University of Southern California Dissertations and Theses

Investigating the role of SASH1 gene located on chromosome 6 in ovarian cancer

(USC Thesis Other)

Investigating the role of SASH1 gene located on chromosome 6 in ovarian cancer

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content INVESTIGATING THE ROLE OF SASH1 GENE LOCATED
ON CHROMOSOME 6 IN OVARIAN CANCER

by

Smita Subramanian

A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR BIOLOGY)

August 2008

Copyright 2008 Smita Subramanian

ii
DEDICATION

Dedicated to my loving parents,
adorable sister & my dear husband
for their endless love & support.

iii
ACKNOWLEDGEMENTS

It gives me immense pleasure to submit my dissertation work on ‘Investigating the role of
SASH1 gene located on chromosome 6 in ovarian cancer’.
At the outset, I acknowledge with deepest gratitude, the valuable guidance and endless
support rendered by Dr. Louis Dubeau, my advisor. I am thankful to him for letting me
be a part of his lab and for his valuable guidance.
I would like to express my heartfelt thanks to Dr. Zoltan Tokes, from my department,
for providing an opportunity to undertake this dissertation and for his constant
encouragement.
I place on record my sincere and heartfelt thanks to Dr. Ite Laird, for being a part of my
thesis committee and all her motivating words.
I am very much thankful to all the kind members of Dr. Dubeau’s Lab – Vanessa Yu,
Jennifer Yeh, Hao Hong, Ying Liu, Rajas Chodankar and George Kohan for their
friendship and support. My sincere thanks goes out to Vanessa Yu and Jennifer Yeh for
all their valuable suggestions and their patience in responding to and clarifying my never-
ending queries. It was indeed a pleasant experience working and interacting with
everyone in the lab, and learning techniques I was totally inexperienced in.
I thank Anne Rice, Program Manager of Biochemistry, for her continuous involvement in
two years of my graduate study.
I am grateful to everyone including my roommates, Sushmita & Preeti and all my friends
at USC who helped me throughout the dissertation in many different ways.
iv
I would like to make a special reference about the Regulatory Science Program at USC,
and wish to thank the entire team for always being extremely supportive throughout my
Lab research and also for ably assisting me with the technical support in the preparation
of this document.
I would like to express my deepest thanks to my husband, Vivek Dharne, for constantly
motivating me till my project completion and being my family here away from home.
Last but not the least, I thank my loving parents and my sister, who are my support
system & were helpful throughout my Masters and all academic endeavors. It is to them I
dedicate this work.
Above all, I am thankful to God who gave me the strength to successfully complete the
project work, overcoming the various obstacles.

v
TABLE OF CONTENTS

Dedication...……………………………………………………………………….ii
Acknowledgements……………………………………………….........................iii
List of Tables……………………………………………………….......................vi
List of Figures……………………………………………………………….........vii
Abstract……………………………………………………………………..........viii
Chapter 1: Introduction……………………………………………….....................1
1.1 Ovarian Cancer Genetics……………………………………….........................2
1.2 Chromosome 6q and Ovarian Cancer………….…………………………….….....8
1.3 Candidate region: 6q24-25………………………………………….................13
1.4 SASH1……………………………………………….....................................15
Chapter 2: Role of SASH1 in ovarian carcinogenesis………………....................21
2.1 Introduction: Our approach………………........................................................21
2.2 Materials & Methods……………….................................................................22
2.3 Results & Discussion……………….................................................................26
Chapter 3: Future Directions……………………………………….......................37
Bibliography…………………………………………………….………………..40

vi
LIST OF TABLES

Table 1: Fine allelic deletion mapping studies of the transferred 14
chromosome 6 in tumorigenic revertants

Table 2: Ct values from real-time PCR comparing SASH1 expression 26
in ovarian cancer cell lines

Table 3: Decrease in cell proliferation by SASH1 siRNA 28

Table 4: Differences in doubling time between SASH1 siRNA
and GFP siRNA cells. 30

Table 5: Difference in % of apoptotic cells in the sub GI region between two 30
populations

Table 6: Cell cycle phase distribution of HEY cells after siRNA transfection 32

vii
LIST OF FIGURES

Figure 1: Knudson’s two-hit hypothesis revised 7

Figure 2: Banding pattern on Chromosome 6 10

Figure 3: Location of SASH1 on long arm of chromosome 6 17

Figure 4: Genomic organization of SASH1 17

Figure 5a: Sequence showing exon 1 along with translation start site 18

Figure 5b: Protein sequence highlighting the PEPE domain 18

Figure 6: Efficiency of siRNA knockdown 48 hours post transfection 27

Figure 7: Growth curve of HEY cells after SASH1 siRNA transfection 29

Figure 8: SASH1 gene silencing increases apoptosis in HEY cells. 31

Figure 9: Differential expression of Caspase 3 between SASH1 siRNA
and GFP siRNA treated cells. 33

viii
ABSTRACT

It is known that there is a strong interplay of various oncogenes and tumor suppressor
genes underlying the mechanism of cancer formation and identifying these can be
instrumental in devising therapeutics approaches. Ovarian cancer being one of the least
understood cancers is also a leading cause of death among women and thus requires a
deeper insight into its molecular mechanisms. It has been previously reported that there is
loss of a chromosomal segment on Chromosome 6 observed in many cancers including
ovarian cancer, giving rise to a strong belief that this region possibly harbors one or more
crucial tumor suppressor genes. One such candidate gene found to be implicated in breast
and colon cancer is SASH1 and the region found to be the hotspot is between 6q24-25.
SASH1, located at 6q24.3, has no known function yet but its role is suggested in
signaling pathways. In our study, we attempted to elucidate the role of this gene in
ovarian cancer. We created an expression vector for this gene earlier thus over expressing
it and also exploited the RNAi technology to knock down the expression of this gene and
observe its effect on growth rate, cell cycle and apoptosis, by using real-time PCR,
growth curve analysis, propidium iodide staining, western blot methods and apoptosis
assays. Contrary to the belief that this gene is a candidate tumor suppressor gene in other
cancers, our data suggested that reduced SASH1 expression resulted in decreased growth
rates and evident apoptosis. By further analysis of its mechanism of action and in-vivo
studies, we should be able to propose that this gene plays a definite role in the
progression of human ovarian cancer and should be further explored as a possible
therapeutic target of ovarian cancer.
1
CHAPTER I – INTRODUCTION

Statistics from American Cancer Society have revealed ovarian cancer as not only the
eighth most common cancer, with an estimated 21,650 new cases in 2008, but also the
fifth most deadly, with an estimated 15,520 deaths in 2008 (49). The major concern in
timely diagnosis and effective treatment for ovarian cancer is that it tends to be highly
asymptomatic and the symptoms known till date are easily masked as general complaints
experienced by women. If diagnosed and treated at an early stage of the disease, 93% of
ovarian cancer patients survive 5 years or longer. However, unfortunately, 81% of cases
are diagnosed at a late stage of the disease. (50).
Ovarian cancer today being a leading cause of death among all gynecological cancers
requires a deeper understanding of all the molecular mechanisms and targets involved in
its formation for development of timely detection and effective therapies. There are many
risk factors found to be associated with ovarian cancer from various epidemiological
studies viz. ovulation, germ cell depletion, hormone replacement therapy, cytokines,
reproductive factors such as late menopause and infertility, lifestyle factors such as
cigarette smoking, obesity, and diet & environmental agents such as talc, pesticides etc.
(31). Of these, reproductive factors are most commonly implicated in the etiology of the
disease. Reproductive and hormonal history of a woman can clearly modulate the risk of
ovarian cancer. Continuous ovulation as in nulliparity increases the likelihood of ovarian
malignancy while conditions that suspend ovulation, such as pregnancy, lactation and
oral contraceptive use are protective (4). It is believed that various genetic alterations
2
may act in concert with the hormonal or environmental factors to potentiate the risk of
ovarian cancer (4).
However, given that these studies are limited and needs further review, there needs to be
a greater emphasis on the possible genetic contribution to tackle this silent killer at an
individual & population level and to make early detection a possibility.

1.1 OVARIAN CANCER GENETICS
A wide range of proteins are involved in regulation of cell growth and these are encoded
by mRNA, which in turn is encoded by DNA within the genome. When the coding DNA
is subject to any defect or damage, the resulting proteins which are responsible for an
array of cellular functions are also affected and such proteins, if functioning in cell cycle
regulation, can lead to unchecked growth and hence induce a tumorigenic state.
We know that cancer is a genetic disease, caused by a myriad of mutations and gene
alterations. Genes through their protein products control most of cell’s functions
including growth, division and death and this control is lost or disturbed as a result of
various mutations. All human cancers display a multitude of genetic and epigenetic
changes, and a number of such alterations are required for the step-wise model of tumor
progression. Five different types of genetic alterations characteristic of tumor populations
that can accumulate during tumor progression leading to malignancy can be listed as
subtle alterations such as point mutations, chromosome number changes such as loss of
heterozygosity, chromosomal translocations, amplifications and introduction of
exogenous sequences. The transformation of a normal cell, such as an ovarian epithelial
cell, to a malignant tumor cell is considered a multistep process that proceeds through an
3
accumulation of mutations in certain genes over the course of many years (50) and thus
causing the tumor to grow uncontrollably and evade apoptosis. However, the exact
number of gene alterations and the identity of all genes involved in most cancers still
remain unknown. Though the possibility of every mutation to cause such negative
consequences are minimized owing to the fidelity of the DNA repair machinery, each
mutation in genes subsequently increases probability of following mutations and once a
certain number has accumulated, transformation occurs (20). Also of importance are the
two characteristics of cancer as proposed by Fearon and Vogelstein, that cancer results
from a combination of activation of oncogenes and deactivation of tumor suppressor
genes and secondly, it is the number of mutations that contributes to tumorigenesis,
regardless of the specific order of their occurrence (17).
It is now well established that molecular genetic aberrations can alter the expression of
genes and may play a role in malignant transformation (24). The main problem
underlying a thorough understanding of its molecular basis is thus identification of the
various genes contributing to the cancerous phenotype. Along this direction, to date
various genes have been identified to be repeatedly altered in cancer, however, there are
still many more to be discovered and have been referred to as ‘cancer-critical genes’ (46).
Loss or mutation of one of these can subsequently increase the likelihood for future
mutations or losses in other genes. These critical genes have been categorized into two
known major groups on basis of their causative mutations and its result on gene activity.
Gain-of-function mutations resulting in increased gene activity drives one set of genes
called proto-oncogenes while second set of genes are tumor suppressor genes, subject to
loss-of-function mutations leading to very little gene product. In both cases, these
4
mutations lead to enhanced proliferation and increased survival which are hallmarks of
cancer. Also worth mentioning among these critical genes are genes involved in DNA
repair, loss of which can cause genomic instability.

Tumor Suppressor Genes (TSG)
Tumor suppressors act recessive at the phenotypic level i.e. both alleles must be lost for
cancer to develop. This concept emerged from Knudson’s two-hit hypothesis, which also
helps understand the important concept of Loss of heterozygosity (LOH).
LOH - Knudson’s two-hit hypothesis for tumorigenesis involving a tumor suppressor
gene can be explained as in normal individuals having two normal copies of the TSG,
two independent ‘hits’ (mutations) are required in the same cell to initiate cancer (23).
However, in individuals with a germline mutation of the TSG already have a first ‘hit’ in
every cell and require only one subsequent ‘hit’ in a cell to initiate a cancer (23). It is
now established that ‘hit’ refers to inactivation of each of the copies of a TSG.
The concept is extensively applied in the context of oncogenesis. Changes in
chromosomal number in cancer cells are not just limited to aneuploidy but also include
LOH. Cancer cells though may appear to possess two normal copies of a chromosome,
may have inherited both chromosomes from the same parent and thus lacking the
chromosome from the other parent. This condition in such tumor cells is described as
LOH and is one of the hallmarks of TSG inactivation. For instance, if a cell containing
two copies of chromosome 6 undergoes a mutation of a TSG linked to cancer
susceptibility on one copy of chromosome 6, the other wild type allele of the gene on the
second copy of chromosome 6 will prevent the cell from losing control of cell growth and
5
thus inhibit abnormal proliferation. These individuals are predisposed to cancer because
all their cells have already sustained the first hit to cancer-linked genes. However, if the
wild type allele is lost at some time during an individual's life, the cell will be left with
only the mutant copy of the TSG which will thus lose its function and therein confer a
growth advantage to the cell. LOH at specific chromosomal regions is frequently
observed in many cancers. LOH may occur mainly through mitotic recombination or loss
of entire chromosomes. They provide means of identifying chromosomal regions bearing
putative TSGs using polymorphic markers (see 1.2). If LOH corresponds to loss of one
allele of a given marker, ‘homozygous deletions’ refer to loss of both the copies. Thus,
allele loss is a term associated with LOH and is the basis for many LOH and karyotyping
studies.
There are a few tumor suppressor genes which are exceptions to the 'two-hit' rule and are
said to exhibit haploinsufficiency, in which mutation of single allele causes cancer
susceptibility (18). Functions of all known TSGs to date are either a repressive effect on
cell cycle regulation or promoting apoptosis. Examples are p53, pRb, PTEN and APC.

Oncogenes
Oncogenes act in a dominant manner wherein alteration in a single allele is sufficient to
allow cancer to develop. A proto-oncogene is a normal gene that due to mutations can
become an oncogene with increased expression or altered function. In normal cells,
proto-oncogenes code for proteins that function in regulation of cell growth, cell cycle
and signal transduction (38). Upon activation in the form of changes in protein structure
due to point mutations, increase in protein concentration resulting from gene
amplifications or chromosomal translocations, a proto-oncogene becomes an oncogene,
6
which can induce tumors (38). Examples of proto-oncogenes include transcription
factors, growth factors or signal transduction genes etc. such as RAS, WNT, MYC and
ERK (38).

Epigenetics
With growing emphasis on the potential of epigenetics, it has now become important to
understand contribution of epigenetic mechanisms in cancer formation and thus
Knudson’s two-hit hypothesis was expanded to include epigenetic mechanisms of gene
inactivation (22). DNA methylation is a powerful mechanism for the suppression of gene
activity by their action as transcriptional repressors and interference with transcription
initiation. It is likely to be limited to the subset containing the CpG sequence in their
binding site, and yet affect a wide diversity of promoter sequences (22). Besides,
intragenic mutations and LOH, abnormal methylation of CpG islands in the promoters of
TSGs causing transcriptional silencing can also be implicated in carcinogenesis and thus
included in Knudson’s two-hit requirement for TSG inactivation, as highlighted in
Figure 1 (22) . It thus provides an additional means of characterization of critical regions.
Examples of TSGs silenced through this mechanism are APC, Rb, CDK2N (22).

7
Figure 1: Knudson’s two-hit hypothesis revised.

Fig. 1 - Two active alleles of a TSG are indicated by the two green boxes shown. The first step of
gene inactivation is shown as a localized mutation on the left or by transcriptional repression by
DNA methylation on the right. The second hit is shown by either LOH or transcriptional
silencing. (Taken from Jones PA, Laird PW., Nature Genetics, 1999)

Genetic predisposition to ovarian cancer can be categorized as being Monogenic i.e. due
to alteration in a single gene or polygenic wherein multiple genes in combination cause
the effects. Monogenic risk is usually hereditary while polygenic tend to be familial.
Most ovarian cancers (90%) are sporadic wherein damage to the genes occurs after birth
and in 10% cases they are inherited from parents (50). In each of these situations, these
mutations could have a direct effect on some of the known identified genes or unknown
potential genes, which may be tumor suppressors or oncogenes and thus, leading to
suppression of tumorigenesis or activation of oncogenesis, respectively. Some genes well
known to be associated with ovarian cancer as targets of such damage are BRCA1 and
BRCA2 (35). In recent past, cell cycle genes have been found to play a role in ovarian
8
tumorigenesis viz. cyclin D1, p16, cyclin B (12). Epidemiologic evidence strongly
suggests that steroid hormones such as estrogens and progesterone are involved in
ovarian carcinogenesis, though their mechanism of action is not fully understood (12). It
will be interesting to answer the question if these cell cycle-regulatory genes and other
cancer-critical genes are controlled by these hormones in ovarian cancer? (12).
Ovarian cancer research being carried out globally is focused on identifying all the key
players in the various mechanisms and pathways that via loss or gain of their function
and regulation, contribute to cancer formation.

1.2 CHROMOSOME 6q & OVARIAN CANCER
Characterization of chromosomal regions bearing genetic alterations
Identification of genetic changes including additions and deletions on different
chromosomes are integral in determining cancer progression and eventually therapeutic
outcomes. Chromosome analysis of malignant cells provides us with a wealth of
information about the genetic and molecular basis of cancer. A major emphasis in cancer
research lies on losses and deletions which are a common occurrence in cancer.
The first step in identifying regions of the genome involved in cancer progression is often
through cytogenetic analysis. Once these large regions are identified, the next step is to
find narrower regions of loss, characteristic of the same cancer. Deletion mapping can be
performed with a variety of experimental

techniques viz. using polymorphic markers and
microsatellite markers (3). While cytogenetic studies help detect chromosomal losses and
large deletions or translocations, LOH analysis along chromosomal arms, using genetic
9
markers, is commonly used to detect the same anomalies at a molecular level as well as
highlight small regions that may harbor potential genes.
A polymorphic marker is a short sequence of DNA

located in a precisely defined
genomic region that allows the paternal allele to be distinguished from the maternal
allele. This DNA is then tested

for the presence of both alleles in the tumor specimen. If

the tumor shows LOH by lacking one of the alleles, it is inferred that some form of loss
has taken place in

the specific region, thereby suggesting the presence of a TSG (3).

Microsatellite markers consist of short repeat units containing 1-5 nucleotides and are
present in abundance throughout the genome and are subject to high mutation rates (48).
In LOH analysis, we can compare normal blood DNA with tumor DNA using a set of
microsatellite markers and from which the loss of one copy as in LOH or both copies as
in homozygous deletions, can be visualized on an analytical gel. Genes contained within
the narrow region can then be selected for investigation. Analysis of frequencies of LOH
in such candidate regions can also be of clinical significance by correlating LOH data
with different tumor stages as well as survival times.
Understanding chromosomal banding patterns
To see chromosomes by microscopy, they are normally treated with chemical dyes, such
as Giemsa, following which the chromosome will appear as a series of alternate dark and
light bands, known as G-positive band and G-negative band respectively. The basic
terminology for these banded chromosomes was decided at a meeting in Paris in 1971,
and is often referred to as the Paris nomenclature (47). Short arm locations are labeled p
(petit) and long arms q (queue). Each chromosome arm is divided into regions labeled p1,
p2, p3 etc., and q1, q2, q3, etc., counting outwards from the centromere. Regions are
10
delimited by specific landmarks, which are consistent and distinct morphological
features, such as the ends of the chromosome arms, the centromere and certain bands.
Regions are divided into bands labeled p11 (one-one), p12, p13, etc., sub-bands labeled
p11.1, p11.2, etc., and sub-sub-bands e.g. p11.21, p11.22, etc., in each case counting
outwards from the centromere and visible only at higher resolution (47). This banding
pattern is used to describe location of genes on each chromosome. (Figure 2)
Figure 2: Banding Pattern of Chromosome 6

Fig. 2 - (Taken from Genetics Home reference, National Library of Medicine)
Molecular studies
We know that there is a strong interplay of various oncogenes and tumor suppressor
genes underlying the mechanism of cancer formation which if definitively identified and
whose mode of action if clearly defined can help greatly in devising therapeutic
approaches against ovarian cancer.
Tumor-specific allele loss has been shown to be an important characteristic of some
tumors (19). Various studies involving allelic loss and karyotypic analysis of many
tumors including those of the ovary and breast have indicated the presence of potential
genes on different chromosomes like 6, 11, 13 and 17. There have been ongoing efforts to
probe further into the genetic epidemiology of cancers through various approaches like
linkage analysis and candidate gene approach.
11
Various critical genes either have been or are being studied on basis of different
chromosomal abnormalities and possess varied implications in different cancers. For
example, WWOX on chromosome 16q has been found to be a TSG associated with a
number of cancers (21) while Rab25 on chromosome 1q22 seems to function as
oncogene (16).
It has been observed from literature that a prime focus has remained on the chromosome
arm 6q and its prospective involvement in various cancers, not to mention gynecological
cancers like that of ovaries & breast. It seems that greater than 50% of high-grade ovarian
carcinomas have LOH on chromosome 6q (7). The relatively high incidence of allelic
losses observed on chromosome 6q represents the first implication by molecular genetic
analysis of this chromosomal region in a human malignancy (24).
Ovarian cancer
Relatively, little is known about the molecular events in ovarian tumorigenesis. Besides
frequent amplification of certain oncogenes such as c-myc and K-ras, karyotypic analyses
have demonstrated a number of recurrent chromosomal abnormalities which may affect
genes important for the control of ovarian carcinogenesis (15).
Deletions and translocations involving different portions of chromosome 6q were
subsequently reported by cytogenetic analyses of primary ovarian carcinomas and
ovarian cancer cell lines (6),(13),(36). Distinct regions of chromosome 6 were found to
be targeted by frequent losses of heterozygosity in primary ovarian tumors in several
allelic deletion mapping studies (10), (41), (8), (15), (24).
In 1989, there was a study from Dr. Dubeau’s lab that first highlighted the occurrence of
genetic losses involving chromosomal segments 3p, 6q and 11p in ovarian carcinomas
12
through recombinant technologies, thus suggesting a role of genes on these chromosomes
in cancer development (15). Later on cytogenetic analysis revealed that 6q deletion was
the indeed most frequent chromosomal abnormality (36) and several allelic mapping
studies were performed with an aim to clarify its importance and determine if specific
molecular changes are associated with specific stages of tumor progression. In their
allelotyping study by Cliby et al. in 1993, they showed using polymorphic markers that
two regions on chromosome 6, one towards distal 6q and other near the centromere, are
significant in ovarian carcinogenesis. As mentioned earlier, a common approach followed
by most of the allelotyping studies is LOH analysis in ovarian carcinoma DNA using pre-
defined microsatellite markers and analyzing tumors for common deletions.
It thus now clearly appears that chromosome 6q harbors a critical region which upon loss
of heterozygosity allows malignant tumor formation thus strongly suggesting that this
region possibly contains at least one or more tumor suppressor genes (41) and most likely
other important genes whose roles have been implicated in the control of ovarian tumor
development.
In the recent past, studies exploring this susceptibility locus on chromosome 6 have
shown using microsatellite markers that there are multiple regions of frequent allelic loss
on Chromosome 6 at 6q13, 6q23-q25 and 6q27 (5). Abnormalities in the 6q24-27 region
were the earliest observations to be reported as important in carcinogenesis especially
ovarian carcinomas (30).
Chromosome 6 has been previously shown to suppress tumorigenicity in melanoma cells
(39) as well as tumorigenicity in breast carcinoma cells (28) suggesting its role in tumor
suppression is not restricted to tumors of ovarian origin, but may be important for a large
13
variety of different cancer types. Indeed, deletions or LOH affecting chromosome 6 were
reported in cancers from a large number of different organs including carcinomas of the
breast (32), endometrium (37), and prostate (11) as well as in small cell lung carcinomas
(27), lymphomas and leukemias (26), and melanomas (40). A few genes in this region on
Chromosome 6 being investigated today with respect to various solid tumors are LOT1
(1), ZAC on 6q25 (5), p34 on 6q25.1 (42), SASH1 on 6q24.3 (44) and HACE1 on 6q21
(45).
In regards to understanding ovarian cancer, effort to isolate a tumor suppressor gene on
chromosome 6q and to realize the chromosomal involvement will require definition of a
small region that is commonly deleted in ovarian tumors (30).

1.3 CANDIDATE REGION 6q24-q25

Deletions of part of chromosome 6q observed in cytogenetic studies of ovarian carcinoma
(15), prompted us to investigate the long arm of chromosome 6 at the molecular level.
With an aim to further characterize the critical region on chromosome 6q, Dubeau lab
carried out a study wherein they used microcell-mediated chromosome transfer (MMCT)
techniques to demonstrate that introduction of an intact chromosome 6 into ovarian
carcinoma cell lines resulted in loss of tumorigenicity, loss of anchorage independence
and decreased growth rates in the resulting hybrids (41). Upon isolation of the subclones
of hybrids that reverted back to the tumorigenic phenotype, we demonstrated presence of
deletions in the long arm of chromosome 6 in all revertants (41). The smallest deletions
were bound by D6S1637 and D6S1564, involving the marker D6S311 locus (41),
strongly suggesting that the tumorigenic phenotype was controlled by one or more genes
14
encoded within this genomic segment mapping to chromosome bands 6q24-q25 (Table
1). Thus, by characterizing the region of frequent deletion it was observed that in the
6q24-25 region, a 2cM fragment possibly controls tumorigenicity in human ovarian
cancer cell lines (41). Loss of this chromosomal region has also been detected in breast
(44) and colorectal tumors (29).
Table 1: Fine allelic deletion mapping studies of the transferred chromosome 6 in
tumorigenic revertants

Table 1 – Hybrids refer to the HEY cells hybridized with exogenous chromosome 6 and revertant
clones are hybrid cells that reverted back to tumorigenicity. (Taken from Wan et al., Oncogene
(1999) 18, 1545 – 1551)

In addition to our study, there are many studies involving transfer of chromosome 6 into
cancer cell lines and all of which observed loss of tumorigenicity. The physical mapping
of this region between D6S1637 and D6S1564 should allow eventual identification of
15
cancer-critical genes. The ultimate goal of our study and that of many others was to
determine if any genes present in this segment could function as tumor suppressors or
prove significant in the mechanism of ovarian cancer formation.
Some of the genes located in this region 6q24-25 have been studied extensively for their
role as tumor suppressors in various cancer types, namely LOT1 (PLAG1) (2), ZAC1 (5),
p34 (42) and SASH1 (44).

1.4 SASH1
Identification of critical genes important in any cancer type can be based on either their
function or their genetic location. From literature, it can be summarized that analysis and
characterization of crucial genes can be studied by either a molecular or a functional
approach. Molecular approach involves use of cytogenetic, LOH and mutational analysis
to identify losses of genes. The functional approach however, involves reintroduction of a
normal copy of the candidate gene into cancer cell lines via microcell-mediated
chromosome transfer (MMCT) technique and also in vitro knockdown methods, to look
for consequences on biological processes such as cell growth, cell survival, signal
transduction etc. Gene silencing methods mainly include RNA interference strategies viz.
antisense technology and siRNA technology.
It was suggested in previous studies that the chromosomal segment bounded by loci
D6S1637 and D6S1564 possibly harbors a tumor suppressor gene important for control
of ovarian cancer. Therefore, the next step was probing into the genes present within this
locus and identification and initial characterization of the relevant genes encoded within
this genomic segment. The results would hopefully be of therapeutic significance in the
16
future and aid in a deeper understanding of ovarian cancer. In pursuit of this, previous
graduate students in the lab undertook several experiments to study the candidate region
for deletions or other chromosomal abnormalities using ovarian carcinoma cell lines and
also the ovarian carcinoma:chromosome 6 microcell hybrids from the earlier MMCT
study in Dubeau’s lab.
From those experiments, a gene was found to be frequently altered in ovarian cancer cell
line and it was called SASH1. Literature highlighted that this gene is identified as a
candidate tumor suppressor gene in breast cancer (44) and colon cancer (29). Thus, it was
encouraging to investigate if this gene is the potential TSG on chromosome 6q.
What is known about SASH1?
A lot known about SASH1 is summarized in the NCBI website. SASH1 is a member of
the “SH3-domain containing expressed in lymphocytes” (SLY1) gene family that
encodes signal adapter proteins composed of several protein-protein interaction domains.
Structurally it contains 2 sterile alpha motifs (SAM) and one Src Homology 3 domain
(SH3) which often functions as an adaptor or scaffold in signal transduction and hence
was named SASH1. The role of the gene may be implicated in signal cascades as an
adapter protein. The exact function of SASH1 is unknown, yet it shows partial homology
to proteins from several species and also shows ubiquitous expression (44). This gene
SASH1 maps to chromosome 6, at 6q24.3 according to Entrez Gene (Figure 3), spanning
nearly 250kb and encoded on the plus strand.

17
Figure 3: Location of SASH1 on long arm of chromosome 6

(Taken from Genecards - http://www.genecards.org/cgi bin/carddisp.pl?gene=SASH1)
The gene encompasses loci D6S311 and D6S1637 and composed of 20 exons, encoding a
protein with a molecular weight of 136653 Da. The gene also harbors the marker D6S311
(Figure 4).
Figure 4: Genomic organization of SASH1

(Taken from Zeller et al., Oncogene. 2003; 22(19):2972-83)

Exon 1 contains the translation start site and the stop codon is located in exon 20.
Its mRNA length is 7709 bp (NM_015278) and has a 3741 bp reading frame that encodes
a protein composed of 1247 amino acids (NP_056093) (Figure 5). Of significance is the
presence of a CG-rich region that overlaps with the translation start site and also many
CG dinucleotides in the coding sequence. The deduced amino acid sequences for human
SASH1 (GenBank NP_056093) shows a polymorphic proline-glutamate repeat (PEPE
domain), which is also known to be observed in many other genes and specific function
of which is not known yet (44).
18
Figure 5a: SASH1 sequence showing Exon 1 along with translation start site.

ATTTTGAAGAGAGGGGTCCCGGGGAGCTCCCTCCAAGATCTAGAGGCTCCGCGGCCAC
CCCTGCCGGGTCCTGCCAAGACTTGCTAGAAGGAACGAGTCGCGTGCCTTAGTTAGTTG
GTTCCCGTCACAGGAAGAAACGCCTTTGCAGTGGGTTTAATTGCTTCTGGGCCGAGCGA
ATTCCCCGCCGTACAACTCAGTGGTGCGGACTTTGCCTCCTGCTACCCTGTTGCTGCGC
CGAGCGGGGTGGGAAAGTTTCTGGAGTTGTCAGTCGCGCAGCCCGTGGCCACCTAGAC
CCGAGGTGCGGGCGCCTGCGAAGGGCCCCCGCGGGGTGGCCGGGGCCGCCGGGGCA
TGCAGCGCGGGGGCGCGGCTCGGTGACGCCGCGGGCGGGGACCCGGCATCCGGGCA
GGC TGCGCGCGGGTGCGGGGCGAGGGCGCCGCGGGGACTGGGACGCACGGCCCGCG
CGCGGGACACGGCC ATG GAG GAC GCG GGA GCA GCT GGC CCG GGG CCG GAG
CCT GAG CCC GAG CCC GAG CCG GAG CCC GAG CCC GCG CCG GAG CCG GAA CCG
GAG CCC AAG CCG GGT GCT GGC ACA TCC GAG GCG TTC TCC CGA CTC TGG ACC
GAC GTG ATG GGT ATC CTG
Fig. 5a – In boxes are the CpG dinucleotides in promoter region and highlighted in blue is the
proline-glutamate repeat sequence CCCGAG. Red arrow marks the translation start site at ATG.

Figure 5b: Protein sequence highlighting the PEPE domain.
MEDAGAAGPG PEPEPEPEPE PEPAPEPEPE PKPGAGTSEA FSRLWTDVMG ILDGSLGNID
DLAQQYADYY NTCFSDVCER MEELRKRRVS QDLEVEKPDA SPTSLQLRSQ IEESLGFCSA
VSTPEVERKN PLHKSNSEDS SVGKGDWKKK NKYFWQNFRK NQKGIMRQTS KGEDVGYVAS
EITMSDEERI QLMMMVKEKM ITIEEALARL KEYEAQHRQS AALDPADWPD GSYPTFDGSS
NCNSREQSDD ETEESVKFKR LHKLVNSTRR VRKKLIRVEE MKKPSTEGGE EHVFENSPVL
DERSALYSGV HKKPLFFDGS PEKPPEDDSD SLTTSPSSSS LDTWGAGRKL VKTFSKGESR
GLIKPPKKMG TFFSYPEEEK AQKVSRSLTE GEMKKGLGSL SHGRTCSFGG FDLTNRSLHV
GSNNSDPMGK EGDFVYKEVI KSPTASRISL GKKVKSVKET MRKRMSKKYS SSVSEQDSGL
DGMPGSPPPS QPDPEHLDKP KLKAGGSVES LRSSLSGQSS MSGQTVSTTD SSTSNRESVK
SEDGDDEEPP YRGPFCGRAR VHTDFTPSPY DTDSLKLKKG DIIDIISKPP MGTWMGLLNN
KVGTFKFIYV DVLSEDEEKP KRPTRRRRKG RPPQPKSVED LLDRINLKEH MPTFLFNGYE
DLDTFKLLEE EDLDELNIRD PEHRAVLLTA VELLQEYDSN SDQSGSQEKL LVDSQGLSGC
SPRDSGCYES SENLENGKTR KASLLSAKSS TEPSLKSFSR NQLGNYPTLP LMKSGDALKQ
GQEEGRLGGG LAPDTSKSCD PPGVTGLNKN RRSLPVSICR SCETLEGPQT VDTWPRSHSL
DDLQVEPGAE QDVPTEVTEP PPQIVPEVPQ KTTASSTKAQ PLEQDSAVDN ALLLTQSKRF
SEPQKLTTKK LEGSIAASGR GLSPPQCLPR NYDAQPPGAK HGLARTPLEG HRKGHEFEGT
HHPLGTKEGV DAEQRMQPKI PSQPPPVPAK KSRERLANGL HPVPMGPSGA LPSPDAPCLP
VKRGSPASPT SPSDCPPALA PRPLSGQAPG SPPSTRPPPW LSELPENTSL QEHGVKLGPA
LTRKVSCARG VDLETLTENK LHAEGIDLTE EPYSDKHGRC GIPEALVQRY AEDLDQPERD
VAANMDQIRV KQLRKQHRMA IPSGGLTEIC RKPVSPGCIS SVSDWLISIG LPMYAGTLST
AGFSTLSQVP SLSHTCLQEA GITEERHIRK LLSAARLFKL PPGPEAM

19
The findings from previous graduate student’s work towards characterization of SASH1
were also very informative. Mutational analyses of the coding region of the gene revealed
no inactivating mutations in the gene’s coding sequence and three single nucleotide
polymorphisms of no known functional significance. The LOH analysis of the genomic
region using PEPE polymorphism showed LOH and homozygous deletions in various
tumors. He over-expressed SASH1 in HEY cell line by construction of an expression
vector for SASH1 and observed decreased growth rates, reduced ability to form colonies
in semi-solid media and absence of tumor formation in nude mice. These results
altogether presented SASH1 as a strong candidate TSG on chromosome 6q with
unknown mechanisms underlying the gene’s function.
Zeller et al. in their study also sought out to investigate the sequence alterations in
SASH1 that could be responsible for its downregulation observed in breast tumors and
cell lines by mutation screening and did not observe any tumor-specific mutations within
the functional domain of the gene and thus raising the possibility of other mechanisms in
its downregulation. In the study by Rimkus et al. in 2006, there was a significant
correlation observed between SASH1 expression and metastasis occurrence compared to
early phases. It was inferred in the Zeller et al. study from their correlation studies
between LOH around microsatellite markers and clinicopathological parameters, that the
loss of D6S311 was significantly associated with short survival time and greater tumor
size (44). This suggested the possibility of a novel gene in the vicinity of this marker
contributing to progression of breast cancer (44).

20
Due to its unknown exact function along with a potential role in signal transduction and
its location within a region commonly deleted in ovarian carcinoma, SASH1 was an
interesting gene to analyze as a potential tumor suppressor gene on chromosomal region
6q24-25.

21
CHAPTER II – ROLE OF SASH1 IN OVARIAN CANCER

2.1 INTRODUCTION - OUR APPROACH
Continuing in the direction of establishing significance of chromosome 6q in ovarian
cancer research, I attempted to further outline the possible function of the gene SASH1 in
the cell and gather preliminary data to ascertain if this is a potential target in the very
poorly understood etiology of ovarian cancer. The question being addressed was ‘what is
the role of SASH1 in ovarian carcinogenesis?
In order to test the hypothesis that SASH1 is a candidate TSG in ovarian cancer, my
specific aim was to examine the consequences of reduced SASH1 expression on ovarian
carcinoma cell lines.
To determine if an ovarian carcinoma cell line with endogenous SASH1 expression
would be a suitable system to work with, I compared the relative gene expression among
various ovarian cancer cell lines.
With gaining advancement in RNA-mediated silencing methodologies, we adopted the
siRNA technology to check for consequences of SASH1 knockdown on growth rate and
look for possible role of the gene in the cell. We generated siRNA specific for SASH1
and employed siRNA against Green Fluorescent Protein (GFP) as a negative control to
treat HEY cells.
We compared growth rates between the differently treated cells and thus assess the
possibility of SASH1 to be a novel TSG in ovarian cancer. We also aimed to look for
involvement of our gene in the cell cycle or cell survival pathway to study its function by
exploiting cell cycle analysis and apoptotic detection assays.
22
2.2 MATERIALS & METHODS

Cell lines
The human ovarian cancer cell line HEY was obtained from Dr. Ronald Buick,
University of Toronto (Buick et al., 1985). HEY cells were used for all the siRNA
transfections and experiments. SASH1 expression in HEY cells was compared to other
ovarian cancer cell lines viz. OVCAR3, SKOV3, CAOV3 and HOC7, by using RT-PCR.

Tissue culture
HEY cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented
with 10% heat inactivated Fetal bovine serum (FBS) and 1% antibiotics – 100U/mL
penicillin & 100 μg/mL streptomycin, at 37
o
C in a humidified incubator with 5% CO
2
and
95% air. Once 100% confluent, dishes were split with 1:20 dilution.

siRNA oligonucleotides
The oligonucleotide sequence of SASH1 specific siRNA was designed according to the
human SASH1 sequence in GenBank (NM_015278.3). The start site of the siRNA
oligonucleotide sequence was at 851 bp stretching across 21 nucleotides and located
within exon 4.
Sense: 5'-GTG GAA AGA AAG AAC CCT CTT-3'
Antisense: 5'-GAG GGT TCT TTC TTT CCA CTT-3'
GFP specific siRNA was used as negative control (Ambion, Inc.) as it has no significant
homology to any known gene sequences from mouse, rat, or human.

23
Sense: 5'-CAA GCU GAC CCU GAA GUU CTT-3'
Antisense: 5'-GAA CUU CAG GGU CAG CUU GTT-3'
For transfection, cells were seeded in 35mm dishes at a concentration 5 x 10
4
cells/2mL
and allowed to grow until they reached 30-50% confluency. Lipofectamine 2000
(Invitrogen) was used as siRNA transfection reagent. Cells were harvested 48 and/or 72
hours after transfection, for following experiments.

Growth Curve Analysis
Untreated HEY cells were plated at a concentration of 5 x 10
4
/2mL per 35 mm dish and
maintained in DMEM medium with serum and antibiotics. Once dishes were 30-50%
confluent, they were transfected with siRNA at concentration of 100pm and maintained
in antibiotic-free medium. 48h and 72h later, cells were harvested and counted using
Beckman Coulter Counter in 1:50 dilution. Each value represented the average of
triplicate dishes.

RNA Extraction from cell lines and Quantitative Real-Time Polymerase chain
reaction (RT-PCR)
Total RNA was isolated using Trizol reagent (Invitrogen, USA), as per the protocol and
quantified before cDNA synthesis. cDNA preparation by reverse transcription was
performed using SuperScript® First-Strand Synthesis System for RT-PCR kit (Invitrogen
Life Technologies, USA). After incubation at 42
o
C for 80min, the reverse transcription
reaction was terminated by heating at 70
o
C for 15min.
The cDNA was used to amplify the gene and expression of SASH1 transcripts was
determined by real-time RT-PCR. Expression of the housekeeping gene RNase P was
24
used as the internal control. RNase P was commercially obtained from Applied
Biosystems. Amplification cycles were: 50
o
C for 2min, 95
o
C for 10min, 95
o
C for 15sec,
followed by 62
o
C for 1min, for 40 cycles. The primers were generated by USC DNA
Core facility.
SASH1-Forward: 5` CGA TGA GAA AGA GAA TGT CTA AAA AAT ACA 3`
SASH1-Reverse: 5` GAG CCA GGC ATT CCA TCA AG 3`
The probe was custom designed and generated by Applied Biosystems. Its sequence was
AGC AGG ACT CGG GC

Propidium Iodide Staining for apoptosis and cell cycle analysis
Flow cytometry analysis was used to determine apoptosis and cell cycle. HEY cells were
transfected with SASH1 siRNA and GFP siRNA as control. Post 48 hours, the floating
medium from the dishes was collected and the adhering cells were harvested. The pellet
was washed twice in ice-cold PBS and fixed in 200 μL PBS and 70% ice-cold ethanol.
Cells were then stained with Propidium Iodide (2.5mg/mL) and RNAse A (10mg/mL) for
flow cytometric analysis of apoptosis and cell cycle.
All of the samples were assayed three times, and the fraction of cell cycle distribution
was calculated.

Preparation of Protein lysates
48 h after transfection, cells from two 10cm dishes were washed with cold PBS and total
protein was extracted in 150 mmol/L NaCl, 25 mmol/L sodium phosphate, 1% Triton X-
100, 5 mmol/L EDTA, 50 mmol/L sodium fluoride, 200 mmol/L PMSF, 200 mmol/L
sodium vanadate, 10 mg/mL leupeptin, 10 mg/mL aprotinin, 1 mmol/L pepstatin A and
25
100 mmol/L phenylarsine oxide. Supernatent was collected and stored at -80
o
C. The
protein concentration was determined with a Bradford Assay (Biorad, Germany)

Western Blot Analysis against Caspase 3 (Apoptosis Assay)
Equal amounts (28 μg) of protein lysates were boiled in loading buffer for 5 minutes,
separated on 10% SDS-polyacrylamide gels and subjected to immunoblotting. The gel
was electroblotted onto a PVDF nylon membrane (Millipore, Bedford) at 40V for
overnight. Membranes were blocked in 0.05% Tween 20 (v/v) PBS containing 5% non-
fat dry milk for an hour at RT.
Antibody Staining: The primary antibody used was rabbit polyclonal anti-cleaved caspase
3 antibody (Cell Signaling technology, USA). The antiserum was used at 1:1000 dilution
in 5% non-fat dry milk on the immunoblots and incubated with the membrane overnight
on a shaker at 4
o
C. The secondary antibody was horseradish peroxidase-conjugated goat
anti-rabbit IgG (Santa Cruz Biotechnology) incubated with membrane at RT for 1 hour.
Membrane photo developing/Film exposure: After washing with 0.1% Tween-20 in PBS
for 10 minutes (3x), the membrane was prepared for developing using the
chemiluminescence substrate detection kit (ECL, Amersham) method. The membrane
was attached to the photo-developing cassette where the film was inserted (Kodak) and
developed.

26
2.3 RESULTS AND DISCUSSION

SASH1 expression in a panel of ovarian cancer cell lines:
The levels of SASH1 expression was determined by comparing the mRNA levels using
real-time PCR in a panel of ovarian cancer cell lines viz. HEY, SKOV3, CAOV3,
OVCAR and HOC7, to determine a suitable system to work with. However, as
interpreted from the ‘Comparative Threshold’ (Ct) values obtained from real-time PCR, it
was found that most of the cell lines had no expression of SASH1 except HEY which
showed relatively higher levels of gene expression (Table 2). The Ct value is the cycle
number that indicates the first significant increase in amount of PCR product, indicating
the threshold level is reached (25). Hence the Ct value correlates with the initial
abundance of the target template. We thus decided to use HEY cell line for all assays.
Table 2: Ct values from real-time PCR comparing SASH1 expression in ovarian
cancer cell lines

SKOV3 CAOV3 OVCAR HOC7 HEY
Ct 0.0020 0.0021 0.0004 0.0012 1

Table 2: Ct values were compared following real-time PCR to compare relative
expression of SASH1 in ovarian cancer cell lines. Values indicate lack of SASH1
expression in SKOV3, CAOV3, OVCAR and HOC7 as compared to HEY.

The next major approach was to achieve the silencing of SASH1 through use of siRNA
technology. Using the SASH1 sequence from GenBank (accession number
NM_015278.3) starting from base 851 stretching across 21 nucleotides in exon 4, an
optimal siRNA sequence was designed earlier by previous graduate student.

27
Specific downregulation of SASH1 expression by siRNA:
The knockdown efficiency of siRNA was first evaluated using RT-PCR to observe the
mRNA levels. We observed 70-80% knockdown 48 hours post transfection (Figure 6)
and the effect of knockdown gradually declined after 72 hours. This was in comparison
to the negative control which was siRNA against GFP. This SASH1-specific siRNA was
used further for all experiments since effective downregulation of gene expression was
achieved and this ensured that results we shall observe can be attributed to reduced gene
expression.
Cells were plated on 35 mm dishes and transfected with siRNA on the next day when
they were 30-50% confluent. RT-PCR and growth curve analysis both were performed
until 96 hours post transfection until when the downregulation was effective without
much cell death from the toxicity of transfection reagent.
Figure 6: Efficiency of siRNA knockdown 48 hours post transfection.

GFP SASH1
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Group
Relative SASH1 expression
GFP
SASH1

Fig. 6 - Gene expression in HEY cells treated with SASH1-specific siRNA was knocked down by
80% 48 hours after transfection in comparison to HEY cells transfected with GFP-specific siRNA
The experiment was performed in triplicate dishes.
28
SASH1 specific siRNA mediated growth inhibition:
Effect of siRNA treatment on cell growth was evaluated by growth curve analysis to
determine if the cells lacking the SASH1 gene grow faster than GFP siRNA treated cells.
This would throw light on the possibility of SASH1 being a potential tumor suppressor
gene. However, the results were not in accordance with this belief. (Table 3)
We observed that SASH1-specific siRNA transfected HEY cells showed decreased
viability and growth was reduced relative to the control. (Figure 7) Cell counts were
performed on day 0 at 1 hour post transfection, day 2 and day 4.

Table 3: Decrease in cell proliferation by SASH1 siRNA

DAY
No. of GFP siRNA
treated cells *
No. of SASH1 siRNA
treated cells *
0 14.7 + 0.7 13 + 0.8
2 44.8 + 3.9 29 + 1.7
4 67 + 3.6 37.1 + 1.9

Table 3 - * Numbers represents cell number x 10,000 cells/mL. Each sample is presented + SEM
of three replicates in an experiment.

Thus, it can be seen that at day 0 when readings were taken 1 hour post transfection, there
is not a marked decrease in growth between the two populations since the siRNA
knockdown has not reached its optimum levels yet. However, 48 hours later, the
differential growth rate is evident and more so at day 4.

29
0
100
200
300
400
500
600
700
800
012 345
Length of siRNA treatment (Day)
Cell Count (x 1000 cells/mL)
SASH1
GFP
Figure 7: Growth curve of HEY cells after SASH1 siRNA transfection

Fig. 7 – Cell counts were obtained at Day 0 at 1 hour post transfection, Day 2 and Day 4.
Cell counts represented are numbers x 1000 cells/mL. HEY cells transfected with SASH1-
specific siRNA showed decreased growth on Day 2 and Day 4 (red) compared to HEY
cells treated with GFP-specific siRNA (blue).

It can be seen that, when compared with GFP siRNA treated cells, cells transfected with
SASH1 siRNA show a remarkable reduction in cell proliferation. From the cell counts, it
can be estimated that there was a 36% decrease in growth in SASH1 siRNA treated cells
compared to GFP siRNA treated cells on Day 2 and a 45% decrease on Day 4.
In SASH1 siRNA transfected HEY cells, the knockdown reduced after 96 hours,
compared to GFP where the cell number showed a continuous increase. Results were
reproduced in 2 independent experiments. The difference in doubling time between the
two populations is shown in Table 4.

30
Table 4: Difference in doubling time between SASH1 siRNA and GFP siRNA cells.

GFP siRNA (days) SASH1 siRNA (days)
Day 0 & Day 2 1.2 1.7
Day 2 & Day 4 3.4 5.6

Table 4 – The doubling time was estimated considering differences between cell counts at all
time points.

Effect of SASH1 specific siRNA on cell cycle of HEY cells:-
To elucidate the mechanisms underlying the siRNA-mediated growth inhibition, we
assumed the possibility of SASH1 playing a role in cell proliferation or cell death
pathway. We performed cell cycle analysis to examine the effects of reduced gene
expression on the cell cycle of HEY cells. We looked at the cell cycle profile after
Propidium Iodide staining at the 48 hour timepoint post siRNA transfection. We expected
to see some significant changes among different cell cycle phases between GFP &
SASH-specific siRNA treated cells. These changes of cell cycle and apoptosis in the
HEY transfectants were detected by flow cytometry (Figure 8).
The cell cycle profile obtained from flow cytometry indicated that the apoptosis rate of
SASH1 siRNA transfected cells was increased compared to the controls as evidenced
from the percentage of cells in the sub G1 peak (Table 5).
Table 5: Difference in % of apoptotic cells in the sub GI region between two
populations

In Sub G1 Region
SASH1 siRNA
treated cells
GFP siRNA
treated cells
Number 1308 451
Total % of cells 7.77 2.91

31
Table 5(Continued) – Table summarizing difference in % of apoptotic cells between cells treated
with and without SASH1 siRNA. Numbers and total % of cells in sub G1 phase in HEY cells
treated with SASH1 siRNA indicates higher apoptotic rate than GFP siRNA treated HEY cells.

Figure 8: SASH1 gene silencing increases apoptosis in HEY cells.

(A)

(B)

Fig. 8 - Hey cells were transfected with SASH1 siRNA or GFP siRNA and then collected by
trypsinisation on Day 2 and stained with Propidium iodide for cell cycle analysis. (A) SASH1
siRNA transfected HEY cells; (B) GFP siRNA transfected HEY cells. Highlighted is the sub G1
peak indicating proportion of apoptotic cells (arrows). Number of cells counted was 20000 events

32
However, upon comparing the differences in other cell cycle phases, it can be seen that
the differences in HEY cells transfected with or without SASH1 siRNA were not
dramatic or evident (Table 6). Results were obtained from 2 independent experiments.

Table 6: Cell cycle phase distribution of HEY cells after siRNA transfection

GROUP
% of cells in
G1
% of cells in
S %
% of cells in
G2/M %
% of cells in
Sub G1
SASH1 siRNA 65.84 9.96 14.97 7.77
GFP siRNA 68.76 13.41 13.13 2.91

Table 6 – Numbers represents the total percentage of cells in the particular cell cycle phase
among the total cell population

On basis of the higher apoptotic rate of SASH1 siRNA-transfected HEY cells than GFP
siRNA-treated cells, we hypothesized that the growth suppression of HEY cells by
siRNA-mediated downregulation of SASH1 expression could be caused by apoptotic cell
death via possible activation of apoptotic pathways.

Effect of SASH1 specific siRNA on activation of apoptotic pathways:
In order to explore this possibility, we planned to measure levels of apoptosis in SASH1
siRNA transfected HEY cells and control cells using various apoptosis detection assays
viz. Annexin V staining, TUNEL methods and Western blot against apoptotic proteins
(14). However, we decided to start with investigating the involvement of Caspase-3, a
predominant caspase involved in execution of apoptosis, causing cell death (9). Caspase-
3 being one of the key executioners of apoptosis is partially or totally responsible for the
33
proteolytic cleavage of many key proteins. Activation of caspase-3 requires proteolytic
processing of its inactive zymogen form into activated p17 and p19 fragments.
We chose to perform a western blot against caspases to first gather preliminary data on
the apoptotic pathway. Assessment of its caspase dependence would help guide future
experiments and identify probable proteins involved in the pathway. Moreover, western
blot analysis was also suitable, given the time and optimization requirements.
We used anti-cleaved caspase 3 antibodies to perform Western blot analysis and
attempted the trial, as accurately as possible, to emulate other experiments involving low
molecular weight proteins like caspase 3 (17-19 kDa). The cleaved Caspase-3 antibody
detected only endogenous levels of the large fragment of activated caspase-3 resulting
from cleavage adjacent to Asp175, thus revealing bands at 17 and 19 kDa.
On performing western blot analysis against Caspase 3 from protein extracts collected at
48 hours post transfection, we indeed observed differential expression between SASH1
siRNA treated cells versus GFP siRNA treated cells (Figure 9)
Figure 9: Differential expression of Caspase 3 between HEY cells treated with
SASH1 siRNA and GFP siRNA.

Fig. 9 – Lane 1 (left) indicates HEY cells treated with SASH1-specific siRNA and Lane 2
(right) shows HEY cells treated with GFP siRNA. Arrows to the left mark the bands
revealed at 19 and 17kDa representing activated cleaved fragments of caspase 3. Dark
bands in lane 1 suggests increased caspase 3 expression in SASH1 siRNA treated cells
34
Fig. 9 (Continued) - compared to GFP siRNA treated cells showing faint bands. β-actin
was used as the loading control.

As shown above, the bands at 19kDa and 17kDa corresponding to the cleaved fragments,
show that there was increased expression of caspase 3 in its cleaved form in SASH1
transfectants as compared to the control, indicating explicit involvement of SASH1 in
apoptotic pathway via caspase dependent mechanisms.
But as a result of time constraints, no further apoptotic detection methods could be
employed to quantitate the apoptotic role and add information to the mechanism of
SASH1 siRNA-induced apoptosis.
Discussion

From the above described methodologies and their results, a conclusion may be drawn
that there is a possibility that SASH1 may not be the putative tumor suppressor gene on
the susceptibility locus on chromosome 6 which has intrigued many researchers since
long. Literature in past has found it to be a candidate TSG in breast and colon cancer,
however, the same was not observed from the initial experiments by silencing the gene,
in ovarian cancer. Infact, the opposite was true. The gene exhibited an oncogene-like
behavior. To reiterate the concepts of cancer genetics, a TSG if inactivated or silenced
will cause the cells to lose regulation of cell growth and result in uncontrolled
proliferation and hence increased growth. However, the growth curve analysis after gene
silencing showed growth suppression indicating the potential role of the gene as a proto-
oncogene in cell cycle, which normally allows progression through the cell cycle.
The difference in the apoptosis levels opens a new direction to probe further into. The
lack of dramatic difference in the G1, S and G2/M phases of cell cycle was not
35
encouraging in considering the function of this gene in cell cycle progression. But the
evident increase in apoptotic rate was supportive of the role of SASH1 in apoptotic
mechanisms. The gene via its role as an adaptor protein in signal transduction probably
confers enhanced survival by evading cell death.

Before drawing conclusions about the genetic contribution by this gene on basis of
siRNA experiments on HEY cell line, it is important to be aware of ‘off-target effects of
siRNA’. Several recent reports have suggested that non-specific effects can be induced
by siRNAs, both at mRNA and protein levels. These findings suggest that siRNAs can
regulate the expression of unintended targets, and thus necessitate further experiments on
clarifying the mechanism and extent of off-target gene regulation.
Secondly, the caveat before interpreting the role of this gene is the use of a single ovarian
carcinoma cell line for silencing experiments. The data does not completely eliminate the
possibility of SASH1 being a TSG since there was differential SASH1 expression in the
panel of similar ovarian carcinoma cell lines and hence suggesting the need to define a
better expression system to accurately represent ovarian cancer and determine the precise
role of the gene in ovarian cancer. It is important to address the question if silencing the
gene in HEY cells alone be sufficient to either consider or eliminate the role of SASH1 as
a putative TSG in ovarian cancer.
These results from the limited set of experiments though not dramatic are certainly
encouraging to study intensively the function of SASH1 and to outline its involvement in
signal transduction, cell proliferation and cell survival. The molecular mechanisms that
regulate SASH1 expression are unknown. Owing to the SAM and SH3 domains which
36
act as scaffolding factors, the function of the gene may lie in multi-protein signaling
complex formation that regulate cell survival and growth (29). The protein probably
exerts a specific function in ovarian cells distinct from other tissues or probably may
require partners to interact with.
Another idea that stems from this data is that if SASH1 is not the putative TSG on
chromosome 6q then there may be one or more other genes in the susceptibility locus
between 6q24-25 and precisely in the location of 6q24.3 that may be considered as
potential targets for further studies. Taking this into consideration, we took a look at
some genes present in the region of SASH1 with the help of NCBI Map viewer, with an
aim to review their related literature. However, it was seen that the band region at 6q24.3
is not very gene-rich and has only few genes including majority of unknown genes that
are not yet validated with a specific role and a few genes relatively known. Out of the 6
genes on 6q24.3 that were relatively known, only two genes SASH1 and SHPRH are
being studied for their tumor suppressor function. SHPRH is suggested to be a candidate
tumor suppressor on basis of its structural domains (34) and is approximately 2300 kb
from SASH1. RAB32 is thought to possess oncogenic properties (33) while
characterization of C6orf103, STXBP5 and SAMD5 is ongoing. With this information it
can be contemplated that there is a possibility of some other genes being the putative
TSG in the 6q24.3 locus and requires detailed functional and molecular analysis.

37
CHAPTER IV – FUTURE DIRECTIONS

All experimental data showed that the downregulation of SASH1 expression could give
rise to growth suppression and lead to apoptosis induction in ovarian carcinoma cells.
However, since work towards characterization of this gene and outlining its role in
ovarian cancer is in its initial stages, there are still many approaches that can be devised
for a thorough understanding of the gene’s function in normal and cancer cells and thus
perhaps shed more light on the molecular basis of ovarian cancer.
The results that were observed can be verified and reproduced under different
experimental conditions with appropriate controls.
An useful step may be to generate antibodies to the particular gene fragment and results
be reproduced at protein levels. This will strengthen the data and should be able confirm
the results observed and include any particular observations regarding the translational
process. It might prove worthy to look for protein associations by techniques like yeast
two-hybrid assay and phage display, suspecting that the protein may require other
proteins as partners to interact with and exert its role.
Considering the CpG island within the coding region, an epigenetic focus shall help gain
more novel information. Promoter methylation studies through MethyLight analysis of
the CpG island in SASH1 can be carried out to assess the methylation patterns if any and
check if those could be underlying mechanisms of gene function. This should be
compared to normal ovarian tissues as well as other tumors except that of ovaries. It is
also tempting to speculate that methylation patterns of the various genes in this candidate
38
region could provide a lot of information on the gene activity and their potential role as
tumor suppressor genes in ovarian cancer.
From literature, it can be seen that a widely used course to define the role of a novel gene
in cancer is to compare gene expression levels between primary tumor specimens versus
normal ovarian tissues. We could specifically downregulate SASH1 in ovarian carcinoma
cells but not in normal ovarian epithelial cells and observe the consequences. To
reproduce the data obtained by initial detection of apoptosis through Propidium iodide
staining, one or more sensitive apoptotic detection methods may be used such as TUNEL
method or Annexin V staining, with a specific aim to quantitate the apoptotic role and
detect various anti and pro-apoptotic proteins.
With tremendous advancement in siRNA technology, there is still lot more that can be
improvised upon and applied for effective knockdown strategies and results. The main
problem in performing experiments with the siRNA oligonucleotides was the transient
nature of the transfection which allowed the siRNA knockdown to remain effective for
only about 5 days and thus there was a limited duration for all experiments. As a solution
to this concern, we can perform a stable transfection for knockdown using a siRNA
expression vector also referred to as shRNA. Vectors directing the synthesis of short
hairpin RNAs (shRNAs) that are then processed to form siRNAs enable persistent
suppression of endogenous gene expression (16). Downregulation of SASH1 can be
achieved through these vector-generated siRNAs to study their effect on cell growth and
apoptosis. This technology is currently the most widely utilized technique in functional
genomic studies and therapeutic gene regulation.

39
To exclude off-target silencing effect mediated by specific-siRNA, we could employ two
or more different sequences of siRNA directed against different genomic regions of
SASH1 to confirm the observations and also employ the effective one for further
analysis. It is certainly interesting to explore if the decrease in levels of SASH1 has any
anti-tumor effects and if the siRNA can be a potential gene therapy.
Considering its anti-TSG behavior, chromosomal analysis of 6q should include probing
for regions with amplifications along with mapping of regions with deletions.
Another area that should be looked into is if the significance of SASH1 is apparent
during the early stages of the disease or advanced stages or disease recurrence.
Our ultimate goal will be to examine the effect in human ovarian cancer cells in vitro and
on tumour growth in vivo using siRNA or over-expression techniques , and thus establish
candidate status of SASH1- mediated signaling for studies in targeted ovarian cancer
therapy.
As summarized in a study by Weir et al. in 2007, systematic understanding of the
molecular basis of a cancer requires: comprehensive characterization of the genomic
aberrations including nucleotide changes, chromosomal rearrangements and epigenetic
alterations; elucidation of their biological role in cancer pathogenesis; and evaluation of
their efficacy for diagnostics, prognostics and therapeutics. This study represents a step
towards initial elucidation of the biological role of SASH1 in cancer pathogenesis
following its genomic characterization in some cancers.
With the specific aims suggested above, a thorough understanding of the gene can be
achieved to reveal its function in a normal cell as well as to establish its contribution in
the molecular mechanisms underlying cancer.
40
BIBLIOGRAPHY

1. Abdollahi, A., R. Bao, and T. C. Hamilton. 1999. LOT1 is a growth suppressor
gene down-regulated by the epidermal growth factor receptor ligands and encodes
a nuclear zinc-finger protein. Oncogene 18:6477-87.

2. Abdollahi, A., D. Roberts, A. K. Godwin, D. C. Schultz, G. Sonoda, J. R.
Testa, and T. C. Hamilton. 1997. Identification of a zinc-finger gene at 6q25: a
chromosomal region implicated in development of many solid tumors. Oncogene
14:1973-9.

3. Angeloni, D. 2007. Molecular analysis of deletions in human chromosome 3p21
and the role of resident cancer genes in disease. Brief Funct Genomic Proteomic
6:19-39.

4. Bandera, C. A. 2005. Advances in the understanding of risk factors for ovarian
cancer. J Reprod Med 50:399-406.

5. Bilanges, B., A. Varrault, E. Basyuk, C. Rodriguez, A. Mazumdar, C.
Pantaloni, J. Bockaert, C. Theillet, D. Spengler, and L. Journot. 1999. Loss of
expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines
and primary tumors. Oncogene 18:3979-88.

46. Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith
Roberts, and Peter Walter. 2002. Molecular Biology of the Cell, Fourth Edition.
Garland Science.

6. Buick, R. N., R. Pullano, and J. M. Trent. 1985. Comparative properties of five
human ovarian adenocarcinoma cell lines. Cancer Res 45:3668-76.

7. Cheng, P. C., J. A. Gosewehr, T. M. Kim, M. Velicescu, M. Wan, J. Zheng, J.
C. Felix, K. F. Cofer, P. Luo, B. H. Biela, G. Godorov, and L. Dubeau. 1996.
Potential role of the inactivated X chromosome in ovarian epithelial tumor
development. J Natl Cancer Inst 88:510-8.

8. Cliby, W., S. Ritland, L. Hartmann, M. Dodson, K. C. Halling, G. Keeney, K.
C. Podratz, and R. B. Jenkins. 1993. Human epithelial ovarian cancer
allelotype. Cancer Res 53:2393-8.

9. Cohen, G. M. 1997. Caspases: the executioners of apoptosis. Biochem J 326 ( Pt
1):1-16.

41
10. Cooke, I. E., A. N. Shelling, V. G. Le Meuth, M. L. Charnock, and T. S.
Ganesan. 1996. Allele loss on chromosome arm 6q and fine mapping of the
region at 6q27 in epithelial ovarian cancer. Genes Chromosomes Cancer 15:223-
33.

11. Cooney, K. A., J. C. Wetzel, C. M. Consolino, and K. J. Wojno. 1996.
Identification and characterization of proximal 6q deletions in prostate cancer.
Cancer Res 56:4150-3.

12. D'Andrilli, G., C. Kumar, G. Scambia, and A. Giordano. 2004. Cell cycle
genes in ovarian cancer: steps toward earlier diagnosis and novel therapies. Clin
Cancer Res 10:8132-41.

13. Deger, R. B., S. A. Faruqi, and J. S. Noumoff. 1997. Karyotypic analysis of 32
malignant epithelial ovarian tumors. Cancer Genet Cytogenet 96:166-73.

14. Dong, K., R. Wang, X. Wang, F. Lin, J. J. Shen, P. Gao, and H. Z. Zhang.
2008. Tumor-specific RNAi targeting eIF4E suppresses tumor growth, induces
apoptosis and enhances cisplatin cytotoxicity in human breast carcinoma cells.
Breast Cancer Res Treat.

15. Ehlen, T., and L. Dubeau. 1990. Loss of heterozygosity on chromosomal
segments 3p, 6q and 11p in human ovarian carcinomas. Oncogene 5:219-23.

16. Fan, Y., X. Y. Xin, B. L. Chen, and X. Ma. 2006. Knockdown of RAB25
expression by RNAi inhibits growth of human epithelial ovarian cancer cells in
vitro and in vivo. Pathology 38:561-7.

17. Fearon, E. R., and B. Vogelstein. 1990. A genetic model for colorectal
tumorigenesis. Cell 61:759-67.

18. Fero, M. L., E. Randel, K. E. Gurley, J. M. Roberts, and C. J. Kemp. 1998.
The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature
396:177-80.

19. Foulkes, W. D., J. Ragoussis, G. W. Stamp, G. J. Allan, and J. Trowsdale.
1993. Frequent loss of heterozygosity on chromosome 6 in human ovarian
carcinoma. Br J Cancer 67:551-9.

20. Hanahan, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell 100:57-
70.

21. Hezova, R., J. Ehrmann, and Z. Kolar. 2007. WWOX, a new potential tumor
suppressor gene. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub
151:11-5.
42

22. Jones, P. A., and P. W. Laird. 1999. Cancer epigenetics comes of age. Nat
Genet 21:163-7.

23. Knudson, A. G., Jr. 1971. Mutation and cancer: statistical study of
retinoblastoma. Proc Natl Acad Sci U S A 68:820-3.

24. Lee, J. H., J. J. Kavanagh, D. M. Wildrick, J. T. Wharton, and M. Blick.
1990. Frequent loss of heterozygosity on chromosomes 6q, 11, and 17 in human
ovarian carcinomas. Cancer Res 50:2724-8.

25. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25:402-8.

26. Menasce, L. P., V. Orphanos, M. Santibanez-Koref, J. M. Boyle, and C. J.
Harrison. 1994. Common region of deletion on the long arm of chromosome 6 in
non-Hodgkin's lymphoma and acute lymphoblastic leukaemia. Genes
Chromosomes Cancer 10:286-8.

27. Merlo, A., E. Gabrielson, M. Mabry, R. Vollmer, S. B. Baylin, and D.
Sidransky. 1994. Homozygous deletion on chromosome 9p and loss of
heterozygosity on 9q, 6p, and 6q in primary human small cell lung cancer. Cancer
Res 54:2322-6.

28. Negrini, M., S. Sabbioni, L. Possati, S. Rattan, A. Corallini, G. Barbanti-
Brodano, and C. M. Croce. 1994. Suppression of tumorigenicity of breast cancer
cells by microcell-mediated chromosome transfer: studies on chromosomes 6 and
11. Cancer Res 54:1331-6.

29. Rimkus, C., M. Martini, J. Friederichs, R. Rosenberg, D. Doll, J. R. Siewert,
B. Holzmann, and K. P. Janssen. 2006. Prognostic significance of
downregulated expression of the candidate tumour suppressor gene SASH1 in
colon cancer. Br J Cancer 95:1419-23.

30. Saito, S., H. Saito, S. Koi, S. Sagae, R. Kudo, J. Saito, K. Noda, and Y.
Nakamura. 1992. Fine-scale deletion mapping of the distal long arm of
chromosome 6 in 70 human ovarian cancers. Cancer Res 52:5815-7.

31. Salehi, F., L. Dunfield, K. P. Phillips, D. Krewski, and B. C. Vanderhyden.
2008. Risk factors for ovarian cancer: an overview with emphasis on hormonal
factors. J Toxicol Environ Health B Crit Rev 11:301-21.

43
32. Sheng, Z. M., A. Marchetti, F. Buttitta, M. H. Champeme, D. Campani, M.
Bistocchi, R. Lidereau, and R. Callahan. 1996. Multiple regions of
chromosome 6q affected by loss of heterozygosity in primary human breast
carcinomas. Br J Cancer 73:144-7.

33. Shibata, D., Y. Mori, K. Cai, L. Zhang, J. Yin, A. Elahi, R. Hamelin, Y. F.
Wong, W. K. Lo, T. K. Chung, F. Sato, M. S. Karpeh, Jr., and S. J. Meltzer.
2006. RAB32 hypermethylation and microsatellite instability in gastric and
endometrial adenocarcinomas. Int J Cancer 119:801-6.

34. Sood, R., I. Makalowska, M. Galdzicki, P. Hu, E. Eddings, C. M. Robbins, T.
Moses, J. Namkoong, S. Chen, and J. M. Trent. 2003. Cloning and
characterization of a novel gene, SHPRH, encoding a conserved putative protein
with SNF2/helicase and PHD-finger domains from the 6q24 region. Genomics
82:153-61.

35. Sowter, H. M., and A. Ashworth. 2005. BRCA1 and BRCA2 as ovarian cancer
susceptibility genes. Carcinogenesis 26:1651-6.

47. Strachan, T., Read, A. 2003. Human Molecular Genetics, Third Edition.
Garland Science.

36. Tibiletti, M. G., B. Bernasconi, D. Furlan, C. Riva, M. Trubia, G. Buraggi,
M. Franchi, P. Bolis, A. Mariani, L. Frigerio, C. Capella, and R. Taramelli.
1996. Early involvement of 6q in surface epithelial ovarian tumors. Cancer Res
56:4493-8.

37. Tibiletti, M. G., B. Bernasconi, M. Taborelli, D. Furlan, A. Fabbri, M.
Franchi, R. Taramelli, M. Trubia, and C. Capella. 1997. Involvement of
chromosome 6 in endometrial cancer. Br J Cancer 75:1831-5.

38. Todd, R., and D. T. Wong. 1999. Oncogenes. Anticancer Res 19:4729-46.

39. Trent, J. M., E. J. Stanbridge, H. L. McBride, E. U. Meese, G. Casey, D. E.
Araujo, C. M. Witkowski, and R. B. Nagle. 1990. Tumorigenicity in human
melanoma cell lines controlled by introduction of human chromosome 6. Science
247:568-71.

40. Walker, G. J., J. M. Palmer, M. K. Walters, D. J. Nancarrow, P. G. Parsons,
and N. K. Hayward. 1994. Simple tandem repeat allelic deletions confirm the
preferential loss of distal chromosome 6q in melanoma. Int J Cancer 58:203-6.

41. Wan, M., T. Sun, R. Vyas, J. Zheng, E. Granada, and L. Dubeau. 1999.
Suppression of tumorigenicity in human ovarian cancer cell lines is controlled by
a 2 cM fragment in chromosomal region 6q24-q25. Oncogene 18:1545-51.
44

42. Wang, M., H. G. Vikis, Y. Wang, D. Jia, D. Wang, L. J. Bierut, J. E. Bailey-
Wilson, C. I. Amos, S. M. Pinney, G. M. Petersen, M. de Andrade, P. Yang, J.
S. Wiest, P. R. Fain, A. G. Schwartz, A. Gazdar, J. Minna, C. Gaba, H.
Rothschild, D. Mandal, E. Kupert, D. Seminara, Y. Liu, A. Viswanathan, R.
Govindan, M. W. Anderson, and M. You. 2007. Identification of a novel tumor
suppressor gene p34 on human chromosome 6q25.1. Cancer Res 67:93-9.

44. Zeller, C., B. Hinzmann, S. Seitz, H. Prokoph, E. Burkhard-Goettges, J.
Fischer, B. Jandrig, L. E. Schwarz, A. Rosenthal, and S. Scherneck. 2003.
SASH1: a candidate tumor suppressor gene on chromosome 6q24.3 is
downregulated in breast cancer. Oncogene 22:2972-83.

45. Zhang, L., M. S. Anglesio, M. O'Sullivan, F. Zhang, G. Yang, R. Sarao, P. N.
Mai, S. Cronin, H. Hara, N. Melnyk, L. Li, T. Wada, P. P. Liu, J. Farrar, R.
J. Arceci, P. H. Sorensen, and J. M. Penninger. 2007. The E3 ligase HACE1 is
a critical chromosome 6q21 tumor suppressor involved in multiple cancers. Nat
Med 13:1060-9.

48. Ziegler, A., Müller-Myhsok, B. 2003. Ian N. M. Day. Molecular Genetic
Epidemiology: A Laboratory Perspective. Human Genetics 112 (1): 101-102.

49. American Cancer Society: Cancer Facts and Figures 2008. Atlanta, Ga:
URL: http://www.cancer.org/docroot/CRI/CRI_2_3x.asp?dt=33. Accessed on
05/01/2008

50. URL: http://www.roswellpark.org/Research/Research_Staff/DiCioccio_RichardA
__PhD. Accessed on 05/23/2008.
51. URL: http://www.genecards.org/cgi-bin/carddisp.pl?gene= SASH1. Genecard for
SASH1. Accessed on 06/06/2008

Abstract (if available)

Abstract It is known that there is a strong interplay of various oncogenes and tumor suppressor genes underlying the mechanism of cancer formation and identifying these can be instrumental in devising therapeutics approaches. Ovarian cancer being one of the least understood cancers is also a leading cause of death among women and thus requires a deeper insight into its molecular mechanisms. It has been previously reported that there is loss of a chromosomal segment on Chromosome 6 observed in many cancers including ovarian cancer, giving rise to a strong belief that this region possibly harbors one or more crucial tumor suppressor genes. One such candidate gene found to be implicated in breast and colon cancer is SASH1 and the region found to be the hotspot is between 6q24-25. SASH1, located at 6q24.3, has no known function yet but its role is suggested in signaling pathways. In our study, we attempted to elucidate the role of this gene in ovarian cancer. We created an expression vector for this gene earlier thus over expressing it and also exploited the RNAi technology to knock down the expression of this gene and observe its effect on growth rate, cell cycle and apoptosis, by using real-time PCR, growth curve analysis, propidium iodide staining, western blot methods and apoptosis assays. Contrary to the belief that this gene is a candidate tumor suppressor gene in other cancers, our data suggested that reduced SASH1 expression resulted in decreased growth rates and evident apoptosis. By further analysis of its mechanism of action and in-vivo studies, we should be able to propose that this gene plays a definite role in the progression of human ovarian cancer and should be further explored as a possible therapeutic target of ovarian cancer.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Exploring the role of the homeobox protein Prox1 as a tumor suppressor in papillary thyroid carcinoma

PDF

DNA hypermethylation: its role in colorectal tumorigenesis and potential clinical applications

PDF

Investigating the function and epigenetic regulation of ABCA3, a novel LUAD tumor suppressor gene

PDF

Mitotic regulation in ovarian epithelial tumors approaching in vitro crisis

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

Construction of plasmids for constitutive and induced expression of secreted alkaline phosphatase in mammalian ovarian carcinoma cells

PDF

The expression of human carboxylesterases in normal tissues and cancer cell-lines

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

The noncanonical role of telomerase in prostate cancer cells: exploring a non-telomeric signaling role for telomerase protein (TERT) in a cancer cell line

PDF

The role of DNA methylation in early detection and progression of pancreatic cancer

PDF

The role of PAX8 in epithelial ovarian carcinoma

PDF

Tight junction protein CLDN18.1 attenuates malignant properties and related signaling pathways of human lung adenocarcinoma in vivo and in vitro

PDF

The role of microRNAs in cancer

PDF

Functional characterization of a prostate cancer risk region

PDF

Integrative genomic and epigenomic analysis of human cancer

PDF

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

PDF

Functional characterization of colon cancer risk-associated enhancers: connecting risk loci to risk genes

PDF

Molecular mechanisms of chemoresistance in breast cancer

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

Asset Metadata

Creator Subramanian, Smita (author)

Core Title Investigating the role of SASH1 gene located on chromosome 6 in ovarian cancer

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Biology

Degree Conferral Date 2008-08

Publication Date 07/30/2010

Defense Date 06/25/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag OAI-PMH Harvest,ovarian cancer genetics,tumor suppressor genes

Language English

Advisor Tokes, Zoltan A. (committee chair), Dubeau, Louis (committee member), Laird-Offringa, Ite A. (committee member)

Creator Email smitags@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1435

Unique identifier UC1439812

Identifier etd-Subramanian-20080730 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-193090 (legacy record id),usctheses-m1435 (legacy record id)

Legacy Identifier etd-Subramanian-20080730.pdf

Dmrecord 193090

Document Type Thesis

Rights Subramanian, Smita

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu