University of Southern California Dissertations and Theses

Mitotic regulation in ovarian epithelial tumors approaching in vitro crisis

(USC Thesis Other)

Mitotic regulation in ovarian epithelial tumors approaching in vitro crisis

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

MITOTIC REGULATION IN OVARIAN EPITHELIAL TUMORS APPROACHING
IN VITRO CRISIS

by
Vanessa Yu
________________________________________________________________

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PATHOBIOLOGY)

August 2009

Copyright 2009 Vanessa Yu
ii

Dedication

This is dedicated to my parents, Jayson and Margaret Yu, who have both instilled
in me a love for learning. I would not have been able to accomplish this Ph.D.
without their love and support.
iii

Acknowledgements

I would like to thank my family, Mom, Dad, and Chris, for their endless love and
guidance. They taught me to reach for the stars, and I would not be the person I
am today without them. I would also like to thank my aunt, Mimi Yu, for
introducing me to USC, and for being such a great role model. I can only hope
that my scientific career will be as fruitful as hers.

I would like to thank my mentor, Dr. Louis Dubeau, for giving me the opportunity
to work in his lab, and for teaching me to think like a scientist. His support and
guidance has meant a lot to me over the years, and I cannot think of a kinder or
more generous PI. I would also like to thank my committee members, Dr. Axel
Schönthal and Dr. Michael Press for their insightful comments and thoughtful
suggestions. It has been a pleasure having them on my committee over the past
few years.

I would like to thank the past and present members of the Dubeau lab for making
it a pleasure to come to work the last five years: Man-Ho Chu, Lindsey Hughes,
Amy Brockmeyer, Hao Hong, Ying Liu, Smita Subramanian, George Kohan, and
Christine Marion. I would also like to say a special thanks to Jennifer Yeh, my
partner in crime, who has experienced the highs and lows of lab work with me. I
iv

would also like to thank Jenilyn Virrey, for always providing a sympathetic ear
and great advice.

Finally, to my Toronto friends, particularly Maricar Traballo and Lindsay Siu-
Chong, you are the best friends a girl can have. Thank you for all your
encouragement and love over the years.
v

Table of Contents

Dedication ii

Acknowledgements iii

List of Figures vii

Abstract viii

Chapter 1: Introduction 1
Determinants of Malignancy in Ovarian Cancer 1
1. Background 1
2. The Role of BRCA1 3
Cell Cycle Regulation 7
1. Overview 7
2. Post-translational Modification of BRCA1 9
3. Aurora Kinases Maintain Genetic Stability 14
Linking Aneuploidy and Cancer Progression 17
1. Aneuploidy: A Cause or Consequence of Cancer 17
Development
2. The Road to Aneuploidy Development 20
3. Examining the Link Between Aneuploidy and Immortalization 26
Overview of Epithelial Models for Aneuploidy Development 29
Rationale 30

Chapter 2: A Mitotic Arrest Triggers In Vitro Crisis in Benign Ovarian Tumors 31
Abstract 31
Introduction 32
Materials and Methods 34
Results 37
Discussion 48

Chapter 3: Down-regulation of BRCA1 in Benign Ovarian Tumors 51
Approaching In Vitro Crisis Abrogates Mitotic Arrest
Abstract 51
Introduction 52
Materials and Methods 54
Results 56
Discussion 70

vi

Chapter 4: Aurora A Controls BRCA1 Expression in Benign Ovarian Tumors 73
Approaching In Vitro Crisis
Abstract 73
Introduction 74
Materials and Methods 77
Results 78
Discussion 88

Chapter 5: Summary and Future Directions 91
Summary 91
Future Directions 101

References 109

vii

List of Figures

Figure 1: Mitotic Spindle Checkpoint Regulation 23

Figure 2: Ploidy Dependent Crisis is Driven by a Cell Cycle Arrest 42

Figure 3: Cell Cycle Arrest Associated with Ploidy Dependent Crisis is 43
Regulated Downstream of the G2/M Checkpoint

Figure 4: An Arrest at the Mitotic Spindle Checkpoint is the Main 45
Determinant of Ploidy Dependent Crisis

Figure 5: Mitotic Arrest is Not Associated with Telomere Dependent Crisis 46

Figure 6: Expression of BRCA1 Isoforms Decrease during Crisis 63

Figure 7: Down-regulation of BRCA1 Isoforms leads to Changes in 64
Cyclin/Cdk Expression

Figure 8: Down-Regulation of BRCA1 Expression Plays a Role in 65
Controlling Crisis

Figure 9: Down-Regulation of BRCA1 Abrogates Mitotic Arrest leading to 66
Acquisition of Tetraploidy

Figure 10: Changes in Mitotic Regulators Control Acquisition of Tetraploidy 68
after BRCA1 Inhibition

Figure 11: A Novel Model for Aneuploidy Development in Cancer 69

Figure 12: Aurora A is Up-regulated During Ploidy Dependent Crisis 83

Figure 13: Aurora A Inhibition leads to a Decrease in Tetraploidy 84
Development During Crisis

Figure 14: Aurora A Controls BRCA1 Expression During Ploidy 86
Dependent Crisis

Figure 15: Alterations in BRCA1 and Aurora A Expression Regulate 87
Mitotic Arrest

Figure 16: A Novel Model for Aneuploidy Development in Cancer 100
Progression
viii

Abstract

Crisis, a mortality checkpoint, is characterized by widespread apoptosis. We
previously showed that epithelial cell strains derived from benign ovarian
cystadenomas and further transfected with SV40 Large T Antigen undergo
polyploidy followed by aneuploidy as they approach in vitro crisis. I sought to
investigate the mechanisms behind these changes, which may recapitulate those
that take place during tumor development, especially for those tumors that have
a near polyploid number of chromosomes. I first tested the hypothesis that the
initial doubling in DNA content, which appears to trigger the entire process,
reflects a cell cycle arrest. I revealed that a mitotic arrest, which is maintained at
the spindle checkpoint between metaphase to anaphase transition, is the main
determinant of ploidy dependent crisis. Further investigation into the mechanism
behind regulation of this arrest showed that down-regulation of BRCA1
expression, a protein controlling familial ovarian cancer predisposition, allowed
cells to overcome such mitotic arrest and re-enter the cell cycle without
completion of cytokinesis, leading to tetraploidy and aneuploidy. Aurora A, a
known upstream regulator of BRCA1, was found to be over-expressed in cells
approaching crisis. Further studies revealed a novel role for Aurora A in
controlling BRCA1 expression during ploidy dependent crisis. I conclude that
over-expression of Aurora A inhibits BRCA1 expression during ploidy dependent
ix

crisis, leading to escape from mitotic arrest and acquisition of tetraploidy, and
subsequent aneuploidy development.
1

Chapter 1: Introduction

Determinants of Malignancy in Ovarian Cancer
1. Background
Ovarian cancer continues to be the most lethal gynecological cancer facing
women in the United States. This is due primarily to a lack of screening methods
for the detection of early stage ovarian cancer (Eagle and Ledermann, 1997).
Current screening methods include transvaginal ultrasound (TVU) and testing for
the presence of rising levels in biomarker CA-125, but there is still a need for
improved and more sensitive early screening methods. According to the World
Health Organization, ovarian epithelial tumors are classified as benign
(cystadenomas), malignant (carcinomas), or low malignant potential/borderline
(LMP). This last group is characterized by minimal invasive potential, although
these tumors can spread outside the ovary and proliferate onto peritoneal
surfaces. LMP tumors are thought to share characteristics of both benign and
malignant lesions. Ovarian epithelial tumors can be further divided into a number
of subtypes, such as serous, mucinous, endometriod, or clear cell tumors.
Serous tumors (40% of common epithelial tumors) are the most widespread,
followed by endometriod (20%), clear cell (6%), and mucinous (1%).

2

According to statistics from the National Institute of Health, 62% of women are
diagnosed after the cancer has already metastasized (Stage III and IV). The five
year survival rate for these cases is 28%, compared to a five year survival rate of
94% if the cancer is detected at Stage I. However, only 15% of cases are
diagnosed this early. The majority of women diagnosed with Stage III or IV
ovarian epithelial carcinoma respond well to initial treatment, but up to 80% of
these women will experience recurrence of their disease (Omura et al., 1991).
Median survival after diagnosis of recurrence is two years, which is the primary
reason why ovarian cancer is the fourth leading cause of death from cancer in
the United States.

Debulking surgery, followed by adjuvant chemotherapy is the standard of care for
women with advanced stage disease. Chemotherapy is expected to have a
greater effect in patients that have been optimally debulked, the goal being to
leave as little residual tumor as possible. First line chemotherapy treatment
includes cisplatin, a platinum based drug, in combination with paclitaxel (taxol), a
mitotic inhibitor (Ozols et al., 2003). Most of these patients will eventually
relapse, and depending on whether they have developed resistance to platinum
agents, they may be treated with the same chemotherapeutic drugs or with other
reagents (Agarwal and Kaye, 2003). However, response to treatment decreases
after each relapse due to development of drug resistance. This is one of the
3

major problems facing ovarian cancer treatment, as the majority of women will
die from chemo-resistant disease within 5 years. However, new therapies such
as anti-angiogenic agents (Bevacizumab) and PARP (poly ADP-ribose
polymerase) inhibitors are currently being tested to improve the standard of care
(Yap et al., 2009).

2. The Role of BRCA1
Women with a familial predisposition to ovarian and breast cancer often have
mutations in BRCA1 or BRCA2. Hereditary ovarian cancer makes up
approximately 5-15% of ovarian cancer cases, and women with a deleterious
mutation in either their BRCA1 or BRCA2 genes have a 10-60% chance of
developing ovarian, and to some extent, fallopian tube or peritoneal cancer,
during their lifetime. Interestingly, even though BRCA1 germline mutations are
rare in sporadic breast and ovarian cancers, this protein is frequently absent or
reduced in sporadic cases, suggesting a wider role for BRCA1 in controlling both
hereditary and sporadic carcinogenesis (McCoy et al., 2003). Germline
mutations in BRCA1 are more prevalent than BRCA2 mutations in familial
ovarian cancer.

4

BRCA1 lies on chromosome 17q21, and encodes 24 exons, the largest being
exon 11, which corresponds to over 50% of the coding region, and contains the
nuclear localization signal (Miki et al., 1994). There are three known gene
products of BRCA1, full length BRCA1, which encodes the majority of the gene,
BRCA1-delta11b, which lacks the majority of exon 11, and BRCA1-IRIS, which
terminates within intron 11 (Wilson et al., 1997; ElShamy et al., 2004). The most
widely studied isoform of BRCA1 is full length BRCA1, which is ubiquitously
expressed in all tissues, and encodes a 220 kDa nuclear protein consisting of
1836 amino acids. This is a multifunctional protein with roles in chromatin
remodeling (Bochar et al., 2000), transcriptional regulation (Monteiro et al.,
1996), DNA repair (Scully et al., 1997), and cell cycle regulation (Xu et al., 1999).
Despite the vast amount of study focused on BRCA1, its underlying mechanisms
are still poorly understood. Part of the problem lies in understanding its complex
roles in regulating different cellular processes.

a. The Paradoxical Nature of BRCA1
Breast and ovarian tumors from patients harboring BRCA1 mutations and
showing loss of heterozygosity at the BRCA1 locus often show retention of the
mutant allele. This fit Knudson’s two hit hypothesis, and initially led to
speculation that BRCA1 functions as a classical tumor suppressor gene.
However, loss of BRCA1 activity often results in growth retardation and reduced
5

cellular proliferation at early embryogenesis, which is contrary to what one would
expect of a classical tumor suppressor gene (Hakem et al., 1996). Likewise,
mutant BRCA1 embryos homozygous for deletions at exon 2 or exon 11 both
share defects in growth development, characterized by embryos that are much
smaller in size, in addition to early embryonic lethality in half of them (Ludwig et
al., 1997; Shen et al ., 1998).

BRCA1 null mutant mice also show accumulation of numerical and structural
alterations, leading to speculation that the presence of chromosomal
abnormalities activates a p53 or p21 dependent cell cycle checkpoint, thereby
causing early embryonic death (Deng 2001). Expression of BRCA1 null
genotype on a p53 null background extends embryonic survival time, but is
accompanied by a further increase in chromosomal abnormalities, suggesting
that abolishment of the p53 checkpoint does not rescue BRCA1 null mutants
from embryonic death, but allows for further unchecked accumulation of
chromosomal abnormalities.

Efforts were made to further investigate BRCA1 function by establishing
embryonic fibroblasts from mutant embryos, but BRCA1 null MEFs were not
viable, even when combined with loss of p53 activity. Mutations that spare an
6

alternative splice form of BRCA1 that lacks exon 11, BRCA1 delta 11, did allow
for embryonic fibroblast growth, albeit with poor proliferation rates when
compared to heterozygous or wildtype cells. MEF cells derived from such
mutants are characterized by a defective G2/M checkpoint and abnormalities in
centrosome duplication, which is similar to what is observed in BRCA1 null mice
(Grigorova et al., 2004). Similarly, the breast cancer cell line HCC1937, derived
from a tumor with a germline BRCA1 mutation, has an abnormal karyotype
number and numerous chromosomal rearrangements and deletions (Scully et al.,
1999).

In summary, BRCA1 mutant or null embryos are characterized by early
embryonic death or growth retardation, which may be the result of accumulation
of chromosomal abnormalities. This suggests that BRCA1 plays an integral role
in maintaining genetic stability and may be involved in cell cycle regulation, as
perturbations in the cell cycle may lead to accumulation of numerical or structural
chromosomal abnormalities. Therefore, the roles of BRCA1 and its binding
partner, Aurora A, in cell cycle regulation will be discussed next.

7

Cell Cycle Regulation
1. Overview
The basic functions of the cell cycle are to achieve duplication of DNA, and
correct segregation of chromosomes into two daughter cells. The cell cycle is
divided into G1, S, G2, and M phase. G1, S, and G2 are collectively known as
interphase. DNA duplication occurs during S phase, and in M phase,
chromosomal segregation takes place. M phase is divided into prophase, pro-
metaphase, metaphase, anaphase, telophase, and finally cytokinesis.

Entry into mitosis starts at prophase, which involves chromosome condensation,
and initiation of mitotic spindle formation. Proteins on the nuclear envelope such
as Histone H3 are phosphorylated to signal for nuclear envelope breakdown,
which is completed during pro-metaphase. After breakdown, metaphase begins,
chromosomes align at the equator of the mitotic spindle, and kinetochore
microtubules attach sister chromatids to opposite poles. At anaphase, the sister
chromatids separate, and microtubules become shorter as sister chromatids are
pulled to opposite ends of the spindle pole. Finally, at telophase, the last stage
of mitosis, two sets of daughter chromosomes arrive at their respective spindle
poles, and a new nuclear envelope starts to assemble around each set.
Cytokinesis, which occurs after mitosis, involves cytoplasmic division by a
8

contractile ring made up of actin and myosin filaments that pinches the cell to
create two daughter cells with their own separate nucleus.

Progression through the cell cycle is controlled by G1/S, S, G2/M, and mitotic
spindle (between metaphase and anaphase) checkpoints. The first three
checkpoints are regulated by cyclin-cyclin dependent kinase (Cdk) complexes,
which are in place to ensure DNA fidelity and proper replication of all DNA before
initiation of M phase. The expression levels of these complexes rises and falls
throughout the cell cycle. G1 checkpoint is controlled by cyclin D/Cdk4 and
cyclin D/Cdk6, S by cyclinA/Cdk2, and G2/M by cyclin B1/Cdk1. Cdks are only
active when bound to their respective cyclins. In the absence of cyclin B1, for
example, Cdk1 is kept inactive due to the inhibitory phosphorylation activities of
Wee1 and Myt1 kinases. Conversion from inactive to active Cdk1 is mediated by
Cdc25 phosphatase activity, a Cdk activating kinase (CAK), which
dephosphorylates those sites on Cdk1.

Cyclin/Cdk arrests the cell at cell cycle checkpoints in response to damage
induced by internal or external stressors, thereby allowing time for cellular repair.
If cell damage is too excessive and repair cannot be completed, apoptotic
pathways will be activated. Cell cycle arrest is achieved through inhibition of
9

cyclin/Cdk activity by tumor suppressor genes such as p53 and p16. P53
activates p21, which binds to all cyclin/Cdk activated checkpoints. P16 binds to
Cdk4 and Cdk6 complexes to inhibit their activity. Inactivation of these cell cycle
checkpoints leads to accumulation of genomic instability, and subsequently,
cancer development (Alberts et al., 2002).

2. Post-translational Modification of BRCA1
a. Phosphorylation
In response to DNA damage induced by ionizing radiation (IR), BRCA1 was
found to play a role in both DNA repair and cell cycle checkpoint activation.
BRCA1 deficient cells were found to be sensitive to IR or drugs that produced
double-stranded breaks, and further investigation into underlying mechanisms
revealed that BRCA1 plays a role in both homologous recombination (HR) and
non-homologous end joining (NHEJ), two DNA repair pathways (Zhang and
Powell 2005).

BRCA1 is shown to have roles in both S and G2/M checkpoint regulation in
response to ionizing radiation. Ataxia telangiectasia mutated (ATM), a protein
involved in cell cycle checkpoint control through phosphorylation of p53 in
response to IR-induced damage, phosphorylates BRCA1 at serine 1423. The
10

generation of a S1423A mutant of BRCA1 abolished G2/M arrest in response to
IR (Xu et al., 2001). ATM also phosphorylates serine 1387 on BRCA1, and
mutation of this specific site abrogates the S phase checkpoint, but not the G2/M
checkpoint, in response to IR (Xu et al., 2002). ATR and Chk2, two other
kinases that control the G2/M checkpoint in response to DNA damage, have also
been shown to phosphorylate BRCA1 at different sites.
BRCA1 has also been shown to have a physiological role in cell cycle regulation.
Aurora A, a protein involved in G2/M and mitotic regulation, has been shown to
phosphorylate BRCA1 at serine 308, thus facilitating timely G2/M progression.
Ouchi et al. (2004) demonstrated that introduction of a S308N BRCA1 mutant
into BRCA1 deficient mouse embryonic fibroblasts (MEF) resulted in a marked
decrease of cells entering the M phase comparable to that of a wild-type BRCA1
mediated G2/M arrest in response to DNA damage. Another study has shown
that ectopic expression of BRCA1 induced a G2/M arrest, regulated upstream by
ERK1/2, which belongs to the mitogen activated protein kinase (MAPK) family
(Yan et al., 2005). These data reveal that phosphorylation of BRCA1 plays an
important role in regulating cell cycle checkpoints physiologically, or in response
to DNA damage.

11

b. BRCA1 as a Ubiquitin Ligase
In recent years, it has also been revealed that BRCA1 acts an E3 ubiquitin ligase
when bound to its partner, BARD1. BRCA1 contains BRCT repeats at its C
terminus (exons 12-24), and a RING domain at its N terminus (exons 1-10),
which associates with BARD1. In a general ubiquitination cascade, E3 ubiquitin
ligases work with two other enzymes, E1, a ubiquitin activating enzyme, and E2,
a ubiquitin conjugating enzyme, to tag substrates for mono or poly-ubiquitination.
Polyubiquitin chains on substrate proteins tags them for degradation by the
proteasome, and monoubiquitination modifies protein substrates (Starita and
Parvin, 2006). BRCA1 ubiquitin ligase activity has been shown to be important in
controlling events within the centrosome.

Centrosome duplication occurs during late G1 and S phase, and after entry into
mitosis, cells normally contain two centrosomes that form the poles of the bipolar
mitotic spindle. Therefore, any aberration in centrosome duplication could lead
to multipolar spindle formation, subsequent mis-segregation of chromosomes,
and finally, aneuploidy development, a hallmark of cancer. BRCA1 localizes to
the centrosome during all phases of the cell cycle, and BRCA1/BARD1 E3
ubiquitin ligase activity has been shown to be important in regulating centrosome
number during S phase. Studies from Dr. Parvin’s laboratory revealed that
BRCA1 inhibition in mammary cell lines resulted in rapid accumulation of extra
12

centrosomes. Furthermore, BRCA1/BARD1 was shown to ubiquitinate γ-tubulin,
a centrosomal protein, at lysines 48 and 344 in vitro. Expression of K48R and
K344R γ tubulin mutants in cells resulted in a marked increase in centrosome
amplification, which revealed a novel role for BRCA1 in cell cycle regulation
(Starita et al., 2004).

Further studies from his lab also revealed that BRCA1/BARD1 ubiquitin activity
plays a role in centrosome function, through controlling centrosomal microtubule
nucleation activity during M phase. Using an in vitro aster (microtubule)
formation assay, mutant BRCA1 that was inactive as an ubiquitin ligase did not
inhibit aster formation by the centrosomes (Sankaran et al., 2005). Centrosome
mediated microtubule nucleation reaches its highest potential during mitosis,
coinciding with proper chromosomal segregation, and decreases in interphase,
after the cells exit mitosis. However, BRCA1 expression at the centrosome is at
peak levels during mitosis, which is contrary to what is expected if BRCA1
inhibits centrosomal nucleation activity. Interestingly, Parvin’s group discovered
that Aurora A kinase phosphorylates BRCA1 during M phase, thus reducing its
ubiquitin ligase activity, and minimizing the effect of BRCA1 on centrosomal
microtubule nucleation (Sankaran et al., 2007).

13

Recently, BRCA1 phosphorylation at serine 988 by Chk2 kinase has also been
shown to play a role in inhibiting microtubule nucleation, in addition to its role in
mediating BRCA1 response to DNA damage. Chabalier-Taste et al. (2008)
found that Chk2 phosphorylates serine 988 on BRCA1 in response to
microtubule damage induced by anti-mitotic drugs such as taxol and nocazodale.
Phosphorylated BRCA1 accumulates at the centrosomes, and when serine 988
on BRCA1 was mutated, inhibition of centrosomal nucleation activity was
abolished. These data suggests that phosphorylation of BRCA1 controls its own
ubiquitin ligase potential, which establishes a link between these post-
translational modifications in regulating events during mitosis.

BRCA1 has clearly shown to have an important role in cell cycle regulation.
Therefore, this may resolve the paradoxical nature of BRCA1 and explain why
loss of wild-type BRCA1 leads to growth defects and widespread chromosomal
abnormalities. BRCA1 may not fit the classical definition of a tumors suppressor
gene, but given its role in maintaining chromosomal stability during S and M
phase, loss of this gene could result in compromised cell viability. Aurora A has
also shown to be an important binding partner for BRCA1. Therefore, I will delve
further into the role of Aurora kinases in maintaining chromosomal stability.

14

3. Aurora Kinases Maintain Genetic Stability
The Aurora kinases were first indentified as a family of serine/threonine kinases
that play a critical role in mitotic regulation. The three members of this family
include Aurora-A, Aurora-B, and Aurora-C. This family of mitotic regulators first
came under scrutiny due to the fact that all three are over-expressed in a variety
of cancers. Aurora-A, for example, is over-expressed in early stage breast and
ovarian cancer, which suggests that aberrant expression of Aurora A may play a
role in carcinogenic progression. Interestingly, expression of all three kinases
peak during the G2-M phase of the cell cycle, and decrease during G1 and S
phase which provide further evidence for their role in regulating events during
mitosis.

Aurora A expression localizes predominantly to the centrosomes and mitotic
spindle. Its expression is regulated by the active Cdh1 form of the anaphase
promoting complex (APC), which targets key proteins for ubiquitin mediated
degradation to signal exit from mitosis (Castro et al., 2002). Upon mitotic entry,
Aurora A plays a role in centrosome maturation through its phosphorylation of
transforming acid coiled-coil (TACC) proteins. Aurora-A and TACC form a
complex at the centrosome and recruit microtubule associated proteins such as
centrosomin or γ tubulin, which promotes centrosome maturation and
microtubule growth (Ikezoe, 2008). Phosphorylation has shown to be important
15

in Aurora A activation, as Ajuba, a LIM domain containing protein, binds to
Aurora A, promoting its autophosphorylation and subsequent activation. This
interaction is important in facilitating Aurora A activation in late G2, and plays an
essential role in the recruitment of cyclin B1/Cdk1 to the centrosomes, resulting
in mitotic commitment (Hirota et al., 2003).

Induced over-expression of Aurora A in murine NIH 3T3 cells and a near diploid
human breast epithelial cell line, MCF10A, results in centrosome amplification
and induction of aneuploidy (Zhou et al., 1998). Similarly, conditional over-
expression of Aurora A in murine mammary epithelium resulted in a significant
increase in binucleated cells, and concurrent increase in p53 mediated apoptosis
(Zhang et al., 2004). This suggests that Aurora over-expression coupled with
p53 inactivation may promote tumorigenic transformation.

Aurora B expression, similar to that of Aurora A, also peaks during G2/M, with
maximal activity occurring between metaphase and mitotic exit. Its expression is
also controlled by APC
Cdh1
mediated proteasomal degradation. Aurora B is
localized to the inner centromeres (attaches to spindle fiber and located at the
center of chromosome) during metaphase, and upon anaphase onset, moves to
the central spindle where initiation of cleavage furrow (cytoplasmic separation)
16

during cytokinesis occurs. Aurora B forms a chromosomal passenger protein
complex with inner centromere protein (INCENP) and survivin during metaphase
to cytokinesis. This ternary complex plays a key role in cytokinesis completion
(Bolton et al., 2002).

Aurora B siRNA mediated inhibition in Drosophila cells induces polyploidy
formation in response to cytokinesis defects. This was accompanied by reduced
microtubule density at the central spindle, chromosome mis-segregation, partial
chromosome condensation, and reduced levels of phosphorylated serine 10
histone H3 (Giet and Glover, 2001). Phosphorylation of histone H3 at serine 10
is thought to be involved in chromosome segregation during prophase, thus
suggesting a multi-functional role for Aurora B in regulating all phases of mitosis.
In support of this theory, Aurora B inhibition leads to bypass of mitotic arrest after
treatment with paclitaxel (taxol), a mitotic inhibitor. This suggests that Aurora B
may also influence events at the mitotic spindle checkpoint, which is supported
by evidence of reduced kinetochore localization of BubR1 and Mad2, two mitotic
checkpoint regulators, after Aurora B inhibition (Ditchfield et al., 2003).

Aurora A and B are over-expressed in many cancer cells. Given the evidence
suggesting that aberrant expression of these kinases are linked to tumorigenic
17

progression, many small molecule inhibitors targeting both Aurora A and B, or
each kinase alone, has been developed. Some of these inhibitors are currently
undergoing clinical trial evaluation. BRCA1 and members of the Aurora kinase
family both have prominent roles in cell cycle regulation. As mentioned
previously, perturbation of cell cycle checkpoints lead to numerical chromosomal
alterations. BRCA1 and Aurora A/B seem to play a role in aneuploidy
progression, but these remain smaller pieces to a bigger puzzle.

Linking Aneuploidy and Cancer Progression
1. Aneuploidy: A Cause or Consequence of Cancer Development
Aneuploidy is characterized by a change in chromosome number that is not a
multiple of the haploid number, and is present in many human cancers,
particularly in aggressive malignant lesions associated with poorer prognosis
(Cahill et al., 1999; Giaretti, 1994). Although it has been nearly a century since
Boveri (1929) proposed that cancer is caused by aneuploidy, the question of
whether it is a cause or consequence of malignant progression is still
controversial (Duesberg vs. Weinberg).

According to the classical theory of cancer progression first advanced by Foulds
(1954) and Nowell (1976), random chromosomal abnormalities are acquired in a
18

gradual, stepwise manner throughout the course of the disease. Proponents of
this and the Weinberg theory (2006) hypothesize that cancer is promoted by
mutation. Their belief is that mutations that result in activation of oncogenes and
inactivation of tumor suppressor genes cause disruption of important signaling
pathways, thereby leading to cancer. Supporters of the Duesberg theory (2007)
believe that aneuploidy is the driving force in cancer progression, and multistep
carcinogenesis is initiated by a random aneuploidy, leading to chromosomal
imbalance, and subsequently, neoplastic transformation (Loeb, 1991).

a. Support of Aneuploidy as a Consequence of Cancer Development
Supporters of this theory view aneuploidy as a by-product of somatic mutation.
The number of mutant genes required for malignant transformation is
unattainable in the span of a human lifetime taking into consideration the low rate
of mutation per cell generation (Zimonjic et al., 2001). Therefore, aneuploidy is
considered to be a means to an end, whereby destabilizing the karyotype leads
to rapid generation of mutant alleles necessary for neoplastic transformation.
Proponents of this view argue that aneuploidy is a consequence of this
hypermutable state, used as a tool to accumulate mutant alleles, but not
necessary in driving progression towards malignancy. This theory was tested
through introduction of known carcinogens, SV40 ER, hTERT, and an oncogenic
allele of H-ras, into normal fibroblast and epithelial cell lines. Results indicated
19

that most transformed cell clones retained a structurally normal diploid karyotype,
and aneuploid variants suffered cell death or did not confer a selective
proliferative advantage (Torres et al., 2008). This finding was echoed in
Drosophila and C. elegans, as most aneuploids have severe developmental
defects or fail to develop (Dyban and Baranov, 1987). Work in mice also
demonstrates that trisomy animals generated using Robertsonian translocations
do not survive much later after birth.

b. Support of Aneuploidy as a Cause of Cancer Development
However, studies have shown that aneuploidy can be advantageous and
promote tumorigenesis, depending on the genetic background (Sotillo et al.,
2007). Weaver et al. (2007) demonstrated that aneuploidy prone mice with
reduced levels of CENP-E, a spindle assembly checkpoint regulator, display an
increase in the frequency of spontaneous lymphomas and benign lung tumors.
Over-expression of Mad2, another checkpoint regulator associated with
tetraploidy and aneuploidy development, also caused tumor formation (Sussan et
al., 2008). Paradoxically, Weaver’s group also demonstrated that Cenp-e
heterozygotes lacking tumor suppressor gene p19/ARF had decreased incidence
of tumors compared to p19/ARF controls. A study of progeny mice from a
Down’s syndrome female (extra 21
st
chromosome) crossed with an Apc
Min
male
demonstrated that trisomy suppressed development of intestinal tumors that
20

typically characterize Apc
Min
heterozygote mutants. These conflicting studies
seem to suggest that aneuploidy can promote tumorigenesis, but under certain
conditions. High levels of aneuploidy seem to have deleterious effects on the
fitness of the species. The mechanisms involved in maintaining this fine balance
is still poorly understood.

2. The Road to Aneuploidy Development
a. The Role of the Mitotic Spindle Checkpoint
Proteins responsible for maintaining the mitotic spindle checkpoint are commonly
mutated in many cancer cell lines, thereby highlighting the importance of the
spindle assembly checkpoint (SAC) in maintaining genomic stability (Dey, 2005;
Williams et al., 2008; Murray, 2004). The SAC plays an integral role in ensuring
the partition of genetic material into two daughter nuclei, and arrests the cell at
the mitotic spindle checkpoint if kinetochores are not properly attached to spindle
microtubules during metaphase.

Progression through anaphase is controlled by the anaphase promoting complex
(APC), an E3 ubiquitin ligase that targets substrates for degradation by the
proteasome (Murray, 2004). Anaphase does not start until all sister chromatids
are attached to opposite spindle poles at their kinetochores, thus establishing
tension between the two kinetochore attachments of a sister chromatid pair.
21

Once anaphase onset begins, the APC/Cdc20 complex adds polyubiquitin chains
to securin and cyclin B1 to secure their degradation, which in turn, activates
separase, a cysteine protein which is kept inactive through binding to securin and
cyclin B1/Cdk1. Separase facilitates the proteolytic cleavage of Scc1, a
component of the cohesin complex which is responsible for holding the sister
chromatids together. Once the cohesin complex is cleaved, sister chromatids
can separate and migrate to opposite ends of the spindle pole, thus triggering
anaphase initiation (Stemmann et al., 2001).

The mitotic checkpoint complex (MCC) localizes to the kinetochores during
mitosis, thereby ensuring all kinetochores are attached to spindle microtubules
during metaphase, thus achieving full occupancy and tension. The MCC is
comprised of Mad2, BubR1, and Bub3, and if chromosomes are not properly
aligned, these proteins bind to Cdc20 and inhibit its activity, thus blocking the
activity of APC/Cdc20, and activating the mitotic spindle checkpoint (Bharadwaj
and Hu, 2004). During pro-metaphase, in the absence of full occupancy at the
kinetochores, Mad2 is recruited to the unattached kinetochore by Mad1, and
Cdc20 is brought to the kinetochore by BubR1-Bub3. Mad2 undergoes a
conformational change, dissociates from Mad1 and binds to Cdc20, which is also
bound to BubR1-Bub3, thus forming the MCC (Figure 1).

22

Studies in mice have shown that Mad2 heterozygotes have a higher incidence of
papillary lung adenocarcinomas compared to wildtype mice, and mouse
embryonic fibroblasts derived from these mutants develop aneuploidy and show
premature sister chromatid separation (Michael et al., 2001). Bub3
haploinsufficient mice also display a slightly higher incidence of lung carcinoma
after carcinogen challenge compared to wildtype, and is accompanied by partial
loss of SAC function and development of moderate aneuploidy (Babu et al.,
2003). Following this trend, BubR1 heterozygote mice developed intestinal and
lung tumors at a higher incidence compared to wildtype mice after exposure to
the carcinogen, azoxymethane (AOM) (Dai et al., 2004). Interestingly, mice
carrying individual homozygous knockouts for all three of these genes are
embryonic lethal. Therefore, these SAC genes are essential for viability, and
knocking out one copy will predispose to aneuploidy and a higher incidence of
tumor formation.

23

Mitotic Spindle Checkpoint Regulation

Figure 1. The role of mitotic checkpoint proteins (MCC) in APC/Cdc20 activation.

Modified from J. Yeh
24

b. The Importance of Kinetochore-Microtubule Attachments
More recently, the concept of merotelic attachments has gained more attention
as a leading contender for aneuploidy development. In a normal scenario,
kinetochores attach to microtubules from a single spindle pole. However, if
kinetochores attach to microtubules from both spindle poles simultaneously, a
merotelic attachment forms, resulting in lagging chromosomes during anaphase.
This is dangerous because these attachments do not trigger cell cycle arrest and
apoptosis through activation of the MCC, and may induce chromosome mis-
segregation and aneuploidy development (Climini, 2008).

A recent study by Bachoum et al. (2009) showed that over-expression of kinesins
that affect kinetochore microtubule depolymerization significantly reduced lagging
chromosomes and instances of chromosome mis-segregation in cell lines that
are characterized by chromosomal instability (CIN) (Thompson and Compton,
2008). There is evidence that cell lines with CIN have very high rates of lagging
chromosomes compared to non-CIN cell lines, which suggests that merotelic
attachments may play an integral role in aneuploidy development (Comai, 2005).

c. Tetraploidy: An Intermediate Step to Aneuploidy Development
Severe ploidy changes are characteristic of many cancers, and the number of
chromosomes present in highly aneuploid cancer cells is usually near tetraploid.
25

This raises the possibility that the severe state of aneuploidy that characterizes
many human cancers is preceded by polyploidy. Polyploidy or tetraploidy occurs
when a cell possesses more than two sets of homologous chromosomes.
Tetraploidy may arise due to cellular stress, aging, or through normal
physiological processes (Zimmet and Ravid, 2000). There is thought to be
several mechanisms responsible for tetraploidy acquisition. One such process,
endoreplication, is defined as the process by which DNA replication occurs
without cell division. This is a normal, programmed process, and
megakaryocytes are an example of terminally differentiated polyploid cells that
evolved from this (Duelli et al., 2005). Cell fusion is another physiological
process that results in the generation of terminally differentiated polyploid cells.
However, there is evidence that suggests viral induced cell fusion can result in
proliferation of tetraploid cells in the presence of p53 inactivation, thereby
providing a link between viral infection and carcinogenesis (Ganem et al., 2007).

Cytokinesis failure generates tetraploidy by accident, and is brought about
through defects in proteins that control cytokinesis or accumulation of massive
errors in chromosome segregation. Tetraploidy may also arise through mitotic
slippage, whereby a prolonged mitotic arrest occurs due to activation of the
mitotic spindle checkpoint. If these arrested cells do not die through apoptotic
pathways, they may escape arrest (slippage) without completion of cytokinesis,
resulting in tetraploid cells re-entering G1 phase (Olaharski et al., 2006).
26

There is convincing evidence supporting the theory that tetraploidy is a transient
step to aneuploidy development. In early stage cancers such as early stage
cervical carcinogenesis or premalignant Barrett’s oesophagus, tetraploid cells are
present (Gallipeau et al., 1996). In the case of preneoplastic Barrett’s
oesophagus, p53 inactivation accompanies this tetraploid phenotype. Rb and
p53 are two tumor suppressor genes that are integral in suppressing proliferation
of tetraploid cells through control of the G1 checkpoint. These two proteins are
inactivated in many mature cancers that have near tetraploid karyotypes, which
suggests that tetraploidy is characteristic of some early stage cancers, but if
chromosomes are lost leading to aneuploidy, progression towards mature
carcinoma may be promoted.

However, more work needs to be done to understand the importance of
tetraploidy in tumor development. Tetraploid cells are genetically unstable, which
may lead to growth arrest and apoptosis, or be beneficial to tumorigenic
progression if cell cycle checkpoints are inactivated.

3. Examining the Link between Aneuploidy and Immortalization
Immortalization is another hallmark of cancer, and recent findings suggest there
is a potential link between aneuploidy and acquisition of replicative immortality.
27

A study by Williams et al. (2008) examined the relationship between trisomy and
immortalization by introducing an extra chromosome into mouse embryonic
fibroblasts (MEF) using Robertsonian translocations. Interestingly, they found
that an extra chromosome (1, 13, 16 or 19) impaired proliferation rates in these
cell lines compared to wildtype (euploid) controls. However, cell lines trisomic for
certain chromosomes were able to immortalize earlier compared to their euploid
controls. This suggests that proliferation defects in these trisomic cell lines do
not impede immortalization, and can eventually be overcome. Another
interesting finding also revealed that once immortalization occurred, both euploid
and trisomic cell lines were near tetraploid. This suggests that once the
immortalization barrier is surmounted, there is no difference in the degree of
aneuploidy that develops (Hayflick, 1965). Similarly, our lab has also established
an in vitro epithelial model to study the association between immortalization and
aneuploidy in cancer development.

a. Determinants of Immortalization
One defining characteristic of cancer cells is their ability to proliferate indefinitely
in vitro, compared to normal cells, which have a limited lifespan. This limited
lifespan has been attributed to telomere shortening, which occurs after each
progressive round of replication. Telomeres are specialized DNA-protein
structures that cap the ends of linear chromosomes. This telomeric sequence
28

consists of a repeating hexanucleotide motif, TTAGGG, which prevents
degradation of chromosomal ends. When telomere length shortens to a critical
level, the Hayflick limit is reached, otherwise known as senescence, or the first
mortality checkpoint (M1) (Maser and DePinho, 2002). Senescence is
characterized by a growth arrest at the G1 checkpoint. These cells can persist in
culture for months or years, but be unable to synthesize DNA.

However, cells may bypass senescence and continue to proliferate if crucial G1
checkpoint regulators such as p53 or RB are inactivated. These cells will
eventually reach crisis, the second mortality checkpoint (M2), due to
accumulating telomere dysfunction. Crisis is characterized by widespread
apoptosis and chromosomal instability. Structural abnormalities include
translocations, deletions, and amplifications, which are thought to be attributed to
telomeric loss (Counter et al., 1992). Crisis may act as a barrier against
immortalization, but rare cells will have acquired the genetic alterations to
overcome crisis and immortalize in culture. These cells are thought to have
activated telomerase, which is a ribonucleoprotein complex capable of
maintaining telomere length above the critical level (Bodnar et al., 1998).
Presence of hTERT, the catalytic subunit of telomerase, has been shown to
induce in vitro immortalization of normal cells.

29

Overview of Epithelial Models for Aneuploidy Development
Our laboratory has developed in vitro epithelial cell models to study the
relationship between crisis, telomere attrition, and aneuploidy development.
Using these models, previous graduate students have discovered a new
determinant of crisis, outside the classical view of telomere attrition. It should be
noted that much of the past work done on crisis utilized fibroblasts, while many
cancers have epithelial origins. Veliscescu et al. (2003) discovered that in cell
strains derived from benign ovarian epithelial tumors (cystadenomas), crisis may
be driven by alterations in DNA ploidy status.

Primary cultures of ovarian cystadenomas were transfected with a SV40 Large T
Antigen expression vector, which inhibits RB and p53 proteins, thus allowing
cells to bypass senescence (M1). At higher passages, cystadenoma strains will
start to undergo ploidy changes, thereby triggering initiation of crisis (M2). Cells
that overcome this first crisis may continue to proliferate, but will eventually
undergo a second crisis due to telomere attrition. Cells able to overcome these
two crises will have achieved replicative immortality.

Ovarian tumors of low malignant potential (LMP) were also transfected with a
SV40 Large T Antigen expression vector, but did not undergo crisis driven by
30

ploidy changes (ploidy-dependent), suggesting that these cells had acquired the
genetic alterations necessary to bypass ploidy dependent crisis. However, LMP
strains eventually underwent a telomere driven crisis (telomere-dependent) (Yu
et al., 2007).

Rationale
The underlying mechanisms leading to aneuploidy development are still poorly
understood. Our epithelial cell models provide us with opportunities to study the
longitudinal progression towards aneuploidy. This also allows me to investigate
the relationship between crisis, which is a barrier to replicative immortality, and
aneuploidy development. Thus, the topic of my dissertation focuses on
investigating the mechanisms triggering ploidy dependent crisis.
31

Chapter 2: A Mitotic Arrest Triggers In Vitro Crisis in Benign
Ovarian Tumors

Chapter 2: Abstract

Crisis is a mortality checkpoint characterized by widespread apoptosis. We
previously showed that epithelial cell strains derived from benign ovarian tumors,
and further transfected with SV40 Large T Antigen, undergo polyploidy followed
by aneuploidy as they approach in vitro crisis, thus providing us with a model to
study the consequences of aneuploidy on cancer development. We referred to
this event as ploidy dependent crisis because it is accompanied by a doubling in
DNA content. Here I show that the ploidy changes that precede crisis in this in
vitro system are triggered by a mitotic arrest. A decrease in DNA synthetic
activity in cells approaching crisis was confirmed by comparing the percentage of
BrdU incorporation at low versus high passage. This suggests that fewer cells
were transitioning through S phase and undergoing DNA replication as they
approached crisis. To investigate if the arrest is regulated downstream of the
G2 checkpoint, I compared the expression levels of Cdk1/cyclin B1, which
mediates entry into mitosis, and those of Cdk2/cyclin A, which regulates S phase
transition, in cells approaching crisis (primarily aneuploid) versus cells at cultured
earlier passages (primarily diploid). Formation of the Cdk1/cyclin B1 complex,
and Cdk1 activity were increased in cells approaching crisis, while formation of
32

the Cdk2/cyclin A complex, and Cdk2 activity were decreased in the same cells.
Increased expression of mitotic regulators during crisis, such as Bub3-BubR1, p-
histone H3, and securin was also observed. These data suggests that ploidy
dependent crisis is characterized by a cell cycle arrest at the M phase. The near
tetraploidy that characterizes cell populations approaching crisis, as well as cell
clones that spontaneously recover from crisis to give rise to immortal cell lines is
probably the result of cells overcoming the M phase arrest, leading to the
initiation of a new cycle before completion of cytoplasmic separation. Given that
a large number of human cancers are near polyploid, this could be an important
mechanism of aneuploidy development in cancer.

Chapter 2: Introduction

Replicative immortality is one of the most distinctive features of cancer cells
compared to normal cells. Normal cells cultured in vitro encounter two mortality
checkpoints. According to classical concepts, the first mortality checkpoint,
senescence, is characterized by a cell cycle arrest at the G1 checkpoint
(Hayflick, 1965). This can be overcome by expression of viral oncoproteins such
as SV40 Large T Antigen and others, which inactivate specific cell cycle
regulators. The second mortality checkpoint, crisis, is characterized by
widespread apoptosis.
33

Although it is well known that telomere attrition can be an important initiating
event leading to crisis and may be the predominant mechanism in certain cell
types such as fibroblasts (Harley et al., 1990), we showed earlier that cell strains
derived from benign ovarian epithelial tumors (cystadenomas) and expressing
SV40 Large T Antigen can undergo crisis in the absence of significant telomere
attrition. We referred to this event as ploidy dependent crisis because it is
preceded by a doubling of cellular DNA content, which can eventually lead to
aneuploidy (Veliscescu et al., 2003). In contrast, cell strains derived from ovarian
epithelial tumors of low malignant potential (LMP), and transfected with the same
SV40 Large T Antigen vector undergo a telomere dependent, but not a ploidy
dependent crisis (Yu et al., 2007). This suggests that LMP tumors, which can be
regarded as intermediate between benign and fully malignant ovarian tumors, are
able to overcome the mechanisms leading to ploidy dependent crisis.

I sought to better understand the mechanisms underlying the increase in DNA
content associated with ploidy dependent crisis. Given that recovery from the
crisis phenomenon can lead to aneuploidy, which is a hallmark of cancer, I
reasoned that such understanding could provide insights into the mechanisms of
acquisition of aneuploidy in certain cancers. I first sought to test the hypothesis
that the doubling of DNA content associated with ploidy dependent crisis is due
34

to a post S phase cell cycle arrest. The results showed that indeed, ploidy
dependent crisis is triggered by a cell cycle arrest during the M phase which, if
overcome, may lead to tetraploidy followed by aneuploidy.

Materials and Methods

Cell Strains and Culture Conditions. ML-10 cell strains were established from
primary cultures of benign epithelial ovarian tumors (cystadenomas), and ML-46
strains from ovarian tumors of low malignant potential (LMP) (Luo et al., 1997).
These strains were infected with an adenovirus vector expressing SV40 Large T
Antigen. All cells were grown in DMEM (Cell Culture Core Facility, USC)
supplemented with 10% FBS and 1% PS.

BrdU Incorporation. BrdU solution was added to culture medium at a final
concentration of 10 uM for 24 hours. Cells were trypsinized and washed in 1 mL
of staining buffer (PBS, 3%FBS, 0.09% sodium azide). Fixation was carried out
according to the protocol (FITC-BrdU flow kit, BD Pharmingen, cat #:552598),
and samples were stained with 7-AAD before flow cytometry analysis.
Fluorescence was measured on a Coulter Profile II flow

cytometer (Beckman
Coulter).

35

Western Blot Analysis. Nuclear extracts were harvested from tissue culture
dishes using a cell lifter (Fisher Scientific), and lysed in cold Buffer A (0.01 M
Hepes, 0.015 M MgCl
2
, 0.01 M KCL, 0.001 M DTT, 0.001 mg/mL leupeptin,
0.002 mg/mL aprotinin, 0.001 mg/mL pepstatin A, 0.0005 M PMSF, 0.001 M
beta-glycerophosphate, 0.001 sodium vanadate, 0.1% triton X, water) to
separate the cytoplasmic and nuclear fractions. Samples were placed on a
rocker at 4° C for 20 minutes, followed by centrifugatio n at 3500 rpm for 10
minutes. The cytoplasmic supernatant was decanted, and the nuclear pellet re-
suspended in cold Buffer C (0.02 M Hepes, 6.25% glycerol, 0.105 M NaCl,
0.0015 MgCl
2,
0.0002 EDTA, 0.001 mg/mL leupeptin, 0.002 mg/mL aprotinin,
0.001 mg/mL pepstatin A, 0.001 sodium vanadate, 0.05 uM PMSF, 0.25 uM DTT,
0.01 M beta-glycerophosphate, water) and placed on a rocker at 4° C for 30
minutes. After centrifugation at 13 000 rpm for 15 min at 4° C to collect cell
debris, the supernatants were collected and stored at -80° C. Protein
concentrations were determined using the BCA protein assay reagent kit
(Pierce). Samples containing 50 ug of protein were electrophoresed on a 10%
polyacrylamide gel and transferred onto PVDF membranes (Bio-Rad
Laboratories) at 4° C overnight. Membranes were blocked in 5% milk with 0.1%
PBS/Tween-20 (TBST) for an hour at room temperature (RT), followed by
incubation with primary (Santa Cruz, 1:200, p-histone H3 cat #:sc-8656-R, MBL,
1:1000, securin cat #: DCS-280) antibody for 1 hour at RT. Following three 10
minute washes in TBST, membranes were incubated with secondary antibody
36

(1:2500 anti-mouse, anti-rabbit) coupled to horseradish peroxidase for 1 hour at
RT. After three washes in TBST, protein bands were detected using ECL
Western reagents (Pierce).

Immunoprecipitation. Nuclear extracts were pre-cleared using 50 ul of protein
G (Santa Cruz, sc-2002) or L (Santa Cruz, sc-2336) agarose beads, followed by
centrifugation at 3000 rpm for 5 minutes. IP reactions were set up using 250 ug
of nuclear extract, 2 ug of antibody (Santa Cruz, cyclin A cat #: sc-239, cyclin B1
cat #: sc-245, BD Transduction Labs, Bub3 cat #: 611730), protease inhibitors
(aprotinin and leupeptin), and triton lysis buffer to a final volume of 1 mL. IP
reactions were placed on a rocker at 4° C for 2 hours, fo llowed by incubation with
50 ul of protein L or G agarose beads at 4° C overnigh t. Supernantant was
decanted, and immunoprecipitates were washed four times in triton lysis buffer,
and centrifuged at 2500 rpm for 5 minutes. Residual supernantant was aspirated
out using a 25 G 5/8 needle, beads resuspended in 20 ul of 2x Laemmli sample
buffer, and boiled in water for 3 minutes. Samples were electrophoresed on a
10% polyacrylamide gel followed by Western blotting (Santa Cruz, Cdk1 cat: sc-
8395, Cdk2 cat #: sc-6248, BD Transduction Labs, BubR1 cat #: 612502, Cdc27
cat #: 61054)

37

Cyclin-Dependent Kinase Assay. The activity of Cdk1 and Cdk2 were
analyzed according to protocol described by Schönthal (2004). IP reactions were
set up with 100 ug of nuclear extract, 10 ul of cyclin A or B1 antibody, and bound
to protein L or G agarose beads. The immunoprecipitates were re-suspended in
kinase reaction mix (50 uM “cold” ATP, 10 uCi γ-
32
P-ATP, and 2 ug of histone
H1), for a total reaction volume of 25 ul. The samples were boiled in 40 ul of 2x
Laemmli sample buffer and electrophoresed on a 10% polyacrylamide gel. The
amount of
32
P-Histone H1 was measured using a phosphoimager, and the gel
was later stained with Coomassie to detect for equal loading of antibody and
histone H1 protein.

Results

Ploidy dependent crisis is driven by a cell cycle arrest
Epithelial cells derived from benign ovarian tumors approaching ploidy-
dependent crisis is accompanied by a doubling in DNA content. I sought to
investigate if this doubling in DNA content is representative of a cell cycle arrest.
Cells were treated with BrdU and 7AAD (DNA marker) for 24 hours at early
passage (35 population doublings) and as they approached crisis (50 population
doublings). Flow cytometry analysis showed that the amount of BrdU
incorporation decreased in cells approaching crisis compared to those
38

undergoing logarithmic growth (Fig 2), in spite of a concomitant doubling in DNA
content. These results support the notion that crisis in cultured ovarian
cystadenomas is driven by a cell cycle arrest.

Cell cycle arrest associated with ploidy dependent crisis is regulated
downstream of the G2/M checkpoint
I next sought to confirm the presence of a cell cycle arrest and to better define
the exact stage of the cell cycle that is affected by investigating the expression
and activity of various cell cycle regulators associated with S, G2 and M phases.
I focused on these post G1 checkpoints because I reasoned that crisis would not
be associated with a doubling in DNA content if it was triggered by an arrest at a
stage preceding DNA replication. Cyclins A and B1 were immunoprecipitated
from nuclear extracts obtained from early passage cells and from cells
approaching crisis, followed by Western blotting (WB) and hybridization to
antibodies against Cdk1 and Cdk2. Expression of Cyclin A/Cdk2, which
regulates S phase progression, decreased in cells approaching crisis (Fig 3a),
whereas expression of cyclin B1/Cdk1, which regulates G2/M progression
expression, appears unchanged (Fig 3b). This finding was further confirmed by
kinase assays assessing Cdk1 (IP with cyclin B1) and Cdk2 activity (IP with
cyclin A) in nuclear extracts of cells harvested at the time of approaching crisis
versus during logarithmic growth phase (Fig 3c). The results showed that Cdk1
39

kinase activity increases and Cdk2 activity decreases during crisis, suggesting an
arrest is regulated by events downstream of cyclin B1/Cdk1.

I investigated whether the cell cycle arrest took place during the G2 versus M
phases by comparing the expression levels of p-histone H3 (marker of prophase)
in nuclear extracts collected from cystadenoma cultures undergoing logarithmic
growth or approaching crisis. Levels of p-histone H3 increased in cystadenoma
cells approaching ploidy dependent crisis compared to cells from earlier
passages (Fig 3d). This suggests the presence of an arrest during M phase,
between metaphase to anaphase transition, because p-histone H3 would have
decreased in cells approaching crisis if the arrest had occurred at the G2 phase.

An arrest at the mitotic spindle checkpoint is the main determinant of
ploidy dependent crisis
The anaphase promoting complex (APC) controls anaphase initiation, and
activation of the APC is inhibited by mitotic checkpoint proteins (MCC) such as
Mad2, BubR1, and Bub3, until all chromosomes are properly aligned (Hoyt et al.,
1991; Li and Murray, 1991). BubR1-Bub3 form a complex to inhibit APC
activation (Taylor et al., 1998), therefore, I sought to determine if this complex is
differentially expressed in crisis versus logarithmically growing cells. Bub3 was
40

immunoprecipitated in nuclear extracts collected from cystadenoma cultures
approaching crisis and undergoing logarithmic growth, followed by Western
blotting using an antibody against BubR1 (Fig 4a). Bub3-BubR1 was up-
regulated during crisis, indicating that a mitotic arrest is maintained by the MCC.
Furthermore, Cdc27, a component of the APC which catalyzes the ubiquitination
of cyclin B1 (Sudakin et al., 1995), thus ushering exit from mitosis, is decreased
during crisis (Fig 4b). Another product of APC ubiquitination, securin (Thornton
and Toczyski, 2003; Hagting et al., 2002) which is degraded to signal exit from
mitosis, is highly expressed in nuclear extracts harvested from cystadenoma
cultures approaching crisis versus logarithmic growth (Fig 4c). These results
indicate that a mitotic arrest is associated with changes in DNA ploidy as
cystadenoma-derived epithelial cells approach crisis.

Mitotic arrest is not associated with telomere dependent crisis
To test the theory that a mitotic arrest triggers changes in DNA ploidy, I
investigated if a cell cycle arrest is present in cultures derived from ovarian
epithelial tumors of low malignant potential (LMP), which had been infected with
the same viral expression vector for SV40 Large T Antigen. We showed earlier
that such cultures, while they undergo a telomere-driven crisis characterized by
telomere attrition, do not undergo a ploidy dependent crisis. BrdU and 7AAD
double staining revealed a slight increase in the number of cells in the S phase
41

as they approached crisis (Fig 5a). To confirm that changes in cyclin/Cdk
expression observed during ploidy-dependent crisis are independent of SV40
Large T Antigen expression, cyclin B1/Cdk1 and cyclin A/Cdk2 expression were
analyzed in nuclear extracts collected from LMP cells either approaching crisis or
during logarithmic growth. The results show a slight increase in cyclin A/Cdk2
expression during crisis (Fig 5b), and cyclin B1/Cdk1 (Fig 5c) expression remains
unchanged. Levels of p-histone H3 remained unchanged (Fig 5d), and securin
expression decreased (Fig 5e) in LMP cells approaching crisis versus logarithmic
growth. Taken together, these data are contrary to the observations made in
cystadenoma cultures undergoing a ploidy-driven crisis, indicating that a mitotic
arrest is not present during crisis characterized by telomere attrition.
42

Ploidy Dependent Crisis is Driven by a Cell Cycle Arrest

Figure 2. Cystadenoma-derived epithelial cells approaching crisis have
decreased BrdU incorporation. Primary cultures of ovarian cystadenomas were
transfected with SV40 Large T Antigen, thus allowing bypass of senescence,
which is characterized by a growth arrest at G1. At higher passages, DNA ploidy
changes start to accumulate, triggering crisis, which is characterized by
widespread apoptosis. Cells that overcome this first crisis will eventually
undergo a second crisis due to telomere attrition, and if this mortality checkpoint
is overcome, cells will have achieved replicative immortality. Cells undergoing
logarithmic growth and approaching crisis were treated with BrdU (marker of
DNA synthesis) in culture for 24 hours, followed by fixation and double staining
with 7AAD (marker for DNA) for flow cytometry analysis.
Velicescu M, et al.
Cancer Research,
2003
43

Cell Cycle Arrest Associated with Ploidy Dependent Crisis is
Regulated Downstream of the G2/M Checkpoint

Figure 3. Cyclin/Cdk complexes are differentially expressed in cystadenoma-
derived epithelial cells approaching crisis versus undergoing logarithmic growth.
Nuclear extracts harvested from crisis and log growth cells were
immunoprecipitated with cyclins A (A) or B1 (B), followed by Western blotting
against Cdk2 and Cdk1. Antibody only and nuclear protein only lanes served as
controls. C. Kinase assays assessed Cdk2 (IP with cyclin A) and Cdk1 (IP with
cyclin B1) activity using histone H1 as a substrate. The gel was stained with
Coomassie to ensure equal loading of the antibody and histone H1 protein.
Phosphorylation of histone H1 was measured from three independent
experiments using a phosphoimager to quantify the intensity of the bands, and
the average±SE was calculated. D. Western blotting was performed using an
anti p-histone H3 antibody to compare expression levels. Ku-70 was used as a
loading control.
44

Figure 3, Continued

45

An Arrest at the Mitotic Spindle Checkpoint is the Main
Determinant of Ploidy Dependent Crisis

Figure 4. Mitotic regulators are differentially expressed in cystadenoma-derived
epithelial cells approaching crisis versus undergoing logarithmic growth. Nuclear
extracts harvested from crisis and logarithmically growing cells were
immunoprecipitated with Bub3 antibody followed by Western blotting against
BubR1 (A) or Cdc27 (B). Antibody only and nuclear protein only lanes served as
controls. C. Western blotting was performed using an anti-securin antibody to
compare securin expression levels, and Ku-70 was used as a loading control.

46

Mitotic Arrest is Not Associated with Telomere Dependent Crisis

Figure 5. Epithelial cells derived from ovarian tumors of low malignant potential
(LMP) do not show evidence of a cell cycle arrest associated with telomere
dependent crisis. Primary cultures of ovarian tumors of low malignant potential
were transfected with a SV40 Large T Antigen expression vector, thus allowing
bypass of senescence. These cells do not undergo ploidy dependent crisis, but
undergo a telomere dependent crisis. A. LMP cultures undergoing logarithmic
growth and approaching crisis were treated with BrdU in culture for 24 hours,
followed by fixation and double staining with 7AAD for flow cytometry analysis.
Nuclear extracts harvested from LMP cultures undergoing logarithmic growth and
approaching crisis were immunoprecipitated with cyclins A (B) or B1 (C), followed
by Western blotting against Cdk2 or Cdk1. Western blotting was used to
compare expression levels of p-histone H3 (D) and securin (E).
Yu J, et al. British
Journal of Cancer,
2007
47

Figure 5, Continued

48

Discussion

My results show that a mitotic arrest precedes significant telomere attrition in
epithelial cells derived from benign ovarian tumors (cystadenomas) approaching
crisis. I hypothesize that a proportion of cells undergoing prolonged mitotic arrest
may escape, and abruptly re-enter the cell cycle at G1 phase without completion
of cytoplasmic separation, thus leading to tetraploidy development. These ploidy
changes precede the crisis event. We have previously shown that epithelial cells
that have acquired the genetic alterations necessary to overcome both ploidy and
telomere dependent crisis will spontaneously immortalize in culture. These
immortalized cell lines are characterized by a near diploid phenotype, which
suggests that chromosomes were lost, and that tetraploidy precedes aneuploidy
development. Therefore, overcoming mitotic arrest may be an important
mechanism behind acquisition of aneuploidy in at least some cancers.

The view that polyploidy precedes aneuploidy is supported by evidence of
tetraploidy in some early stage cancers. Preneoplastic lesions of Barrett’s
oesophagus (Doak et al., 2003) or early stages of cervical carcinogenesis
(Bharadwaj and Hu, 2004) are characterized by the appearance of tetraploid
cells. Loss of p53 normally accompanies this karyotype, as this protein is
thought to play a key role in preventing proliferation of tetraploid subpopulations.
49

Both RB and p53 are frequently mutated in many cancer cells (Olaharski et al.,
2006), particularly in more aggressive, malignant lesions, which are typically
characterized by a near tetraploid number of chromosomes. This suggests that
acquisition of aneuploidy may be associated with greater tumorigenic potential.

Tetraploidy is thought to arise through uncorrected errors in chromosome
segregation. Mitotic spindle proteins such as BubR1, Bub3, and Mad2 are
localized to the kinetochores and detect kinetochore-microtubule misalignment,
leading to activation of the mitotic spindle checkpoint to allow time for repair of
these errors (Sherr and McCormick, 2002). However, if arrested cells are not
repaired or undergo programmed cell death, cells may escape from prolonged
mitotic arrest even if kinetochore-microtubule misalignment persists. This is
evidenced by spindle poisons such as nocazodale, which induces mitotic arrest
that may be overcome after prolonged treatment, leading to the generation of
tetraploid cells. My results show that this process may occur in the absence of
synthetic inhibitors, as a mitotic arrest is overcome in epithelial strains
approaching crisis, leading to acquisition of tetraploidy. Normally, a post-mitotic
G1 checkpoint leads to another cell cycle arrest in tetraploid cells that arise from
mitotic slippage, thereby reducing the risk that such mitotic errors will be
propagated. However, this G1 checkpoint is p53 dependent, a protein that is
non-functional in many cancers.
50

I have also shown p53 and RB inactivation alone are not determinants of
aneuploidy progression. Epithelial cells derived from tumors of low malignant
potential (LMP) and transfected with SV40 Large T Antigen expression vector,
thus inhibiting RB and p53, do not undergo mitotic arrest. We have previously
shown that these cell strains bypass ploidy dependent crisis as well, which
suggests that they have somehow acquired the ability to bypass mitotic arrest
and changes in DNA ploidy status. This may explain why these LMP tumors are
near diploid (aneuploid) in vivo. LMP or borderline tumors share characteristics
of both benign and malignant lesions, and are considered to be intermediate
between cystadenomas and carcinomas. Given that a mitotic arrest triggering
tetraploidy acquisition is present in epithelial cells derived from cystadenomas,
but not LMP tumors, further supports the view that progression from tetraploidy to
aneuploidy increases malignant potential. Therefore, understanding the
mechanism behind this transition will give us greater insight into the determinants
of malignant progression in cancer.

51

Chapter 3: Down-regulation of BRCA1 in Benign Ovarian Tumors
Approaching In Vitro Crisis Abrogates Mitotic Arrest

Chapter 3: Abstract

I showed in the previous chapter that epithelial strains derived from benign
ovarian tumors and further transfected with SV40 Large T Antigen undergo a
mitotic arrest associated with the development of tetraploidy, followed by
aneuploidy, as they approach ploidy dependent crisis. I hypothesized that
BRCA1, a protein controlling familial breast and ovarian cancer predisposition, is
involved in regulating this M phase arrest. I revealed that down-regulation of
BRCA1 abrogates mitotic arrest associated with ploidy dependent crisis, leading
to acquisition of tetraploidy, which precedes aneuploidy development. After
sorting of cells approaching crisis, BRCA1 expression levels were found to be
approximately three fold lower in the tetraploid fraction compared to the diploid
fraction. Typically, net proliferation is markedly decreased as cells approach
crisis, however, down-regulation of BRCA1 expression using siRNA prevented
such decrease, allowing the cell cultures to continue to expand at rates
comparable to those seen at early passages. Down-regulation of BRCA1 also
led to an increase in cells with a tetraploid number of chromosomes as
evidenced from DNA profiling studies by flow cytometry and examination of
52

metaphase spreads. This may, in part, account for the fact that cancers that
develop in BRCA1 mutation carriers are typically highly aneuploid.

Chapter 3: Introduction

One distinctive difference between normal and cancer cells cultured in vitro is the
ability of cancer cells to proliferate indefinitely in culture (Hayflick, 1965). Normal
cells cultured in vitro encounter two mortality checkpoints. According to classical
concepts, the first mortality checkpoint, senescence, is characterized by a cell
cycle arrest at the G1 checkpoint while the second, crisis, is characterized by
widespread apoptosis, often triggered by telomere attrition (Hara et al., 1991;
Shay et al., 1991). Although most of this knowledge is based on studies utilizing
cultured fibroblasts, most human cancers arise from epithelial cells. Using an
epithelial cell model that we felt is more reflective of human cancers, I showed in
the preceding chapter that the primary determinant of crisis in epithelial strains
derived from benign ovarian tumors, and transfected with SV40 Large T Antigen,
is not telomere attrition, but a mitotic arrest. If overcome, this leads to the
development of polyploidy, followed by aneuploidy. We referred to this as a
ploidy dependent crisis as it is accompanied by a doubling of DNA content prior
to the development of aneuploidy (Velicescu et al., 2003).

53

Aneuploidy, characterized by a change in chromosome number that is not a
multiple of the haploid number, is present in many human cancers, particularly in
aggressive malignant lesions associated with poorer prognosis (Cahill et al.,
1999; Giaretti, 1994). BRCA1, a protein that is commonly mutated in familial
breast and ovarian cancer (Miki et al., 1994; Futreal et al., 1994) has been shown
to play a critical role in preventing centrosome amplification, a chromosomal
instability (CIN) that is thought to lead to aneuploidy development (Sankaran et
al., 2007). However, the idea that BRCA1 may function as a determinant of
aneuploidy development is still a controversial issue. To resolve this issue, I
sought to understand the role of BRCA1 in acquisition of aneuploidy.

I utilized our epithelial cell strains to examine the role of BRCA1 isoforms in
controlling ploidy dependent crisis. I reasoned that germline BRCA1 mutations in
individuals predisposed to breast and ovarian cancer, would affect all three
known gene products, full length BRCA1, IRIS (ElShamy and Livingston, 2004),
and Delta11b (Wilson et al., 1997). However, my findings suggest that only
alterations in full length BRCA1 expression plays a role in regulating mitotic
arrest associated with the crisis event. I demonstrated that down-regulation of
full length BRCA1 leads to abrogation of mitotic arrest, and subsequently,
acquisition of tetraploidy in these epithelial strains approaching ploidy-dependent
54

crisis. This may explain why BRCA1 related cancers are frequently severely
aneuploid, high grade malignant lesions (Foulkes, 2008).

Materials and Methods

Cell Strains and Culture Conditions. Refer to Chapter 2.

FACS. ML-10 cells cultured on tissue culture dishes were incubated in DMEM
(Cell Culture Core Facility, USC) supplemented with 10%

FBS in the presence of
10 μM Hoechst 33342 reagent (Molecular

Probes) for 60 min at 37° C. After
dissociation

with 0.05% trypsin/0.02% EDTA, the cells were resuspended in

DMEM plus 20% FBS and 10 μM Hoechst 33342. The cells were sorted based
on fluorescence intensity

using a FACSar plus cytometer (Becton Dickinson).

Analysis of DNA Ploidy by Flow Cytometry. Cells were trypsinized and one
million cells re-suspended in 0.2 mLs of PBS, and fixed in 2 mLs of 70% ethanol.

After centrifugation, the cell pellets were resuspended in 1

ml of PBS, 10 μg/ml
propidium iodide, and 100 ug/ml

RNase. Fluorescence was measured on a
Coulter Profile II flow

cytometer (Beckman Coulter).

Transfection. Cells were transfected with siRNA against BRCA1 (5’
CGAUUUGACGGAAACAUCU 3’) and IRIS (5’ UUUUACAAAUUUCCAAGUA 3’)
55

at 30-50% confluency with Lipofectamine 2000 (cat #: 11668019, Invitrogen) for
72 hours according to protocol.

Qt RT PCR. RNA extraction (Trizol Reagent, Invitrogen), digestion with DNase
(New England Biolabs), and cDNA synthesis with oligo dT (Invitrogen) was
carried out according to protocol. 1:10 and 1:100 dilutions of cDNA were
prepared, and 8 ul of cDNA was used in a total reaction volume of 20 ul. Probes
(BRCA1 5’ AAAATAATCAAGAAGAGCAAAGCATGGATTCAAACT 3’, IRIS 5’
AAATGTTTATGCTTTTGGGGAGCACATTTTACA 3’) at a final concentration of
200 nM, forward (BRCA1 5’ AAGAGGAACGGGCTTGGAA 3’, IRIS 5’
TTGTGTTTGCCCCAGTCTATTT 3’, Delta 11b 5’
GCTGAGAGGCATCCAGAAAAGT 3’) and reverse (BRCA1 5’
CACACCCAGATCCTGCTTCA 3’, IRIS 5’ AAGCAGT
TCCTTTAACTATACTTGGAAA 3’, Delta11b 5’ GCCCTGAGCAGTCTTCAGAGA
3’) primers at 150 nM each, and Taqman Universal PCR master mix (PE Applied
Biosystems, Foster City, CA) were also added. Thermal cycle conditions
included 40 cycles of 95° C for 30s, followed by 61° C for 1 min. Analysis of RT
data was accomplished using ABI Prism 7700 Sequence Detection System (PE
Applied Biosystem).

56

Western Blot Analysis. Refer to Chapter 2. The primary antibody used is anti-
BRCA1 (1:200, Santa Cruz, cat #: sc: 645).

Metaphase Spreads. Cells were trypsinized and prepared for spreading
according to the protocol by Hseish CL (1994). After fixation, cells were dropped
from a distance onto glass sides, dried at room temperature, and stained with
hematoxylin and eosin. Light microscopy was used to take pictures of the
spreads.

Results

Expression of BRCA1 isoforms decrease during crisis
I sought to investigate if expression of BRCA1 isoforms change in cystadenoma-
derived epithelial cells approaching crisis (50 populations doublings) compared to
logarithmic growth (35 population doublings). RNA extraction, cDNA synthesis,
and Qt-RT-PCR using gene specific primers against delta11b, IRIS, and BRCA1,
were carried out to detect for differential expression at the RNA level (Fig 6a-c).
Western blotting was also performed to examine BRCA1 nuclear protein levels
(Fig 6d). All three isoforms were down-regulated in primary cultures derived from
benign ovarian tumors approaching crisis, which suggests that changes in
BRCA1 expression may be involved in regulating the crisis phenomenon.

57

Down-regulation of BRCA1 isoforms leads to changes in cyclin/Cdk
expression
As mentioned in the previous chapter, a mitotic arrest associated with ploidy
dependent crisis is characterized by a decrease in cyclin A/Cdk2, which
regulates S phase expression, whereas cyclin B1/Cdk1, which regulates G2/M
expression, remains unchanged. Delta11b is known to be a cytoplasmic protein,
therefore, we focused on examining if changes in BRCA1 and IRIS, both nuclear
proteins, influences expression of these complexes. Full length BRCA1 was
down-regulated using siRNA targeted against the C terminus (Fig 7a), and IRIS,
which terminates within intron 11 of BRCA1, was inhibited using siRNA against
intron 11, in cells approaching crisis (Fig 7b). Cyclins A and B1 were
immunoprecipitated from nuclear extracts obtained from cells approaching crisis
treated with siRNA against IRIS, BRCA1, and GFP (negative control) for 72
hours, followed by Western blotting against Cdk1 and Cdk2. Cyclin A/Cdk2 and
cyclin B1/Cdk1 expression decreased in cells treated with siRNA against IRIS
versus GFP (Fig 7c), whereas cyclin A/Cdk2 remains unchanged and cyclin
B1/Cdk1 decreases in cells treated with siRNA against BRCA1 compared to GFP
(Fig 7d). This suggests that down-regulation of IRIS caused an overall decrease
in cell cycle progression. In the previous chapter I showed that a M phase
blockage in cells approaching crisis results in an increase in Cdk1 activity and
high cyclin B1/Cdk1 levels compared to earlier passages. A decrease in cyclin
58

B1/Cdk1 expression after BRCA1 knockdown in cells approaching crisis,
suggests that the mitotic arrest may have been overcome.

Down-regulation of BRCA1 expression plays a role in controlling crisis
Mitotic arrest is the primary determinant of ploidy dependent crisis, and as
previously established, this is accompanied by an overall decrease in
proliferation rates. I sought to determine if down-regulation of BRCA1 and IRIS
in cells approaching crisis regulates mitotic arrest, by examining its
consequences on proliferation. Cell counts were calculated using a Coulter
Counter at two time points, 24 and 72 hours post transfection. Proliferation rates
were compared between cells transfected with siRNA against IRIS (Fig 8a) or
BRCA1 (Fig 8b) versus GFP. Down-regulation of IRIS caused a decrease in
proliferation rates, which is supported by the evidence of an overall decrease in S
and G2/M progression from the previous figure. This suggests that IRIS may not
have a role in regulating the mitotic arrest. However, down-regulation of BRCA1
increased proliferation in cells approaching crisis. This is reflected in a shorter
doubling time of 1.2 days in the BRCA1 siRNA group compared to a longer
doubling time of 2.7 days in the GFP siRNA control group.

To determine if the effects of BRCA1 down-regulation is specific to the crisis
event, BRCA1 expression was inhibited in epithelial strains undergoing
logarithmic growth (Fig 8c). Proliferation was not affected after BRCA1 down-
59

regulation compared to the GFP siRNA control (Fig 8d), as evidenced by the
doubling times of cells transfected with siRNA against GFP (1.3 days) versus
BRCA1 (1.4 days). Interestingly, BRCA1 down-regulation in cells approaching
crisis caused a shorter doubling time of 1.2 days, comparable to the doubling
time of cells undergoing logarithmic growth treated with siRNA against GFP (1.3
days). These data indicates that inhibition of a specific isoform of BRCA1, full
length BRCA1, rescues proliferation in cells approaching crisis. Therefore, this
protein may play a role in abrogating mitotic arrest.

Down-regulation of BRCA1 abrogates mitotic arrest leading to acquisition
of tetraploidy
I hypothesized that a proportion of epithelial cells undergoing prolonged mitotic
arrest may escape, thus abruptly exiting mitosis without completing cytoplasmic
separation, leading to acquisition of tetraploidy. I further hypothesized that
changes in BRCA1 expression may play a role in abrogating mitotic arrest, based
on earlier observations that BRCA1 down-regulation rescued proliferation in cells
approaching crisis. Firstly, to establish if changes in BRCA1 expression is
associated with DNA ploidy status, cystadenoma-derived epithelial cells
approaching crisis were separated using fluorescence activated cells sorting
(FACS) into diploid and tetraploid fractions, put back into culture, and harvested
for RNA extraction the following day. BRCA1 RNA expression was significantly
60

decreased in the tetraploid versus diploid fraction, thereby lending support to the
theory that changes in BRCA1 expression lead to abrogation of M phase arrest
(Fig 9a).

To test the hypothesis, cystadenoma cultures approaching crisis were treated
with siRNA against GFP and BRCA1 for 72 hours, followed by cell cycle profile
analysis using flow cytometry to detect for changes in cell cycle progression (Fig
9b). Tetraploidy is represented in the 4N peak, which includes tetraploid cells
undergoing G1 transition, and the 8N peak, which represent tetraploid cells
undergoing G2/M. Flow analysis demonstrated that siRNA treatment against
BRCA1 caused an increase in tetraploidy formation (4N and 8N peaks)
compared to its GFP control, suggesting that BRCA1 down-regulation abrogates
mitotic arrest, leading to an increase in tetraploidy acquisition. To confirm this
finding, epithelial strains undergoing logarithmic growth were treated with siRNA
against GFP and BRCA1 for 72 hours, followed by cell cycle analysis using flow
cytometry (Fig 9c). As expected, DNA profiles remained unchanged between the
two groups as these cells were growing logarithmically, and had not undergone a
mitotic arrest. To further quantify the effect of BRCA1 down-regulation on
tetraploidy development in cystadenoma cultures approaching crisis, metaphase
spreads were collected 72 hours post siRNA transfection against GFP and
BRCA1 (Fig 9d). Slides were stained with H&E, and pictures of 50 metaphase
spreads from each treatment group were taken, in two independent experiments.
61

Diploid spreads were scored as 46±5 chromosomes, and tetraploid spreads
scored as 92±5 chromosomes. The Fisher’s Exact T Test was used for statistical
analysis, and in both experiments, there was a statistically significant increase
(p=0.03) in the number of tetraploid spreads after siRNA treatment against
BRCA1 compared to GFP. These results indicate that BRCA1 facilitates
abrogation of mitotic arrest, leading to acquisition of tetraploidy.

Changes in mitotic regulators control acquisition of tetraploidy after
BRCA1 inhibition.
I sought to investigate the mechanism behind BRCA1 down-regulation leading to
acquisition of tetraploidy. Mitotic spindle proteins such as BubR1, Bub3, and
Mad2 are localized to the kinetochores and detect kinetochore-microtubule
misalignment, leading to activation of the mitotic spindle checkpoint if these
errors are detected (Bharadwaj and Hu, 2004). Therefore, changes in
expression of these, and other mitotic regulators may facilitate escape from
mitotic arrest, leading to re-entry into G1 phase without completion of cytokinesis.
In the previous chapter, I showed that a mitotic arrest in cystadenoma-derived
epithelial cells approaching crisis is accompanied by elevated levels of p-histone
H3, Bub3-BubR1, and a decrease in expression of Cdc27. Using Western
blotting, I examined expression levels of these proteins, as well as Mad 2, in
nuclear extracts harvested from cells approaching crisis treated with siRNA
against BRCA1 versus GFP for 72 hours (Fig 10a). P-histone H3 and BubR1
62

levels decreased, and Cdc27 expression increased, which suggests that
changes in expression of these mitotic regulators facilitate escape from mitotic
arrest after BRCA1 down-regulation.

Completion of cytokinesis also requires the activity of a ternary complex, coined
the chromosomal passenger complex, consisting of Aurora B, inner centromere
protein (INCENP), and survivin (Bolton et al., 2002). To test my theory that cells
escaping mitotic arrest after BRCA1 down-regulation re-enter G1 without
completion of cytoplasmic separation, I examined expression of this complex in
nuclear extracts harvested from cystadenoma cultures approaching crisis treated
with siRNA against BRCA1 and GFP (Fig 10b). Western blotting revealed that
expression levels of Aurora B and survivin decreased in the BRCA1 versus GFP
siRNA group. This indicates that BRCA1 down-regulation leading to tetraploidy
acquisition in cells approaching crisis, is due to a cytokinesis defect.
63

Expression of BRCA1 Isoforms Decrease during Crisis

Figure 6. Expression of BRCA1 isoforms is down-regulated in cystadenoma-
derived epithelial cells approaching crisis. Expression of three gene products
encoded by BRCA1, delta 11b (A), IRIS (B), and BRCA1 (C), was analyzed at
the RNA level during crisis versus logarithmic growth using Qt-RT-PCR with
isoform-specific probes and primers. Relative expression was compared using
the comparative threshold cycle method (deltadeltaCt), with RNase P serving as
an internal control. D. Nuclear extracts were harvested from crisis and
logarithmically growing cells, followed by Western blotting with an anti-BRCA1
antibody. Ku-70 served as a loading control.
64

Down-regulation of BRCA1 Isoforms leads to Changes in
Cyclin/Cdk Expression

Figure 7. BRCA1 and IRIS inhibition in cystadenoma-derived epithelial cells
approaching crisis causes changes in cyclin/Cdk expression. Cells approaching
crisis were treated with siRNA against GFP (negative control), BRCA1 (A) and
IRIS (B) for 72 hours, followed by RNA extraction, cDNA synthesis, and Qt-RT-
PCR using BRCA1 and IRIS specific probes and primers to detect the extent of
knockdown at the RNA level. Relative expression was compared using the
comparative threshold cycle method (deltadeltaCt), with RNase P serving as an
internal control. Nuclear extracts harvested from these cells were
immunoprecipitated with cyclin A or B1, followed by Western blotting against
Cdk2 or Cdk1 to detect for changes in cyclin A/Cdk2 (C) and cyclin B1/Cdk1
expression (D). Antibody only and nuclear protein only lanes served as controls.
65

Down-Regulation of BRCA1 Expression Plays a Role in
Controlling Crisis

Figure 8. BRCA1 inhibition rescues proliferation in cystadenoma-derived
epithelial cells approaching crisis. Cell strains approaching crisis were treated
with siRNA against GFP, IRIS (A), and BRCA1 (B). 24 and 72 hours after the
initial treatment, 3 dishes from each treatment group were trypsinized, and cells
counted using a Coulter Counter. The average cell count of three dishes from
each treatment group was plotted on a log scale over two time points. Error bars
represent standard error. C. Cells undergoing logarithmic growth were treated
with siRNA against GFP and BRCA1 for 72 hours, followed by QT-RT-PCR to
analyze relative BRCA1 expression. D. These cells were counted at the
indicated time points post siRNA treatment using the Coulter Counter and the
method described above.
66

Down-Regulation of BRCA1 Abrogates Mitotic Arrest leading to
Acquisition of Tetraploidy

Figure 9. BRCA1 inhibition abrogates mitotic arrest leading to tetraploidy
development in cystadenoma-derived epithelial cells approaching crisis. A.
Cells approaching crisis were sorted into diploid and tetraploid fractions using
fluorescence activated cell sorting (FACS), and re-cultured for 24 hours. Qt-RT-
PCR was used to detect BRCA1 RNA expression in diploid and tetraploid
fractions. Cell strains approaching crisis (B) and undergoing logarithmic growth
(C) were treated with siRNA against GFP and BRCA1 for 72 hours, trypsinized,
fixed in 70% ethanol, and stained with propidium iodide for DNA profiling using
flow cytometry. D. Cells approaching crisis were treated with siRNA against GFP
and BRCA1 for 72 hours, fixed, and dropped from a distance onto glass slides to
create metaphase spreads, followed by staining with H&E.

67

Figure 9, Continued

68

Changes in Mitotic Regulators Control Acquisition of Tetraploidy
after BRCA1 Inhibition

Figure 10. BRCA1 inhibition in cystadenoma-derived epithelial cells
approaching crisis leads to changes in expression of mitotic regulators. Cells
approaching crisis were treated with siRNA against GFP and BRCA1 for 72
hours, followed by nuclear protein extraction. A. Western blotting was
performed to examine differential expression of known mitotic regulators in GFP
versus BRCA1 groups. B. Western blotting was used to detect for changes in
expression of the chromosomal passenger complex.

69

A Novel Model for Aneuploidy Development in Cancer

Figure 11. A novel, mechanistic model for the progression of aneuploidy in
cancer. Cancer arises amongst a background of proliferation, made permissible
by mutations such as p53 or RB inactivation, which may give rise to a population
of genetically abnormal pre-cancerous cells. Due to accumulation of mitotic error
in these cells, the mitotic spindle checkpoint is activated, and the majority of
these arrested cells will die due to apoptosis. However, if alterations in
expression of mitotic regulators such as BRCA1 occur, this may facilitate
abrogation of mitotic arrest, leading to an abrupt exit from mitosis without
completion of cytoplasmic separation, and subsequent acquisition of tetraploidy.
Tetraploid cells are genetically unstable, but if chromosomes are lost resulting in
aneuploidy, then progression towards low or high grade carcinoma may ensue
depending on the severity of aneuploidy that develops.
70

Discussion

Our laboratory previously found that cell clones that are able to recover from
crisis, a mortality checkpoint, are aneuploid and have achieved replicative
immortality, two hallmarks of cancer. Using these cell models, my studies have
revealed a novel role for BRCA1 in controlling the crisis phenomenon. In the
previous chapter, I have observed that a mitotic arrest is the primary determinant
of ploidy dependent crisis in epithelial strains derived from benign ovarian tumors
(cystadenomas). I now reveal that BRCA1 inhibition facilitates escape from this
arrest, leading acquisition of tetraploidy, which is thought to be an intermediate
step towards aneuploidy development.

BRCA1 is a multi-functional protein involved in many aspects of cell cycle
regulation (Vaughn et al., 1996; Chen et al., 1996), DNA repair (Scully et al.,
1997; Scully et al., 1999) and chromatin remodeling (Bochar et al., 2000). It has
been suggested that cancers with germline BRCA1 mutations display an
aggressive, aneuploid, and undifferentiated phenotype due to deficiency in DNA
repair. However, this is evidence suggesting that BRCA1 also plays a role in
mitotic regulation. BRCA1 has been shown to regulate transcription of Mad2, a
spindle checkpoint protein (Wang et al., 2004). BRCA1 has also been implicated
in controlling centrosome number during the S phase of the cell cycle (Starita et
71

al., 2004), as well as centrosomal nucleation activity during M phase (Sankaran
et al., 2005). My results reveal a novel role for BRCA1 in regulating a M phase
arrest during ploidy dependent crisis. Furthermore, loss of IRIS, another known
gene product of BRCA1, seems to result in an overall decrease in cell cycle
progression and proliferation, thereby highlighting the distinct functions of these
two proteins.

I conclude that BRCA1 may be involved in regulating the mitotic spindle
checkpoint, and that loss of BRCA1 results in mitotic slippage, a mechanism for
tetraploidy development. Therefore, I propose a novel mechanistic model for the
acquisition of aneuploidy in cancer, in which a mitotic arrest is initiated in
response to accumulation of mitotic errors as cells age in vivo. Under normal
physiological conditions, these cells will undergo crisis (apoptosis) and die, but if
mutations that alter BRCA1 expression coupled with p53 and RB inactivation
occur, cells may overcome mitotic arrest, leading to tetraploidy, and subsequent
aneuploidy development (Fig 11). I conclude that down-regulation of BRCA1
facilitates escape from mitotic arrest, causing an abrupt exit from mitosis without
completion of cytoplasmic division (cytokinesis), which leads to the generation of
tetraploid cells that are able to proliferate due to the absence of a p53 dependent
post mitotic G1 checkpoint. Tetraploid cells are thought to be genetically
unstable, but if chromosomes are lost resulting in aneuploidy, then low or high
72

grade carcinoma may develop depending on the severity of aneuploidy that
ensues.

My results reveal a novel relationship between alterations in BRCA1 expression
and crisis initiation. Down-regulation of BRCA1 in cystadenoma-derived
epithelial cells approaching crisis caused an increase in cell proliferation, which
may delay crisis onset and influence acquisition of replicative immortality. To test
this view, we plan to introduce a stable knockdown of BRCA1, and investigate
this effect on the timing of crisis. Therefore, our epithelial cell model for
aneuploidy development provides exciting opportunities to investigate the
mechanisms behind progression towards immortalization, and to address the
century old question first proposed by Boveri (1929), of whether aneuploidy is a
cause of cancer development.
73

Chapter 4: Aurora A Controls BRCA1 Expression in Benign
Ovarian Tumors Approaching In Vitro Crisis

Chapter 4: Abstract

Our laboratory has established an in vitro epithelial cell model to study the
development of aneuploidy, a hallmark of cancer. Epithelial strains derived from
benign ovarian tumors were transfected with SV40 Large T Antigen, allowing
bypass of senescence, the first mortality checkpoint, but not crisis, the second
checkpoint. As these cells approach crisis, they undergo ploidy changes that are
characterized by a doubling in DNA content, which we refer to as a ploidy
dependent crisis. I showed in the previous chapters that this doubling in DNA
content is reflective of a mitotic arrest, and that down-regulation of BRCA1, a
protein that is commonly mutated in breast and ovarian cancer, facilitates escape
from prolonged mitotic arrest leading to tetraploidy, a precursor to aneuploidy
development. I sought to identify upstream factors responsible for mediating
these changes in BRCA1 in this chapter. Here I show that Aurora A is involved
in controlling BRCA1 expression during ploidy dependent crisis and therefore,
plays a role in regulating mitotic arrest. Aurora A protein levels and kinase
activity are up-regulated in epithelial strains approaching ploidy dependent crisis,
but subsequent down-regulation of this protein using siRNA resulted in a
decrease in tetraploidy development and concomitant decrease in proliferation.
74

Aurora A down-regulation also caused an increase in BRCA1 expression in cells
approaching crisis, suggesting that over-expression of Aurora A inhibits BRCA1
expression during the crisis phenomenon. Down-regulation of both BRCA1 and
Aurora A using siRNA rescued net cellular proliferation and tetraploidy
development compared to siRNA against Aurora A alone, further supporting the
notion that BRCA1 is a key downstream target of Aurora A, and over-expression
of Aurora leading to inhibition of BRCA1 may facilitate abrogation of mitotic
arrest, resulting in tetraploidy development. This may provide a possible
mechanism to account for the fact that over-expression of Aurora A is associated
with the appearance of aggressive and severely aneuploid lesions in many
human cancers.

Chapter 4: Introduction

Normal cells are inherently different from cancerous cells, and one distinct
difference between these cells when cultured in vitro, is the ability of cancer cells
to proliferate indefinitely (Hayflick, 1965). Normal cells encounter two mortality
checkpoints. The first, senescence (M1), is characterized by a growth arrest at
the G1 checkpoint. However, this checkpoint may be overcome by inhibiting key
cell cycle checkpoint regulators such as p53 and RB. If senescence is bypassed,
cells may continue to proliferate until they reach crisis (M2), the second mortality
75

checkpoint, which is characterized by widespread apoptosis (Maser and
DePinho, 2002; Hara et al., 1991).

According to the classical definition of crisis, the crisis checkpoint is triggered by
telomere shortening (Lustig, 1999). However, most of these studies were
performed on fibroblasts, which may not be representative of human cancers of
epithelial origin. In our in vitro model system, epithelial strains derived from
benign ovarian tumors (cystadenomas) and further transfected with SV40 Large
T Antigen, thus inhibiting RB and p53, underwent crisis driven by changes in
DNA ploidy, which we referred to as a ploidy-dependent crisis. This was
characterized by a doubling in DNA content, and preceded any significant
telomere attrition. Interestingly, cultures derived from ovarian tumors of low
malignant potential (LMP) bypassed ploidy dependent, but not telomere
dependent crisis, suggesting that these tumors, which have both benign and
malignant features, have acquired the genetic alterations necessary to overcome
ploidy dependent crisis (Yu et al., 2007). Bypass of these two crises results in
aneuploidy development due to loss of chromosomes, and acquisition of
replicative immortality, which points to an exciting link between these two
hallmarks of cancer.

76

In the previous chapters, I showed that the main determinant of this ploidy
dependent crisis is a mitotic arrest, if overcome, lead to the development of
tetraploidy, followed by aneuploidy. I also discovered that this mitotic arrest is
controlled by alterations in BRCA1 expression, a protein associated with familial
predisposition to breast and ovarian cancer. Down-regulation of BRCA1
facilitates abrogation of mitotic arrest leading to acquisition of tetraploidy. I
sought to find upstream factors which may be responsible for controlling
expression of BRCA1, and thus, mitotic arrest.

Aurora A, a member of the Ser/Thr kinase family, operates at peak activity during
the G2-M phase of the cell cycle. This protein has also been shown to be over-
expressed in many human epithelial cancers, such as breast and ovarian
(Tanaka et al., 1999; Tanner et al., 2000). Over-expression of this protein has
been associated with induction of aneuploidy (Zhou et al., 1998), and an
aggressive, malignant cancer phenotype, suggesting that Aurora-A may have a
role in promoting tumorigenesis (Marumoto et al., 2005). Recent evidence
suggests that Aurora-A acts as an upstream factor to mediate various post-
translation modifications of BRCA1. Aurora A phosphorylates BRCA1 at Ser308,
thus promoting entry from G2-M phase (Ouchi et al., 2004), and has also been
shown to inhibit the ubiquitination activity of BRCA1 at the centrosome during M
phase, thus preventing multi-polar spindle formation (Sankaran et al., 2007).
77

Therefore, I sought to investigate the relationship between Aurora A and BRCA1
in regulating the mitotic arrest associated with ploidy dependent crisis. I revealed
that over-expression of Aurora A inhibits BRCA1 expression in cystadenoma-
derived epithelial strains approaching crisis, thus leading to abrogation of mitotic
arrest and acquisition of tetraploidy, which is an intermediate step towards
aneuploidy development.

Materials and Methods

Cell Strains and Culture Conditions. ML-3 cells were established from primary
cultures of benign epithelial ovarian tumors (cystadenomas) (Luo et al., 1997).
This strain was infected with an adenovirus vector expressing SV40 Large T
Antigen. MCV50 is a cell line that was initially derived from ML-10 and
spontaneously immortalized in culture. Refer to chapter 2 for descriptions of
other cell strains. All cells were grown in DMEM (Cell Culture Core Facility,
USC) supplemented with 10% FBS and 1% PS.

Western Blot Analysis. Refer to chapter 2. Primary antibodies used include
Aurora A (1:1000, Cell Signaling Technology, cat #: 4718), p-Aurora A/Aurora
B/Aurora C (1:1000, Cell Signaling Technology, cat #: 2914), and BRCA1.

78

Transfection. Cells were transfected with siRNA against BRCA1 and Aurora A
(5’ AUGCCCUGUCUUACUGUCA 3’) at 30-50% confluency with Lipofectamine
2000 for 72 hours according to protocol.

Analysis of DNA Ploidy by Flow Cytometry. Refer to chapter 3.

Results

Aurora A is up-regulated during ploidy dependent crisis
I sought to investigate if Aurora A is involved in regulating events during crisis. I
examined protein levels and kinase activity of Aurora A in nuclear extracts
harvested from cystadenoma-derived epithelial strains approaching ploidy
dependent crisis versus undergoing logarithmic growth (Fig 12a). I specifically
examined phosphorylation of Thr288 on Aurora A, which is located on the T loop
of the kinase domain, and has been shown to increase Aurora A enzymatic
activity (Littlepage et al., 2002). After Western blotting using p-Aurora-A and
Aurora A antibodies, I observed that Aurora A protein levels and kinase activity
were up-regulated during crisis. This suggests that changes in Aurora A
expression may play a critical role in regulating mitotic arrest and acquisition of
tetraploidy during crisis. To confirm that up-regulation of Aurora A is associated
with ploidy dependent crisis, independent of the presence of SV40 Large T
Antigen, I utilized epithelial strains developed in our lab which bypassed ploidy
79

dependent crisis, but underwent crisis due to telomere attrition. These epithelial
strains were derived from ovarian tumors of low malignant potential (LMP), and
nuclear extracts were harvested during telomere-dependent crisis or logarithmic
growth. I observed that Aurora A expression and kinase activity decreased in
cells approaching telomere-dependent crisis compared to logarithmic growth (Fig
12b). This suggests that over-expression of Aurora A is linked with controlling
ploidy dependent crisis.

Aurora A inhibition leads to a decrease in tetraploidy development during
crisis
To examine if over-expression of Aurora A plays a role in abrogating mitotic
arrest leading to acquisition of tetraploidy during ploidy-dependent crisis, I down-
regulated this protein using siRNA in epithelial strains approaching crisis. After
treatment with Aurora-A and GFP (negative control) siRNA for 72 hours, cells
were collected for DNA profile analysis using flow cytometry (Fig 13a). The 4N
peak is representative of an intermixed population of diploid cells cycling through
or arrested in G2/M, and tetraploid cells undergoing G1 transition. Aurora A
inhibition led to a decrease in the intermixed population (4N peak) and in the
percentage of tetraploid cells (8N peak) compared to the GFP siRNA control.
The results suggest that Aurora A over-expression may play a key role in driving
acquisition of tetraploidy. To further test this theory, I inhibited Aurora A in two
epithelial strains undergoing logarithmic growth and in an immortal cell line that
80

had overcome ploidy and telomere dependent crisis (Fig 13b). These cells are
near diploid, and are not undergoing mitotic arrest. I observed that Aurora A
down-regulation in these cells led to a minimal decrease in percentage of cells
cycling through G2/M compared to the GFP siRNA control. This suggests that
Aurora A specifically influences events during ploidy dependent crisis, and is
involved in acquisition of tetraploidy.

Aurora A controls BRCA1 expression during ploidy dependent crisis
Aurora A is a known upstream regulator of BRCA1, and has already been shown
to control BRCA1 ubiquitination activity during mitosis. As mentioned in the
previous chapter, BRCA1 expression decreases in epithelial strains approaching
ploidy dependent crisis versus logarithmic growth. I hypothesized that Aurora A
over-expression during crisis may play a role in inhibiting BRCA1 expression,
thus controlling abrogation of mitotic arrest, and acquisition of tetraploidy. To test
this theory, BRCA1 expression was examined in nuclear extracts harvested from
cells approaching ploidy dependent crisis treated with siRNA against GFP or
Aurora A (Fig 14a). BRCA1 expression increased after Aurora A inhibition
compared to the GFP control, which suggests that Aurora A regulates BRCA1
expression during crisis. In comparison, BRCA1 expression was also examined
in two epithelial strains undergoing logarithmic growth and in one immortal cell
line treated with siRNA against Aurora A and GFP (Fig 14b). BRCA1 expression
remains unchanged after Aurora A siRNA treatment in these cells, which
81

suggests that Aurora A only influences BRCA1 expression during ploidy
dependent crisis.

Alterations in BRCA1 and Aurora A expression regulate mitotic arrest
As mentioned in the second chapter, mitotic arrest is the main determinant of
crisis, and crisis is characterized by a decrease in net proliferation (i.e. growth
rate minus rate of cell death). I sought to determine if changes in BRCA1 and
Aurora A expression may influence crisis onset by examining the consequences
of down-regulating BRCA1 and Aurora A on proliferation. Epithelial strains
approaching ploidy dependent crisis were treated with siRNA against GFP,
Aurora A, and both Aurora A and BRCA1. Cell counts were calculated using a
Coulter Counter at two time points, 24 and 72 hours post transfection, and
proliferation rates were compared between the different siRNA treatments (Fig
15a). Treatment with siRNA against Aurora A caused a dramatic decrease in
proliferation rates as evidenced by a doubling time of 3.4 days compared to the
GFP control (1.6 days). This suggests that down-regulation of Aurora A may be
inducing cells arrested in mitosis to undergo apoptosis. Interestingly, treatment
with both siRNA against BRCA1 and Aurora A resulted in an almost complete
rescue of proliferation, as evidenced by a doubling time of 2 days after siRNA
treatment against BRCA1 and Aurora A, compared to the GFP control (1.6 days).
I sought to determine if this increase in proliferation after BRCA1 and Aurora A
down-regulation compared to Aurora A siRNA treatment alone was due to an
82

increase in tetraploidy acquisition. Epithelial strains approaching ploidy
dependent crisis were treated with siRNA against GFP, Aurora A, BRCA1, and
Aurora A/BRCA1 for 5 days to achieve a more dramatic effect, and then collected
for DNA profile analysis using flow cytometry (Fig 15b). As expected, treatment
with siRNA against BRCA1 resulted in an increase in tetraploidy development as
evidenced by the increase in percentage of cells under the 4N and 8N peak.
When comparing the 4N and 8N peaks, treatment with Aurora A/BRCA1 siRNA
led to an increase in tetraploidy acquisition compared to treatment with Aurora A
siRNA alone. This suggests that BRCA1 is a downstream target of Aurora A
during ploidy dependent crisis, and inhibition of BRCA1 controls acquisition of
tetraploidy. Thus, over-expression of Aurora A may activate a signaling cascade,
of which BRCA1 is a downstream mediator, leading to abrogation of mitotic
arrest and subsequent acquisition of tetraploidy.

83

Aurora A is Up-regulated During Ploidy Dependent Crisis

Figure 12. Aurora A protein and kinase levels are up-regulated in epithelial
strains approaching ploidy dependent crisis. Nuclear extracts were harvested
from epithelial strains undergoing logarithmic growth or approaching crisis.
These cells were derived from benign ovarian cystadenomas (A), referred to as
ML-10, or ovarian tumors of low malignant potential (B), referred to as ML-46.
Western blotting was carried out using antibodies against Aurora A and Thr288
of Aurora A, its catalytic active site. Ku-70 served as a loading control.

84

Aurora A Inhibition leads to a Decrease in Tetraploidy
Development During Crisis

Figure 13. Down-regulation of Aurora A in epithelial strains derived from benign
ovarian tumors approaching crisis led to a decrease in tetraploidy. A. Epithelial
strains approaching crisis (ML-10) were treated with siRNA against GFP and
Aurora A for 72 hours. Cell were either collected for nuclear extraction, followed
by immunoblotting with anti-Aurora A antibody or trypsinized, fixed in 70%
ethanol, and stained with propidium iodide for flow cytometry analysis. GAPDH
served as a loading control. B. Epithelial strains undergoing logarithmic growth
(ML-3 and ML-10) and an immortal cell line (MCV50) were also subjected to the
same treatment described above. Ku-70 served as a loading control.

85

Figure 13, Continued

86

Aurora A Controls BRCA1 Expression During Ploidy Dependent
Crisis

Figure 14. Down-regulation of Aurora A in epithelial strains derived from benign
ovarian tumors approaching crisis leads to an increase in BRCA1 expression. A.
Nuclear extracts were collected from epithelial strains approaching crisis (ML-10)
treated with siRNA against Aurora A and GFP for 72 hours, followed by Western
blotting using antibodies against BRCA1 and Aurora A. Ku-70 served as a
loading control. B. Epithelial strains undergoing logarithmic growth (ML-3 and
ML-10) and an immortal cell line (MCV50) were subjected to the same treatment
described above.

87

Alterations in BRCA1 and Aurora A Expression Regulate Mitotic
Arrest

Figure 15. BRCA1 and Aurora A down-regulation in epithelial strains derived
from benign ovarian tumors approaching crisis leads to an increase in
proliferation and tetraploidy formation compared to treatment with siRNA against
Aurora A alone. A. Cell strains approaching crisis were treated with siRNA
against GFP, Aurora A, and Aurora A/BRCA1. 24 and 72 hours after the initial
treatment, 3 dishes from each treatment group were trypsinized, and cells
counted using a Coulter Counter. The average cell count of three dishes from
each treatment group was plotted on a log scale over two time points. Error bars
represent standard error. B. Cell strains approaching crisis were treated with
siRNA against GFP, BRCA1, Aurora A, Aurora A/BRCA1 for 5 days, followed by
trypsinization, fixation in 70% ethanol, and staining with propidium iodide for DNA
profiling using flow cytometry.
88

Discussion

My results reveal a novel role for Aurora A in controlling BRCA1 expression
during ploidy dependent crisis. Previous studies have shown that Aurora A is
over-expressed in many human cancers such as bladder, pancreatic, breast, and
ovarian (Frazier et al., 2004; Li et al., 2003) and that over-expression of this
protein is associated with aneuploidy development. This suggests that over-
expression of Aurora A may have an important role in promoting tumorigenesis
and progression towards malignancy. Our cystadenoma-derived epithelial
strains provide a longitudinal model to study this process. My findings reveal that
Aurora A over-expression inhibits BRCA1 expression during ploidy driven crisis,
leading to abrogation of mitotic arrest, and subsequently, acquisition of
tetraploidy.

Treatment with siRNA against Aurora A in cells approaching ploidy dependent
crisis provides further proof that Aurora plays an integral role in tetraploidy
development. Inhibition of Aurora A using siRNA led to a decrease in tetraploidy
development as evidenced in cell cycle profiles. This led me to speculate that
down-regulation of Aurora A may activate an apoptotic pathway, leading to
programmed death of cells undergoing prolonged mitotic arrest. Thus, if these
arrested cells die, fewer cells will escape mitotic arrest and develop tetraploidy.
A recent study has shown that Aurora A inhibition through the use of small
89

molecule inhibitors, led to the activation of a p73-dependent apoptotic pathway in
p53 deficient cancer cells (Dar et al., 2008). Therefore, this supports the notion
that inhibition of Aurora A may activate apoptosis in cells arrested at the mitotic
spindle checkpoint. It may be interesting to examine if a p73 dependent
apoptotic cascade is activated after Aurora A siRNA treatment in epithelial strains
approaching ploidy dependent crisis.

I have shown in the previous chapter that changes in BRCA1 expression is
involved in abrogation of mitotic arrest leading to acquisition of tetraploidy.
Interestingly, down-regulation of both BRCA1 and Aurora A led to an increase in
proliferation and tetraploidy development compared to cells treated with siRNA
against Aurora A alone. I conclude that BRCA1 is an important downstream
factor of Aurora A, and that down-regulation of BRCA1 during crisis is controlled
by Aurora A. In support of this view, down-regulation of Aurora A led to an
increase in BRCA1 expression during ploidy dependent crisis. This interaction is
restricted to crisis, as epithelial strains and a cell line undergoing logarithmic
growth do not undergo changes in BRCA1 expression after Aurora A inhibition.
This reveals a novel role for Aurora A in controlling protein levels of BRCA1.
Previous studies have shown that Aurora A is involved in post-translational
modification of BRCA1, through phosphorylation of specific serine residues or
inhibition of BRCA1 ubiquitin ligase activity. It may be interesting to examine if
90

Aurora A over-expression during ploidy dependent crisis may modify post-
translational activities of BRCA1.

I have revealed that changes in Aurora A and BRCA1 expression are part of the
underlying mechanisms controlling ploidy dependent crisis and acquisition of
tetraploidy, a precursor to aneuploidy development. However, I believe that
analyzing global expression changes through the use of microarrays may shed
more light into identifying other key regulators. Comparing differential expression
profiles during ploidy dependent crisis versus logarithmic growth will give us
further insight into important factors that drive progression towards aneuploidy
and immortalization, two hallmarks of cancer.
91

Chapter 5: Summary and Future Directions

Summary

Our laboratory has established in vitro epithelial cell models to study the
development of aneuploidy in cancer. These epithelial strains were derived from
benign ovarian tumors (cystadenomas), and further transfected with a SV40
Large T Antigen vector, thus inhibiting p53 and RB. This allows cells to bypass
senescence, the first mortality checkpoint, which is characterized by a growth
arrest at G1. These cells continue to proliferate, and at higher passages,
undergo a doubling in DNA content that is accompanied by acquisition of
tetraploidy. These changes in DNA ploidy status precedes crisis, the second
mortality checkpoint, which is characterized by widespread apoptosis. If cells
overcome this ploidy dependent crisis, they start to lose chromosomes resulting
in aneuploidy. These cells will continue to proliferate, but will eventually undergo
a second crisis due to telomere shortening, which we refer to as a telomere
dependent crisis. Cells that overcome telomere dependent crisis will
spontaneously immortalize in culture (Veliscescu et al., 2003).

In the past, most of the previous studies on crisis were done using fibroblasts,
and telomere attrition was found to be the only determinant of crisis in this cell
type (Bodnar et al., 1998). However, most human cancers are epithelial in
92

nature. Therefore, our epithelial model may be more reflective of events that
take place during tumor development. In addition, this cell model links two
hallmarks of cancer, progression towards aneuploidy and replicative immortality.

In contrast, we previously found that epithelial strains derived from ovarian
tumors of low malignant potential (LMP) and transfected with the same SV40
Large T Antigen expression vector, undergoes only telomere dependent crisis,
which suggests that ploidy dependent crisis is bypassed (Yu et al., 2007). LMP
tumors share characteristics of both benign and malignant lesions and is thought
to be an intermediate between the two, which indicates that these epithelial
strains have acquired the genetic alterations necessary to bypass ploidy
dependent crisis.

Crisis is a barrier to replicative immortality, and in the case of ploidy dependent
crisis, cells approaching this phenomenon are characterized by acquisition of
tetraploidy, which is an intermediate step to aneuploidy development. This is
supported by evidence in early stage human cancers, such as premalignant
lesions of Barrett’s oesophagus (Doak et al., 2003) or early stage cervical
carcinogenesis (Olaharski et al., 2007), which are characterized by the
appearance of tetraploid cells. Therefore, the goal of this dissertation is to study
the mechanisms controlling the crisis phenomenon, which will give us greater
insight into aneuploidy development.
93

I hypothesized that the doubling in DNA content preceding ploidy dependent
crisis is reflective of a cell cycle arrest. Preliminary findings revealed a decrease
in BrdU incorporation, a marker for DNA replication, in cystadenoma-derived
epithelial cells approaching crisis versus undergoing logarithmic growth. This is
suggestive of a cell cycle arrest. Further investigation into the mechanism
regulating this arrest revealed that epithelial strains approaching crisis exhibited
a decrease in cyclin A/Cdk2 expression, which controls S phase transition, and
decrease in Cdk2 activity compared to cell strains undergoing logarithmic growth.
Cyclin B1/Cdk1, which regulates G2/M transition, was unchanged, but Cdk1
activity increases in epithelial strains approaching crisis. This indicates that the
arrest occurs downstream of cyclin B1/Cdk1.

To confirm this, expression of p-histone H3, a marker for prophase activation,
was examined in cells approaching crisis compared to logarithmic growth. This
kinase was up-regulated during crisis, which suggests that the arrest occurs at
the mitotic spindle checkpoint, between metaphase to anaphase transition.
Transition from metaphase to anaphase is controlled by the anaphase promoting
complex (APC), which binds to Cdc20, thus ushering cells into anaphase if all
chromosomes are properly aligned.

94

The Bub3-BubR1 complex, which inhibits APC activation at the mitotic spindle
checkpoint, is up-regulated, and Cdc27, a marker for APC activation, decreases
during crisis. Furthermore, securin, a protein that is degraded to signal exit from
mitosis, is also decreased during crisis compared to logarithmic growth. Taken
together, these data suggests that an arrest is taking place at the mitotic spindle
checkpoint in epithelial strains approaching ploidy dependent crisis.
Interestingly, I found that this mitotic arrest is specific to ploidy dependent crisis
as epithelial strains derived from LMP tumors approaching telomere dependent
crisis did not show evidence of an arrest. This suggests that these LMP strains
have acquired the ability to bypass mitotic arrest.

I hypothesized that if cells escape mitotic arrest, they will abruptly exit mitosis
without completion of cytoplasmic separation occurring during cytokinesis, thus
leading to the generation of tetraploid cells. I further hypothesized that BRCA1,
which is commonly mutated in familial breast and ovarian cancer (Futreal et al.,
1994), may play a role in regulating this process. I observed that all three gene
products of BRCA1 were down-regulated in cystadenoma-derived epithelial cells
approaching crisis versus logarithmic growth. However, full length BRCA1,
which is the most widely studied protein of the BRCA1 gene, seems to be the
critical isoform involved in regulating crisis.

95

We previously characterized that net proliferation decreased in cells approaching
crisis. However, down-regulation of BRCA1 using siRNA rescued proliferation to
rates comparable to that seen during logarithmic growth at earlier passages.
This finding led us to believe that BRCA1 is involved in maintaining the mitotic
arrest associated with ploidy dependent crisis, and that decreased expression of
BRCA1 may facilitate abrogation of mitotic arrest leading to acquisition of
tetraploidy. To test this theory, I sorted epithelial cells approaching crisis into
diploid and tetraploid fractions, and observed that BRCA1 RNA expression
decreased in the tetraploid fraction compared to the diploid fraction. In support of
this data, down-regulation of BRCA1 using siRNA resulted in a significant
increase in tetraploidy development, as evidenced in cell cycle profiles and
metaphase spreads. Interestingly, down-regulation of BRCA1 in epithelial strains
undergoing logarithmic growth did not change proliferation rates or cell cycle
profile, which suggests that changes in BRCA1 expression specifically influences
events during crisis.

I delved further into the mechanism behind BRCA1 down-regulation, and
subsequent acquisition of tetraploidy. Changes in expression of mitotic
regulators were examined, revealing that expression of p-histone H3 and BubR1
decreased, and Cdc27 increased in cells approaching crisis treated with siRNA
against BRCA1 compared to the GFP control. As mentioned above, both p-
histone H3 and BubR1-Bub3 were up-regulated, and Cdc27 down-regulated in
96

cells approaching crisis compared to logarithmic growth. Therefore, the reversal
in expression after BRCA1 down-regulation is indicative of an abrogation of
mitotic arrest.

Expression of survivin, INCENP, and Aurora B, which form a ternary complex
that plays a critical role in completion of cytokinesis, was examined after BRCA1
down-regulation in cells approaching crisis. Aurora B and survivin expression
decreased compared to the GFP siRNA control. This suggests that BRCA1
down-regulation facilitates escape from mitotic arrest without completion of
cytoplasmic separation, which is a mechanism for tetraploidy development.

My next step was to identify upstream regulators which may influence changes in
BRCA1 expression during ploidy dependent crisis. I sought to determine if
Aurora A, which has been shown to be involved in post-translational modification
of BRCA1, is involved in controlling BRCA1 expression during crisis. I observed
that Aurora A kinase activity and expression is up-regulated in cells approaching
ploidy dependent crisis compared to logarithmic growth, which is opposite to
what is observed with BRCA1 expression during crisis. In contrast, Aurora A
protein and kinase levels were decreased in epithelial strains derived from LMP
tumors approaching telomere dependent crisis. This suggests that over-
expression of Aurora A activity is associated with changes in DNA ploidy status.

97

To investigate if Aurora A is involved in tetraploidy development, siRNA was
used to down-regulate Aurora A in cystadenoma-derived epithelial cells
approaching crisis. DNA profiles revealed a decrease in tetraploidy development
after Aurora A siRNA treatment compared to the GFP control, which suggests
that over-expression of Aurora A during ploidy dependent crisis plays a role in
acquisition of tetraploidy. Interestingly, down-regulation of Aurora A in two
epithelial strains undergoing logarithmic growth, and in an immortalized cell line
derived from one of these epithelial strains, resulted in a minimal decrease in
G2/M progression as observed in DNA profiles. This indicates that changes in
Aurora A influences events during crisis, possibly through mediating BRCA1
expression.

Examination of BRCA1 expression after Aurora A inhibition in cells approaching
ploidy dependent crisis revealed that BRCA1 expression was up-regulated
compared to the GFP siRNA control. However, Aurora A inhibition in epithelial
strains undergoing logarithmic growth and in an immortalized cell line showed
that BRCA1 expression remains unchanged. This suggests that Aurora A affects
BRCA1 expression specifically during ploidy dependent crisis. Over-expression
of Aurora A in epithelial cells approaching ploidy dependent crisis may inhibit
BRCA1 expression, leading to acquisition of tetraploidy.

98

To determine if BRCA1 is the main downstream target of Aurora A during crisis,
proliferation rates were compared after siRNA treatment against GFP, Aurora A,
and both Aurora A and BRCA1 in cystadenoma-derived epithelial cells
approaching crisis. Results revealed that Aurora A inhibition led to a dramatic
decrease in proliferation, but treatment with siRNA against both BRCA1 and
Aurora A partially rescued proliferation to rates comparable to the GFP siRNA
control. Cell cycle profiles were also compared after siRNA treatment against
GFP, Aurora A, BRCA1, and both Aurora A and BRCA1 in cells approaching
crisis. Aurora A/BRCA1 knockdown resulted in an increase in tetraploidy
formation compared to treatment with siRNA against Aurora A alone. These
results indicate that BRCA1 is a critical downstream target of Aurora A, and this
interaction mediates escape from mitotic arrest leading to acquisition of
tetraploidy.

To summarize my dissertation results, a mitotic arrest is the main determinant of
ploidy dependent crisis in epithelial strains derived from benign ovarian tumors
(cystadenomas). Over-expression of Aurora A in cells approaching crisis
mediates down-regulation of BRCA1, which facilitates escape from mitotic arrest,
leading to tetraploidy formation, a precursor to aneuploidy development. These
results reveal a novel role for Aurora A and BRCA1 in controlling ploidy
dependent crisis, and may be reflective of events that occur during tumor
99

development, particularly in tumors with a near tetraploid number of
chromosomes.

Therefore, I propose a novel, mechanistic model for the development of
aneuploidy in cancer. A mitotic arrest is initiated in response to accumulation of
mitotic errors as cells age in vivo. Under normal physiological conditions, these
arrested cells will undergo crisis (apoptosis) and die, but if mutations that alter
Aurora A and BRCA1 expression coupled with p53 and RB inactivation occur,
cells may overcome mitotic arrest. I conclude that over-expression of Aurora A
inhibits BRCA1 expression, which facilitates escape from mitotic arrest, causing
cells to abruptly exit mitosis without completion of cytoplasmic division
(cytokinesis). This leads to the generation of tetraploid cells that are able to
proliferate due to the absence of a p53 dependent post mitotic G1 checkpoint.
Tetraploid cells are thought to be genetically unstable, but if chromosomes are
lost resulting in aneuploidy, then low or high grade carcinoma may develop
depending on the severity of aneuploidy that ensues (Fig 16).

100

A Novel Model for Aneuploidy Development in Cancer
Progression

Figure 16. The role of BRCA1 and Aurora A in aneuploidy development.

101

Future Directions

1. Investigate the effect of BRCA1 down-regulation on the timing of
crisis

My findings reveal that BRCA1 down-regulation using siRNA rescues
proliferation of epithelial strains approaching ploidy dependent crisis to rates
comparable to that of earlier passages. I revealed that this increase in
proliferation was due to escape from mitotic arrest, leading to an increase in
tetraploidy acquisition. This indicates that down-regulation of BRCA1 may
influence onset of crisis, which is a barrier against replicative immortality.
However, the effect of siRNA is transient, and after a week at most, BRCA1
levels will revert back to their normal levels. I propose creating a stable BRCA1
knockdown by subcloning the BRCA1 siRNA sequence into a retroviral vector.
Transfection of this BRCA1 siRNA vector into epithelial strains undergoing
logarithmic growth will help us determine if initiation of crisis is reached earlier
compared to cells transfected with a GFP siRNA retroviral vector. We can also
create an over-expression BRCA1 vector, and transfect it into cells approaching
crisis, which will allow us to determine if expression of higher levels of BRCA1
will rescue cells from crisis.

102

2. Characterize the mechanism behind BRCA1 down-regulation leading
to acquisition of tetraploidy

My findings reveal that down-regulation of BRCA1 abrogates mitotic arrest
associated with ploidy-dependent crisis, leading to an increase in tetraploidy
acquisition. I hypothesized that this BRCA1 inhibition causes cells to abruptly
exit prolonged mitotic arrest without completion of cytoplasmic separation, a
mechanism for tetraploidy development. This process is known as mitotic
slippage. However, to further strengthen our theory, I propose using time lapse
fluorescence microscopy after BRCA1 knockdown in epithelial cells approaching
crisis. Staining cells with DAPI (binds to DNA), β-tubulin (microtubules), γ-tubulin
(centrosomes), and fluorescent-conjugated antibodies specific to actin and
myosin (involved in forming the contractile ring during cytokinesis), will allow us
to view the mechanism behind acquisition of tetraploidy, and confirm if it is due to
a defect in cytokinesis.

3. Characterize the interaction between BRCA1 and Aurora A in
cystadenoma-derived epithelial cells approaching ploidy crisis

My results suggest that Aurora A over-expression mediates down-regulation of
BRCA1 in cells approaching ploidy dependent crisis. This is a novel finding, as
previous studies have focused on the post-translational modification of BRCA1
103

by Aurora A. As mentioned before, these studies revealed that Aurora A
phosphorylates or inhibits the ubiquitin ligase activity of BRCA1. However,
experiments included in these past studies show no evidence that Aurora A
modifies BRCA1 protein expression. Interestingly, my results also suggest that
Aurora A does not influence expression of BRCA1 in cells undergoing logarithmic
growth. This suggests that Aurora A interacts specifically with BRCA1 during
ploidy dependent crisis. Examining the interaction between these two proteins
could be accomplished through co-IP experiments, which would reveal if there is
a direction interaction during crisis.

It would be also be interesting to investigate if Aurora A influences post-
translational modification of BRCA1. This may be accomplished by investigating
expression of BARD1, a binding partner of BRCA1 (Brzovic et al., 2001) that is
required for its ubiquitin ligase activity, after Aurora A knockdown in cells
approaching crisis. Ubiquitin ligase activity of BRCA1 may also be analyzed after
Aurora A knockdown. Treatment with proteasome inhibitors such as MG-132 will
preserve the expression of ubiquitin polymers. IP with BRCA1 followed by
Western blotting with an anti-ubiquitin protein will reveal if this specific function of
BRCA1 is perturbed.

Aurora A may also control the transcription of BRCA1, which could provide
another explanation for Aurora A mediated down-regulation of BRCA1 during
104

crisis. To test this theory, chromatin immunoprecipitation (ChIP) may be used to
examine if Aurora A binds to the promoter of BRCA1. Formaldehyde is used to
cross link DNA binding proteins to the DNA (promoter region) to which they bind.
This is followed by sonication, which will break up the DNA-protein complexes
into smaller pieces. Immunoprecipitation with an Aurora A specific antibody will
purify all the DNA pieces bound to Aurora A. The next step is heating up the
complexes, which will reverse the cross-linking process, and free the DNA. This
is followed by PCR, using specific primers against the promoter region of
BRCA1. If PCR yields a product, then Aurora A binds to the promoter region of
BRCA1, and controls its transcription.

If Aurora A is found to bind to the promoter region of BRCA1, the next step would
be to determine if Aurora A over-expression in cells approaching crisis inhibits
transcription of BRCA1. This may be determined by generating a BRCA1
reporter construct, which fuses the promoter region of BRCA1 to a luciferase
reporter gene. This construct will be transfected into epithelial strains
approaching ploidy dependent crisis, followed by treatment with siRNA against
Aurora A and GFP. Examining the levels of luciferase activity between the two
treatment groups will allow us to determine if Aurora A controls transcription of
BRCA1.

105

4. Examine the mechanism behind Aurora A down-regulation leading
to decrease in tetraploidy during ploidy dependent crisis

We found that down-regulation of Aurora A in epithelial strains approaching
ploidy dependent crisis led to a decrease in proliferation, which is accompanied
by a decrease in tetraploidy development. I hypothesized that this was due to
the activation of an apoptotic pathway in cells undergoing mitotic arrest. To test
this theory, I propose that apoptosis be examined using TUNEL or Annexin V
staining in cells approaching crisis treated with siRNA against GFP and Aurora A.
Examination of cleavage in caspases 3 and 7, which are the executioners of the
intrinsic and extrinsic apoptotic pathway, will also reveal if Aurora A down-
regulation activates an apoptotic pathway regulated by the caspases. A recent
study has shown that Aurora A inhibition mediated through the use of small
molecule inhibitors leads to the activation of a p73-dependent apoptotic pathway
in p53 deficient cancer cells (Dar et al., 2008). Our cell model is also p53
deficient, thus, it would be interesting to see if this pathway is involved in
activating apoptosis after Aurora A down-regulation in cells approaching crisis.

5. Examine the role of IRIS in controlling ploidy dependent crisis

My preliminary findings suggest that down-regulation of IRIS, a gene product of
BRCA1, leads to a decrease in cell proliferation, which is characterized by a
106

decrease in cyclin A/Cdk2 (S phase) and cyclin B1/Cdk1 (G2/M phase)
expression in epithelial cells approaching ploidy dependent crisis. This is a novel
finding, as current data regarding IRIS has shown that this protein is responsible
for activating cyclin D1 expression (Hao and ElShamy, 2007). Cyclin D1 forms a
complex with Cdk4 or Cdk6, and is responsible for maintaining the G1
checkpoint. However, in our cell model, cells will cycle through G1 regardless,
due to the presence of SV40 Large T Antigen which inhibits RB and p53.
Therefore, the decrease in cell proliferation after IRIS knockdown cannot be
attributed to a decrease in cyclin D1 expression. It may be interesting to
examine if IRIS has a role in regulating the S and G2/M checkpoints during crisis.
For example, the G2/M checkpoint cannot be bypassed if Myt1 or Wee1 kinases
inhibit specific phosphorylation sites on cyclin B1/Cdk1. IRIS may have a similar
effect on S and G2/M checkpoints, which would reveal a novel role for IRIS in cell
cycle regulation.

6. Examine differential expression patterns in epithelial strains
undergoing logarithmic growth versus ploidy dependent crisis

My results reveal that changes in expression of BRCA1 and Aurora A are
involved in mediating the crisis phenomenon. However, other findings in our lab
suggest that other proteins may be involved in regulating this process. Another
graduate student, Jennifer Yeh, has found that a novel complex comprising of
107

Bub3, c-jun, and SUMO-1, may play a role in acquisition of tetraploidy during
ploidy dependent crisis. This indicates that other proteins are likely involved in
regulating crisis. I propose that a microarray be performed to compare global
expression changes in epithelial strains undergoing logarithmic growth versus
approaching ploidy dependent crisis. We may utilize the Affymetrix Human All
Exon Microarray in Dr. Triche’s lab to compare differential expression of mRNA
transcripts during crisis compared to logarithmic growth. RNA extracts will be
collected from duplicate dishes in each group, and samples run through the
microarray. The data generated may give us a better idea of which pathways are
responsible for driving initiation of crisis. For example, aberrant expression of
specific mitotic proteins may give us greater insight into how these proteins
function together to trigger mitotic arrest, and eventually crisis onset.

7. Examine the interaction between BRCA1 and a novel complex
comprised of Bub3, c-jun, and SUMO-1

As mentioned above, Jennifer Yeh has discovered a novel complex that is
involved in regulating ploidy dependent crisis. The function of this complex is not
yet characterized, but it is up-regulated in cells approaching ploidy dependent
crisis compared to undergoing logarithmic growth. She has also found that this
complex is present in various cell lines that are near tetraploid, but not in near
diploid cell lines. I hypothesize that down-regulation of BRCA1 may control
108

expression of this complex in epithelial strains approaching ploidy dependent
crisis. If this complex is differentially expressed in cells approaching crisis
treated with siRNA against BRCA1 versus GFP, than this indicates that BRCA1
may be an upstream regulator of this novel complex.
109

References

Agarwal R, Kaye, S. B. Ovarian cancer: strategies for overcoming resistance to
chemotherapy. Nature Rev. Cancer 2003;3:502–516.
Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. The molecular
biology of the cell. Fourth edition. New York: Garland Science, 2002.

Babu JR, Jeganathan KB, Baker DJ, Wu X, Kang-Decker N, van Deursen JM.
Rae1 is an essential mitotic checkpoint regulator that cooperates with Bub3 to
prevent chromosome missegregation. J Cell Biol 2003; 160:341-353.

Bakhoum SF, Thompson SL, Manning AL, Compton DA. Genome stability is
ensured by temporal control of kinetochore microtubule dynamics. Nat Cell Biol
2009;11:27-35.

Bharadwaj R, Hu Y. The spindle checkpoint, aneuploidy, and cancer. Oncogene
2004;23:2016-2027.

Bochar DA, Wang L, Beniya H, Kinev, A, Xue Y, Lane WS, Wang W, Kashanchi
F, Shiekhattar R. BRCA1 is associated with a human SWI/SNF related complex:
linking chromatin remodeling to breast cancer. Cell 2000;102:257-265.

Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB,
Shay JW, Lichtsteiner S, Wright WE. Extension of life span by introduction of
telomerase into normal human cells. Science 1998;279:349-352.

Bolton MA, Lan W, Powers SE, McCleland ML, Kuang J, Stukenberg PT. Aurora
b kinase exists in a complex with surviving and INCENP and its kinase activity is
stimulated by surviving binding and phosphorylation. Mol Biol Cell
2002;13:3064-3077.

Boveri T. The Origin of Malignant Tumors. Baltimore, MD: Williams and Wilkins,
1929.

Brzovic PS, Rajagopal P, Hoyt DW, King MC, Klevit RE. Structure of a BRCA1-
BARD1 heterodimer RING-RING complex. Nat Struct Biol 2001;8:833-837

Cahill DP, Kinzler KW, Vogelstein B, Lengauer C. Genetic instability and
darwinian selection in tumours. Trends Cell Biol 1999;9:M57–M60.

110

Casenghi M, Mangiacasale R, Tuynder M, Caillet-Fauquet P, Elhajouji A, Lavia
P, Mousset S, Kirsch-Volders M, Cundari E. p53-independent apoptosis and
p53-dependent block of DNA rereplication following mitotic spindle inhibition in
human cells. Exp Cell Res 1999;250: 339–350.

Castro A, Arlot-Bonnemains Y, Vigneron S, Labbe JC, Prigent C, Lorca T.
APC/Fizzy-related targets aurora-A kinase for proteolysis. EMBO Rep
2002;3:457-462.

Chabalier-Taste C, Racca C, Dozier C, Larminat F. BRCA1 is regulated by Chk2
in response to spindle damage. Biochim Biophys Acta 2008;1783:2223-2233.
Chen Y, Farmer AA, Chen CF, Jones DC, Chen PL, Lee WH. BRCA1 is a 220-
kDa nuclear phosphoprotein that is expressed and phosphorylated in a cell cycle-
dependent manner. Cancer Res 1996;56:3168-3172

Climini D. Merotelic kinetochore orientation, aneuploidy, and cancer. Biochim
Biophy Acta 2008;1786:32-40.
Comai L. The advantages and disadvantages of being polyploidy. Nat Rev Genet
2005;6:836-846.

Counter CM, Avilion AA, LeFeuvre CE, Stewart NG, Greider CW, Harley CB,
Bacchetti S. Telomere shortening associated with chromosome instability is
arrested in immortal cells which express telomerase activity. EMBO J
1992;11:1921-1929.

Dai W, Want Q, Liu T, Swamy M, Fang Y, Xie S, Mahmood R, Yang YM, Xu M,
Rao CV. Slippage of mitotic arrest and enahanced tumor development in mice
with BubR1 haploinsufficiency. Cancer Res 2004;62:440-445.

Dar AA, Belkhiri A, Ecsedy J, Zaika A, El-Rifai W. Aurora Kinase A inhibition
leads to p73 dependent apoptosis in p53-deficient cancer cells. Cancer Res
2008;68:8998-9004.

Deng CX. Tumorigenesis as a consequence of genetic instability in Brca1 mutant
mice. Mutat Res 2001;477:183-189.

Dey P. Aneuploidy and malignancy: an unsolved equation. J Clin Pathol
2005;57:1245–1249.

111

Ditchfield C, Johnson VL, Tighe A, Ellston R, Haworth C, Johnson T, Mortlock A,
Keen N, Taylor SS. Aurora B couples chromosome alignment with anaphase by
targeting BubR1, Mad2, and Cenp-E to kinetochores. J Cell Biol 2003;161:267-
280.

Doak SH, Jenkins GJS, Parry EM, D’Souza FR, Griffiths AP, Toffazal N, Shah V,
Baxter JN, Parry JM. Chromosome 4 hyperploidy represents an early genetic
aberration in premalignant Barrett’s oesophagus. Gut 2003;52:623–628.

Duelli DM, Hearn S, Myers MP, Lazebnik Y. A primate virus generates
transformed human cells by fusion. J Cell Biol 2005;171:493-503.

Duesberg P: Chromosomal chaos and cancer. Sci Am 2007;296:52-59.

Dyban AP, Baranov VS. Cytogenetics of Mammalian Embryonic Development.
New York/Oxford: Clarendon Press/Oxford University Press; 1987.

Eagle K, Ledermann J. Tumor markers in ovarian malignancies. Oncologist
1997;2:324–329.

ElShamy WM, Livingston DM. Identification of BRCA1-IRIS, a BRCA1 locus
product. Nat Cell Biol 2004;6:954-67.

Foulds L. The experimental study of tumor progression: a review. Cancer Res
1954;14:327-339.

Foulkes, WD. BRCA1-sowing the seeds crooked in the furrow. Nature Genetics
2008;40:8-9.

Fraizer GC, Diaz MF, Lee IL, Grossman HB, Sen S. Aurora-A/STK15/BTAK
enhances chromosomal instability in bladder cancer cells. Int J Oncol
2004;25:1631-1639.
Futreal PA, Liu Q, Shattuck-Eidens D, Cochran C, Harshman K, Tavtigian S,
Bennett LM, Haugen-Strano A, Swensen J, Miki Y, et al. BRCA1 mutations in
primary breast and ovarian carcinomas. Science 1994;266:120-122.

Gallipeau PC, Cowan DS, Sanchez CA, Barrett MT, Emond MJ, Levine DS,
Rabinovitch PS, Reid BJ. 17p (p53) allelic losses, 4n (G2/tetraploid) populations,
and progression to aneuploidy in Barrett’s esophagus. Proc Natl Acad Sci USA
1996;93:7081-7084

112

Ganem NJ, Storchova Z, Pellman D. Tetraploidy, aneuploidy and cancer. Curr
Opin Genet Dev 2007;17: 157-162.

Giaretti W. A model of DNA aneuploidization and evolution in colorectal cancer.
Lab Invest 1994;71:904–910.

Giet R, Glover DM. Drosophila aurora B kinase is required for histone H3
phosphorylation and condensin recruitment during chromosome condensation
and to organize the central spindle during cytokinesis. J Cell Biol 2001;152:669–
682.

Grigorova M, Staines JM, Ozdag H, Caldas C, Edwards PA. Possible causes of
chromosome instability: comparison of chromosomal abnormalities in cancer cell
lines with mutations in BRCA1, BRCA2, CHK2 and BUB1. Cytogenet Genome
Res 2004;104:333-340.

Hagting A, Den Elzen N, Vodermaier HC, Waizenegger IC, Peters JM, Pines J.
Human securin proteolysis is controlled by the spindle checkpoint and reveals
when the APC/C switches from activation by Cdc20 to Cdh1. J Cell Biol
2002;157:1125–1137.

Hakem R, de la Pompa JL, Sirard C, Mo R, Woo M, Hakem A, Wakeham A,
Potter J, Reitmair A, Bilia F, Firpo E, Hui CC, Roberts J, Rossant J, Mak TW.
The tumor suppressor gene Brca1 is required for embryonic cellular proliferation
in the mouse. Cell 1996;85:1009-1023.

Hao L, ElShamy WM. BRCA1-IRIS activates cyclin D1 expression in breast
cancer cells by downregulating the JNK phosphatase DUSP3/VHR. Int J Cancer
2007;121:39-46.

Hara E, Tsurui H, Shinozaki A, Nakada S, Oda K. Cooperative effect of
antisense-Rb and antisense-p53 oligomers on the extension of life span in
human diploid fibroblasts, TIG-1. Biochem Biophys Res Commun 1991;179:528–
534.

Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human
fibroblasts. Nature 1990;345: 458-460.

Hayflick L. The limited in vitro lifetime of human diploid cell strains. Exp Cell Res
1965;37:614–636.

113

Hirota T, Kunitoku N, Sasayama T, Marumoto T, Zhang D, Nitta M, Hatakeyama
K, Saya H. Aurora-A and an interacting activator, the LIM protein Ajuba, are
required for mitotic commitment in human cells. Cell 2003;114:585–598.

Hoyt MA., Totis L, Roberts BT. S. cerevisiae genes required for cell cycle arrest
in response to loss of microtubule function. Cell 1991;66:507–517.

Hsieh CL. Basic cytogenetic techniques: culturing, slide making, and g-banding.
Cell Biology: a laboratory handbook, Academic Press Inc, 1994

Ikezoe T. Aurora kinases as an anti-cancer target. Cancer Letters 2008;262:1-9.

Kirsch-Volders M, Vanhauwaert A, De Boeck M, Decordier I. Importance of
detecting numerical versus structural chromosome aberrations. Mutat Res
2002;504:137–148.

Li D, Zhu J, Firozi PF, Abbruzzese JL, Evans DB, Cleary K, Friess H, Sen S.
Overexpression of oncogenic STK15/BTAK/Aurora A kinase in human pancreatic
cancer. Clin Cancer Res 2003;9:991-997.

Li R, Murray A. Feedback control of mitosis in budding yeast. Cell 1991;66:519–
531.

Littlepage LE, Wu H, Andresson T, Deanehan JK, Amundadottir LT, Ruderman
JV. Identification of phosphorylated residues that affect the activity of the mitotic
kinase Aurora-A. Proc Natl Acad Sci USA 2002;99:15440-15445.

Loeb, L. Mutator phenotype may be required for multistage carcinogenesis.
Cancer Res 1991;51:3075-3079.

Ludwig T, Chapman DL, Papaioannou VE, Efstratiadis A. Targeted mutations of
breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1,
Brca2, Brac1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes
Dev 1997;11:1226-1241.

Luo MP, Gomperts B, Imren S, DeClerck YA, Ito M, Velicescu M, Felix JC,
Dubeau L. Establishment of long-term in vitro cultures of human ovarian
cystadenomas and LMP tumors and examination of their spectrum of expression
of matrix-degrading proteinases. Gynecol Oncol 1997;67: 277-284.

Lustig AJ. Crisis intervention: the role of telomerase. Proc Natl Acad Sci USA
1999;96:3339-3341.

114

Marumoto T, Zhang D, Saya H. Aurora-A - a guardian of poles. Nat Rev Cancer
2005;5:42-50.

Maser RS, DePinho RA. Connecting chromosomes, crisis, and cancer. Science
2002;97:149-155.

McCoy ML, Mueller CR, Roskelley CD. The role of the breast cancer
susceptibility gene 1 (BRCA1) in sporadic epithelial ovarian cancer. Reprod Biol
Endocrinol 2003;1:72.

Michael LS, Liberal V, Chatterjee A, Kirchwegger R, Pasche B, Gerald W, Dobles
M, Sorger PK, Murty VV, Benezra R. Mad2 haplo-insufficiency causes
premature anaphase and chromosome instability in mammalian cells. Nature
2001;409:355-359.

Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, harshman K, Tavtigian S, Liu
Q, Chchran C, Bennett LM, Ding W, et al. A strong candidate for the breast and
ovarian cancer susceptibility gene BRCA1. Science 1994;266:66-71.

Monteiro AN, August A, Hanafusa H. Evidence for a transcriptional activation
function of BRCA1 C-terminal region. Proc Natl Acad Sci USA 1996;93:3595-
13599.

Murray AW. Recylcing the cell cycle: cyclins revisited. Cell 2004;116:221-234.

Nowell PC. The clonal evolution of tumor cell populations. Science 1976;194:23-
28.

Olaharski A, Sotelo R, Solorza-Luna G, Gonsebatt ME, Guzman P, Mohar A,
Eastmond DA. Tetraploidy and chromosomal instability are early events during
cervical carcinogenesis Carcinogenesis 2006;27:337–343.

Omura GA, Brady MF, Homesley HD, Yordan E, Jajor FJ, Buchsbaum HJ et al.
Long-term follow up and prognostic factor analysis in advanced ovarian
carcinoma: the Gynecologic Oncology Group experience. J Clin Oncol
1991;9:1138–1150.

Ouchi M, Fujiuchi N, Sasai K, Katayama H, Minamishima YA, Ongusaha PP,
Deng C, Sen S, Lee SW, Ouchi T. BRCA1 phosphorylation by Aurora-A in the
regulation of G2 to M transition. J Biol Chem 2004;279:19643-19648.

115

Ozols, RF, Bundy BN, Greer BE, Fowler JM, Clarke-Pearson D, Burger RA,
Mannel RS, DeGEest K, Hartenbach EM, Baergen R, et al. Phase III trial of
carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with
optimally resected stage III ovarian cancer: a Gynecologic Oncology Group
study. J Clin Oncol 2003;21:3194–3200.

Sankaran S, Crone DE, Palazzo RE, Parvin JD. Aurora-A kinase regulates
breast cancer-associated gene 1 inhibition of centrosome-dependent microtubule
nucleation. Cancer Res 2007;67:11186-11194.

Sankaran S, Starita LM, Groen AC, Ko MJ, Parvin JD. Centrosomal microtubule
nucleation activity is inhibited by BRCA1 dependent ubiquitination. Mol Cell Biol
2005;25:8656-8668.

Schonthal AH, ed. Checkpoint controls and cancer, Vol 2. New Jersey: Humana
Press, 2004

Scully R, Chen J, Ochs RL, Keegan K, Hoekstra M, Feunteun J, Livingston DM.
Dynamic changes of BRCA1 subnuclear location and phosphorylation state are
initiated by DNA damage. Cell 1997;90:425-35.

Scully R, Ganesan S, Vlasakova K, Chen J, Socolovsky M, Livingston DM.
Genetic analysis of BRCA1 function in a defined tumor cell line. Mol Cell
1999;4:1093-1099.

Shay JW, Pereira-Smith OM, Wright W. A role for both RB and p53 in the
regulation of human cellular senescence. Exp Cell Res 1991;196:33–39.

Shen SC, Weaver Z, Xu X, Li C, Weintstein W, Guan XY, Ried T, Deng CX. A
targeted disruption of the murine Brca1 gene causes gamma-irradiation
hypersensitivity and genetic instability. Oncogene 1998;17: 3115-24.

Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer Cell
2002;2:103-112.

Sotillo R, Hernando E, Diaz-Rodriquez E, Teruya-Feldstein J, Cordon-Cardo C,
Lowe SW, Benezra R. Mad2 overexpression promotes aneuploidy and
tumorigenesis in mice. Cancer Cell 2007;11:9-23.

Starita LM, Machida Y, Sankaran S, Elias JE, Griffin K, Schlegel BP, Gygi SP,
Parvin JD. BRCA1-dependent ubiquitination of γ-tubulin regulates centrosome
number. Mol Cell Biol 2004;24:8457-8466.

116

Starita LM, Parvin JD. Substrates of the BRCA1 dependent ubiquitin ligase.
Cancer Biol Ther 2006;5:137-141.

Stemmann O, Zou H, Gerber, SA, Gygi SP, Kirschner MW. Dual inhibition of
sister chromatid separation at metaphase. Cell 2001;107:715-726.

Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca FC, Ruderman JV,
Hershko A. The cyclosome, a large complex containing cyclin-selective ubiquitin
ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell
1995;6:185–198.

Sussan TE, Yang A, Li F, Ostrowski MC, Reeves RH. Trisomy represses
Apc(Min) mediated tumors in mouse models of Down’s syndrome. Nature
2008;451:73-75.

Tanaka T, Kimura M, Matsunaga K, Fukada D, Mori H, Okano Y. Centrosomal
kinase AIK1 is overexpressed in invasive ductal carcinoma of the breast. Cancer
Res 1999;59:2041–2044.

Tanner MM, Grenman S, Koul A, Johannsson O, Meltzer P, Pejovic T, Borg A,
Isola JJ. Frequent amplification of chromosomal region 20q12-q13 in ovarian
cancer. Clin Cancer Res 2000;6:1833–1839.

Taylor SS, Ha E, McKeon F. The human homologue of Bub3 is required for
kinetochore localization of Bub1 and a Mad3/Bub1-related protein kinase. J Cell
Biol 1998;142:1-11.

Thompson SL, Compton DA. Examining the link between chromosomal
instability and aneuploidy in human cells. J Cell Biol 2008;180:665-672.

Thornton BR, Toczyski DP. Securin and B-cyclin/CDK are the only essential
targets of the APC. Nature Cell Biol 2003;5:1090–1094.

Torres EM, Williams BR, Amon A. Aneuploidy: cells losing their balance.
Genetics 2008;179:737-746.

Vaughn JP, Davis PL, Jarboe MD, Huper G, Evans AC, Wiseman RW, Berchuck
A, Iglehart JD, Futreal PA, Marks JR. BRCA1 expression is induced before DNA
synthesis in both normal and tumor-derived breast cells. Cell Growth Differ
1996;7:711-715.

117

Veliscescu M, Yu J, Herbert BS, Shay JW, Granada E, Dubeau L. Aneuploidy
and telomere attrition are independent determinants of crisis in SV40-
transformed epithelial cells. Cancer Res 2003;63:5813-5820.

Wang RH, Yu H, Deng CX. A requirement for breast-cancer-associated gene 1
(BRCA1) in the spindle checkpoint. Proc Natl Acad Sci USA 2004;101:7108-
7113

Weaver BA, Silk AD, Montagna C, Verdier Pinard P, Cleveland DW. Aneuploidy
acts both oncogenically and as a tumor suppressor. Cancer Cell 2007;11:25-36.

Weinberg RA. The biology of Cancer. New York: Garland Science, 2006.

Williams BR, Prabhu VR, Hunter KE, Glazier GM, Whittaker CA, Housman DE,
Amon A. Aneuploidy affects proliferation and spontaneous immortalization in
mammalian cells. Science 2008;322:703-708.

Wilson CA, Payton MN, Elliott GS, Buaas FW, Cajulis EE, Grosshans D, Ramos
L, Reese DM, Slamon DJ, Calzone FJ. Differential subcellular localization,
expression and biological toxicity of BRCA1 and the splice variant BRCA1-
delta11b. Oncogene 1997;14:1-16

Xu B, Kim S, Kastan MB. Involvement of Brca1 in S-phase and G(2)-phase
checkpoints after ionizing irradiation. Mol Cell Biol 2001;21:3445-3450.

Xu B, O’Donnell AH, Kim ST, Kastan MB. Phosphorylation of serine 1387 in
Brca1 is specifically required for the Atm-mediated S-phase checkpoint after
ionizing irradiation. Cancer Res 2002;62:4588-4591.

Xu X, Weaver Z, Linke SP, Li C, Gotay J, Wang XW, Harris CC, Ried T, Deng
CX. Centrosome amplification and a defective G2-M cell cycle checkpoint induce
genetic instability in BRCA1 exon 11 isofomr deficient cells. Mol Cell
1999;3:389-95.

Yan Y, Spieker RS, Kim M, Stoeger SM, Cowan KH. BRCA1-mediated G2/M cell
cycle arrest requires ERK1/2 kinase activation. Oncogene 2005;24:3285-3296.

Yap, TA, Carden CP, Kaye SB. Beyond chemotherapy: targeted therapies in
ovarian cancer. Nat Rev Cancer 2009;9:167-81.

Yu J, Roy D, Brockmeyer AD, Dubeau L. Increased chromosomal stability in
cultures of ovarian tumors of low malignant potential compared to cystadenomas.
Br J Cancer 2007;96:1908-1913.
118

Zhang D, Hirota T, Marumoto T, Shimizu M, Kunitoku N, Sasayama T, Arima Y,
Feng L, Suzuki M, Takeya M, Saya H. Cre-loxP-controlled periodic Aurora-A
overexpression induces mitotic abnormalities and hyperplasia in mammary
glands of mouse models. Oncogene 2004;23: 8720–8730.

Zhang J, Powell SN. The role of the BRCA1 tumor suppressor in DNA double-
strand break repair. Mol Cancer Res 2005;3:531-539.

Zhou H, Kuang J, Zhong L, Kuo WL, Gray JW, Sahin A, Brinkley BR, Sen S.
Tumour amplified kinase STK15/BTAK induces centrosome amplification,
aneuploidy and transformation. Nat Genet 1998;20:189–193.

Zimmet J, Ravid K. Polyploidy: occurrence in nature, mechanisms, and
significance for megakaryocyte-platelet system. Exp Hematol 2000;28:3-16.

Zimonjic D, Brooks MW, Popescu N, Weinberg RA, Hahn WC. Derivation of
human tumor cells in vitro without widespread genomic instability. Cancer Res
2001;61:8838-8844.

Abstract (if available)

Abstract Crisis, a mortality checkpoint, is characterized by widespread apoptosis. We previously showed that epithelial cell strains derived from benign ovarian cystadenomas and further transfected with SV40 Large T Antigen undergo polyploidy followed by aneuploidy as they approach in vitro crisis. I sought to investigate the mechanisms behind these changes, which may recapitulate those that take place during tumor development, especially for those tumors that have a near polyploid number of chromosomes. I first tested the hypothesis that the initial doubling in DNA content, which appears to trigger the entire process, reflects a cell cycle arrest. I revealed that a mitotic arrest, which is maintained at the spindle checkpoint between metaphase to anaphase transition, is the main determinant of ploidy dependent crisis. Further investigation into the mechanism behind regulation of this arrest showed that down-regulation of BRCA1 expression, a protein controlling familial ovarian cancer predisposition, allowed cells to overcome such mitotic arrest and re-enter the cell cycle without completion of cytokinesis, leading to tetraploidy and aneuploidy. Aurora A, a known upstream regulator of BRCA1, was found to be over-expressed in cells approaching crisis. Further studies revealed a novel role for Aurora A in controlling BRCA1 expression during ploidy dependent crisis. I conclude that over-expression of Aurora A inhibits BRCA1 expression during ploidy dependent crisis, leading to escape from mitotic arrest and acquisition of tetraploidy, and subsequent aneuploidy development.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Understanding and controlling mitotic errors leading to aneuploidy in early ovarian cancer development

PDF

Understanding the role of BRCA1 and Aurora A kinase in polyploidy development in ovarian carcinoma precursor cells

PDF

The discovery of a novel 105kDa complex comprised of BUB3, C-JUN and SUMO-1 and its relationship to ovarian cancer development

PDF

Insights from mouse models on the origin of ovarian cancer and its predisposing mechanisms

PDF

Investigating the role of SASH1 gene located on chromosome 6 in ovarian cancer

PDF

Study of bone morphogenetic protein-2 and stromal cell derived factor-1 in prostate cancer

PDF

Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

Discovery of novel small molecules for ovarian cancer treatment

PDF

Identification of CBP/FOXM1 as a molecular target in triple negative breast cancer

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

Using chemical biology approaches to investigate the consequences of protein concentration and activity in cancer cells

Asset Metadata

Creator Yu, Vanessa (author)

Core Title Mitotic regulation in ovarian epithelial tumors approaching in vitro crisis

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Pathobiology

Publication Date 08/08/2009

Defense Date 06/24/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aneuploidy,Aurora A,BRCA1,mitotic arrest,OAI-PMH Harvest,ovarian cancer

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Dubeau, Louis (committee chair), Press, Michael (committee member), Schonthal, Axel (committee member)

Creator Email vanessa.m.yu@gmail.com,vmy81@yahoo.ca

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2551

Unique identifier UC1470710

Identifier etd-Yu-3177 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-253542 (legacy record id),usctheses-m2551 (legacy record id)

Legacy Identifier etd-Yu-3177.pdf

Dmrecord 253542

Document Type Dissertation

Rights Yu, Vanessa

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu