interest to examine whether blocking of these neighboring
modifications stimulates the interaction between acetylated H3 tails and
bromodomain-containing factors in future studies.

K9 and K27 methylation as a key determinant of H3 tail-factor interactions.
As a first step to delineate the contribution of H3 tail modifications in factor
association, the effect of K9 and K27 methylation was investigated by their
mutations to arginine. In contrast to methylations of K4 and K36 that are
associated with active chromatin, these methylations are known to induce
chromatin condensation for transcription repression (Sims et al., 2003).
Unexpectedly, our experiments revealed that K9 and K27 mutations significantly
inhibited K4 di-methylation and K36 mono-methylation (Fig. 2-3D) of the
ectopic H3 tails, but not K4/K36-specific HMT activities of the complex (Fig. 2-
4C, compare lane 5 and lane 6). Although we do not have a clear explanation for
these results, it is tempting to speculate that the methylations of ectopic H3 tails
38
at K9 and/or K27 (especially di-/tri-methylations at K9 and/or mono-methylation
at K27) in vivo could either directly or indirectly modulate HMT activities
specific for K4 and K36. This dependency will allow cells to keep balance
between active methylations at K4 and K36 and repressive methylations at K9
and K27. Thus, it will be interesting to study the similar effect of K4 and K36
mutations on K9 and K27 methylations in future experiments. In contrast to
methylation, mutations of K9 and K27 have little or no effect on tail acetylation
(at lysines 9, 14, 18 and 23) and phosphorylation (at serine 10), implying
independent action of cellular HAT and kinase.

Our mass spectrometry analysis also indicated that proteins associated with wild
type H3 tail are different from those associated with K9/K27-mutated H3 tail,
supporting specific role of methylations at these two sites in factor recruitment.
A major finding is that these two marks are specifically required for association
of repressive factors including HP1, HDAC5/9, Mi-2b, G9a and TIF1 β. We did
not attempt to delineate precisely whether blocking K9 methylation or K27
methylation is a major cause for dissociation of these factors from ectopic H3 tail.
However, based on the pioneering works that established specific interaction
between HP1 chromodomain and K9 methylated H3 tail and the recent model
which describes HP1-mediated recruitment of multiple repressive factors (Daniel
et al., 2005; de la Cruz et al., 2005), we assume that K9 mutation of ectopic H3
tail is the major cause for the factor dissociation. Indeed, it has recently been
demonstrated that TIF1 β and HDAC5 can stably associate with HP1(Nielsen et
al., 1999; Zhang et al., 2002), suggesting that the TIF1 β and HDAC5 are
39
indirectly associated with H3 tail via HP1 in the complex. Thus, K9 mutation can
cause the simultaneous dissociation of HP1, TIF1 β and HDAC5. Our
demonstration that interactions of H3 tails with other factors are not sensitive to
mutations at K9 and K27 further reflects the specific role of K9 and K27
methylation in the recruitment of known repressive factors. Significantly, the
mutant H3 tail complex showed activity similar to that of the wild type complex
in our transcription assays. Since we only checked effects of the complexes on
acetylation-mediated transcription, it will be of interest to check if the wild type
and mutant complexes could differentially regulate transcription when chromatin
templates are acetylated by p300 and methylated by H3-K9/K27-specific HMTs.
It is likely that the H3-K9/K27 methylation of chromatin might conceivably
result in the recruitment of repressive factors (HP1, HDAC5/9, Mi-2b, G9a
and/or TIF1 β) from the wild type H3 tail-associated complex and consequent
repression of p300-mediated transcription. However, since all repressive factors
specifically recognizing H3-K9/K27 methylation are dissociated in the mutant
H3 tail complex, we expect to find H3-K9/K27 methylation of chromatin to
minimally change the effect of the mutant H3 tail-associated complex in p300-
mediated transcription. Although more work is required to clearly understand the
details, the results presented in this study are sufficient to demonstrate a
functional complexity of H3 tail-mediated transactivation accompanying with
multiple modification and recruitment processes. Application of differentially-
mutated H3 tails in described purification will undoubtedly facilitate our efforts
to gain a full understanding of the mechanism of action of H3 tail and its
modification in transcription. Moreover, individual characterization of H3 tail-
40
associated factors will also provide a basis to identify most critical factors in
chromatin transcription.

MATERIALS AND METHODS

Plasmids. cDNA sequence encoding amino acids 1-40 of human H3 was PCR
amplified by use of a 5’ primer (5’-ATTGCGGCCGCATGCATATGGCTCG
TACTAAACAG-3’), which introduced NotI and NsiI sites, and a 3’ primer (5’-
TAAGAATTCTCTGCAGGTGAGGCTTTTTCACACC-3’), which introduced
EcoRI and PstI sites. The generated products were digested with NotI-EcoRI and
inserted into NotI-EcoRI-linearized pBS SK
+
(pBS-1xnH3). The plasmid (pBS-
2xnH3) containing two copies of H3 tail cDNA was generated by inserting the
NsiI-EcoRI-digested H3 tail cDNA fragment into PstI-EcoRI-digested pBS-
1xnH3. Note that NsiI and PstI produce compatible cohesive ends. To yield the
plasmid (pBS-4xnH3) containing four copies of H3 tail cDNA, two copies of H3
tail cDNA digested from pBS-2xnH3 were ligated into PstI-EcoRI-digested pBS-
2xnH3. Finally, pBS-8xnH3 was generated by inserting four copies of H3 tail
cDNA into PstI-EcoRI-digested pBS-4xnH3. After subcloning eight tandem
repeats of the synthesized H3 tail cDNA in pBS, the inserted DNA was excised
with NotI and EcoRI and ligated into NotI and EcoRI sites of pIRES containing
FLAG and HA tags to generate the plasmid (pFHnH3-IRESneo) for mammalian
expression. The same procedure was used to construct the plasmid encoding
mutant H3-K9/27R tail domain except that mutations in K9 and K27 to Arginine
41
(R) were introduced to original H3 cDNA by using the Quick Change II Site-
Directed Mutagenesis kit (Stratagene).

Purification and identification of H3 tail- interacting proteins. HeLa cells
were transfected with pFHnH3-IRESneo (wild type and K9/27R) using
Lipofectamine (Invitrogen) and selected with G418 (500 µg/ml) for 2 weeks.
G418-resistent colonies stably expressing H3 tails were grown in spinner culture
in DME-phosphate (Irvine Scientific) supplemented with 10% bovine calf serum
(BCS). Nuclear extracts were prepared as described (Malik and Roeder, 2003).
For purification of H3 tail-interacting proteins, nuclear extracts (300 mg) were
fractionated through Phosphocellulose P11 column (Whatman). The P11
BC1000 and BC1500 fractions containing expressed H3 tails were dialyzed
against BC300 and applied to M2 agarose affinity chromatography (Sigma).
After extensive washings with BC300 containing 0.1% NP-40, H3 tail-associated
proteins were eluted from M2-agarose by using FLAG peptide (200 ng/µl).
Expression and purification of ectopic H3 tails were confirmed by Western blot
using both FLAG (Sigma) and HA (Santa Cruz Biotechnology) antibodies. The
purified H3 tail-associated proteins were analyzed by data-dependent tandem
mass spectrometry using an LCQ DecaXP ion trap mass spectrometer (Thermo
Finnigan) as described previously (Gygi et al., 1999). The mass spectral data
were searched against human protein sequence database using SEQUEST (Yates
et al., 1995). Antibodies employed in Western blot analysis were as follows:
histone H1, histone H2B and CARM1 antibodies were obtained from Upstate;
HMGB1 antibody was from Abcam; TIF1 β, Nucleolin and Spt16 antibodies
42
were from Santa Cruz Biotechnology; Lamin-A/C antibody was from Sigma; α-
Tubulin antibody was from Cell Signaling Technology; PARP1, HP1 and G9a
antibodies were kind gifts from Drs. Comai, Rice and Stallcup, respectively;
antibodies against TRAP150 and SAP130 were kindly provided by Drs. Roeder
and Martinez.

Histone methylation assay. HMT assays were performed as previously
described (Nishioka et al., 2002). Briefly, 1 µg core histones or 0.3 µg
recombinant histone H3 were incubated with H3 tail-interacting proteins for 1h
at 30
o
C in HMT reaction buffer (100 mM HEPES at pH 7.8, 300 mM KCl, 2.5
mM EDTA, 25 mM DTT, 50 mM sodium butyrate) in the presence of 2.3 µM
3
H-SAM or 50 µM cold SAM. The antibodies used for detection of H3 tail
modifications were as follows: anti-dimethyl H3-K4, anti-monomethyl H3-K9,
anti-dimethyl H3-K9, anti-dimethyl H3-K36, anti-acetyl H3-K9, anti-acetyl H3-
K14, anti-acetyl H3-K18, anti-acetyl H3-K23, and anti-phospho H3-S10
antibodies were purchased from Upstate; anti-monomethyl H3-K4, anti-trimethyl
H3-K4, anti-monomethyl H3-K36, and anti-trimethyl H3-K36 antibodies were
purchased from Abcam; anti-dimethyl H3-R17 antibody was obtained from Dr.
Stallcup; anti-trimethyl H3-K9, anti-monomethyl H3-K27, anti-dimethyl H3-
K27, and anti-trimethyl H3-K27 antibodies were obtained from Dr. Rice.

In vitro transcription assay. Chromatin templates were assembled as described
(Ito et al., 1999) by using recombinant histones and chromatin assembly
factors ACF and NAP1. The plasmid DNA template containing adenovirus
43
major late core promoter (AdML) and p53 response elements was as described
(An et al., 2004). Flag-tagged p53 was expressed in bacteria and purified as
recently described (An et al., 2004). Flag-tagged p300 protein was expressed in
insect Sf9 cells and purified on M2-agarose according to standard procedure.
Transcription assays were performed using p53 (15 ng), p300 (20 ng) and acetyl-
CoA (10 µM) as reported previously (Kundu et al., 2000) except that H3 tail-
associated factors were added together with p300 and acetyl-CoA (Fig. 2-5A).

44
CHAPTER 3. FACT-mediated exchange of histone variant H2A.X
regulated by phosphorylation of H2A.X and ADP-ribosylation of Spt16

Three major processes that regulate DNA accessibility in chromatin context are
posttranslational modifications of histones, ATP-dependent chromatin
remodeling, and incorporation of histone variants. H2A.X is one of the histone
variants which constitutes about 5-10 % of total cellular H2A in higher
organisms. H2A.X is different from conventional H2A in that it is rapidly
phosphorylated at a highly conserved serine residue in its C-terminus upon DNA
double strand break (DSB) by phosphatidylinositol 3'-kinase-like kinase
(PI3KK) family such as Ataxia-telangiectasia mutated (ATM), Ataxia-
telangiectasia and Rad3-related protein (ATR), and DNA-dependent protein
kinase (DNA-PK) during DNA DSB (Burma et al., 2001; Chen et al., 2000;
Fernandez-Capetillo et al., 2004; Park et al., 2003; Paull et al., 2000; Rogakou et
al., 1999; Ward and Chen, 2001). Previous work has indicated that mutating the
phosphorylation site of yeast H2A.X impairs the non-homologous end-joining
(NHEJ) mediated DSB repair process (Downs et al., 2000). The critical role of
H2A.X in DNA repair also has been demonstrated in gene-knockout studies, in
which embryonic stem cells lacking H2A.X are sensitive to ionizing radiation
and prone to genomic instability (Bassing et al., 2002). These results have further
recapitulated in mice lacking H2A.X, which are also prone to genomic instability
and early onset of tumors (Celeste et al., 2003; Celeste et al., 2002).

45
Recent studies demonstrate that specific replacing activities are required for
exchange between conventional histone H2A and H2A variants in nucleosome.
SWR1 chromatin remodeling complex in yeast is the first remodeling activity
identified to catalyze integration of H2A.Z into nucleosome (Mizuguchi et al.,
2004). Tip60 complex in Drosophila has also been characterized as a major
activity which catalyze the exchange of H2A.X and γ-H2A.X (Kusch et al.,
2004). However, the detailed mechanism on how H2A.X is initially incorporated
into the nucleosome within human cell is still unknown.

Here, we demonstrate the purification and characterization of H2A.X-associated
complex which facilitates exchange between H2A.X and H2A. We found that
Spt16 and SSRP1 (also named FACT complex) of the purified complex play a
major role in its exchanging activity. H2A.X dissociation from nucleosome by
FACT complex is facilitated by H2A.X phosphorylation by DNA-PK that
induces conformational changes of the chromatin. We also found that ADP-
ribosylation of Spt16 by PARP1 leading to the dissociation of FACT complex
from H2A.X-H2B dimer inhibits dissociation of H2A.X-H2B dimer from
nucleosome during DNA damage.

To purify factors facilitating H2A.X exchange, we generated HeLa cell line
stably expressing FLAG and HA-tagged histone H2A.X for the purification of
H2A.X-associated complex by using a combination of conventional and
immunoaffinity chromatographies. In detail, cDNA sequence encoding human
H2A.X was PCR-amplified and inserted into a mammalian expression vector
46
that has been modified to include the FLAG and HA epitope coding sequence
(Fig. 3-1A). HeLa cells were transfected with pFH-H2A.X-IRESneo and
selected for two weeks, which are resistant to G418. After establishment of
stable cell line, we first confirmed localization of ectopic H2A.X protein to be
mostly in the nucleus by Western (Fig. 3-1B) and immunostaining analyses (Fig.
3-1C). To purify H2A.X-associated complex, nuclear extracts were fractionated
using Phosphocellulose P11 column. H2A.X-associated complex was
specifically eluted in 0.8 and 1.2 M KCl fractions (Fig. 3-1A). Combined P11
0.8/1.2 fractions were further purified by using M2 agarose affinity
chromatography. Analysis of the purified complex on SDS-PAGE showed
twelve major bands, which were not detectable with normal HeLa nuclear extract
(Fig. 3-1D). To identify individual component of H2A.X-associated complex, we
next subjected the complex to the mass spectrometry analysis. Results are
summarized in figure 3-1D. As expected from recent studies, we identified
several DNA repair-related factors including DNA-PK, breast cancer-associated
gene 2 (BRCA2), PARP1, and Ku. We also found the association of factors that
are known to introduce histone methylation (MMSET and PRMT5) and
acetylation (Tip60). A stable association of PP2C gamma and FACT complex
(Spt16 and SSRP1) within the H2A.X-associated complex were detected. Our
mass spectrometry results were further confirmed by immunoblot using available
antibodies (Fig. 3-1E).

47
Fig. 3-1. Purification of H2A.X-associated complex
(A) Schematic diagram of purification of H2A.X-associated complex. Nuclear
extracts from HeLa-derived H2A.X expressing cells were fractionated over P11
ion exchange column and step eluted with BC buffer as indicated. A pool of 0.8
and 1.2 M KCl elutes was subjected to M2 agarose affinity purification. Control
purification was conducted in parallel with similar fractions derived from HeLa
cells. Western blotting was performed with anti-HA antibody as indicated. Lane
1, mock-purified fraction from control HeLa nuclear extract; lane 2, proteins
purified with H2A.X.
(B) Nuclear localization of ectopic H2A.X. Nuclear and cytoplasmic fractions
were prepared and analyzed by Western blotting with FLAG antibody. α-Tubulin
and Lamin-A/C were used as markers for cytoplasmic and nuclear fractions,
respectively.
(C) Immunostaining of ectopic H2A.X. Ectopically expressed H2A.X was
stained by FLAG antibody and DAPI was used for nucleus staining.
(D) Mass spectrometry analysis of H2A.X-bound polypeptides. After H2A.X-
associated complex were resolved by 4-20% gradient SDS-PAGE, bands were
excised and subjected to mass spectrometric analysis. Protein size markers (in
kilodalton) are indicated on the left. Lane 1, mock-purified fraction from control
HeLa nuclear extract; lane 2, proteins purified with H2A.X.
(E) Immunoblots of H2A.X-associated complex. Purified H2A.X-associated
complex were separated by 4-20% gradient SDS-PAGE, and selected
components were analyzed by Western blotting using the indicated antibodies.
Lane 1, input; lane 2, mock-purified control; lane 3, H2A.X-associated complex.
48
Fig. 3-1. Continued.

A
B C
D
E
49
Since FACT complex has recently been characterized as a H2A-H2B specific
chaperon (Belotserkovskaya et al., 2003), it is possible that FACT complex
within H2A.X-associated complex can facilitate exchange between H2A-H2B
dimer and H2A.X-H2B dimer. To check this possibility, Spt16 and SSRP1,
components of FACT complex, were expressed using baculovirus system and
purified as recently described (Fig. 3-2A) (Orphanides et al., 1999). Our
interaction studies clearly showed that Spt16 and SSRP1 can directly interact
with H2A.X (Fig. 3-2B). Next, FACT complex was subjected to histone
exchange assay if H2A.X-associated complex and recombinant FACT complex
can promote deposition of H2A.X-H2B dimer into nucleosome by its histone
chaperone activity. For exchange assays, we prepared recombinant H2A.X-H2B
dimer, regular histone octamer (containing H2A) and H2A.X containing histone
octamer. Briefly, recombinant 6xHis H2A.X protein was purified after
expression in Bacteria. After removing 6xHis tags by Thrombin cleavage,
H2A.X was reconstituted into dimer with H2B. In addition, H2A and H2A.X
were reconstituted with H2B, H3 and H4 for regular and H2A.X containing
octamer, respectively, and reconstituted octamers were purified through gel
filtration column to remove unfolded histone proteins (Fig. 3-2C). These purified
H2A and H2A.X containing histone octamers were reconstituted nucleosomes
onto biotinylated DNA strand that contains histone positioning sequence
(Lowary and Widom, 1998) and purified by glycerol gradient centrifugation.
Fractions that contain only nucleosomes were combined for exchange assays
(Fig. 3-2D).

50
With reconstituted nucleosomes in hand, we next checked if the integration of
H2A.X-H2B dimer can be facilitated by FACT complex. H2A-containing
nucleosomes were immobilized into streptavidin-conjugated magnetic beads and
incubated with H2A.X-associated complex or purified FACT complex in the
presence of H2A.X-H2B dimers and. We found that both H2A.X-associated
complex and FACT complex significantly facilitate deposition of H2A.X into the
nucleosome, replacing conventional H2A (Fig. 3-2E). To confirm similar action
of FACT complex in vivo, Spt16 was depleted by siRNA directed against Spt16
in 293T cells for 48 hrs. After initial depletion, cells were transfected with
FLAG-H2A.X together with second siRNA treatment to maintain depletion of
Spt16. Chromatin was isolated from siRNA-treated cells and analyzed for
integration of newly expressed FLAG-H2A.X protein. siRNA-treated cells
showed minimal integration of H2A.X into the chromatin (Fig. 3-2F, compare
lane 3 with lane 4). However, some of the newly expressed FLAG- H2A.X was
still integrated in spite of Spt16 depletion due to incomplete knock down of the
Spt16 or the involvement of other histone chaperone proteins such as PP2C
gamma showing H2A-H2B chaperone activity (Kimura et al., 2006) in H2A.X-
H2B dimer integration. Taken together, these results clearly underscore the
critical role of FACT complex in the integration of H2A.X into cellular
chromatin.

We next checked if FACT complex can also facilitate dissociation of H2A.X-
H2B dimer from the nucleosome. H2A.X-containing nucleosomes immobilized
on beads were incubated with H2A.X-associated complex or purified FACT
51

Fig. 3-2. H2A.X-H2B dimer integration by FACT complex
(A) Purification of FACT complex. Spt16and SSRP1 were expressed in Sf9 cells
and affinity purified via the FLAG and His tagged, respectively.
(B) In vitro interaction of Spt16 and SSRP1 with H2A.X. Lane 1, input; lane 2,
normal IgG with Spt16/SSRP1; lane 3, normal IgG and H2A.X with
Spt16/SSRP1/; lane 4, H2A.X antibody with Spt16/SSRP1; lane 5, H2A.X
antibody and H2A.X with Spt16/SSRP1.
(C) Coomassie staining of reconstituted H2A.X-H2B dimer and octamer (regular
and H2A.X containing).
(D) Purification of mononucleosomes. Reconstituted mononucleosomes were
purified through 5-25% glycerol gradient centrifugation. Total 25 fractions (each
200 µl) were collected from the top (#1) to the bottom (#25). 14 to 19 fractions
were mixed and used for histone exchange assays. F indicates free DNA and R /
X represent regular octamer- / H2A.X-containing mononucleosome,
respectively.
(E) H2A.X-H2B dimer integration by FACT complex in vitro.
Mononucleosomes (120 ng) were incubated with FACT complex (1 µg) and
H2A.X-associated complex and H2A.X-H2B dimer integration was detected by
H2A.X antibody after 30 and 60 min reactions.
(F) Inhibition of H2A.X-H2B dimer integration by Spt16 knock-down. Two
consecutive transfection of siSpt16 blocked integration of newly expressed
ectopic H2A.X, whereas non-specific siRNA did not affect FACT activity. Lane
1, non-specific siRNA and pFH-IRESneo; lane 2, siSpt16 and pFH-IRESneo;
52

Fig. 3-2. Continued.

lane 3, non-specific siRNA and pFH-H2A.X-IRESneo; lane 4, siSpt16 and pFH-
H2A.X-IRESneo. Histone H3 was used as loading control.

53

Fig. 3-2. Continued.

A
B
C
D
E F
54
complex in the presence of H2A-H2B dimers. After settling down nucleosomes
attached to beads, supernatant was TCA precipitated to detect free H2A.X
released from nucleosomes. Both FACT complex and H2A.X-associated
complex induced disassociation of H2A.X-H2B dimer from nucleosome (Fig. 3-
3A, compare lanes 3 and 5 with lane 2). A recent study showed that
phosphorylation of H2A.X by DNA damage cause the release of FACT complex
from H2A.X (Du et al., 2006). Therefore, it is also possible that FACT induced
dissociation of H2A.X-H2B dimer from nucleosomes could be inhibited by
phosphorylation of H2A.X. To check this possibility, we first gave
phosphorylations to H2A.X-containing nucleosomes by DNA-PK or DNA-PK
within H2A.X-associated complex (Fig. 3-3B). After phosphorylation,
phosphorylated H2A.X-containing nucleosomes were incubated with FACT
complex and H2A.X-associated complex in the presence of H2A-H2B dimer.
Dissociation of H2A.X-H2B dimer from nucleosomes was dramatically
increased by H2A.X phosphorylation (Fig. 3-3A, compare lanes 3 and 5 with
lanes 4 and 6, respectively). These results implicate that phosphorylation of
H2A.X itself might not induce release of FACT complex from γ-H2A.X-H2B
dimer through change of binding affinity. Indeed, our in vitro interaction assays
between γ-H2A.X and Spt16 or SSRP1 did not show any effect of
phosphorylation of H2A.X on its interaction with Spt16 and SSRP1 (or FACT)
(Fig. 3-3C, compare lane 5 with lane 7). We also checked the effect of H2A.X
phosphorylation for interaction with FACT in vivo. H2A.X proteins were
immunoprecipitated after triggering phosphorylation of H2A.X by treating cells
with Etoposide, and the level of co-immunoprecipitated Spt16 was determined
55
by Western analysis. In contrast to our in vitro results, phosphorylation of
H2A.X significantly inhibited the interaction between Spt16 and H2A.X (Fig. 3-
3D, compare lane 3 with lane 6). A possible explanation for discrepancy between
in vivo versus in vitro is that phosphorylation of H2A.X itself does not inhibit
binding with FACT complex but other factors are required for release of FACT
complex during DNA damage.

Since phosphorylated H2A.X was more easily dissociated from nucleosomes
compared to unmodified H2A.X by FACT complex (Fig. 3-3A), it is also
possible that phosphorylation of H2A.X might alter chromatin structure, which
will in turn facilitate dissociation of H2A.X-H2B dimer. The H2A.X C-terminal
domain is well exposed out of the nucleosomes at the region where the DNA
enters and exits nucleosome. Therefore, it is likely that phosphorylation of
H2A.X could negatively affect the association of DNA with a nucleosome and
the internucleosomal interaction to release chromatin structure. To test this
possibility, we performed micrococcal nuclease (MNase) digestion assay with
nucleosomal arrays reconstituted on 17 copies of nucleosome positioning
sequences. We used histone octamer containing either unmodified H2A.X or
phosphorylated H2A.X to check the effect of phosphorylation of H2A.X.
Interestingly, nucleosomal arrays containing phosphorylated H2A.X were more
easily digested by MNase compared to unmodified H2A.X containing arrays
(Fig. 3-3E, compare lane 3 with lane 6). These results strongly support possible
role of phosphorylation of H2A.X in disrupting chromatin structure. This

56
Fig. 3-3. Phosphorylation effect of H2A.X for H2A.X-H2B dimer
dissociation
(A) Phosphorylation effect on H2A.X-H2B dimer dissociation in vitro. Lane 1,
input; lane 2, negative control, no FACT complex; lane 3, H2A.X containing
mononucleosome with FACT complex; lane 4, γ-H2A.X containing
mononucleosome with FACT complex; lane 5, H2A.X containing
mononucleosome with H2A.X-associated complex; lane 6, γ-H2A.X containing
mononucleosome with H2A.X-associated complex.
(B) Phosphorylation of different substrates. H2A.X (0.5 µg), H2A.X-H2B dimer
(0.5 µg) and H2A.X containing mononucleosomes (120 ng) underwent
phosphorylation by DNA-PK (10 U) or H2A.X-associated complex
supplemented with ATP (10 mM) and phosphorylation was detected by γ-H2A.X
antibody. Lane1, recombinant H2A.X and DNA-PK without ATP; lanes 2, 3 and
4, DNA-PK with H2A.X, H2A.X-H2B dimer and H2A.X containing
mononucleosomes, respectively; lanes 5, 6 and 7, H2A.X-associated complex
with H2A.X, H2A.X-H2B dimer and H2A.X containing mononucleosomes,
respectively.
(C) In vitro interaction of Spt16 and SSRP1 with γ-H2A.X. Lane 1, input; lane 2,
normal IgG with Spt16/SSRP1; lane 3, normal IgG and H2A.X with
Spt16/SSRP1; lane 4, H2A.X antibody with Spt16/SSRP1; lane 5, H2A.X
antibody and H2A.X with Spt16/SSRP1; lane6, normal IgG and γ-H2A.X with
Spt16/SSRP1; lane 7, H2A.X antibody and γ-H2A.X with Spt16/SSRP1.

57
Fig. 3-3. Continued.

(D) Co-immunoprecipitation of Spt16 with H2A.X and γ-H2A.X. Lanes 1 and 4,
input; lanes 2 and 5, nuclear extracts incubated with control IgG; lanes 3 and 6,
nuclear extracts incubated with H2A.X antibody.
(E) Nucleosomal arrays digestion with MNase. M indicates 123 bp DNA ladder.
Lanes 1-3, H2A.X containing nucleosomal arrays digested with 0.2, 0.5 and 1.0
mU MNase; lanes 4-6, γ-H2A.X containing nucleosomal arrays digested with 0.2,
0.5 and 1.0 mU MNase.

58
Fig. 3-3. Continued.

A
B
C
D
E
59
structural change will make the site of DSB to be more accessible by repair
factors.

Upon DNA breakage, prolonged phosphorylation of H2A.X promotes DSB foci
formation and stable association of repair factors at the site of damage
(Fernandez-Capetillo et al., 2004; Pilch et al., 2003). Therefore, it is possible that
phosphorylation of H2A.X acts as a maintenance and amplification mark for
efficient DSB repair. In this regard, dissociation of H2A.X-H2B dimer should be
inhibited during DSB repair. Since PARP1-mediated poly-ribosylation of Spt16
during DNA damage has been identified as a signal to dissociate FACT complex
from H2A-H2B dimer (Huang et al., 2006), and we also found PARP1 as a
component of H2A.X complex from our mass spectrometry results (Fig. 3-1D),
we next checked if PARP1 can down-regulate FACT activity for dissociation of
H2A.X-H2B dimer from nucleosomes. In our in vitro binding assays, we found
that PARP1 can directly interact with H2A.X (Fig. 3-4A and B). We also
confirmed that Spt16 could be highly ribosylated by recombinant PARP1 or
PARP1 in H2A.X-associated complex (Fig. 3-4C). Using this ADP-ribosylated
Spt16, we next checked if ADP-ribosylation of Spt16 has any effect on
dissociation of H2A.X-H2B dimer by FACT complex. FACT-induced
dissociation of H2A.X-H2B dimer from nucleosome was significantly inhibited
by ADP-ribosylation of Spt16 (Fig. 3-4D, compare lanes 3 and 5 with lanes 4
and 6, respectively). These results demonstrate that ADP-ribosylation of a FACT
subunit Spt16 by PARP1 inhibits FACT activity for H2A.X-H2B dimer
dissociation from the nucleosome.
60
Fig. 3-4. Inhibition of H2A.X-H2B dimer dissociation through Spt16
modification by PARP1
(A) Purification of PARP1. PARP1 was expressed in Sf9 cells and affinity
purified via the FLAG and His tagged, respectively.
(B) In vitro interaction of PARP1 with H2A.X. Lane 1, input; lane 2, normal IgG
with PARP1; lane 3, normal IgG and H2A.X with PARP1; lane 4, H2A.X
antibody with PARP1; lane 5, H2A.X antibody and H2A.X with PARP1
(C) In vitro ribosylation of Spt16 by PARP1. Lane 1, Spt16 and PARP1 without
NAD
+
; lanes 2, Spt16 and PARP1 with NAD
+
; lanes 3, H2A.X-associated
complex without NAD
+
; lanes 4, H2A.X-associated complex with NAD
+
.
(D) Inhibition of H2A.X-H2B dimer dissociation by PARP1. ADP-ribosylated
Spt16 by PARP1 in the presence of NAD
+
led to release FACT complex from
nucleosomes resulting in inhibition of dimer dissociation. Calf thymus DNA was
used to activate PARP1. Lane 1, input; lane 2, negative control, no FACT
complex; lane 3, FACT complex without ribosylation of Spt16; lane 4, FACT
complex with ribosylation of Spt16; lane 5, H2A.X-associated complex without
ribosylation of Spt16; lane 6, H2A.X-associated complex with ribosylation of
Spt16.
(E) Occupancy of Spt16 and PARP1 on the chromatin during DNA damage.
Crosslinked, sheared chromatin from HeLa cells treated with or without 100 µM
Etoposide (2 and 6 hrs) was immunoprecipitated with the indicated antibodies.
(F) Degradation of PARP1 during prolonged DNA damage. Cleaved fragment of
PARP1 was detected after 6 hrs treatment of Etoposide by using PARP1
antibody.
61
Fig. 3-4. Continued.

A
B
C
D
E
F
62
To check the cooperative functions of FACT and PARP1 in DSB repair, we
performed chromatin immunoprecipitation assays after treating cells with
Etoposide with different durations. We confirmed that p21 gene was occupied by
both Spt16 and PARP1 0 time point. After 2 hrs treatment, the occupancy of
Spt16 in p21 gene was decreased, probably due to ribosylation of Spt16, but the
same level of PARP1 was located at p21 gene. This result implies that ADP-
ribosylation of Spt16 indeed causes dissociation of Spt16 from p21 gene. (Fig. 3-
4E, second panel, lane 2). However, with prolonged treatment of cell with
Etoposide, chromatin was reoccupied by Spt16 (Fig. 3-4E, second panel, lane 3),
while PARP1 occupancy was significantly reduced (Fig. 3-4E, third panel, lane
3). These results are consistent with recent finding that activated PARP1
undergoes autoribosylation to get dissociated from the chromatin (Kim et al.,
2004). Another possibility is that prolonged DNA damage induced by Etoposide
activates caspase activity which results in PARP1 degradation (Bell et al., 2001).
Indeed, we observed degraded form of PARP1 after 6 hrs Etoposide treatment
(Fig. 3-4F, fifth panel, lane 3). Taken together, these results suggest that
presence of phosphorylated H2A.X on the chromatin is stabilized at the early
stage of DNA damage via dissociation of FACT complex by PARP1 induced
ADP-ribosylation of Spt16.

In this report, we purified H2A.X-associated complex from HeLa cells and
identified its function in H2A.X-H2B dimer exchanges for integration and
dissociation of H2A.X within nucleosomes. This exchanging activity is mediated
by one of H2A.X-associated complex, Spt16/SSRP1, also known as FACT
63
complex. We demonstrated that FACT-induced H2A.X-H2B dimer exchanges
can be regulated by PARP1 during DSB repair process. Based on these results,
we propose a model for steps involved in actions of H2A.X during DSB repair
process (Fig. 3-5). Initially, FACT complex is associated with H2A.X and
facilitates a continuous exchange between H2A-H2B and H2A.X-H2B dimers.
Upon DNA damage, nucleosomal H2A.X undergoes localized phosphorylation
and induces conformational change of chromatin. This structural alteration then
facilitates recruitment of repair factors. This H2A.X phosphorylation induced
structural change of chromatin also facilitates dissociation of H2A.X-H2B dimer
from the nucleosome by FACT complex in our assays, while stable association
of phosphorylated H2A.X on the chromosome is required for DSB repair system.
Most importantly, this stable localization of phosphorylated H2A.X can be
maintained through Spt16 ribosylation by activated PAPR1, which removes
FACT complex from phosphorylated H2A.X-H2B dimer. Accordingly,
phosphorylated H2A.X recruits histone modifying factors such as NuA4, INO80,
and Tip60 complexes (Downs et al., 2004; van Attikum et al., 2004) to facilitate
DSB repair through further structural changes of chromatin. After repairing
damaged DNA, phosphorylated H2A.X can be replaced with unmodified H2A.X
or H2A by FACT complex and/or other remodeling activities such as Tip60
complex (Kusch et al., 2004). Although it has not been elucidated that
phosphorylation of H2A.X is removed after dissociation from nucleosome in
human, these removed γ-H2A.Xs may get dephosphorylated by Protein
Phosphatase 2A (PP2A) (Chowdhury et al., 2005) and recycle H2A.X.

64
Fig. 3-5. Model for steps involved in action of H2A.X during DSB repair
process
Upon DNA damage, nucleosomal H2A.X integrated by FACT complex
undergoes phosphorylation by ATM, ATR or DNA-PK. These phosphorylations
concerted with other modifications change chromatin structure facilitating
recruitment repair factors. Spt16 ribosylation by activated PARP1 stimulates
release of FACT complex from nucleosome to stabilize localization of H2A.X
during DNA repair process.

65
MATERIALS AND METHODS

Plasmids. cDNA sequence encoding human H2A.X was PCR amplified by use
of a 5’primer (TAAGCTAGCATGTCGGGCCGCGGCAA), which introduced
NheI site, and a 3’ primer (TAAGGATCCTGTACTCCTGGGAGGC), which
introduced BamHI site. The PCR products were digested with NheI-BamHI and
ligated into NheI and BamHI sites of pIRES containing FLAG and HA tags to
generate the plasmid (pFH-H2A.X-IRESneo) for mammalian expression of
H2A.X.

Purification and identification of H2A.X-associated proteins. HeLa cells
were transfected with pFH-H2A.X-IRESneo by using Lipofectamine
(Invitrogen) and selected with G418 (500 µg/ml) for 2 weeks. Colonies stably
expressing FH-H2A.X were grown in spinner culture in DME-phosphate (Irvine
Scientific) supplemented with 10% bovine calf serum (BCS). Nuclear extracts
were prepared as described (Malik and Roeder, 2003). For purification of
H2A.X-associated complex, nuclear extracts (300 mg) were fractionated through
Phosphocellulose P11 column (Whatman). The P11 BC800 and BC1200
fractions containing expressed H2A.X were dialyzed against BC300 and applied
to M2 agarose affinity chromatography (Sigma). After extensive washings with
BC300 containing 0.1% NP-40, H2A.X-associated complex were eluted from
M2-agarose by using FLAG peptide (200 ng/µl). Expression and purification of
ectopic H2A.X were confirmed by Western blot using both FLAG (Sigma) and
HA (Santa Cruz Biotechnology) antibodies. The purified H2A.X-associated
66
complex was analyzed by Mass spectrometry. Antibodies employed in Western
blot analysis were as follows: Spt16 and SSRP1 antibodies were from Santa
Cruz Biotechnology; Lamin-A/C antibody was from Sigma; α-Tubulin antibody
was from Cell Signaling Technology; PARP1 antibody was from Abcam; Tip60
antibody was from Upstate; DNA-PK and Ku antibodies were kindly provided
by Dr. Lieber.

Fluorescence microscopy. Immunofluorescence staining was performed as
described previously (Yang et al., 2006). HeLa cells stably expressing FH-
H2A.X were plated on coverglass (VWR) and stained with FLAG antibody
followed by staining with Cy3-conjugated secondary antibody (Jackson
ImmunoResearch Inc.). Localization of ectopically expressed H2A.X was
determined under fluorescence microscopy (Zeiss).

Preparation of H2A.X-H2B dimer, H2A.X containing octamer and
reconstitution of mononucleosome. 6xHis-H2A.X (pET15b-H2A.X) was
expressed in bacteria. After two step purification with Ni
+
-NTA and SP-
sepharose column (eluted with BC600), 6xHis tag was removed from purified
H2A.X by using Thrombin Cleavage Capture Kit (Novagen). Lyophilized
H2A.X and other histones were dissolved in 8 M guanidium solution by rotating
at RT for 2 hrs and combined (for dimer and octamer). After refolding of dimer
and octamer, these refolded histones were passed through Sephacryl S300
column (GE healthcare) to remove unfolded histones. Purified histone octamers
(regular and H2A.X-containing) and 5’ biotinylated 207 bp DNA fragments were
67
reconstituted into mononucleosomes by using conventional salt dialysis method
(Hamiche et al., 1999) and further purified by glycerol gradient centrifugation to
remove free DNAs and unfolded histones.

Preparation of recombinant FACT and PARP1. Recombinant FACT and
PARP1 were prepared as described (Li et al., 2004; Orphanides et al., 1999).
Baculoviruses for FACT (hSPT16, hSSRP1) and hPARP1 were kindly provided
by Drs. Reinberg and Comai, respectively.

Pull-down and co-immunoprecipitation assays. For in vitro pull-down assays,
recombinant H2A.X (1 µg) was incubated with purified Spt16, SSRP1, and
PARP1 (1 µg each) in the presence or absence of H2A.X antibody (Upstate
Biotechnology) and protein A/G agarose (Santa Cruz Biotechnology). After
washing (150 mM NaCl, 25 mM HEPES, 10% glycerol, 0.05% NP-40), bound
proteins were analyzed by immunoblot with anti-Spt16, SSRP1 and PARP1
antibodies. For co-immunoprecipitation assays, nuclear extracts of HeLa cells
were immunoprecipitated by H2A.X antibody or control IgG and protein A/G
after 2 hrs treatment of Etoposide (Sigma) or without treatment and analyzed by
immunoblot using Spt16 antibody.

Histone exchange assays. Standard histone exchange assays were performed as
described (Mizuguchi et al., 2004) with some modification. Briefly, for
integration assay, regular mononucleosomes (120 ng) were incubated with
H2A.X-H2B dimer (0.5 µg) in the presence or absence with FACT and H2A.X-
68
associated complex in reaction buffer (25 mM HEPES (pH7.6), 0.37mM EDTA,
0.35 mM EGTA, 5 mM MgCl
2
, 1 mM DTT, 70 mM KCl, 10% glycerol, 0.02%
NP-40, and 0.1 mg/ml BSA) for 60 min at 30
o
C and then immobilized into
streptavidin-conjugated Dynabeads (Dynal). After three times washing,
nucleosomal incorporation of H2A.X was checked by immunoblot using H2A.X
antibody. For dissociation assays, the same protocol was used except that
H2A.X-containing mononucleosomes were used.

RNAi for Spt16 depletion. siRNA for Spt16 was purchased from Santa Cruz
Biotechnology. 2X10
5
293T cells were plated on 6 well plates 24 hrs before
transfection. siSpt16 was transfected by using siPORT NeoFX (Ambion). Cells
pre-depleted Spt16 for 48 hrs were again transfected siSpt16 and f: H2A.X. 48
hrs post transfection, chromatin was isolated as previously described (Wysocka
et al., 2001) and f: H2A.X was detected by FLAG antibody.

Kinase and ADP-ribosylation assays. DNA-PK

(Promega) and H2A.X-
associated complex were mixed with recombinant H2A.X or H2A.X-H2B dimer
and H2A.X-containing mononucleosome in the presence of calf thymus DNA
(Invitrogen) and ATP (10 mM) in kinase buffer (50 mM Tris-HCl (pH7.5), 20
mM EGTA, 10 mM MgCl
2
, 1 mM DTT, and 1mM beta-glycerophosphate).
Reactions were incubated at 30°C for 30 min. Phosphorylation was determined
by using γ-H2A.X antibody (Abcam). Purified recombinant Spt16 (0.5 µg) were
incubated with PARP1 (0.5 µg) in the presence of calf thymus DNA in ADP-
ribosylation buffer (10 mM Tris-HCl (pH7.5), 1 mM MgCl
2
, 1 mM DTT) at
69
37°C for 5 min. The ADP-ribosylation reactions were started by adding NAD
+

(400 µM) and incubated at 37°C for 15 more minutes.

MNase digestion. For MNase digestion, nucleosomal arrays were reconstituted
with H2A.X containing octamer and 17mer Widom’s DNA template which has
17 repeated histone positioning sequences by salt dialysis (Hamiche et al., 1999).
The reconstituted nucleosomal arrays (2 µg) containing unmodified H2A.X and
γ-H2A.X were digested with 0.2, 0.5, 1.0 mU of micrococcal nuclease (Sigma)
for 4 min at room temperature in HEG buffer (25 mM HEPES (pH 7.6), 0.1 mM
EDTA, 10% glycerol) containing 2 mM CaCl
2
. Reactions were terminated by
adding stop solution (20 mM EDTA, 200 mM NaCl, 1% SDS, 0.25 mg/ml
glycogen), incubated with proteinase K at 37 °C for 1hr and then extracted with
organic solvent. The DNA was precipitated and resuspended in TE (pH 8.0).
Samples of the various MNase digests were analyzed by electrophoresis in 1%
(w/v) agarose gels.

Chromatin Immunoprecipitation assays. ChIP assays were performed as
described previously (Kim et al., 2003). HeLa cells were treated with 100 µM
Etoposide to give DNA damage. Then, cells were collected with different times
(0, 2, and 6 hrs). Primers used for PCR were from the p21 p53 response element
region (5 ′ primer, 5 ′-TGACATTGTTCCCAGCAC-3 ′; 3 ′ primer, 5 ′-
TACCATCCCCTTCCTCAC-3 ′).

70
CHAPTER 4: Involvement of Niemann-Pick Type C2 Protein in
Hematopoiesis Regulation

INTRODUCTION

Hematopoietic stem cells (HSC) reside in bone marrow, can renew themselves,
differentiate into various specialized cells, and undergo programmed cell death.
Murine HSCs consist of long term reconstituting (LTR) cells and short term
reconstituting (STR) cells based on their repopulation abilities in lethally
irradiated animals (Qiu et al., 2006). When studying the gene expression profile
of HSC subsets using DD-PCR and microarrays (Jiang F. Zhong, 2005), NPC2
protein and its receptor, mannose 6-phosphate receptor (MPR)/ insulin-like
growth factor II receptor (IGFII-R), were found to be highly expressed in both
LTR and STR HSC subsets.
Niemann-Pick Type C2 (NPC2) protein, originally named epididymic secretory
protein (ESP), is a small glycoprotein secreted by the epididymis (Nakamura et
al., 2000). Porcine NPC2 protein is known as a major cholesterol binding protein
in the epididymal fluid, which facilitates the maturation of sperm (Okamura et al.,
1999). Recently, mutations of the human NPC2 gene were linked to NPC disease,
an inherited autosomal recessive lipid storage disorder, characterized
biochemically by cellular cholesterol and glycolipid accumulation (Naureckiene
et al., 2000).
71
Upon glycosylation with mannose, NPC2 protein can bind with MPR.
Classically, MPR is considered to be a transport protein that diverts newly
synthesized lysosomal enzymes from the secretory pathway to the
endolysosomal system. However, recent studies suggest that MPR can interact
with other proteins and play various roles. For example, the local level of IGF-II
and the activity of transforming growth factor (TGF)- β1 can be modified by
MPR (Ghosh et al., 2003). Studies of gain and loss of MPR function suggest that
MPR might be a putative tumor suppressor gene: overexpression of MPR results
in growth inhibition while deletion of MPR accelerates progression of
tumorigenesis (O'Gorman et al., 2002; Zaina and Squire, 1998). Furthermore,
MPR-mediated internalization of granzyme B can induce apoptosis in cytotoxic
T lymphocytes (Motyka et al., 2000).
The high level of expression of NPC2 and its receptor in HSC suggest that these
proteins may play a role in the regulation of hematopoiesis. Our initial studies,
done at the standard oxygen level of around 20%, were negative. However,
when the studies were repeated at 7%, the physiological oxygen level of bone
marrow, NPC2 was shown to play an active role in the hematopoietic process.

RESULTS

Murine NPC2 protein expression, purification, and characterization. NPC2
mRNA and protein levels in murine hematopoietic stem cell subsets and bone
marrow cells were detected by RT-PCR (Fig. 4-1A, left panel) and western blot
72

Fig. 4-1. NPC2 protein expression, purification and characterization
(A) RT-PCR (left panel): negative control (lane 1); mRNA from Lin
-
Sca
+
Kit
+
CD34
+
CD38
-
cells (lane 2),

Lin
-
Sca
+
Kit
+
CD34
+
CD38
+
cells (lane 3), and
Lin
-
Sca
+
Kit
+
CD34
-
CD38
+
cells (lane 4), respectively. PCR was performed with
this primer set; Forward 5’-ATGCGTTTTCTGGCCGCCACG-3’ and Reverse
5’-GCTTGTGATCTGAACTGGGATCTC-3’ (450 bp). HPRT gene was used as
internal control. Western blot of NPC2 protein (right panel): secreted NPC2
protein in the medium from 293T cells (lane 1); NPC2 protein in whole bone
marrow cells (lane 2) and Lin
-
Sca
+
cells(lane 3), respectively. NPC2 from 293T
supernatant shows slower migration due to glycosylation. After treatment with
deglycosidase (PNGase F), the NPC2 from 293T supernatants migrates at the
same position as that isolated from the bone marrow (data not shown). Arrow
indicates 16 KDa molecular weight.
(B) Silver staining of an SDS-polyacrylamide gel containing purified
recombinant NPC2 protein. 10 and 20 µg of purified NPC2 protein were loaded
in lanes 1 and 2, respectively.
(C) Filipin staining: NPC2 fibroblasts accumulate intracellular cholesterol which
is stained by Filipin (upper panel). In the presence of NPC2 protein, the defect is
corrected and the cells do not accumulate cholesterol as shown by the absence of
Filipin staining (lower panel).

73
Fig. 4-1. Continued.

A
B C
74
(Fig. 4-1B, right panel). Secreted NPC2 protein from 293T cells was purified and
the purity was determined with silver staining, as shown in figure 4-1B. To
examine the cholesterol-binding activity of the protein, Filipin staining was
performed. Functional NPC2 protein can rescue the mutant NPC2 fibroblasts
from intracellular cholesterol accumulation, resulting in the decrease of
intracellular Filipin staining. The intensity of Filipin staining is significantly
decreased in NPC2 fibroblasts treated with NPC2, thereby indicating that the
purified NPC2 protein retains active cholesterol binding ability and prevents
intracellular cholesterol accumulation in the cell line (Fig. 4-1C).

Effect of NPC2 protein in hematopoietic CFC assays. CFC assays were used
to examine whether NPC2 protein plays a role in the process of hematopoiesis.
When the assays were performed in normal air oxygen (~20 %), no effect was
seen. However, when the assays were repeated at the physiological oxygen
concentration of bone marrow, 7%, the results shown in figure 4-2A were
obtained. The plates with NPC2 protein gave 35 % more CFU-GEMM colonies,
and 25 % less CFU-GM colonies compared with control plates. Besides the shift
in colony type and number, most of the CFU-GEMM colonies in plates with
NPC2 were high potential proliferation (HPP) colonies, as the diameter of most
these colonies was larger than 0.5 mm, while the CFU-GEMM colonies in
control plates were significantly smaller (Fig. 4-2B). The BFU-E colony number
in these assays was less than 5, and there was no significant difference between
control and NPC2 treated groups.

75
Fig. 4-2. NPC2 effects in CFC assays
(A) NPC2 results in shift of colony type in CFC assay. 500 Lin
-
Sca
+
Kit
+
cells
were cultured in the presence of SCF, EPO, and TPO under 7 % oxygen
condition. Compared with control plate, there are more CFU-GEMM colonies
and less CFU-GM colonies when 1 µg/ml of purified NPC2 protein is added to
the plate. Results are a summary of three individual experiments with a total of
six samples. (* P<0.05)
(B) Colony size changes after NPC2 treatment. Arrow indicates HPP colonies.
(C) Table shows the summary of colony phenotype in CFC assay. (
$
: colonies
with diameter > 0.5mm;
$$
: colonies with diameter < 0.5mm; *: p<0.05, **:
p<0.001)

A
B
C
C
76
Since different cytokines and growth factors play different roles in
hematopoiesis regulation, to determine if the effects of NPC2 protein in the CFC
assay are growth factor/cytokine specific, CFC assays were performed with
different growth factor/cytokine combinations. In the experiment, both SCF and
EPO were kept constant with a third factor added (100 ng/plate): TPO,
interleukin (IL)-3, IL-6, IL-11 or Flt-3 ligand. The NPC2 protein resulted in an
increase of CFU-GEMM colony number and size only when TPO was present in
the assay system (Table), and not with any other tested factors.

NPC2 protein function in hematopoiesis is independent of cholesterol
binding activity, but dependent on M6P receptor. Since NPC2 is known to be
a cholesterol-binding protein, we used different NPC2 mutant proteins to
determine if the observed NPC2 effects on hematopoiesis depend on the
protein’s cholesterol-binding activity (Ko et al., 2003). Plasmids containing the
gene for four different mutant proteins were kindly provided by Drs. M.P. Scott
and D.C. Ko (Stanford University, Stanford, CA). The mutant proteins were
expressed, purified and their cholesterol-binding activities were determined with
Filipin staining. F66A and V96F are mutants with abolished cholesterol-binding
activity, whereas D72A and D75A are mutants with normal cholesterol binding
activity. In the CFC assays, all four of the mutant proteins showed the same
effects as the wild type protein: increased CFU-GEMM colony number and size,
strongly suggesting that the effects of NPC2 protein on hematopoiesis are
independent of its cholesterol binding activity (Fig. 4-3A).

77

Table. Effects of growth factors on NPC2 protein function

78

Fig. 4-3. NPC2 function relies on MPR but is independent of cholesterol
binding
(A) Effects of different mutant NPC2 proteins in the CFC assay. Wild type and
mutant NPC2 proteins (1 µg) were added in the CFC assay in the presence of
SCF, EPO and TPO under 7% oxygen. Mutants D72A and D75A retain
cholesterol-binding activity; F66A andV96F are defective in cholesterol binding.
There is no significant difference in colony number and type between wild type
NPC2 protein and mutant proteins. Both wild type and mutant proteins induce
significant colony type shift compared with control plates. Results are a
summary of two individual experiments with a total of four samples.
(B) M6P inhibits NPC2 function. The NPC2-dependent colony type shift is
reversed by M6P in a dose dependant manner. There is no change in total colony
numbers. 1 µg NPC2 and different doses of M6P were used. (* P<0.05, N: NPC2,
M: M6P (mM))

79
Fig. 4-3. Continued.

A
B
80
Next we determined if mannose 6-phosphate (M6P) could block the effects of
NPC2 protein via MPR. As shown in figure 4-3B, increased CFU-GEMM and
decreased CFU-GM colony numbers are gradually diminished as increased
amounts of M6P (1 mM to 7 mM) are added to the assay system. In the absence
of NPC2 protein, M6P (5 mM) itself does not show any effect (Fig. 5-3B),
suggesting that NPC2 plays its role via MPR.

NPC2 protein regulates survival and differentiation in MO7e cells. To
determine if NPC2 promotes MO7e cell survival via inhibiting apoptosis, the
Annexin V staining assay was used. After 4 days culture with 7 % oxygen,
apoptosis was induced by switching cells to serum-free medium for 4 hours.
Cells were then collected to determine the percentage of apoptotic cells. As
shown in figure 4-4A and B, there were significantly fewer apoptotic cells in
TPO-plus-NPC2-treated cells than TPO-only-treated cells (30.9 % vs. 39.4 %,
P=0.00235). Next, the effect of NPC2 protein on cell proliferation was
determined. After 24 hours serum starvation, MO7e cells were cultured with
TPO only or TPO plus NPC2 protein at both 7 % and 20 % oxygen conditions.
As shown in figure 4-4B, there was no significant cell proliferation difference
under either condition for the first 5 days. However, at day 10, under 7% oxygen,
the viable cell number declined in the TPO only condition, while there was still a
slight increase in the TPO plus NPC2 condition. The difference in the total
viable cell number at 10 days was significant (2.1 vs. 1.7×10
6
,

P=0.022). These
results suggest that NPC2 protein, together with TPO, may play roles in MO7e
cell survival, but have less effect on cell proliferation.
81

Fig. 4-4. Anti-apoptosis effect of NPC2 protein in MO7e cells
(A) After 4 days culture in the presence of either TPO alone or TPO with NPC2
protein, MO7e cells were switched to serum-free medium for 4 hrs to induce
apoptosis, followed by Annexin V staining to determine the percent of apoptotic
cells by FACS analysis (* P=0.00235).
(B) MO7e cell proliferation and survival curve. 24 hr serum-starved cells were
transferred into 24 well plates and cultured under various conditions (no
treatment: control, NPC2 only: 0.5 µg/ml, TPO only: 10 ng/ml, and NPC2 plus
TPO: 0.5 µg/ml and 10 ng/ml respectively). Cell number was determined every
24 hrs using a hemacytometer with trypan blue staining. Results are a summary
of two individual experiments with total of six samples (* P=0.022).

A
B
82
Since NPC2 protein results in more CFU-GEMM in the CFC assay, an indication
of a possible anti-differentiation effect, we tested if NPC2 protein can play a
similar role with MO7e cells. As determined by the appearance of CD41
expression on cell surface, MO7e cells undergo partial megakaryocyte (MK)
differentiation when cultured in the presence of TPO (Hirai et al., 1997). 10
4
cells were mixed with methylcellulose in the presence of SCF and TPO (100
ng/ml each) under 7 % oxygen conditions. After 7 days culture, we observed a
difference in colony phenotype: most of the colonies in the NPC2-treated plates
were more condensed with cells in high density, while colonies in the control
plates were more diffuse with cells at a low density (Fig. 4-5A). These cells were
recovered and stained with anti-CD41 antibody. There were fewer CD41
+
cells
from NPC2-treated plates compared with plates without NPC2 protein (Fig. 4-5B,
4.99 % vs. 8.85 %, P=0.0319). NPC2 mutants (both cholesterol-binding-
defective and non-defective mutants) showed the same effects as wild type
protein (data not shown). These results suggest that NPC2 may have an anti-
differentiation effect in MO7e cells, and that these effects are independent of
cholesterol-binding activity.

HIF-1 α is up-regulated by NPC2 protein in MO7e cells. All results showing
NPC2 effects in hematopoiesis were obtained under the condition of 7% O
2
,the
oxygen level of bone marrow, but not under normal oxygen levels (~20 % O
2
).
This observation led us to examine whether NPC2 might also modulate HIF-1 α
(hypoxia inducible factor I) expression in MO7e cells. MO7e cells were
collected at 4, 8 and 12 hrs of growth in medium with TPO or TPO/NPC2
83

Fig. 4-5. Anti-differentiation effect of NPC2 in MO7e cells
(A) NPC2 induces MO7e colony phenotype change. At day 7, in the presence
of NPC2, MO7e cells made more compacted colonies, whereas MO7e cells
without NPC2 made more diffuse colonies. Top penal: low magnification 4×;
lower penal: high magnification 10×.
(B) NPC2 inhibits TPO-induced differentiation. MO7e cells were stained with
anti-CD41 antibody, and analyzed with FACS to measure CD 41

expression.
Results are a summary of two individual experiments with total of six samples (*
P=0.0319).

A
B
84

Fig. 4-6. NPC2 up-regulates HIF-1 α level in MO7e cells
Western blot analysis assessing changes of HIF-1 α protein level with or without
NPC2 protein in MO7e cells at different times. Results are representative of
three individual experiments. Oxygen level was 7%. ARNT (aryl hydrocarbon
receptor nuclear translocator): a binding partner of HIF-1 α expressed
constitutively was used as loading control. Density of band was determined by
using Quantity one (BIO-RAD, Hercules, CA).

85
protein to detect HIF-1 α protein by western blot. There was no change in HIF-1 α
protein level under 20 % oxygen. However, under 7 % oxygen, we observed an
increase of HIF-1 α at 8 and 12 hrs. Cells with TPO and NPC2 protein showed a
higher HIF-1 α level compared to cells with TPO only (Fig. 4-6).

DISCUSSION
The high expression of NPC2 protein and its receptor, MPR, in HSC led us to
study their potential function in hematopoiesis. Using in vitro colony assays, we
showed that NPC2 could shift the colony type in the CFC assay: increasing early
progenitor cell colony formation (CFU-GEMM) at the expense of later
progenitor cell colony formation (CFU-GM). This observation only occurred at
the oxygen level of bone marrow (7 %), with no effect being seen in air (~20 %
oxygen). Further study also showed that NPC2’s effect occurs specifically in the
presence of TPO in the assay system, since NPC2 did not show any effect when
TPO is replaced by IL-3, IL-6, or Flt-3 ligand, factors commonly used in CFC
assays. This observation suggests that NPC2 may play its role by influencing the
TPO/Mpl system. If NPC2 functions via a general mechanism such as by
influencing cholesterol content in the cell, its effect should be observed when
TPO is replaced by other factors.
NPC2 has been characterized as a cholesterol-binding protein. Cholesterol is an
important biological molecule with multiple functions, including modifying the
permeability and fluidity of lipid membranes, serving as a precursor for steroid
hormone and bile acid synthesis, and modifying proteins by covalent binding in
86
the lipid membrane (Alpy et al., 2001). It has been known that NPC1, a
transmembrane protein, can alter certain signaling pathways through modulating
the cell surface lipid content by binding with lipid rafts, which is a cholesterol-
rich region on cell membranes. (Lusa et al., 2001). It has been reported that lipid
rafts are important for the function of some growth factors, such as FGF2 and
TNF (Cottin et al., 2002; Ridyard and Robbins, 2003). We first attempted to
examine if both NPC2 and Mpl are located in lipid rafts, which might suggest
that the function of the TPO/Mpl system may be facilitated by the presence of
NPC2 protein. However, we could detect neither NPC2 nor Mpl in lipid raft
fractions (data not shown).
Further experiments demonstrated that the NPC2 function is independent of
cholesterol- binding activity, as shown in figure 4-3A. NPC2 mutants, whether
maintaining cholesterol- binding activity or not, can function as well as wild type
protein in the CFC assay (Fig. 4-2A). Thus, NPC2 effects on HSC are not
dependent on cholesterol-binding activity.
Next, we did experiments to determine if NPC2 protein functions via MPR. It
has been demonstrated that M6P can block the NPC2 effect in NPC2 mutant
fibroblasts.
5
. Similar results were obtained in the CFC assay: M6P shows dose-
dependent inhibitory effects on NPC2 function (Fig. 4-3B). These results suggest
that the binding of NPC2 with MPR is not simply related to cholesterol traffic,
but rather that some other unknown mechanism leads to the effect in the CFC
system. In fact, although MPR is traditionally considered as a protein which
transports other molecules between the cell surface and cytoplasmic organelles,
87
recent studies have suggested that MPR is involved in many other cell
physiological functions. It regulates the leukemia inhibitory factor (LIF) function
via internalization and degradation; and it regulates cytokine-induced receptor
dimerization following signal transduction pathways, such as IL-6, IL-11,
oncostatin M (OSM), ciliary neutrophic factor (CNTF), and cardiotrophin-1 (CT-
1) (Cullinan et al., 1996; Gearing, 1993; Kellokumpu-Lehtinen et al., 1996;
Stewart et al., 1992). In addition, MPR regulates intracellular growth factor level,
such as IGF-II, TGF-ß1. Impaired MPR leads to disease due to excessive
accumulation of IGF-II or TGF-β1
6
. It has also been reported that granzyme B, a
serine proteinase, is internalized into the cell upon binding to MPR, and released
in the cytoplasm to regulate apoptosis (Motyka et al., 2000).
How NPC2 functions in HSC regulation is unknown. One speculation is that
upon binding and internalization via MPR, NPC2 is released into the cytoplasm
and interacts with other molecules to regulate HSC. Recently it was
demonstrated that NPC2 interacts with dehydrodolichyl diphosphate synthase
(DedolPP), which is involved in the regulation of dolichol biosynthesis (Kharel
et al., 2004). This finding opens the possibility that NPC2 may have different
binding partners in the cytoplasm to perform different functions. By
immunofluorescence staining, we also observed exogenous NPC2 protein can
accumulate in the nucleus (data not shown). We plan to examine whether NPC2
protein may play a role in transcriptional regulation or in the transportation of
other molecules between the nucleus and cytoplasm.
88
It has been reported that TPO induces cell differentiation, TPO also shows an
anti-apoptosis function (Sigurjonsson et al., 2004). In both HSC (Lin
-
Sca
+
Kit
+
)
and MO7e cells, NPC2 plays a role in cell differentiation and apoptosis. When
NPC2 is present with TPO, we observed increased CFU-GEMM in the CFC
assay (Fig. 4-2) and decreased CD41
+
cells in MO7e culture (Fig. 4-5B). These
data suggest NPC2 may inhibit TPO-induced differentiation. In addition, NPC2
increases the TPO-mediated anti-apoptosis effect (Fig. 4-4A and B). Since
MAPK and/or PI3K/Akt signaling pathways are important for cell survival and
apoptosis regulation, protein phosphorylation of signaling molecules such as
JAK2, STAT3, STAT5, p38, and ERK1/2 were examined in normal oxygen
conditions. There was no significant difference in protein phosphorylation
between NPC2/TPO- treated and TPO- treated cells under these conditions (data
not shown). We could not perform the same experiment under 7 % oxygen
because protein phosphorylation occurs very rapidly and we did not have
apparatus available to carry out the experiment in low oxygen. However,
considering that all NPC2 effects on hematopoiesis were observed under low
oxygen conditions, it is possible that NPC2-regulated phosphorylation might also
occur in HSC under low oxygen.
Following this line of thinking, we tested the hypothesis that NPC2 may affect
molecules regulated by oxygen level. HIF-1 α is one of the best-studied proteins
with such a property. By regulating its target genes, HIF-1 α is involved in
multiple cellular functions, including cell survival, proliferation and
differentiation via multiple factors such as VEGF, EPO, IGF2 and NIX
(Semenza, 2003). Figure 4-6 shows the TPO and NPC2 effect on the HIF-1 α
89
protein level: NPC2 can up-regulate HIF-1 α under 7 % oxygen. Since other
HIF-1α stimulatory factors, such as VEGF and EPO, stimulate HIF-1 α via
PI3K/Akt signaling pathway (Semenza, 2003), TPO may also function by the
same mechanism under low oxygen conditions. Recently, it has been reported
that by stabilizing HIF-1 α protein, TPO enhances VEGF expression in
HSC(Kirito et al., 2005). NPC2 may play its role together with TPO in
influencing HIF-1 α level in HSC. It remains to be determined if NPC2 functions
via the TPO signaling pathway.
NPC2 is a cholesterol binding protein related to neuron-degenerative disease.
Our report is the first to show the involvement of NPC2 protein in hematopoiesis.
Further more, our data demonstrates that NPC2 functions via TPO/Mpl system
on 7% oxygen. Because of the high expression of endogenous NPC2 protein, the
observed effects from the exogenous NPC2 in our experimental system are not
dramatic, but show the exogenous NPC2 mediated effects are statistically
significant. In NPC2 patients, the major pathological change occurs in the
nervous system. The lack of a hematopoietic phenotype in NPC2 disease may be
from the existence of other molecules that can compensate for the loss of
functional NPC2 protein. A similar observation is seen in the TPO/Mpl knock-
out mice: normal platelets are produced in these animals suggesting a
compensatory mechanism(Bunting et al., 1997). Our study suggests that NPC2
may function in hematopoietic tissue differently than in the central nervous
system.

90
MATERIALS AND METHODS

Mice and progenitor cell isolation. C57 BL/6J (Ly5.2) female mice were
obtained from the Jackson Laboratory (Bar Harbor, ME) and the animal facility
at the University of Southern California (USC, Los Angeles, CA). All animals
were housed under specific pathogen-free conditions, given acidified drinking
water and autoclaved chow ad libitum. Mice used in the experiments were 8 to
12 weeks of age. The study protocol was approved by the USC Animal Care and
Use Committee. Stem and progenitor cells were isolated as previously described
(Qiu et al., 2006).

Cell culture and Filipin staining. 293T cells were cultured as previously
described (Daino et al., 2000). MO7e cells were obtained from Wyeth (Madison,
NJ), and were maintained in DMEM plus 10 % FBS, 2 mM glutamine, and 2
ng/ml GM-CSF (R & D System, Minneapolis, MN) (Ritchie et al., 1996) in a
tissue culture incubator at 37
o
C, 10 % CO
2
, and 20 % O
2
. For the apoptosis and
differentiation assays, MO7e cells were serum-starved for 18 to 20 hrs in DMEM
supplemented with 1 % bovine serum albumin (BSA). NPC2 fibroblast cells,
which have a mutant NPC2 gene and accumulate large amounts of intracellular
cholesterol, were obtained from Dr. D.S. Ory (Frolov et al., 2001) (Washington
University. St. Louis, MJ). They were cultured in chamber slides (Nalge Nunc
International, Rochester, NY) at a density of 1.5×10
4
/chamber. The following
day, fresh medium was added in the presence or absence of NPC2 protein
(10µg/ml). 3 days later, cells were washed with PBS and fixed in 10 % formalin
91
for 1hr at room temperature (RT). Then intracellular cholesterol was stained with
Filipin (freshly made in DMSO and used at a final concentration of 50µg/ml) for
1hr at RT. After 4 washes with PBS, Filipin fluorescence was detected by
fluorescence microscopy using Nikon Eclipse E800 with 100X magnification
(Melville, NY).

Production of polyclonal antibody to NPC2 protein. Based on the structural
similarity and alignment between NPC2 protein and Derf2 protein (Ichikawa et
al., 1998), three peptides were synthesized as follow:
1) NH
2
-PSIKLVVEWKLEDDKKNNL-COOH;
2) NH
2
-NCPIQKDKTTSYLNKLPVK-COOH;
3) NH
2
-PCQLHKGQSYSVNIT-COOH.
Each peptide was injected into 2 rabbits and serum was collected and tested by
western blot. The serum from rabbit number 3 using peptide number 2 was
shown to give the best results. Aliquots of the serum were stored at -80
o
C.

NPC2 cDNA cloning, expression, and purification. NPC2 cDNA was cloned
from a mouse bone marrow low density cDNA library using the following
primers, 5’-GCGAATTCCTATTAGCTTGTGATCTGAACTGG-3’ and
5’GCTCTAGACTATTAATGGTGATGGTGATGATGGCTTGTGATCTGAA
CTGGGATCTC-3’ (the 6-histidine tag is underlined). The 450 bp fragment of
the PCR product was subcloned into a protein expression vector, pTT3
(Durocher et al., 2002), to form an NPC2 expression plasmid: pTT3/NPC2.
NPC2 protein was expressed in 293T cells with transfection using Lipofectamine
92
Plus reagent following the manufacturer’s instructions (Invitrogen, Carlsbad,
CA). The medium was replaced with 293 SFM II medium (Invitrogen, CA) 24
hrs post transfection. At 72 hrs post transfection, the supernatants were collected
and concentrated by using Amicon Centricon Plus-80 (Millipore, Billerica, MA).
NPC2 protein was purified from concentrated supernatants using Ni
+
-NTA
affinity column system (Qiagen, Valencia, CA) and desalted using Centricon
Plus-80, following the manufacturer’s instructions. Purified proteins were
characterized by Filipin staining to confirm cholesterol binding activity. To
perform RT-PCR analysis of NPC2 expression in bone marrow cell subsets, we
used the following primers: forward 5’-ATGCGTTTTCTGGCCGCCACG-3’,
reverse 5’-GCTTGTGATC TGAACTGGGATCTC-3’ (450 bp).

Immunoblotting. Western blots were performed as previously described
3
. HIF-
1 α and ARNT antibodies were purchased from BD Pharmingen (San Diego, CA).

Detection of apoptotic cell. An apoptosis assay was performed with TACS
apoptosis detection kit following the manufacturer’s instructions (R & D System,
MN). In brief, the cells were cultured for 4 days with TPO in the presence or
absence of NPC2. Then cells were transferred to serum-free medium for 4 hours
and collected to determine the percentage of apoptotic cells. 5×10
5
MO7e cells
were collected and washed in PBS. Then, cells were resuspended in 100 µl of
incubation reagent and incubated in the dark for 15 min. at room temperature.
After adding 400 µl binding buffer, cells were analyzed by flow cytometry
within 1 hr for maximal signal.
93
In vitro CFC assays. Assays for colony-forming unit-granulocyte-macrophage
(CFU-GM), burst-forming unit-erythroid (BFU-E), and colony-forming unit-
granulocyte- erythroid- macrophage- megakaryocyte (CFU-GEMM) were
performed using methylcellulose-based medium (M3334; Stem Cell
Technologies, Vancouver, Canada). This medium contains 3 U/ml erythropoietin
(EPO); 100 ng/ml stem cell factor (SCF) and 100 ng/ml TPO (R & D System,
MN). Sorted murine stem cells (Lin
-
Sca
+
Kit
+
) were mixed with methylcellulose
containing supplements and plated (500 cells/plate) in 35 mm dish. Cells were
incubated at 37
o
C with 10 % CO
2
and 7 % O
2
for 12 days.

Statistical analysis. Student t test was used for data analysis.

94
CHAPTER 5: CONCLUDING REMARKS

The packaging of DNA into chromatin adds a high level of complexity to
understanding the mechanism of various DNA processes in eukaryotic cells.
Current models view gene regulation in chromatin context as occurring via three
distinct processes; post-synthetic histone modifications, ATP-dependent
chromatin reorganization and incorporation of histone variants. In order to have
better understanding on various chromatin-dependent processes, I investigated
how histone H3 tails and histone variant H2A.X regulate chromatin-dependent
processes. I found that H3 tails and their modifications are specifically
recognized by multiple regulatory factors for their action in transcription. I also
found that H2A.X exchange within chromatin is regulated by FACT complex
(Spt16 and SSRP1) and PARP1.

Isolation and characterization of proteins associated with histone H3 tails in
vivo

The histone H3 N-terminal tails play an important role in regulating chromatin
transcription. Recent discoveries of specific interactions of regulatory factors
with H3 tails suggest that H3 tails and their modifications are a key player in the
precise regulation of transcription activity. However, these in vitro studies are
limited to the contribution of specific tail modifications for factor interaction. To
have better understanding on the role of H3 tails in more physiological
environment, I generated HeLa cells that stably express epitope-tagged H3 tails
95
containing multiple modifications such as acetylations (K9, 14, 18, 23),
methylations (K4, 9, 27, 39 and R18), and phosphorylation (S10). My
purification of factors associated with ectopic H3 tails identified multiple histone
methyltransferases (HMTs) and transcription regulatory factors that are known to
play a critical role in chromatin transcription. Moreover, point mutations of K9
and K27 of the ectopic tails to block their cellular modifications completely
abolished the association of all repressive factors including HP1 and several co-
repressors. These observations implicate that disruption of specific modification
of H3 tail influences factor recruitment to establish distinct chromatin
environment. Importantly, my transcription analysis showed that the purified H3
tail-associated factors can significantly stimulate p300-mediated transcription
from chromatin templates. Therefore, modified H3 tail, when accessible in
relaxed chromatin, can act as a transcriptional regulator by mediating recruitment
of specific sets of cofactors.

In conclusion, this new methodology to purify histone tail-interacting proteins
directly from living cells will provide better understanding for action of histone
tails in transcriptional regulation. Moreover, this approach will be a valuable tool
to understand combinatorial role of multiple histone modifications in regulation
of transcription events in chromatin.

96
FACT-mediated exchange of histone variant H2A.X regulated by
phosphorylation of H2A.X and ADP-ribosylation of Spt16

Histone variants have specific expression, localization, and species-distribution
patterns, leading to changes in chromatin structure and dynamics. Histone
variant H2A.X constitutes about 5-10% of total cellular H2A in higher
organisms and is rapidly phosphorylated at a highly conserved serine residue in
extended carboxyl terminus upon DNA double strand break. Although it remains
unclear to what extent, recent studies showed that the H2A.X plays a critical role
in chromatin remodeling for DNA double strand break repair. As a first step
toward understanding the contribution of H2A.X in various cellular processes, I
purified H2A.X-associated proteins from HeLa cells that stably express epitope-
tagged H2A.X. In my purification, I found that ectopic H2A.X is specifically
associated with several DNA repair factors (DNA-dependent protein kinase,
breast cancer-associated gene 2, PARP1 and Ku), histone modifying factors
(MMSET, PRMT5 and Tip60) and other regulatory factors (PP2C gamma, Spt16
and SSRP1) within the complex. I also found that nucleosomal integration and
dissociation of H2A.X can be mediated by Spt16 and SSRP1 or FACT complex,
which are two components of H2A.X-associated complex. In addition, PARP1-
mediated ribosylation of Spt16 leads to FACT complex dissociation from H2A.X,
which allows stable association of H2A.X on the chromatin during DNA damage
repair. Importantly, I also observed that phosphorylation of H2A.X stimulates
conformational changes of chromatin to enhance accessibility of nucleosomal
DNA, which appears to promote the action of repair factors in chromatin context.
97
Since little is known about how H2A.X and its phosphorylation contribute to
DNA DSB repair process, my discovery that stable association of H2A.X on the
chromatin is regulated by FACT complex and PARP1 during DNA damage will
significantly facilitate our understanding of DNA repair process. In addition,
although I did not put much attention to histone modifying activities within
H2A.X-associated complex for my graduate research, my future studies will be
directed to understand how these H2A.X-associated HMT/HAT activities
contribute to H2A.X-induced DNA double strand break repair and/or gene
regulation.

98
Involvement of Niemann-Pick Type C2 Protein in Hematopoiesis Regulation

A complicated network system regulates the balance of different bone marrow
cell subsets to maintain the homeostasis of self-renew, proliferation and
differentiation. The change of gene expression profile in different subsets of
bone marrow cells at different physiological situations plays important role in
these regulations. Using Affymetrix cDNA microarray technology, the gene
expression profiles of different subsets in hematopoietic stem cell compartment
were analyzed and compared with public HSC database. I paid a special attention
onto high expressed genes that code for secretory proteins. I found that murine
NPC2 protein (epididymal secretory protein) and its receptor (Mannose 6-
Phosphate Receptor) are highly expressed in all three stem cell subsets.

Although the function of murine NPC2 protein is not well understood, the
function of NPC2 homolog proteins in other species has been reported. The
porcine NPC2 protein is known as a major cholesterol binding protein in the
epididymal fluid, which facilitates the maturation of sperm. Recently, the
mutations of NPC2 gene lead to Niemann-Pick type C (NPC) disease, which is
an inherited autosomal recessive lipid storage disorder characterized
biochemically by cellular cholesterol and glycolipid accumulation. This
observation strongly suggests that NPC2 is involved in the exit of cholesterol
and other lipids from the endosomal or lysosomal. In addition, the human NPC2
protein was identified to be a lysosomal protein with cholesterol binding activity.
Glycosylated with mannose, NPC2 protein is recognized by the Mannose 6-
99
Phosphate Receptors (MPRs)/ Insulin-like Growth Factor II receptors (IGFII-Rs)
which divert newly synthesized lysosomal enzymes from the secretory pathway
to the endolysosomal system. It was also reported that several growth factors are
inactivated via MPR/IGFII-R mediated internalization and degradation pathway,
such as Leukemia Inhibitory Factor (LIF), and IGF-II.

Here, I showed novel function of NPC2 protein related to the hematopoiesis
regulation. This function can only be detected under physiological oxygen level
in the bone marrow. Using different methods, my results show that NPC2 protein
has anti-differentiation and anti-apoptosis effects via the TPO/Mpl system. The
hematopoiesis regulation effect is independent of cholesterol binding activity but
relies on mannose 6-phosphate receptor (MPR)/ insulin-like growth factor II
receptor (IGFII-R).

100
BIBLIOGRAPHY

Alpy, F., Stoeckel, M. E., Dierich, A., Escola, J. M., Wendling, C., Chenard, M.
P., Vanier, M. T., Gruenberg, J., Tomasetto, C., and Rio, M. C. (2001). The
steroidogenic acute regulatory protein homolog MLN64, a late endosomal
cholesterol-binding protein. J Biol Chem 276, 4261-4269.

An, W., Kim, J., and Roeder, R. G. (2004). Ordered cooperative functions of
PRMT1, p300, and CARM1 in transcriptional activation by p53. Cell 117, 735-
748.

An, W., Palhan, V. B., Karymov, M. A., Leuba, S. H., and Roeder, R. G. (2002).
Selective requirements for histone H3 and H4 N termini in p300-dependent
transcriptional activation from chromatin. Mol Cell 9, 811-821.

Angelov, D., Bondarenko, V. A., Almagro, S., Menoni, H., Mongelard, F., Hans,
F., Mietton, F., Studitsky, V. M., Hamiche, A., Dimitrov, S., and Bouvet, P.
(2006). Nucleolin is a histone chaperone with FACT-like activity and assists
remodeling of nucleosomes. Embo J 25, 1669-1679.

Ausio, J., Dong, F., and van Holde, K. E. (1989). Use of selectively trypsinized
nucleosome core particles to analyze the role of the histone "tails" in the
stabilization of the nucleosome. J Mol Biol 206, 451-463.

Ayyanathan, K., Lechner, M. S., Bell, P., Maul, G. G., Schultz, D. C., Yamada,
Y., Tanaka, K., Torigoe, K., and Rauscher, F. J., 3rd (2003). Regulated
recruitment of HP1 to a euchromatic gene induces mitotically heritable,
epigenetic gene silencing: a mammalian cell culture model of gene variegation.
Genes Dev 17, 1855-1869.

Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O.,
Allshire, R. C., and Kouzarides, T. (2001). Selective recognition of methylated
lysine 9 on histone H3 by the HP1 chromo domain. Nature 410, 120-124.

101
Bassing, C. H., Chua, K. F., Sekiguchi, J., Suh, H., Whitlow, S. R., Fleming, J.
C., Monroe, B. C., Ciccone, D. N., Yan, C., Vlasakova, K., et al. (2002).
Increased ionizing radiation sensitivity and genomic instability in the absence of
histone H2AX. Proc Natl Acad Sci U S A 99, 8173-8178.

Bell, B., Scheer, E., and Tora, L. (2001). Identification of hTAF(II)80 delta links
apoptotic signaling pathways to transcription factor TFIID function. Mol Cell 8,
591-600.

Belotserkovskaya, R., Oh, S., Bondarenko, V. A., Orphanides, G., Studitsky, V.
M., and Reinberg, D. (2003). FACT facilitates transcription-dependent
nucleosome alteration. Science 301, 1090-1093.

Berger, S. L. (2002). Histone modifications in transcriptional regulation. Curr
Opin Genet Dev 12, 142-148.

Bianchi, M. E., and Agresti, A. (2005). HMG proteins: dynamic players in gene
regulation and differentiation. Curr Opin Genet Dev 15, 496-506.

Brand, M., Moggs, J. G., Oulad-Abdelghani, M., Lejeune, F., Dilworth, F. J.,
Stevenin, J., Almouzni, G., and Tora, L. (2001). UV-damaged DNA-binding
protein in the TFTC complex links DNA damage recognition to nucleosome
acetylation. Embo J 20, 3187-3196.

Bunting, S., Widmer, R., Lipari, T., Rangell, L., Steinmetz, H., Carver-Moore,
K., Moore, M. W., Keller, G. A., and de Sauvage, F. J. (1997). Normal platelets
and megakaryocytes are produced in vivo in the absence of thrombopoietin.
Blood 90, 3423-3429.

Burma, S., Chen, B. P., Murphy, M., Kurimasa, A., and Chen, D. J. (2001).
ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J
Biol Chem 276, 42462-42467.

Bustin, M., Catez, F., and Lim, J. H. (2005). The dynamics of histone H1
function in chromatin. Mol Cell 17, 617-620.

102
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P.,
Jones, R. S., and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in
Polycomb-group silencing. Science 298, 1039-1043.

Celeste, A., Difilippantonio, S., Difilippantonio, M. J., Fernandez-Capetillo, O.,
Pilch, D. R., Sedelnikova, O. A., Eckhaus, M., Ried, T., Bonner, W. M., and
Nussenzweig, A. (2003). H2AX haploinsufficiency modifies genomic stability
and tumor susceptibility. Cell 114, 371-383.

Celeste, A., Petersen, S., Romanienko, P. J., Fernandez-Capetillo, O., Chen, H.
T., Sedelnikova, O. A., Reina-San-Martin, B., Coppola, V., Meffre, E.,
Difilippantonio, M. J., et al. (2002). Genomic instability in mice lacking histone
H2AX. Science 296, 922-927.

Chen, H. T., Bhandoola, A., Difilippantonio, M. J., Zhu, J., Brown, M. J., Tai, X.,
Rogakou, E. P., Brotz, T. M., Bonner, W. M., Ried, T., and Nussenzweig, A.
(2000). Response to RAG-mediated VDJ cleavage by NBS1 and gamma-H2AX.
Science 290, 1962-1965.

Chowdhury, D., Keogh, M. C., Ishii, H., Peterson, C. L., Buratowski, S., and
Lieberman, J. (2005). gamma-H2AX dephosphorylation by protein phosphatase
2A facilitates DNA double-strand break repair. Mol Cell 20, 801-809.

Cloos, P. A., Christensen, J., Agger, K., Maiolica, A., Rappsilber, J., Antal, T.,
Hansen, K. H., and Helin, K. (2006). The putative oncogene GASC1
demethylates tri- and dimethylated lysine 9 on histone H3. Nature 442, 307-311.

Cosgrove, M. S., and Wolberger, C. (2005). How does the histone code work?
Biochem Cell Biol 83, 468-476.

Cottin, V., Doan, J. E., and Riches, D. W. (2002). Restricted localization of the
TNF receptor CD120a to lipid rafts: a novel role for the death domain. J
Immunol 168, 4095-4102.

103
Cullinan, E. B., Abbondanzo, S. J., Anderson, P. S., Pollard, J. W., Lessey, B. A.,
and Stewart, C. L. (1996). Leukemia inhibitory factor (LIF) and LIF receptor
expression in human endometrium suggests a potential autocrine/paracrine
function in regulating embryo implantation. Proc Natl Acad Sci U S A 93, 3115-
3120.

Daino, H., Matsumura, I., Takada, K., Odajima, J., Tanaka, H., Ueda, S.,
Shibayama, H., Ikeda, H., Hibi, M., Machii, T., et al. (2000). Induction of
apoptosis by extracellular ubiquitin in human hematopoietic cells: possible
involvement of STAT3 degradation by proteasome pathway in interleukin 6-
dependent hematopoietic cells. Blood 95, 2577-2585.

Daniel, J. A., Pray-Grant, M. G., and Grant, P. A. (2005). Effector proteins for
methylated histones: an expanding family. Cell Cycle 4, 919-926.

Daujat, S., Bauer, U. M., Shah, V., Turner, B., Berger, S., and Kouzarides, T.
(2002). Crosstalk between CARM1 methylation and CBP acetylation on histone
H3. Curr Biol 12, 2090-2097.

de la Cruz, X., Lois, S., Sanchez-Molina, S., and Martinez-Balbas, M. A. (2005).
Do protein motifs read the histone code? Bioessays 27, 164-175.

Downs, J. A., Allard, S., Jobin-Robitaille, O., Javaheri, A., Auger, A., Bouchard,
N., Kron, S. J., Jackson, S. P., and Cote, J. (2004). Binding of chromatin-
modifying activities to phosphorylated histone H2A at DNA damage sites. Mol
Cell 16, 979-990.

Downs, J. A., Lowndes, N. F., and Jackson, S. P. (2000). A role for
Saccharomyces cerevisiae histone H2A in DNA repair. Nature 408, 1001-1004.

Du, Y. C., Gu, S., Zhou, J., Wang, T., Cai, H., Macinnes, M. A., Bradbury, E. M.,
and Chen, X. (2006). The dynamic alterations of H2AX complex during DNA
repair detected by a proteomic approach reveal the critical roles of
Ca(2+)/calmodulin in the ionizing radiation-induced cell cycle arrest. Mol Cell
Proteomics 5, 1033-1044.

104
Durocher, Y., Perret, S., and Kamen, A. (2002). High-level and high-throughput
recombinant protein production by transient transfection of suspension-growing
human 293-EBNA1 cells. Nucleic Acids Res 30, E9.

Fernandez-Capetillo, O., Lee, A., Nussenzweig, M., and Nussenzweig, A. (2004).
H2AX: the histone guardian of the genome. DNA Repair (Amst) 3, 959-967.

Frolov, A., Srivastava, K., Daphna-Iken, D., Traub, L. M., Schaffer, J. E., and
Ory, D. S. (2001). Cholesterol overload promotes morphogenesis of a Niemann-
Pick C (NPC)-like compartment independent of inhibition of NPC1 or
HE1/NPC2 function. J Biol Chem 276, 46414-46421.

Gearing, D. P. (1993). The leukemia inhibitory factor and its receptor. Adv
Immunol 53, 31-58.

Ghosh, P., Dahms, N. M., and Kornfeld, S. (2003). Mannose 6-phosphate
receptors: new twists in the tale. Nat Rev Mol Cell Biol 4, 202-212.

Gygi, S. P., Rist, B., Gerber, S. A., Turecek, F., Gelb, M. H., and Aebersold, R.
(1999). Quantitative analysis of complex protein mixtures using isotope-coded
affinity tags. Nat Biotechnol 17, 994-999.

Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., and Wu, C. (1999). ATP-
dependent histone octamer sliding mediated by the chromatin remodeling
complex NURF. Cell 97, 833-842.

Hansen, J. C. (2002). Conformational dynamics of the chromatin fiber in
solution: determinants, mechanisms, and functions. Annu Rev Biophys Biomol
Struct 31, 361-392.

Hediger, F., and Gasser, S. M. (2006). Heterochromatin protein 1: don't judge the
book by its cover! Curr Opin Genet Dev 16, 143-150.

105
Hirai, H., Shimazaki, C., Yamagata, N., Goto, H., Inaba, T., Kikuta, T.,
Sumikuma, T., Sudo, Y., Ashihara, E., Fujita, N., et al. (1997). Effects of
thrombopoietin (c-mpl ligand) on growth of blast cells from patients with
transient abnormal myelopoiesis and acute myeloblastic leukemia. Eur J
Haematol 59, 38-46.

Huang, J. Y., Chen, W. H., Chang, Y. L., Wang, H. T., Chuang, W. T., and Lee,
S. C. (2006). Modulation of nucleosome-binding activity of FACT by
poly(ADP-ribosyl)ation. Nucleic Acids Res 34, 2398-2407.

Ichikawa, S., Hatanaka, H., Yuuki, T., Iwamoto, N., Kojima, S., Nishiyama, C.,
Ogura, K., Okumura, Y., and Inagaki, F. (1998). Solution structure of Der f 2,
the major mite allergen for atopic diseases. J Biol Chem 273, 356-360.

Ito, M., Yuan, C. X., Malik, S., Gu, W., Fondell, J. D., Yamamura, S., Fu, Z. Y.,
Zhang, X., Qin, J., and Roeder, R. G. (1999). Identity between TRAP and SMCC
complexes indicates novel pathways for the function of nuclear receptors and
diverse mammalian activators. Mol Cell 3, 361-370.

Jenuwein, T., and Allis, C. D. (2001). Translating the histone code. Science 293,
1074-1080.

Jiang F. Zhong, Y. Z., Susan Sutton, Andrew Su, Yuxia Zhan, Lunjian Zhu,
Chunli Yan, Tim Gallaher, Patrick B. Hohnson, W. French. Anderson and
Michael P. Cooke (2005). Gene expression profile of murine long-term
reconstituting versus short-term reconstituting hematopoietic stem cells. ProNatl
Acad Sci Accepted.

Jin, J., Cai, Y., Li, B., Conaway, R. C., Workman, J. L., Conaway, J. W., and
Kusch, T. (2005). In and out: histone variant exchange in chromatin. Trends
Biochem Sci 30, 680-687.

Kato, H., Tamamizu-Kato, S., and Shibasaki, F. (2004). Histone deacetylase 7
associates with hypoxia-inducible factor 1alpha and increases transcriptional
activity. J Biol Chem 279, 41966-41974.

106
Kellokumpu-Lehtinen, P., Talpaz, M., Harris, D., Van, Q., Kurzrock, R., and
Estrov, Z. (1996). Leukemia-inhibitory factor stimulates breast, kidney and
prostate cancer cell proliferation by paracrine and autocrine pathways. Int J
Cancer 66, 515-519.

Kharel, Y., Takahashi, S., Yamashita, S., and Koyama, T. (2004). In vivo
interaction between the human dehydrodolichyl diphosphate synthase and the
Niemann-Pick C2 protein revealed by a yeast two-hybrid system. Biochem
Biophys Res Commun 318, 198-203.

Kim, J. H., Li, H., and Stallcup, M. R. (2003). CoCoA, a nuclear receptor
coactivator which acts through an N-terminal activation domain of p160
coactivators. Mol Cell 12, 1537-1549.

Kim, M. Y., Mauro, S., Gevry, N., Lis, J. T., and Kraus, W. L. (2004). NAD+-
dependent modulation of chromatin structure and transcription by nucleosome
binding properties of PARP-1. Cell 119, 803-814.

Kimura, H., Takizawa, N., Allemand, E., Hori, T., Iborra, F. J., Nozaki, N.,
Muraki, M., Hagiwara, M., Krainer, A. R., Fukagawa, T., and Okawa, K. (2006).
A novel histone exchange factor, protein phosphatase 2Cgamma, mediates the
exchange and dephosphorylation of H2A-H2B. J Cell Biol 175, 389-400.

Kirito, K., Fox, N., Komatsu, N., and Kaushansky, K. (2005). Thrombopoietin
enhances expression of vascular endothelial growth factor (VEGF) in primitive
hematopoietic cells through induction of HIF-1{alpha}. Blood 105, 4258-4263.

Ko, D. C., Binkley, J., Sidow, A., and Scott, M. P. (2003). The integrity of a
cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control
lysosome cholesterol levels. Proc Natl Acad Sci U S A 100, 2518-2525.

Kornberg, R. D., and Lorch, Y. (1999). Twenty-five years of the nucleosome,
fundamental particle of the eukaryote chromosome. Cell 98, 285-294.

Kouzarides, T. (2002). Histone methylation in transcriptional control. Curr Opin
Genet Dev 12, 198-209.

107
Kundu, T. K., Palhan, V. B., Wang, Z., An, W., Cole, P. A., and Roeder, R. G.
(2000). Activator-dependent transcription from chromatin in vitro involving
targeted histone acetylation by p300. Mol Cell 6, 551-561.

Kusch, T., Florens, L., Macdonald, W. H., Swanson, S. K., Glaser, R. L., Yates,
J. R., 3rd, Abmayr, S. M., Washburn, M. P., and Workman, J. L. (2004).
Acetylation by Tip60 is required for selective histone variant exchange at DNA
lesions. Science 306, 2084-2087.

Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001).
Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins.
Nature 410, 116-120.

Lee, D. Y., Northrop, J. P., Kuo, M. H., and Stallcup, M. R. (2006). Histone H3
lysine 9 methyltransferase G9a is a transcriptional coactivator for nuclear
receptors. J Biol Chem 281, 8476-8485.

Lee, Y. H., Koh, S. S., Zhang, X., Cheng, X., and Stallcup, M. R. (2002).
Synergy among nuclear receptor coactivators: selective requirement for protein
methyltransferase and acetyltransferase activities. Mol Cell Biol 22, 3621-3632.

Li, B., Carey, M., and Workman, J. L. (2007). The role of chromatin during
transcription. Cell 128, 707-719.

Li, B., Navarro, S., Kasahara, N., and Comai, L. (2004). Identification and
biochemical characterization of a Werner's syndrome protein complex with
Ku70/80 and poly(ADP-ribose) polymerase-1. J Biol Chem 279, 13659-13667.

Lowary, P. T., and Widom, J. (1998). New DNA sequence rules for high affinity
binding to histone octamer and sequence-directed nucleosome positioning. J Mol
Biol 276, 19-42.

Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J.
(1997). Crystal structure of the nucleosome core particle at 2.8 A resolution.
Nature 389, 251-260.

108
Lusa, S., Blom, T. S., Eskelinen, E. L., Kuismanen, E., Mansson, J. E., Simons,
K., and Ikonen, E. (2001). Depletion of rafts in late endocytic membranes is
controlled by NPC1-dependent recycling of cholesterol to the plasma membrane.
J Cell Sci 114, 1893-1900.

Macdonald, N., Welburn, J. P., Noble, M. E., Nguyen, A., Yaffe, M. B., Clynes,
D., Moggs, J. G., Orphanides, G., Thomson, S., Edmunds, J. W., et al. (2005).
Molecular basis for the recognition of phosphorylated and phosphoacetylated
histone h3 by 14-3-3. Mol Cell 20, 199-211.

Malik, H. S., and Henikoff, S. (2003). Phylogenomics of the nucleosome. Nat
Struct Biol 10, 882-891.

Malik, S., and Roeder, R. G. (2003). Isolation and functional characterization of
the TRAP/mediator complex. Methods Enzymol 364, 257-284.

Marion, C., Roux, B., Pallotta, L., and Coulet, P. R. (1983). Study of chromatin
organization with trypsin immobilized on collagen membranes. Biochem
Biophys Res Commun 114, 1169-1175.

Martin, C., and Zhang, Y. (2005). The diverse functions of histone lysine
methylation. Nat Rev Mol Cell Biol 6, 838-849.

Martinez, E., Palhan, V. B., Tjernberg, A., Lymar, E. S., Gamper, A. M., Kundu,
T. K., Chait, B. T., and Roeder, R. G. (2001). Human STAGA complex is a
chromatin-acetylating transcription coactivator that interacts with pre-mRNA
splicing and DNA damage-binding factors in vivo. Mol Cell Biol 21, 6782-6795.

McGhee, J. D., Felsenfeld, G., and Eisenberg, H. (1980). Nucleosome structure
and conformational changes. Biophys J 32, 261-270.

Mizuguchi, G., Shen, X., Landry, J., Wu, W. H., Sen, S., and Wu, C. (2004).
ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin
remodeling complex. Science 303, 343-348.

109
Mosammaparast, N., Guo, Y., Shabanowitz, J., Hunt, D. F., and Pemberton, L. F.
(2002). Pathways mediating the nuclear import of histones H3 and H4 in yeast. J
Biol Chem 277, 862-868.

Motyka, B., Korbutt, G., Pinkoski, M. J., Heibein, J. A., Caputo, A., Hobman,
M., Barry, M., Shostak, I., Sawchuk, T., Holmes, C. F., et al. (2000). Mannose 6-
phosphate/insulin-like growth factor II receptor is a death receptor for granzyme
B during cytotoxic T cell-induced apoptosis. Cell 103, 491-500.

Nakamura, Y., Takayama, N., Minamitani, T., Ikuta, T., Ariga, H., and
Matsumoto, K. (2000). Primary structure, genomic organization and expression
of the major secretory protein of murine epididymis, ME1. Gene 251, 55-62.

Nakayama, J., Rice, J. C., Strahl, B. D., Allis, C. D., and Grewal, S. I. (2001).
Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin
assembly. Science 292, 110-113.

Naureckiene, S., Sleat, D. E., Lackland, H., Fensom, A., Vanier, M. T., Wattiaux,
R., Jadot, M., and Lobel, P. (2000). Identification of HE1 as the second gene of
Niemann-Pick C disease. Science 290, 2298-2301.

Nielsen, A. L., Ortiz, J. A., You, J., Oulad-Abdelghani, M., Khechumian, R.,
Gansmuller, A., Chambon, P., and Losson, R. (1999). Interaction with members
of the heterochromatin protein 1 (HP1) family and histone deacetylation are
differentially involved in transcriptional silencing by members of the TIF1
family. Embo J 18, 6385-6395.

Nishioka, K., Chuikov, S., Sarma, K., Erdjument-Bromage, H., Allis, C. D.,
Tempst, P., and Reinberg, D. (2002). Set9, a novel histone H3 methyltransferase
that facilitates transcription by precluding histone tail modifications required for
heterochromatin formation. Genes Dev 16, 479-489.

O'Gorman, D. B., Weiss, J., Hettiaratchi, A., Firth, S. M., and Scott, C. D. (2002).
Insulin-like growth factor-II/mannose 6-phosphate receptor overexpression
reduces growth of choriocarcinoma cells in vitro and in vivo. Endocrinology 143,
4287-4294.

110
Okamura, N., Kiuchi, S., Tamba, M., Kashima, T., Hiramoto, S., Baba, T.,
Dacheux, F., Dacheux, J. L., Sugita, Y., and Jin, Y. Z. (1999). A porcine
homolog of the major secretory protein of human epididymis, HE1, specifically
binds cholesterol. Biochim Biophys Acta 1438, 377-387.

Orphanides, G., Wu, W. H., Lane, W. S., Hampsey, M., and Reinberg, D. (1999).
The chromatin-specific transcription elongation factor FACT comprises human
SPT16 and SSRP1 proteins. Nature 400, 284-288.

Park, E. J., Chan, D. W., Park, J. H., Oettinger, M. A., and Kwon, J. (2003).
DNA-PK is activated by nucleosomes and phosphorylates H2AX within the
nucleosomes in an acetylation-dependent manner. Nucleic Acids Res 31, 6819-
6827.

Paull, T. T., Rogakou, E. P., Yamazaki, V., Kirchgessner, C. U., Gellert, M., and
Bonner, W. M. (2000). A critical role for histone H2AX in recruitment of repair
factors to nuclear foci after DNA damage. Curr Biol 10, 886-895.

Pilch, D. R., Sedelnikova, O. A., Redon, C., Celeste, A., Nussenzweig, A., and
Bonner, W. M. (2003). Characteristics of gamma-H2AX foci at DNA double-
strand breaks sites. Biochem Cell Biol 81, 123-129.

Pray-Grant, M. G., Daniel, J. A., Schieltz, D., Yates, J. R., 3rd, and Grant, P. A.
(2005). Chd1 chromodomain links histone H3 methylation with SAGA- and
SLIK-dependent acetylation. Nature 433, 434-438.

Qiu, Y., Zhao, Y., Becker, M., John, S., Parekh, B. S., Huang, S., Hendarwanto,
A., Martinez, E. D., Chen, Y., Lu, H., et al. (2006). HDAC1 acetylation is linked
to progressive modulation of steroid receptor-induced gene transcription. Mol
Cell 22, 669-679.

Ridyard, M. S., and Robbins, S. M. (2003). Fibroblast growth factor-2-induced
signaling through lipid raft-associated fibroblast growth factor receptor substrate
2 (FRS2). J Biol Chem 278, 13803-13809.

111
Ritchie, A., Vadhan-Raj, S., and Broxmeyer, H. E. (1996). Thrombopoietin
suppresses apoptosis and behaves as a survival factor for the human growth
factor-dependent cell line, M07e. Stem Cells 14, 330-336.

Rogakou, E. P., Boon, C., Redon, C., and Bonner, W. M. (1999). Megabase
chromatin domains involved in DNA double-strand breaks in vivo. J Cell Biol
146, 905-916.

Santos-Rosa, H., Schneider, R., Bernstein, B. E., Karabetsou, N., Morillon, A.,
Weise, C., Schreiber, S. L., Mellor, J., and Kouzarides, T. (2003). Methylation of
histone H3 K4 mediates association of the Isw1p ATPase with chromatin. Mol
Cell 12, 1325-1332.

Sarma, K., and Reinberg, D. (2005). Histone variants meet their match. Nat Rev
Mol Cell Biol 6, 139-149.

Schneider, R., Bannister, A. J., Weise, C., and Kouzarides, T. (2004). Direct
binding of INHAT to H3 tails disrupted by modifications. J Biol Chem 279,
23859-23862.

Semenza, G. L. (2003). Targeting HIF-1 for cancer therapy. Nat Rev Cancer 3,
721-732.

Sigurjonsson, O. E., Gudmundsson, K. O., Haraldsdottir, V., Rafnar, T.,
Agnarsson, B. A., and Gudmundsson, S. (2004). Flt3/Flk-2 ligand in
combination with thrombopoietin decreases apoptosis in megakaryocyte
development. Stem Cells Dev 13, 183-191.

Sims, R. J., 3rd, Nishioka, K., and Reinberg, D. (2003). Histone lysine
methylation: a signature for chromatin function. Trends Genet 19, 629-639.

Stewart, C. L., Kaspar, P., Brunet, L. J., Bhatt, H., Gadi, I., Kontgen, F., and
Abbondanzo, S. J. (1992). Blastocyst implantation depends on maternal
expression of leukaemia inhibitory factor. Nature 359, 76-79.

Strahl, B. D., and Allis, C. D. (2000). The language of covalent histone
modifications. Nature 403, 41-45.
112
Thomas, C. E., Kelleher, N. L., and Mizzen, C. A. (2006). Mass spectrometric
characterization of human histone H3: a bird's eye view. J Proteome Res 5, 240-
247.

Turner, B. M. (2002). Cellular memory and the histone code. Cell 111, 285-291.

Underhill, C., Qutob, M. S., Yee, S. P., and Torchia, J. (2000). A novel nuclear
receptor corepressor complex, N-CoR, contains components of the mammalian
SWI/SNF complex and the corepressor KAP-1. J Biol Chem 275, 40463-40470.

van Attikum, H., Fritsch, O., Hohn, B., and Gasser, S. M. (2004). Recruitment of
the INO80 complex by H2A phosphorylation links ATP-dependent chromatin
remodeling with DNA double-strand break repair. Cell 119, 777-788.

Van Holde, K. E. (1989). Chromatin (New York: Springer-Verlag).

Vignali, M., and Workman, J. L. (1998). Location and function of linker histones.
Nat Struct Biol 5, 1025-1028.

Wang, A., Kurdistani, S. K., and Grunstein, M. (2002). Requirement of Hos2
histone deacetylase for gene activity in yeast. Science 298, 1412-1414.

Ward, I. M., and Chen, J. (2001). Histone H2AX is phosphorylated in an ATR-
dependent manner in response to replicational stress. J Biol Chem 276, 47759-
47762.

Workman, J. L., and Kingston, R. E. (1998). Alteration of nucleosome structure
as a mechanism of transcriptional regulation. Annu Rev Biochem 67, 545-579.

Wysocka, J., Reilly, P. T., and Herr, W. (2001). Loss of HCF-1-chromatin
association precedes temperature-induced growth arrest of tsBN67 cells. Mol
Cell Biol 21, 3820-3829.

Wysocka, J., Swigut, T., Milne, T. A., Dou, Y., Zhang, X., Burlingame, A. L.,
Roeder, R. G., Brivanlou, A. H., and Allis, C. D. (2005). WDR5 associates with
histone H3 methylated at K4 and is essential for H3 K4 methylation and
vertebrate development. Cell 121, 859-872.
113
Yang, C. K., Kim, J. H., and Stallcup, M. R. (2006). Role of the N-terminal
activation domain of the coiled-coil coactivator in mediating transcriptional
activation by beta-catenin. Mol Endocrinol 20, 3251-3262.

Yang, X. J., and Seto, E. (2003). Collaborative spirit of histone deacetylases in
regulating chromatin structure and gene expression. Curr Opin Genet Dev 13,
143-153.

Yates, J. R., 3rd, Eng, J. K., McCormack, A. L., and Schieltz, D. (1995). Method
to correlate tandem mass spectra of modified peptides to amino acid sequences
in the protein database. Anal Chem 67, 1426-1436.

Zaina, S., and Squire, S. (1998). The soluble type 2 insulin-like growth factor
(IGF-II) receptor reduces organ size by IGF-II-mediated and IGF-II-independent
mechanisms. J Biol Chem 273, 28610-28616.

Zegerman, P., Canas, B., Pappin, D., and Kouzarides, T. (2002). Histone H3
lysine 4 methylation disrupts binding of nucleosome remodeling and deacetylase
(NuRD) repressor complex. J Biol Chem 277, 11621-11624.

Zeng, L., and Zhou, M. M. (2002). Bromodomain: an acetyl-lysine binding
domain. FEBS Lett 513, 124-128.

Zhang, C. L., McKinsey, T. A., and Olson, E. N. (2002). Association of class II
histone deacetylases with heterochromatin protein 1: potential role for histone
methylation in control of muscle differentiation. Mol Cell Biol 22, 7302-7312.

Zhang, Y., LeRoy, G., Seelig, H. P., Lane, W. S., and Reinberg, D. (1998). The
dermatomyositis-specific autoantigen Mi2 is a component of a complex
containing histone deacetylase and nucleosome remodeling activities. Cell 95,
279-289.

Zheng, C., and Hayes, J. J. (2003). Structures and interactions of the core histone
tail domains. Biopolymers 68, 539-546.

Zlatanova, J., and van Holde, K. (1998). Linker histones versus HMG1/2: a
struggle for dominance? Bioessays 20, 584-588.

Abstract (if available)

Abstract Posttranslational modifications of histones, ATP-dependent chromatin remodeling, and incorporation of histone variants are three major events to regulate DNA dependent processes in chromatin context.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Molecular mechanism of the recruitment of SWI/SNF chromatin remodeling complex and histone acetyltransferase to estrogen-responsive promoters

PDF

Identification and characterization of PR-Set7 and histone H4 lysine 20 methylation-associated proteins

PDF

Histone H3 N-terminal tail proteolysis in mammalian myogenic differentiation

PDF

Targeting chromatin modification in human cancer: SMYD3 mediated ERα transcription regulation. Cooperative role between H3.3 and HP1ϒ

PDF

Identification of two negative regulators of p53: H1.2 complex and VprBP

PDF

The role of histone H4 lysine 20 monomethylation in gene expression and differentiation

PDF

Characterization and functional study of a novel human protein SFMBT, and PR-Set7 histone methyltransferase

PDF

Developing new tools to discover and investigate histone H3 proteases

PDF

Studies of the biological relevance of Histone H4 Lysine 20 monomethylation: discovery of its role in the cell cycle and localization within the human genome

PDF

Epigenetic regulation of non CPG island gene promoters

PDF

The mechanism of recruitment of Tip60 to ER target genes

PDF

Transcriptional regulation by epigenetic mechanisms

PDF

Determinination of the causal potential of histone modifications on transcription and chromatin structure

PDF

Multiple functions of the PR-Set7 histone methyltransferase: from transcription to the cell cycle

PDF

Role of SH2/SH3 adapter Nck in regulation of actin cytoskeleton and cell motility

PDF

DNA hypermethylation: its role in colorectal tumorigenesis and potential clinical applications

PDF

Use of DNA methylation inhibitors for chemotherapy and chemoprevention of cancer

PDF

The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

PDF

Determining the necessity of nuclear matrix metalloproteinase-2 (MMP-2) activity for proficient skeletal muscle differentiation

PDF

Roles of three domains of CCAR1 in transcription activation by nuclear receptors

Asset Metadata

Creator Heo, Kyu (author)

Core Title Investigation of two distinct chromatin events: H3 tail-mediated factor recruitment and H2A.X exchange

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2007-05

Publication Date 05/01/2007

Defense Date 03/29/2007

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag histone chromatin,OAI-PMH Harvest

Language English

Advisor An, Woojin (committee chair), Dubeau, Louis (committee member), Rice, Judd C. (committee member), Stallcup, Michael R. (committee member)

Creator Email heo@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m444

Unique identifier UC1477830

Identifier etd-Heo-20070501 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-484083 (legacy record id),usctheses-m444 (legacy record id)

Legacy Identifier etd-Heo-20070501.pdf

Dmrecord 484083

Document Type Dissertation

Rights Heo, Kyu

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu