University of Southern California Dissertations and Theses

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

(USC Thesis Other)

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
THE ROLE OF ENDOPLASMIC RETICULUM PROTEINS GRP78 AND IP3R1 IN
REGULATION OF GLUCOSE HOMEOSTASIS AND ACUTE PANCREATITIS

by
Risheng Ye

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

December 2010

Copyright 2010 Risheng Ye
ii

To
my parents, who have been supporting me all the time with all their hearts; and my wife
Miao, who has accompanied me all the way here with her understanding and love.
iii

Acknowledgements
This work is the result of the sagacious guidance from my mentor, Dr. Amy S.
Lee. With her courage, persistence and enthusiasm, she also demonstrates to me the
characters of a successful scientist. Dr. Lee has recruited excellent scholars to the lab, and
created a terrific environment for research. I would like to thank the former Lee lab
members, Shengzhan Luo, Changhui Mao, Jianze Li, Brenda Lee, Min Hong, Vince Tai,
Peter Baumeister, Yong Fu and Min Ni, as well as my current colleague, Dezheng Dong,
Hui Zhou, Yi Zhang, Kyle Pfaffenbach, Miao Wang, Shiuan Wey, Biquan Luo, Wan-
Ting Chen and Genyuan Zhu, for their professional and personal assistance.
I am thankful to my dissertation committee members, Drs. Michael Stallcup
and Louis Dubeau, for their suggestions and instructions on my research. I am grateful to
the numerous collaborators that have made my projects possible. Dr. Jason Kim and his
group at the Pennsylvania State University (now at the University of Massachusetts
Medical School), especially Drs. Dae Young Jung, John Jun and Hwi Jin Ko, contributed
to the mouse phenotyping studies in Chapter 2. Drs. Stephen Pandol and Olga
Mareninova provided guidance and assessments on the pancreas pathology, and Dr.
David Hinton and Ernesto Barron provided cell imaging expertise in Chapter 3. Dr.
Robert Chow and his lab members Jung Hwa Cho, Drs. Darren Michael and Wenyong
Xiong, provided helpful discussion and advised on pancreatic islet isolation, insulin
secretion and Ca
2+
imaging. I am also grateful to Drs. Richard Bergman and Orison
iv

Woolcott for their helpful discussion. My special thanks go to Rita Thomas, for her
expertise in insulin ELISA.
I have been blessed with the love and continuous encouragement from my
parents and other family members. One of my career goals is to make them proud of me.
I am thankful to all the friends I have met in this city. We have been sharing a lot of our
lives along the journey.
Last but certainly not least, I would like to express my greatest gratitude to my
wife, Miao Wang. Her companionship, understanding and precious love bring colors, joy
and happiness into my life.
v

Table of Contents
DEDICATION ii
ACKNOWLEDGEMENTS iii
ABSTRACT xi
Chapter 1: Introduction 1
1.1 Endoplasmic reticulum 1
1.2 GRP78: an ER rheostat 2
1.3 IP3Rs: ER IP
3
-mediated Ca
2+
efflux channels 4
1.4 Diabetes mellitus and potential links to ER stress 6
1.4.1 Glucose and fat metabolism 6
1.4.2 Insulin secretion and signaling 7
1.4.3 Type 1 diabetes 8
1.4.4 Obesity and type 2 diabetes 9
1.5 Acute pancreatitis associating with ER stress 10

Chapter 2: Grp78 heterozygosity promotes adaptive UPR and attenuates diet-
induced obesity and insulin resistance 12
2.1 Introduction 12
2.2 Materials and methods 13
2.3 Results 20
2.3.1 Mitigation of HFD-induced obesity with increased
energy expenditure in Grp78+/- mice 20
2.3.2 Resistance to HFD-induced type 2 diabetes in Grp78+/-
mice 22
2.3.3 Grp78 heterozygosity improves insulin sensitivity
independent of adiposity 24
2.3.4 Prominent increase of insulin sensitivity in WAT of
HFD-fed Grp78+/- mice 27
2.3.5 Grp78 heterozygosity promotes adaptive UPR in WAT 29
2.3.6 Adaptive UPR protects against ER stress-induced
insulin resistance 37
2.4 Discussion 38

Chapter 3: Grp78 heterozygosity regulates ER chaperone balance in exocrine
pancreas and mediates differential response to cerulein-induced acute
pancreatitis 43
3.1 Introduction 43
3.2 Materials and methods 44
vi

3.3 Results 50
3.3.1 ER lumen dilation and chaperone reduction in
Grp78+/- exocrine pancreas 50
3.3.2 Recovery of ER structure and chaperone levels in
Grp78+/- exocrine pancreas after high-fat diet regimen 52
3.3.3 Differential response to experimental pancreatitis in
Grp78+/- mice is associated with ER chaperone balance in
pancreas 56
3.3.4 Modulation of UPR signaling by cerulein and diet in
pancreas of Grp78+/- Mice 60
3.3.5 Protection against cerulein-induced cell death by 4-PBA 63
3.4 Discussion 63

Chapter 4: IP3R1 mutation perturbs glucose homeostasis and enhances
susceptibility to diabetes 68
4.1 Introduction 68
4.2 Materials and methods 69
4.3 Results 75
4.3.1 D2D transgenic mice showed impaired glucose
homeostasis 75
4.3.2 Disruption of the inositol 1,4,5-triphosphate receptor 1-
encoding gene (Itpr1) in D2D mice 76
4.3.3 Glucose intolerance in the Itpr1 heterozygous mutant
(opt/+) mice 81
4.3.4 Susceptibility to HFD-induced diabetes in opt/+ mice 83
4.4 Discussion 85

Chapter 5: Conclusions and perspectives 86

Bibliography 91

vii

List of Tables
Table 2.1: Primers for RT-PCR

19
Table 4.1: Primers for IPCR

72
Table 4.2: Primers for mouse genotyping

73

viii

List of Figures
Figure 2.1: Attenuation of diet-induced obesity in Grp78+/- mice

20
Figure 2.2: Enhancement of energy expenditure in Grp78+/- mice

21
Figure 2.3: Resistance to HFD-induced diabetes in Grp78+/- mice

23
Figure 2.4: Alleviation of HFD-induced liver steatosis and WAT inflammation
in Grp78+/- mice

24
Figure 2.5: Enhanced glucose metabolism in RD-fed Grp78+/- mice

25
Figure 2.6: Increased insulin sensitivity in Grp78+/- MEFs

26
Figure 2.7: Increased insulin sensitivity in Grp78+/- mice after short-term HFD

27
Figure 2.8: Grp78 heterozygosity improves insulin sensitivity predominantly in
WAT

28
Figure 2.9: Grp78 heterozygosity improves insulin signaling in WAT

29
Figure 2.10: Grp78 heterozygosity promotes adaptive UPR signaling in WAT

31
Figure 2.11: Grp78 heterozygosity improves ER protein folding capacity in
WAT

33
Figure 2.12: Upregulation of ER chaperones GRP94 and PDI in immortalized
Grp78+/- MEFs

33
Figure 2.13: Posttranscriptional down-regulation of ER chaperones in WAT
following HFD regimen

34
Figure 2.14: ER chaperone protein levels in skeletal muscle and liver

35
Figure 2.15: Grp78 heterozygosity upregulates PGC-1α and GRP75 in WAT

36
Figure 2.16: Overexpression of active ATF6 improves insulin sensitivity in
MEFs under ER stress

38
Figure 2.17: Grp78 heterozygosity protects against diet-induced obesity and
insulin resistance

39
ix

Figure 3.1: Reduction of GRP78 protein in pancreatic acinar cells of adult
Grp78+/- mice

50
Figure 3.2: Dilated ER lumen in Grp78+/- pancreatic acinar cells

51
Figure 3.3: Reduced ER chaperone levels in Grp78+/- exocrine pancreas

52
Figure 3.4: HFD-fed Grp78+/- mice gained similar weight as wild-types

53
Figure 3.5: Recovery of ER morphology in pancreatic acinar cells of Grp78+/-
mice after HFD

54
Figure 3.6: Restored ER chaperone levels in exocrine pancreas of Grp78+/-
mice after HFD

55
Figure 3.7: Scheme of cerulein-induced acute pancreatitis

56
Figure 3.8: Diet-induced differential response to experimental pancreatitis in
Grp78+/- mice

57
Figure 3.9: Pathological parameters of acute pancreatitis in Grp78+/- mice

58
Figure 3.10: Differential cell death in exocrine pancreas of Grp78+/- mice with
experimental pancreatitis

59
Figure 3.11: Specific regulation of pancreatic ER chaperones and response to
experimental pancreatitis in Grp78+/- mice backcrossed into C57BL/6
background

60
Figure 3.12: Modulation of ER stress response by cerulein and diet in pancreas
of Grp78+/- mice

62
Figure 3.13: CHOP immunostaining in pancreatic acinar cells of Grp78+/- mice

62
Figure 3.14: 4-PBA protected against cerulein-induced cell death

63
Figure 4.1: Schematic drawing of the 3kb/LacZ and D2/LacZ reporter genes

75
Figure 4.2: Age-dependent hyperglycemia in D2D mice

76
Figure 4.3: Progressive glucose intolerance in D2D mice

76
x

Figure 4.4: IPCR amplification of the genomic DNA sequences flanking the
transgene in D2D mice

77
Figure 4.5: Identification of the genomic DNA sequences flanking the transgene
in D2D mice

78
Figure 4.6: D2D mice are Itpr1-heterozygous

80
Figure 4.7: Protein level of IP3R isoforms and ER chaperones in pancreatic
islets of opt/+ mice

82
Figure 4.8: Glucose intolerance in opt/+ mice

82
Figure 4.9: HFD-fed opt/+ mice showed normal food intake and fat absorption

83
Figure 4.10: Protein level of IP3R1 and ER chaperones in pancreatic islets of
HFD-fed opt/+ mice

84
Figure 4.11: opt/+ mice were predisposed to HFD-induced diabetes

84
xi

Abstract
The endoplasmic reticulum (ER) is an intracellular organelle for protein folding,
lipid synthesis and Ca
2+
storage. It also is responsible for transporting most secreted and
transmembrane proteins to their proper cellular locations. ER undergoes stress when the
protein load exceeds its folding capacity, and cellular signaling cascades are activated as
unfolded protein response (UPR). GRP78 is a major chaperone assisting protein folding,
as well as a master regulator of UPR signaling. In this thesis, we discovered that
heterozygosity of Grp78 enhances energy expenditure through upregulation of
mitochondria activity, and alleviate high fat diet (HFD)-induced obesity and type 2
diabetes in mouse. The latter is also achieved through increase in insulin sensitivity in the
white adipose tissue (WAT) of HFD-fed Grp78+/- mice, with adaptive UPR improving
ER folding capacity and quality control. This mechanism is validated through
overexpression of the active form of ATF6, a transcription factor known to upregulate ER
chaperones. This induces protective UPR and improves insulin signaling in mouse
embryonic fibroblasts (MEFs) upon ER stress. In the exocrine pancreatic acinar cells,
Grp78 heterozygosity differentially regulates ER chaperone levels in a diet- and genetic
background-dependent manner. The modulation of chaperone balance correlates with the
ER morphology as well as the severity of cerulein-induced acute pancreatitis.
Administration of chemical chaperone 4-phenolbutyrate (4-PBA) protects pancreatic
acinar cells from cerulein-induced death. We also uncovered a novel role of the ER Ca
2+

channel IP3R1 in glucose homeostasis is also discovered in mouse models. Progressive
xii

glucose intolerance is serendipitously observed in one line of transgenic mouse model
resulting from genomic integration of the transgene. Itpr1, the IP3R1-encoding gene, is
among the 10 loci disrupted by the gene insertion. The Itpr1 heterozygous mutant mice,
opt/+, develop early-onset glucose intolerance. The opt/+ mice are more susceptible to
HFD-induced hyperglycemia, glucose intolerance and insulin resistance. In conclusion,
the role of GRP78 in type 2 diabetes and acute pancreatitis is revealed as a modulator of
UPR signaling and chaperone balance. IP3R1 is identified as a novel regulator of glucose
metabolism in vivo and protects against diet-induced diabetes.
1

Chapter 1: Introduction
1.1 Endoplasmic reticulum
In eukaryotic cells, the endoplasmic reticulum (ER) is an organelle composed
of membrane cisternae. ER consists of multiple functional compartments with
corresponding structure. The rough ER is in charge of protein entrance and processing,
characterized by the ribosomes dynamically binding on its membrane. The smooth ER,
which lacks ribosome binding, serves multiple functions including lipid/steroid synthesis,
carbohydrate/steroid metabolism, and intracellular Ca
2+
storage (Fagone and Jackowski
2009; Sammels, Parys et al. 2010). The ER has intensive crosstalk with the other
organelles. As a well-described pathway for protein trafficking, the secretory and
membrane proteins are transported from ER to Golgi in vesicles (Murshid and Presley
2004), while most of the ER resident proteins are retained back to the ER via recognition
of their C-terminal KDEL (Lys-Asp-Glu-Leu) motif (Munro and Pelham 1987; Mirco
and Michele 2009). ER provides membrane for the reformation of nuclear envelope
during the anaphase of mitosis (Dultz and Ellenberg 2007; Fagone and Jackowski 2009).
The crosstalk between ER and mitochondria can be indirect via the modulation of
cytosolic Ca
2+
concentration (Sammels, Parys et al. 2010), or through direct membrane
association (Csordás and Hajnóczky 2009) and coupling of Ca
2+
channels (Szabadkai,
Bianchi et al. 2006).

2

1.2 GRP78: an ER rheostat
The homeostasis in ER is mainly maintained by the protein folding machinery
consisting of various molecular chaperones (Ni and Lee 2007). The 78-kDa glucose-
regulated protein (GRP78, as known as binding immunoglobulin protein, BiP) is a major
chaperone involved in multiple steps of protein processing. GRP78 assists the post-
translational translocation of newly synthesized peptides from cytosol in ER, functioning
as a molecular ratchet with its peptide-binding domain and ATPase domain (Matlack,
Misselwitz et al. 1999). To accomplish correct folding of peptides into proteins, GRP78
forms a complex with other ER chaperones, GRP94, PDI (protein disulfide isomerase),
ERp72, GRP170/ORP150, UGGT (UDP-glucose glycoprotein-glucosyltransferase),
CaBP1 (Ca
2+
binding protein 1), cyclophilin B and SDF2-L1. Another chaperoning
system involving calnexin, calreticulin and GRP58/ERp57 recognizes the nascent
peptides with monoglucosylated N-linked glycans (Ni and Lee 2007). GRP78 also targets
the misfolded proteins, which will be either correctly re-folded, or retro-translocated into
cytosol for proteasome-mediated degradation (namely ER-associated degradation,
ERAD) (Hendershot 2004).
When the protein load within ER exceeds its folding capacity, ER is under
stress and the unfolded protein response (UPR) signaling pathways are activated (Ron
and Walter 2007). There are three major branches of UPR signaling, namely PERK
(PKR-like ER kinase), ATF6 (activating transcription factor 6) and IRE1 (inositol-
requiring enzyme 1), which are ER transmembrane proteins. Transduction of these
3

signaling cascades depends on the time and severity of ER stress. As part of the adaptive
and pro-survival response, UPR first manages to retrieve ER balance by reducing protein
load and increasing folding capacity (Rutkowski and Kaufman 2007). Specifically,
autophosphorylation of dimerized PERK leads to phosphorylation of eIF2α and global
inhibition of mRNA translation, immediately reducing ER protein load (Harding, Zhang
et al. 1999). IRE1 is also activated through oligomerization and transphosphorylation
(Shamu and Walter 1996). ATF6 is transported from ER to Golgi and cleaved by Site-1
and Site-2 proteases (S1P and S2P) to generate an active transcription factor (Haze,
Yoshida et al. 1999), and induce the expression of ER chaperones, such as GRP78,
GRP94 and PDI, for protein folding. Transcription of the x-box binding protein 1 (XBP-
1) is also induced by the active ATF6, and the mRNA is spliced by the active
endonuclease IRE1 (Yoshida, Matsui et al. 2001). The spliced Xbp-1 mRNA is translated
to transcription factor XBP-1, which subsequently induces the expression of ER
chaperones like ERdj4, p58
IPK
and HEDJ. The ER degradation-enhancing mannosidase-
like protein (EDEM) is also a target of XBP-1, and promotes ERAD to attenuate
misfolded protein accumulation (Lee, Iwakoshi et al. 2003). At the late stage of UPR,
ATF4 and CHOP, the transcription factors downstream of phosphorylated eIF2α (p-
eIF2α), activate GADD34, a dominant mediator of eIF2α dephosphorylation. This
negative feedback loop results in resumption of global translation (Ma and Hendershot
2003), which is required for expression of most UPR target genes (Novoa, Zhang et al.
2003). If the balance between protein load and folding capacity is improved by the
adaptive UPR, the cell is able to recover from ER stress and survive. In case of prolonged
4

challenge or unsolvable misfolded/unfolded protein accumulation, the resumed protein
synthesis exacerbates ER stress, and the pro-apoptotic pathways of UPR lead to cell death
(Rutkowski and Kaufman 2007; Wang, Wey et al. 2009).
GRP78 is not only a chaperone, but also a master regulator of UPR signaling
(Wang, Wey et al. 2009). Under unstressed status, GRP78 binds to the three initial signal
transducers, PERK, ATF6 and IRE1, and prevents their activation. In response to the
accumulation of unfolded/misfolded proteins in ER, GRP78 dissociates from these
transducers, allowing their activation (Rutkowski and Kaufman 2004). Recently, an
alternative mechanism was suggested that GRP78 may sequester the inactive form of
IRE1 and desensitize it to mild ER stress (Pincus, Chevalier et al. 2010). Other
subcellular insults, such as depletion of the Ca
2+
storage, also cause ER stress. As a major
Ca
2+
-binding protein, GRP78 can be titrated away from the signal transducers and switch
on the UPR. To study the physiological role of GRP78, our laboratory created targeted
mutation of the Grp78 allele in mouse models. Homozygous deletion of Grp78 results in
early embryonic lethality; however, the Grp78+/- mice with partial reduction in GRP78
expression level are viable and fertile (Luo, Mao et al. 2006).

1.3 IP3Rs: ER IP
3
-mediated Ca
2+
efflux channels
The inositol 1,4,5-triphosphate receptors (IP3Rs) are a family of ligand-gated
Ca
2+
channels. Located on the membrane of intracellular Ca
2+
stores, such as ER and
5

secretory vesicles, IP3Rs mediate Ca
2+
release when bound with inositol 1,4,5-
triphosphate (IP
3
) (Foskett, White et al. 2007). IP3Rs are reported to couple with
mitochondria Ca
2+
uptake channels through the molecular chaperone GRP75 (Szabadkai,
Bianchi et al. 2006). As a key modulator of cytosolic Ca
2+
concentration, IP3Rs have
been intensively studied in a variety of Ca
2+
-controlled cellular processes including
muscle contraction, neuronal processing and cell death (Vanderheyden, Devogelaere et al.
2009). In mammals there are three isoforms of IP3R (IP3R1, 2 and 3) forming homo- or
heterotetrameric channels (Foskett, White et al. 2007). Expression of IP3R1 is observed
in most tissues, and especially prominent in the cerebellum (Taylor, Taufiq Ur et al.
2009). In the mouse pancreatic β-cells, IP3R1 is the most abundant isoform (Lee and
Laychock 2001). Expression of mouse IP3R2 is most prominent in cardiac and skeletal
muscle, as well as liver, kidney and other epithelial tissues, while mouse IP3R3 is
expressed in both endocrine and exocrine pancreas, as well as testis, spleen, thymus and
gastrointestinal tract (Taylor, Taufiq Ur et al. 2009). Strikingly, double knockout of
IP3R2 and IP3R3 in mice showed severe impairment of Ca
2+
signaling and secretion in
acinar cells of the exocrine tissues, and the mice are lean and hypoglycemic as a result of
difficulty in nutrient digestion (Futatsugi, Nakamura et al. 2005). Furthermore, variations
within IP3R3 have been identified as a risk factor for type 1 diabetes in human (Roach,
Deutsch et al. 2006).
IP3R1 is critical for motor function and survival as its homozygous deletion in
mice leads to ataxia and epileptic seizures resulting in death by 3 to 4 weeks of age
(Matsumoto, Nakagawa et al. 1996). Interestingly, these phenotypes are highly similar to
6

that of the opisthotonous (opt) mouse (Street, Bosma et al. 1997). The opt mutation arose
spontaneously in a C57BL/Ks-db2J colony and classic genetic techniques localized opt to
the same chromosomal localization as Itpr1. Subsequent genetic and molecular analysis
revealed that the opt mutation results in a genomic deletion of two exons in Itpr1 and
aberrant splicing of the Itpr1 mRNA transcripts. Thus, the opt mutation leads to
production of IP3R1 protein missing several potential kinase and ATP-binding regulatory
sites, with markedly decreased stability (Street, Bosma et al. 1997).

1.4 Diabetes mellitus and potential links to ER stress
1.4.1 Glucose and fat metabolism
Dietary carbohydrate is a main nutrient source for biogenesis of energy. It is
digested in the gut and converted into glucose in the liver. Glucose is transported into the
blood, and taken up by all the peripheral tissues. The brain consumes blood glucose at a
constant rate, under most of the physiological conditions. Glucose catabolism produces
ATP, which is particularly active in brain, muscle and kidney. Excessive glucose can first
be stored as glycogen in liver and muscle (Klover and Mooney 2004). When the
glycogen stores are saturated, glucose will be converted to fatty acids, which primarily
happens in liver. The fatty acids, from either hepatic lipogenesis or dietary, are coated by
lipoproteins and carried into the blood circulation (Glatz, Luiken et al. 2010). Eventually,
fatty acids are stored in the adipose tissue in the form of triglycerides, or undergo β-
7

oxidation for ATP production (Zechner, Strauss et al. 2005). In animals, there is no
biochemical mechanism converting fatty acids to glucose. The brown adipose tissue,
characterized by highly abundant mitochondria with uncoupled electron transport chain,
acutely combusts fat and glucose for thermogenesis in response to cold stimulation or
low-protein diets (Cannon and Nedergaard 2004).
1.4.2 Insulin secretion and signaling
In response to the elevated glucose levels in blood, insulin is secreted from the
pancreatic β-cells, which compose a majority of the endocrine islets of Langerhans.
Exocytosis of the insulin-containing vesicles exhibits a biphasic pattern upon glucose
stimulation. The first phase is triggered by the extracellular Ca
2+
influx and a rapid
increase in cytosolic Ca
2+
concentration, while the molecular mechanism for the second
phase awaits further investigation (Henquin 2009; Wang and Thurmond 2009;
Jitrapakdee, Wutthisathapornchai et al. 2010). Emerging evidence suggests that the IP3Rs
may play regulatory roles in pancreatic β-cell exocytosis and metabolism (Srivastava,
Atwater et al. 1999; Dyachok and Gylfe 2004). For example, mice heterozygous for the
anx7 gene, which encodes for Ca
2+
-activated GTPase supporting Ca
2+
channel activities,
exhibit defects in IP3 receptor expression, Ca
2+
signaling and insulin secretion in cells
from pancreatic islets (Srivastava, Atwater et al. 1999). It has been reported that protein
kinase A-mediated promotion of Ca
2+
-induced Ca
2+
release via IP3Rs is implicated as
part of the mechanism by which cAMP amplifies insulin release (Dyachok and Gylfe
8

2004). Noticeably, β-cells are susceptible to ER stress, due to their high rates in insulin
translation and processing (Harding, Zeng et al. 2001).
After being secreted into the blood, insulin promotes nutrient uptake and
storage in peripheral tissues, mainly liver, muscle and adipose. Binding of insulin to its
receptor (IR) initiates the signal transduction via a cascade of kinases, including insulin
receptor substrate 1/2 (IRS-1/2), phosphoinositide 3-kinase (PI3K) and AKT (also known
as protein kinase B, PKB). Serine phosphorylation on IRS represses its tyrosine
phosphorylation and the downstream signaling. The active AKT inhibits hepatic
gluconeogenesis by inactivating the transcription factor Foxo1. In muscle and adipose,
AKT induces the translocation of glucose transporters (GLUT) to plasma member, and
promotes glucose uptake from the blood (Taniguchi, Emanuelli et al. 2006). Insulin
stimulates lipoprotein lipase (LPL) formation in adipose tissue, to assist fat transport and
storage (Wang and Eckel 2009). In pancreatic β-cells, insulin signaling is required for
glucose-stimulated insulin secretion (GSIS) (Kulkarni, Winnay et al. 1999). Although the
brain is irresponsive to insulin-stimulated glucose uptake, ablation of insulin signaling in
neurons leads to dysregulation of food intake, energy disposal and reproduction hormone
(Bruning, Gautam et al. 2000).
1.4.3 Type 1 diabetes
The diagnostic criteria of diabetes are high blood glucose level either under
fasting status ( ≥7.0 mM) or 2 hours after an oral bolus of 75 g glucose ( ≥11.1 mM). The
inefficiency in blood glucose clearance, i.e. glucose intolerance, usually results from
9

defect in insulin production from pancreatic β-cells or insulin action on peripheral tissues
(Stumvoll, Goldstein et al. 2005). Type 1 diabetes arises from autoimmune destruction of
β-cells, which is triggered by genetic (e.g. HLA variable) or environmental (e.g. viral
infection) factors (Hober and Sauter 2010). Cytokines, such as IL-1β, TNF-α and IFN-γ,
are produced from invading immune cells and induce β-cell death through NF-κB and
STAT-1 signaling (Cnop, Welsh et al. 2005). As part of the pathways, ER stress is
thought to be triggered by nitric oxide, and contribute to β-cell apoptosis (Oyadomari,
Takeda et al. 2001).
1.4.4 Obesity and type 2 diabetes
Insulin resistance is a hallmark of type 2 diabetes, which composes 90% of the
diabetes mellitus cases. With impaired insulin signaling, the peripheral tissues become
insensitive to insulin and fail to activate insulin-stimulated glucose uptake. Obesity is the
most prevalent risk factor for insulin resistance and type 2 diabetes in human (Stumvoll,
Goldstein et al. 2005). With excessive nutrient storage in the form fat, white adipose
tissue (WAT) undergoes hypertrophy and hyperplasia, with macrophage infiltration.
Inflammation is thought to contribute to local insulin resistance in WAT, which can
subsequently lead to uncontrolled release of fatty acids, secretion of inflammatory
cytokines, and alterations in the balance of adipokines, and ultimately impact lipoprotein
metabolism and systemic insulin sensitivity (Gutierrez, Puglisi et al. 2009). Ectopic
deposit of fat in other peripheral tissues, e.g. skeletal muscle and liver, also impair their
insulin signaling (Erion and Shulman 2010).
10

At the early stage of type 2 diabetes, pancreatic β-cells are able to increase
insulin production to compensate for the insufficient insulin signaling and glucose uptake
in peripheral tissues. Although glucose intolerance is detectable after food intake, the
fasting blood glucose level remains normal, accompanied by hyperinsulinemia
(Biddinger and Kahn 2006). Excessive nutrient intake and progressive insulin resistance
deleteriously increase the demand on insulin synthesis and exert ER stress on β-cells
(Scheuner and Kaufman 2008; Eizirik and Cnop 2010). Chronic exposure to elevated
glucose and fatty acid levels in blood can also be cytotoxic. At the late stage of type 2
diabetes, β-cell dysfunction and apoptosis lead to defective insulin production and lasting
hyperglycemia. Patients become insulin-dependent as those with type 1 diabetes (Eizirik,
Cardozo et al. 2008).

1.5 Acute pancreatitis associating with ER stress
The exocrine pancreas is highly specialized for production and secretion of
digestive enzymes. In response to meal stimulation, acinar cells of the exocrine pancreas
exhibit the highest protein synthesis rate among human tissues (Case 1978). Consistent
with this cellular function, acinar cells are morphologically characterized by abundant ER.
Acute pancreatitis is pathologically characterized by inflammation, edema, and cell
necrosis of exocrine pancreas. ATP depletion and premature activation of digestive
enzymes contribute to necrosis of pancreatic acinar cells (Pandol, Saluja et al. 2007). To
study the pathogenesis of pancreatitis, multiple experimental models for pancreatitis have
11

been established in rodent. Administration of cerulein, a cholecystokinin (CCK)
analogues, leads to activation of digestive proenzymes, severe acinar cell necrosis and
inflammation in mouse (Pandol, Saluja et al. 2007). Recently, activation of ER stress
signaling was observed in pancreas of rats treated with secretagogues or following
arginine-induced acute pancreatitis (Kubisch, Sans et al. 2006; Kubisch and Logsdon
2007). ER stress caused by misfolding of mutant digestive zymogens has also been linked
to hereditary chronic pancreatitis in human (Kereszturi, Szmola et al. 2009).
12

Chapter 2: Grp78 heterozygosity promotes adaptive UPR and
attenuates diet-induced obesity and insulin resistance
2.1 Introduction
Obesity is the leading factor in development of insulin resistance and type 2
diabetes (Stumvoll, Goldstein et al. 2005). In liver and white adipose tissue (WAT) of
mouse models, ER stress has been recently suggested as the mechanistic link from
obesity to insulin resistance (Ozcan, Cao et al. 2004). The initial UPR signaling
transducer IRE-1 and its downstream kinase, JNK, are critical molecules impairing the
insulin signaling. JNK-mediated phosphorylation of Ser307 on IRS-1 inhibits its tyrosine
phosphorylation and the downstream insulin signaling (Hirosumi, Tuncman et al. 2002).
Improving protein folding capacity by administration of small chemical chaperone
molecules such as 4-phenylbutyrate (4-PBA) or tauroursodeoxycholate (TUDCA)
attenuates ER stress and enhances insulin sensitivity in liver and WAT of the ob/ob
mouse model (Ozcan, Yilmaz et al. 2006).
GRP78 regulates ER homeostasis by mediating protein folding, targeting
misfolded protein for ERAD, binding ER Ca
2+
stores, and controlling UPR signaling (Lee
2001; Hendershot 2004; Ni and Lee 2007). To study its in vivo role, our laboratory had
created the Grp78 targeted mutant mouse model. Homozygous ablation of Grp78 results
in embryonic lethality by E3.5; however, the Grp78+/- mice are viable and fertile (Luo,
Mao et al. 2006). We discovered that high-fat diet (HFD)-induced obesity was
13

substantially mitigated in the Grp78+/- mice with the C57BL/6 genetic background,
accompanied by enhanced energy expenditure. Grp78 heterozygosity also increased
insulin sensitivity, independent of the reduced adiposity. A prominent increase in insulin-
stimulated glucose uptake and insulin signaling was in observed in WAT of the Grp78+/-
mice, with adaptive UPR including compensatory upregulation of ER chaperones.
Meanwhile, the HFD-induced translation arrest was attenuated. As part of the adaptive
UPR, active ATF6 induced ER chaperone expression and improved insulin sensitivity in
mouse embryonic fibroblasts (MEFs) under ER stress challenge. In utilization of the
Grp78+/- mouse model, the role of ER homeostasis in glucose homeostasis is further
elucidated.

2.2 Materials and methods
Animals
The Grp78+/- mice were generated as described (Luo, Mao et al. 2006) and
were backcrossed into C57BL/6 genetic background for 5 to 8 generations. For
genotyping of the Grp78 knockout (-) allele, the primers PF3 and PTR (Luo, Mao et al.
2006) were used in PCR analysis. Reactions were run under the following conditions:
94°C for 5 min, followed by 46 cycles of 94°C for 20 sec, 62°C for 30 sec, and 72°C for
30 sec, ended with 72°C for 7 min. Mice were fed on regular diet (RD, 11% fat by
calories, Harlan Teklad) continuously after weaning (at about 3-week old), or changed to
high-fat diet (HFD, 45% fat by calories, Research Diets) at 10-week old. Only male mice
14

were used in this study. Mouse body weight was measured after overnight fasting. Food
intake was analyzed by daily food mass measurement for 5 successive days, during the
third week of HFD regimen. Mouse stool was processed to Oil Red O staining for lipids
as described (Harding, Zeng et al. 2001). All protocols for animal use and euthanasia
were reviewed and approved by the University of Southern California Institutional
Animal Care and Use Committee.
Body composition and energy balance
20-week old mice were fed HFD for 10 weeks. Whole body fat and lean mass
were non-invasively measured in conscious mice using
1
H-MRS (Echo Medical Systems,
Houston, TX). A 3-day measurement of water intake, energy expenditure, and physical
activity were performed using the metabolic cages (TSE Systems, Bad Homburg,
Germany). All procedures were approved by the Pennsylvania State University
Institutional Animal Care and Use Committee.
Blood glucose and insulin
Mouse tail blood was measured for glucose by OneTouch Ultra System
(Lifescan Inc., Milpitas, CA). For insulin, plasma was prepared from blood by
centrifugation, and measured with ELISA kit (Linco Research).
Tissue processing
After sacrifice, mouse tissues were fixed in 10% formalin for histological
analysis, or immediately frozen in liquid nitrogen and stored at -80°C for immunoblotting.
15

Immunohistochemistry
Paraffin sections of formalin-fixed tissues were stained with H&E for
morphological evaluation. For immunohistochemistry, primary antibodies used included
insulin (1:100, Signet), glucagon (1:100, Signet), and CD68 (1:50, Santa Cruz
Biotechnology).
Insulin tolerance test
Mice were subjected to intraperitoneal injection of insulin (0.5 mU/g body
weight) after 6 hr fasting, followed by blood glucose measurement.
Hyperinsulinemic-euglycemic clamp
After 10-week HFD regimen, 20-week old Grp78+/- mice and their wild-type
littermates were subjected to hyperinsulinemic-euglycemic clamp to assess insulin
sensitivity in vivo as described (Kim, Higashimori et al. 2004). At 4~5 days before clamp
experiments, mice were anesthetized, and an indwelling catheter was inserted in the right
internal jugular vein (Kim, Higashimori et al. 2004). On the day of clamp experiment, a
3-way connector was attached to the catheter to intravenously deliver solutions (e.g.,
glucose, insulin). Mice were placed in a rat-size restrainer (to minimize stress during
experiments in awake state) and tail-restrained using a tape to obtain blood samples from
the tail vessels.
Following overnight fast (~15 hr), a 2 hr hyperinsulinemic-euglycemic clamp
was conducted in awake mice with a primed (150 mU/kg body weight) and continuous
infusion of human regular insulin (Humulin; Eli Lilly, Indianapolis, IN) at a rate of 2.5
16

mU/kg/min to raise plasma insulin within a physiological range (Kim, Higashimori et al.
2004). Blood samples (20 μL) were collected at 20 min intervals for the immediate
measurement of plasma glucose concentration, and 20% glucose was infused at variable
rates to maintain glucose at basal concentrations. Basal and insulin-stimulated whole
body glucose turnover were estimated with a continuous infusion of [3-
3
H] glucose
(Perkin Elmer, Boston, MA) for 2 hr prior to the clamps (0.05 μCi/min) and throughout
the clamps (0.1 μCi/min), respectively. All infusions were performed using microdialysis
pumps (CMA/Microdialysis, North Chelmsford, MA). To estimate insulin-stimulated
glucose uptake in individual tissues, 2-deoxy-D-[1-
14
C]glucose (2-[
14
C]DG) was
administered as a bolus (10 μCi) at 75 min after the start of clamps. Blood samples were
taken before, during, and at the end of clamps for the measurement of plasma [
3
H]glucose,
3
H
2
O, 2-[
14
C]DG concentrations, and/or insulin concentrations. At the end of the clamps,
mice were euthanized, and tissues were taken for biochemical and molecular analysis
(Kim, Higashimori et al. 2004).
Glucose concentrations during clamps were analyzed using 10 μL plasma by a
glucose oxidase method on a Beckman Glucose Analyzer 2 (Beckman, Fullerton, CA).
Plasma insulin concentrations were measured by ELISA using kits from Alpco
Diagnostics (Salem, NH). Plasma triglyceride and FFA concentrations were measured
using Sigma diagnostic kits (Sigma Diagnostics, St Louis, MO) and spectrophotometry.
Plasma concentrations of [3-
3
H]glucose, 2-[
14
C]DG, and
3
H
2
O were determined
following deproteinization of plasma samples as previously described (Haneda, Xiao et al.
2004). The radioactivity of
3
H in tissue glycogen was determined by digesting tissue
17

samples in KOH and precipitating glycogen with ethanol. For the determination of tissue
2-[
14
C]DG-6-P content, tissue samples were homogenized, and the supernatants were
subjected to an ion-exchange column to separate 2-[
14
C]DG-6-P from 2-[
14
C].
Rates of basal hepatic glucose production (HGP) and insulin-stimulated whole
body glucose turnover were determined as the ratio of the [
3
H]glucose infusion rate to the
specific activity of plasma glucose at the end of the basal period and during the final 30
min of clamp, respectively (Kim, Higashimori et al. 2004). Insulin-stimulated rate of
HGP during clamp was determined by subtracting the glucose infusion rate from whole
body glucose turnover. Whole body glycolysis and glycogen plus lipid synthesis from
glucose were calculated as previously described (Kim, Higashimori et al. 2004). Insulin-
stimulated glucose uptake in individual tissues was assessed by determining the tissue
content of 2-[
14
C]DG-6-P and plasma 2-[
14
C]DG profile.
Insulin signaling analysis
Following clamps, WAT were prepared for lysates. Total and phospho-Tyr
IRS-1 levels were analyzed by immunoblotting. Insulin-stimulated AKT activity was
determined by immunoprecipitating tissue lysates with a polyclonal AKT antibody
(Upstate Biotechnology) that recognized both AKT1 and AKT2, coupled with protein G-
sepharose beads (Amersham Pharmacia Biotechnology, Piscataway, NJ) as previously
described (Kim, Higashimori et al. 2004).

18

Cell culture and transfection
The Grp78+/- MEFs were isolated and immortalized with SV40 large tumor
antigen as described (Lu, Jousse et al. 2004). The similarly transformed wild-type MEFs
were provided by Dr. Stanley Korsmeyer (Harvard University). To overexpress a HA-
tagged active nuclear form of ATF6, cells were transfected with the plasmid pCGN-
ATF6(373) (Luo and Lee 2002) using PolyFect (Qiagen) for 24 hr, controlled by the
vector transfection. To induce ER stress, cells were treated with tunicamycin (1.5 μg/ml,
Sigma) for 14 hr.
Insulin sensitivity analysis
After cultured in serum-free medium for 5 hr, cells were treated with insulin
(100 nM, Sigma) for 15 min, followed by immediate lysate preparation (Ozcan, Ozcan et
al. 2008). Insulin-stimulated phosphorylation of AKT was determined by immunoblotting
phosphor-Ser473 and total AKT.
Immunoblotting
Lysates of tissues from individual mice or cells were extracted in ice-cold
RIPA buffer (50 mM Tris-Cl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate,
0.1% SDS) containing cocktails of proteinase inhibitors and phosphatase inhibitors
(Roche), by centrifugation (13,000 g, 15 min) following homogenization and three
freeze-thaw cycles. Proteins were separated by 8% or 12% SDS-PAGE, and transferred
to nitrocellulose membrane (Pall) and subjected to Western blotting (Luo and Lee 2002).
Primary antibodies used included pSer473-AKT, AKT (1:1000, Cell Signaling or Upstate
19

Biotechnology); pTyr-IRS-1, IRS-1 (Upstate Biotechnology); JNK1, GAPDH, ATF4,
CHOP, GADD34, XBP-1, EDEM, GRP78, Hemagglutinin (HA) tag (1:1000, Santa Cruz
Biotechnology); pSer51-eIF2α, eIF2α (1:1000, Cell Signaling); ATF6 (1:100, Abcam);
GRP94, PDI, calnexin, and calreticulin (1:2000, Stressgen); PGC-1 (1:1000,
Calbiochem); β-actin (1:5000, Sigma). Western blotting was repeated two to six times,
and quantitated using the Quantity One system (Bio-Rad).
RT-PCR
Tissue samples from individual mice were homogenized and extracted for RNA
using TRI reagent (Sigma). cDNA samples were prepared using SuperScript™ II Reverse
Transcriptase (Invitrogen). To assess mRNA levels of specific genes, the primer pairs
listed in Table 2.1 were applied for RT-PCR.
Table 2.1. Primers for RT-PCR
Gene Primer name Primer sequence
Grp78
mG78ex5F 5’ – GCAGAAACTCCGGCGTGAGG – 3’
mG78ex6R 5’ – GGCTCCTTGCCATTGAAGAAC – 3’
Grp94
mG94ex16F 5’ – ACGGCAACACTTCGGTCAGG – 3’
mG94ex18R 5’ – CCACACGGGATTCATAGCGAG – 3’
PDI
mPDIex2F 5’ – GCCCCTGAGTATGAAGCTGC – 3’
mPDIex5R 5’ – TCTCTCAAGTTGCTGGCTGC – 3’
calnexin
mCNXex8F 5’ – GGCCCAAAATAGCAGATCCAG – 3’
(CNX) mCNXex12R 5’ – GCCTCCAGCATCTGCAGCAC – 3’
calreticulin
mCRTex1F 5’ – CCGCTGCCTGAAGATCGTC – 3’
(CRT) mCRTex3R 5’ – TGTCCTTCTGGTCCAAACCAC – 3’
β-actin Mb-actin1 5’ – GACGGCCAGGTCATCACTAT – 3’
Mb-actin2 5’ – GTACTTGCGCTCAGGAGGAG – 3’
(Ni, Zhou et al. 2009)
20

Statistical analysis
Two-tailed student’s t-test was applied for all pairwise comparisons.
2.3 Results
2.3.1 Mitigation of HFD-induced obesity with increased energy expenditure
in Grp78+/- mice
To explore the role of GRP78 in development of obesity and type 2 diabetes,
Grp78+/- mice and their wild-type (Grp78+/+) littermates on the C57BL/6 background
were fed with high-fat diet (HFD) from 10-week old. To avoid the metabolic complexity
caused by hormonal cycles in females, only male mice were used in this study.
Surprisingly, under HFD regimen, Grp78+/- mice gained less body weight than their
wild-type siblings (Fig. 2.1A and B). Consistently, the
1
H-MRS body composition
analyses revealed a primary reduction of fat mass in Grp78+/- mice (Fig. 2.1C).

Figure 2.1. Attenuation of diet-induced obesity in Grp78+/- mice. (A) Fasting body weight of Grp78+/+
and +/- mice fed on regular diet (RD) continuously, or on high-fat diet (HFD) from 10-week old (n ≥7 mice
per condition). (B) A representative picture of Grp78+/+ and +/- siblings after 20-week HFD. (C) Body
composition of Grp78+/+ (n=9) and Grp78+/- (n=6) mice after 11-week HFD, measured by proton
magnetic resonance spectroscopy (
1
H-MRS). Data are presented as the mean±SEM. *P<0.05, **P<0.01 for
+/- versus +/+.
A B C
21

To understand the physiological mechanism for the lean phenotype of the
Grp78+/- mice, a series of metabolic measurements were performed. There was no
significant difference in food intake (Fig. 2.2A), water intake (Fig. 2.2B) or fat absorption
(Fig. 2.2C) between the two genotypes. Rather, the increased energy expenditure in the
Grp78+/- mice, as measured by indirect calorimetry (Fig. 2.2D), might contribute to their
reduced adiposity. Both O
2
consumption (P=0.006) and CO
2
production (P=0.0009) was
significantly enhanced in the +/- mice (Fig. 2.2E), while no alteration was observed in
the respiratory exchange ratios (Fig. 2.2F) or physical activities (Fig. 2.2G).

Figure 2.2. Enhancement of energy expenditure in Grp78+/- mice. On HFD-fed mice: (A) Food intake
measurement. n=7 (+/+) or 5 (+/-). (B) Water intake measurement. n=5 (+/+) or 7 (+/-). (C) Oil Red O
staining of stool smear. Negative control: dH
2
O; positive control: white adipose extract. (D to F): Metabolic
cage studies on mice after 10-week HFD (n ≥3 mice per condition). (D) Energy expenditure. (E) O
2

consumption and CO
2
production. (F) Respiratory exchange ratio. (G) Total physical activity. Data are
presented as the mean±SEM. *P<0.05, **P<0.01 for +/- versus +/+.

A B C
EF G D
22

2.3.2 Resistance to HFD-induced type 2 diabetes in Grp78+/- mice
In mice with C57BL/6 mice, HFD-induced obesity leads to diabetic phenotypes
including insulin resistance, hyperinsulinemia, pancreatic β-cell hyperplasia and
hyperglycemia (Surwit, Kuhn et al. 1988). After 20 weeks of HFD (30-week old), while
Grp78+/+ mice developed hyperglycemia (159±6 mg/dl) as expected, Grp78+/- mice
maintained significantly lower fasting glucose level (118±9 mg/dl) (Fig. 2.3A). The
fasting plasma insulin level was also lower in the Grp78+/- mice (0.26±0.06 ng/ml
versus 0.55±0.08 ng/ml in Grp78+/+ mice, P=0.009) (Fig. 2.3B). Consistently, the
Grp78+/- mice were resistant to HFD-induced β-cell hyperplasia, which was evident in
the Grp78+/+ mice (Fig. 2.3C). The distribution pattern of glucagon-stained α-cells was
normal in the pancreatic islets of both Grp78+/+ and +/- mice (Fig. 2.3D). Transmission
electron microscopy further revealed that Grp78 heterozygosity does not change the
number and distribution of secretory granules in β-cells (Fig. 2.3E).
Fatty liver could be a complication of HFD-induced type 2 diabetes (Cusi
2009). In agreement with the mitigated obesity (Fig. 2.1) and diabetic phenotypes (Fig.
2.3), hepatic steatosis was markedly alleviated in Grp78+/- mice (Fig. 2.4A).
Inflammation in white adipose tissue (WAT) has recently been linked to obesity-
associated insulin resistance (Wellen and Hotamisligil 2005). Correspondingly, WAT of
the HFD-fed Grp78+/- mice showed less inflammation than that of the HFD-fed
Grp78+/+ mice, as revealed by H&E and CD68 staining (Fig. 2.4B). Comparing to the
RD-fed mice, HFD regimen led to increase in adipocyte size in both Grp78+/+ and +/-
23

mice. However, there was no apparent difference in adipocyte size or morphology
between the two genotypes, either RD-fed or HFD-fed (Fig. 2.4B).

Figure 2.3. Resistance to HFD-induced diabetes in Grp78+/- mice. (A) Fasting blood glucose (n ≥7 mice
per condition). (B) Fasting blood insulin after 19-week HFD. n=15 (+/+) or 16 (+/-). Data are presented as
the mean±SEM. **P<0.01 for +/- versus +/+. (C and D) Insulin (C) and glucagon (D) immunostaining on
pancreas sections from 25-week old mice on RD or after 15-week HFD (n ≥3 mice per condition). Lower
panels exhibit the boxed areas within the corresponding upper panels. Numbers above scale bars indicate
the represented object distance. (E) Representative transmission electron micrograph (TEM) of pancreatic
β-cells in 15-week old Grp78+/+ and +/- mice on RD. Secretory granules (SG) containing electron dense
proteins and nuclei (N) are labeled.
A
C
B
E
D
24

Figure 2.4. Alleviation of HFD-induced liver steatosis and WAT inflammation in Grp78+/- mice. For
25-week old mice on RD or after 15-week HFD (n ≥3 mice per condition): (A) H&E staining on liver
sections. Lower panels exhibit the boxed areas within the corresponding upper panels. (B) H&E and CD68
staining on WAT sections. Arrowheads indicate inflammation. Scale bars with numbers above indicate the
represented object distance.

2.3.3 Grp78 heterozygosity improves insulin sensitivity independent of
adiposity
The resistance to HFD-induced hyperinsulinemia and β-cell hyperplasia in
Grp78+/- mice suggested improved insulin sensitivity in peripheral tissues, which could
be a secondary effect of the reduced adiposity. Another possibility was that Grp78
heterozygosity could primarily enhance insulin sensitivity, not depending on the lean
A
B
25

phenotype. To test this, hyperinsulinemic-euglycemic clamp was performed on regular
diet (RD)-fed mice at the age of 13 weeks, when there was no significant difference in
body weight and fat mass between the two genotypes (Fig. 2.5A). During the steady state,
the glucose infusion rates to maintain normal blood glucose level (GINF) were
significantly elevated in the Grp78+/- mice, indicating a increase in insulin sensitivity
(Fig. 2.5B). Upon insulin stimulation, the whole body glucose turnover and glycolysis
both exhibited a trend towards enhancement in the Grp78+/- mice (Fig. 2.5C). These data
suggest that Grp78 heterozygosity improves glucose metabolism and insulin sensitivity in
mice, which is independent of reduced adiposity.

Figure 2.5. Enhanced glucose metabolism in RD-fed Grp78+/- mice. Hyperinsulinemic-euglycemic
clamp studies on 13-week old Grp78+/+ (n=5) and +/- (n=4) mice on RD. (A) Body composition
measured by
1
H-MRS. (B) Glucose infusion rates (GINF) during steady state. (C) Whole body glucose
turnover and glycolysis during clamps. Data are presented as the mean±SEM. *P<0.05 for +/- versus +/+.

As supporting evidence, MEF cell lines were established from Grp78+/+ and
+/- mouse embryos and subjected to insulin stimulation following serum starvation in
culture medium. The insulin-stimulated AKT phosphorylation was higher in Grp78+/-
MEFs compared to wild-type MEFs (Fig. 2.6A). While tunicamycin-induced ER stress
A B C
26

impaired insulin sensitivity in wild-type MEFs, a recovery was observed in Grp78+/-
MEFs (Fig. 2.6B). Thus, Grp78 heterozygosity improves insulin sensitivity in cultured
MEFs.

Figure 2.6. Increased insulin sensitivity in Grp78+/- MEFs. (A) Following 5 hr serum starvation,
immortalized Grp78+/+ and +/- MEFs were treated with PBS or 100 nM insulin for 15 min. (B) Following
5 hr serum starvation and 3 hr simultaneous treatment of DMSO or tunicamycin (Tu, 10 μg/ml),
immortalized Grp78+/+ and +/- MEFs were treated with 100 nM insulin for 15 min. Whole cell lysates
were subjected to Western blotting for phosphorylated (Ser473) and total AKT.

Towards further confirmation, cohorts of Grp78+/+ and +/- mice were
examined for metabolic parameters after 3 weeks of HFD, when the body weight
remained comparable between the two genotypes (Fig. 2.7A). Both Grp78+/+ and +/-
mice were able to maintain normal fasting and fed blood glucose levels, as controlled by
the RD-fed, age-matched cohorts (Fig. 2.7B). Interestingly, the HFD-fed Grp78+/- mice
exhibited a 45% decrease in fed insulin level (1.12±0.11 ng/ml versus 2.01±0.21 ng/ml in
wild-type mice, P=0.002) (Fig. 2.7C). In addition, a ~25% decrease was observed in both
fasting (P=0.008) and fed (P=0.2) blood insulin level of the RD-fed Grp78+/- mice in
comparison to wild-types (Fig. 2.7C), in agreement with the clamp studies (Fig. 2.5B and
C). To directly examine whether Grp78 heterozygosity improved systemic insulin
sensitivity in mice after 3-week HFD, insulin tolerance test was performed, and glucose
clearance was more rapid in Grp78+/- mice (Fig. 2.7D). Collectively, these results
A B
27

support that Grp78 heterozygosity primarily enhances insulin sensitivity in both in vivo
and in vitro systems.

Figure 2.7. Increased insulin sensitivity in Grp78+/- mice after short-term HFD. For 13-week old mice
on RD or after 3-week HFD: (A) Fasting body weight (HFD). (B and C) Blood glucose (B) and insulin (C)
under fasting or fed states (RD and HFD). (A to C: n ≥6 mice per condition.) (D) Insulin tolerance test
(HFD). n=4 (+/+) or 5 (+/-). Data are presented as the mean±SEM. *P<0.05, **P<0.01 for +/- versus +/+.

2.3.4 Prominent increase of insulin sensitivity in WAT of HFD-fed
Grp78+/- mice
To further understand how Grp78 heterozygosity leads to enhanced systemic
glucose metabolism in HFD-fed mice, hyperinsulinemic-euglycemic clamp was
performed on cohorts of mice after 10-11 weeks of HFD, to examine the insulin
sensitivity of individual peripheral tissues (Fig. 2.8). Whole body glucose metabolism
was significantly elevated in the Grp78+/- mice, both at steady-state and upon insulin
stimulation, corresponding with increased insulin sensitivity (Fig. 2.8A). Consistently,
insulin-stimulated whole body glucose flux (glycolysis and glycogen plus lipid synthesis)
were increased by ~25% in the Grp78+/- mice (Fig. 2.8B). Tissue-specific glucose
metabolism was assessed using 2-deoxy-D-[1-
14
C]glucose injection during clamps.
Strikingly, for the Grp78+/- mice, insulin-stimulated glucose uptake was increased by 2-
A B C D
28

fold in WAT (P=0.001) (Fig. 2.8C), but unaltered in skeletal muscle and brown adipose
tissue (Fig. 2.8D). Interestingly, there was a trend towards increased insulin sensitivity in
Grp78+/- liver, indicated by the lower rate of hepatic glucose production (HGP) at both
basal and clamp states (Fig. 2.8E).

Figure 2.8. Grp78 heterozygosity improves insulin sensitivity predominantly in WAT.
Hyperinsulinemic-euglycemic clamp studies on Grp78+/+ (n=9) and +/- (n=6) mice after 10-11 weeks of
HFD. (A) Whole body glucose metabolism indicated by glucose infusion rates (GINF) and clamp glucose
turnover. (B) Whole body glycolysis and glucose anabolism during clamps. (C and D) Glucose uptake by
white adipose (C), skeletal muscle and brown adipose (D) during clamps. (E) Hepatic glucose production at
steady state or during insulin stimulation. Data are presented as the mean±SEM. *P<0.05, **P<0.01 for +/-
versus +/+.

To investigate the underlying molecular mechanism, the insulin-stimulated
phosphorylation of insulin receptor substrate (IRS)-1 and AKT in the WAT was
A B
C D E
29

measured by Western blotting (Fig. 2.9A). Corresponding with the enhanced insulin
sensitivity (Fig. 2.8C), Grp78 heterozygosity improves insulin signaling transduction in
WAT. JNK1 was reported to be upregulated by obesity and impair insulin signaling
(Hirosumi, Tuncman et al. 2002; Ozcan, Cao et al. 2004). In WAT, JNK1 level was
significantly elevated by HFD regimen in wild-type, but not Grp78+/- mice (Fig. 2.9B).
This is consistent with the improved insulin signaling by Grp78 heterozygosity (Fig.
2.9A), and the recent findings that JNK1 deletion in WAT increased AKT signaling in
HFD-fed mice (Sabio, Das et al. 2008).

Figure 2.9. Grp78 heterozygosity improves insulin signaling in WAT. Representative Western blots and
quantitation of phosphorylation of IRS-1 (Tyr) and AKT (Ser473) in WAT of mice after clamps (n=4 mice
per genotype, A), and JNK1 in WAT of 25-week old mice on RD or after 15-week HFD (n=3-5 mice per
condition, B). Data are presented as the mean±SEM. **P<0.01 for +/- versus +/+;
##
P<0.01 for HFD
versus RD.

2.3.5 Grp78 heterozygosity promotes adaptive UPR in WAT
ER stress was reported to activate inflammation and impair insulin signaling in
obese mouse models (Ozcan, Cao et al. 2004). GRP78 is well established as a chaperone
assisting protein folding, as well as a general quencher of UPR signaling under non-stress
status (Wang, Wey et al. 2009). Reduction of GRP78 protein, as a direct result from
Grp78 heterozygosity, could be anticipated to exacerbate ER stress and insulin resistance.
However, cells could adapt to chronic, mild ER stress by activating the pro-survival UPR
A B
30

that attenuate protein load and improves folding capacity in ER (Rutkowski, Arnold et al.
2006). From this point of view, partial loss of GRP78 could mimic low chronic ER stress
and promote adaptive UPR when the cells are unstressed. Consequently, cells with
adaptive UPR might be better protected from obesity-induced ER stress. To dissect the
physiological role of GRP78 in ER homeostasis, protein lysates were prepared from
WAT of Grp78+/+ and +/- mice and the UPR signaling molecules were examined by
Western blotting (Fig. 2.10). Ser51 phosphorylation of the eukaryotic translation
initiation factor eIF2α is a marker of ER stress and attenuation of global protein
translation (Rutkowski and Kaufman 2004). In agreement with previous reports (Ozcan,
Cao et al. 2004), eIF2α phosphorylation was dramatically increased in WAT of HFD-fed
wild-type mice compared to the RD-fed ones, demonstrating constant translational block
in response to HFD-induced ER stress. The RD-fed Grp78+/- mice showed no significant
elevation of eIF2α phosphorylation, suggesting that partial reduction of GRP78 alone
dose not lead to translation arrest in WAT. Comparing to the HFD-fed wild-types, the
HFD-fed Grp78+/- mice exhibited a markedly decrease in eIF2α phosphorylation (Fig.
2.10), implying partial recovery of protein synthesis and attenuation of ER stress.
In tissue culture systems of ER stress, dephosphorylation of eIF2α is mediated
by a negative feedback loop of signal transduction. As downstream signaling of
phosphorylated eIF2α, transcription factors ATF4 and CHOP induce expression of
GADD34, a dominant mediator of eIF2α dephosphorylation. This eventually leads to
resumption of protein synthesis (Novoa, Zeng et al. 2001; Ma and Hendershot 2003).
Interestingly, HFD significantly reduced the expression level of ATF4 and GADD34 in
31

WAT of the Grp78+/+ mice, suggesting a suppression of the negative feedback, and
explaining the sustained eIF2α phosphorylation. In contrast, this suppression was not
observed in the WAT of the Grp78+/- mice, consistent with the recovered translation
(Fig. 2.10).

Figure 2.10. Grp78 heterozygosity promotes adaptive UPR signaling in WAT. Whole cell lysates were
prepared from WAT of 25-week old mice on RD or after 15-week HFD (n=4-6 mice per condition), and
subjected to immunoblotting of indicated UPR signaling molecules. The protein loading was normalized
against β-actin. (A) Representative Western blots. ATF6 (FL): full length ATF6. ATF6 (N): cleaved,
nuclear form of ATF6. XBP-1s: spliced, active XBP-1. XBP-1u: unspliced, inactive XBP-1. (B)
Quantitation of relative protein levels are presented as the mean±SEM. *P<0.05, **P<0.01 for +/- versus
+/+;
#
P<0.05,
##
P<0.01 for HFD versus RD.

The ATF6 and the IRE1 branches of the UPR signaling were also analyzed in
WAT. An increase in the active ATF6 cleaved form was detected in WAT of HFD-fed
Grp78+/- mice, compared to the wild-type mice under both RD and HFD regimen, and
the RD-fed Grp78+/- mice (Fig. 2.10). As an essential pro-survival transcription factor
downstream of the activated IRE-1 (Rutkowski and Kaufman 2007), spliced XBP-1 was
strikingly elevated in Grp78+/- mice compared to the wild-types, in either the RD-fed or
A B
32

the HFD-fed cohorts (Fig. 2.10). One of the protective roles of XBP-1 splicing during ER
stress is to promote ERAD and improve protein quality control by transcriptional
activation of a subset of genes, including EDEM (Lee, Iwakoshi et al. 2003). A
significant increase of EDEM was observed in WAT of HFD-fed Grp78+/- mice, in
comparison to the RD-fed mice or the HFD-fed Grp78+/+ mice (Fig. 2.10). These data
suggest that upon HFD stress, Grp78 heterozygosity promotes ERAD in WAT.
As an important part of the adaptive UPR, enhancement of protein folding
capacity helps to retrieve ER homeostasis (Wang, Wey et al. 2009). The protein levels of
ER chaperones GRP78, GRP94, PDI, calnexin (CNX) and calreticulin (CRT), which are
downstream targets of adaptive UPR, were measured in WAT by immunoblotting (Fig.
2.11). As expected, heterozygous knockout of the Grp78 allele in the RD-fed Grp78+/-
mice resulted in a partial reduction in GRP78 protein level. On the other hand, GRP94
and PDI were significantly increased, and no change was detected for CNX and CRT
levels (Fig. 2.11). Similar observations were reported for primary Grp78+/- MEFs (Luo,
Mao et al. 2006), and confirmed in the immortalized Grp78+/- MEF cell lines used in
this study (Fig. 2.12). Therefore, both in MEFs and WAT, Grp78 heterozygosity induces
compensatory upregulation of GRP94 and PDI in response to partial reduction of GRP78.
However, after 15 weeks of HFD, protein levels of GRP78, GRP94, PDI, CNX
and CRT were all significantly reduced in the WAT of the Grp78+/+ mice (Fig. 2.11),
despite increases in their mRNA levels (Fig. 2.13A), suggesting translational block or
some other posttranscriptional regulation. To further confirm this intriguing finding, we
expanded the observation on Grp78+/+ mice after 3, 7, 10, or 24 weeks of HFD.
33

Compared to the age-matched RD-fed Grp78+/+ mice, protein levels of ER chaperones
were significantly reduced in WAT after 10 weeks of HFD regimen (Fig. 2.13B).

Figure 2.11. Grp78 heterozygosity improves ER protein folding capacity in WAT. Whole cell lysates
were prepared from WAT of 25-week old mice on RD or after 15-week HFD (n=4-6 mice per condition),
and subjected to immunoblotting of indicated ER chaperones. (A) Representative Western blots. CNX:
calnexin. CRT: calreticulin. (B) Quantitation of relative protein levels are presented as the mean±SEM.
*P<0.05, **P<0.01 for +/- versus +/+;
#
P<0.05,
##
P<0.01 for HFD versus RD.

Figure 2.12. Upregulation of ER chaperones GRP94 and PDI in immortalized Grp78+/- MEFs. Whole
cell lysates from immortalized wild-type (+/+) and Grp78+/- MEFs were subjected to Western blotting for
indicated ER chaperones. The protein loading was normalized against β-actin.

A B
34

Figure 2.13. Posttranscriptional down-regulation of ER chaperones in WAT following HFD regimen.
Analyses were performed on WAT of wild-type (Grp78+/+) mice (n ≥3 per condition) (A) Relative mRNA
levels of the indicated ER chaperones (25-week old, 15 weeks of HFD versus RD). The mRNA levels were
measured by RT-PCR and normalized against β-actin. (B) Relative protein levels of the indicated ER
chaperones were measured by Western blotting (normalized against β-actin) after 3, 7, 10, 15, and 24
weeks of HFD, compared to the age-matched RD controls. The dashed lines indicate the HFD:RD ratio
value of 1. Data are mean±SEM.
#
P<0.05,
##
P<0.01 for HFD versus RD.
A B
35

Interestingly, in WAT of the HFD-fed Grp78+/- mice, GRP78 level was nearly
comparable to the wild-type controls. Furthermore, all the other ER chaperones (GRP94,
PDI, CNX and CRT) were markedly upregulated, as compared to the HFD-fed
Grp78+/+ mice (Fig. 2.11). Collectively, these results suggest that chronic HFD regimen
could decrease the ER protein folding capacity in WAT of the wild-type mice. However,
Grp78 heterozygosity promotes adaptive responses in WAT to maintain ER chaperone
synthesis, which may contribute in part to the metabolic benefits. Consistent with this
notion, in skeletal muscle of the Grp78+/- mice where insulin sensitivity was not
improved under HFD conditions (Fig. 2.8D), compensatory ER chaperone upregulation
was not observed (Fig. 2.14A). In the Grp78+/- liver showing a trend of enhanced insulin
sensitivity after HFD (Fig. 2.8E), the level of GRP94, but not the other ER chaperones,
was upregulated (Fig. 2.14B).

Figure 2.14. ER chaperone protein levels in skeletal muscle and liver. Quantitation of indicated ER
chaperones levels in skeletal muscle (normalized against α-actin, A) and liver (normalized against β-actin,
B) of Grp78+/+ and +/- mice on RD or after 15-week HFD. Data are presented as the mean±SEM.
*P<0.05, **P<0.01 for +/- versus +/+;
##
P <0.01 for HFD versus RD.

A B
36

Recently, expression of metabolic genes was suggested to directly respond to
ER homeostasis (Rutkowski, Wu et al. 2008). Corresponding to the adaptive UPR and
improved protein folding capacity in Grp78+/- WAT, the expression of PGC-1α, a
transcriptional co-activator and regulator of mitochondrial energy metabolism and
biogenesis (Cunningham, Rodgers et al. 2007), was enhanced in the WAT of the RD-fed
Grp78+/- mice (Fig. 2.15A). Following 15 weeks of HFD, the PGC-1α level was
dramatically decreased in WAT of the Grp78+/+ mice, and significantly restored in the
Grp78+/- mice (Fig. 2.15A). Interestingly, GRP75, a mitochondrial chaperone mediating
the coupling of ER and mitochondrial Ca
2+
channels (Szabadkai, Bianchi et al. 2006),
was also upregulated in WAT of RD-fed and HFD-fed Grp78+/- mice compared to their
wild-type controls (Fig. 2.15B).

Figure 2.15. Grp78 heterozygosity upregulates PGC-1α and GRP75 in WAT. Whole cell lysates from
WAT of 25-week old mice on RD or after 15-week HFD (n=4-6 mice per condition) were subjected to
Western blotting for PGC-1α (A) and GRP75 (B). In the representative blots, lanes that were run on the
same gel but noncontiguous are divided by lines. Quantitative protein levels are presented as the
mean±SEM. *P<0.05, **P<0.01 for +/- versus +/+;
#
P<0.05,
##
P<0.01 for HFD versus RD.
A B
37

2.3.6 Adaptive UPR protects against ER stress-induced insulin resistance
We further tested whether induction of ER chaperones, the downstream targets
of adaptive UPR, can improve insulin sensitivity under ER stress. As one of the three
UPR signaling branches, protease-cleaved activation of ATF6 induces transcription of
multiple ER chaperones (Wu, Rutkowski et al. 2007; Yamamoto, Sato et al. 2007;
Adachi, Yamamoto et al. 2008). We enforced expression of an active, nuclear form of
ATF6 [ATF6(N)] in the immortalized wild-type MEFs, and examined insulin sensitivity
under ER stress or not. Expression of the HA-tagged ATF6(N) was confirmed by
immunoblotting. The downstream effect of ATF6(N) was revealed by the upregulation of
ER chaperones GRP94, GRP78 and CRT. When cells were subjected to 14-hr treatment
with ER stress inducer tunicamycin, the chaperone expression was further induced (Fig.
2.16A). To assess the cellular insulin sensitivity, insulin-stimulated AKT phosphorylation
was measured by Western blotting. In non-stressed cells, there was no significant
difference between MEFs transfected with HA-ATF6(N) and the vector control.
Tunicamycin-induced ER stress severely impaired insulin signaling in the control cells, in
agreement with previous findings (Ozcan, Cao et al. 2004). Strikingly, overexpression of
ATF6(N) recovered the insulin signaling in cells under tunicamycin insult, suggesting the
protection against ER stress-induced insulin resistance (Fig. 2.16A and B). These in vitro
data support our in vivo observations that adaptive UPR triggered by Grp78
heterozygosity might contribute to the improved insulin sensitivity under HFD-induced
ER stress.
38

Figure 2.16. Overexpression of active ATF6 improves insulin sensitivity in MEFs under ER stress. A
HA-tagged nuclear form of ATF6 [ATF6(N)] was overexpressed in immortalized wild-type MEFs via
transient transfection 72 hr prior to insulin stimulation, controlled by the empty vector. Transfected MEFs
were treated with DMSO or 1.5 μg/ml tunicamycin (Tu) for 14 hr before insulin stimulation. Following 5
hr serum starvation, cells were treated with 100 nM insulin for 15 min. (A) Whole cell lysates were
subjected to Western blotting for indicated proteins. (B) Quantitation of AKT Ser473 phosphorylation is
presented as the mean±SEM. *P<0.05 for +/- versus +/+; ##P<0.01 for HFD versus RD.

2.4 Discussion
Reduction of GRP78, a major ER chaperone and a master regulator of ER
stress signaling (Wang, Wey et al. 2009), triggers compensatory upregulation of other
chaperones in multiple tissues and cell culture systems (Luo, Mao et al. 2006; Li, Ni et al.
2008; Wang, Ye et al. 2010). In this study, we intensively dissect the effects of Grp78
heterozygosity on UPR signaling and ER chaperone balance, which might contribute to
the improved glucose homeostasis in the HFD-induced obese mouse model. We
demonstrate that Grp78 heterozygosity triggers adaptive UPR resulting in compensatory
upregulation of ER chaperones, attenuation of translational block, and improvement of
A B
39

insulin sensitivity, particularly in WAT. While the underlying mechanisms are likely to
be complex, a working model is proposed based on our results (Fig. 2.17).

Figure 2.17. Grp78 heterozygosity protects against diet-induced obesity and insulin resistance. A
model on the proposed mechanisms for the protective effects of Grp78 heterozygosity, which may
contribute to the metabolic benefits against diet-induced obesity and insulin resistance.

We speculate that because of the critical roles of GRP78 in maintaining ER
homeostasis, and the extra demand for protein synthesis and trafficking in WAT
magnified by HFD challenge, compensatory adaptive UPR are activated, including
upregulation of ER chaperones and ERAD, which improves ER quality control and
attenuates inflammation, consequentially improving insulin signaling and glucose
metabolism. In the RD-fed Grp78+/- mice, insulin-stimulated glucose uptake was
enhanced in skeletal muscle, but not in WAT, as revealed by hyperinsulinemic-
40

euglycemic clamp studies (data not shown). The mechanism on how Grp78
heterozygosity promotes insulin sensitivity could be tissue-specific. Other beneficial
effects from the improved ER homeostasis may include enhancement in mitochondrial
activity and energy expenditure, which confers the protection against diet-induced
obesity, insulin resistance and type 2 diabetes.
Recently, it was reported that GRP78 overexpression inhibits SREBP-1c
activation induced by insulin and ER stress, and alleviates fatty liver in the ob/ob mice
(Kammoun, Chabanon et al. 2009). These new findings support the beneficial role of ER
chaperones during metabolic disorders. In their study, chaperone level is increased by
exogenous overexpression of GRP78; in our study, Grp78 heterozygosity results in
compensatory increase of the other ER chaperones, as part of the adaptive UPR. The
consistent notion from both studies is that elevation of protein folding capacity can
attenuate insulin resistance under ER stress, which is further supported by our
observation of enhanced insulin signaling in MEFs where GRP78 and other ER
chaperone levels were elevated upon overexpression of active ATF6. Nonetheless,
chaperone upregulation might account for only part of the beneficial effects from Grp78
heterozygosity and adaptive UPR, noting that in non-stressed MEFs, active ATF6
expression did not enhance insulin sensitivity while Grp78 heterozygosity did.
Interestingly, siRNA knockdown of GRP78 inhibits AKT phosphorylation in prostate
cancer cells cultured with serum (Fu, Wey et al. 2008). One explanation could be that the
activation of AKT by multiple growth factors via different pathways requires GRP78 on
cell surface (Zhang, Liu et al. 2010), which is reported to mediate AKT phosphorylation
41

through coupling with other cell surface proteins (Kelber, Panopoulos et al. 2009; Misra
and Pizzo 2010).
Our studies also suggest that under chronic physiological stress, UPR signal
transduction might be different from the observations in tissue culture models
administrated with pharmacological reagents. For example, in WAT of the wild-type
mice under HFD-induced metabolic stress, sustained eIF2α phosphorylation was
observed, correlating with translational block and downregulation of UPR markers. In
contrast, cultured cells treated with supraphysiological doses of ER stress inducers
exhibit transient eIF2α phosphorylation followed by activation of the downstream signals
(Ma and Hendershot 2003; Ron and Walter 2007). One plausible explanation is that the
proximal UPR signaling is constantly activated to cope with the mild, chronic ER stress
imposed by metabolic demands. This could be an unfavorable status and might progress
towards cell dysfunction.
There are potential links from chaperone proteins to mitochondria function and
energy expenditure in previous reports. Partial reduction in GRP78, a major binding
protein for the ER Ca
2+
stores, could lead to increased Ca
2+
efflux from the ER to the
cytosol. Modulation of cytosolic Ca
2+
levels has been reported to affect energy
metabolism (Hirosumi, Tuncman et al. 2002). There is evidence that the members of the
glucose regulated protein (GRP) family are important regulators of mitochondria function.
For instance, GRP94, which is upregulated by Grp78 heterozygosity, is reported to
molecularly interact with GRP75, an essential mitochondrial chaperone that imports
mitochondrial proteins into the matrix (Matsumoto, Nakagawa et al. 1996). GRP75 is in
42

turn physically linked to the voltage-dependent anion channel (VDAC) and mediates the
coupling of ER and mitochondrial Ca
2+
channels (Szabadkai, Bianchi et al. 2006). Our
studies revealed that the level of GRP75, as well as PGC-1α, are elevated in WAT of
Grp78+/- mice. Increases in mitochondrial biogenesis and function are associated with
elevated energy expenditure. As a supporting evidence, cultured cells with siRNA
knockdown of endogenous GRP78 showed massive ER expansion, coupled with a
substantial increase in mitochondria quantity (Li, Ni et al. 2008). In view of the emerging
evidence indicating that ER and the mitochondria are linked physically and functionally
at least in part through chaperone interaction, the Grp78+/- mouse model will provide a
novel experimental system for future investigations into this exciting new area.
43

Chapter 3: Grp78 heterozygosity regulates ER chaperone balance
in exocrine pancreas and mediates differential response to cerulein-
induced acute pancreatitis
3.1 Introduction
As professional secretory cells, the normal function of exocrine pancreatic
acinar cells highly depends on balance between protein load and folding capacity within
the ER (Lee 2005; Iida, Li et al. 2007). GRP78, the major chaperone targeting unfolded
or misfolded proteins in ER, can regulate the other chaperone levels via signaling UPR
(Wang, Wey et al. 2009). In a Grp78 heterozygous mouse model with C57BL/6 x 129/sv
genetic background, we observed abnormal ER morphology and downregulated ER
chaperones in exocrine pancreas, associated with an exacerbated experimental
pancreatitis response. Interestingly, after high-fat diet (HFD) regimen, ER structure as
well as chaperone levels were restored in Grp78+/- pancreatic acinar cells, which
correlated with improvement in experimental pancreatitis. Fortuitously, we discovered
that Grp78+/- mice backcrossed into the C57BL/6 background also exhibited improved
ER chaperone profile in pancreas, and no greater severity of experimental pancreatitis
compared to wild-type littermates. Administration of 4-phenolbutyrate (4-PBA), a
chemical chaperone assisting protein folding (Welch and Brown 1996), protected against
cerulein-induced pancreatic acinar cell death. Taken together, our studies suggest a
protective role of ER chaperone balance against the acute pancreatitis.
44

3.2 Materials and methods
Animals
The Grp78+/- mice used in this study were generated as described (Luo, Mao
et al. 2006) and maintained in C57BL/6 x 129/sv background through sibling mating,
unless indicated. Mice were maintained under a 12 hour light-dark cycle with ad libitum
access to water and food. Mice were fed on regular diet (RD) (11% fat by calories,
Harlan Teklad, Indianapolis, IN) continuously after weaning (at about 3-week old), or
changed to HFD (45% fat by calories, Research Diets, New Brunswick, NJ) at 10-week
old. Only male mice were used in this study, to circumvent the potential interference
from the female hormonal cycles. Mouse body weight was measured after overnight
fasting. Food intake was analyzed by daily food mass measurement for 5 successive days,
during the 10
th
week of HFD regimen. Mouse stool was collected during the 20
th
week of
HFD regimen, and processed to Oil Red O staining for lipids as described (Harding, Zeng
et al. 2001). The Grp78+/- mouse strain was also backcrossed into C57BL/6 genetic
background for 7 generations and analyzed for ER chaperone levels in pancreas and
severity of experimental pancreatitis. All protocols for animal use and euthanasia were
reviewed and approved by the University of Southern California Institutional Animal
Care and Use Committee.

45

Tissue processing
After sacrifice by cervical dislocation following CO
2
anesthesia, mouse tissues
were immediately frozen in liquid nitrogen and stored at -80°C for immunoblotting, or
fixed in 10% formalin for paraffin sections. For GRP78 immunofluorescence, pancreas
was fixed for 2 hours with 4% paraformaldehyde, and tissue pieces were equilibrated for
2 hours at 4°C in a 15% sucrose-phosphate buffer solution and then embedded in OCT
compound (Miles, Elkhart, IN).
Islet isolation
After sacrifice by cervical dislocation following CO
2
anesthesia, mouse
pancreas was digested by injection of Liberase RI (Roche, Indianapolis, IN) and DNase
(Roche, Indianapolis, IN) via the pancreatic duct (Michael, Geng et al. 2004), followed
by incubation at 37°C for 25 minutes. Islets of Langerhans were hand-picked under a
light microscope.
Immunoblotting
Tissues were homogenized in ice-cold radio-immunoprecipitation assay (RIPA)
buffer (Li, Baumeister et al. 2000) containing cocktails of proteinase inhibitors (Roche,
Indianapolis, IN) and phosphatase inhibitors (Roche, Indianapolis, IN) with a Dounce
homogenizer (Wheaton, Millville, NJ), followed by centrifugation at 13000×g at 4°C for
15 minutes. The Western blotting was performed as described previously (Luo and Lee
2002). Antibodies used included GRP78 (C-20), CHOP, GADD34, XBP-1, EDEM,
GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA); KDEL, GRP94, calnexin,
46

calreticulin (Stressgen, Ann Arbor, MI); pSer51-eIF2α, eIF2α (Cell Signaling, Danvers,
MA); amylase (Calbiochem, Whitehouse Station, NJ); trypsin (Chemicon, Temecula,
CA); and β-actin (Sigma-Aldrich, St. Louis, MO). For each experimental condition,
tissue samples from three or more animals were examined. The Western blotting
procedure was repeated two to six times.
Histological analysis, immunohistochemistry, immunofluorescence and
TUNEL assay
Formalin-fixed pancreas sections were embedded in paraffin. Five μm sections
were stained with hematoxylin and eosin (H&E) for assessment of general morphology.
PCNA (PC10) and GADD153 (B-3) primary antibodies (Santa Cruz Biotechnology,
Santa Cruz, CA) were used for PCNA immunofluorescence and CHOP
immunohistochemistry, respectively. Insulin and glucagon primary antibodies (Signet
Labs, Dedham, MA) were also used for immunohistochemistry. Staining procedure was
as previously described (Wang, Ye et al. 2010). For GRP78 immunofluorescence analysis,
5 μm frozen pancreatic tissue sections were fixed in 0.1 M phosphate buffer containing
4% paraformaldehyde, washed several times in phosphate-buffered saline (PBS)
supplemented with 0.5% saponin, 0.2% Tween-20 and blocked with 2% donkey serum.
Tissue sections were then incubated overnight with GRP78 (C-20) primary antibody
(Santa Cruz Biotechnology, Santa Cruz, CA) followed by incubation with secondary
antibody conjugated with FITC (Jackson ImmunoResearch Laboratories, West Grove,
PA). Images were visualized using the Zeiss LSM510 laser scanning confocal
47

microscope with a 63x objective. TUNEL assay was performed on paraffin sections using
the cell death detection kit (Roche, Indianapolis, IN), and counted in an average of 25
fields by the Quantity One software (Bio-Rad, Hercules, CA).
Transmission electron microscopy
The procedure was similar with that previously described (Wang, Ye et al.
2010). Pancreas tissues were fixed in ½ strength Karnovsky's fixative (final
concentrations: 2% paraformaldehyde, 2.5% glutaraldehyde in 0.1 M cacodylate buffer,
pH 7.4) overnight at 4°C, than post fixed in 1% osmium tetroxide for 2 hours on ice.
Samples were dehydrated in a graded alcohol (ETOH) series and infiltrated with Eponate
resin (Ted Pella Inc., Redding, CA). Ultrathin sections were cut at 70 nm and stained
with uranyl acetate and lead citrate. Sections were examined on a JEOL JEM 2100
electron microscope (Peabody, MA) and photographed with the Orius SC1000B Gatan
digital camera (Pleasanton, CA).
Experimental pancreatitis
Mice were subjected to 7 hourly intraperitoneal (IP) injections of cerulein
(Sigma-Aldrich, St. Louis, MO) at a dosage of 50 μg/kg body weight per injection. Mice
subjected to comparable injections of PBS served as controls. One hour after the last
injection, mice were sacrificed and collected for tissues.

48

Quantitation of neutrophil infiltration, edema and necrosis
H&E-stained pancreas sections were examined by Nikon Eclipse TE2000-S
inverted phase microscope (Nicon Corp., Japan). Neutrophils were identified by their
histological characteristics as described previously (Sandoval, Gukovskaya et al. 1996).
The number of infiltrating neutrophils was obtained by counting the neutrophils at 40×
magnification in an average of 50 fields covering at least 1000 acinar cells. For each
animal, neutrophil numbers were expressed as a percentage of acinar cells. For
quantitation of edema, the percentage area of non-parenchymal space was analyzed in an
average of 50 fields, using the ImageJ software (NIH, Bethesda, MD). Quantification of
necrosis was performed as described previously (Mareninova, Sung et al. 2006). Cells
with swollen cytoplasm, loss of plasma membrane integrity and leakage of organelles
into interstitium were considered necrotic. A total of at least 1000 acinar cells were
counted on pancreatic tissue sections from each animal.
Serum amylase and lipase
Serum amylase and lipase levels were measured in a Hitachi 707 analyzer
(Antech Diagnostics, Irvine, CA), as described previously (Mareninova, Sung et al. 2006).
Tissue culture and treatment
NIH3T3 cells were cultured in Dulbecco’s modified Eagle’s medium
containing 10% fetal bovine serum and antibiotics. To induce ER stress, cells were
treated with 300 nM thapsigargin (Sigma-Aldrich, St. Louis, MO) for 16 hours. Rat
exocrine pancreas cell line AR42J was cultured in F-12K medium supplied with 20%
49

fetal bovine serum and antibiotics. Primary pancreatic acini were isolated from wild-type
mice and cultured as described (Szmola and Sahin-Tóth 2010). After administration with
cerulein (Sigma-Aldrich, St. Louis, MO) and/or sodium 4-phenolbutyrate (Calbiochem,
Whitehouse Station, NJ), cells were subjected to trypan blue exclusion assay for cell
viability (Dong, Ko et al. 2005).
Statistical analysis
Two-tailed Student t test was applied for all pairwise comparisons.
50

3.3 Results
3.3.1 ER lumen dilation and chaperone reduction in Grp78+/- exocrine
pancreas
Consistent with the normal growth and organ development in the heterozygous
Grp78 (Grp78+/-) mice reported previously (Dong, Ni et al. 2008), their general
pancreatic morphology was comparable with that of the wild-type (Grp78+/+) mice, as
revealed by H&E staining (Fig. 3.1A). Confocal microscopy of immunofluorescence
staining revealed the reduction of GRP78 in the exocrine pancreas (Fig. 3.1B).

Figure 3.1. Reduction of GRP78 protein in pancreatic acinar cells of adult Grp78+/- mice. (A)
Representative H&E staining of pancreatic sections from 7-month old Grp78+/+ and +/- mice fed regular
diet (RD, n ≥3 for each genotype). (B) Confocal microscopy of GRP78 (green) immunofluorescence (IF) on
pancreatic acinar cells. N: nucleus. n=2 (+/+) or 4 (+/-).

A
B
51

As professional cells in protein production and secretion (Gittes 2009),
pancreatic acinar cells might have specific demands on GRP78, the major chaperone and
master regulator of ER homeostasis (Lee 2005). To investigate whether decreased level
of GRP78 would lead to changes in subcellular organelles in pancreatic acinar cells,
transmission electron microscopy (TEM) was used to examine the organelle structure and
organization (Fig. 3.2). In contrast to the tightly packed ER in wild-type (0 with dilated
ER out of 35 cells from 10 random fields), notable dilation of ER lumen was observed in
~35% (12 out of 34 cells from 10 random fields) of Grp78+/- acinar cells, suggesting
GRP78 mediates maintenance of normal ER structure. There was no apparent difference
in number or appearance of secretory granules between the two genotypes.

Figure 3.2. Dilated ER lumen in Grp78+/- pancreatic acinar cells. Representative transmission electron
micrographs (TEM) of pancreatic acinar cells of 6-month old Grp78+/+ and +/- mice fed RD (n=2 for
each genotype). Lower panels demonstrate higher magnification of the boxed area of the corresponding
upper panels. Arrowheads indicate endoplasmic reticulum (ER). N: nucleus; G: secretory granules.

52

To address whether the abnormal ER structure associates with changes in ER
homeostasis, we measured protein levels of ER chaperones, including GRP78, GRP94,
calnexin (CNX), and calreticulin (CRT), in pancreas (Fig. 3.3). Grp78 heterozygosity led
to notably reduction of not only GRP78, but also CNX and CRT. GRP94 level in
Grp78+/- and +/+ pancreas was comparable. Considering the major portion (~90%) of
digestive acinar cells within the whole pancreas, these data inferred reduction of specific
ER chaperones GRP78, CNX and CRT in exocrine pancreas, which resulted from Grp78
heterozygosity. The depleted chaperones might correlate with the abnormal ER structure,
representing disturbance in ER homeostasis.

Figure 3.3. Reduced ER chaperone levels in Grp78+/- exocrine pancreas. Protein levels of ER
chaperones GRP78, GRP94, calnexin (CNX), and calreticulin (CRT) were examined in pancreas from 7-
month old Grp78+/+ and +/- mice fed RD (n ≥3 for each genotype) by Western blotting. Left panel:
representative blots. Right panel: quantitative levels normalized against β-actin. Data are presented as the
mean±SEM. *P<0.05, **P<0.01.

3.3.2 Recovery of ER structure and chaperone levels in Grp78+/- exocrine
pancreas after high-fat diet regimen
53

Previous studies revealed that high-fat diet (HFD) enhances the synthesis and
secretion of digestive enzymes from exocrine pancreas (Spannagel, Nakano et al. 1996;
Chowdhury, Nishikawa et al. 2000). With reduced GRP78 level in the Grp78+/- mice,
the increased demand on digestive enzyme synthesis in the pancreatic acinar cells might
lead to mild chronic ER stress, which is known to trigger adaptive ugregulation of ER
chaperones (Rutkowski, Arnold et al. 2006). To test this, Grp78+/+ and +/- male
littermates were fed HFD (45% fat by calories) from 10-week old, for 20 weeks (Fig.
3.4A). HFD regimen elevated body weight in both genotypes at a similar extent (Fig. 3.4
B). Food intake of Grp78+/- mice was approximate to that of Grp78+/+ mice (Fig. 3.4C).
There was no evidence of fat malabsorption in these mice, as determined by Oil Red O
staining of stool smears (Fig. 3.4D).

Figure 3.4. HFD-fed Grp78+/- mice showed normal food intake and fat absorption. (A) Scheme of
high-fat diet (HFD) feeding. Cohorts of Grp78+/+ and +/- male littermates were fed RD after weaned at 3-
week old and switched to HFD feeding from 10-week old. (B) Fasting body weight. n ≥5 mice per condition.
#
P<0.05,
##
P<0.01 for HFD versus RD. (C) Food intake measurement during the 10
th
week of HFD. n=9
mice for each genotype. Data are presented as the mean±SEM. (D) Oil Red O staining of stool smear from
mice during the 20
th
week of HFD. Negative control: dH
2
O; positive control: white adipose extract. n=3
(+/+) or 4 (+/-).
A
B
C
D
54

Strikingly, after HFD regimen, Grp78+/- mice exhibited well-organized,
tightly-packed ER in pancreatic acinar cells, as revealed by TEM (Fig. 3.5).

Figure 3.5. Recovery of ER morphology in pancreatic acinar cells of Grp78+/- mice after HFD.
Representative TEM of pancreatic acinar cells from mice after 12 weeks of HFD (n=2 for each genotype).
Lower panels demonstrate higher magnification of the boxed area of the corresponding upper panels.
Arrowheads indicate ER. N: nucleus; G: secretory granules.

Noting the association between dilated ER lumen (Fig. 3.2) and reduced
chaperones (Fig. 3.3) in exocrine pancreas of Grp78+/- mice fed RD (11% fat by
calories), the ER chaperone levels in pancreas of the HFD-fed mice were examined (Fig.
3.6A). Interestingly, despite the haploinsufficiency of Grp78 gene, GRP78 protein level
in Grp78+/- pancreas was comparable with that in the Grp78+/+ mice, suggesting that
HFD triggers recovery of GRP78 level in the pancreas of the heterozygous mice. In
contrast to the unaltered GRP94, reduced CNX and CRT in the RD-fed mice (Fig. 3.3),
55

HFD regimen led to marked upregulation of GRP94, as well as recovery of CNX and
CRT, in Grp78+/- pancreas in the levels comparable to the Grp78+/+ mice (Fig. 3.6A).
The restoration of the GRP78 level and upregulation of GRP94 responses were mainly
contributed by the exocrine pancreas, since the Grp78+/- endocrine islets showed
reduced GRP78 and GRP94, but comparable levels of CNX and CRT, with that of
Grp78+/+ mice (Fig. 3.6B).

Figure 3.6. Restored ER chaperone levels in exocrine pancreas of Grp78+/- mice after HFD. Protein
levels of ER chaperones GRP78, GRP94, calnexin (CNX), and calreticulin (CRT) were examined in whole
pancreas (A) and isolated islets of Langerhans (B) from Grp78+/+ and +/- mice after 20 weeks of HFD
(n ≥3 for each genotype) by Western blotting. Left panels: representative blots. Right panels: quantitative
levels normalized against β-actin. Data are presented as the mean±SEM. **P<0.01.

A
B
56

Collectively, these studies showed that GRP78 protein level is restored in
Grp78+/- pancreas after chronic HFD, which is accompanied by the reinforcement of
other ER chaperones and relative normal ER structure in pancreatic acinar cells. These
findings further support the link between ER chaperone balance and ER structure
maintenance.

3.3.3 Differential response to experimental pancreatitis in Grp78+/- mice is
associated with ER chaperone balance in pancreas
Towards further understanding of the role of ER homeostasis in pancreatitis,
we employed cerulein-induced acute pancreatitis as an experimental model. After 7
hourly intraperitoneal (IP) injections of cerulein (50 μg/kg body weight), Grp78+/+ and
+/- mice continuously fed RD, or after 20 weeks of HFD, were sacrificed for analyses
(Fig. 3.7).

Figure 3.7. Scheme of cerulein-induced acute pancreatitis. 30-week old Grp78+/+ and +/- male
littermates, fed RD or HFD, were subjected to 7 hourly intraperitoneal injections of cerulein (50 μg/kg
body weight), followed by sacrifice and analysis.

Corresponding to the abnormal ER structure (Fig. 3.2) and decreased chaperone
levels (Fig. 3.3) under physiological conditions, the exocrine pancreas from Grp78+/-
57

mice showed greater morphological changes of pancreatitis than wild-type. There was
conspicuous augment of cell necrosis, edema and inflammation observed in pancreas
from Grp78+/- mice compared to Grp78+/+ mice (Fig. 3.8A). Chaperone profile was
improved (Fig. 3.6A) and ER structure was reinstated (Fig. 3.5) in the pancreas of
Grp78+/- mice after HFD regimen. Consistently, there was much less severe
experimental pancreatitis observed in the HFD-fed Grp78+/- mice (Fig. 3.8B) than in the
RD-fed Grp78+/- mice.

Figure 3.8. Diet-induced differential response to experimental pancreatitis in Grp78+/- mice.
Representative H&E staining of pancreatic sections from RD-fed (A) and HFD-fed (B) mice after cerulein
injection (n ≥3 for each condition). Lower panels demonstrate higher magnification of the boxed area of the
corresponding upper panels.

To further characterize the severity of acute pancreatitis in cerulein-treated
animals, infiltrated neutrophil counting (Fig. 3.9A) was employed as a key quantitative
index of inflammation (Pandol, Saluja et al. 2007). Consistent with the morphological
abnormalities (Fig. 3.8A), there was a 3.8-fold increase (24±4 versus 6±1) in neutrophilic
infiltration observed in the pancreas of RD-fed Grp78+/- mice, in comparison to that
A B
58

from Grp78+/+ mice. After HFD, the pancreas from Grp78+/- mice showed fewer
neutrophils than that from Grp78+/+ mice (8±2 versus 12±2). When edema area was
quantitated (Fig. 3.9B), RD-fed Grp78+/- mice displayed a 73% increase compared with
Grp78+/+ mice. After HFD, the edema area in the pancreas from Grp78+/- mice was
comparable with that of Grp78+/+ mice, and 18% lower than that of the RD-fed
Grp78+/- mice (P=0.02). In the RD-fed group, blood amylase (Fig. 3.9C) and lipase (Fig.
3.9D) levels were similar between the two genotypes. In the HFD-fed group, amylase and
lipase levels increased by 2.5- and 4-fold respectively in the Grp78+/+ mice, whereas
Grp78+/- mice displayed levels comparable to the RD-fed mice.

Figure 3.9. Pathological parameters of acute pancreatitis in Grp78+/- mice. (A and B) H&E-stained
pancreas sections were counted for neutrophils (A), or quantitated for area of edema represented by non-
parenchymal space (B). (C and D) Serum samples were assayed for amylase (C) and lipase (D). Data are
presented as the mean±SEM. n ≥3 mice for each condition. *P<0.05, **P<0.01.

Next the extent of cell death contributed by apoptosis and necrosis, respectively,
was determined. TUNEL assays used for detection of apoptosis revealed no apoptotic
signal in PBS-treated mice, whereas after cerulein treatment, about 7% of Grp78+/+
acinar cells were apoptotic, in either RD-fed or HFD-fed mice, compared to about 4%
A B C D
59

apoptotic acinar cells in Grp78+/- mice, either RD-fed or HFD-fed (Fig. 3.10A and B).
Histological examination was performed to detect necrosis. While less than 3% of the
acinar cells were necrotic in PBS treated mice, after cerulein treatment, about 27% of
Grp78+/+ acinar cells, compared to 47% of the Grp78+/- mice (1.7-fold increase,
P=0.004), underwent necrosis (Fig. 3.10C). After HFD, about 58% of Grp78+/+ acinar
cells, compared to 27% of the Grp78+/- mice (2.1-fold decrease, P=0.001) were necrotic
(Fig. 3.10C).

Figure 3.10. Differential cell death in exocrine pancreas of Grp78+/- mice with experimental
pancreatitis. The Grp78+/+ and +/- mice were fed with either RD or HFD, and treated with either PBS or
cerulein as indicated. (A) TUNEL assay on pancreas sections. Representative fields showing TUNEL (red)
signal alone (upper panels) or merged with DAPI (blue, lower panels). (B)Apoptotic cells (TUNEL merged
with DAPI) were counted as percentage of total cells (DAPI). (C) Necrotic cells were counted on H&E-
stained pancreas sections as percentage of total cells. Data are presented as the mean±SEM. n ≥3 mice for
each condition. **P<0.01.
A
B C
60

Taken together, Grp78+/- mice exhibited exacerbated necrotizing pancreatitis,
which was improved after HFD regimen, associating with recovery of chaperone levels
(Fig. 3.6A).
Serendipitously, we examined the chaperone levels in pancreas from RD-fed
Grp78+/- mice backcrossed into pure C57BL/6 genetic background for 7 generations.
Although decreased GRP78 was observed in these Grp78+/- mice, GRP94 was
upregulated while CNX and CRT were comparable to those in the wild-type littermates
(Fig. 3.11A). Cerulein administration led to similar severity of pancreatitis between the
two genotypes in C57BL/6 background mice (Fig. 3.11B). These fortuitous findings
suggest that the general ER chaperone balance, rather than GRP78 alone, contributes to
the protection against experimental pancreatitis.

Figure 3.11. Specific regulation of pancreatic ER chaperones and response to experimental
pancreatitis in Grp78+/- mice backcrossed into C57BL/6 background. (A) Protein levels of ER
chaperones were examined in pancreas from RD-fed 7-month old Grp78+/+ and +/- littermates
backcrossed into C57BL/6 background for 7 generations (n ≥3 for each genotype) by Western blotting. Left
panel: representative blots. Right panel: quantitative levels normalized against GAPDH. Data are presented
as the mean±SEM. *P<0.05, **P<0.01. (B) Representative H&E staining of pancreatic sections from mice
after cerulein injection (n ≥3 for each genotype).

3.3.4 Modulation of UPR signaling by cerulein and diet in pancreas of
Grp78+/- Mice
A B
61

To evaluate the effect of cerulein treatment and diet on ER stress, pancreas
lysates from Grp78+/+ and +/- mice (C57BL/6 x 129/sv background), fed RD or HFD,
were prepared and subjected to immunoblotting analysis of ER stress markers. First we
examined the phosphorylation status of the translational initiation factor
eIF2α. Compared to mice injected with PBS, cerulein treatment induced eIF2α
phosphorylation, in both RD and HFD fed mice of both genotypes (Fig. 3.12A). Cerulein
treatment also induced the nuclear transcriptional factor CHOP and the spliced form of
X-box binding protein (XBP-1s) in RD-fed Grp78+/+ mice (Fig. 3.12B). Interestingly, in
the cerulein-treated group, we observed a 4.7-fold increase in CHOP level in the RD-fed
Grp78+/- mice, compared to Grp78+/+ mice. After HFD, CHOP levels in both
genotypes were reduced to that comparable to the RD-fed Grp78+/+ mice (Fig. 3.12B).
The differential levels of CHOP induction were further confirmed by immunostaining of
pancreas sections (3.13). On the other hand, the growth arrest and DNA damage
inducible 34 protein (GADD34) was not detectable in mice of all the experimental groups,
although GADD34 induction was readily observed in thapsigargin-treated mouse
fibroblast NIH3T3 cells (Fig. 3.12B). For the ER degradation-enhancing mannosidase-
like protein (EDEM), similar levels were observed for PBS-treated mice of both
genotypes; after cerulein treatment, reduction in EDEM level was observed in the RD
group but not in the HFD group (Fig. 3.12B). Collectively, these results show that
cerulein treatment induces ER stress in mouse pancreas, and that cerulein and diet exert
differential effects on selective ER stress markers in the pancreas of Grp78+/- mice.
62

Figure 3.12. Modulation of ER stress response by cerulein and diet in pancreas of Grp78+/- mice.
Whole cell lysates of pancreas from Grp78+/+ and +/- mice, fed RD or HFD, after 7 hourly PBS or
cerulein injections (n ≥3 for each condition), were subjected to immunoblotting of the indicated ER stress
response proteins: (A) pSer51- and total eIF2α, (B) CHOP, GADD34, spliced form of XBP-1(XBP-1s) and
EDEM, with GAPDH serving as loading control. NIH3T3 cells, either non-treated (-) or treated with 300
nM thapsigargin for 16 hr (Tg) served as negative and positive control respectively. Left panels:
representative Western blots. Lanes for the NIH3T3 samples were run on the same gel as the tissue samples
but noncontiguous. Right panels: quantitation of relative protein levels after normalization against GADPH
levels. Data are presented as the mean±SD.

Figure 3.13. CHOP immunostaining in pancreatic acinar cells of Grp78+/- mice. The 7-month old
Grp78+/+ and +/- mice were fed with either RD or HFD, and treated with PBS or cerulein as indicated.
Paraffin sections of pancreas were subjected to immunostaining for CHOP (brown), counterstained with
hematoxylin (blue). Arrowheads: acinar cell nuclei with positive CHOP staining.
A
B
63

3.3.5 Protection against cerulein-induced cell death by 4-PBA
To test the hypothesis that improved folding capacity can attenuate the severity
of acute pancreatitis, 4-phenolbutyrate (4-PBA), a chemical chaperone known to assist
protein folding and alleviate ER stress (Welch and Brown 1996; Kubota, Niinuma et al.
2006), was administrated to exocrine pancreatic cells. In either the rat pancreatic cell line
AR42J (Fig. 3.14A) or the mouse primary acinar cells (Fig. 3.14B), treatment of 4-PBA
alone was not detrimental for cell viability. Cell death was significantly induced by
cerulein, and suppressed by 4-PBA in a dose-dependent manner. These results directly
support the protective role of ER protein folding capacity in cerulein-induced acute
pancreatitis.

Figure 3.14. 4-PBA protected against cerulein-induced cell death. Trypan blue exclusion assay was
performed on (A) AR42J cells after 72 hr treatment of 4-PBA and simultaneous treatment of cerulein
during the last 24 hr, and (B) primary acinar cells isolated from wild-type mice and simultaneously treated
with 4-PBA and cerulein for 8 hr. Percentage of dead cells is presented as the mean±SEM from triplicate
samples. *P<0.05, **P<0.01 versus the cerulein-only treatment.

3.4 Discussion
Although molecular signaling in the pathogenesis of acute pancreatitis remains
incomplete, ER homeostasis is emerging as a mediator of pancreatic acinar cell function
A B
64

under both physiological and pathological conditions (Pandol 2006). Utilizing a targeted
mutant mouse model of GRP78, we discovered the potential protective role of ER
chaperones against experimental pancreatitis. Reduction of multiple ER chaperones,
along with partial ER lumen dilation, occurred in Grp78+/- mice with C57BL/6 x 129/sv
background, when fed RD. These physiological changes were associated with an
increased severity of cerulein-induced experimental pancreatitis. Further, cerulein
treatment induced ER stress response, including phosphorylation of eIF2α and induction
of CHOP and XBP-1s, as previously reported for the arginine-induced acute pancreatitis
in rats (Kubisch, Sans et al. 2006). Noticeably, CHOP level was dramatically elevated in
pancreas of cerulein-treated, RD-fed Grp78+/- mice, as compared to wild-type control.
Nonetheless, CHOP elevation in the pancreas of the Grp78+/- mice did not result in
GADD34 induction or increase in apoptosis. Rather, we observed decrease in apoptosis
in these mice, associating with increase in necrosis, neutrophil infiltration and
pancreatitis severity. This implies that CHOP-mediated ER stress apoptotic pathway was
not activated after 7 hours of cerulein treatment.
More mechanistic insights are provided from our discovery that after chronic
HFD regimen, the chaperone levels (including GRP78) and morphology of ER in
pancreas from Grp78+/- mice were restored, thus physiologically mimicking a gain-of-
function of ER chaperones. This is consistent with our hypothesis that partial depletion of
GRP78 in the exocrine pancreas of the Grp78+/- mice leads to adaptive increase in ER
protein folding capacity when challenged with HFD. Accordingly, these mice showed
improvement in acute pancreatitis. Despite the use of blood digestive enzymes as a
65

measure of severity in clinical pancreatitis, blood amylase levels do not always correlate
with clinical severity of the disease, rather the inflammatory and necrosis scores show a
much stronger correlation (Evans, Robinson et al. 1986; Winslet, Hall et al. 1992; Al-
Bahrani and Ammori 2005). This was also observed in our mouse model following
cerulein treatment. In direct support of our mechanistic explanation, Grp78+/- mice
backcrossed to C57BL/6 genetic background did not exhibit general decrease in ER
chaperone levels, and exacerbated acute pancreatitis was not observed in these mice.
Taken together, the findings from our mouse models suggest that ER chaperone balance
in exocrine pancreas protects against the severity of acute pancreatitis.
The impact of Grp78 insufficiency on ER homeostasis and cellular function
could be dose-dependent and tissue-specific. Homozygous knockout of Grp78 suppresses
proliferation of mouse embryonic blastocysts and leads to apoptosis of the inner cell mass,
resulting in embryonic lethality at day 3.5 (Luo, Mao et al. 2006), but does not affect
prostate development when the targeted mutation is restricted to the postnatal prostate
epithelium (Fu, Wey et al. 2008). Nonetheless, knockout of GRP78 in these same cells
blocks prostate cancer progression (Fu, Wey et al. 2008). Correspondingly, Grp78
heterozygosity did not change superficial phenotypes in mice, but significantly impedes
the growth of MMTVPyVT transgene-induced mammary tumor progression and tumor
angiogenesis (Dong, Ni et al. 2008), implying that GRP78 function is particularly critical
for pathophysiological conditions such as cancer (Lee 2007). Knockdown of Grp78 by
siRNA results in massive ER lumen expansion and disorganization in mammalian cell
lines HEK293 and HeLa (Li, Ni et al. 2008). Here we report that moderate dilation of ER
66

lumen was observed in pancreatic acinar cells with Grp78 heterozygosity. Compensatory
upregulation of ER chaperones is observed in liver and mouse embryonic fibroblasts
(Luo, Mao et al. 2006), but not in pancreas. Our discovery of different ER chaperone
profiles in pancreas from RD-fed Grp78+/- mice in different genetic backgrounds also
suggests a polygenic response to Grp78 heterozygosity, which awaits further
investigation.
Our studies suggest improving ER protein folding capacity as a potential target
for prevention and therapy of acute pancreatitis. Administration of chemical chaperones,
e.g. 4-PBA, has been shown to attenuate ER stress and confer improvement in a variety
of diseases, including Parkinson's disease (Kubota, Niinuma et al. 2006; Ono, Ikemoto et
al. 2009), leptin resistance (Ozcan, Ergin et al. 2009), insulin resistance (Ozcan, Yilmaz
et al. 2006), and autosomal dominant familial isolated hypoparathyroidism (Datta,
Waheed et al. 2007), as well as adipose tissue differentiation and maturation (Basseri,
Lhotak et al. 2009), and palmitate-mediated hepatocyte cell death (Pfaffenbach, Gentile
et al. 2010). Here we demonstrate that in both primary acini and cell lines from rodent
exocrine pancreas, cerulein-induced cell death is rescued by 4-PBA treatment.
Enhancement of ER protein folding capacity might inhibit the vicious signaling leading
to severe inflammation and cell necrosis, thus reduce the high mortality rate in patients
with necrotizing pancreatitis.
Obesity has been demonstrated as a risk factor for acute pancreatitis in human,
associating with higher severity and mortality rate (Frossard, Lescuyer et al. 2009).
Although the underlying mechanism remains unknown, it has been proposed that
67

excessive fat with necrosis might exacerbate inflammation during the course of acute
pancreatitis (Frossard, Lescuyer et al. 2009). Although not designed to address this topic,
our study might provide some potentially interesting thoughts. First, HFD regimen
worsened the experimental pancreatitis in wild-type mice, consistent with the reports on
human patients. Second, although HFD does impose stress on exocrine pancreas in the
wild-type mice, an adaptive response to the chronic ER stress upon HFD is triggered by
Grp78 heterozygosity, resulting in upregulation of GRP94 level and recovery of other ER
chaperone levels including GRP78. Similar responses are demonstrated in white adipose
tissue, protecting against insulin resistance (Chapter 2). Future studies creating new
mouse models with gain of chaperone function will provide direct proof of our
hypothesis which has significant therapeutic implications for acute pancreatitis.
68

Chapter 4: IP3R1 mutation perturbs glucose homeostasis and
enhances susceptibility to diabetes
4.1 Introduction
As an essential secondary messenger, Ca
2+
controls various cellular processes,
such as vesicle trafficking, filament activation, and cell death. Cytosolic Ca
2+

concentration is regulated by ion flux via channel proteins located on plasma membrane
and intracellular Ca
2+
stores. As ligand-gated Ca
2+
efflux channels, the inositol 1,4,5-
triphosphate receptors (IP3Rs) have been found on the membrane of endoplasmic
reticulum (ER) as well as secretory granules (Vanderheyden, Devogelaere et al. 2009).
The evidence on their regulatory roles in pancreatic β-cell exocytosis and metabolism is
emerging. The association between defective IP3Rs expression and impaired Ca
2+

signaling/insulin secretion was observed in the mouse pancreatic β-cells from the anx7+/-
mice, with the notion that Anx7 is a GTPase supporting Ca
2+
channel function
(Srivastava, Atwater et al. 1999). During cAMP amplification of insulin release, the
protein kniase A-promoted Ca
2+
release from intracellular stores to cytosol is through the
IP3R channels (Dyachok and Gylfe 2004). In human, the IP3R3-encoding gene variations
have been identified as a risk factor for type 1 diabetes (Roach, Deutsch et al. 2006).
While investigating the in vivo regulation of the ER rheostat GRP78, three
transgenic mouse lines were created to study the role of a promoter element (D2) in
Grp78 gene transcription. Fortuitously, we observed progressive glucose intolerance in
69

only one of these lines, referred to below as D2D, as a consequence of the genomic
integration site of the transgene. With inverse PCR (IPCR), it was determined that the
transgene replaced 10 gene loci on chromosome 6, with the Itpr1 gene interrupted near
the middle. As a first step towards elucidating the molecular mechanism leading to
glucose intolerance in the D2D line, we investigated whether disruption of one Itpr1
allele is a contributing factor to the phenotype, assisted by the opt/+ mouse model. Our
results revealed that opt/+ mice exhibited early-onset glucose intolerance. The
pathophysiological significance of IP3R1 was further revealed by the aggravation of
high-fat diet (HFD)-induced diabetes in opt/+ mice. Collectively, our findings
demonstrate the novel physiological role of IP3R1 in maintenance of glucose
homeostasis, although the underlying mechanism awaits further investigation.

4.2 Materials and methods
Plasmid construction
To construct the D2/LacZ plasmid, the BamHI fragment from -169/LacZ was
first inserted into the BglII site at the internal deletion junction of D300/LacZ (Luo,
Baumeister et al. 2003). The D2 promoter was then digested with HindIII and sub-cloned
back to the SV40-β-gal plasmid at the HindIII site.

70

Animals
The D2/LacZ transgenic mouse lines (D2D, D2P and D2L) were generated by
the same procedure as previously described (Kim, Higashimori et al. 2004). Itpr1
heterozygous mutant mice opt/+ were purchased from Jackson Laboratory, in the
B6C3Fe genetic background. Both D2D and the opt/+ mice were maintained via sibling
mating. Mice were fed on regular diet (RD, 11% fat by calories, Harlan Teklad)
continuously after weaning at 3-week old, or changed to high-fat diet (HFD, 45% fat by
calories, Research Diets) at 10-week old, with ad libitum food access. Only male mice
were used in this study, since the hormonal cycles in female might confound the
metabolic phenotypes. Mouse body weight was measured after overnight fasting. Food
intake was analyzed by daily food mass measurement for 4 or 5 successive days. Mouse
stool was processed to Oil Red O staining for lipids as described (Wang, Ye et al. 2010).
All protocols for animal use and euthanasia were reviewed and approved by the
University of Southern California Institutional Animal Care and Use Committee.
Blood glucose and insulin
Mouse tail blood was measured for glucose by OneTouch Ultra System
(Lifescan Inc., Milpitas, CA), or prepared for plasma and measured for insulin with
ELISA kit (Linco Research).

71

Glucose tolerance test
After overnight fasting, mice were subjected to intraperitoneal injection of
glucose (1 mg/g body weight), followed by blood glucose measurement at multiple time
points.
Inverse PCR (IPCR)
Genomic DNA was prepared from mouse tail biopsy with the previously
described procedure (Laird, Zijderveld et al. 1991). Five μg genomic DNA was digested
with 40 U restriction endonuclease StuI (New England Biolabs, Ipswich, MA) in a total
volume of 50 μl (37°C, overnight). Following inactivation of the restriction enzyme
(65°C, 20 min) and precipitation in 70% ethanol, the restrictive DNA fragments were
ligated with 3200 U of T4 DNA ligase (New England Biolabs, Ipswich, MA) in a total
volume of 450 μl (16°C, overnight) to form circles. After precipitation in 70% ethanol,
the DNA was dissolved in 40 μl storage buffer (10 mM Tris-Cl, 0.1 mM EDTA, pH 7.5)
and served as the template of the subsequent nested PCR. The nested PCR was performed
in a total volume of 50 μl, with 2.5 U Taq polymerase (New England Biolabs, Ipswich,
MA) and 2.5 U Taq extender (Stratagene, La Jolla, CA). The primer sequences are listed
in Table 4.1. PCR products were separated by agarose gel electrophoresis, purified with
Gel Extraction Kit (QIAGEN, Valencia, CA), and sequenced.

72

Genotyping
The D2 transgenic mouse lines (D2D, D2P and D2L) were genotyped by PCR
with the primer pair LacZ-901 and LacZ-1351, yielding a 451-bp product from the
D2/LacZ transgene locus and no product from the wild-type (WT) allele. For direct
determination of the junction sequences between genomic DNA and the transgene, the
primers G78P-1R and ItprR were used for the 5’-end, and M106M-f6 and LacZ-3F for
the 3’-end. To distinguish the homozygous D2D mice from the heterozygous ones, PCR
primers Itpr-1f and ItprR-3 were used to amplify a 604-bp product exclusively from the
WT allele, while LacZ-901 and LacZ-1351 were used to detect the D2D allele. The
primer sequences are listed in Table 4.2. Opt mice were genotyped following the protocol
from the Jackson Laboratory.
Table 4.1. Primers for IPCR
For the 5’-end of the D2/LacZ transgene
1
st
pair
G78P-1F 5’ – GCAGCGTACTTCTTCCGAGTGAGA – 3’
G78P-1R 5’ – TCACAAAGATTGTCCTGCTTCTATCT – 3’
2
nd
pair
G78P-2F 5’ – GAAACGGTTTCCAGGTGAGAGGTCA – 3’
G78P-2R2 5’ – CATGAGCCACCATATCTATCTCCT – 3’
For the 3’-end of the D2/LacZ transgene
1
st
pair
LacZ-1F 5’ – CGCTACAGTCAACAGCAACTGATGGA – 3’
LacZ-1R 5’ – CTGCAAGGCGATTAAGTTGGGTAAC – 3’
2
nd
pair
LacZ-2F 5’ – CATGGCTGAATATCGACGGTTTCCA – 3’
LacZ-2R 5’ – CGGCTTACGGCAATAATGCCTTTCCA – 3’

73

Table 4.2. Primers for mouse genotyping
LacZ-901 5’ – CTGGCTGGAGTGCGATCTTCCTGAG – 3’
LacZ-1351 5’ – GCGAGTGGCAACATGGAAATCGCTG – 3’
G78P-1R 5’ – TCACAAAGATTGTCCTGCTTCTATCT – 3’
ItprR 5’ – AGGAGGCCATTCCCAAGAGGCACGAT – 3’
M106M-f6 5’ – CAGAGTATTGTTTCTGTTCTTGCCCTGATGG – 3’
LacZ-3F 5’ – GACAAACTCGGAACTTGTTTATTGCAGC – 3’
Itpr-1f 5’ – TTCATCTGGTTCGTAGTTGCGTGG – 3’
Itpr-R3 5’ – CACAGATGGCCTGGCTAGAAACAGAGG – 3’

Islet isolation
After anesthesia and sacrifice, mouse islets of Langerhans were isolated with
the similar procedure as previously described (Michael, Geng et al. 2004). About 3.5 ml
ice-cold digestion solution, which consists of 0.233 mg/ml Liberase RI and 0.1 mg/ml
DNase (Roche, Indianapolis, IN) in Hanks’ balanced salt solution (HBSS), was infused
into the pancreas via the common bile duct and the pancreatic duct. The inflated pancreas
was excised and transferred to a glass vial with 2.5 ml ice-cold digestion solution. After
incubation in a 37°C water bath for 25 min, the vial was shaken by hand vigorously for
45 sec to disperse the digested content. After washing with ice-cold HBSS for at least 5
times, the content was placed in a 10-cm dish, and the islets were hand-picked under a
microscope.
Immunoblotting
Mouse brain lysates were prepared as described (Wang, Ye et al. 2010). The
pancreatic islets were lysed by 5 min boiling in SDS loading buffer (50 mM Tris-Cl, 100
74

mM DTT, 2% SDS, 10% glycerol, 0.005% bromophenol blue). Western blots were
performed mainly with 8-10% SDS-PAGE. To detect IP3R isoforms with high molecular
weight (more than 240 kDa), protein lysates were separated on 6% SDS-PAGE. The
IP3R antiserum and antibodies were gifts from Dr. Richard Wojcikiewicz (State
University of New York Upstate Medical University). These included rabbit polyclonal
IP3R1 (CT1) antiserum against the conserved C terminus of rat IP3R1, rat monoclonal
IP3R1 (4C11) antibody against the amino acids 679-727 of mouse IP3R1 and mouse
monoclonal IP3R3 antibody (BD Biosciences, San Jose, CA). The other primary
antibodies used included β-actin (Sigma-Aldrich, St. Louis, MO); GRP78, GAPDH
(Santa Cruz Biotechnology, Santa Cruz, CA); GRP94, PDI, calnexin, and calreticulin
(Stressgen, Ann Arbor, MI).
Statistical analysis
Two-tailed student’s t-test was applied for all pairwise comparisons.
75

4.3 Results
4.3.1 D2D transgenic mice showed impaired glucose homeostasis
To understand the transcriptional regulation of Grp78 gene in vivo, D2, an
internal deletion mutant of the 3-kilobase rat Grp78 promoter, was constructed to drive a
LacZ reporter gene (Fig. 4.1). Within the D2 promoter, the sequence spanning -300 to -
170 was deleted, eliminating the ATF/CRE-like site and adjacent upstream sequence.

Figure 4.1. Schematic drawing of the 3kb/LacZ and D2/LacZ reporter genes. The locations of the
TATA box, ERSE, and the CRE element are indicated. Additional CCAAT sequences and their orientation
with respect to the TATA element are represented by arrows. The lollipop symbols indicate the occurrence
of GC-rich sequences similar to Sp1 binding sites.

Three lines of the D2 transgenic mice were independently generated,
denominated as D2D, D2P and D2L, respectively. Serendipitously, we observed elevated
fasting blood glucose in male D2D mice (136±14 mg/dl versus 105±6 mg/dl in their sex-
matched wild-type littermates, P=0.048) at the age of 22 weeks (Fig. 4.2A), but not in the
D2P (Fig. 4.2B) or D2L (data not shown) lines. This moderate hyperglycemia was not
due to excessive food intake (Fig. 4.2C). Rather, it associated with a 45% decrease in
blood insulin (Fig. 4.2D). Strikingly, D2D mice developed progressive glucose
intolerance, from 14-week old (Fig. 4.3A) to 23-week old (Fig. 4.3B), as revealed by
intraperitoneal glucose tolerance test.
76

Figure 4.2. Age-dependent hyperglycemia in D2D mice. (A) Fasting blood glucose of D2D mice and
their wild-type (WT) siblings at the indicated ages (n ≥7 mice for each genotype). (B) Fasting blood glucose
of 7-month old WT (n=5) and D2P mice (n=7). (C) Food intake measurement on WT and D2D mice (n=3
per genotype). (D) Fasting blood insulin of 6-month old WT (n=14) and D2D mice (n=12).

Figure 4.3. Progressive glucose intolerance in D2D mice. Intraperitoneal glucose tolerance test was
performed on (A) 14-week old WT (n=6) and D2D (n=5) mice, and (B) 23-week old WT (n=6) and D2D
(n=7) mice. Data are presented as the mean±SEM. *P<0.05, **P<0.01.

4.3.2 Disruption of the inositol 1,4,5-triphosphate receptor 1-encoding gene
(Itpr1) in D2D mice
Our observation that perturbed glucose homeostasis was only observed in the
D2D line but not in the other lines of the D2 transgenic mice suggests that it likely
resulted from the genomic integration site of the D2 transgene in the D2D line rather than
A B C D
A B
77

an inherent property of the D2 transgene. To identify the genomic DNA sequences
flanking the transgene in the D2D mice, we employed the inverse PCR (IPCR) strategy
described previously (Li, Shen et al. 1999). As depicted in Fig. 4.4A, the genomic DNA
from the D2D mice was digested with the restriction endonuclease StuI, which cut the
D2/LacZ transgene once in the middle. Following ligation of the restricted DNA
fragments to form circles, the genomic DNA flanking the 5’-end (Fig. 4.4B) and 3’-end
(Fig. 4.4C) of the transgene was amplified by nested PCR.

Figure 4.4. IPCR amplification of the genomic DNA sequences flanking the transgene in D2D mice.
(A) Strategy of the inverse PCR (IPCR). The D2/LacZ transgene is presented with 5’ to 3’ orientation. The
single StuI restriction site on the transgene is indicated by a solid line, with the assumed ones on the
flanking genomic DNA represented by dash lines. The restrictive DNA fragments were ligated to form
circles. The position and orientation of the nested PCR primers are indicated by arrows underneath the
transgene, for detection of the genomic sequences flanking either the 5’-end or the 3’-end of the transgene.
(B and C) Agarose gel electrophoresis of the products from the nested PCR. Asterisks indicate the PCR
products containing mouse genomic DNA, flanking the 5’-end (B) or the 3’-end (C) of the transgene, as
revealed by sequencing and BLAST with assembled mouse genome.

A
B C
78

Sequencing of the nested PCR products revealed that the two gene loci flanking
the D2 transgene were Itpr1 and Cntn4, located at the 108.4M bp and 106.0M bp regions
of wild-type chromosome 6 respectively (Fig. 4.5A). Additionally, a 2.4-kb fragment
originally at the 105.5M bp region of the same chromosome was incorporated between
the 5’-end of the transgene and the 3’-half of the Itpr1 locus, in a reverse-complementary
manner. The nested PCR also amplified sequences from the self-ligated transgene,
suggesting the presence of its tandem repeats. The junctions between the transgene and
the mouse genome were independently determined by PCR amplification from the D2D
genomic DNA and sequencing of the PCR products (Fig. 4.5B and C), providing direct
evidence that the Cntn4 and Itpr1 genes were interrupted in the D2D mice.

Figure 4.5. Identification of the genomic DNA sequences flanking the transgene in D2D mice. (A)
Schematic drawing of the transgene tandem repeats with flanking genomic sequences on mouse
chromosome 6, as suggested by IPCR. The gray boxes represent the genomic DNA, with arrows above
indicating their 5’ to 3’ orientation on the chromosome 6. Their positions on the chromosome and the
involved loci are also noted on top. The StuI sites on the transgene repeats and the flanking DNA are
labeled. To independently determine the junction sequences, the primer pair M106M-f6 and LacZ-3F was
used for the 3’-end of the transgene, yielding a 0.54-kb PCR product (B). And the G78P-1R and ItprR pair
was used for the 5’-end, yielding a 5.0-kb PCR product (C).

A
B C
79

Genomic mapping by IPCR implied that on chromosome 6 of the D2D mice,
the 2.4-Mbp genomic DNA between the two junctions was replaced by the tandem
repeats of D2/LacZ transgene, with its 5’ to 3’ orientation inverse to that of chromosome
6 (Fig. 4.6A). The 2.4-Mbp sequences contain 8 intact gene loci, as well as the 3’-half of
Cntn4 and the 5’-half of Itpr1 (Fig. 4.6B). The identification of the junction sequences
enabled us to distinguish the homozygous D2D (D/D) from the heterozygous mice (D/+)
by determining the presence of the wild-type allele (+) and the D2D allele (D) with
genotyping via PCR. In 3-week old offspring (n=52) from D/+ x D/+ mating pairs, there
was no D/D, and the +/+:D/+ ratio was approximate to 1:2 (Fig. 4.6C). The lethality for
the homozygous D2D mice was consistent with that reported for the homozygous Itpr1
knockout and opt mutant mice (Matsumoto, Nakagawa et al. 1996; Street, Bosma et al.
1997). However, the contribution by the other 9 disrupted loci remains to be determined.
In agreement with the genetic and molecular data that the D2D mice were heterozygous
for the transgene insertion (D/+), the level of the Itpr1-encoded IP3R1 protein in D2D
mouse brain was reduced by about 63% compared to wild-type (WT) siblings, as
revealed independently in Western blots using antibodies against the amino acids 679-
727 (4C11) or the carboxyl end (CT1) of IP3R1 (Fig. 4.6D). In contrast to its prominent
expression in the brain, IP3R1 protein was barely detectable in the liver and below
detection limit in white adipose and spleen of both WT and D2D mice (Fig. 4.6E).
80

Figure 4.6. D2D mice are Itpr1-heterozygous. (A) Schematic drawing of D2D mouse chromosome 6 with
the transgene insert. In the 148-Mbp of mouse chromosome 6 (upper panel), the area surrounding the
transgene insertion site is represented by the gray box expanded in the lower panel. Schematic drawing of
the insertion site was modified from the MGI Mouse Genome Browser on build 37, NCBI transcripts. The
transgene in reverse-complementary tandem repeats (solid arrows) displaces a 2.4-Mbp (106.0-108.4 Mbp)
segment of genomic DNA. The 10 open reading frames in this segment are represented by the numbered
open arrows underneath, and annotated in (B). The arrows indicate the orientation of the genes. (C)
Genotypes of 3-week old offspring from mating pairs of heterozygous D2D mice (D/+ x D/+) with
observed numbers. *Probability of finding no homozygous D2D (D/D) progeny among 52 individuals by
chance; P=3.2x10
-7
. (D) Western blotting for IP3R1 in the brain of D2D mice and their wild-type (WT)
littermates. Primary antibodies against amino acids 679-727 (4C11) or the conserved C terminal (CT1) of
IP3R1 were used. β-actin served as the loading control. E: Western blotting for IP3R1 in the brain, liver,
white adipose and spleen of WT and D2D mice, with β-actin as the loading control.
A
B
C
D E
81

4.3.3 Glucose intolerance in the Itpr1 heterozygous mutant (opt/+) mice
Based on the implied linkage between IP3Rs to Ca
2+
-triggered insulin
exocytosis in pancreatic β-cells (Dyachok and Gylfe 2004), and prominent expression of
IP3R1 in mouse pancreatic islets (Lee and Laychock 2001), we examined the effect of
reduction in IP3R1 on glucose homeostasis in the opt/+ mice established to express
reduced level of IP3R1 (Street, Bosma et al. 1997). Only male mice were used for
examination, since the hormonal cycle in females might interfere with metabolism and
complicate the results. In pancreatic islets of opt/+ mice (Fig. 4.7A), we confirmed that
the IP3R1 protein level decreased by 50% comparing to wild-type, while there was no
compensatory upregulation of IP3R3 protein, the other isoform expressed in mouse
pancreatic islets (Lee and Laychock 2001).
Since IP3R1 is associated with the ER membrane, alteration of its expression
level may impact ER homeostasis. A commonly used marker for ER stress is the
induction of GRP78 (Lee 2001). There could also be adaptive increases of other ER
chaperones to increase the folding protein capacity of the ER (Ye, Jung et al. 2010).
Pancreatic islets were isolated from WT and opt/+ mice and the profile of ER chaperones
were analyzed by Western blotting. Interestingly, no change in GRP78, GRP94 and
calnexin were detected, however a decrease in calreticulin and PDI was observed in opt/+
islets compared to WT (Fig. 4.7B).
82

Figure 4.7. Protein level of IP3R isoforms and ER chaperones in pancreatic islets of opt/+ mice.
Whole cell lysates were prepared from isolated pancreatic islets of opt/+ mice and their wild-type
littermates (+/+), and subjected to Western blotting for (A) IP3R1 (CT1) and IP3R3, with β-actin as the
loading control; and (B) indicated ER chaperones, with GAPDH as loading control.

During the age of 10-18 weeks, the fasting body weight (Fig. 4.8A) and blood
glucose (Fig. 4.8B) of opt/+ mice were similar to those of their WT littermates. However,
10-week old opt/+ mice exhibited noticeable glucose intolerance (Fig. 4.8C), as revealed
by glucose tolerance test. This is consistent with the observation on D2D mice (Fig. 4.3),
and underscores the role of IP3R1 in regulation of glucose metabolism.

Figure 4.8. Glucose intolerance in opt/+ mice. (A and B) Fasting body weight (A) and fasting blood
glucose (B), n ≥6 mice per genotype. (C) Intraperitoneal glucose tolerance test (1 mg/g body weight) on 10-
week old +/+ (n=6) and opt/+ mice. Data are presented as the mean±SEM. *P<0.05, **P<0.01.

A B
A B C
83

4.3.4 Susceptibility to HFD-induced diabetes in opt/+ mice
To test whether Itpr1 heterozygosity exposes the mice to diet-induced diabetes,
we fed cohorts of opt/+ mice and their wild-type littermates with high-fat diet (HFD)
from 10-week old (Fig. 4.9A). The opt/+ mice showed about 90% of food intake as their
WT siblings (Fig. 4.9B), and no fat mal-absorption as revealed by Oil Red O staining of
stool smear (Fig. 4.9C).

Figure 4.9. HFD-fed opt/+ mice showed normal food intake and fat absorption. (A) Scheme of high-fat
diet (HFD) feeding. Cohorts of opt/+ and +/+ male littermates were fed regular diet (RD) after being
weaned at 3-week old, and switched to HFD feeding from 10-week old. (B and C) For mice during the fifth
week of HFD: (B) Food intake measurement. n=6 for each genotype. Data are presented as the mean±SEM.
(C) Oil Red O staining of stool smear. Negative control: dH
2
O; positive control: white adipose extract. n=4
for each genotype.

In the pancreatic islets of HFD-fed opt/+ mice, while IP3R1 protein level was
lower (Fig. 4.10A), the ER chaperone profile was similar to that in WT. There was no
change in GRP78, calreticulin or PDI, with minor reduction in GRP94 and calnexin (Fig.
4.10B).
A B C
84

Figure 4.10. Protein level of IP3R1 and ER chaperones in pancreatic islets of HFD-fed opt/+ mice.
Pancreatic islets were isolated from mice after 2-week HFD, prepared for whole cell lysates, and subjected
to Western blotting for (A) IP3R1 (CT1) and (B) indicated ER chaperones. β-actin (A) and GAPDH (B)
served as the loading control respectively.

During the first 6 weeks of HFD regimen, the body weight gain was similar
between the two genotypes (Fig. 4.11A). However, opt/+ mice showed increase in fasting
blood glucose from the fourth week of HFD (Fig. 4.11B). Correspondingly, exacerbated
glucose intolerance (Fig. 4.11C) and insulin resistance (Fig. 4.11D) were observed in the
opt/+ mice, suggesting their glucose homeostasis was more vulnerable upon HFD
challenge.

Figure 4.11. opt/+ mice were predisposed to HFD-induced diabetes. (A and B) Fasting body weight (A)
and fasting blood glucose (B) of mice fed high-fat diet (HFD) from 10-week old, n ≥8 mice per genotype.
(C) Glucose tolerance test on +/+ (n=9) and opt/+ (n=7) mice after 4-week HFD. (D) Insulin tolerance test
on +/+ (n=10) and opt/+ (n=4) mice after 6-week HFD. Data are presented as the mean±SEM. *P<0.05,
**P<0.01.

A B
A B C D
85

4.4 Discussion
The physiological significance of IP3Rs has been underscored in the context of
excitable cells, including neurons and muscle cells (Vanderheyden, Devogelaere et al.
2009). In this study, the novel role of IP3R isoform 1 in maintenance of glucose
homeostasis was first implied by the D2D transgenic mouse line, and then established in
the heterozygous mutant mouse model opt/+. Three transgenic mouse lines with the same
D2/LacZ transgene were independently generated, whereas progressive glucose tolerance
was only observed in the D2D line. This pointed to the position effect by the transgene
integration, which was then elucidated by IPCR. Among the disrupted or displaced loci
on mouse chromosome 6, the IP3R1-encoding gene Itpr1 was further investigated based
on its functional implication for Ca
2+
signaling. While the Itpr1 knockout mouse model
(Matsumoto, Nakagawa et al. 1996) is not available, the Itpr1 heterozygous mutant
(opt+) mice (Street, Bosma et al. 1997) allowed us to directly address the in vivo
function of IP3R1. Upon matching the D2D mice, early-onset glucose intolerance was
detected in the opt/+ mice, although the underlying mechanism awaits further
investigation. The requirement of IP3R1 to maintain glucose homeostasis was further
revealed on mice upon high-fat diet challenge during adulthood. 4 to 6 weeks after
switching from regular diet to high-fat diet, opt/+ mice exhibited hyperglycemia,
aggravated glucose intolerance, and insulin resistance, suggesting their susceptibility to
diabetes. Future studies on the molecular pathways linking IP3R1 deficiency to glucose
metabolism may provide novel therapeutic strategies for diabetes.
86

Chapter 5: Conclusions and Perspectives
Endoplasmic reticulum (ER) homeostasis and stress are involved extensively in
a variety of diseases, such as neurodegenerative disorders, inflammation, cancer,
atherosclerosis, and diabetes mellitus (Yoshida 2007). In this thesis, new insights into
role of ER in glucose metabolism as well as acute pancreatitis are provided by studies on
two ER proteins, GRP78 and IP3R1. GRP78 functions as both a major chaperone for
protein processing and a general controller of ER stress signaling transduction (Lee 2005).
In mouse models, Grp78 haploinsufficiency was able to trigger adaptive responses,
including compensatory upregulation of the other ER chaperones, upon chronic
metabolic stress. These adaptive responses are beneficial for cell function and survival,
revealed by both improvement of insulin sensitivity during type 2 diabetes and resistance
to cell death during acute pancreatitis. The Ca
2+
store in ER also contributes to its
homeostasis, and regulates the cytosolic Ca
2+
oscillation via transmembrane channel
proteins (Taylor, Prole et al. 2009). Utilizing the opt/+ mouse model, this study provides
direct evidence on the in vivo role of IP3R1, a major ER Ca
2+
efflux channel, in
regulation of glucose metabolism. This could be a experimental system to understand the
molecular mechanism underlying a type 1 diabetes risk factor reported in human (Roach,
Deutsch et al. 2006).
Although the intriguing roles of ER homeostasis and its stress-induced
signaling in insulin action and glucose metabolism are still emerging (Ozcan, Cao et al.
2004; Hotamisligil 2010), the metabolic benefits from molecular chaperones (Ozcan,
87

Yilmaz et al. 2006) imply that improving ER protein folding capacity might be a
potential therapeutic strategy for insulin resistance syndromes including type 2 diabetes.
As indispensable mediators of ER balance, the protein chaperones could play important
roles in metabolic homeostasis, as demonstrated by previous reports. For example,
homozygous knockout of CRT in mice leads to postnatal growth retardation,
hypoglycemia, increased levels of serum triglycerides and cholesterol (Guo, Nakamura et
al. 2002). CRT and CNX modulate insulin signaling through association and stabilization
of the insulin receptor (Ramos, Swanson et al. 2007; Basseri, Lhotak et al. 2009). Thus,
ER chaperones, either individually or collectively, may be protective against metabolic
stress.
Although the involvement of adaptive UPR with energy storage and
expenditure awaits further investigation, it is supported by the recent discovery that
expression of metabolic gene network directly responds to ER homeostasis (Rutkowski,
Wu et al. 2008). Recent studies reported that the chemical chaperone 4-phenylbutyrate, as
a UPR modulator, reduces weight gain in HFD-fed C57BL/6 mice by inhibiting
adipogenesis (Basseri, Lhotak et al. 2009). This provides a potential mechanism whereby
improvement of ER homeostasis could result in reduced adiposity. We observed that
HFD led to increase in adipocyte size in both Grp78+/+ and +/- mice, and there is no
apparent difference in adipocyte size or morphology between the two genotypes, either
RD-fed or HFD-fed. Nonetheless, CHOP, a known inhibitor of C/EBPα critical for
adipogenesis (Batchvarova, Wang et al. 1995), is induced in the WAT of Grp78+/- mice.
This, coupled with decreased fat mass, suggests that adipogenesis might be inhibited in
88

Grp78+/- mice via CHOP induction in preadipocytes. However, these remain to be
established in future experiments. ER stress also contributes to the activation of
inflammatory response and insulin/leptin resistance in hypothalamus, which could be part
of the underlying mechanism of diet-induced obesity (Zhang, Zhang et al. 2008; Ozcan,
Ergin et al. 2009). Whether Grp78 heterozygosity improves ER homeostasis in
hypothalamic neurons and protects against HFD-induced obesity await further
investigation.
There are several mechanisms that could potentially explain the beneficial
effect of ER chaperones on acute pancreatitis. As pancreatic acinar cells are major
professional cells in protein production and secretion, in the C57BL/6 x 129/sv genetic
background, ER chaperone reduction resulting from Grp78 heterozygosity could reduce
protein folding capacity and ERAD, leading to accumulation of malfolded proteins,
thereby exacerbate pancreatic acinar cell necrosis. Additionally, ER Ca
2+
homeostasis
may also be affected. Reduction of both CRT and GRP78, the major Ca
2+
-binding
chaperones in ER (Lievremont, Rizzuto et al. 1997; Ni and Lee 2007; Michalak,
Groenendyk et al. 2009), might promote ER Ca
2+
depletion in Grp78+/- acinar cells upon
pathological insults. The abnormal elevation of cytosolic Ca
2+
, in turn, will lead to
mitochondria dysfunction, ATP depletion, and autoactivation of digestive enzymes,
resulting in necrotic cell death (Criddle, Gerasimenko et al. 2007).
ER stress could also exacerbate acute pancreatitis through signaling
inflammation. Different signaling pathways initiated by ER stress have been reported to
induce inflammatory responses (Yamamoto, Sato et al. 2007). For example, a liver-
89

specific, ER membrane-anchored transcription factor CREBH is activated by site-1 and
site-2 protease-mediated cleavage in response to ER stress, and subsequently initiates an
acute, systemic inflammatory response (Zhang, Shen et al. 2006). In intestinal epithelial
cells, inhibition of ER stress contributes to the anti-inflammatory mechanisms of
interleukin-10 (Shkoda, Ruiz et al. 2007). During the pathogenesis of type 2 diabetes, ER
stress activates inflammation signaling via IKKβ/NF-κB and JNK pathways, which
contribute to insulin resistance in liver and white adipose (Wellen and Hotamisligil 2005;
Shoelson, Lee et al. 2006). In the acute pancreatitis, although molecular signaling
between ER stress and inflammatory response awaits future investigation, our results
reveal a correlation between the ER stress marker CHOP induction and neutrophil
infiltration.
There are several future directions to understand how IP3R1 insufficiency
perturbs glucose metabolism. As a major isoform expressed in mouse pancreatic islets
(Lee and Laychock 2001), IP3R1 mediates the Ca
2+
flux from ER to cytosol. Reduction
in IP3R1 protein might affect the cytosolic Ca
2+
oscillation, which is a potential mediator
of the glucose-stimulated insulin secretion (Dyachok and Gylfe 2004; Collins, Hoppa et
al. 2010). IP3Rs were also detected on the membrane of secretory vesicles (Srivastava,
Atwater et al. 1999). Discharge of vesicular Ca
2+
might promote the exocytosis of
insulin-containing granules. IP3R1 is abundant also in the central nervous system
(Taylor, Taufiq Ur et al. 2009), which could have potential impact on glucose
homeostasis and energy metabolism. Although the protein level of IP3R1 is hardly
detectable by immunoblotting in the insulin-responsive peripheral tissues, such as liver
90

and white adipose, whether IP3R1 affects insulin sensitivity in mouse awaits further
determination. Study on IP3Rs might reveal novel links between Ca
2+
signaling and
metabolic disorders.
91

Bibliography

Adachi, Y., K. Yamamoto, et al. (2008). "ATF6 Is a Transcription Factor Specializing in
the Regulation of Quality Control Proteins in the Endoplasmic Reticulum." Cell
Structure and Function 33(1): 75-89.
Al-Bahrani, A. Z. and B. J. Ammori (2005). "Clinical laboratory assessment of acute
pancreatitis." Clinica Chimica Acta 362(1-2): 26-48.
Basseri, S., S. Lhotak, et al. (2009). "The chemical chaperone 4-phenylbutyrate inhibits
adipogenesis by modulating the unfolded protein response." J. Lipid Res. 50(12):
2486-2501.
Batchvarova, N., X. Z. Wang, et al. (1995). "Inhibition of adipogenesis by the stress-
induced protein CHOP (Gadd153)." EMBO J 14(19): 4654-61.
Biddinger, S. B. and C. R. Kahn (2006). "From mice to men: insights into the insulin
resistance syndromes." Annu Rev Physiol 68: 123-58.
Bruning, J. C., D. Gautam, et al. (2000). "Role of Brain Insulin Receptor in Control of
Body Weight and Reproduction." Science 289(5487): 2122-2125.
Cannon, B. and J. A. N. Nedergaard (2004). "Brown Adipose Tissue: Function and
Physiological Significance." Physiol. Rev. 84(1): 277-359.
Case, R. M. (1978). "Synthesis, intracellular transport and discharge of exportable
proteins in the pancreatic acinar cell and other cells." Biol Rev Camb Philos Soc
53(2): 211-354.
Chowdhury, P., M. Nishikawa, et al. (2000). "Response of rat exocrine pancreas to high-
fat and high-carbohydrate diets." Proc Soc Exp Biol Med 223(3): 310-5.
Cnop, M., N. Welsh, et al. (2005). "Mechanisms of Pancreatic {beta}-Cell Death in Type
1 and Type 2 Diabetes: Many Differences, Few Similarities." Diabetes
54(suppl_2): S97-107.
92

Collins, S. C., M. B. Hoppa, et al. (2010). "Progression of Diet-Induced Diabetes in
C57BL6J Mice Involves Functional Dissociation of Ca2+ Channels From
Secretory Vesicles." Diabetes 59(5): 1192-1201.
Criddle, D. N., J. V. Gerasimenko, et al. (2007). "Calcium signalling and pancreatic cell
death: apoptosis or necrosis?" Cell Death Differ 14(7): 1285-94.
Csordás, G. and G. Hajnóczky (2009). "SR/ER-mitochondrial local communication:
Calcium and ROS." Biochimica et Biophysica Acta (BBA) - Bioenergetics
1787(11): 1352-1362.
Cunningham, J. T., J. T. Rodgers, et al. (2007). "mTOR controls mitochondrial oxidative
function through a YY1-PGC-1[agr] transcriptional complex." Nature 450(7170):
736-740.
Cusi, K. (2009). "Nonalcoholic fatty liver disease in type 2 diabetes mellitus." Current
Opinion in Endocrinology, Diabetes and Obesity 16(2): 141-149
10.1097/MED.0b013e3283293015.
Datta, R., A. Waheed, et al. (2007). "Signal sequence mutation in autosomal dominant
form of hypoparathyroidism induces apoptosis that is corrected by a chemical
chaperone." Proc Natl Acad Sci U S A 104(50): 19989-94.
Dong, D., B. Ko, et al. (2005). "Vascular targeting and antiangiogenesis agents induce
drug resistance effector GRP78 within the tumor microenvironment." Cancer Res
65(13): 5785-91.
Dong, D., M. Ni, et al. (2008). "Critical Role of the Stress Chaperone GRP78/BiP in
Tumor Proliferation, Survival, and Tumor Angiogenesis in Transgene-Induced
Mammary Tumor Development." Cancer Res 68(2): 498-505.
Dultz, E. and J. Ellenberg (2007). "Nuclear envelope." 17(5): R154-R156.
Dyachok, O. and E. Gylfe (2004). "Ca(2+)-induced Ca(2+) release via inositol 1,4,5-
trisphosphate receptors is amplified by protein kinase A and triggers exocytosis in
pancreatic beta-cells." J Biol Chem 279(44): 45455-61.
93

Eizirik, D. L., A. K. Cardozo, et al. (2008). "The Role for Endoplasmic Reticulum Stress
in Diabetes Mellitus." Endocr Rev 29(1): 42-61.
Eizirik, D. L. and M. Cnop (2010). "ER Stress in Pancreatic {beta} Cells: The Thin Red
Line Between Adaptation and Failure." Sci. Signal. 3(110): pe7.
Erion, D. M. and G. I. Shulman (2010). "Diacylglycerol-mediated insulin resistance." Nat
Med 16(4): 400-402.
Evans, D. B., A. W. Robinson, et al. (1986). "Acute pancreatitis with normal amylase."
Digestive Diseases and Sciences 31(7): 779-780.
Fagone, P. and S. Jackowski (2009). "Membrane phospholipid synthesis and endoplasmic
reticulum function." J. Lipid Res. 50(Supplement): S311-316.
Foskett, J. K., C. White, et al. (2007). "Inositol Trisphosphate Receptor Ca2+ Release
Channels." Physiol. Rev. 87(2): 593-658.
Frossard, J. L., P. Lescuyer, et al. (2009). "Experimental evidence of obesity as a risk
factor for severe acute pancreatitis." World J Gastroenterol 15(42): 5260-5.
Fu, Y., S. Wey, et al. (2008). "Pten null prostate tumorigenesis and AKT activation are
blocked by targeted knockout of the stress response chaperone GRP78/BiP in
prostate epithelium." Proc Natl Acad Sci USA 105: 19443-19448.
Futatsugi, A., T. Nakamura, et al. (2005). "IP3 receptor types 2 and 3 mediate exocrine
secretion underlying energy metabolism." Science 309(5744): 2232-4.
Gittes, G. K. (2009). "Developmental biology of the pancreas: a comprehensive review."
Dev Biol 326(1): 4-35.
Glatz, J. F. C., J. J. F. P. Luiken, et al. (2010). "Membrane Fatty Acid Transporters as
Regulators of Lipid Metabolism: Implications for Metabolic Disease." Physiol.
Rev. 90(1): 367-417.
94

Guo, L., K. Nakamura, et al. (2002). "Cardiac-specific expression of calcineurin reverses
embryonic lethality in calreticulin-deficient mouse." J Biol Chem 277(52): 50776-
9.
Gutierrez, D., M. Puglisi, et al. (2009). "Impact of increased adipose tissue mass on
inflammation, insulin resistance, and dyslipidemia." Current Diabetes Reports
9(1): 26-32.
Haneda, M., H. Xiao, et al. (2004). "Regulation of mouse GADD34 gene transcription
after DNA damaging agent methylmethane sulfonate." Gene 336(1): 139-146.
Harding, H. P., H. Zeng, et al. (2001). "Diabetes mellitus and exocrine pancreatic
dysfunction in perk-/- mice reveals a role for translational control in secretory cell
survival." Mol Cell 7(6): 1153-1163.
Harding, H. P., Y. Zhang, et al. (1999). "Protein translation and folding are coupled by an
endoplasmic-reticulum-resident kinase." Nature 397(6716): 271-274.
Haze, K., H. Yoshida, et al. (1999). "Mammalian Transcription Factor ATF6 Is
Synthesized as a Transmembrane Protein and Activated by Proteolysis in
Response to Endoplasmic Reticulum Stress." Mol. Biol. Cell 10(11): 3787-3799.
Hendershot, L. M. (2004). "The ER function BiP is a master regulator of ER function."
Mt Sinai J Med 71(5): 289-97.
Henquin, J. (2009). "Regulation of insulin secretion: a matter of phase control and
amplitude modulation." Diabetologia 52(5): 739-751.
Hirosumi, J., G. Tuncman, et al. (2002). "A central role for JNK in obesity and insulin
resistance." Nature 420(6913): 333-336.
Hober, D. and P. Sauter (2010). "Pathogenesis of type 1 diabetes mellitus: interplay
between enterovirus and host." Nat Rev Endocrinol 6(5): 279-289.
Hotamisligil, G. S. (2010). "Endoplasmic Reticulum Stress and the Inflammatory Basis
of Metabolic Disease." Cell 140(6): 900-917.
95

Iida, K., Y. Li, et al. (2007). "PERK eIF2 alpha kinase is required to regulate the viability
of the exocrine pancreas in mice." BMC Cell Biology 8(1): 38.
Jitrapakdee, S., A. Wutthisathapornchai, et al. (2010). "Regulation of insulin secretion:
role of mitochondrial signalling." Diabetologia 53(6): 1019-1032.
Kammoun, H. L., H. Chabanon, et al. (2009). "GRP78 expression inhibits insulin and ER
stress-induced SREBP-1c activation and reduces hepatic steatosis in mice." J Clin
Invest 119(5): 1201-15.
Kelber, J. A., A. D. Panopoulos, et al. (2009). "Blockade of Cripto binding to cell surface
GRP78 inhibits oncogenic Cripto signaling via MAPK/PI3K and Smad2/3
pathways." Oncogene 28(24): 2324-2336.
Kereszturi, É., R. Szmola, et al. (2009). "Hereditary pancreatitis caused by mutation-
induced misfolding of human cationic trypsinogen: A novel disease mechanism."
Human Mutation 30(4): 575-582.
Kim, H.-J., T. Higashimori, et al. (2004). "Differential Effects of Interleukin-6 and -10 on
Skeletal Muscle and Liver Insulin Action In Vivo." Diabetes 53(4): 1060-1067.
Klover, P. J. and R. A. Mooney (2004). "Hepatocytes: critical for glucose homeostasis."
The International Journal of Biochemistry & Cell Biology 36(5): 753-758.
Kubisch, C. H. and C. D. Logsdon (2007). "Secretagogues differentially activate
endoplasmic reticulum stress responses in pancreatic acinar cells." Am J Physiol
Gastrointest Liver Physiol 292(6): G1804-12.
Kubisch, C. H., M. D. Sans, et al. (2006). "Early activation of endoplasmic reticulum
stress is associated with arginine-induced acute pancreatitis." Am J Physiol
Gastrointest Liver Physiol 291(2): G238-245.
Kubota, K., Y. Niinuma, et al. (2006). "Suppressive effects of 4-phenylbutyrate on the
aggregation of Pael receptors and endoplasmic reticulum stress." J Neurochem
97(5): 1259-68.
96

Kulkarni, R. N., J. N. Winnay, et al. (1999). "Altered function of insulin receptor
substrate-1-deficient mouse islets and cultured beta-cell lines." J Clin Invest
104(12): R69-75.
Laird, P. W., A. Zijderveld, et al. (1991). "Simplified mammalian DNA isolation
procedure." Nucleic Acids Res 19(15): 4293.
Lee, A.-H., N. N. Iwakoshi, et al. (2003). "XBP-1 Regulates a Subset of Endoplasmic
Reticulum Resident Chaperone Genes in the Unfolded Protein Response." Mol.
Cell. Biol. 23(21): 7448-7459.
Lee, A. S. (2001). "The glucose-regulated proteins: stress induction and clinical
applications." Trends Biochem Sci 26(8): 504-510.
Lee, A. S. (2005). "The ER chaperone and signaling regulator GRP78/BiP as a monitor
of endoplasmic reticulum stress." Methods 35(4): 373-81.
Lee, A. S. (2007). "GRP78 Induction in Cancer: Therapeutic and Prognostic
Implications." Cancer Res 67(8): 3496-3499.
Lee, B. and S. G. Laychock (2001). "Inositol 1,4,5-trisphosphate receptor isoform
expression in mouse pancreatic islets: effects of carbachol." Biochem Pharmacol
61(3): 327-36.
Li, J., M. Ni, et al. (2008). "The unfolded protein response regulator GRP78/BiP is
required for endoplasmic reticulum integrity and stress-induced autophagy in
mammalian cells." Cell Death Differ 15(9): 1460-1471.
Li, J., H. Shen, et al. (1999). "Leukaemia disease genes: large-scale cloning and pathway
predictions." Nat Genet 23(3): 348-53.
Li, M., P. Baumeister, et al. (2000). "ATF6 as a transcription activator of the endoplasmic
reticulum stress element: thapsigargin stress-induced changes and synergistic
interactions with NF-Y and YY1." Mol Cell Biol 20(14): 5096-5106.
97

Lievremont, J. P., R. Rizzuto, et al. (1997). "BiP, a major chaperone protein of the
endoplasmic reticulum lumen, plays a direct and important role in the storage of
the rapidly exchanging pool of Ca2+." J Biol Chem 272(49): 30873-9.
Lu, P. D., C. Jousse, et al. (2004). "Cytoprotection by pre-emptive conditional
phosphorylation of translation initiation factor 2." EMBO J 23(1): 169-79.
Luo, S., P. Baumeister, et al. (2003). "Induction of Grp78/BiP by translational block:
activation of the Grp78 promoter by ATF4 through an upstream ATF/CRE site
independent of the endoplasmic reticulum stress elements." J Biol Chem 278(39):
37375-37385.
Luo, S. and A. S. Lee (2002). "Requirement of the p38 mitogen-activated protein kinase
signalling pathway for the induction of the 78 kDa glucose-regulated
protein/immunoglobulin heavy-chain binding protein by azetidine stress:
activating transcription factor 6 as a target for stress-induced phosphorylation."
Biochem. J. 366(3): 787-795.
Luo, S., C. Mao, et al. (2006). "GRP78/BiP is required for cell proliferation and
protecting the inner cell mass from apoptosis during early mouse embryonic
development." Mol Cell Biol 26(15): 5688-97.
Ma, Y. and L. M. Hendershot (2003). "Delineation of a Negative Feedback Regulatory
Loop That Controls Protein Translation during Endoplasmic Reticulum Stress." J.
Biol. Chem. 278(37): 34864-34873.
Mareninova, O. A., K. F. Sung, et al. (2006). "Cell death in pancreatitis: caspases protect
from necrotizing pancreatitis." J Biol Chem 281(6): 3370-81.
Matlack, K. E. S., B. Misselwitz, et al. (1999). "BiP Acts as a Molecular Ratchet during
Posttranslational Transport of Prepro-[alpha] Factor across the ER Membrane."
Cell 97(5): 553-564.
Matsumoto, M., T. Nakagawa, et al. (1996). "Ataxia and epileptic seizures in mice
lacking type 1 inositol 1,4,5-trisphosphate receptor." Nature 379(6561): 168-71.
98

Michael, D. J., X. Geng, et al. (2004). "Fluorescent cargo proteins in pancreatic beta-
cells: design determines secretion kinetics at exocytosis." Biophys J 87(6): L03-5.
Michalak, M., J. Groenendyk, et al. (2009). "Calreticulin, a multi-process calcium-
buffering chaperone of the endoplasmic reticulum." Biochem J 417(3): 651-66.
Mirco, C. and S. Michele (2009). "The KDEL receptor: New functions for an old
protein." FEBS Letters 583(23): 3863-3871.
Misra, U. K. and S. V. Pizzo (2010). "Ligation of cell surface GRP78 with antibody
directed against the COOH-terminal domain of GRP78 suppresses Ras/MAPK
and PI 3-kinase/AKT signaling while promoting caspase activation in human
prostate cancer cells." Cancer Biol Ther 9(2): 142-52.
Munro, S. and H. R. B. Pelham (1987). "A C-terminal signal prevents secretion of
luminal ER proteins." Cell 48(5): 899-907.
Murshid, A. and J. F. Presley (2004). "ER-to-Golgi transport and cytoskeletal interactions
in animal cells." Cellular and Molecular Life Sciences 61(2): 133-145.
Ni, M. and A. S. Lee (2007). "ER chaperones in mammalian development and human
diseases." FEBS Lett 581(19): 3641-51.
Ni, M., H. Zhou, et al. (2009). "Regulation of PERK Signaling and Leukemic Cell
Survival by a Novel Cytosolic Isoform of the UPR Regulator GRP78/BiP." PLoS
ONE 4(8): e6868.
Novoa, I., H. Zeng, et al. (2001). "Feedback inhibition of the unfolded protein response
by GADD34-mediated dephosphorylation of eIF2alpha." J Cell Biol 153(5):
1011-22.
Novoa, I., Y. Zhang, et al. (2003). "Stress-induced gene expression requires programmed
recovery from translational repression." Embo J 22(5): 1180-7.
99

Ono, K., M. Ikemoto, et al. (2009). "A chemical chaperone, sodium 4-phenylbutyric acid,
attenuates the pathogenic potency in human alpha-synuclein A30P+A53T
transgenic mice." Parkinsonism & related disorders 15(9): 649-654.
Oyadomari, S., K. Takeda, et al. (2001). "Nitric oxide-induced apoptosis in pancreatic
beta cells is mediated by the endoplasmic reticulum stress pathway." PNAS
98(19): 10845-10850.
Ozcan, L., A. S. Ergin, et al. (2009). "Endoplasmic Reticulum Stress Plays a Central Role
in Development of Leptin Resistance." Cell Metabolism 9(1): 35-51.
Ozcan, U., Q. Cao, et al. (2004). "Endoplasmic Reticulum Stress Links Obesity, Insulin
Action, and Type 2 Diabetes." Science 306(5695): 457-461.
Ozcan, U., L. Ozcan, et al. (2008). "Loss of the tuberous sclerosis complex tumor
suppressors triggers the unfolded protein response to regulate insulin signaling
and apoptosis." Mol Cell 29(5): 541-51.
Ozcan, U., E. Yilmaz, et al. (2006). "Chemical Chaperones Reduce ER Stress and
Restore Glucose Homeostasis in a Mouse Model of Type 2 Diabetes." Science
313(5790): 1137-1140.
Pandol, S. J. (2006). "Acute pancreatitis." Curr Opin Gastroenterol 22(5): 481-6.
Pandol, S. J., A. K. Saluja, et al. (2007). "Acute pancreatitis: bench to the bedside."
Gastroenterology 132(3): 1127-51.
Pfaffenbach, K. T., C. L. Gentile, et al. (2010). "Linking endoplasmic reticulum stress to
cell death in hepatocytes: roles of C/EBP homologous protein and chemical
chaperones in palmitate-mediated cell death." Am J Physiol Endocrinol Metab
298(5): E1027-1035.
Pincus, D., M. W. Chevalier, et al. (2010). "BiP Binding to the ER-Stress Sensor Ire1
Tunes the Homeostatic Behavior of the Unfolded Protein Response." PLoS Biol
8(7): e1000415.
100

Ramos, R. R., A. J. Swanson, et al. (2007). "Calreticulin and Hsp90 stabilize the human
insulin receptor and promote its mobility in the endoplasmic reticulum." Proc Natl
Acad Sci U S A 104(25): 10470-5.
Roach, J. C., K. Deutsch, et al. (2006). "Genetic mapping at 3-kilobase resolution reveals
inositol 1,4,5-triphosphate receptor 3 as a risk factor for type 1 diabetes in
Sweden." Am J Hum Genet 79(4): 614-27.
Ron, D. and P. Walter (2007). "Signal integration in the endoplasmic reticulum unfolded
protein response." Nat Rev Mol Cell Biol 8(7): 519-29.
Rutkowski, D. T., S. M. Arnold, et al. (2006). "Adaptation to ER stress is mediated by
differential stabilities of pro-survival and pro-apoptotic mRNAs and proteins."
PLoS Biol 4(11): e374.
Rutkowski, D. T. and R. J. Kaufman (2004). "A trip to the ER: coping with stress."
Trends Cell Biol 14(1): 20-28.
Rutkowski, D. T. and R. J. Kaufman (2007). "That which does not kill me makes me
stronger: adapting to chronic ER stress." Trends in Biochemical Sciences 32(10):
469-476.
Rutkowski, D. T., J. Wu, et al. (2008). "UPR pathways combine to prevent hepatic
steatosis caused by ER stress-mediated suppression of transcriptional master
regulators." Dev Cell 15(6): 829-40.
Sabio, G., M. Das, et al. (2008). "A stress signaling pathway in adipose tissue regulates
hepatic insulin resistance." Science 322(5907): 1539-43.
Sammels, E., J. B. Parys, et al. (2010). "Intracellular Ca2+ storage in health and disease:
A dynamic equilibrium." Cell Calcium 47(4): 297-314.
Sandoval, D., A. Gukovskaya, et al. (1996). "The role of neutrophils and platelet-
activating factor in mediating experimental pancreatitis." Gastroenterology
111(4): 1081-91.
101

Scheuner, D. and R. J. Kaufman (2008). "The Unfolded Protein Response: A Pathway
That Links Insulin Demand with {beta}-Cell Failure and Diabetes." Endocr Rev
29(3): 317-333.
Shamu, C. E. and P. Walter (1996). "Oligomerization and phosphorylation of the Ire1p
kinase during intracellular signaling from the endoplasmic reticulum to the
nucleus." Embo J 15(12): 3028-39.
Shkoda, A., P. A. Ruiz, et al. (2007). "Interleukin-10 blocked endoplasmic reticulum
stress in intestinal epithelial cells: impact on chronic inflammation."
Gastroenterology 132(1): 190-207.
Shoelson, S. E., J. Lee, et al. (2006). "Inflammation and insulin resistance." J Clin Invest
116(7): 1793-801.
Spannagel, A. W., I. Nakano, et al. (1996). "Adaptation to fat markedly increases
pancreatic secretory response to intraduodenal fat in rats." Am J Physiol
Gastrointest Liver Physiol 270(1): G128-135.
Srivastava, M., I. Atwater, et al. (1999). "Defects in inositol 1,4,5-trisphosphate receptor
expression, Ca(2+) signaling, and insulin secretion in the anx7(+/-) knockout
mouse." Proc Natl Acad Sci USA 96(24): 13783-8.
Street, V. A., M. M. Bosma, et al. (1997). "The type 1 inositol 1,4,5-trisphosphate
receptor gene is altered in the opisthotonos mouse." J Neurosci 17(2): 635-45.
Stumvoll, M., B. J. Goldstein, et al. (2005). "Type 2 diabetes: principles of pathogenesis
and therapy." Lancet 365(9467): 1333-46.
Surwit, R. S., C. M. Kuhn, et al. (1988). "Diet-induced type II diabetes in C57BL/6J
mice." Diabetes 37(9): 1163-7.
Szabadkai, G., K. Bianchi, et al. (2006). "Chaperone-mediated coupling of endoplasmic
reticulum and mitochondrial Ca2+ channels." J. Cell Biol. 175(6): 901-911.
102

Szmola, R. and M. Sahin-Tóth (2010). "Pancreatitis-associated chymotrypsinogen C
(CTRC) mutant elicits endoplasmic reticulum stress in pancreatic acinar cells."
Gut 59(3): 365-372.
Taniguchi, C. M., B. Emanuelli, et al. (2006). "Critical nodes in signalling pathways:
insights into insulin action." Nat Rev Mol Cell Biol 7(2): 85-96.
Taylor, C. W., D. L. Prole, et al. (2009). "Ca2+ Channels on the Move." Biochemistry
48(51): 12062-12080.
Taylor, C. W., R. Taufiq Ur, et al. (2009). "Targeting and clustering of IP3 receptors: key
determinants of spatially organized Ca2+ signals." Chaos 19(3): 037102.
Vanderheyden, V., B. Devogelaere, et al. (2009). "Regulation of inositol 1,4,5-
trisphosphate-induced Ca2+ release by reversible phosphorylation and
dephosphorylation." Biochimica et Biophysica Acta (BBA) - Molecular Cell
Research 1793(6): 959-970.
Wang, H. and R. H. Eckel (2009). "Lipoprotein lipase: from gene to obesity." Am J
Physiol Endocrinol Metab 297(2): E271-288.
Wang, M., S. Wey, et al. (2009). "Role of the unfolded protein response regulator
GRP78/BiP in development, cancer, and neurological disorders." Antioxid Redox
Signal 11(9): 2307-16.
Wang, M., R. Ye, et al. (2010). "Essential role of the unfolded protein response regulator
GRP78/BiP in protection from neuronal apoptosis." Cell Death Differ 17(3): 488-
98.
Wang, Z. and D. C. Thurmond (2009). "Mechanisms of biphasic insulin-granule
exocytosis - roles of the cytoskeleton, small GTPases and SNARE proteins." J
Cell Sci 122(7): 893-903.
Welch, W. J. and C. R. Brown (1996). "Influence of molecular and chemical chaperones
on protein folding." Cell Stress Chaperones 1(2): 109-15.
103

Wellen, K. E. and G. S. Hotamisligil (2005). "Inflammation, stress, and diabetes." J. Clin.
Invest. 115(5): 1111-1119.
Winslet, M., C. Hall, et al. (1992). "Relation of diagnostic serum amylase levels to
aetiology and severity of acute pancreatitis." Gut 33(7): 982-6.
Wu, J., D. T. Rutkowski, et al. (2007). "ATF6[alpha] Optimizes Long-Term Endoplasmic
Reticulum Function to Protect Cells from Chronic Stress." Developmental Cell
13(3): 351-364.
Yamamoto, K., T. Sato, et al. (2007). "Transcriptional Induction of Mammalian ER
Quality Control Proteins Is Mediated by Single or Combined Action of
ATF6[alpha] and XBP1." Developmental Cell 13(3): 365-376.
Ye, R., D. Y. Jung, et al. (2010). "Grp78 heterozygosity promotes adaptive unfolded
protein response and attenuates diet-induced obesity and insulin resistance."
Diabetes 59(1): 6-16.
Yoshida, H. (2007). "ER stress and diseases." Febs J 274(3): 630-58.
Yoshida, H., T. Matsui, et al. (2001). "XBP1 mRNA Is Induced by ATF6 and Spliced by
IRE1 in Response to ER Stress to Produce a Highly Active Transcription Factor."
Cell 107(7): 881-891.
Zechner, R., J. G. Strauss, et al. (2005). "Lipolysis: pathway under construction." Current
Opinion in Lipidology 16(3): 333-340.
Zhang, K., X. Shen, et al. (2006). "Endoplasmic reticulum stress activates cleavage of
CREBH to induce a systemic inflammatory response." Cell 124(3): 587-99.
Zhang, X., G. Zhang, et al. (2008). "Hypothalamic IKKbeta/NF-kappaB and ER stress
link overnutrition to energy imbalance and obesity." Cell 135(1): 61-73.
Zhang, Y., R. Liu, et al. (2010). "Cell Surface Relocalization of the Endoplasmic
Reticulum Chaperone and Unfolded Protein Response Regulator GRP78/BiP."
Journal of Biological Chemistry 285(20): 15065-15075.

Abstract (if available)

Abstract The endoplasmic reticulum (ER) is an intracellular organelle for protein folding, lipid synthesis and Ca2+ storage. It also is responsible for transporting most secreted and transmembrane proteins to their proper cellular locations. ER undergoes stress when the protein load exceeds its folding capacity, and cellular signaling cascades are activated as unfolded protein response (UPR). GRP78 is a major chaperone assisting protein folding, as well as a master regulator of UPR signaling. In this thesis, we discovered that heterozygosity of Grp78 enhances energy expenditure through upregulation of mitochondria activity, and alleviate high fat diet (HFD)-induced obesity and type 2 diabetes in mouse. The latter is also achieved through increase in insulin sensitivity in the white adipose tissue (WAT) of HFD-fed Grp78+/- mice, with adaptive UPR improving ER folding capacity and quality control. This mechanism is validated through overexpression of the active form of ATF6, a transcription factor known to upregulate ER chaperones. This induces protective UPR and improves insulin signaling in mouse embryonic fibroblasts (MEFs) upon ER stress. In the exocrine pancreatic acinar cells, Grp78 heterozygosity differentially regulates ER chaperone levels in a diet- and genetic background-dependent manner. The modulation of chaperone balance correlates with the ER morphology as well as the severity of cerulein-induced acute pancreatitis. Administration of chemical chaperone 4-phenolbutyrate (4-PBA) protects pancreatic acinar cells from cerulein-induced death. We also uncovered a novel role of the ER Ca2+ channel IP3R1 in glucose homeostasis is also discovered in mouse models. Progressive glucose intolerance is serendipitously observed in one line of transgenic mouse model resulting from genomic integration of the transgene. Itpr1, the IP3R1-encoding gene, is among the 10 loci disrupted by the gene insertion.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

PDF

The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

The molecular mechanism of GRP78 translocation from the endoplasmic reticulum to the cell surface

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

Utilizing chemotherapies to alter the balance between life and death in the ER stress response of cancer

PDF

Examining perillyl alcochol in glioblastoma treatment and relating its effect to endoplasmic reticulum stress response to further advance its usage in combination treatment with dimethyl-celecoxib

PDF

The differential effects of selective COX-2 inhibitors on cell proliferation and induced ER stress in glioblastoma and pancreatic carcinoma cell lines

Asset Metadata

Creator Ye, Risheng (author)

Core Title The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2010-12

Publication Date 09/20/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag acute pancreatitis,diabetes,endoplasmic reticulum,glucose homeostasis,GRP78,IP3R1,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lee, Amy S. (committee chair), Dubeau, Louis (committee member), Stallcup, Michael R. (committee member)

Creator Email rishengy@usc.edu,rishengye@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3460

Unique identifier UC1443189

Identifier etd-Ye-4139 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-385540 (legacy record id),usctheses-m3460 (legacy record id)

Legacy Identifier etd-Ye-4139.pdf

Dmrecord 385540

Document Type Dissertation

Rights Ye, Risheng

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu