University of Southern California Dissertations and Theses

A novel construct to study the pulsatility of insulin secretion in single cells, islets and whole pancreas

(USC Thesis Other)

A novel construct to study the pulsatility of insulin secretion in single cells, islets and whole pancreas

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content A NOVEL CONSTRUCT TO STUDY THE PULSATILITY OF INSULIN
SECRETION IN SINGLE CELLS, ISLETS, AND WHOLE PANCREAS

by

Vivekanandan Shanmuganathan

A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

December 2008

Copyright 2008 Vivekanandan Shanmuganathan

DEDICATION

I would like to dedicate my thesis work to my parents and grandparents.

ii

ACKNOWLEDGEMENTS
I would like to first thank my research advisor, Dr. Robert Chow, for his continuous
guidance and support throughout two years. Apart from encouraging me to work hard he
has helped me grow as a scientist.
I am extending my thanks to Dr. Joseph.M. Johnson, whose has helped me a lot in the lab
especially in imaging, planning of experiments and advising me on so many things.
I also want to thank Dr. Wenyong Xiong, with whom I started this work. Dr. Haijiang Cai
has been very helpful to me in teaching the basic techniques of molecular biology. I
would also like to thank Dr. Zoltan Tokes for his constant support and monitoring right
from day one and also for chairing my master’s committee.
Dr. Nancy Lee’s advice and critical suggestions have been very helpful, and I would also
like to thank her for helping me with western blots. I would also like to thank Dr. Ralf
Langen and Dr. Jonah Chan for being members of my committee and for their critical
suggestions.
My friends have been very helpful to me in getting my experiments done, especially
Adithya from Dr. Tobias Ulmer’s lab, Satish from Dr. Young Kwon Hong’s lab and
Krishna Kali from Dr. Derek Sieburth’s lab .
I am very grateful to my roommates and to all members of the Chow lab, for their
support and encouragement.

iii

TABLE OF CONTENTS

DEDICATION ii
ACKNOWLEDGEMENTS iii
LIST OF FIGURES v
ABBREVIATIONS vi
ABSTRACT vii
1. INTRODUCTION AND BACKGROUND 1
1.1 CLEAVAGE SITE SEQUENCE 12
1.2 SPECIFIC AIM OF THE STUDY 12

2. MATERIALS AND METHODS 13
2.1 SPLICING BY OVERLAP EXTENSION 13
2.2 PRIMERS 13
2.3 ADENOVIRAL PRODUCTION 14
2.4 VIRAL PLAQUE ASSAY 15
2.5 CELL CULTURE 15
2.6 PREPARATION OF CELL EXTRACT 16
2.7 ANTIBODIES 16
2.8 PREPARATION OF SUPERNATANT 16
2.9 IMMUNOBLOTTING 17
2.10 TIRF IMAGING 18

3. RESULTS 19
4. DISCUSSION 26
5. CONCLUSION 30
REFERENCES 31

iv

LIST OF FIGURES

Figure: 1 Insulin secretion in portal vein and in a single cell 2

Figure: 2 Schematic showing of glucose stimulated insulin secretion by beta cells 4

Figure: 3 Comparison of periodicity of insulin secretion at different levels 5

Figure: 4 Structures of preproinsulin and insulin 11

Figure: 5 Making of the adenoviral construct using Cre-Lox 14

Figure: 6 PCR amplification of VAMP and pHluorin 19

Figure: 7 Splicing by Overlap Extension 20

Figure: 8 PCR checking of recombinant adenoviral DNA 21

Figure: 9 Western blot of the AtT-20 cells transfected with SP and MSP 23

Figure: 10 Western blot of the cell lysate 23

Figure: 11 TIRF images of the AtT-20 cells transfected with MSP 24

Figure: 12 Western blot of the concentrated supernatants incubated with high
and low potassium 25

v

ABBREVIATIONS

ATP adenosine triphosphate

ADP adenosine diphosphate

CMV cyto megalo virus

DMEM Dulbecco’s modified eagle’s medium

DNA deoxyribose nucleic acid

EGFP emhanced green flourescent protein

GFP green flourescent protein

HEK 293 human embryonic kidney 293 cells

MCS multiple cloning site

MSP modified synaptopHluorin

PBS phosphate buffered saline

PCR ploymerase chain reaction

PVDF poly vinyl di flouride

RIPA radioactive immuno protective assay

SDS-PAGE sodium dodecyl sulphate-poly acrylamide gel electrophoresis

SNARE soluble N-ethylmaleimide-sensitive factor attachemnt protein receptor

SP synaptopHluorin

TBS tris buffered saline

TIRF total internal reflection flourescence

VAMP 2 vesicle associated membrane protein 2

vi

vii

ABSTRACT

Insulin is secreted in rhythmic pulses, which disappear in type 2 diabetes.
Curiously, secretion periodicity differs when comparing single cells, single
islets, versus whole pancreas. To test whether the different periods arise
due to specific regulatory mechanisms found only at specific levels of
tissue organization, it is desirable to compare secretion periods at all
tissue levels with the same assay. We have designed a fluorescent vesicle
reporter that is a fusion protein consisting of synaptobrevin (a vesicle
SNARE) and pHluorin (a highly pH-sensitive variant of green fluorescent
protein), separated by an intervening proprotein convertase 1/3 cleavage
site. We demonstrate that when expressed in single AtT20 cells, it is
cleaved and pHluorin is released into the supernatant. Because pHluorin is
released and does not stay in the membrane after exocytosis, this reporter
gives a strong signal with low background and can be used to dissect the
mechanisms underlying pulsatile insulin release.
1. INTRODUCTION AND BACKGROUND

Development of antibody-based assays such as radioimmunoassays and enzyme-linked
immunosorbent assays allowed investigators for the first time to monitor accurately the
changes in the concentration of various hormones in the blood as a function of time.
Investigators discovered that insulin and a number of other hormones exhibit rhythmic
pulses of secretion (29). Interestingly, reports have shown that pulsatile insulin secretion
has a greater glucose-lowering effect than continuous secretion (10) and that pulsatility is
lost in diabetic patients--an abnormality that could also be seen in their close relatives.
Thus, pulsatile insulin secretion appears to be important for insulin to exert its normal
physiological functions.

The pulse interval of insulin secretion in vivo has been reported to range widely from 5
minutes (23) to 8 minutes (19) to 15-20 minutes (29) (Figure 1A, below). In contrast, as
shown by our laboratory (12) and as will be discussed in more detail below, secretion
from single cells has been found to occur in pulses separated by much shorter periods
(<1minute) (Figure 1B). Why the pulse intervals are so different for secretion studied in
vivo versus in single cells in vitro (Figure 3) is a persisting mystery. Some of the
discrepancies in frequency among the different studies may be attributable to the vast
differences in sensitivities of the different types of assays employed. However, the
discrepancy may also be due to the loss of normal physiological inputs when tissues are
taken out for in vitro studies – in particular, the inputs that arise at higher levels of tissue
organization (e.g. paracrine and nervous system signaling).
1

(A) (B)

Fig: 1(A) Insulin secretion pulses measured in human portal vein at the basal state, showing pulse
intervals of approximately 5 mins (24). 1(B) Cumulative insulin vesicle secretion in a single glucose-
stimulated human pancreatic beta cell (12). Insulin granules were labeled with C-peptide-EGFP and
imaged undergoing exocytosis. The discrete steps are bursts of exocytosis, separated by intervals of
~45 s.

The hormones secreted by the many islets are collected by the pancreatic ducts, which
empty into the portal vein, which leads to the liver. Insulin undergoes significant hepatic
extraction (approximately 100-fold reduction in pulse amplitude) in the liver before
reaching the systemic circulation (23), where blood flow is turbulent and mixing with
recirculating insulin occurs.

To understand how the anatomical level at which a study is carried out may influence the
results of secretion assays, it is important to review the relevant anatomy. Insulin is
synthesized, stored and secreted by the pancreas. The pancreas comprises both the
2

exocrine and endocrine tissues. The exocrine tissues secrete enzymes that facilitate
digestion, while the endocrine tissues secrete hormones into the blood stream to target
distant organs and tissues. Approximately 5% of the mass of pancreas is endocrine cells,
which reside in small clusters of one to two thousand cells, called the islets of
Langerhans. A single islet of Langerhans comprises alpha, beta, delta, epsilon and
pancreatic polypeptide (pp) cells, which secrete glucagon, insulin, somatostatin, ghrelin
and pancreatic polypeptide respectively. Beta cells make up approximately 80% of the
cells present in the islet of Langerhans.

Initial studies were conducted in the systemic blood circulation, where insulin levels were
very low due to normal hepatic extraction, and re-mixing of insulin with previously
released insulin confounded accurate estimates of the true secretion rate. Furthermore, at
the time the radioimmunoassay was less sensitive than modern assays. More recent
studies have been conducted in the portal circulation, using sophisticated deconvolution
techniques and insulin C-peptide assays (C-peptide is a processing fragment of proinsulin
that is not removed by the liver) and, more recently, studies have been conducted even at
the islet and single-cell level.

Studies at single cells employ assays having totally different principles than the antibody-
based assays – for example, measurement of membrane capacitance, a sensitive
electrical parameter that is proportional to the membrane surface area, which increases as
vesicle membrane is added to the plasma membrane by exocytosis; imaging of exocytosis
of fluorescent proteins targeted to the vesicle lumen or vesicle membrane (see Figure.
3

1B); or electrochemical detection of insulin or serotonin, which is co-released with
insulin. These three assays are sensitive enough to detect single-vesicle secretion. Our
goal will be to develop an assay that can be used from the single-vesicle/single cell to the
individual islet to the whole pancreas, to help work out the mechanisms that may explain
any differences in the periodicity of secretion.

Fig: 2 Schematic showing of glucose stimulated insulin secretion by beta cells (20).

4
The mechanisms underlying the pulsatility of insulin secretion and, in particular, setting
the period of the pulses in vivo are still poorly understood, despite intense interest, and
there may be different regulatory mechanisms at different levels of tissue organization –
from beta cell to single Islet to intact pancreas. Figure 2 shows a schematic of a beta cell
metabolizing glucose, which leads (after many steps not illustrated) to an increase in the

intracellular ratio of ATP/ADP, which then causes K-ATP channels to shut down,
resulting in membrane depolarization and the opening of the calcium channels. Calcium
entering the cells triggers exocytosis of insulin granules. The ATP/ADP ratio is believed
to oscillate, due to what has been called the “metabolic oscillator”, and this contributes in
some way to the overall pulsatility of insulin secretion (8). However, as discussed, the
factors determining the periodicity are still unclear.

Fig: 3 Comparison of the periodicity of insulin secretion at the whole pancreas, islets and single beta
cell levels.
There are nearly a million islets, each consisting of 1000 to 2000 beta cells, in the human
pancreas. In order for the secretion seen in the portal vein to be large discrete pulses, the
5

pancreas must somehow synchronize the activity of the many beta cells in each islet and
the million or so islets spread throughout the pancreas. This coordination can be achieved
only if there is some form of connection or communication among all the cells of any
given islet and among all islets. For example, gap junctions in the beta cell plasma
membranes mediate electrical coupling among the cells within an islet, and by setting the
electrical impedance of the system, affect the periodicity of electrical firing, and may
thereby affect the periodicity of insulin secretion (11). However, physiological studies do
not appear to indicate that all cells are electrically coupled. Also important at the islet
level is the cell-cell paracrine signaling among the different islet cells. Although many
different signaling molecules and receptors are known to be present among the different
islet cells, there is still no clear overall model that would explain how these diverse
mechanisms might or might not play a role in controlling the pulsatility of insulin
secretion (30).

At the whole pancreas level, islets are innervated by the autonomic nervous system.
Although parallel innervation of the many islets in the pancreas could be helpful in
synchronizing secretion from all islets, even the nature of the transmitter that might be
responsible for synchronization is still unclear (30).

Previous studies have used perfused islets and monitored the calcium oscillations as a
surrogate marker of insulin secretion (27). This is an attractive approach as it is known
that calcium is an important trigger for fast exocytosis; however, there have been reports
that even in the absence of clear changes in calcium concentration, insulin secretion may
6

exhibit pulsatility (26). Furthermore, another study reports that even when there was
influx of calcium and calcium release from internal stores there was no insulin secretion
if there was no ATP production by oxidative phosphorylation (21). Thus, cytoplasmic
calcium oscillations may not accurately reflect insulin secretion, and it would be
advantageous to develop a single technique that could be used to monitor secretion at
single cells, islets and even in vivo.

In previous studies in our lab, we used TIRF (total internal reflection fluorescence)
microscopy to monitor the fluorescent fusion protein C-peptide-EGFP targeted to insulin
vesicles (Figure 1B; 12). C-peptide is a processing fragment, cleaved from proinsulin
during proinsulin processing. TIRF microscopy is an excellent technique to monitor the
dynamics of membrane-associated fluorescent vesicles, because the light used to excite
fluorescence is confined only to a thin (300 nanometers) aqueous layer above the glass
coverslip that includes the cell membrane attached to the coverslip. Our previous work
showed that glucose-stimulated beta cells secrete in discrete bursts of exocytosis
(typically 20 vesicles undergoing exocytosis at the same time), occurring with a pulse
interval of about 45 seconds (12).

The short intervals we observed between glucose-stimulated bursts of secretion in single
cells were nearly identical in duration to those reported previously for glucose-stimulated
calcium oscillations in single beta cells. In contrast, in perfused islets and pancreas
secretion pulses are separated having a frequency of about 5 (24) and 8 minutes (19),
similar to the periods for insulin concentration changes in vivo. We were thus motivated
7

to understand the mechanisms that might underlie the different periodicities, and we
wanted to compare single beta cell secretion to secretion at the level of the islet and
whole pancreas.

Unfortunately, TIRF cannot be readily applied to study secretion from whole islets, nor
can it be used to study insulin secretion in vivo. Furthermore we have discovered that C-
peptide-EGFP is not an ideal marker for studying secretion at islets or pancreas. In pilot
experiments we found that islets isolated from transgenic mice in which the beta cells
expressed C-peptide-EGFP did not exhibit glucose-stimulated fluorescence changes. In
addition, when the mice expressed significant amounts of C-peptide-EGFP, they were
diabetic. These finding preclude meaningful comparative studies going from single cell,
to islet, to whole perfused pancreas using C-peptide-EGFP.

To address these problems, we set out to design another fluorescent fusion protein that
can be used to monitor insulin secretion directly (i.e. not using calcium concentration
changes as a surrogate marker of secretion) from cell to islet to whole pancreas. Previous
reports have shown that the fluorescent fusion protein synaptopHluorin can be used in
single cells to study exocytosis and endocytosis (3). Most importantly, it can even be
used in transgenic animals (2, 25), apparently without significant deleterious effects.

In synaptopHluorin, synaptobrevin is attached to pHluorin. Synaptobrevin is a 18 kD
transmembrane protein (4) and one of the SNARE proteins that mediate vesicle-plasma
membrane fusion in exocytosis, and pHluorin is a mutant form of Green Fluorescent
8

Protein (GFP) that has been modified so that its fluorescence is highly pH sensitive (15).
pHluorin is attached to the c-terminal of synaptobrevin, which resides in the acidic lumen
of the vesicles (1), where its fluorescence is almost completely quenched. During
exocytosis the luminal side of the vesicle is externalized and the pH rises to 7.4, leading
pHluorin to fluoresce brightly. Thus, synaptopHluorin’s signal-to-noise ratio at
exocytosis is expected to be better than that of the C-peptide-EGFP construct that we
have used previously.

We obtained synaptopHluorin, a fusion construct of ecliptic pHluorin and synaptobrevin,
as a gift from the Rothman Lab (Columbia University, New York City) , and we designed
an important modification of introducing a cleavage site between synaptobrevin and
pHluorin. This modification addresses one of the problems associated with
synaptopHluorin, which is that much of the synaptopHluorin (approximately 30%) stays
in the plasma membrane after exocytosis, where pHluorin remains at neutral pH, so that it
contributes to significant background fluorescence (25, 6). One strategy that has been
used to circumvent the problem is to introduce a cleavage site for tobacco etch virus
(TEV) protease between synaptobrevin and pHluorin. External application of TEV
protease cleaves away the pHluorin exposed at the cell surface, thus eliminating the
background fluorescence (27). A limitation of this approach is that it requires the external
application of a protease not normally present in a living cell or animals.

9

We planned to make a construct that could be used to monitor secretion not only with
cells in culture, but also in vivo. Our strategy, therefore, was to introduce a cleavage site
between synaptobrevin and pHluorin for an enzyme that is native to the pancreatic beta
cell. Fortunately, we can take advantage of the fact that proinsulin is processed by the
prohormone convertase to give functional insulin.

Insulin is normally synthesized as a single polypeptide of 110 amino acids, the
preproinsulin. Once inside the secretory vesicle proinsulin is processed by the
endopeptidases such as prohormone convertase 1/3 and 2. Prohormone convertase 1/3
acts at the junction of B-chain and C-peptide, while PC2 cleaves at the junction of A-
chain and C-peptide as shown in Fig 4(A).

Prohormone convertases (PC) are normally involved in the processing of many precursor
polypeptides to give biologically active molecules. Seven mammalian PC’s have been
identified: Furin, PC 1/3, PC 2, PC4, PC5, PACE4 and PC7. Even though insulin is
processed by PC1/3 and PC2, studies show that there is a much more severe block of
insulin processing in mice lacking PC1/3, compared to mice lacking PC2. Therefore, we
introduced the PC1/3 cleavage site between synaptobrevin and pHluorin.

10

(A)

(B)

Fig: 4(A) Preproinsulin with its signal peptide. Processing site of prohormone convertase1/3 and 2
also shown. 4(B) Mature insulin polypeptide within the vesicle after being processed by the
prohormone convertases.

11

1.1. CLEAVAGE SITE SEQUENCE

Insulin is synthesized as a polypeptide precursor having three domains – A, B and C (See
Fig 4). PC1/3 cleaves between the B-chain and C-chain, while PC2 is thought to cleave
between C chain (C-peptide) and A-chain. We inserted the cleavage site present in the rat
insulin sequence. We have used AtT 20 cells to test our construct, as several publications
have shown that AtT 20 cells have high quantities PC1/3 (22). The specific sequence we
used is
Ala-Ala-Ala-Lys-Ser-Arg-Arg-Glu-Ala-Ala-Ala

5’ gct-gct-gca-aaa-tct-aga-aga-gaa-gca-gct-gct 3’
3’ cga-cga-cgt-ttt-aga-tct-tct-ctt-cgt-cga-cga 5’

1.2. SPECIFIC AIM OF THE STUDY

The aim of the study is to design a reporter construct that can be used to study insulin
secretion at all levels of tissue organisation -- from single beta cells, individual islets, or
the intact pancreas. It is hoped that the ability to study secretion at different levels of
tissue organisation will help us dissect the mechanisms underlying the co-ordination of
secretion among islets and cells leading to pulsatile insulin secretion. We will

1. Design a construct that is cleavable by the enzyme prohormone convertase (1/3).
2. Prove that the construct is being cleaved and secreted.

12

2. MATERIALS AND METHODS

2.1 SPLICING BY OVERLAP EXTENSION

We obtained the plasmid encoding synaptopHluorin (ecliptic pHluorin) as a gift from
James E. Rothman. We introduced a PC1/3 cleavage site between the synaptobrevin and
pHluorin sequences using PCR splicing by overlap extension. Briefly, using appropriate
PCR primers we amplified a DNA fragment containing synaptobrevin and a N-terminal
half of the PC1/3 cleavage site. At the same time, using appropriate PCR primers, we
amplified a DNA fragment containing C-terminal half of the cleavage site and pHluorin.
By design, there was overlap of the two DNA fragments so that a third PCR reaction
produced a combined product. In this way we managed to introduce the cleavage site
between synaptobrevin and pHluorin. The whole process was monitored at each stage by
running agarose gels to check whether the bands were of the appropriate size. The final
DNA product was sequenced to confirm the introduction of cleavage site.

2.2. PRIMERS

All the primers were synthesized by IDT technologies (IN, USA).

1.5’ccggaaaaaagcggccgcaaaaggaaaaaggatgtcggctaccgc 3’
2 5’tgcttctcttctagattttgcagcagcagtgctgaagtaaacgatgatga 3’
3.5’gctgcaaaatctagaagagaagcagctgctagtaaaggagaagaacttttcactgg 3’
4.5’ ggggtacccctttgtatagttcatccatgcca 3’

13

2.3. ADENOVIRAL PRODUCTION

The creation of an adenovirus vector was performed in two stages. First the
synaptopHluorin construct was subcloned into the plasmid pDNR-CMV at the MCS
(Multiple Cloning Site) of this plasmid. The MCS of pDNR-CMV is flanked by loxp
sites which are recognized by the Cre enzyme. Next, using a Cre-loxP reaction, the
synaptopHluorin cassette was transferred into the adenovirus genome. Then bacteria
capable of transformation with large plasmids were electroporated with the adenoviral
DNA and were selected with an antibiotic. 24 hrs after culturing the bacteria, 15 random
colonies were tested by PCR with primers given by manufacturer to test for the
successful recombinants, out of which 3 were positive.

Fig: 5 Making of Adenoviral constructs using Cre-Lox reaction.

14

Once a positive bacterial clone had been identified, it was grown in LB (Luria-Bertani)
medium for 16 hrs, and recombinant adenoviral DNA was extracted. DNA was linearised
with the Pac I restriction enzyme, and HEK (Human Embryonic Kidney) 293 cells of 80-
90% confluency were transfected. After more than 50% of the HEK 293 cells exhibited
the desired cytopathic effect, cells were lysed to harvest the virus.

2.4. VIRAL PLAQUE ASSAY:

Viral suspensions were diluted with PBS (Phosphate Buffered Saline, 1X) in ratios of
1:10, 1:100, 1:1000. 100 μl of 1:10 diluted suspension were added to the six well plates
containing 80-90% confluent HEK cells. After 2 hrs incubation at 37 C, the cells were
overlaid with 0.5% soft agar. After 48 hrs, fluorescent spots were counted to calculate the
titer of the virus.

2.5. CELL CULTURE
AtT-20 cells were obtained from ATCC (VA, USA). Cells were grown in DMEM (4.5g/l
glucose) and horse serum was added to final concentration of 10% and pH was adjusted
to 8.0 using sodium hydroxide. Medium was changed three times a week.
HEK 293 cells were grown in DMEM (4.5g/l glucose) supplemented with 0.1mM Non-
essential amino acids, 10mM HEPES and fetal bovine serum was added to the final
concentration of 10%. The pH of the medium was adjusted to 7.4 with NaOH.

15

2.6. PREPARATION OF CELL EXTRACT
AtT-20 cells were grown to 80-90% confluency in six-well plates. The cells were
transfected (Transmax, a gift from ZZ Wang, University of Southern California, Los
Angeles, California) with the plasmid encoding synaptopHluorin. SynaptopHluorin
expression was checked under epifluorescence after 24 hrs. 72 hrs after transfection, cells
were harvested with cold PBS, and RIPA lysis buffer (150 mM NaCl, 0.1% SDS, 1%
sodium deoxycholate, 50 mM Tris Hcl, 1% Triton x-100, 1% NP-40 Idet Solution, pH
7.5) was added to the cell pellet to extract the proteins. Cells were incubated with RIPA
buffer for 30 min on ice. After 30 minutes, cells were centrifuged at 12,000 rpm for 15
min and the supernatant was further used for immunoblotting.

2.7. ANTIBODIES
Antibody against pHluorin (Rabbit polyclonal-anti GFP) was from Chemicon
(MA, USA). Antibody against synaptobrevin (Rabbit polyclonal-anti VAMP2) was
obtained from AbCam (MA, USA); and secondary goat anti-rabbit HRP conjugated was
from Santa Cruz Biotechnology (CA, USA).

2.8. PREPARATION OF SUPERNATANT
In parallel, we prepared three pairs of flasks of AtT20 cells, grown to 80-90%
confluency: two flasks of cells were transfected with the modified/cleavable
synaptopHluorin, two were transfected with synaptopHluorin, and two other flasks were
not transfected, as a control. Transfection was carried out using Transmax reagent. After
72 hrs, cell media in all flasks was removed, and each flask was gently washed two
16

times with extracellular solution (in mM: 140 NaCl, 4 KCl, 1 CaCl
2
, 1 MgCl
2
, HEPES,
pH adjusted to 7.4 with NaOH). To one of each pair of flasks, we added isosmolar high
potassium solution (100 mM KCl, as an isosmolar replacement for NaCl, in the
extracellular solution) and to the other flask of the pair we added normal potassium
solution (normal extracellular solution, containing 4 mM KCl). Cells were incubated at
37 C for 30 minutes. Then the supernatant was removed and concentrated using
membrane-containing centrifuge tubes. The membranes had a capacity to retain proteins
of size greater than 10 kD. After concentrating the supernatant 25 μl was loaded onto the
12% SDS-PAGE from different samples.

2.9. IMMUNOBLOTTING
12% SDS-PAGE gels were used and the gels were run at a constant current of 20 mA.
After the gel run, proteins were transferred overnight to a PVDF membrane at constant
current of 110 mA in the cold room. Protein transfer and equal loading was checked
using Ponceau S stain of the PVDF membrane. Membrane was blocked with 5% non-fat
dry milk containing 0.1% Tween-20 for 1 hr at room temperature. After that, primary
antibody (1:1000) diluted in non-fat dry milk was added to the membrane and incubated
for 90 mins at room temperature. Membrane was then washed with TBS-T (Tris Buffer
Saline containing 0.1% tween-20) for 3 X 5 min and once with TBS, then secondary
antibody (1: 5000) diluted in 5% non fat dry milk was added and incubated for 1 hr at
room temperature (7). Membranes were washed again with TBS for 3 X 5 min and then
chemiluminescence was developed. Chemiluminescence was developed using Pierce
West-Pico kit (IL, USA).
17

2.10. TIRF IMAGING
We have previously published detailed descriptions of our TIRF microscope and how it is
used for imaging (12-14).

18

3. RESULTS
We first carried out PCR to produce the synaptobrevin- and pHluorin- containing DNA
fragments as shown in the Fig 6. The DNA fragment encoding synaptobrevin was
amplified using primers 1 and 2. The DNA fragment encoding pHluorin was amplified
using primers 3 and 4. We gel purified the two DNA fragments. The intervening PC 1/3
cleavage site was created by overlap extension of the gel-purified DNA fragments as
shown in Fig 7. The size of the PCR fragment encoding synaptobrevin is 351 bp and the
size corresponding to pHluorin is 720 bp, therefore the size of the DNA encoding
synaptopHluorin is expected around 1071 bp; we got the bands of the right size in the
agarose gel (Fig 6, see below), and also sequenced the DNA product in the USC Norris
Microchemical Core Facility to double check it.

pHluorin(GFP)
Synaptobrevin(VAMP 2)
Fig: 6. PCR amplification of VAMP and pHluorin : 1.5% agarose gel showing the bands of VAMP 2
and pHluorin prior to splicing by overlap extension.

19

Fig: 7. Splicing by Overlap Extension: 1.5% agarose gel showing the bands of synaptopHluorin after the
introduction of the PC1/3 site by splicing by overlap extension.

We then subcloned the construct into the adenoviral vector. As adenoviral DNA is quite
large we transformed high-capacity bacteria to produce recombinant DNA. GC10
bacterial cells bought from Gene Choice (MD, USA) were electroporated with the
adenoviral DNA. After electroporation, bacterial cells were plated on agar plates and
incubated for 24 hrs. To check whether the bacterial colonies on the plate had
recombinant adenoviral DNA, we performed PCR on the bacterial colonies using specific
primers provided by the manufacturer. For every successful recombination we expected
to see a band of approximately 600 bp; if not, a band of approximately 200 bp is seen.
Once we got a positive colony of bacteria containing recombinant adenoviral DNA, we
cultured the bacteria overnight in LB broth with appropriate antibiotic, and the DNA was
purified.

20

Fig: 8. PCR checking of recombinant DNA: Bands for checking the recombinant adenoviral DNA
containing the gene of interest. If the gene of interest is present we get a band of about 600bp, if not, we get
a band about 221bp using the specific primers described by the manufacturer.

The adenoviral DNA being circular, we linearised it using Pac I enzyme. We digested
about 6 micrograms of DNA and transfected 3 wells of 80-90% confluent HEK 293 cells
in a six-well plate. We used Transmax reagent to transfect the cells. Transfection
efficiency was monitored by checking the fluorescence under epifluorescence. We
normally have a transfection efficiency of 60-70%. Once transfected, cells started
producing the virus, and also started coming off the plate. This effect is called the
cytopathic effect. This cytopathic effect was seen 4 days after transfection. Once more
than 50% of cells in a plate were floating, cells were lysed to harvest the virus.

21

Adenoviral titer was calculated by performing serial dilutions of the viral stock solutions
in phosphate buffered saline (PBS) and then using 100 μl of each dilution to perform
parallel infections of 80-90% confluent HEK 293 cells in a 6-well plate. After 48 hrs, the
number of fluorescent spots was counted using a 10X microscopic objectives.

The number of fluorescent spots in the 1:10 dilution dish was 170 (average of two plates)
Calculation of the adenoviral titer:
= 170/ (0.1 * 0.1)
= 1.7 x 10
4
pfu/ml.
So, adenoviral titer – 1.7 * 10
4
pfu/ml.
We did not need to concentrate the viral stock solution, since for imaging, it is easy to
identify and image even a few transduced cells.

In order to confirm the expression of the construct, AtT-20 cells were transfected
synaptopHluorin and modified synaptopHluorin, and immunoblotted with synaptobrevin-
2 antibody. Cells without transfection are the control (Control lane, Fig 9). We got the
bands of the appropriate size in the other two lanes.

22

Fig: 9 Western blot of the cells transfected with synaptopHluorin and modified synaptopHluorin.
Lane 1 and 2 were the AtT-20 cells transfected with synaptopHluorin. Lane 3 and 4 were the AtT-20 cells
transfected with modified synaptopHluorin. Lane 5 is the control without transfection. 30 μg of protein
were loaded in each lane in a 12% SDS- PAGE. Membrane was immunoblotted with synaptobrevin-2
antibody.

To test whether the construct is cleaved within the cells in which PC 1/3 is found in
vesicles, we transfected AtT-20 cells using Transmax reagent. We already knew from
previous publications that AtT-20 cells express PC 1/3 (22), so we used this cell line to
test our construct. Transfected cells were lysed after 72 hrs using RIPA lysis buffer to
collect the cell lysate. Immuoblotting was performed on the cell lysate. Protein-bound
membrane was probed with anti-GFP antibody and we expected bands of size 45 kD and
27 kD, since size of the construct is 45 kD and pHluorin alone is 27 kD. We got the
expected bands (Fig 10).

23
Fig: 10: Western blot of the AtT -20 cell lysate. Membrane was probed with anti-GFP (pHluorin)
antibody at 1:1000 dilution. Secondary antibody used was Goat anti rabbit HRP-conjugated Polyclonal IgG
at 1: 5000 dilution. MSP: AtT-20 cells transfected with modified synaptopHluorin. SP: AtT-20 cells
transfected with synaptopHluorin. Control is the lane AtT-20 cells without transfection. 30 μg of protein
was loaded in each lane.

Then to see whether we could image exocytosis, we used TIRF imaging. AtT-20 cells
were transfected with modified synaptopHluorin, under the control of CMV promoter.
Transfected cells were plated in HTB9-coated coverslips. Upon stimulation with high
potassium solution we were able to see the appearance and disappearance of fluorescent
vesicles. Appearance should be due to the dequenching of the pHluorin fluorescence at
exocytosis. Disappearance could be due to diffusion of the pHluorin away from the site
of exocytosis. However, from these movies alone, we could not exclude that the
disappearance might be due to retraction of the fluorescent vesicle back into the
cytoplasm (Fig 11).

Fig: 11: TIRF images of the AtT-20 cells transfected with VAMP-pHluorin. Shown are images in
which a red arrow points to the appearance of a single vesicle and its disappearance on fusing with the
plasma membrane.

In order to confirm that the cleaved pHluorin had in fact been exocytosed, we stimulated
a flask of AtT-20 cells using high potassium solution (for a control, we also incubated
another flask of cells with low potassium solution). After incubating the cells with the
potassium solution for 30 minutes, the supernatant was removed and concentrated. The
24

concentrated solutions were run in 12% SDS-PAGE gel and were immunoblotted with
GFP and VAMP2 antibody, as shown in Fig 12.

Fig 12: Western blot of the concentrated supernatant incubated with high and low potassium
solution. Lane 1 is the cells without transfection treated with low potassium solution. Lane 2 and 4 were
supernatants cells treated with high potassium solution. Lane 3 and 5 were supernatants from cells treated
with low potassium solution. Lane 2 and 3 were the cells transfected with modified synaptopHluorin. Lane
4 and 5 were the cells transfected with synaptopHluorin. MSP- Modified SynaptopHluorin.
SP- SynaptopHluorin. L- Protein ladder.

We were able to see two bands of approximately 36 and 27 kD when we probed with
GFP antibody in lane 3 and 5. When the same protein-bound membrane was
immunoblotted with synaptobrevin antibody we got a single band of size slightly greater
than 36 kD, which coincides with the faint band in the gel immunoblotted with GFP
antibody. This supports the idea that the two bands in the GFP blot correspond to
synaptopHluorin and pHluorin that has been cleaved away from synaptopHluorin.

25

4. DISCUSSION

In this study we sought to develop a construct that can be used at all levels of tissue
organization to study pulsatile insulin secretion, so that we can for the first time to test
how secretion behaves using the same reporter for all levels, and then study the
underlying mechanisms.
In order to check the expression of our construct, AtT-20 cells were transfected with
synaptopHluorin and modified synaptopHluorin, and immunoblotted with synaptobrevin
antibody. We see a bright band of size 45 kD which corresponds to the size of
synaptopHluorin. In the lane transfected with modified synaptopHluorin we see the band
for synaptopHluorin slightly higher due to the modification of the original protein. The
cleavage site introduced is 11 amino acids, which increases the size of the modified
protein by approximately 1.1 kD.

We have shown by immunoblotting that the pHluorin is cleaved from synaptobrevin
within the vesicle by proprotein convertase (1/3). We found the expected two bands one
of the size 45 kD and 27 kD. One of the bands (45 kD) corresponds to the size of
synaptopHluorin and the other band of 27 kD corresponds to size of pHluorin alone.
Since the construct is under the CMV (cytomegalovirus) promoter, which drives the
expression of protein in high levels, it is possible that the protein levels were too high for
the endogenous PC1/3 to completely cleave it. Alternatively some of the synaptopHluorin
may have been uncleaved, because it was located in the premature vesicles. It is known
that insulin exists in both cleaved and uncleaved form in beta cell, and the uncleaved
26

form is believed to present in immature vesicles, in which proinsulin has not been
cleaved to form insulin.

For a single cell study, we have used TIRF microscopy of AtT-20 cells to show single
vesicles appearing and disappearing at the plasma membrane. In this experiment we see
exocytosis as fluorescent spots that appear and disappear. Since the imaging was not fast
enough, we did not observe a cloud of fluorescence that dispersed.

We have also shown that the pHluorin is cleaved and secreted into the extracellular
medium by the cells in the Figure 12 by immunoblotting the concentrated supernatants
with GFP and VAMP2 antibody. Upon stimulation with high potassium solution, rapid
exocytosis takes place which causes the release of cleaved pHluorin into the supernatant
solution. pHluorin could be seen as a clear band in the lane 3 and 5 in figure 12 in which
the AtT-20 cells were transfected with modified synaptopHluorin and synaptopHluorin
respectively. Appropriately we expect much of the pHluorin band to be in lane 2 and 4 in,
because those were the lanes treated with high potassium and we also expect to see band
corresponding to pHluorin alone. We see two bands when immunoblotted with GFP,
perhaps because the cleavage site of prohormone convertases are dibasic amino acids,
there are may be some sites within the construct apart from our modification, which
could cause cleavage and give rise to products of different size. Of the two bands 36 kD
and 27 kD, the latter size band is darker. This shows that the construct is primarily
cleaved at the cleavage site introduced, but there also some cleavage within the construct.
It should also be noted that AtT-20 cells do show spontaneous action potentials, which
27

would cause lead to secretion of pHluorin even without stimulation by high potassium
solution. Thus, the majority pHluorin detected in the western blotting is due to secretion.

We used a synaptopHluorin construct as a true marker of exocytosis, rather than monitor
cytoplasmic calcium changes, as has been done in some previous studies. We have been
able to demonstrate secretion of pHluorin from single cells. As noted above, we
previously used a C-peptide-EGFP construct successfully to study single-vesicle/single-
cell exocytosis. Unfortunately, transgenic mice expressing this construct were either
diabetic or did not secrete properly, precluding studies in vivo. Previous reports have
shown that transgenic mice expressing synaptopHluorin in hippocampal neurons and
neuromuscular junctions are phenotypically normal (2, 25, and 9). Therefore, in the
future, we plan to create a transgenic mouse expressing modified synaptopHluorin only
in beta cells by using a mouse insulin specific promoter, and this mouse model could be
used to study how pulsatility is controlled in various tissue levels.

Even though for most of the experiments we transfected cells using Transmax reagent,
we know that the adenovirus we produced is working and able to transduce cells. Since
we have constructed the adenovirus, we are hoping that we can use the same marker to
monitor exocytosis for single cells, individual islets and even the whole pancreas. For the
latter two tissue levels, we need to replace the CMV promoter with an insulin promoter,
so we can get beta cell specific expression of the protein. For long-term studies it may be
beneficial to use another type of viral vector such as lentivirus or adeno-associated virus,
as these viruses could be used for stable expression of the protein by integrating the
28

DNA into the cellular genome.

It may be even possible to transduce some islets and transplant them into the pancreas
and monitor pHluorin oscillations. By this method we could dissect which mechanism
plays a key role in connecting the islets. Other studies have suggested that there are
cholinergic and adrenergic nerves across the pancreas which somehow coordinates the
islets.

Groups of islets could be imaged in the presence of various compounds in vitro to dissect
how islets are coordinated for pulsatile insulin secretion. Instead of seeing the rise and
decrease of calcium using calcium dyes, we could see the oscillations caused due to
secretion of pHluorin. pHluorin gives fluorescence, once the environmental pH rises to
7.4 upon exocytosis and since it’s being cleaved, it will diffuse away from the cells
causing decrease in fluorescence. So there would be an oscillation in fluorescence due to
pHluorin.

29

5. CONCLUSION

Insulin is secreted in pulses and to secrete in unison all the cells within a given islet have
to be coordinated and all the islets have to be coordinated. To test how islets are
coordinated, we have designed a synaptopHluorin with a PC 1/3 cleavable site in between
synaptobrevin and pHluorin. We have demonstrated that pHluorin is cleaved from
synaptobrevin and secreted into the extracellular solution by western blotting, and we
have also imaged the exocytosis of pHluorin. In the future, we would like to image the
diffusion of pHluorin away from the membrane, and show that the construct can be used
at all levels to study the pulsatility of insulin secretion. Having successfully generated
this construct, we would also like to study the hypothesis that innervation plays an
important role in setting the oscillation frequency in the intact pancreas.

30

REFERENCES

1. Anderson, R. G., and L. Orci. 1988. A view of acidic intracellular
compartments. J Cell Biol 106:539-43.

2. Araki, R., H. Sakagami, Y. Yanagawa, T. Hikima, T. Ishizuka, and H.Yawo.
2005. Transgenic mouse lines expressing synaptopHluorin in hippocampal and
cerebellar cortex. Genesis 42: 53-60.

3. Balaji, J., and T.A. Ryan. 2007. Single vesicle imaging reveals that synaptic
vesicle exocytosis and endocytosis are coupled by a single stochastic mose.
Proc Natl Acad Sci USA 104: 20576-20581

4. Baumert, M., P. R. Maycox, F. Navone, P. De Camilli, and R. Jahn. 1989.
Synaptobrevin: an integral membrane protein of 18,000 daltons present in small
synaptic vesicles of rat brain. EMBO J 8:379-84.

5. Chalfie, M., Y. Tu, G. Euskirchen, W. W. Ward, and D. C. Prasher. 1994.
Green fluorescent protein as a marker for gene expression. Science 263:802-5.

6. Dittman, J. S., and J. M. Kaplan. 2006. Factors regulating the abundance and
localization of synaptobrevin in the plasma membrane. Proc Natl Acad Sci U S A
103: 11399-11404.

7. Gallagher, S., S. E. Winston, S. A. Fuller, and J. G. Hurrell. 2008.
Immunoblotting and immunodetection. Curr Protoc Mol Biol Chapter 10:Unit
10.

8. Heart, E., R.F. Corkey, J. D. Wikstrom, O. S. Shirihai and B. Corkey. 2005.
Glucose dependent increase in mitochondrial membrane potential, but not
cytoplasmic calcium, correlates with insulin secretion in single islet cells. Am J
Physiol Endocrinol Metab 290: E143-148.

9. Li, Z., J. Burrone, W.J. Tyler, K.N. Hartman, D.F. Albeanu, and V.N.
Murthy. 2005. Synaptic vesicle recycling studied in transgenic mice expressing
synaptopHluorin. Proc Natl Acad Sci U S A 102: 6131-36.

10. Matthews, D. R., B. A. Naylor, R. G. Jones, G. M. Ward, and R. C. Turner.
1983. Pulsatile insulin has greater hypoglycemic effect than continuous delivery.
Diabetes 32:617-21.

11. Meissner, H. P. 1976. Electrophysiological evidence for coupling between beta
cells of pancreatic islets. Nature 262:502-4.

31

12. Michael, D. J., W. Xiong, X. Geng, P. Drain, and R. H. Chow. 2007. Human
insulin vesicle dynamics during pulsatile secretion. Diabetes 56:1277-88.

13. Michael, D. J., R. A. Ritzel, L. Haataja, and R. H. Chow. 2006. Pancreatic beta
cells secrete insulin in fast and slow release forms. Diabetes 55:600-7.

14. Michael, D. J., X. Geng, N. X. Cawley, Y. P. Loh, C. J. Rhodes, P. Drain, and
R. H. Chow. 2004. Flourescent cargo proteins in pancreatic beta cell: design
determines secretion kinetics at exocytosis. Biophysical J 87:L03-5

15. Miesenbock, G., D. A. De Angelis, and J. E. Rothman. 1998. Visualizing
secretion and synaptic transmission with pH-sensitive green fluorescent proteins.
Nature 394:192-5.

16. Porksen, N., S. Munn, D. Ferguson, T. O'Brien, J. Veldhuis, and P. Butler.
1994. Coordinate pulsatile insulin secretion by chronic intraportally transplanted
islets in the isolated perfused rat liver. J Clin Invest 94:219-27.

17. Porksen, N., S. Munn, J. Steers, J. D. Veldhuis, and P. C. Butler. 1996.
Effects of glucose ingestion versus infusion on pulsatile insulin secretion. The
incretin effect is achieved by amplification of insulin secretory burst mass.
Diabetes 45:1317-23.

18. Porksen, N., S. Munn, J. Steers, J. D. Veldhuis, and P. C. Butler. 1995. Impact
of sampling technique on appraisal of pulsatile insulin secretion by deconvolution
and cluster analysis. Am J Physiol 269:E1106-14.

19. Porksen, N., S. Munn, J. Steers, S. Vore, J. Veldhuis, and P. Butler. 1995.
Pulsatile insulin secretion accounts for 70% of total insulin secretion during
fasting. Am J Physiol 269:E478-88.

20. Rorsman, P., 1997. The pancreatic beta cell as a fuel sensor: an
electrophysiologist’s viewpoint. Diabetalogia 40:487-495.

21. Rustenbeck, I., C. Herrmann, and T. Grimmsmann. 1997. Energetic
requirement of insulin secretion distal to calcium influx. Diabetes 46:1305-11.

32
22. Smeekens, S. P., A. S. Avruch, J. LaMendola, S. J. Chan, and D. F. Steiner.
1991. Identification of a cDNA encoding a second putative prohormone
convertase related to PC2 in AtT20 cells and islets of Langerhans. Proc Natl Acad
Sci U S A 88:340-4.

33

23. Song, S., L. Kjems, R. Ritzel, S. McIntyre, M. Johnson, J. Veldhuis, and P.
Butler. 2002. Pulsatile insulin secretion by human pancreatic islets. J Clin
Endocrinol Metab 87:213-21.

24. Song, S. H., S. S. McIntyre, H. Shah, J. D. Veldhuis, P. C. Hayes, and P. C.
Butler. 2000. Direct measurement of pulsatile insulin secretion from the portal
vein in human subjects. J Clin Endocrinol Metab 85:4491-9.

25. Tabares, L., R. Ruiz, P.L. Clemente, M.A. Gaffield, G.A.D. Toledo, R.F.
Chacon, and W.J. Betz. 2007. Monitoring synaptic function at the
neuromuscular junction of a mouse expressing synaptopHluorin. J Neuroscience
27(20): 5422-5430.

26. Westerlund, J., E. Gylfe, and P. Bergsten. 1997. Pulsatile insulin release from
pancreatic islets with nonoscillatory elevation of cytoplasmic Ca2+. J Clin Invest
100:2547-51.

27. Wienisch, M., and J. Klingauf. 2006. Vesicular proteins exocytosed and
subsequently retrieved by compensatory endocytosis are nonidentical. Nat
Neurosci 9:1019-27.

28. Wyatt, R.M., and R.J.B. Gordon. 2008. Heterogeneity in synaptic vesicle
release at neuromuscular synapses of mice expressing synaptopHluorin. J
Neuroscience 28: 325-335.

29. Yalow, R. S., and S. A. Berson. 1960. Immunoassay of endogenous plasma
insulin in man. J Clin Invest 39:1157-75.

30. Zhang, M., B. Fendler, B. Peercy, P. Goel, R. Bertram, A. Sherman and
L.Satin. 2008 In press Biophysical J.

31. Zhu, X., L. Orci, R. Carroll, C. Norrbom, M. Ravazolla and D. F. Steiner.
2002. Severe block in processing of proinsulin to insulin accompanied by
elevation of des-64,65 proinsulin intermediates in islets of mice lacking
prohormone convertase 1/3. Proc Natl Acd Sci U S A 99: 10299-10304.

Abstract (if available)

Abstract Insulin is secreted in rhythmic pulses, which disappear in type 2 diabetes. Curiously, secretion periodicity differs when comparing single cells, single islets, versus whole pancreas. To test whether the different periods arise due to specific regulatory mechanisms found only at specific levels of tissue organization, it is desirable to compare secretion periods at all tissue levels with the same assay. We have designed a fluorescent vesicle reporter that is a fusion protein consisting of synaptobrevin (a vesicle SNARE) and pHluorin (a highly pH-sensitive variant of green fluorescent protein), separated by an intervening proprotein convertase 1/3 cleavage site. We demonstrate that when expressed in single AtT20 cells, it is cleaved and pHluorin is released into the supernatant. Because pHluorin is released and does not stay in the membrane after exocytosis, this reporter gives a strong signal with low background and can be used to dissect the mechanisms underlying pulsatile insulin release.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Construction of plasmids for constitutive and induced expression of secreted alkaline phosphatase in mammalian ovarian carcinoma cells

PDF

Stem cell and gene transfer-based approaches to generate insulin-producing cells

PDF

Structural studies of the IAPP membrane-mediated aggregation pathway

PDF

The folding, misfolding and refolding of membrane proteins and the design of a phosphatidylserine-specific membrane sensor

PDF

Pten deletion in adult pancreatic beta-cells induces cell proliferation and G1/S cell cycle progression

PDF

The response of Allograft inflammatory factor-1 to neurotoxic injury, and its role as a secreted protein

PDF

Characterization of the STARS (STochastic gene Activation with Regulated Sparseness) mouse line

PDF

Studies on the role of a novel protein, TMEM 56 in tumorigenic growth for MCF-7 cells

PDF

Variation in CRY2 and MTNR1B have independent effects on insulin secretion in Mexican Americans

PDF

The expression of human carboxylesterases in normal tissues and cancer cell-lines

PDF

Enhanced Burkitt 's lymphoma cell killing by the combination treatments of bortezomib with celecoxib and 2,5-dimethyl-celecoxib (DMC)

PDF

Studies of murine prostate cancer stem / progenitor cells

PDF

A novel role for hypoxia-inducible factor-1alpha (HIF-1alpha) in the regulation of inflammatory chemokines and leukotriene expression in sickle cell disease

PDF

Quantitative evaluation of the effectiveness of an integrin antagonist, vicrostatin, in cell migration

PDF

Generation and characterization of anti-CD138 chimeric antigen receptor T (CAR-T) cells for the treatment of hematologic malignancies

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

PDF

Ectopic fat and adipose tissue inflammation in overweight and obese African Americans and Hispanics

Asset Metadata

Creator Shanmuganathan, Vivekanandan (author)

Core Title A novel construct to study the pulsatility of insulin secretion in single cells, islets and whole pancreas

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2008-12

Publication Date 12/05/2008

Defense Date 09/11/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag beta cells,diabetes,exocytosis,islets,OAI-PMH Harvest,SNARE-complex,SynaptopHluorin

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Tokes, Zoltan A. (committee chair), Chan, Jonah R. (committee member), Chow, Robert HP. (committee member), Langen, Ralf (committee member)

Creator Email shanmuga@usc.edu,vivekanandan85@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1880

Unique identifier UC1438272

Identifier etd-Shanmuganathan-2557 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-129059 (legacy record id),usctheses-m1880 (legacy record id)

Legacy Identifier etd-Shanmuganathan-2557.pdf

Dmrecord 129059

Document Type Thesis

Rights Shanmuganathan, Vivekanandan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu