University of Southern California Dissertations and Theses

Searching for lymphoid-specific phosphatase (LYP) inhibitor

(USC Thesis Other)

Searching for lymphoid-specific phosphatase (LYP) inhibitor

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

SEARCHING FOR LYMPHOID-SPECIFIC PHOSPHATASE (LYP) INHIBITOR

by

Lei Zhao

A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

December 2007

Copyright 2007 Lei Zhao

ii
TABLE OF CONTENTS

List of Tables………………………………………………………………………. iii

List of Figures………..……………………………………………………………. iv

Abstract……...…………………………………….………………………………. v

Chapter 1. Introduction………………………………………………………….… 1

Chapter 2. Biochemical characterization of LYP and PEST…...………….…... 8

Chapter 3. Search for small molecule inhibitors…………….………………… 20

Chapter 4. RNAi knockdown of LYP………………………..………………….. 36

References……………………………………………………………………….. 41

iii
LIST OF TABLES

Table 1: Kinetic parameters for LYPCAT and PESTCAT……………………. 17

Table 2: IC
50
values for some small molecules in phosphatase assay…..… 22

Table 3: Kinetic parameters of PTP assays………………………………...… 27

iv
LIST OF FIGURES

Figure 1: Clustering of the T-cell receptor and a co-receptor
initiates signaling within the T cell…………………………………… 7

Figure 2: Protein purification…………………………………………………… 12

Figure 3: Biochemical characterizations of LYPCAT and
PESTCAT using pNPP as the substrate …………………………... 15

Figure 4: Non-linear fit of experimental data to Michaelis-
Menten equation using different substrates ………………………. 16

Figure 5: Substrate dependence in small molecule screenings………….… 24

Figure 6: Substrate dependence in dose-dependence studies…………….. 25

Figure 7: Michaelis-Menten kinetics of other phosphatases……………...… 28

Figure 8: LYP knockdown by RNAi increases TCR signaling………………. 38

v
ABSTRACT

Lymphoid-specific protein tyrosine phosphatase (LYP) has been found to be
one of the most potent inhibitors of T cell subpopulation activation. A
gain-of-function single nucleotide polymorphism (SNP) C1858T has been
shown to be involved in several autoimmune diseases. We compared the
enzymatic activity of LYP and Pro, Glu, Ser, Thr-rich protein tyrosine
phosphatase (PEST). In vitro biochemical studies showed that LYP could
differentially hydrolyze several phosphatase substrates. We screened a small
molecule library for potential LYP inhibitors. In addition, our siRNA studies
confirmed that T-cell receptor signaling was enhanced once LYP expression
got repressed.

1
Chapter 1. Introduction

Specific Aims
LYP (lymphoid tyrosine phosphatase), encoded by the PTPN22 gene, is one of
the protein tyrosine phosphatases specifically expressed in hemopoietic cells.
As a negative modulator involved in TCR (T cell receptor) signaling, it interacts
with multiple downstream kinases including Csk, Lck and ZAP-70. A recently
described functional SNP (single nucleotide polymorphism) in the PTPN22
gene, which abolishes the binding of LYP to Csk, predisposes human to type 1
diabetes, rheumatoid arthritis, systemic lupus erythematosus, and other
autoimmune diseases. The current working hypothesis in the laboratory is that
inhibition of LYP might help to prevent and/or treat autoimmunity in subjects
carrying the autoimmune-predisposing LYP genetic variants. The long-term
goal of the project is to find or generate an inhibitor of LYP.

The first aim of this investigation is to clarify the enzymology of LYP in
comparison to other similar members in the same PTP family to find a specific
LYP inhibitor. In order to do this, we plan to express the catalytic domains of all
three members in LYP family in E. coli, followed by protein isolation and
purification. Then we will determine the biochemical characters of each enzyme
to establish conditions for maximum enzymatic activity, including kinetics,

2
optimal pH, and sensitivity to salt concentration. The resistance to phosphatase
inhibitors was tested on the optimum conditions for enzymatic activity. We will
use in vitro phosphatase assays using pNPP, phosphotyrosine peptides and
fluorescent peptides as substrates.

The second aim is to develop LYP inhibitors to be used in cell biology
experiments. We will take two approaches: peptide-based inhibitor screening
and small molecule inhibitor screening. The first approach is based on the fact
that synthetic peptides having a similar sequence to natural substrate could
serve as an effective inhibitor of the enzyme. According to the information of the
Lck Y394 auto-phosphorylation site, we will generate a library that has random
amino acids on each position of the peptide. We will take advantage of a novel
fluorescent amino acid residue that has been found to be an excellent PTP
(protein tyrosine phosphatases) substrate after being incorporated into small
peptides to screen for inhibitors. After that we will get the inhibitor across the
plasma membrane by means of attaching an antennapedia or polyarginine tag
to the peptide. Compared to peptide inhibitors, small molecules have a higher
chance of getting across the cell membrane. Thus, we will screen a small
molecule library using in vitro phosphatase assays.

3
Background
Protein tyrosine phosphorylation is a key mechanism for the cellular signal
transduction (Mustelin et al., 2005). It is regulated by synergistic action of
kinases and phosphatases. Tyrosine phosphorylation is involved in many
important cellular events, including cell fate decision, inter- and intra-cellular
communication, cell motility and morphology, regulation of gene transcription,
and transport of molecules in or out of cells. In the immune system, tyrosine
phosphorylation relays the signal through soluble mediators and cell-cell
contacts (Mustelin et al., 2001; Mustelin, 1994; Mustelin et al., 2003; Mustelin
and Tasken, 2003). Many inherited or acquired human diseases stem from
abnormalities in PTPs, which dephosphorylate tyrosine residues (Alonso et al.,
2004; Andersen et al., 2004). The first evidence showing that PTP abnormalities
cause autoimmune diseases came from the motheaten mouse (Shultz and
Green, 1976), in which a severe hyperinflammatory disease and
hyperresponsive T and B lymphocytes resulted from the loss of the
SH2-containing protein tyrosine phosphatase-1 (SHP1) (Tsui et al., 1993).

Autoimmune disease also develops in mice transgenic for a gain-of-function
mutant of CD45, a member of transmembrane phosphatase family (Majeti et al.,
2000). Severe phenotypes are also observed in many PTP-knock-out mice.
Mice lacking PEP (PEST-enriched phosphatase) display exaggerated and
prolonged effector T cell expansion (Hasegawa et al., 2004).

4
During the last two decades, only PTKs (protein tyrosine kinases) have been
intensively studied (Hubbard and Till, 2000; Hunter, 2000; Robertson et al.,
2000; Robinson et al., 2000), while little was known about PTPs. It has been
shown that both the catalytic domain and non-catalytic segments of the PTPs
contribute to the definition of substrate specificity in vivo. Whereas non-catalytic
domains may target the PTPs to specific intracellular compartments in which the
effective local concentration of substrate is high (Andersen et al., 2001; Fischer,
1999; Mauro and Dixon, 1994), the PTP catalytic domains themselves confer
site-selective protein dephosphorylation by recognizing both the
phosphotyrosine residue to be dephosphorylated and its flanking amino acids in
the substrate. The combination of structural studies, kinetic analysis of PTP
domains, and studies involving substrate-trapping mutants (Flint et al., 1997) as
well as PTP chimeras (O’Reilly and Neel, 1998) has convincingly demonstrated
that isolated PTP domains may exhibit exquisite substrate selectivity. Both
PTKs and PTPs are highly expressed in the immune system, which may
account for their regulation of antigen-receptor-mediated lymphocyte activation,
cytokine-induced differentiation and responses to many other stimuli. It is still far
from clear what most of the numerous PTPs found in immune cells do and
which of them dephosphorylate key signaling proteins, including various PTKs
and their immediate substrates.

5
LYP, a 110-kDa PTP which is encoded by the PTPN22 gene, is strictly
expressed in hemopoietic cells (Cohen et al., 1999). It plays an important role in
negatively regulating TCR signaling. LYP consists of an N-terminal
phosphatase domain and a C-terminal non-catalytic domain with several
proline-rich motifs. It belongs to the NT4 (non-transmembrane 4) family of PTPs.
There are two other members in this family: PEST (Pro, Glu, Ser, Thr-rich PTP)
and BDP1 (brain-derived phosphatase 1). They are highly homologous within
the phosphatase domain (Andersen et al., 2001). During signal transduction,
LYP interacts with the SH3 domain of the Csk kinase (Cloutier and Veillette,
1996), an important suppressor of the Src family kinases Lck and Fyn, through
its most N-terminal proline-rich motif. The dephosphorylation of
TCR-associated kinases, like Lck, Fyn and ZAP-70, accounts for the inhibitory
effect of LYP on T-cell activation (Cloutier and Veillette, 1999) (Figure 1).

Recent studies found that a SNP C1858T (R620W) in LYP is associated with
type I diabetes (Bottini et al., 2004), rheumatoid arthritis (Begovich et al., 2004),
systemic lupus erythematosus (SLE) (Kyogoku et al., 2004) and Graves’
disease (Velaga et al., 2004). This SNP generates an amino acid substitution
R620W, which disrupts an interaction between LYP and Csk. Interestingly, the
failure of binding to Csk does not compromise the repressing activity of LYP.
Instead, the W620 variant was shown to be a gain-of-function mutant, resulting
in increased phosphatase activity and further attenuation of T-cell activation

6
(Vang et al., 2005). It is possible that LYP W620 predisposes to autoimmune
disease because it suppresses TCR signaling more efficiently during thymic
development, resulting in the survival of autoreactive T cells that would have
been deleted by negative selection in individuals carrying the variants (Bottini et
al., 2006). In addition, W620 might be acting at the regulatory T cell level,
decreasing their activity and thus favoring the autoimmunity. Thus, we have
reason to believe that inhibition of LYP in people carrying predisposing gene
variants would be a promising approach to treat autoimmune diseases.

7

Figure 1. Clustering of the T-cell receptor and a co-receptor initiates signaling
within the T cell. When T-cell receptors become clustered on binding MHC:peptide
complexes on the surface of an antigen-presenting cell, activation of
receptor-associated kinases such as Fyn leads to phosphorylation of the CD3 γ, δ, and
εITAMs as well as those on the ζ chain. The tyrosine kinase ZAP-70 binds to the
phosphorylated ITAMs of the ζ chain, but is not activated until binding of the co-receptor
to the MHC molecule on the antigen-presenting cell (here shown as CD4 binding to an
MHC class II molecule) brings the kinase Lck into the complex. Lck then
phosphorylates and activates ZAP-70. (Figure 6-12, Immunobiology, 6
th
edition.
Garland Science 2005)

8
Chapter 2. Biochemical characterization of LYP and PEST

Materials and Methods
cDNA and Reagents. A cDNA encoding human LYP1 was obtained from
Tomas Mustelin (The Burnham Institute for Medical Research, La Jolla, CA). A
cDNA encoding human PTP-PEST was obtained from Axel Ullrich (Max Planch
Institute for Biochemistry, Germany). PfuUltra polymerase was purchased from
Stratagene, CA. Amplified products were purified using a PCR Purification Kit
from QIAGEN, CA. Restriction enzymes and T4 ligase were obtained from New
England Biolabs, MA. DNA sequencing was performed using the BigDye
Terminator v3.1 Cycle Sequencing Kit from Applied Biosystems, CA. The
tyrosine phosphopeptides were purchased from Celtek, LLC (Nashville, TN). All
other reagents were purchased from Invitrogen, CA or Sigma, MO. The catalytic
domain of LYP1 (a.a. 2-295) was cloned between the BamHI and XhoI sites of
the pET28a(+) vector (primers LYPCAT-F,
CGGGATCCGACCAAAGAGAAATTCTG and LYPCAT-R,
CCCAAGCTTTTAATCCATCTGTCTCTTAAATAG), which allows the expression
of proteins with an N-terminus cleavable 6xHis tag. The catalytic domain of
PTP-PEST (a.a. 2-323) was cloned in the same vector using a similar strategy
(primers PEST-F, CGGGATCCGAGCAAGTGGAGATCCTG and PEST-R,
GCCCTCGAGTTAGCTGATCATGTTTTCAGTGTT).

9
Protein expression and isolation. Plasmid constructs were transformed into
E. coli BL21(DE3) codonPlus-RIL cells. Cells were grown overnight at 37°C on
Luria-Bertani (LB) agar plates containing 50ng/ml of kanamycin. Liquid cultures
of E. coli were performed in LB medium containing 50ng/ml of kanamycin. IPTG
was added to the cultures to a final concentration of 0.5mM when the optical
density at 595nm had reached 0.5. Cells were harvested after 4 hours of
induction. Isolation of His
6
-tagged recombinant proteins was performed by
single-step affinity chromatography using Ni-nitrilotriacetic acid (NTA) agarose
columns. The purity of the recombinant proteins was consistently over 95%, as
determined by Coomassie blue staining of polyacrylamide gels.

In vitro phosphatase assays. All reactions were carried out at 37°C in a 50 µl
total volume in polystyrene flat-bottom 96-well plates. The reaction buffer
contained 50mM Bis-Tris, 1mM dithiothreitol (DTT), pH 6.0. When pNPP was
used as a substrate, the substrate hydrolysis rate was measured by reading the
p-nitrophenol absorbance at 405nm after addition of 200 µl of 1M NaOH to the
reaction mixture. The nonenzymatic hydrolysis of the substrate was corrected
by measuring the control without addition of enzyme. When the
phosphotyrosine peptide was used as a substrate, the amount of free
phosphate released, which was correlated to hydrolysis rate, was measured by
reading absorbance at 620nm after adding BIOMOL GREEN reagent (BIOMOL
International, Plymouth Meeting, PA). When fluorescence peptide was used as

10
a substrate, the excitation wavelength was 334nm and the emission wavelength
was 460nm. Absorbance readings were carried out on a VICTOR
3
V 1420
Multilabel Counter (PerkinElmer, Shelton, CT). Time of reaction, amount of
enzyme and substrate concentration were optimized to have a linear kinetics.
The initial hydrolysis rate (v
0
) was measured in triplicate and kinetic parameters
were determined by fitting the data to the Michaelis-Menten equation using
nonlinear regression and the Prism software (GraphPad Prism version 4.0 for
Mac OS X; GraphPad Software, San Diego, CA).

Results
The prerequisite of my project was to obtain a reasonable amount of highly pure
LYP . To accomplish this task, we decided to express the recombinant proteins in
E. coli, and isolate the proteins using an affinity purification method. At the
beginning, we cloned several fragments of LYP catalytic domain into the pEGST
vector, which carried an N-terminal GST tag. Instead of cloning the full-length
LYP, we were only interested in the phosphatase domain which forms the
minimal unit retaining catalytic activity. Unfortunately, all of these GST-tagged
constructs were insoluble. During the isolation, we found that there was little, if
any, protein in the supernatant. Since GST may interfere with the folding of its
immediate downstream fusion protein, we used a different vector, pET28a(+), to
build more constructs carrying an N-terminal 6xHis tag. In the end, we got one
single construct carrying a fragment of amino acid 2 to 309 which was shown to

11
be partially soluble. This His-tagged catalytic domain of LYP (His-LYPCAT) was
purified to 95% homogeneity using Ni-NTA beads.

Since both PEST and BDP had a catalytic domain of similar sequence to that of
LYP, we wanted to purify these two proteins as controls in the future
counter-screen experiments for LYP specific inhibitor. We cloned and purified
the His-tagged catalytic domain of PEST (His-PESTCAT), which shared a
homologous region with LYPCAT according to the sequence alignment.
Concerned that the histidine-tag may affect the biochemical properties of PTPs,
we cut the tag off with thrombin and collected the purified proteins (Figure 2).

12

We were unable to isolate and purify BDP, the last member of the NT4 family
using the same strategy shown above. First of all, the His-tagged catalytic
domain of BDP (His-BDPCAT) was more severely insoluble than the other two
PTPs. When treated with thrombin, it was cut non-specifically inside. Then we
tried two approaches to address this problem. First, we introduced a TEV
proteinase recognition site in the N-terminus of the protein. However, TEV did
not efficiently cut off the tag of the fusion protein. Second, we cloned this
BDPCAT fragment into pEGST vector and tried to express it as a GST-fusion
protein. Unfortunately, this construct was not soluble just like all the other GST
constructs designed before.
Figure 2. Protein purification. The phosphatase domains of LYP (amino acids 2-309)
and PEST (amino acids 2-323) were cloned into the E.coli expression vector pET28a(+),
with a 6xHis tag at the NH
2
terminus to facilitate purification. The cell lysates were
sequentially treated with Ni-NTA agarose beads and thrombin. The protein concentrations
were measured by Bradford assay. The purity of each protein was assessed by
Coomassie Blue staining. Left, 300ng of LYPCAT; right, 300ng of PESTCAT.

13
The next step was to study the biochemical properties of LYP and PEST using in
vitro phosphatase assays. We used three different substrates: pNPP
(para-nitrophenyl-phosphate), phosphotyrosine peptides and fluorescent
peptides. The principle behind these assays was the same: performing a
dephosphorylation reaction and detecting the change of physical or chemical
properties between the reactants and products. pNPP was a colorless
compound. After hydrolysis, it lost the phosphate group and became
para-nitrophenol, which was bright yellow and could be detected at 405nm. The
phosphotyrosine peptide was synthesized as a 14-mer bearing the same
sequence as the auto-phosphorylation site of Lck Y394, a natural substrate of
LYP in the cell. A phosphorylated tyrosine was incorporated instead of tyrosine
394. Once this peptide got hydrolyzed, the free phosphate released could be
detected by measuring the absorbance at 620nm after being treated with
BIOMOL GREEN. Fluorescent peptides (9-mer and 14-mer) also had the same
sequence as the natural substrate binding site, with a fluorescent amino acid
pCAP (phosphorylated coumaryl amino acid) incorporated instead of tyrosine
394. Once hydrolyzed to CAP, the peptides underwent a large increase in
fluorescence intensity which was linearly in proportion to concentration.

Since salt concentration might affect enzymatic activity under physiological
conditions, we performed the assays with different amount of NaCl. As we
expected, both enzymes became inactivated as the salt concentration

14
increased (Figure 3a). We also tested the enzymatic activity of both LYPCAT
and PESTCAT under different pH values using pNPP as substrate. We found
that both enzymes were most active at pH 6.0. At pH 7.4, they retained about
60% activity (Figure 3b). In the last part of the biochemical characterization, we
determined the inhibitory effect of vanadate, which was a generic phosphatase
inhibitor, on both enzymes. Interestingly, LYP was more sensitive to vanadate
than PEST (Figure 3c). Preliminary data showed that in the pNPP assay, both
LYP and PEST displayed Michaelis-Menten kinetics (Figure 4a). The two
enzymes hydrolyzed phosphotyrosine peptide with less discrepancy (Figure 4b).
Finally, we detected no difference between the capacities of both enzymes to
hydrolyze pCAP peptide (14-mer) (Figure 4c). Table 1 showed a summary of the
kinetic parameters of LYP and PEST. The fluorescent 14-mer was shown to be a
good substrate for both enzymes. We observed a significant increase of
fluorescence intensity using much less enzyme than in pNPP assay. The
incubation time could also be reduced to 3-5 minutes.

15

pH on pNPP
3 4 5 6 7 8 9
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0.40
0.45
0.50
0.55
LYPCAT before N
PEST before NaO
pH
Figure 3. Biochemical characterizations of LYPCAT and PESTCAT using pNPP as the
substrate. The reactions were performed in 50mM Bis-Tris, pH 6.0 (a, c), 1mM DTT. 5mM
of pNPP was incubated with 0.4 µM of LYPCAT/PESTCAT at 37°C for 20 minutes. Each
reaction was carried out in triplicate. (a) Different amounts of NaCl were included in the
reactions. The lowest concentration of NaCl was 0.01mM. (b) Sodium citrate (pH 4.0, 5.0
and 5.5), Bis-Tris (pH 6.0) and Tris-HCl (pH 7.0 and 8.0) were used as reaction buffers. (c)
Different amounts of vanadate were included in the reactions.
a.
b.
c.
LYPCAT and P ESTCAT
-0.100
0.000
0.100
0.200
0.300
0.400
0.500
0.600
0.700
0 0.00002 0.0002 0.002 0.02 0.2 2
[Vanadate] (m M)
LYPCAT
PES TCAT

16

M-M LYP and PEST on pNPP
0 1 2 3 4 5 6
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
LYPCAT
PESTCAT

VMAX
KM
LYPCAT
0.4337
1.817
PESTCAT
1.036
3.192
[pNPP] (mM)
M-M of pY peptide by
LYP and PEST
0.0 0.1 0.2 0.3 0.4 0.5
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0.40
0.45
0.50
0.55
LYPCAT
PESTCAT

VMAX
KM
LYPCAT
0.4716
0.07069
PESTCAT
0.6145
0.1118
[pY peptide] (mM)
pCAP peptide hydrolysis by
LYP and PEST
0.0 0.1 0.2 0.3 0.4 0.5
0
25000
50000
75000
100000
125000
150000
175000
200000
225000
LYPCAT
PESTCAT

VMAX
KM
LYPCAT
227325
0.08100
PESTCAT
229759
0.08408
[pCAP] (mM)
Figure 4. Non-linear fit of experimental data to Michaelis-Menten equation using
different substrates. The buffer used for both enzymes was 50mM Bis-Tris (pH 6.0), 1mM
DTT. (a) pNPP was incubated with 0.4 µM of LYPCAT or PESTCAT for 20 minutes at 37°C;
(b) Lck pY394 14-mer was incubated with 0.1 µM of LYPCAT or PESTCAT for 3 minutes at
37°C; (c) pCAP 14-mer was incubated with 0.1 µM of LYPCAT or PESTCAT for 5 minutes at
37°C.The time of the reaction, amount of enzyme, and concentration of the substrate were
optimized to have a linear kinetics (data not shown).
a. b.
c.

17
Table 1. Kinetic parameters for LYPCAT and PESTCAT

*The kinetic parameters in pNPP assays were calculated using the extinction coefficient of
18.000 M
-1
cm
-1
; **the release of inorganic phosphate was calculated by comparison with a
standard curve of inorganic phosphate;
+
the amount of fluorescent 14-mer hydrolysis was
calculated by comparison with a standard curve of MU (7-hydroxy-4-methylcoumarin, which
was an analog of CAP and has the same intrinsic fluorescence).

Discussion
We have been trying to isolate and purify all three enzymes in the same PTP
family, because we need PEST and BDP to counter-screen for the LYP
specificity of any inhibitor we obtain in future. BDPCAT will be the last enzyme to
be expressed and purified. To solve the severe solubility problem, we have been
thinking of several approaches. First, we could isolate the His-tagged BDPCAT
under denaturing conditions and refold the protein subsequently. Since
renaturation conditions must be determined empirically for each individual
protein, we should consider the following pitfalls when designing experiments. 1)
The protein concentration should be low. 2) Include thiol reagents to
accommodate appropriate disulfide bonds. A pair of reduced glutathione (GSH)

Enzyme Substrate K
m
(M) V
max
(M/s) k
cat
(s
-1
)
k
cat
/K
m

(M
-1
s
-1
)
pNPP* 1.817 x 10
-3
1.17 x 10
-4
292.5 1.61 x 10
5

Lck pY394** 7.069 x 10
-5
4.42 x 10
-7
4.42 6.25 x 10
4

LYPCAT
Lck pCAP394
+
8.100 x 10
-5
1.17 x 10
-6
11.69 1.44 x 10
5

pNPP 3.192 x 10
-3
2.80 x 10
-4
700 2.19 x 10
5

Lck pY394 1.118 x 10
-4
5.90 x 10
-7
5.90 5.28 x 10
4

PESTCAT
Lck pCAP394 8.408 x 10
-5
1.18 x 10
-6
11.83 1.41 x 10
5

18
and oxidized glutathione (GSSG) creates the necessary oxidizing potential and
allows the optimal, native conformation to be reached. 3) Remove denaturants
slowly by dilution or dialysis to prevent protein aggregation. We could add
glycine to improve the solubility, or use low concentration of urea to stabilize the
protein upon refolding. 4) Include salts and maintain neutral pH. Second, we
could build a different construct. Nus-tag and Trx-tag from the Novagen pET
vector system have been reported to enhance the solubility of their fusion
partners (LaVallie et al., 1993; Novy et al., 1995; Davis et al., 1999; Harrison,
2000). The Nus-tag and Trx-tag vectors together with trxB/gor mutant host
strains facilitate disulfide bond formation in the cytoplasm, which may help
maximize the level of soluble, active, properly folded protein. On the other hand,
we could use a different length of catalytic domain without compromising the
sequence homology. Shorter peptides may have greater solubility. Third, we
may consider using fusion BDPCAT retaining the histidine tag. Before doing this,
we need to check whether the histidine tag affects its biochemical characters. If
we see significant difference between His-tagged BDPCAT and BDPCAT, we
need to use all three enzymes in their His-tagged forms. If the tag does not have
an effect, we can use only His-tagged BDPCAT. Fourth, we may use a different
expression system, e.g. insect cells infected by baculovirus, yeast or
mammalian cells. The advantages include amicable cellular environment,
functional disulfide bridges and eukaryotic-specific post-translational
modifications which lead to proper folding of the recombinant proteins. But the

19
process takes much more time to be accomplished. Recently Dr. Yingge Liu (Dr.
Bottini’s lab, USC Keck school of Medicine) has successfully expressed
full-length LYP using the insect cell system.

We have already seen that LYP and PEST have different sensitivity to vanadate.
The following step is to determine its inhibition mechanism. We plan to choose
several vanadate concentrations according to the dose-dependence curve, and
use Lineweaver-Burk equation in data analysis. We can also characterize other
phosphatase inhibitors like metal ions, NaPP, NaF etc. From our initial studies
using pNPP as a substrate, we found that at pH 4.0, NaOH, which was added to
stop the reaction and enhance the absorbance, greatly affected the reading.
Before adding NaOH, there was no apparent activity of both LYPCAT and
PESTCAT; when NaOH was included, the reading of LYPCAT increased
significantly, while there was no change in PESTCAT reading. This may suggest
that NaOH can generate some artifacts that are not a result of activity. In order
to confirm this, we plan to repeat all the biochemical reactions without NaOH.

20
Chapter 3. Search for small molecule inhibitors

After we purified the catalytic domain of LYP, and studied its biochemical
property, we would screen a small molecule library for a specific LYP inhibitor
using the in vitro phosphatase assay under optimal conditions (see Chapter 2).

Methods
Small molecule screening assays. All reactions were carried out at 37°C in a
55.6 µl total volume in polystyrene 96-well plates with flat bottoms. The reaction
buffer contained 50mM Bis-Tris, 1mM dithiothreitol (DTT), 10% DMSO, pH 6.0.
Small molecules were prepared in DMSO and included in reactions to assess
the inhibition effects. When pNPP was used as a substrate, the substrate
hydrolysis rate was measured by reading the p-nitrophenol absorbance at
405nm after addition of 200 µl of 1M NaOH to the reaction mixture. The
nonenzymatic hydrolysis of the substrate was corrected by measuring the
control without addition of enzyme. When 6,8-difluoro-4-methylumbelliferyl
phosphate (DiFMUP) was used as a substrate, the excitation wavelength was
358nm and the emission wavelength was 455nm; when fluorescence peptides
were used as a substrate, the excitation wavelength was 334nm and the
emission wavelength is 460nm. Absorbance readings were carried out on a
VICTOR
3
V 1420 Multilabel Counter (PerkinElmer, Shelton, CT). Time of

21
reaction, amount of enzyme and substrate concentration were optimized to
have a linear kinetics. The initial hydrolysis rate (v
0
) was measured in triplicate
and kinetic parameters were determined by fitting the data to the
Michaelis-Menten equation using nonlinear regression and the Prism software
(GraphPad Prism version 4.0 for Mac OS X; GraphPad Software, San Diego,
CA). In order to search for a small molecule inhibitor, we collaborated with Dr.
Nouri Neamati, who kindly provided us with a small molecule library for drug
designing purpose. With the help of Dr. Deng, we screened about 1500
compounds using the pNPP assay. We used 100 µM of compounds in the first
round of screening.

Results
About 10% of the compounds showed inhibitory activity. In the second round,
we screened these potential candidates at 100 µM, 33 µM and 11 µM to generate
dose-dependent curves, from which we determined IC
50
for each compound
(Table 2).

As mentioned before, pCAP peptides were shown to be substrates for PTPs. In
addition to the advantage of being suitable to continuous assays, pCAP
peptides might provide more specific phosphatase assays compared to generic
PTP substrates (i.e. pNPP and DiFMUP). The catalytic domain of PTP was

22
composed of a catalytic pocket, which was conserved in various PTPs, and a
peripheral domain which provided the substrate-specificity.

Cpd.
IC
50
( µM
)
Cpd.
IC
50
( µM)
Cpd.
IC
50
( µM)
Cpd.
IC
50
( µM)
AS187 60, 58 AS205 9,20,25 AS198 20, 48 AS182 50
AS178 45, 65 LX104 15, 10 LX102 35, 28 AS172 90
AS160 75, 85 A V58 63, 17 A V55 76, 65 AS139 25,46, 17
AS138 26, 52, 8 LX107 55, 55 AS376 50, 28 AS129 50
AS80 40, 78 AS373 58, 35 AS350 85, 45 AS28 27,80, 56
AS26 55, 99 AS346 88, 55 AS338 90 AS24 62
AS22 79 Mpd4 90, 88 MPD3 75, 56 AS127 47
AS342 85 MP30 68, 55 Mpd23 25, 26 AS330 22, 38
AS306 58, > 100 LX120 30, 42 LX117 50 AS289 35, 53
AS207 18, 70,
X255A27
98
X255A26
100
X255A24
102
X255A2
3
104
X255A21
98 T32 80 XR44 82
X135 95 NCS66 18 NCS65 95 NCS64 87
G4442 90 G4441 25 BSN15 80 HD34 77
DFC1 77 DFC18 15 DFC18 23 NP18 17
SPI177E
65
SPI177F
63
SPI177J
33 X159 110
2A17 95 LJ7 77 NP24 23
SPI177B
70
LX25 73 HD22 75

AS285 29, 75, LX111 65, 70 AS216 63, 90 AS238 50
The reactions were performed in 96-well plates in 50mM Bis-Tris, pH 6.0, 1mM DTT . 5mM of
pNPP was incubated with 0.4 µM of LYPCAT/PESTCAT at 37°C for 20 minutes. Each
reaction was carried out in duplicate. Three concentrations of each molecule (11 µM, 33 µM
and 100 µM) were used to determine IC
50
values.
Table 2. IC
50
values for representative small molecules in phosphatase

23
The P-loop of LYP (also called the signature sequence), which had 7 amino
acids and centers on Cys-227, interacted with the phosphate group. In other
words, different PTPs might have similar catalytic pocket and the same
mechanism to remove phosphate groups from their substrates; however, they
must have unique peripheral domains to recognize their own substrates. Since
the pCAP peptides contained a stretch of residues that mimic the signature
sequence, we expected to obtain more specific inhibitors using pCAP peptides
as substrates compared to generic small molecule substrates (pNPP and
DiFMUP) in the screening studies. In order to confirm this, we performed
screening assays using all three substrates (pNPP, DiFMUP and pCAP 9-mer).
In the pair-wise comparisons, we could see the differences of inhibition between
pCAP 9-mer and other two substrates (Figure 5). The distributions of data
points indicated that some inhibitors obtained from pNPP or DiFMUP screening
were less effective in pCAP peptide screening. In the dose-dependent studies,
some small molecules had lower IC50 values in DiFMUP screening than those
in pCAP peptide screening (Figure 6), which again confirmed that the screening
results depended on the substrate used in the assay.

24

Figure 5. Substrate dependence in small molecule screenings. In vitro phosphatase
assays were performed in the presence of 40 µg/ml of small molecule compounds. 5mM
pNPP, 0.2mM DiFMUP or 0.2mM pCAP 9-mer peptide was incubated with 0.2 µM, 5nM or
25nM of LYPCAT, respectively. The inhibition percentage was calculated as the reduction of
enzymatic activity compared to the reaction with no compound. Time of the reaction,
amount of enzyme, and concentration of the substrate were optimized to have a linear
kinetics (data not shown). Each point represented the average of three identical reactions of
a single compound. The slope of best-fitting curve ( β) was shown on each plot.

β=0.83
β=0.84 β=0.95

25

E3P17
0 10 20 30 40 50
-10
0
10
20
30
40
50
60
70
80
90
100
110
120
DiFMUP
pCAP9mer
[Cpd.] (ug/ml)
C2P20
0 10 20 30 40 50
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
DiFMUP
pCAP9mer
[Cpd.] (ug/ml)
D11P12
0 10 20 30 40 50
0
25
50
75
100
125
DiFMUP
pCAP9mer
[Cpd.] (ug/ml)
G9P13
0 10 20 30 40 50
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
DiFMUP
pCAP9mer
[Cpd.] (ug/ml)
E7P16
0 10 20 30 40 50
0
10
20
30
40
50
60
70
80
90
100
110
120
DiFMUP
pCAP9mer
[Cpd.] (ug/ml)
H8P15
0 10 20 30 40 50
0
10
20
30
40
50
60
70
80
90
100
110
120
DiFMUP
pCAP9mer
[Cpd.] (ug/ml)
Figure 6. Substrate dependence in dose-dependence studies. In vitro phosphatase
assays were performed in the presence of indicated amounts of small molecule
compounds. 5nM or 25nM LYPCAT was incubated with 0.2mM DiFMUP or pCAP 9mer
peptide, respectively. Each point represented the average of three identical reactions.

26
Counter-screening, which referred to screening the potential inhibitors using
enzymes other than the target, was crucial in drug discovery process. An ideal
inhibitor should specifically inhibit the targeted enzyme without compromising
any other enzymatic function. As mentioned before, we expected to get more
specific LYP inhibitors using pCAP peptides as the substrates compared to
using pNPP or DiFMUP as the substrate. Thus, there would be reduced need
for counter-screening. Our biochemical studies showed that all the other three
PTPs (HePTP, LMPTP and PTP1B) efficiently hydrolyze pCAP peptides (Figure
7 and Table 3). After adjusted for basal activity (measured by DiFMUP
hydrolysis), we found that pCAP 14-mer behaved as a more specific substrate
for LYP than pCAP 9-mer (Table 3, relative k
cat
(14-mer/9mer)=7.3, relative
K
m
=0.4, relative k
cat
/K
m
=16.5).

27
Table 3. Kinetic parameters of PTP assays

k
cat
(s
-1
) DiFMUP Lck9mer Lck14mer 9mer/DiF 14mer/DiF 14mer/9mer
LYP(CAT) 6.7 2.2 16 0.3 2.4 7.3
(His)HePTP(CAT) 30 34 24.5 1.1 0.8 0.7
LMPTP(1) 30.2 13.4 6.4 0.4 0.2 0.5
PTP1B 89 195 137 2.2 1.5 0.7

k
cat
/K
m
(×10
6
M
-1
s
-1
) DiFMUP Lck9mer Lck14mer 9mer/DiF 14mer/DiF 14mer/9mer
LYP(CAT) 0.9 0.1 1.3 0.1 1.5 16.5
(His)HePTP(CAT) 2.3 1.0 0.4 0.5 0.2 0.4
LMPTP(1) 0.7 0.1 0.0 0.1 0.0 0.6
PTP1B 9.6 2.9 1.7 0.3 0.2 0.6

K
m
(×10
-6
M) DiFMUP Lck9mer Lck14mer 9mer/DiF 14mer/DiF 14mer/9mer
LYP(CAT) 7.4 27.2 12 3.7 1.6 0.4
(His)HePTP(CAT) 13.3 32.6 56.3 2.5 4.2 1.7
LMPTP(1) 42.4 231.5 186.8 5.5 4.4 0.8
PTP1B 9.3 66.9 78.6 7.2 8.5 1.2

28

Figure 7. Michaelis-Menten kinetics of other phosphatases. In vitro phosphatase
assays were performed as described in Figure 2. Each point represented the average of
three identical reactions. Time of the reaction, amount of enzyme, and concentration of the
substrate were optimized to have a linear kinetics (data not shown).

29
Discussion
As mentioned before, we planned to take two approaches for the purpose of
finding a LYP inhibitor. Currently we are collaborating with Dr. Amy Barrios
(Department of Chemistry, USC) to build a peptide library specific for LYP. This
library will be based on the sequence flanking Lck Y394, the natural substrate of
LYP, with fluorescent amino acid incorporated. Due to the difficulty of handling
large-scale peptide synthesis, we will fix one terminal of the peptide (e.g.
C-terminal to Y394) and randomly change the amino acids on each position on
the other terminal. Then we will screen this library for a good substrate for LYP,
and counter-screen using PESTCAT and His-BDPCAT for the most specific
substrate for LYP. An alternative is to replace Y394 with an inhibitor group,
which cannot be dephosphorylated. The peptide synthesized this way is
expected to competitively inhibit LYP activity. Lastly, we will modify the specific
peptide inhibitor to deliver it into the cells. Recently, Stephanie Stanford in our
lab did some preliminary experiments to show that attaching antennapedia or
polyarginine tag to the terminus of peptides would be a feasible way to get
exogenous polymers across the plasma membrane. By means of flow
cytometry, Stephanie showed that 33.9% of polyarginine-tagged peptides were
internalized by cells. People in other groups showed that antennapedia tag
facilitates peptide penetration (Zhang and Smith, 2005; Alonso et al., 2004).
Thus, we might be able to translocate a sufficient amount of peptide inhibitor
into the cells.

30
We are collaborating with Dr. Nouri Neamati (School of Pharmacy, USC) to
screen for a small molecule inhibitor. We have already found some lead
compounds after screening a part of the library. We plan to deduce a general
pharmacophore model by analyzing the structures of these active molecules.
Once we get the model, we can design more compounds, which are probably
more active, with the help from computational chemistry. Since the protein
structure is instrumental to inhibitor screening, we are collaborating with Dr.
Xiaojiang Chen (Department of Molecular and Computational Biology, USC) to
solve the 3D-structure of LYP. If we can obtain the structure with certain
resolution, we could use the structural information about catalytic domain to
search the database to find any compound that fits the target conformation. In
this way the screening process will be shortened with greater odds to “hit the
target”. Meanwhile, we are going to screen the small molecule library using
DiFMUP as a substrate. Compared to the pNPP assay, it is more sensitive so
that much less enzyme is needed (e.g. in a typical in vitro phosphatase assay,
up to 40 times enzyme is needed for pNPP to get the same level of
signal-to-background ratio as that for DiFMUP). In addition, the reaction goes
faster and does not need to be stopped (e.g. pNPP needs 20 minutes to be
hydrolyzed, while DiFMUP needs less than 5 minutes). We are going to send
the recombinant LYP to NIH, where with the help from robots, people can
screen a library hundreds of times as large as the one we have. Hopefully we
will get some leads that have IC
50
in the range of several micromolar or even

31
nanomolar. Then we will counter-screen these leads using PEST, BDP and
other enzymes to check for specificity. Afterwards we will get the potential
inhibitor across cell membrane, and examine its effect on T-cell signaling. If LYP
is inhibited in vivo, we expect to see up-regulated T-cell activation.

Although DiFMUP has several advantages in screening such as high sensitivity,
high signal-to-background ratio, short incubation time and easy handling
process, it lacks the ability to distinguish between similar PTPs. In other words,
the positive leads found from DiFMUP screening may inhibit a panel of PTPs,
since they simply disrupt the nucleophilic attack that happens at the catalytic
site. Thus, we may get a significant amount of false- positive results in the
inhibitors we obtain.

The pCAP peptides are synthesized to address this issue. Each PTP has its
unique catalytic domain composed of nucleophilic residue (i.e. the catalytic site)
and other peptidic sequences which provide necessary interactions with the
substrate (e.g. hydrophobic interaction and hydrogen bonds). The catalytic
domain provides the substrate specificity for individual PTP . The pCAP peptides
used in our study (9-mer and 14-mer of Lck Y394) have the same sequence of
the auto-phosphorylation site on Lck, which is a known substrate of LYP in vivo.
As expected, pCAP 9-mer showed some specificities for LYP compared to
pNPP and DiFMUP (Figure 5 and 6) However, both pCAP 9-mer and 14-mer

32
were shown to be good substrates for HePTP, PTP1B and LMPTP as well
(Figure 7). The possible explanation is that the sequences of the peptides only
cover small fragments of the inner catalytic pocket of LYP. Thus, the peptides
were not long enough to reach the peripheral domain of LYP. Actually, this
hypothesis was confirmed by our peptides comparison study (Table 3), which
showed that the 14-mer was more selective for LYP than the 9-mer. We have
reason to believe that if we make the peptide even longer (on both ends), it will
become a more specific substrate for LYP. However, it will take more resources
to synthesize a longer peptide, and the quality and yield will decrease. So we
need to find a balance between the specificity and feasibility.

Once we obtain the LYP inhibitor, we will first examine its inhibition mechanism
using in vitro phosphatase assays. Two sets of rate measurements will be
carried out, with the enzyme concentration held constant. In the first set,
substrate concentration is also held constant, permitting measurement of the
effect of increasing inhibitor concentration on the initial rate (i.e. determine the
IC
50
). In the second set, inhibitor concentration is held constant but substrate
concentration is varied. The results are plotted as the reciprocal of initial rate
versus the reciprocal of substrate concentration. We can determine whether the
inhibitor follows competitive inhibition kinetics or uncompetitive inhibition
kinetics from this double-reciprocal plot. We will see below that this information

33
is critical to examine the in vivo effects of the inhibitor on antigen
receptor-mediated T cell signaling.

As mentioned before, it has been shown that antennapedia or polyarginine tag
can facilitate the cellular uptake of exogenous peptides (Derossi et al., 1994;
Rothbard et al., 2002). The antennapedia tag is a 16-amino acid peptide
corresponding to the third helix of the homeodomain of Antennapedia protein. It
is composed of basic and hydrophobic amino acids, and is able to translocate
across biological membranes by an energy-independent mechanism.

Polyarginine tag is a stretch of 7 or more arginine residues. Homopolymers or
peptides containing a high percentage of cationic amino acids have a unique
ability to cross the plasma membrane of cells, and consequently have been
used to facilitate the uptake of biopolymers and small molecules. In our studies,
the target peptides have fluorescent amino acids incorporated, which enable us
to easily track the peptides by flow cytometry.

Once the inhibitor successfully gets across the plasma membrane, we will take
several approaches to assess its effects on TCR signaling. 1) We will examine
the modification of cellular protein tyrosine phosphorylation level using
immunoblot. There are extensive studies showing that LYP regulates only a
restricted set of substrates. Consequently, we expect to see little change in

34
global phosphorylation level. Since LYP down-regulates TCR signaling by
dephosphorylation of Src family kinases (Lck, Fyn) and Zap70, we expect to see
augmentations of phosphorylated LYP substrates with treatment of inhibitor. We
are also interested to see whether there will be any change in the
phosphorylation level of other proximal molecules involved in TCR signaling
(e.g. ITAM in zeta subunit, Erk2). 2) LYP W620 is known to be a gain-of-function
variant. We will treat the cells that over-express W620 with the inhibitor and
examine whether the TCR signaling can be brought down to the same level as
in cells that over-express R620. 3) We will investigate the effects of the inhibitor
on T cell activation. There are several approaches we can take. To stimulate T
cells, we can use anti-CD3 α and anti-CD28; for the control, we can use PMA
plus ionomycin, which bypasses early TCR signaling events. The interleukin-2
(IL-2) released in the culture supernatant can be quantitated either by ELISA or
by measuring incorporation of tritiated thymidine in the IL-2-dependent indicator
cell line HT-2. Luciferase reporter assay is a good alternative to give us strong
evidence about T cell activation. We can transfect the cells with a luciferase
reporter gene driven by the nuclear factor of activated T cells (NFAT)/activator
protein-1 (AP-1) transcription factor complex. In cells treated with the LYP
inhibitor, we expect to see up-regulated TCR signaling, and thus more IL-2
produced and higher luciferase activity than that of untreated cells.

35
In addition to assessing the modifications of TCR signaling in T cell lines, we are
also interested to do the investigations in human primary T cells. It has been
reported that LYP-Trp620 inhibits primary T cell activation more potently than
LYP-Arg620 (Vang et al., 2005). We will collect primary T lymphocytes from
individuals with T1D of genotype PTPN22
1858C/1858T
, and treat them with the LYP
inhibitor to see if the TCR signaling can be recovered. All the methods that can
be used in T cell lines can also be used in primary T cells.

Lastly, we can use the LYP inhibitor in mouse models to assess its effects on T
cell development and differentiation. Given that the phosphatase domain of
PEP (mouse homolog of LYP) shares a significant similarity in the sequence
with LYP, we expect that the LYP inhibitor will also repress the activity of PEP.
This needs to be confirmed by in vitro phosphatase assays, though. Recently
Hasegawa et al. discovered that although normal naïve T cell functions were
retained in Pep-deficient mice, effector/memory T cells showed increased
expansion and function. We are curious to see whether LYP inhibitor can
generate similar effects in vivo. Once the dosage and optimal treatment
strategies have been determined, such an inhibitor could be of broader value for
preventing the emergence or reappearance of those autoimmune diseases
predisposed by LYP-Trp620.

36
Chapter 4. RNAi knockdown of LYP

For the last part of my project, we planned to examine the effect of LYP
knockdown in the cellular environment using small interference RNA (siRNA).

Methods
Cell culture, transfection and stimulation. The siRNA duplex si327, which
has the sequence 5’- AUUGAUGUAGCUGGAAUCCUC as previously reported
was purchased from Integrated DNA Technologies (Coralville, IA). The
scramble siRNA was a gift from Dr. Baruch Frenkel (Department of Biochemistry
and Molecular Biology, USC). Jurkat Tag cell line, a derivative of Jurkat cells
stably transfected with SV40 large T antigen, was cultured in completed RPMI
1640 (with 2 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate,
4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, 90%; fetal
bovine serum (cell culture core facility, Norris Comprehensive Cancer Center,
USC), 10%) at 37°C, 5% CO
2
. Cells were transfected in Nuclofecter Solution V
according to manufacturer’s protocol G-10 (Amaxa). Cells were then incubated
at 37°C for 48 h in completed RPMI 1640 medium before harvesting. Prior to
stimulation, cells were collected by centrifuging at 1400rpm for 5 minutes. After
that, cells were resuspended in plain RPMI at 4×10
6
cells/ml, and stimulated
with 1.5 µg/ml OKT3 (courtesy of Dr. Tomas Mustelin from Berman Institute, La
Jolla, CA) for 7 h at 37°C.

37
Luciferase assay. The NFAT and AP-1 elements of the proximal IL-2 promoter
were inserted into a luciferase reporter construct. RLO construct was used as
internal control. Both constructs were given by Dr. Mustelin as courtesy. In the
presence of indicated siRNA, 0.8mg luciferase reporter construct and 60ng
RLO construct were transfected into 4×10
6
cells. After 48 h, cells were
stimulated for 7 h with 1.5 µg/ml OKT3. After that, cells were lysed and assayed
for dual luciferase activity using Dual-Luciferase® Reporter Assay System from
Promega (Madison, WI) in accordance with the manufacturer’s instructions.
NFAT-AP-1 activation in each sample was normalized for basal renilla luciferase
activity.

Western Blot Analysis. The cells were lysed in a lysis buffer (150mM NaCl,
20mM Tris, pH7.4, 1% Nonidet P-40, 5mM EDTA, 2mM Na
3
VO
4
, 1mM PMSF)
containing 10 µg/ml aprotinin and leupeptin (Sigma, St. Louis, MO). The lysates
were cleared by centrifugation for 20 min at 13200 rpm. Protein concentration
was determined using Bio-Rad Protein Assay (Bio-Rad, CA). Equal amounts of
total protein for different samples were separated on 10% SDS-PAGE gels
under reduced conditions and then transferred onto nitrocellulose membrane
from Amersham Biosciences (Pittsburgh, PA). The blot was then incubated with
antibody against LYP (R&D systems, Minneapolis, MN), phosphorylated Erk
(Anti-Active
®
MAPK; Promega, Madison, WI), Tyr
416
-phosphorylated Lck (Cell
Signaling Technology, Danvers, MA), Erk (C-14; Santa Cruz, CA) and Lck (Cell

38
Signaling, Danvers, MA). The signals were detected by using horseradish
peroxidase-conjugated anti-IgG antibodies and ECL detection reagents
(Amersham Biosciences, Pittsburgh, PA).

Results
Figure 8a showed that when LYP was knocked down in Jurkat TAG cells, TCR
signaling was up-regulated, which in turn increased the amount of luciferase
driven by NFAT-AP-1 promoter by approximately two-fold. Figure 8b showed
that the phosphorylation level of Erk was increased upon LYP silencing in
resting cells, while it was difficult to tell whether more Lck got phosphorylated
once LYP was knocked down.

LYP
pLck
Lck
pErk
Erk
α-CD3 (min) - 1 2 - 1 2
siRNA siLYP
scrambled
a. b.
Figure 8. LYP knockdown by RNAi increases TCR signaling. (a) Luciferase assays
were performed as described in Methods. NFAT-AP-1 activation was recorded after OKT3
stimulation of Jurkat TAG cells. (b) 4.5 µg of siRNA oligos (siLYP or scrambled) were
transfected into Jurkat TAG cells. After 48 hours, cells were stimulated for indicated time
using α-CD3 and the total lysates were analyzed by Western-Blot using indicated
antibodies.

39
Discussion
These preliminary data confirmed that knockdown of LYP can result in
up-regulation of TCR signaling (Hasegawa et al., 2004). We included the study
here as a positive control for the inhibitor screening mentioned above. We
performed a set of optimization experiments to find the best conditions for
knockdown. First we tried electroporation as a method to deliver the siRNA
oligos into the cells, which was used routinely in DNA transfections in the lab.
However, we did not detect any significant knockdown. Then we switched to
nucleofection, and performed different trials including time-course study,
dose-dependence study and protocol selections. After we found the best
conditions, we decided to confirm the knockdown and TCR signaling increase
by several approaches. In luciferase assay, we were able to detect a two-fold
increase of TCR signaling measured by an NFAT-AP-1-reporter response. This
was consistent with recent results in PEP-deficient mice, which have little
phenotypic alterations in T-cell function, with enhanced activation of Lck and
expansion of memory T cells, but apparently normal naïve T-cell function
(Hasegawa et al., 2004). In Western-blot study of total cell lysates, we were able
to detect up-regulated phosphorylated Erk in resting Jurkat cells, which acted as
a downstream player in TCR signaling. But unexpectedly we could not confirm
that Lck activation was also enhanced. One possible explanation was that we
used such a strong stimulus that all the signaling molecules were engaged, and
what we detected then was just the signal at its saturated status. On the other

40
hand, we could try to look at other signal molecules that function in TCR
signaling.

There are other methods to assess the effects of LYP knockdown, which are
stated in Chapter 2 discussion section. We are also planning to check the
knockdown cells using reverse-transcribed quantitative PCR. Subsequently we
will clarify whether the knockdown also happens at the mRNA level. Lastly, we
have a fluorophore-conjugated LYP antibody which worked very well in
flow-cytometry. We are going to label the cells with this antibody, and confirm
the knockdown by FACS (fluorescent-activated cell sorting).

41
References

Alonso, A. et al. Lck dephosphorylation at Tyr-394 and inhibition of T cell
antigen receptor signaling by Yersinia phosphatase YopH. J. Biol. Chem. 279,
4922-4928 (2004).

Alonso, A. et al. Protein tyrosine phosphatases in the human genome. Cell 117,
699-711 (2004).

Andersen, J.N. et al. A genomic perspective on protein tyrosine phosphatases:
gene structure, pseudogenes, and genetic disease linkage. FASEB J. 18, 8-13
(2004).

Anderson, J.N., Elson, A., Lammers, R., Romer, J., Clausen, J., Moller, K.B. &
Moller, N.P.H. Comparative study of protein tyrosine phosphatase epsilon
isoforms: membrane localization confers specificity in cellular signaling.
Biochem. J. 354, 581-590 (2001).

Andersen, J.N. et al. Structural and evolutionary relationships among protein
tyrosine phosphatase domains. Mol. Cell. Biol. 21, 7117-7136 (2001).

Begovich, A.B. et al. A missense single-nucleotide polymorphism in a gene
encoding a protein tyrosine phosphatase (PTPN22) is associated with
rheumatoid arthritis. Am. J. Hum. Genet. 75, 330-337 (2004).

Bottini, N. et al. A functional variant of lymphoid tyrosine phosphatase is
associated with type 1 diabetes. Nat. Genet. 36, 337-338 (2004).

Bottini, N., Vang, T., Cucca, F. & Mustelin T. Role of PTPN22 in type 1 diabetes
and other autoimmune diseases. Semin. Immunol. 18, 207-213 (2006).

Cloutier, J. & Veillette, A. Association of inhibitory tyrosine protein kinase
p50csk with protein tyrosine phosphatase PEP in T cells and other hemopoietic
cells. EMBO J. 15, 4909-4918 (1996).

Cloutier, J. & Veillette, A. Cooperative Inhibition of T-Cell Antigen Receptor
Signaling by a Complex between a Kinase and a Phosphatase J. Exp. Med. 189,
111-121 (1999).

Cohen, S., Dadi, H., Shaoul, E., Sharfe, N. & Roifman, C.M. Cloning and
Characterization of a Lymphoid-Specific, Inducible Human Protein Tyrosine
Phosphatase, Lyp. Blood 93, 2013-2024 (1999).

42
Davis, G.D., Elisee, C., Newham, D.M., and Harrison, R.G. Biotechnol. Bioeng.
65, 382–8 (1999).

Derossi, D. et al. The third helix of the Antennapedia homeodomain
translocates through biological membranes. J. Biol. Chem. 269 (14), 10444-50
(1994).

Fischer, E.H. Cell signaling by protein tyrosine phosphorylation. Adv. Enzyme
Regul. 39, 359-369 (1999).

Flint, A.J., Tiganis, T., Barford, D. & Tonks, N.K. Development of
substrate-trapping mutants to identify physiological substrates of
protein-tyrosine phosphatases. Proc. Natl. Acad. Sci. USA 94, 1680-1685
(1997).

Harrison, R.G. inNovations 11, 4–7 (2000).

Hasegawa, K. et al. PEST domain-enriched tyrosine phosphatase (PEP)
regulation of effector/memory T cells. Science 303, 685-689 (2004).

Hubbard, S.R. & Till, J.H. Protein tyrosine kinase structure and function. Annu.
Rev. Biochem. 69, 373-398 (2000).

Hunter, T. Signaling – 2000 and beyond. Cell 100, 113-127 (2000).

Kyogoku, C. et al. Genetic association of the R620W polymorphism of protein
tyrosine phosphatase PTPN22 with human SLE. Am. J. Hum. Genet. 75,
504-507 (2004).

LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant, K.L., Schendel, P.F., and
McCoy, J.M. Bio/Technology 11, 187–93 (1993).

Majeti, R. et al. An inactivating point mutation in the inhibitory wedge of CD45
causes lymphoproliferation and autoimmunity. Cell 103, 1059-1069 (2000).

Mauro, L.J. & Dixon, J.E. Zip codes direct intracellular protein tyrosine
phosphatases to the correct cellular address. Trends Biochem. 19, 151-155
(1994).

Mustelin, T. Src Family Tyrosine Kinases in Leukocytes 1-155 (Landes, Austin,
1994).

43
Mustelin, T., Abraham, R.T., Rudd, C.E., Alonso, A. & Merlo, J.J. Protein
tyrosine phosphorylation in T cell signaling. Front. Biosci. 7, 918-969 (2001).

Mustelin, T., Rahmouni, S., Bottini, N. & Alonso, A. Role of protein tyrosine
phosphatases in T cell activation. Immunol. Rev. 192, 139-147 (2003).

Mustelin, T. & Tasken, K. Positive and negative regulation of T cell activation
through kinases and phosphatases. Biochem. J. 371, 15-27 (2003).

Mustelin, T., Vang, T. & Bottini, N. Protein tyrosine phosphatases and the
immune response. Nat. Rev. Immunol. 5, 43-57 (2005).

Novy, R., Berg, J., Yaeger, K., and Mierendorf, R. inNovations 3, 7–9 (1995).

O’Reilly, A.M. & Neel, B.G. Structural determinants of SHP-2 function and
specificity in Xenopus mesoderm induction. Mol. Cell. Biol. 18, 161-177 (1998).

Robertson, S.C., Tynan, J.A. & Donoghue, D.J. RTK mutations and human
syndromes when good receptors turn bad. Trends Genet. 16, 265-271 (2000).

Robinson, D.R., Wu, Y.M. & Lin, S.F. The protein tyrosine kinase family of the
human genome. Oncogene 19, 5548-5557 (2000).

Rothbard, J.B., et al. Arginine-rich molecular transporters for drug delivery: role
of backbone spacing in cellular uptake. J. Med. Chem. 45 (17), 3612-3618
(2002).

Shultz, L.D. & Green, M.C. Motheaten, an immunodeficient mutant of the
mouse. J. Immunol. 116, 936-943 (1976).

Tsui, H.W., Siminovitch, K.A., de Souza, L. & Tsui, F.W.L. Motheaten and viable
motheaten mice have mutations in the haematopoietic cell phosphatase gene.
Nat. Genet. 4, 124-129 (1993).

Vang T., Congia M., Macis M.D., Musumeci L., Orru V., Zavattari P., Nika K.,
Tautz L., Tasken K., Cucca F., Mustelin T., Bottini N. Autoimmune-associated
lymphoid tyrosine phosphatase is a gain-of-function variant. Nat. Genet. 12,
1317-1319 (2005).

Velaga, M.R. et al. The codon 620 tryptophan allele of the lymphoid tyrosine
phosphatase (LYP) gene is a major determinant of Graves’ disease. J. Clin.
Endocrinol. Metab. 89, 5862-5865 (2004).

44
Zhang, W., & Smith, S.O. Mechanism of penetration of Antp(43-58) into
membrane bilayers. Biochem. 44, 10110-10118 (2005).

Abstract (if available)

Abstract Lymphoid-specific protein tyrosine phosphatase (LYP) has been found to be one of the most potent inhibitors of T cell subpopulation activation. A gain-of-function single nucleotide polymorphism (SNP) C1858T has been shown to be involved in several autoimmune diseases. We compared the enzymatic activity of LYP and Pro, Glu, Ser, Thr-rich protein tyrosine phosphatase (PEST). In vitro biochemical studies showed that LYP could differentially hydrolyze several phosphatase substrates. We screened a small molecule library for potential LYP inhibitors. In addition, our siRNA studies confirmed that T-cell receptor signaling was enhanced once LYP expression got repressed.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Structure and regulation of lymphoid tyrosine phosphatase (LYP) in autoimmune response

PDF

The molecular mechanism underlying the autoimmune-associated PTPN22 R620W variation and the quest for therapeutics

PDF

Development, synthesis and applications of highly sensitive fluorescent probes for studying protein tyrosine phosphatases

PDF

Low molecular weight protein tyrosine phosphatase and insulin signal transduction

PDF

Obtaining insights into biomolecular interactions through surface plasmon resonance

PDF

Construction of plasmids for constitutive and induced expression of secreted alkaline phosphatase in mammalian ovarian carcinoma cells

PDF

The differential effects of selective COX-2 inhibitors on cell proliferation and induced ER stress in glioblastoma and pancreatic carcinoma cell lines

PDF

Identification of small molecular inhibitors targeting G13D mutant K-ras

PDF

Genetic interaction between androgen receptor and Lef1 in bone mass control

PDF

A synthetic lethal screen for NF-κB-dependent plasma cell disorders

PDF

A novel construct to study the pulsatility of insulin secretion in single cells, islets and whole pancreas

PDF

Studies on the role of a novel protein, TMEM 56 in tumorigenic growth for MCF-7 cells

PDF

Nuclear respiratory factor-1 regulation by PTEN signaling

PDF

Mechanisms for regulating the expression of the TATA-binding protein

PDF

Mixed lineage leukemia proteins (MLLs), their effect as coregulators on target gene expression and global histone methylation

PDF

Searching for mitogenic factors from the epicardium: PDGFA, Igf2 and more

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Using novel small molecule modulators as a tool to elucidate the role of the Myocyte Enhancer Factor 2 (MEF2) family of transcription factors in leukemia

PDF

Differential effect of ethanol and r-sulforaphane on regulation of heme oxygenase-1 in endothelial cells

PDF

IFN-α treatment inhibits induction of type-2 innate lymphoid cell dependent airway hyperresponsiveness

Asset Metadata

Creator Zhao, Lei (author)

Core Title Searching for lymphoid-specific phosphatase (LYP) inhibitor

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2007-12

Publication Date 10/29/2007

Defense Date 10/15/2007

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag autoimmune disease,kinetics,OAI-PMH Harvest,phosphatase,screening,T cell signaling

Language English

Advisor Tokes, Zoltan A. (committee chair), Bottini, Nunzio (committee member), Frenkel, Baruch (committee member)

Creator Email leizhao@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m888

Unique identifier UC1446742

Identifier etd-Zhao-20071029 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-557142 (legacy record id),usctheses-m888 (legacy record id)

Legacy Identifier etd-Zhao-20071029.pdf

Dmrecord 557142

Document Type Thesis

Rights Zhao, Lei

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu