University of Southern California Dissertations and Theses

Chemical dissection of monosaccharide metabolic chemical reporter selectivity

(USC Thesis Other)

Chemical dissection of monosaccharide metabolic chemical reporter selectivity

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content CHEMICAL DISSECTION OF MONOSACCHARIDE METABOLIC CHEMICAL
REPORTER SELECTIVITY

by

Emma Grace Jackson

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CHEMISTRY)

December 2021

Copyright 2021 Emma Grace Jackson

ii
Table of Contents

List of Figures iii

Abstract v

Chapter 1: Metabolic Engineering of Glycans 1
Introduction 1
Core N-linked glycosylation 3
Sialic acid 4
Mucin O-linked glycosylation 9
Fucose 12
O-GlcNAc modification 15
Glycosaminoglycans 19
Conclusions and outlook 21
Chapter 1 References 23

Chapter 2: 4-deoxy-4-fluoro-GalNAz (4FGalNAz) is a metabolic chemical reporter of O-GlcNAc
modifications, highlighting the notable substrate flexibility of O-GlcNAc transferase 40
Introduction 40
Results and Discussion 44
Conclusion 52
Methods and Materials 54
Chapter 2 References 75

Chapter 3: Anomeric fatty-acid functionalization prevents non-enzymatic S-glycosylation by
monosaccharide metabolic chemical reporters 82
Introduction 82
Results and Discussion 85
Conclusion 91
Methods and Materials 92
Chapter 3 References 104

Chapter 4: Synthesis and application of other metabolic chemical reporters 108
Introduction 108
1-OH and 6-OH GlcNAlk and GlcNAz 108
Ac34AzGalNAc 110
Methods and Materials 112
Chapter 4 References 119

References 120

Appendices 143
Appendix A: NMR Spectra 143

iii
List of Figures

Figure 1.1: Bioorthogonal reactions occur selectively between two functional groups not found in
biology 2

Figure 1.2: Outline of metabolic chemical reporters and inhibitors 4

Figure 1.3: Examples of MCRs for different classes of glycosylation 5

Figure 1.4: Examples of MCIs for different classes of glycosylation 9

Figure 1.5: GAG MCR/MCI candidates and inhibitors 21

Figure 2.1: Metabolic chemical reports of glycosylation 41

Figure 2.2: Design and synthesis of Ac34FGalNAz 42

Figure 2.3: Ac34FGalNAz treatment results in protein labeling in live cells 45

Figure 2.4: Ac34FGalNAz modifies proteins through largely an O-linkage 46

Figure 2.5: Ac34FGalNAz treatment does not inhibit O-GlcNAc or glycosaminoglycans 47

Figure 2.6: Ac34FGalNAz is not particularly toxic to mammalian cells 48

Figure 2.7: Proteomic analysis of MCR-labeled proteins 49

Figure 2.8: Ac34FGalNAz is an O-GlcNAc reporter 50

Figure 2.9: 4FGalNAz is a substrate for GalK2 and AGX1 51

Figure 3.1: Workflow for treatment with MCRs 82

Figure 3.2: Per-O-acetylated sugars can chemically modify cysteine residues 83

Figure 3.3: Proposed mechanism of non-enzymatic S-glycosylation 84

Figure 3.4: Characterization of GlcNAlk derivatives 85

Figure 3.5: Characterization of 1-Hex-6AzGlcNAc 86

Figure 3.6: 1-Hex-GlcNAlk and 1-Hex-6AzGlcNAc cell panel 87

Figure 3.7: 1-Hex-GlcNAlk and 1-Hex-6AzGlcNAc are incorporated more efficiently 88

Figure 3.8: Neither 1-Hex-GlcNAlk nor 1-Hex-6AzGlcNAc chemically modify cell lysates 89

Figure 3.9: 1-Hex-GlcNAlk labeling increases in cells expressing mutant AGX1 90

iv
Figure 4.1: Synthesis of C1-OH and C6-OH Ac3GlcNAlk and Ac3GlcNAz 108

Figure 4.2: A variety of proteins are labeled with C1-OH and C6-OH Ac3GlcNAlk and Ac3GlcNAz 109

Figure 4.3: MTS assay in NIH3T3 and HeLa cell lines 110

Figure 4.4: Synthesis of Ac34AzGalNAc 111

Figure 4.5: Ac34AzGalNAc shows no labeling in NIH3T3 cells above background 112

v
Abstract

Bioorthogonal chemistries have revolutionized many fields. For example, metabolic chemical
reporters (MCRs) of glycosylation are analogs of monosaccharides that contain bioorthogonal functionality,
like azides or alkynes. MCRs are metabolically incorporated into glycoproteins by living systems, and
bioorthogonal reactions can be subsequently employed to install visualization and enrichment tags.
Unfortunately, most MCRs are not selective for one class of glycosylation (e.g., N-linked vs. O-linked) and
often non-enzymatically label cysteine residues, complicating the types of information that can be obtained.
We and others have successfully created MCRs that are selective for intracellular O-GlcNAc modification
by altering the structure of the MCR and thus biasing it to certain metabolic pathways and/or O-GlcNAc
transferase (OGT). Here, we attempt to do the same for the core GalNAc residue of mucin O-linked
glycosylation. The most widely applied MCR for mucin O-linked glycosylation, GalNAz, can be
enzymatically epimerized at the 4-hydroxyl to give GlcNAz. This results in a mixture of cell-surface and
O-GlcNAc labeling. We reasoned that replacing the 4-hydroxyl of GalNAz with a fluorine would lock the
stereochemistry of this position in place, causing the MCR to be more selective. After synthesis, we found
that 4FGalNAz labels a variety of proteins in mammalian cells and does not perturb endogenous
glycosylation pathways unlike 4FGalNAc. However, through subsequent proteomic and biochemical
characterization we found that 4FGalNAz does not widely label cell-surface glycoproteins but instead is
primarily a substrate for OGT. We also report a solution in the synthesis and characterization of two reporter
molecules functionalized at the anomeric position with hexanoic acid: 1-Hex-GlcNAlk and 1-Hex-
6AzGlcNAc. Both reporters exhibit robust labeling over background with negligible amounts of non-
specific chemical labeling in cell lysates. This strategy serves as a template for the design of future reporter
molecules allowing for more reliable interpretation of results.

1
Chapter 1: Metabolic engineering of glycans
*

Introduction
Many metazoan proteins are modified with one if not multiple classes of glycans. However, the
identities of these modified proteins are still being ascertained, and the functional consequences of the
majority of glycosylation events are unknown. One of the major roadblocks to the study of glycans is a lack
of tools to identify and characterize glycoproteins. For example, traditional biological approaches are poorly
suited for the glycan/glycoprotein visualization or identification. The creation of anti-glycan antibodies for
immunostaining or enrichment has been frustrated by the heterogeneity of glycan structures and the fact
that these complex carbohydrates are extracellular self-constituents. Carbohydrate binding lectins are an
alternative, but they typically display rather poor binding affinities to monovalent ligands and can bind to
multiple classes of glycans that contain the same or similar monosaccharides. A solution to some of these
challenges has emerged through the development of techniques that exploit cellular carbohydrate
metabolism. All of the necessary monosaccharide building blocks found in glycans can be enzymatically
synthesized from glucose and other dietary constituents like amino acids. However, cells are equipped with
carbohydrate salvage pathways that enable them to scavenge certain advanced monosaccharides from the
environment. This raised the possibility that chemically- modified sugars could be metabolically delivered
through these metabolic pathways to engineer new chemical functionality into glycans. More specifically,
it was theoretically possible that monosaccharides with designed modifications could transit these salvage
pathways. The lab of Werner Reuter was the first to explore the structural promiscuity of these salvage
pathways and demonstrated that the biosynthesis of sugar sialic acid from N-acetyl-mannosamine was

Nichole Pedowitz (USC) contributed to the work presented in this chapter.

2
tolerant of hydrocarbon extensions of the N-acetyl group, resulting in the enzymatic transformation of
xenobiotic ManNAc derivatives into the corresponding sialic acids on cell surface glycans (Kayser et al.,
1992). This chapter describes how the tolerance of monosaccharide biosynthetic pathways has been
exploited for the development of tools for both the identification and visualization, as well as the inhibition,
of glycans. In the case of glycan characterization, in pioneering work the Bertozzi lab exploited the
discoveries of Reutter to introduce a ketone onto the cell surface that could be subsequently chemically
tagged by aminooxy-tag reporters in a two-step incorporation/detection paradigm (Mahal et al., 1997). This
work inspired the invention of a range of new bioorthogonal reactions (Figure 1.1) (D. M. Patterson et al.,
2014; Row Rd Fau - Prescher & Prescher, 2018). The discovery that monosaccharide salvage pathways are
permissive for relatively small chemical perturbations and the invention of multiple bioorthogonal reactions
has together led to the development of a series of “metabolic chemical reporters (MCRs)” for different
classes of glycans (Figure 1.2A). Likewise, an understanding of the mechanism and tolerance to substrate
variation of the glycosyltransferase enzymes that add monosaccharides to proteins or growing glycans has
allowed for the creation of monosaccharide analogs that either act as mechanistic enzymatic inhibitors or
as suicide substrates, which we term metabolic chemical inhibitors (MCIs) (Figure 1.2B). Below, we cover
an abbreviated background of the major types of protein glycosylation, followed by a description of the
MCRs or MCIs that have been developed to target these classes of glycans.

Figure 1.1 Bioorthogonal reactions occur selectively between two functional groups not found in biology. (A) The
Staudinger ligation between an organic azide and a phosphine results in the formation of an amide bond. (B) The
copper(I) catalyzed azide-alkyne cycloaddition (CuAAC) gives a triazole from an organic azide and a terminal
alkyne. (C) Organic azides can also react with strained cyclooctynes using the strain promoted azide-alkyne
cycloaddition (SPAAC). (D) Tetrazine reagents undergo rapid inverse electron demand Diels-Alder (IED-DA)
cycloadditions with activated alkenes.

3
Core N-linked glycosylation
In eukaryotes, N-linked glycans, found on secreted and membrane-bound proteins, are transferred
en bloc from a preassembled lipid-linked donor and covalently linked to asparagine residues via GlcNAcβ1-
Asn linkage on the luminal side of the endoplasmic reticulum (Helenius & Aebi, 2004; Schwarz & Aebi,
2011). This modification occurs co-translationally as the protein substrate is translocated into the
endoplasmic reticulum. The minimal amino acid sequence for N-glycan transfer is Asn-X-Ser/Thr where
X is any amino acid except Pro. All eukaryotic N-glycans consist of the same core: Mana1-3(Mana1-
6)Manb1-4GlcNAcb1-4GlcNAcb1-Asn. This pentasaccharide core is extended with additional
monosaccharides resulting in three general types of structures: oligomannose or high mannose, where only
mannose residues are used for extension; complex, GlcNAc is used to initiate “antennae” beyond the core;
and hybrid, a combination of the previous two, where mannose extends the Mana1-6 arm and one to two
GlcNAc residues initiate the extension on the Mana1-3 arm. In vertebrate N-glycans there may also be a
core modification on the proximal Asn-linked GlcNAc residue with a1-6fucose. N-linked glycans play an
instrumental role in the quality control process of protein folding. Proteins entering the ER undergo N-
linked glycosylation before they undergo protein folding. These N-glycans are recognized by lectin
chaperones that aid in the proper folding of the protein. If the protein is not properly folded, N-glycan
trimming leads to a truncated version of the N-glycan marking the protein to be retro-translocated into the
cytoplasm where it will be degraded. The variety of important functions of N-linked glycosylation has
implicated this type of glycosylation in metabolic disorders as well as some cancers due to changes in a
variety of modifications on the long branches of carbohydrates seen in N-linked glycosylation.
Core N-linked reporters
Breidenbach et al. demonstrated that the core of N-linked glycans in yeast can be targeted for MCR
incorporation using GlcNAc residues (Breidenbach et al., 2010). An engineered strain of Saccharomyces
cerevisiae that was dependent on exogenous GlcNAc could metabolically incorporate the azide and alkyne

4
containing GlcNAc derivatives GlcNAz and GlcNAlk (Figure 1.3). The requirement for genetic
modification to achieve useful levels of MCR incorporation in yeast suggests that normally MCRs compete
ineffectively with endogenous UDP-GlcNAc. This result suggests that GlcNAc-based MCRs may be
incorporated into N-linked glycans in mammalian cells. However, as we will describe below, GlcNAc-
based MCRs are largely incorporated into intracellular O-GlcNAc modifications preventing the selective
labeling of N-linked glycans.

Sialic acid
Sialylation is the addition of members of the nine-carbon backbone sialic acid monosaccharides,
typically to the capping end of glycoproteins on the cell surface (Varki, 2008). This modification plays
important roles in cell-cell, cell-glycan, and cell-pathogen interactions and recognition. The electronegative
charge of sialic acid at neutral pH can also play an important role in protein stabilization as well as ion
binding. Alterations in sialylation has been shown to be linked to cancer.

Figure 1.2 Outline of metabolic chemical reporters and inhibitors. (A) Metabolic chemical reporters (MCRs) are
analogs of monosaccharides containing biorthogonal functional groups. They are converted to donor sugars by cellular
metabolism. Glycosyltransferases then label glycoproteins for subsequent tagging using bioorthogonal reactions. (B)
Metabolic chemical inhibitors (MCIs) can function through three different mechanisms. First, they can contain
modifications that will directly inhibit glycosyltransferases. Second, they can function as decoy substrates to block the
elaboration of glycoprotein glycans. Finally, they can contain modifications that will block further elaboration once
they are incorporated into glycans.

5
Sialic acid reporters (MCRs)
Numerous reporters have been developed to visualize sialylation as a means to understand more
about its function and support development of future therapeutics in diseases associated with sialylation.
As mentioned above, one of the first sialic acid MCRs was ManLev, which incorporates a chemically
reactive ketone within the side chain of the N-acyl position of ManNAc (Figure 1.3) (Mahal et al., 1997).
Functionalization at the N-acyl position of ManNAc and metabolic processing leads to the corresponding
bioorthogonal moiety at the C5 position of the sialic acid. Cells treated with ManLev metabolize this
substrate to the CMP-sialic acid sugar donor and express SiaLev in cell-surface glycans. The ketone can
then be detected through the use of biotin-hydrazide and flow cytometry. However, this method suffers
from a low rate of hydrazone formation and its reversibility, as well as not being truly bioorthogonal. In
response to these challenges the Staudinger ligation was created. The Staudinger ligation involves the
reaction of an azide with an ester-functionalized triarylphosphine and creates an amide bond (Saxon &
Bertozzi, 2000). A ManNAc analog with an N-azidoacetyl group termed Ac4ManNAz is an effective MCR

Figure 1.3 Examples of MCRs for different classes of glycosylation.

6
(Figure 1.3). O-Acetylation of the hydroxyl groups improves diffusion across the cell membrane, and non-
specific esterases remove the acetates allowing for its metabolism and generation of the azide-bearing sialic
acid analog, SiaNAz, on the cell surface. The Staudinger ligation, combined with suitable phosphine tags
and visualization with flow cytometry, was used to visualize SiaNAz on the cell surface. The exquisite
bioorthogonal nature of the Staudinger ligation even allowed for the labeling and detection of cell surface
sialic acid residues upon feeding Ac4ManNAz to mice (Prescher et al., 2004). Increases in sialic acid levels
on the cell-surface are associated with various types of cancer. Neves et al. treated mice with lung cancer
xenografts with Ac4ManNAz and found healthy tissue had reduced Ac4ManNAz-associated signal
compared to the xenografts (Neves et al., 2011). These initial studies have encouraged the development of
other ManNAc analogs with different bioorthogonal functionalities. Previous research showed that the
machinery responsible for sialylation could tolerate modifications at the N-acyl position up the five carbons
in length (Keppler et al., 2001; Luchansky et al., 2004). Hsu et al. demonstrated that an alkyne-modified
ManNAc termed Ac4ManNAlk could be used for the visualization of cell-surface sialylation (Figure 1.3)
(Hsu et al., 2007). Incorporation of SiaNAlk could be detected at a 15-fold increase over background upon
treatment of Hep3B cells followed by standard copper-catalyzed azide-alkyne cycloaddition (CuAAC)
(Rostovtsev et al., 2002; Tornøe et al., 2002) with a fluorogenic azido-hydroxycoumarin tag. Alternative
sialic acid MCRs have been created by modification of sialic acid. Feng et al. developed two sialic acid
analogs, bearing two different bioorthogonal moieties (Feng et al., 2013). 9AzSiaNAlk and 9AzSiaDAz
both contain an azide at the C9 position and either an alkyne or diazirine photo-cross-linker on the N-acetyl
side chain of the sialic acid, respectively (Figure 1.3). The two different moieties allowed for dual-color
labeling or enrichment of proteins that bind sialic acids through the use of a cross-linker. These unnatural
sialic acids could be used to dimerize CD22 (sialic acid-binding immunoglobulin-like lectin 2) by photo-
crosslinking the metabolically delivered diazirine. Using alkyne-biotin, dimerized CD22 was captured and
enriched and then detected by western blot. Möller et al. investigated functionalization of C4 of ManNAc,
which upon metabolic incorporation results in functionalization of C7 of sialic acid. Incorporation of an
azide at C4 of ManNAc (and acetylation) gave a reporter termed Ac34AzManNAc (Möller et al., 2012).

7
Ac34AzManNAc is incorporated into cell surface glycans; it was concluded that it was only incorporated
into O-linked glycans as removal of N-linked glycans with PNGase F gave no loss of label. Strain-promoted
azide-alkyne cycloaddition (SPAAC) (Agard et al., 2004) was used to visualize sialic acids resulting from
metabolic incorporation of Ac34AzManNAc in O-glycosylated proteins in live zebra fish embryos. Despite
the important applications of these reporters using the Staudinger ligation, CuAAC, and SPAAC, each
reaction poses their own set of drawbacks. The Staudinger ligation suffers from a low reaction rate as well
as inactivation of the phosphine-tag through autoxidation (Lin et al., 2019). Most CuAAC conditions
generate toxic levels of copper(I) making it difficult to use in applications with live cells and animal models.
Early generations of SPAAC also suffered from low reaction rates (Agard et al., 2004); however, this
limitation was successfully addressed through the development of modified cyclooctynes, most notably a
series of dibenzocyclooctynes that result in an 1000-fold increase in the reaction kinetics (Mbua et al.,
2011). Unfortunately, these SPAAC tags can have poor solubility in aqueous environments complicating
their use in biological settings, and they can react with reduced cysteine residues in cell lysates. One
promising set of alternatives with extremely fast reaction kinetics are the inverse electron demand Diels-
Alder (IED-DA) reactions of tetrazines with alkenes and alkynes (Wu & Devaraj, 2018). Unfortunately,
the best reaction partners, the tetrazine and a transcyclooctene are both too large for general metabolic
engineering. Yang et al. showed that the smaller methylcyclopropene group is an effective dienophile with
tetrazines, allowing visualization of phospholipids on live mammalian cells (Yang et al., 2012). Patterson
et al. developed a sialic acid conjugate containing a cyclopropene moiety at C9, 9-Cp-NeuAc, and used
flow cytometry to demonstrate cell-surface labeling (Figure 1.3) (Patterson et al., 2012). It was shown that
9-Cp-NeuAc and 9-Az-NeuAc could be used in tandem and that IED-DA and SPAAC could be used
simultaneously to selectively detect the individual functional groups. Cole et al. designed a ManNAc
derivative with the methylcyclopropene on the N-acyl position termed Ac4ManNCyc (Figure 1.3) (Cole et
al., 2013). The Prescher lab later designed the carbamate-linked version, Ac4ManCCp and demonstrated
enhanced cell-surface fluorescence through flow cytometry (Figure 1.3) (David M. Patterson et al., 2014).
Ac4ManCCp can be used simultaneously withAc4GlcNAz in tandem labeling strategies to visualize cell

8
surface glycosylation (Späte et al., 2014). Niederwieser et al. demonstrated that a straight-chain alkene-
modified analog of ManNAc, Ac4ManPtl, is a sialic acid MCR that can be visualized using a fluorescent
tetrazine tag (Niederwieser et al., 2013).
Sialic acid inhibitors (MCIs)
Inhibitors of sialic acid modifications typically target the sialyltransferase (ST) class of
glycosyltransferases responsible for catalyzing the transfer of this monosaccharide. Like many glycosyl
transfer reactions, the sialyl group of CMP-sialic acid, the sugar donor for STs, proceeds through an
oxocarbenium-ion-like transition state in a half-chair conformation facilitated by the electron donating
oxygen in the pyranose ring (Lairson et al., 2008). This feature of the enzymatic reaction encouraged the
development of mechanism-based inhibitors of STs. Burkart et al. synthesized a fluorinated sialic acid
analog, termed 3Fax-Neu5Ac (D. Burkart et al., 1999). Mechanistic studies using 3Fax-Neu5Ac supported
the existence of a cationic transition state in the ST reaction. Paulson et al. synthesized peracetylated 3Fax-
Neu5Ac (Figure 1.4), adapting the molecule for use in vivo by taking advantage of the sialic acid salvage
pathway that exists for sialic acid, which metabolically converts 3Fax-Neu5Ac to the corresponding CMP-
sugar, to act as an inhibitor of STs (Macauley et al., 2014; Rillahan et al., 2012). 3Fax-Neu5Ac inhibited
the formation of sialylated Lewis X (SLeX) in a human myeloid cell line. The inclusion of fluorine is
tolerated by the salvage pathway up to and including the synthesis of CMP-3Fax-Neu5Ac, but this is not a
competent glycosyl donor as the 3-fluoro group destabilizes the cationic transition state. Build-up of CMP-
3Fax-Neu5Ac in the cell results in feedback inhibition of sialic acid biosynthesis, thereby inhibiting sialic
acid modifications by direct and indirect mechanisms. Recently, Boltje et al. generated a panel of C-
5carbamate substituted 3Fax-Neu5Ac derivatives (Heise et al., 2019). Inclusion of the carbamate increased
potency in cells yet still allowed the substrate to be transformed into the CMP conjugate, which inhibited
STs. The above strategy targets the glycosyltransferases involved in glycan biosynthesis. An alternative
approach involves the incorporation of chain terminating subunits. In an early example of metabolic

9
hijacking, Mahal et al. demonstrated that the small molecule, N-butanoylmannosamine (ManBut), is
converted to an unnatural sialic acid derivative that is efficiently incorporated into cell surface glycans
(Mahal et al., 2001). While most sialic acid residues occupy terminal positions on glycan chains, poly-a2,8-
sialic acid (PSA) represents an important exception. Metabolic labeling with ManBut leads to incorporation
of SiaBut, which is not a substrate for further extension and causes truncation of the polysaccharide chain.

Mucin O-linked glycosylation
Mucin O-linked glycosylation is the most abundant form of glycosylation in higher eukaryotes
(Hang & Bertozzi, 2005; Varki et al., 2015). It is initiated by the transfer of GalNAc to Ser/Thr residues of
membrane-bound and secreted proteins catalyzed by one of 20 polypeptide GalNAc transferases
(ppGalNAcTs) (Ten Hagen et al., 2003). The resulting core GalNAc residue (Tn antigen) can be elaborated
on the C3 and/or C6 hydroxyl groups by other glycosyltransferases (Brockhausen et al., 2000; Jensen et al.,
2010). Sugar residues commonly found within O-linked glycans include Gal, GlcNAc, Fuc, and Sia. Gal
and GlcNAc can be modified by sulfation, and Sia modified by acetylation. Mucin O-linked glycans can
vary in length from the single core monosaccharide GalNAc to 20 or more sugar residues. These extensions
can be linear or branched and serve a variety of purposes and alter the structure of the underlying
polypeptide (Barchi, 2013; Tabak, 2010; Tian & Ten Hagen, 2009). O-linked glycans result in physical
properties that provide protective barrier for cells from physical and chemical damage, promote cellular

Figure 1.4 Examples of MCIs for different classes of glycans.

10
interactions, repel cell-surface interactions, and protect against infection (Bansil et al., 1995). O-linked
glycans can also help maintain cellular homeostasis by aiding in signaling mechanisms (Jonckheere & Van
Seuningen, 2010; Singh & Hollingsworth, 2006).
Mucin O-linked reporters (MCRs)
Hang et al. developed a chemical reporter with a bioorthogonal tag that labels mucin O-linked
glycosylation. Their strategy targeted the core GalNAc residue using a GalNAc analog bearing an azide
tag, N-azidoacetylgalactosamine (GalNAz) (Hang et al., 2003). Following incorporation, the azide can be
conjugated with phosphine probes using the Staudinger ligation (Figure 1.3). CHO cells were treated with
Ac4GalNAz and then with phosphine-FLAG followed by fluorescent labeling with FITC-conjugated anti-
FLAG and then studied using flow cytometry. Cells treated with Ac4GalNAz showed a 30-fold increase in
fluorescence compared to untreated cells. Two other reporters, Ac42AzGal and Ac36AzGalNAc, showed
no significant increase in fluorescence compared to untreated cells suggesting that they are not utilized as
a substrate for mucin O-linked glycosylation. A competition experiment was used to demonstrate that
GalNAz is incorporated through the GalNAc salvage pathway. When GalNAz was competed with 5 mM
GalNAc, cell surface azides were completely suppressed. Partial inhibition could also be achieved with
GlcNAc, which was shown to be through epimerization of the resulting UDP-GlcNAc to UDP-GalNAc by
the enzyme UDP-glucose 4-epimerase (GALE). This same study and follow up analysis by Zaro et al. (Zaro
et al., 2011) studied glycoproteins with known glycosylation patterns and showed that GalNAz is
preferentially incorporated into mucin-type glycosylation. GlyCAM-IgG, a glycoprotein with both N-
linked and mucin O-linked glycosylation, was expressed in the presence of Ac4GalNAz. The IgG domain
was enriched using Sepharose beads and then subjected to CuAAC conditions with an alkyne-fluorophore
tag followed by in-gel fluorescence scanning, which showed robust labeling by GalNAz. Treatment with
PNGase F, an enzyme that cleaves N-linked glycans, followed by CuAAC and in-gel fluorescence scanning
showed a minimal decrease in signal suggesting that GalNAz is poorly incorporated into N-linked glycans

11
and is mostly incorporated into mucin-type glycosylation. Dube et al. extended the use of GalNAz to living
organisms (Dube et al., 2006). Ac4GalNAz was injected into live mice for 7 days and then spleens and other
organs were harvested and probed for mucin-type glycosylation using the Staudinger ligation with
phosphine-FLAG. Harvested organs showed variable labeling. In particular, the splenocytes showed
distinct populations of high efficiency and low efficiency labeling by Ac4GalNAz with B-cells showing a
higher efficiency of labeling over T-cells. In an exciting new development, Choi et al. introduced an
innovative chemical-genetic MCR-based strategy for deconvoluting the protein substrates of different
ppGalNAcTs (Choi et al., 2019). Initially, the steric bulk of the bioorthogonal group at the N-acetyl-position
of GalNAc was increased so that no wild-type ppGalNAcTs could utilize the corresponding UDP donor-
sugar. They then used structure-guided mutagenesis to create a “hole” in the ppGalNAcT active site so that
the mutant enzyme could accept the biorthogonal “bump” on the GalNAc derivative. Using this bump-hole
approach mutants of several ppGalNAcTs were created that could selectively utilize UDP-GlcNAc bearing
a hexynoic acid substitution at the N-acyl-position (Figure 1.3). These mutant enzymes can selectively
transfer the modified glycosyl donor to peptides in the presence of wild type enzymes that can only use
unmodified UDP-GlcNAc, and thus can be used to deconvolute the peptide substrates of individual
ppGalNAcTs. While this strategy has not yet been extended to living cells, it could potentially enable the
mapping of each ppGalNAcT to its glycoproteinsubstrate(s).
Mucin O-linked inhibitors (MCIs)
Inhibitors of mucin O-linked glycosylation serve as important probes for understanding the
underlying cellular functions of mucin glycosylation. As noted above, the defining feature of mucin O-
linked glycosylation compared to other types of glycosylation is the initial addition of GalNAc to Ser/Thr
residues of protein substrates (Ten Hagen et al., 2003). One useful group of metabolic inhibitors of mucin
O-linked glycosylation utilizes GalNAc analogs as decoy primers that suppress elaboration of O-linked
glycans (Brown et al., 2003; Prescher & Bertozzi, 2006). These unnatural sugars exploit two different

12
mechanisms to accomplish this goal. The first mechanism, exemplified by benzyl N-acetyl-a-
galactosaminide (benzyl a-GalNAc), acts as a decoy substrate for the elaborating glycosyltransferases
(Brown et al., 2003), “soaking up” the elaboration and leaving an unmodified core GalNAc residue (the Tn
antigen) on glycoproteins. The second mechanism, exemplified by per-O,S-acetyl N-thioglycolyl-
galactosamine (Ac5GalNTGc) (Agarwal et al., 2013), involves metabolic incorporation of this thiosugar
onto glycoproteins in-place of the normal GalNAc moiety, but once incorporated it cannot be elaborated
by the downstream glycosyltransferases. Ac5GalNTGc therefore functions in a similar fashion to ManBut
described above. While both benzyl a-GalNAc and Ac5GalNTGc disrupt O-glycan elongation globally,
they have drawbacks. For example, because GalNAc monosaccharides are transferred onto a multiple
different glycans, these GalNAc analogs may inhibit other forms of glycosylation. Indeed, a reporter
analogous to Ac5GalNTGc, Ac4GalNAz, was shown to label both O-linked and O-GlcNAc glycans (Boyce
et al., 2011).
Fucose
L-Fucose, a 6-deoxyhexose, is commonly found at the termini of N-linked and O-linked glycans.
The addition of fucose to glycans is catalyzed by a class of enzymes known as fucosyltransferases (FucTs)
that utilize the sugar donor GDP-fucose. Fucosylation has been shown to be important in cell-cell and cell-
pathogen interactions and fucosylation levels, like those of sialylation, are elevated during development
(Becker & Lowe, 2003).
Fucose reporters (MCRs)
The fucose salvage pathway allows the incorporation of fucose analogs onto glycans. By
incorporation of an appropriate chemically-reactive group, the resultant adducts can be tagged and
visualized. The first fucose MCR was the azide-bearing fucose analog, Ac4FucAz, developed by Sawa et
al. Ac4FucAz enters the fucose salvage pathway and is converted to the GDP donor and ultimately utilized

13
by fucosyltransferases (Becker & Lowe, 2003). The incorporated sugar can be visualized on cell surface
fucosylated glycans in living cells through CuAAC labeling with an alkyne-bearing fluorescent tag. In
parallel, Rabuka et al. synthesized three fucose analogs with azide substitutions at C2, C4, and C6 of fucose
(Rabuka et al., 2006). The 2- and 4-azido fucose were not metabolically incorporated, and while the 6-
azidofucose was incorporated it unfortunately showed high cytotoxicity (Figure 1.3). Hsu et al.
demonstrated that 6-alkynyl-fucose or Ac4FucAlk, with an alkyne linked to the C5 carbon of fucose (Figure
1.3), showed lower cytotoxicity (Hsu et al., 2007). Unfortunately, both fucose MCRs gave low levels of
metabolic labeling. This prompted a series of experiments in live zebrafish embryos aimed at both
understanding and overcoming this limitation. Chemoenzymatically synthesized GDP-FucAlk was
microinjected into single-cell zebrafish embryos and then subjected to CuAAC with a fluorescent probe
(Soriano Del Amo et al., 2010). To prevent cytotoxicity the biocompatible Cu(I)-complex involving the
bis(tert-butyltriazolyl) ligand BTTES was employed to prevent copper(I) from passing through the cell
membrane. At 2.5 h post fertilization (hpf), fucosylated glycans in the enveloping layer could be visualized,
indicating that conversion of the fucose-MCR into the corresponding GDP donor sugar may be the
problematic step. The Bertozzi lab used GDP-FucAz with SPAAC-tagging to study cell surface
fucosylation during zebrafish development (Dehnert et al., 2012). FucAz-1-phosphate, the metabolic
precursor to the GDP sugar donor, gave no labeling enhancement over background, suggesting that the
fucose salvage pathway enzymes do not tolerate the C6-azido modification after FucAz-1-phosphate. While
Okeley et al. was able to improve their previous metabolic labeling with FucAlk by using GDP-FucAlk and
a rate-accelerating, chelating azide-assisted CuAAC reaction, it was subsequently found that FucAlk also
acts as a metabolic inhibitor of normal fucosylation (Okeley et al., 2013). Subsequently, Kizuka et al.
synthesized additional alkyne-bearing fucose MCRs and found that extension of the C5 position to 7-
alkynyl-fucose (Figure 1.3) gave anon-inhibitory fucose MCR (Kizuka et al., 2016). However, they found
that this reporter is selectively incorporated into only the core position of N-linked glycans. The field still
awaits the development of a broad-spectrum fucose MCR.

14
Fucose inhibitors (MCIs)
Early approaches toward inhibition of fucosylation were transition-state analogs that act by
destabilizing the putative transition state on the FucT enzyme (Burkart et al., 2000). The proposed transition
state for fucosyltransferases is thought to involve the fucose ring adopting a flattened conformation with
oxocarbenium ion character due to the presence of oxygen in the ring. The first varieties synthesized by
Burkart et al. were 2- and 6-fluorinated GDP-fucose analogs (GDP-2F-fucose and GDP-6F-fucose)
(Burkart et al., 2000). These analogs have Ki values ranging from 1 to 35 mM for FucT III, V, and VII.
Another analog was a transition state mimic that replaced the pyranose ring with acyclohexene (Mitchell et
al., 2002). This molecule sits in a half-chair conformation but cannot be turned over due to the lack of a
ring oxygen to stabilize an oxocarbenium-ion like transition state. These compounds exhibited competitive
inhibition of FucT V and VI with Ki values ranging from 6 to 13 mM with no inhibition observed for any
other glycosyltransferases tested (Mitchell et al., 2002). Tokokuni’s lab has also made progress toward
developing transition-state inhibitors in their development of carba- and C-fucosyl analogs of GDP-fucose
(Norris et al., 2004). Carbafucose substitutes a carbon for the pyranose ring oxygen, generating a
cyclohexane. C-fucose replaces the glycosidic oxygen with methylene, to give a phosphonate. Studies with
FucT V revealed that GDP-C-fucose was a more potent inhibitor with Ki values of 8 mM compared to 26
mM for GDP-carbafucose. The aforementioned compounds are effective FucT inhibitors; however, as
GDP-based compounds they are not cell permeable and cannot be applied readily in cellular studies.
Rillahan et al. showed that both per-acetylated 2F- and 6F-fucose are cell-permeable and can be converted
to GDP-2F-fucose and GDP-6F-fucose through the fucose salvage pathway (Figure 1.4) (Rillahan et al.,
2012). After treatment with 2F-Fuc for 3 days, HL-60 cells had almost complete loss of fucose-containing
Lewis X and sLeXstructures; reduced but not complete loss of expression of these structures was obtained
with 6F-Fuc. Metabolic uptake of 2F-Fuc results in build-up of GDP-2F-fucose and feed-back inhibition of
GDP-fucose biosynthesis. Remarkably, 2F-Fuc is orally available and inhibits protein fucosylation in vivo
(Okeley et al., 2013). Zandberg et al. developed a similar approach by using per-acetylated 5-thiofucose

15
(5T-Fuc) (Zandberg et al., 2012). This molecule is metabolized to GDP-5T-Fuc and inhibited both FucT
III and FucT VII. Treatment of HepG2 cells with 5T-Fuc decreased the levels of cell surface sLeX.
Interestingly, 5T-Fuc showed no inhibitory effect on core fucosylation. This study demonstrated that
treatment of endothelial cells with 5T-Fuc prevented adhesion. Allen et al. synthesized 6,6,6-
trifluorofucose, termed fucostatin I, which reduced fucosylation of recombinant antibodies produced in cell
culture (Allen et al., 2016). This molecule is proposed to inhibit the biosynthesis of fucose from mannose
in cells, thereby starving FucTs of GDP-fucose. Interestingly, the authors found that a small amount of
6,6,6-trifluorofucose was also incorporated onto proteins. This prompted the synthesis of a protected
phosphonate analog at the anomeric position, resulting in fucostatin II, which inhibits fucosylation by the
same mechanism but without unnatural mono-saccharide incorporation (Allen et al., 2016).
O-GlcNAc modification
O-GlcNAcylation involves the addition of the monosaccharide N-acetylglucosamine (GlcNAc) to
serine and threonine residues of nuclear, cytosolic, and mitochondrial proteins (Bond Mr Fau - Hanover &
Hanover, 2015; Yang & Qian, 2017; Zachara, 2018). O-GlcNAc is dynamically modified through the action
of just two enzymes; O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA), which catalyze the addition
and removal of GlcNAc, respectively (Joiner et al., 2019; King et al., 2019; Levine & Walker, 2016). The
majority of GlcNAc molecules are synthesized from glucose through the hexosamine biosynthetic pathway
(HBP) and are transformed into the nucleotide sugar donor, UDP-GlcNAc, which is the substrate for OGT.
The dependence of UDP-GlcNAcsynthesis on the supply of glucose and other biomolecules means that O-
GlcNAcylation can act as a nutrient biosensor, with its abundance varying as a function of nutrient density
within a cell. O-GlcNAcylation differs from most other forms of glycosylation in three major ways; (1) it
is reversibly modulated, (2) it occurs on intracellular proteins, and (3) once the GlcNAc moiety has been
added it is not elaborated further. The dynamic nature of O-GlcNAcylation establishes it as an important
part of modulating gene expression, signal transduction, stress responses, and protein stability. These roles

16
have been shown to be essential to the normal growth and development of nearly all multicellular
organisms. Genetic knockout of OGT results in embryonic lethality in Drosophila and mice, while tissue
specific knockout of OGT in T-cells causes apoptosis and loss of OGT in neurons is associated with
neurodegeneration in mice (O'Donnell et al., 2004; Shafi et al., 2000; Sinclair et al., 2009; Wang et al.,
2016). Shifts in global O-GlcNAcylation have been implicated in a variety of diseases. O-GlcNAc levels
are consistently elevated in all types of cancer compared to healthy tissue whereas neurodegenerative
disorders are associated with an overall reduction (Akan et al., 2018; Banerjee et al., 2016; Ferrer et al.,
2016; Ma et al., 2017; Ma & Vosseller, 2013; Trinca & Hagan, 2018). Taken together, these general
observations indicate that O-GlcNAc plays a vital role in modulating various proteins and pathways.
O-GlcNAc reporters (MCRs)
Hang and Vocadlo et al. synthesized the first two metabolic reporters for O-GlcNAcylation,
Ac4GlcNAz and Ac4GalNAz (Figure 1.3) (Hang et al., 2003; Vocadlo et al., 2003). These MCRs are C4
epimers that are interconverted by the enzyme UDP-glucose 4-epimerase (GALE) and both can be
incorporated into O-GlcNAcylated proteins. As part of these studies, they synthesized UDP-GlcNAz and
the individual corresponding upstream-metabolites of the GlcNAc salvage pathway and directly
demonstrated that all of the relevant enzymes, including OGT, can utilize the azide analog as a substrate in
vitro. OGA cleaves GlcNAz from proteins with similar efficiency as GlcNAc, indicating that MCRs would
not necessarily affect the dynamics of the modification. Treatment of Jurkat cells with Ac4GlcNAz resulted
in labeling of numerous nuclear proteins, which are known to be O-GlcNAcylated in human cells. Later,
Boyce et al. studied the potential for cross-talk between the GalNAc and GlcNAc salvage pathways (Boyce
et al., 2011). Using Ac4GalNAz, they demonstrated robust labeling on nucleo-cytoplasmic proteins that was
increased by the overexpression of OGT. These results suggested that UDP-GalNAz is converted to UDP-
GlcNAz by GALE allowing for the labeling of proteins by GalNAz, which was directly demonstrated using
metabolite analysis. They also found that GalNAz demonstrated superior labeling versus GlcNAz, which

17
was attributed to a bottleneck in the synthesis of UDP-GlcNAz by the GlcNAc salvage pathway. Zaro et al.
explored the possibility of improving O-GlcNAc labeling through the use of CuAAC and an alkyne analog
of GlcNAc, Ac4GlcNAlk (Figure 1.3) (Zaro et al., 2011). CuAAC labeling of cells treated with
Ac4GlcNAlk was robust and similar to labeling with Ac4GlcNAz. GlcNAz and GlcNAlk were metabolically
incorporated and removed at similar rates, indicating that GlcNAlk does not noticeably affect the dynamics
of the modification. While GlcNAlk showed improved signal-to-noise ratio, it was not specific to O-
GlcNAcylation. Both GlcNAz and GlcNAlk were incorporated into the reporter protein GlyCAM-IgG,
which bears both N-linked and mucin O-linked glycosylation, and the removal of the N-linked glycans
showed significant decrease in labeling of both GlcNAz and GlcNAlk, suggesting both analogs are
incorporated into N-linked glycans. Both analogs labeled FoxO1A, a known O-GlcNAc modified protein,
showing that both compounds can be used for detection of O-GlcNAc protein modification. We set out to
identify a more selective MCR for O-GlcNAc modification. Inspired by work demonstrating that UDP-6-
azido-6-deoxy-GlcNAc was a substrate for OGT,(Mayer et al., 2011) we synthesized Ac36AzGlcNAc (Fig.
3) (Chuh et al., 2014). Cells treated with Ac36AzGlcNAc gave similar labeling patterns and intensity as for
Ac4GlcNAz. In order to determine whether Ac36AzGlcNAc could report on O-GlcNAc modifications,
proteins were enriched from cells treated with Ac36AzGlcNAc and known O-GlcNAc modified proteins
NEDD4, pyruvate kinase, and nucleoporin 62 (nup62) were identified by western blotting. Additionally,
6AzGlcNAc robustly labeled FoxO1, a known O-GlcNAc modified protein, but did not label GlyCAM-
IgG. Together these experiments demonstrated selectivity for incorporation into O-GlcNAc modifications.
Chuh et al. developed a reporter with the alkyne moiety at the 6-position, Ac36AlkGlcNAc, which gives
improved signal-to-noise ratio (Figure 1.3) (Chuh et al., 2017). When compared to Ac36AzGlcNAc, the
alkyne derivative exhibited essentially identical labeling patterns and intensity but lower background. Chuh
et al. showed that when Ac36AlkGlcNAc was used in proteomics workflows, caspases-3 and -8 were
modified (Chuh et al., 2017). Caspase-8 was O-GlcNAc modified near its cleavage/activation site, which
blocks cleavage and activation. OGT displays considerable substrate promiscuity, which prompted the
analysis of additional GlcNAc analogs, including 2-azido-2-deoxy-glucose (Ac42AzGlc) (Shen et al.,

18
2017; Zaro et al., 2017) and 4-deoxy-GlcNAz (Ac34dGlcNAz) (Figure 1.3) (Li et al., 2016). Both of these
MCRs appear to be selective for O-GlcNAc modifications over cell-surface glycosylation. Interestingly,
fully O-acetylated Ac42AzGlc displayed high toxicity in cells at higher concentrations for longer periods
of time (i.e. 200mM for 16 h). The Yarema lab has previously shown that fully-acetylated versus partially-
protected MCRs undergo differential metabolism and exhibit different toxicity (Aich et al., 2008). In line
with these findings, selective removal of the 6-O-acetyl group from Ac42AzGlc alleviated its toxicity. OGA
does not utilize Ac34dGlcNAz as a substrate, indicating that this probe might alter the normal dynamics of
O-GlcNAc modifications.
O-GlcNAc inhibitors (MCIs)
A range of OGT inhibitors have been developed that allow exploration of the role O-GlcNAcylation
on cellular functions (Trapannone et al., 2016). Small molecule inhibitors have been vital in deciphering
the role OGT plays as a catalytic enzyme versus a scaffolding protein. The 3D structure of the catalytic
domain of OGT has supported the design of substrate analogs and other small molecules (Gross et al., 2008;
Lazarus et al., 2011; Martin et al., 2018). Structural work shows that OGT binds UDP-GlcNAc first
followed by its protein substrate (Lazarus et al., 2011; Schimpl et al., 2012). In order to react, the bond
between the UDP moiety and GlcNAc must undergo a substitution reaction, releasing UDP and transferring
GlcNAc onto Ser/Thr within proteins. One class of analogs, developed by Dorfmueller et al., replaced the
linking oxygen connecting GlcNAc to the phosphorus of UDP with less reactive groups, namely UDP-S-
GlcNAc, UDP-C-GlcNAc, and C-UDP (Dorfmueller et al., 2011). While not cell permeable, these analogs
afforded useful structural insight. Gloster et al. developed a novel MCI, 2-acetamido-2-deoxy-5-thio-D-
glucopyranose (Ac45SGlcNAc) (Gloster et al., 2011). Administered to cells as the per-acetate
Ac45SGlcNAc, this compound enters the GlcNAc salvage pathway and is converted to UDP-5SGlcNAc.
However, UDP-5SGlcNAc is not a substrate for OGT and instead competitively inhibits this enzyme.
Inhibition with Ac45SGlcNAc lowers the normal turnover rate to just 0.2–5% of that of its normal substrate,

19
with an EC50 value of 5mM. By incorporating more lipophilic N-acyl groups, Liu et al. developed a
hexanoic acid derivative with improved cell permeability and bioactivity (Liu et al., 2018). This study
showed that OGT inhibition with this derivative led to deficient leptin signaling in mice. Administration of
these compounds to 3T3-L1 adipocytes lowered expression of Sp1 suggesting that OGT plays a role in
regulation of fat tissues. The Jiang group modified the 5SGlcNAc scaffold to incorporate electrophilic
substituents off the N-acetyl group (Worth et al., 2019). These inhibitors react with a cysteine residue in
the OGT active site, resulting in non-reversible covalent inhibition. These inhibitors successfully cause
reduction of OGT activity, however questions of the specificity of their electrophilic groups in the cellular
environment remain unanswered. These inhibitors have been reported to reduce the pool of intracellular
UDP-GlcNAc and therefore may inhibit other glycosyltransferases directly and/or indirectly (Ortiz-Meoz
et al., 2015).
Glycosaminoglycans
Glycosaminoglycans (GAGs) are linear polysaccharides composed of repetitive disaccharide
building blocks containing amino sugars. Many GAGs are covalently bound to protein substrates to form
macromolecules termed proteoglycans (Bülow & Hobert, 2006; Handel et al., 2005; Soares da Costa et al.,
2017). GAG subtypes can be further classified as one of the following: hyaluronan (HA), keratan sulfate
(KS), chondroitin sulfate/dermatan sulfate (CS/DS), or heparin/heparan sulfate (HS). All GAG subtypes
share a characteristic pattern of alternating hexosamine and uronic acid subunits with the exception of KS
which instead alternates between hexosamine and galactose. Each GAG subtype can be attached to proteins
(i.e., proteoglycans) besides HA, but they differ in their attachment to the underlying proteins. KS chains
are linked to underlying N-linked, mucin O-linked, or O-linked mannose glycans (Funderburgh, 2002).
CS/DS and HS GAG side chains are attached to core proteins at serine residues through a unique form of
core glycosylation. Assembly begins with a xylose monosaccharide and is extended into a tetrasaccharide
core composed of GlcAb(1-3)Galb(1-3)Galb(1-4)Xylb-serine. Addition of either a GalNAc or GlcNAc

20
determines if the GAG chain belongs to the CS/DS or HS subtype respectively. Proteoglycans have been
identified in virtually all mammalian cell types. The protein core is synthesized in the rough endoplasmic
reticulum followed by translocation and the attachment and elongation of the polysaccharide chain in the
Golgi apparatus. Completed proteoglycans are secreted into the extracellular matrix (ECM), inserted into
the plasma membrane, or stored in secretory granules (Pomin & Mulloy, 2018). GAGs can be sulfated
through the action of various sulfotransferase enzymes, resulting in an increased negative charge (Soares
da Costa et al., 2017). The anionic character of sulfated GAGs facilitates interactions with a large number
of different proteins including proteases (Douaiher et al., 2014), growth factors (Andres et al., 1991;
Billings & Pacifici, 2015; Christianson & Belting, 2014; Kirkbride et al., 2008; Korpetinou et al., 2014;
Lewis et al., 2000), cytokines (Korpetinou et al., 2014), lectins (Iozzo, 1998; Morawski et al., 2012), and
various structural proteins (Eklund et al., 2001; Iozzo, 1998). Proteoglycans have important biological
functions including regulating cell-cell interactions, enzyme inhibition, and cell proliferation.
Glycosaminoglycan reporter/inhibitors (combination MCR/MCIs)
MCRs have been developed for the visualization of GAGs. For example, Linhardt’s lab synthesized
the UDP sugar donors of the 4-azido-N-acetylhexosamines 4AzGlcNAc and 4AzGalNAc and demonstrated
that these MCRs were incorporated into HS and HA polysaccharide chains in vitro (Figure 1.5) (Zhang et
al., 2017). In both cases, incorporation of these potential MCRs led to premature termination and truncation
of the GAG chains. Therefore, the MCRs are MCIs but the resulting azido-terminated GAGs are substrates
for bioorthogonal tagging. Unfortunately, this method is not currently applicable for cellular systems,
because the metabolic enzymes required to generated UDP-GlcNAc do not tolerate large substituents at the
4-position (Guan et al., 2009). To exploit this possibility future efforts will need to focus on genetically
engineering these pathways to enhance their promiscuity. Using a similar strategy, the Bertozzi lab
synthesized the UDP donor sugar of 4-azido-4-deoxy-xylose (4AzXyl) (Beahm et al., 2014). Injection of

21
this UDP-4-AzXyl into zebrafish embryos resulted in the incorporation of this MCR into the core position
of the appropriate proteoglycans and blockage of GAG extension.
Glycosaminoglycan inhibitors (MCIs)
van Wijk et al. reported a series of 4-deoxy xylose analogs whose inhibitory effects were
characterized in hepatocytes by monitoring the incorporation of heavy isotope-labeled [3H]GlcN into
elongated GAG chains (Berkin et al., 2000). Unfortunately, these 4-deoxy xylose moieties showed only
small inhibitor effects even at concentrations up to 20 mM. In an attempt to target a later step in GAG
biosynthesis, they also synthesized 4-deoxy-GlcNAc (Figure 1.5) (van Wijk et al., 2013). This molecule
was administered to cells as the per-O-acetylated sugar and metabolically converted into UDP-4-deoxy-
GlcNAc through the GlcNAc salvage pathway. 4-Deoxy-GlcNAc inhibited both HS and CS expression in
SKOV3 cells, reducing chain length by up to 96%. This molecule acts to inhibit either the GlcNAc-
glycosyltransferase or the biosynthesis of UDP-GlcNAc and is not a chain-terminating substrate. An
example of a true chain terminator for GAG synthesis was also reported by van Wijk et al. (van Wijk et al.,
2015) 4-Fluoro and 6-fluoro derivatives of both GalNAc and GlcNAc (Figure 1.5) are converted in vitro
to the corresponding UDP-sugars. The 4-fluoro analogs are incorporated into GAG chains and terminate
elongation (Schultz et al., 2017), while the 6-fluoro variants largely functioned to reduce cellular pools of
UDP-GlcNAc and UDP-GalNAc.Given the importance of these donor sugars for other types of
glycosylation, more work is needed to accurately define the specificity of these MCIs before they can be
applied to detailed biological studies of GAG function.

Figure 1.5 GAG MCR/MCI candidates and inhibitors.

22
Conclusions and outlook
Metabolic perturbation has been a uniquely impactful chemical method for the interrogation and
manipulation of glycoproteins. These tools have helped to overcome the limitations inherent in the non-
genetically coded biosynthesis of glycans, which is compounded by their heterogeneous and complex
structures. The continued development of MCRs with different structures, glycan selectivity, etc. combined
with the creation of improved bioorthogonal reactions has moved the field from the superficial analysis of
cellular labeling by flow cytometry to intricate and insightful biochemical experiments in a variety of cell
types and even within living organisms. The simultaneous improvement of tags for enrichment and
proteomics techniques has generated vast amounts of hypothesis-generating data concerning the identities
of different glycoproteins and sites of glycan attachment for future investigations. Likewise, the expanding
field of MCIs has created opportunities to inhibit types of glycosylation that have been refractory to
traditional small molecule approaches. However, challenges still remain. In the case of MCRs, a major
challenge is the creation of reporters that are selective for one class of glycosylation over another, which
would allow highly targeted studies. Additionally, recent data has shown that treatment of cells with MCRs
results in non-enzymatic chemical labeling of proteins, particularly intracellular proteins on cysteine
residues (Qin et al., 2018). “Off-target” labeling needs to be taken into account and all potentially
glycosylated proteins need to be confirmed by complementary techniques or direct identification of a
bonafide glycosylation site. Fortunately, it appears that background modification and toxicity can be
diminished using different protecting group patterns on the monosaccharide hydroxyl-groups (Hao et al.,
2019). MCIs also suffer from a lack of selectivity and limitations on what types of monosaccharide
modifications can be tolerated by cellular biosynthetic pathways. The field would greatly benefit from
careful metabolite analysis of both MCRs and MCIs, which may identify unexpected cross-talk between
different metabolic pathways that might be exploited for the development of more advanced chemical tools
for inhibiting, manipulating and detecting glycans.

23
Chapter 1 References

Agard, N. J., Prescher Ja Fau - Bertozzi, C. R., & Bertozzi, C. R. (2004). A strain-promoted [3 + 2] azide-
alkyne cycloaddition for covalent modification of biomolecules in living systems. (0002-7863 (Print)).
Agarwal, K., Kaul R Fau - Garg, M., Garg M Fau - Shajahan, A., Shajahan A Fau - Jha, S. K., Jha Sk Fau
- Sampathkumar, S.-G., & Sampathkumar, S. G. (2013). Inhibition of mucin-type O-glycosylation
through metabolic processing and incorporation of N-thioglycolyl-D-galactosamine peracetate
(Ac5GalNTGc). (1520-5126 (Electronic)).
Aich, U., Campbell Ct Fau - Elmouelhi, N., Elmouelhi N Fau - Weier, C. A., Weier Ca Fau -
Sampathkumar, S. G., Sampathkumar Sg Fau - Choi, S. S., Choi Ss Fau - Yarema, K. J., & Yarema, K. J.
(2008). Regioisomeric SCFA attachment to hexosamines separates metabolic flux from cytotoxicity and
MUC1 suppression. (1554-8937 (Electronic)).
Akan, I., Olivier-Van Stichelen, S., Bond, M. R., & Hanover, J. A.-O. (2018). Nutrient-driven O-GlcNAc
in proteostasis and neurodegeneration. (1471-4159 (Electronic)).
Allen, J. G., Mujacic, M., Frohn, M. J., Pickrell, A. J., Kodama, P., Bagal, D., . . . McCarter, J. D. (2016).
Facile Modulation of Antibody Fucosylation with Small Molecule Fucostatin Inhibitors and Cocrystal
Structure with GDP-Mannose 4,6-Dehydratase. (1554-8937 (Electronic)).
Andres, J. L., Rönnstrand L Fau - Cheifetz, S., Cheifetz S Fau - Massagué, J., & Massagué, J. (1991).
Purification of the transforming growth factor-beta (TGF-beta) binding proteoglycan betaglycan. (0021-
9258 (Print)).

24
Banerjee, P. S., Lagerlöf, O., & Hart, G. W. (2016). Roles of O-GlcNAc in chronic diseases of aging.
(1872-9452 (Electronic)).
Bansil, R., Stanley E Fau - LaMont, J. T., & LaMont, J. T. (1995). Mucin biophysics. (0066-4278
(Print)).
Barchi, J. J., Jr. (2013). Mucin-type glycopeptide structure in solution: past, present, and future. (1097-
0282 (Electronic)).
Beahm, B. J., Dehnert Kw Fau - Derr, N. L., Derr Nl Fau - Kuhn, J., Kuhn J Fau - Eberhart, J. K.,
Eberhart Jk Fau - Spillmann, D., Spillmann D Fau - Amacher, S. L., . . . Bertozzi, C. R. (2014). A
visualizable chain-terminating inhibitor of glycosaminoglycan biosynthesis in developing zebrafish.
(1521-3773 (Electronic)).
Becker, D. J., & Lowe, J. B. (2003). Fucose: biosynthesis and biological function in mammals.
Glycobiology, 13(7), 41R-53R.
Berkin, A., Szarek Wa Fau - Kisilevsky, R., & Kisilevsky, R. (2000). Synthesis of 4-deoxy-4-fluoro
analogues of 2-acetamido-2-deoxy-D-glucose and 2-acetamido-2-deoxy-D-galactose and their effects on
cellular glycosaminoglycan biosynthesis. (0008-6215 (Print)).
Billings, P. C., & Pacifici, M. (2015). Interactions of signaling proteins, growth factors and other proteins
with heparan sulfate: mechanisms and mysteries. (1607-8438 (Electronic)).
Bond Mr Fau - Hanover, J. A., & Hanover, J. A. (2015). A little sugar goes a long way: the cell biology
of O-GlcNAc. (1540-8140 (Electronic)).

25
Boyce, M., Carrico, I. S., Ganguli, A. S., Yu, S.-H., Hangauer, M. J., Hubbard, S. C., . . . Bertozzi, C. R.
(2011). Metabolic cross-talk allows labeling of O-linked β-N-acetylglucosamine-modified
proteins via the N-acetylgalactosamine salvage pathway. Proceedings of the National
Academy of Sciences, 108(8), 3141.
Breidenbach, M. A., Gallagher Je Fau - King, D. S., King Ds Fau - Smart, B. P., Smart Bp Fau - Wu, P.,
Wu P Fau - Bertozzi, C. R., & Bertozzi, C. R. (2010). Targeted metabolic labeling of yeast N-glycans
with unnatural sugars. (1091-6490 (Electronic)).
Brockhausen, I., Ernst, B., Hart, G. W., & Sinay, P. (2000). Biosynthesis of the O-Glycan Chains of
Mucins and Mucin-Type Glycoproteins (Vol. 3). John Wiley and Sons, Inc.
Brown, J. R., Fuster, M. M., & Esko, J. D. (2003). Glycoside Primers and Inhibitors of Glycosylation.
Carbohydrate‐Based Drug Discovery, 883-898. (Wiley Online Books)
Burkart, M. D., Vincent Sp Fau - Düffels, A., Düffels A Fau - Murray, B. W., Murray Bw Fau - Ley, S.
V., Ley Sv Fau - Wong, C. H., & Wong, C. H. (2000). Chemo-enzymatic synthesis of fluorinated sugar
nucleotide: useful mechanistic probes for glycosyltransferases. (0968-0896 (Print)).
Bülow, H. E., & Hobert, O. (2006). The molecular diversity of glycosaminoglycans shapes animal
development. (1081-0706 (Print)).
Choi, J. A.-O., Wagner Ljs Auid- Orcid: --- Fau - Timmermans, S. B. P. E., Timmermans, S., Malaker Sa
Auid- Orcid: --- Fau - Schumann, B., Schumann B Fau - Gray, M. A., Gray Ma Fau - Debets, M. F., . . .
Bertozzi, C. A.-O. (2019). Engineering Orthogonal Polypeptide GalNAc-Transferase and UDP-Sugar
Pairs. (1520-5126 (Electronic)).

26
Christianson, H. C., & Belting, M. (2014). Heparan sulfate proteoglycan as a cell-surface endocytosis
receptor. (1569-1802 (Electronic)).
Chuh, K. N., Batt, A. R., Zaro, B. W., Darabedian, N., Marotta, N. P., Brennan, C. K., . . . Pratt, M. R.
(2017). The New Chemical Reporter 6-Alkynyl-6-deoxy-GlcNAc Reveals O-GlcNAc Modification of the
Apoptotic Caspases That Can Block the Cleavage/Activation of Caspase-8. Journal of the American
Chemical Society, 139(23), 7872-7885.
Chuh, K. N., Zaro, B. W., Piller, F., Piller, V., & Pratt, M. R. (2014). Changes in Metabolic Chemical
Reporter Structure Yield a Selective Probe of O-GlcNAc Modification. Journal of the American
Chemical Society, 136(35), 12283-12295.
Cole, C. M., Yang, J., Šečkutė, J., & Devaraj, N. K. (2013). Fluorescent Live-Cell Imaging of
Metabolically Incorporated Unnatural Cyclopropene-Mannosamine Derivatives. ChemBioChem, 14(2),
205-208.
D. Burkart, M., P. Vincent, S., & Wong, C.-H. (1999). An efficient synthesis of CMP-3-fluoroneuraminic
acid. Chemical Communications(16), 1525-1526.
Dehnert, K. W., Baskin, J. M., Laughlin, S. T., Beahm, B. J., Naidu, N. N., Amacher, S. L., & Bertozzi,
C. R. (2012). Imaging the Sialome during Zebrafish Development with Copper-Free Click Chemistry.
ChemBioChem, 13(3), 353-357.
Dorfmueller, H. C., Borodkin Vs Fau - Blair, D. E., Blair De Fau - Pathak, S., Pathak S Fau - Navratilova,
I., Navratilova I Fau - van Aalten, D. M. F., & van Aalten, D. M. (2011). Substrate and product analogues
as human O-GlcNAc transferase inhibitors. (1438-2199 (Electronic)).

27
Douaiher, J., Succar, J., Lancerotto, L., Gurish, M. F., Orgill, D. P., Hamilton, M. J., . . . Stevens, R. L.
(2014). Development of mast cells and importance of their tryptase and chymase serine proteases in
inflammation and wound healing. (1557-8445 (Electronic)).
Dube, D. H., Prescher, J. A., Quang, C. N., & Bertozzi, C. R. (2006). Probing mucin-type O-linked
glycosylation in living animals. Proceedings of the National Academy of Sciences of the United States of
America, 103(13), 4819.
Eklund, L., Piuhola J Fau - Komulainen, J., Komulainen J Fau - Sormunen, R., Sormunen R Fau -
Ongvarrasopone, C., Ongvarrasopone C Fau - Fássler, R., Fássler R Fau - Muona, A., . . . Pihlajaniemi, T.
(2001). Lack of type XV collagen causes a skeletal myopathy and cardiovascular defects in mice. (0027-
8424 (Print)).
Feng, L., Hong, S., Rong, J., You, Q., Dai, P., Huang, R., . . . Chen, X. (2013). Bifunctional Unnatural
Sialic Acids for Dual Metabolic Labeling of Cell-Surface Sialylated Glycans. Journal of the American
Chemical Society, 135(25), 9244-9247.
Ferrer, C. M., Sodi, V. L., & Reginato, M. J. (2016). O-GlcNAcylation in Cancer Biology: Linking
Metabolism and Signaling. (1089-8638 (Electronic)).
Funderburgh, J. L. (2002). Keratan sulfate biosynthesis. (1521-6543 (Print)).
Gloster, T. M., Zandberg Wf Fau - Heinonen, J. E., Heinonen Je Fau - Shen, D. L., Shen Dl Fau - Deng,
L., Deng L Fau - Vocadlo, D. J., & Vocadlo, D. J. (2011). Hijacking a biosynthetic pathway yields a
glycosyltransferase inhibitor within cells. (1552-4469 (Electronic)).

28
Gross, B. J., Swoboda Jg Fau - Walker, S., & Walker, S. (2008). A strategy to discover inhibitors of O-
linked glycosylation. (1520-5126 (Electronic)).
Guan, W., Cai L Fau - Fang, J., Fang J Fau - Wu, B., Wu B Fau - George Wang, P., & George Wang, P.
(2009). Enzymatic synthesis of UDP-GlcNAc/UDP-GalNAc analogs using N-acetylglucosamine 1-
phosphate uridyltransferase (GlmU). (1364-548X (Electronic)).
Handel, T. M., Johnson Z Fau - Crown, S. E., Crown Se Fau - Lau, E. K., Lau Ek Fau - Proudfoot, A. E.,
& Proudfoot, A. E. (2005). Regulation of protein function by glycosaminoglycans--as exemplified by
chemokines. (0066-4154 (Print)).
Hang, H. C., & Bertozzi, C. R. (2005). The chemistry and biology of mucin-type O-linked glycosylation.
(0968-0896 (Print)).
Hang, H. C., Yu, C., Kato, D. L., & Bertozzi, C. R. (2003). A metabolic labeling approach toward
proteomic analysis of mucin-type O-linked glycosylation. Proceedings of the National Academy of
Sciences, 100(25), 14846.
Hao, Y., Fan, X., Shi, Y., Zhang, C., Sun, D. E., Qin, K., . . . Chen, X. A.-O. (2019). Next-generation
unnatural monosaccharides reveal that ESRRB O-GlcNAcylation regulates pluripotency of mouse
embryonic stem cells. (2041-1723 (Electronic)).
Heise, T., Pijnenborg, J. F. A., Büll, C., van Hilten, N., Kers-Rebel, E. D., Balneger, N., . . . Boltje, T. A.-
O. (2019). Potent Metabolic Sialylation Inhibitors Based on C-5-Modified Fluorinated Sialic Acids.
(1520-4804 (Electronic)).

29
Helenius, A., & Aebi, M. (2004). Roles of N-linked glycans in the endoplasmic reticulum. (0066-4154
(Print)).
Hsu, T.-L., Hanson, S. R., Kishikawa, K., Wang, S.-K., Sawa, M., & Wong, C.-H. (2007). Alkynyl sugar
analogs for the labeling and visualization of glycoconjugates in cells. Proceedings of the National
Academy of Sciences, 104(8), 2614.
Iozzo, R. V. (1998). Matrix proteoglycans: from molecular design to cellular function. (0066-4154
(Print)).
Jensen, P. H., Kolarich D Fau - Packer, N. H., & Packer, N. H. (2010). Mucin-type O-glycosylation--
putting the pieces together. (1742-4658 (Electronic)).
Joiner, C. M., Li, H., Jiang, J., & Walker, S. (2019). Structural characterization of the O-GlcNAc cycling
enzymes: insights into substrate recognition and catalytic mechanisms. (1879-033X (Electronic)).
Jonckheere, N., & Van Seuningen, I. (2010). The membrane-bound mucins: From cell signalling to
transcriptional regulation and expression in epithelial cancers. (1638-6183 (Electronic)).
Kayser, H., Zeitler R Fau - Kannicht, C., Kannicht C Fau - Grunow, D., Grunow D Fau - Nuck, R., Nuck
R Fau - Reutter, W., & Reutter, W. (1992). Biosynthesis of a nonphysiological sialic acid in different rat
organs, using N-propanoyl-D-hexosamines as precursors. (0021-9258 (Print)).
Keppler, O. T., Horstkorte, R., Pawlita, M., Schmidt, C., & Reutter, W. (2001). Biochemical engineering
of the N-acyl side chain of sialic acid: biological implications. Glycobiology, 11(2), 11R-18R.

30
King, D. T., Males, A., Davies, G. J., & Vocadlo, D. J. (2019). Molecular mechanisms regulating O-
linked N-acetylglucosamine (O-GlcNAc)-processing enzymes. (1879-0402 (Electronic)).
Kirkbride, K. C., Townsend Ta Fau - Bruinsma, M. W., Bruinsma Mw Fau - Barnett, J. V., Barnett Jv Fau
- Blobe, G. C., & Blobe, G. C. (2008). Bone morphogenetic proteins signal through the transforming
growth factor-beta type III receptor. (0021-9258 (Print)).
Kizuka, Y., Funayama, S., Shogomori, H., Nakano, M., Nakajima, K., Oka, R., . . . Taniguchi, N. (2016).
High-Sensitivity and Low-Toxicity Fucose Probe for Glycan Imaging and Biomarker Discovery. (2451-
9448 (Electronic)).
Korpetinou, A., Skandalis, S. S., Labropoulou, V. T., Smirlaki, G., Noulas, A., Karamanos, N. K., &
Theocharis, A. D. (2014). Serglycin: at the crossroad of inflammation and malignancy. (2234-943X
(Print)).
Lairson, L. L., Henrissat B Fau - Davies, G. J., Davies Gj Fau - Withers, S. G., & Withers, S. G. (2008).
Glycosyltransferases: structures, functions, and mechanisms. (0066-4154 (Print)).
Lazarus, M. B., Nam Y Fau - Jiang, J., Jiang J Fau - Sliz, P., Sliz P Fau - Walker, S., & Walker, S.
(2011). Structure of human O-GlcNAc transferase and its complex with a peptide substrate. (1476-4687
(Electronic)).
Levine, Z. G., & Walker, S. (2016). The Biochemistry of O-GlcNAc Transferase: Which Functions Make
It Essential in Mammalian Cells? (1545-4509 (Electronic)).

31
Lewis, K. A., Gray Pc Fau - Blount, A. L., Blount Al Fau - MacConell, L. A., MacConell La Fau -
Wiater, E., Wiater E Fau - Bilezikjian, L. M., Bilezikjian Lm Fau - Vale, W., & Vale, W. (2000).
Betaglycan binds inhibin and can mediate functional antagonism of activin signalling. (0028-0836
(Print)).
Li, J., Wang, J., Wen, L., Zhu, H., Li, S., Huang, K., . . . Wang, P. G. (2016). An OGA-Resistant Probe
Allows Specific Visualization and Accurate Identification of O-GlcNAc-Modified Proteins in Cells.
(1554-8937 (Electronic)).
Lin, F. L., Hoyt Hm Fau - van Halbeek, H., van Halbeek H Fau - Bergman, R. G., Bergman Rg Fau -
Bertozzi, C. R., & Bertozzi, C. R. (2019). Mechanistic investigation of the staudinger ligation. (0002-
7863 (Print)).
Liu, T. W., Zandberg, W. A.-O., Gloster, T. A.-O., Deng, L., Murray, K. D., Shan, X., & Vocadlo, D. A.-
O. (2018). Metabolic Inhibitors of O-GlcNAc Transferase That Act In Vivo Implicate Decreased O-
GlcNAc Levels in Leptin-Mediated Nutrient Sensing. (1521-3773 (Electronic)).
Luchansky, S. J., Goon, S., & Bertozzi, C. R. (2004). Expanding the Diversity of Unnatural Cell-Surface
Sialic Acids. ChemBioChem, 5(3), 371-374.
Ma, X., Li, H., He, Y., & Hao, J. (2017). The emerging link between O-GlcNAcylation and neurological
disorders. (1420-9071 (Electronic)).
Ma, Z., & Vosseller, K. (2013). O-GlcNAc in cancer biology. (1438-2199 (Electronic)).

32
Macauley, M. S., Arlian, B. M., Rillahan, C. D., Pang, P. C., Bortell, N., Marcondes, M. C., . . . Paulson,
J. C. (2014). Systemic blockade of sialylation in mice with a global inhibitor of sialyltransferases. (1083-
351X (Electronic)).
Mahal, L. K., Charter Nw Fau - Angata, K., Angata K Fau - Fukuda, M., Fukuda M Fau - Koshland, D.
E., Jr., Koshland De Jr Fau - Bertozzi, C. R., & Bertozzi, C. R. (2001). A small-molecule modulator of
poly-alpha 2,8-sialic acid expression on cultured neurons and tumor cells. (0036-8075 (Print)).
Mahal, L. K., Yarema, K. J., & Bertozzi, C. R. (1997). Engineering Chemical Reactivity on Cell Surfaces
Through Oligosaccharide Biosynthesis. Science, 276(5315), 1125.
Martin, S. A.-O., Tan, Z. W., Itkonen, H. M., Duveau, D. Y., Paulo, J. A., Janetzko, J. A.-O., . . . Walker,
S. A.-O. X. (2018). Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors.
(1520-5126 (Electronic)).
Mayer, A., Gloster Tm Fau - Chou, W. K., Chou Wk Fau - Vocadlo, D. J., Vocadlo Dj Fau - Tanner, M.
E., & Tanner, M. E. (2011). 6''-Azido-6''-deoxy-UDP-N-acetylglucosamine as a glycosyltransferase
substrate. (1464-3405 (Electronic)).
Mbua, N. E., Guo J Fau - Wolfert, M. A., Wolfert Ma Fau - Steet, R., Steet R Fau - Boons, G.-J., &
Boons, G. J. (2011). Strain-promoted alkyne-azide cycloadditions (SPAAC) reveal new features of
glycoconjugate biosynthesis. (1439-7633 (Electronic)).
Mitchell, M. L., Tian F Fau - Lee, L. V., Lee Lv Fau - Wong, C.-H., & Wong, C. H. (2002). Synthesis
and evaluation of transition-state analogue inhibitors of alpha-1,3-fucosyltransferase. (1433-7851 (Print)).

33
Morawski, M., Brückner G Fau - Arendt, T., Arendt T Fau - Matthews, R. T., & Matthews, R. T. (2012).
Aggrecan: Beyond cartilage and into the brain. (1878-5875 (Electronic)).
Möller, H., Böhrsch, V., Bentrop, J., Bender, J., Hinderlich, S., & Hackenberger, C. P. R. (2012). Glycan-
Specific Metabolic Oligosaccharide Engineering of C7-Substituted Sialic Acids. Angewandte Chemie
International Edition, 51(24), 5986-5990.
Neves, A. A., Stöckmann, H., Harmston, R. R., Pryor, H. J., Alam, I. S., Ireland-Zecchini, H., . . . Brindle,
K. M. (2011). Imaging sialylated tumor cell glycans in vivo. The FASEB Journal, 25(8), 2528-2537.
Niederwieser, A., Späte, A.-K., Nguyen, L. D., Jüngst, C., Reutter, W., & Wittmann, V. (2013). Two-
Color Glycan Labeling of Live Cells by a Combination of Diels–Alder and Click Chemistry. Angewandte
Chemie International Edition, 52(15), 4265-4268.
Norris, A. J., Whitelegge Jp Fau - Strouse, M. J., Strouse Mj Fau - Faull, K. F., Faull Kf Fau - Toyokuni,
T., & Toyokuni, T. (2004). Inhibition kinetics of carba- and C-fucosyl analogues of GDP-fucose against
fucosyltransferase V: implication for the reaction mechanism. (0960-894X (Print)).
O'Donnell, N., Zachara Ne Fau - Hart, G. W., Hart Gw Fau - Marth, J. D., & Marth, J. D. (2004). Ogt-
dependent X-chromosome-linked protein glycosylation is a requisite modification in somatic cell function
and embryo viability. (0270-7306 (Print)).
Okeley, N. M., Alley Sc Fau - Anderson, M. E., Anderson Me Fau - Boursalian, T. E., Boursalian Te Fau
- Burke, P. J., Burke Pj Fau - Emmerton, K. M., Emmerton Km Fau - Jeffrey, S. C., . . . Senter, P. D.
(2013). Development of orally active inhibitors of protein and cellular fucosylation. (1091-6490
(Electronic)).

34
Ortiz-Meoz, R. F., Jiang, J., Lazarus, M. B., Orman, M., Janetzko, J., Fan, C., . . . Walker, S. (2015). A
small molecule that inhibits OGT activity in cells. (1554-8937 (Electronic)).
Patterson, D. M., Jones, K. A., & Prescher, J. A. (2014). Improved cyclopropene reporters for probing
protein glycosylation. Molecular BioSystems, 10(7), 1693-1697.
Patterson, D. M., Nazarova La Fau - Prescher, J. A., & Prescher, J. A. (2014). Finding the right
(bioorthogonal) chemistry. (1554-8937 (Electronic)).
Patterson, D. M., Nazarova, L. A., Xie, B., Kamber, D. N., & Prescher, J. A. (2012). Functionalized
Cyclopropenes As Bioorthogonal Chemical Reporters. Journal of the American Chemical Society,
134(45), 18638-18643.
Pomin, V. H., & Mulloy, B. (2018). Glycosaminoglycans and Proteoglycans. (1424-8247 (Print)).
Prescher, J. A., & Bertozzi, C. R. (2006). Chemical technologies for probing glycans. (0092-8674
(Print)).
Prescher, J. A., Dube, D. H., & Bertozzi, C. R. (2004). Chemical remodelling of cell surfaces in living
animals. 430(7002), 873-877.
Qin, W., Qin, K., Fan, X., Peng, L., Hong, W., Zhu, Y., . . . Chen, X. A.-O. (2018). Artificial Cysteine S-
Glycosylation Induced by Per-O-Acetylated Unnatural Monosaccharides during Metabolic Glycan
Labeling. (1521-3773 (Electronic)).

35
Rabuka, D., Hubbard, S. C., Laughlin, S. T., Argade, S. P., & Bertozzi, C. R. (2006). A Chemical
Reporter Strategy to Probe Glycoprotein Fucosylation. Journal of the American Chemical Society,
128(37), 12078-12079.
Rillahan, C. D., Antonopoulos A Fau - Lefort, C. T., Lefort Ct Fau - Sonon, R., Sonon R Fau - Azadi, P.,
Azadi P Fau - Ley, K., Ley K Fau - Dell, A., . . . Paulson, J. C. (2012). Global metabolic inhibitors of
sialyl- and fucosyltransferases remodel the glycome. (1552-4469 (Electronic)).
Rostovtsev, V. V., Green, L. G., Fokin, V. V., & Sharpless, K. B. (2002). A Stepwise Huisgen
Cycloaddition Process: Copper(I)-Catalyzed Regioselective “Ligation” of Azides and Terminal Alkynes.
Angewandte Chemie International Edition, 41(14), 2596-2599.
Row Rd Fau - Prescher, J. A., & Prescher, J. A.-O. (2018). Constructing New Bioorthogonal Reagents
and Reactions. (1520-4898 (Electronic)).
Saxon, E., & Bertozzi, C. R. (2000). Cell Surface Engineering by a Modified Staudinger Reaction.
Science, 287(5460), 2007.
Schimpl, M., Zheng X Fau - Borodkin, V. S., Borodkin Vs Fau - Blair, D. E., Blair De Fau - Ferenbach,
A. T., Ferenbach At Fau - Schüttelkopf, A. W., Schüttelkopf Aw Fau - Navratilova, I., . . . van Aalten, D.
M. (2012). O-GlcNAc transferase invokes nucleotide sugar pyrophosphate participation in catalysis.
(1552-4469 (Electronic)).
Schultz, V. L., Zhang, X., Linkens, K., Rimel, J., Green, D. E., DeAngelis, P. L., & Linhardt, R. A.-O.
(2017). Chemoenzymatic Synthesis of 4-Fluoro-N-Acetylhexosamine Uridine Diphosphate Donors:
Chain Terminators in Glycosaminoglycan Synthesis. (1520-6904 (Electronic)).

36
Schwarz, F., & Aebi, M. (2011). Mechanisms and principles of N-linked protein glycosylation. (1879-
033X (Electronic)).
Shafi, R., Iyer Sp Fau - Ellies, L. G., Ellies Lg Fau - O'Donnell, N., O'Donnell N Fau - Marek, K. W.,
Marek Kw Fau - Chui, D., Chui D Fau - Hart, G. W., . . . Marth, J. D. (2000). The O-GlcNAc transferase
gene resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny.
(0027-8424 (Print)).
Shen, D. L., Liu, T. W., Zandberg, W., Clark, T., Eskandari, R., Alteen, M. G., . . . Vocadlo, D. A.-O.
(2017). Catalytic Promiscuity of O-GlcNAc Transferase Enables Unexpected Metabolic Engineering of
Cytoplasmic Proteins with 2-Azido-2-deoxy-glucose. (1554-8937 (Electronic)).
Sinclair, D. A., Syrzycka M Fau - Macauley, M. S., Macauley Ms Fau - Rastgardani, T., Rastgardani T
Fau - Komljenovic, I., Komljenovic I Fau - Vocadlo, D. J., Vocadlo Dj Fau - Brock, H. W., . . . Honda, B.
M. (2009). Drosophila O-GlcNAc transferase (OGT) is encoded by the Polycomb group (PcG) gene,
super sex combs (sxc). (1091-6490 (Electronic)).
Singh, P. K., & Hollingsworth, M. A. (2006). Cell surface-associated mucins in signal transduction.
(0962-8924 (Print)).
Soares da Costa, D., Reis, R. L., & Pashkuleva, I. (2017). Sulfation of Glycosaminoglycans and Its
Implications in Human Health and Disorders. (1545-4274 (Electronic)).
Soriano Del Amo, D., Wang W Fau - Jiang, H., Jiang H Fau - Besanceney, C., Besanceney C Fau - Yan,
A. C., Yan Ac Fau - Levy, M., Levy M Fau - Liu, Y., . . . Wu, P. (2010). Biocompatible copper(I)
catalysts for in vivo imaging of glycans. (1520-5126 (Electronic)).

37
Späte, A. K., Bußkamp H Fau - Niederwieser, A., Niederwieser A Fau - Schart, V. F., Schart Vf Fau -
Marx, A., Marx A Fau - Wittmann, V., & Wittmann, V. (2014). Rapid labeling of metabolically
engineered cell-surface glycoconjugates with a carbamate-linked cyclopropene reporter. (1520-4812
(Electronic)).
Tabak, L. A. (2010). The role of mucin-type O-glycans in eukaryotic development. (1096-3634
(Electronic)).
Ten Hagen, K. G., Fritz Ta Fau - Tabak, L. A., & Tabak, L. A. (2003). All in the family: the UDP-
GalNAc:polypeptide N-acetylgalactosaminyltransferases. (0959-6658 (Print)).
Tian, E., & Ten Hagen, K. G. (2009). Recent insights into the biological roles of mucin-type O-
glycosylation. (1573-4986 (Electronic)).
Tornøe, C. W., Christensen, C., & Meldal, M. (2002). Peptidotriazoles on Solid Phase: [1,2,3]-Triazoles
by Regiospecific Copper(I)-Catalyzed 1,3-Dipolar Cycloadditions of Terminal Alkynes to Azides. The
Journal of Organic Chemistry, 67(9), 3057-3064.
Trapannone, R., Rafie, K., & van Aalten, D. M. (2016). O-GlcNAc transferase inhibitors: current tools
and future challenges. (1470-8752 (Electronic)).
Trinca, G. M., & Hagan, C. R. (2018). O-GlcNAcylation in women's cancers: breast, endometrial and
ovarian. (1573-6881 (Electronic)).

38
van Wijk, X. M., Lawrence, R., Thijssen, V. L., van den Broek, S. A., Troost, R., van Scherpenzeel, M., .
. . van Kuppevelt, T. H. (2015). A common sugar-nucleotide-mediated mechanism of inhibition of
(glycosamino)glycan biosynthesis, as evidenced by 6F-GalNAc (Ac3). (1530-6860 (Electronic)).
van Wijk, X. M., Thijssen, V. L., Lawrence, R., van den Broek, S. A., Dona, M., Naidu, N., . . . van
Kuppevelt, T. H. (2013). Interfering with UDP-GlcNAc metabolism and heparan sulfate expression using
a sugar analogue reduces angiogenesis. (1554-8937 (Electronic)).
Varki, A. (2008). Sialic acids in human health and disease. (1471-4914 (Print)).
Varki, A., Cummings, R. D., Esko, J. D., Stanley, P., Hart, G. W., Aebi, M., . . . Seeberger, P. H. (2015).
Essentials of Glycobiology. In. https://doi.org/NBK453060
Vocadlo, D. J., Hang, H. C., Kim, E.-J., Hanover, J. A., & Bertozzi, C. R. (2003). A chemical approach
for identifying O-GlcNAc-modified proteins in cells. Proceedings of the National Academy
of Sciences, 100(16), 9116.
Wang, A. C., Jensen, E. H., Rexach, J. E., Vinters, H. V., & Hsieh-Wilson, L. C. (2016). Loss of O-
GlcNAc glycosylation in forebrain excitatory neurons induces neurodegeneration. (1091-6490
(Electronic)).
Worth, M., Hu, C. W., Li, H., Fan, D., Estevez, A. A.-O., Zhu, D., . . . Jiang, J. A.-O. (2019). Targeted
covalent inhibition of O-GlcNAc transferase in cells. (1364-548X (Electronic)).
Wu, H. A.-O., & Devaraj, N. A.-O. (2018). Advances in Tetrazine Bioorthogonal Chemistry Driven by
the Synthesis of Novel Tetrazines and Dienophiles. (1520-4898 (Electronic)).

39
Yang, J., Šečkutė, J., Cole, C. M., & Devaraj, N. K. (2012). Live-Cell Imaging of Cyclopropene Tags
with Fluorogenic Tetrazine Cycloadditions. Angewandte Chemie International Edition, 51(30), 7476-
7479.
Yang, X., & Qian, K. (2017). Protein O-GlcNAcylation: emerging mechanisms and functions. (1471-
0080 (Electronic)).
Zachara, N. E. (2018). Critical observations that shaped our understanding of the function(s) of
intracellular glycosylation (O-GlcNAc). (1873-3468 (Electronic)).
Zandberg, W. F., Kumarasamy J Fau - Pinto, B. M., Pinto Bm Fau - Vocadlo, D. J., & Vocadlo, D. J.
(2012). Metabolic inhibition of sialyl-Lewis X biosynthesis by 5-thiofucose remodels the cell surface and
impairs selectin-mediated cell adhesion. (1083-351X (Electronic)).
Zaro, B. W., Batt, A. R., Chuh, K. N., Navarro, M. X., & Pratt, M. A.-O. (2017). The Small Molecule 2-
Azido-2-deoxy-glucose Is a Metabolic Chemical Reporter of O-GlcNAc Modifications in Mammalian
Cells, Revealing an Unexpected Promiscuity of O-GlcNAc Transferase. (1554-8937 (Electronic)).
Zaro, B. W., Yang, Y.-Y., Hang, H. C., & Pratt, M. R. (2011). Chemical reporters for fluorescent
detection and identification of O-GlcNAc-modified proteins reveal glycosylation of the ubiquitin ligase
NEDD4-1. Proceedings of the National Academy of Sciences, 108(20), 8146.
Zhang, X., Green, D. E., Schultz, V. L., Lin, L., Han, X., Wang, R., . . . Linhardt, R. A.-O. (2017).
Synthesis of 4-Azido-N-acetylhexosamine Uridine Diphosphate Donors: Clickable Glycosaminoglycans.
(1520-6904 (Electronic)).

40
Chapter 2: 4-deoxy-4-fluoro-GalNAz (4FGalNAz) is a metabolic chemical reporter
of O-GlcNAc modifications, highlighting the notable substrate flexibility of O-
GlcNAc transferase*

Introduction
Metabolic chemical reporters (MCRs) of protein glycosylation are powerful chemical tools that
have been used for over a decade to identify and characterize different types of glycans (Figure 2.1a)
(Jackson et al., 2021; Pedowitz & Pratt, 2021). MCRs are typically analogs of naturally occurring
monosaccharides that contain bioorthogonal functionalities at different positions of the sugar ring. If these
chemical modifications are relatively small, MCRs can take advantage of carbohydrate salvage pathway
enzymes with different levels of substrate tolerance to yield corresponding nucleotide sugar donors for
subsequent transfer onto proteins by glycosyltransferases. Then a second bioorthogonal-chemistry step can
be exploited for the selective installation of visualization and/or affinity tags (Nguyen & Prescher, 2020;
Parker & Pratt, 2020). During the initial characterization of MCRs in the late 90s and early 00s, most of
these probes were assumed to largely label one class of glycosylation. For example, Ac 4GlcNAz was
originally thought to label intracellular O-GlcNAc modifications while its C4-epimer, Ac 4GalNAz, seemed
to largely label mucin O-linked glycosylation on the cell surface (Figure 2.1b) (Hang et al., 2003; Vocadlo
et al., 2003). However, more careful analysis demonstrated that these two MCRs could be interconverted
by the enzyme UDP-glucose 4-epimerase (GALE) after they reach their UDP donor-sugars (Figure 2.1b)
(Boyce et al., 2011). Therefore, treatment with either of these MCRs results in a mixture of labeled
glycoproteins, which could complicate their clean application in certain types of experiments.

Giuliano Cutolo (USC), Bo Yang (Harvard), Nageswari Yarravarapu (UT Southwestern), Mary Burns (UT
Southwestern), Ganka Bineva-Todd (Francis Crick Institute), Chloe Roustan (Francis Crick Institute), and
James Thoden (Wisconsin) contributed to the work presented in this chapter.

41
This observation catalyzed an interest in the development of MCRs that are selective for one type of
glycosylation over another. We and others have been most successful in the creation of MCRs that are
selective for O-GlcNAc modification, owing largely to what appears to be a fairly large substrate tolerance
by O-GlcNAc transferase (OGT). For example, building upon previous in vitro observations with OGT, we
demonstrated that both GlcNAc and glucose modified at the 6-position (e.g., 6-azido-6-deoxy-GlcNAc or
6AzGlcNAc) were selective reporters of O-GlcNAc (Chuh et al., 2017; Chuh et al., 2014; Darabedian, Gao,
et al., 2018). Independently, we and the Vocadlo lab also found that 2-azido-2-deoxy-glucose (2AzGlc)
selectively labeled the O-GlcNAc glycome (Shen et al., 2017; Zaro et al., 2017). Finally, work by Wang
and co-workers demonstrated that 4-deoxy-GlcNAz was also a selective reporter of O-GlcNAc
modifications (Li et al., 2016).
Unfortunately, the development of selective MCRs for mucin O-linked glycosylation has been
more difficult. Much of the success in this area has built upon our preliminary observation that larger
substitutions at the N-acetyl position of UDP-GlcNAc and UDP-GalNAc appeared to inhibit their
interconversion by GALE (Zaro et al., 2011). This was confirmed through a series of careful experiments
by the Bertozzi and Schumann (a co-author here) labs to create GalNAc analogs that were not accepted by
GALE and where therefore selective for cell-surface glycosylation and even glycosyltransferase-specific
mucin O-linked glycosylation through a bump-hole strategy (Debets et al., 2020; Schumann et al., 2020).

Figure 2.1 Metabolic chemical reporters (MCRs) of glycosylation. a) MCRs are monosaccharide analogs with
bioorthogonal functionalities. Cellular metabolism transforms MCRs into donor sugars where they are used by
glycosyltransferases to modify glycoproteins. b) GlcNAc- and GalNAc-based MCRs are typically non-selective, due
in part to epimerization by the enzyme GALE.

42
While these first GalNAc-selective MCRs are powerful tools, the large N-acetyl groups limit their
metabolism by the endogenous GalNAc salvage-pathway enzymes and therefore require their
administration as protected 1-phosphate derivatives and engineering of the downstream enzyme AGX1,
which is responsible for the generation of the corresponding UDP-derivatives (Yu et al., 2012). We
hypothesized that this limitation could be overcome through rational design of a new MCR, termed
Ac 34FGalNAz, that contained the small α-azido-acetate of GalNAz and a 4-deoxy-4-fluoro modification
(Figure 2.2a). Importantly, fluorine has been used often as a bioisostere for hydroxyl groups in
carbohydrates (Hevey, 2019). As mentioned above, GalNAz is accepted by the endogenous salvage
pathway and metabolized to UDP-GalNAz. Importantly, 4-deoxy-4-fluoro-GalNAc also transits the salvage

Figure 2.2 Design and synthesis of Ac34FGalNAz. a) The axial fluorine of 4FGalNAz will not participate in the
hydride abstraction reaction critical to UDP-GlcNAc/GalNAc epimerization by GALE. b) Synthesis of
Ac34FGalNAz.

43
enzymes. Unfortunately, the resulting UDP-4FGalNAc potently feedback inhibits the production of
endogenous UDP-GlcNAc/GalNAc presumably through the hexosamine biosynthetic enzyme Glutamine
fructose-6-phosphate amidotransferase (GFAT) (Barthel et al., 2011; Berkin et al., 2000; van Wijk et al.,
2013). However, we have shown that azido-substitution of the N-acetyl position of different UDP-sugars
blocks this feedback mechanism (Walter et al., 2018). With these data in mind, we reasoned that
Ac 34FGalNAz could be converted to UDP-4FGalNAz by endogenous enzymes and be incompatible with
epimerization by GALE (Figure 2.2a), preventing the formation of the GlcNAc epimer. Several studies
have found that OGT can transfer UDP-GalNAc to peptide substrates, but at significantly lower efficiency
compared to UDP-GlcNAc (Lazarus et al., 2012; Li et al., 2019; Ma et al., 2018). Therefore, we
hypothesized that UDP-4FGalNAz would be more compatible with the GALNT (ppGalNAc-T) family of
enzymes that initiate mucin O-linked glycosylation, making Ac 34FGalNAz a selective mucin O-linked
MCR.
Here, we describe the synthesis and characterization of Ac 34FGalNAz as an MCR. Using living
cells, we found that Ac 34FGalNAz treatment results in protein and cell-surface labeling but at a reduced
efficiency compared to Ac 4GalNAz and that this labeling is O- or S-linked in nature. Importantly, we also
found that Ac 34FGalNAz does not result in feedback inhibition of O-GlcNAc or glycosaminoglycan
modifications. Subsequent proteomics experiments unambiguously identified 4FGalNAz as a modification
on mostly intracellular proteins that are known targets of OGT, while analogous treatment with Ac 4GalNAz
yielded the expected mixture of cell-surface and intracellular glycoproteins. This surprising result prompted
us to explore whether UDP-4FGalNAz may be a substrate for OGT. Towards this goal, we performed a
series of in vitro enzymatic experiments demonstrating that 4FGalNAz can transit through the enzymes of
the salvage pathway and is indeed a substrate for OGT that outperforms UDP-GalNAc. In contrast, we
observed essentially no turnover of UDP-4FGalNAz by GALNT1 or T2. Finally, we confirmed these results
in living cells by showing that an inhibitor of OGT dramatically reduced protein labeling upon
Ac 34FGalNAz treatment. While these results show that our initial design rationale for a mucin O-linked

44
MCR turned out to be flawed, they also further confirm the surprising enzymatic flexibility of OGT for
accepting xenobiotic monosaccharides.

Results and Discussion
We first synthesized Ac 34FGalNAz over 9 steps (Figure 2.2b). First, we protected the anomeric
position of GlcNAc (2.1) as an α-O-benzyl glycoside 2.2, which we then further elaborated to yield the 3,4-
benzylidene 2.3 in good yields. We then reacted compound 2.3 with benzylbromide to give the fully
protected monosaccharide 2.4, which was subjected to reductive benzylidene opening, isolate the 4-
hydroxyl group and yielding derivative 2.5. We then activated the 4-hydroxyl with trifluoromethanesulfonic
anhydride and inverted the resulting intermediate by reaction with tetrabutylammonium fluoride, resulting
in O-benzyl protected 4FGalNAc (2.6). We then removed the benzyl protecting groups with hydrogenation
to give 2.7 followed by removal of the N-acetate under acidic conditions to yield the free aminosugar 2.8.
Finally, we added the azidoacetic acid group to give 4FGalNAz (2.9) and then acetylated the hydroxyl
groups, resulting in Ac 34FGalNAz.
With Ac 34FGalNAz in hand, we next set out to determine if it would label proteins in mammalian
cells by treating CHO cells with either Ac 4GalNAz or Ac 34FGalNAz at 50 or 200 μM for either 16 h (Figure
2.3a) or 3 d (Figure 2.3b). We subjected the corresponding cell lysates to CuAAC with alkyne-TAMRA
and analyzed them by in gel-fluorescence scanning. As expected from published experiments, we observed
robust labeling of a variety of proteins by GalNAz and gratifyingly reduced but notable labeling by
4FGalNAz. Next, we tested whether at least some of this labeling was localized to the cell surface.
Specifically, we first treated CHO cells with 50 μM of either Ac 4GalNAz or Ac 34FGalNAz for 3 d. We
then collected the live cells by gentle centrifugation and reacted any cell surface azides using three different
strain-promoted azide-alkyne cycloaddition (SPAAC) reagents: DBCO-biotin followed by FITC-avidin,
DBCO-FLAG followed by FITC-anti-FLAG antibody, or DBCO-AFDye-488. Using flow-cytometry, we

45
observed cell-surface labeling under all three methods for both GalNAz and 4FGalNAz, with 4FGalNAz
again showing reduced signal (Figure 2.3c).
Careful examination of per-O-acetylated monosaccharide MCRs by the Chen lab uncovered
background chemical modification of protein cysteines that might obscure glycosyltransferase-mediated

Figure 2.3 Ac34FGalNAz treatment results in protein labeling in live cells. a & b) 4FGalNAz labeling can be detected
by in-gel fluorescence. CHO cells were treated with Ac4GalNAz or Ac34FGalNAz (panel a: 16 h; panel b: 3 d) before
CuAAC with TAMRA-alkyne and analysis by in-gel fluorescence. c) 4FGalNAz labeling can be detected by flow
cytometry. CHO cells were treated with individual MCRs (50 μM) for 3 d before the live cells were subjected to SPACC
with the indicated DBCO regents and detection of fluorescence by flow-cytometry.

46
signal under certain circumstances (Qin et al., 2018). More specifically, they found that deacetylation of
the anomeric position can be followed by elimination of the 3-O-acetate, resulting in the formation of a
Michael acceptor that reacts with nucleophilic cysteine residues (Qin et al., 2020). To test if the
Ac 34FGalNAz might also result from this type of chemical modification, we followed the Chen lab protocol
and incubated native cell lysates with a range of concentrations (50 - 2000 μM) of GalNAz, Ac 4GalNAz,

Figure 2.4 Ac34FGalNAz modifies proteins through largely an O-linkage. a) 4FGalNAz displays relatively
reduced background chemical-labeling of cysteines. The indicated concentrations of various MCRs were incubated
with cell lysates before CuAAC with TAMRA-alkyne. and in-gel fluorescence. b) β-Elimination removes
4FGalNAz signal. CHO cells were treated with the individual MCRs (50 μM) for 3 d before CuAAC with biotin-
alkyne and visualization by streptavidin blot. β-Elimination (55 mM NaOH) removes this signal. Anti-O-GlcNAc
western blotting is a positive control.

47
or Ac 34FGalNAz. Consistent with the Chen lab results, we observed significant protein labeling by
Ac 4GalNAz at higher concentration and that the majority of this signal was absent in free GalNAz (Figure
2.4a). We found that Ac 34FGalNAz displays an intermediate level of lysate labeling, with essentially no
background reactivity at our chosen concentration of 50 μM for cell-based experiments. Finally, we set out
to determine if 4FGalNAz protein labeling was mostly O(S)- or N-linked to proteins by again treating CHO
cells with 50 μM of either Ac 4GalNAz or Ac 34FGalNAz for 3 d. We then performed CuAAC with alkyne-
biotin, separated the proteins by SDS-PAGE, and transferred them in duplicate to a PVDF membrane. We
subjected the membranes to either H 2O (as a control) or NaOH (55 mM) at 50 °C overnight, which results
in the β-elimination of O- and S-linked glycans. Upon blotting with HRP-linked streptavidin, we observed
loss of essentially all of both the GalNAz and 4FGalNAz (Figure 2.4b). Taken together, these data
demonstrate that mammalian cell proteins are indeed labeled upon Ac 34FGalNAz-treatment, most likely
through O-linkages.
Treatment of cells with Ac 34FGalNAc results in inhibition of both O-GlcNAc modifications and
glycosaminoglycans (GAGs) on the cell surface by reducing the cellular concentrations of UDP-GlcNAc
and UDP-GalNAc, presumably through its conversion to UDP-4FGalNAc and feedback inhibition of the
biosynthesis of UDP-GlcNAc by GFAT (van Wijk et al., 2015). To test if 4FGalNAz might affect O-

Figure 2.5 Ac34FGalNAz treatment does not inhibit O-GlcNAc or glycosaminoglycans. a) 4FGalNAz does not
inhibit O-GlcNAc. CHO cells were treated under the indicated conditions before visualization of O-GlcNAc levels
by western blotting. b) 4FGalNAz does not inhibit glycosaminoglycans (GAGs). CHO cells were treated with
Ac34FGalNAz (50 μM) for 3 days before the live cells were analyzed using GAG-specific antibodies by flow
cytometry.

48
GlcNAc modifications, we again treated CHO cells with either Ac 4GalNAz or Ac 34FGalNAz (200 μM, 16
h or 50 μM for 3 d) and performed western blotting using an anti-O-GlcNAc antibody (Figure 2.5a). In the
case of Ac 4GalNAz, we observed an increase in the antibody staining, which we reasoned could result from
detection of the resulting GlcNAz moieties by the RL2 antibody. Importantly, we did not find any inhibition
of O-GlcNAc upon Ac 34FGalNAz treatment. We then treated CHO cells (50 μM, 3d) with Ac 34FGalNAz
and detected heparan sulfate, chondroitin sulfate, or dermatan sulfate using flow cytometry (Figure 2.5b).
Once again, we detected no loss of any GAG chains upon Ac 34FGalNAz treatment. These results
demonstrate that 4FGalNAz does not have the same detrimental effect as 4FGalNAc on endogenous
glycosylation. They are consistent with our published observation that increased steric bulk at the N-acetyl
position of UDP-GlcNAc or UDP-GalNAc, like an azide, prevented feedback inhibition of GFAT (Walter
et al., 2018). Finally, we used an MTT assay to show that Ac 34FGalNAz was not toxic to cells at 50 μM
and displayed similar toxicity to Ac 4GalNAz at 200 μM (Figure 2.6).
With these initial characterization experiments completed, we moved on to perform
glycoproteomics. Specifically, we employed the IsoTaG platform to identify specific modification sites and
glycans labelled by GalNAz and/or 4FGalNAz. Accordingly, we treated Jurkat cells with either
Ac4GalNAz (50 μM), Ac 34FGalNAz (50 μM) or DMSO vehicle for 3 d. For this experiment we chose to
use Jurkat cell as they have fairly simple mucin O-linked glycans due to a mutant COSMC chaperone. We
then performed CuAAC on the corresponding lysates with a mixture of isotopically labeled, cleavable biotin
tags and selectively enriched the labeled proteins. Next, we used Byonic™ and IsoStamp v2.0 software to

Figure 2.6 Ac34FGalNAz is not particularly toxic to mammalian cells. CHO cells were incubated with MCR or DMSO
vehicle under the indicated conditions before cell viability was measured using an MTT assay.

49
assign peptides containing either GalNAz or 4FGalNAz modifications, as well as more elaborated glycan
structures. With IsoTaG, we identified 67 GalNAz modified proteins significantly enriched over the DMSO
control (greater than or equal to 2-fold change; p-value < 0.05; Figure 2.7a), and we localized GalNAz to
249 unique peptides (198 sites at S/T and 51 sites at C after filtering for peptide spectral matches > 2;
corresponds to 50 highly confident glycosites identified by EThcD and delta Mod > 10, Table S1),
representing the expected mixture of cell-surface and intracellular glycoproteins. Consistent with its overall
lower levels of labeling, we identified fewer enriched (36) 4FGalNAz proteins (Figure 2.7b), as well as
site identifications (154 unique peptides; 134 sites at S/T and 20 sites at C after filtering for peptide spectral
matches > 2; corresponds to 34 highly confident glycosites identified by EThcD and delta Mod > 10, Table
S1). In contrast to our hypothesis that 4FGalNAz would be a more selective reporter for mucin O-linked
glycosylation, we found that almost all of the 4FGalNAz-modified proteins were intracellular, and many
were known to be O-GlcNAcylated (e.g. HCF-1 and NUP153).
To investigate this somewhat unexpected result, we next set out to characterize the ability of
different enzymes to utilize 4FGalNAz and its associated metabolites in vitro. As we mentioned in the
introduction, GalNAz-based MCRs are thought to be biosynthesized into UDP-sugar donors by the
enzymes of the GalNAc-salvage pathways (Figure 2.8a). Briefly, GalNAc is first phosphorylated at the
anomeric position by GalK2, followed by conjugation with UTP to form UDP-GalNAc by AGX1 (or

Figure 2.7 Proteomic analysis of MCR-labeled proteins. Jurkat cells were treated with a) Ac4GalNAz (50 μM) or b)
Ac34FGalNAz (50 μM) for 3 d. Labeled proteins were then enriched using neutravidin beads after CuAAC with
IsoTaG alkyne-biotin. Proteins were then identified using label free quantitation after on-bead trypsin digestion and
LC-MS/MS. The results are shown as a Volcano Plot (x-axis: log2 ratio of MCR to DMSO vehicle, y-axis; -log10 p-
value). Significantly enriched proteins that differ at least 2 linear-fold with a p-value < 0.01 (Student’s t-test) are
marked in red.

50
UAP1). UDP-GalNAc can then be used by glycosyltransferases, including the GALNT (ppGalNAcT)

Figure 2.8 Ac34FGalNAz is an O-GlcNAc reporter. a) The GalNAc salvage pathway of mammalian cells. b)
Chemoenzyamtic synthesis of 4FGalNAz-1-phopshate and UDP-4FGalNAz. c) In vitro GALNT activity with various
nucleotide sugars. A luminescence-based coupled enzyme assay (UDP-Glo; Promega) utilizing UDP-GalNAc or
UDP-4FGalNAz at 50 µM and 50 µM peptide substrate, was used to assess GALNT1 and GALNT2 activity. Data
represent the mean, and error bars represent standard deviation of 3 trials. d) In vitro ncOGT activity with various
nucleotide sugars. A luminescence-based coupled enzyme assay (UDP-Glo; Promega), utilizing UDP-GlcNAc, UDP-
GalNAc, UDP-GlcNAz, and UDP-4F-GalNAz all at 40 µM and 125 µM peptide substrate, was used to assess ncOGT
activity. Data represent the mean, and error bars represent standard deviation.

51
family. To test if 4FGalNAz is a substrate for these enzymes, we first prepared the relevant substrates using
a chemoenzymatic strategy (Figure 2.8b). First, we removed the acetates from Ac 34FGalNAz to yield the
associated free sugar. We then subjected 4FGalNAz to enzymatic transformation using the fused version
of two bacterial enzymes, an N-acetylhexosamine kinase (NahK) and a GlcNAc-1-P uridyltransferase
(GlmU) (Zhai et al., 2012). To generate UDP-4FGalNAz, we added both ATP and UTP and obtained
4FGalNAz-1-phosphate by omitting the UTP. With these metabolites in hand, we then attempted to obtain
Michaelis-Menten kinetic constants using recombinant GalK2 and AGX1. We found that the enzymes were
able to turn over 4FGalNAz and 4FGalNAz-1-phosphate respectively, albeit with reduced efficiency
compared to the natural GalNAc substrates (Figure 2.9).
We next tested GALNT1 and GALNT2 with UDP-GalNAc or UDP-4FGalNAz (50 μM) and the
standard peptide acceptor MUC5AC using the UDP-Glo™ assay from Promega (Figure 2.8c). Consistent
with our proteomics data, we could not detect any GALNT activity with UDP-4FGalNAz despite clear
turnover of the native UDP-GalNAc substrate. Next, we used the same UDP-Glo™ assay to test OGT

Figure 2.9 4FGalNAz is a substrate for GalK2 and AGX1. a) 4FGalNAz is accepted by GALK2. Michaelis-Menten
enzyme curves were measured using recombinant GalK2 and the indicated concentrations of either GalNAc or
4FGalNAz. Enzyme constants were determined using line fitting in Graphpad Prism 9. b) 4FGalNAz-1-phosphate is
accepted by AGX1. Michaelis-Menten enzyme curves were measured using recombinant AGX1 and the indicated
concentrations of either GalNAc or 4FGalNAz. Enzyme constants were determined using line fitting in Graphpad
Prism 9.

52
activity against a small panel of UDP donor-sugars (Figure 2.8d). We confirmed previously published data
showing that OGT accepted UDP-GalNAc but less efficiently than UDP-GlcNAc and that the MCR UDP-
GlcNAz was a good OGT substrate (Lazarus et al., 2012; Li et al., 2019; Ma et al., 2018). We also found
that UDP-4FGalNAz was also a substrate accepted about 2.5 times better than UDP-GalNAc but less
efficiently than UDP-GlcNAc or UDP-GlcNAz. Finally, we set out to confirm whether the 4FGalNAz
signal we observed in cells resulted from OGT activity. Accordingly, we pre-treated CHO cells with the
OGT inhibitor Ac 45SGlcNAc (200 μM) for 24 h before addition of Ac 34FGalNAz (50 μM) for an additional
24 h. Using in-gel fluorescence we found that OGT-inhibitor treatment caused a major reduction in
fluorescent signal (Figure 2.8e), confirming that the majority of 4FGalNAz labeling is indeed due to OGT
activity.

Conclusions
MCRs are powerful tools for the labeling and subsequent visualization/identification of
glycoproteins (Jackson et al., 2021; Pedowitz & Pratt, 2021). Since their introduction, we and others have
created MCRs built on several monosaccharide scaffolds including GlcNAc, GalNAc, ManNAc, sialic acid,
and fucose. Unfortunately, several of these monosaccharides can be interconverted by cellular metabolism,
rendering the corresponding MCRs non-selective for different classes of glycans. This has been a
particularly challenging problem for GlcNAc-based and GalNAc-based MCRs through reversible
epimerization of UDP-GlcNAc and UDP-GalNAc by GALE. We have had some success at creating
GalNAc selective reporters by building on the fact that large N-acetyl substituents render UDP-GalNAc
refractory to epimerization by GALE (Debets et al., 2020; Schumann et al., 2020; Zaro et al., 2011).
However, these same large modifications require engineering of enzymes in the GalNAc-salvage pathway
to ensure their metabolism. Here, we attempted to overcome the requirement for biosynthetic-pathway
engineering through the synthesis and evaluation of 4FGalNAz. We hypothesized that the axial fluorine
would act as an isostere for the electronics of the 4-hydroxyl group of GalNAz and be impossible to

53
epimerize to the GlcNAc stereochemistry by GALE. Therefore, we reasoned that the stereochemistry of
4FGalNAz would allow it to be efficiently accepted by the mucin GALNT glycosyltransferases over OGT.
Our hypothesis initially seemed reasonable as treatment of cells with Ac 34FGalNAz resulted in protein
labeling and some cell-surface signal that could be detected by flow-cytometry, albeit much less than upon
Ac 4GalNAz treatment (Figure 2.3). However, we used subsequent proteomics, in vitro biochemistry, and
competition with an OGT inhibitor in cells to discover that UDP-4FGalNAz is not a detectable substrate
for GALNT1 or 2 but is accepted by OGT (Figures 2.7 & 2.8). We do not know the underlying origins of
the positive flow cytometry signal is coming from but believe that it could arise from acceptance of
4FGalNAz by other glycosyltransferases that generate oligosaccharide branches, or it is possible that the
DBCO reagents diffuse into the cell to some extent to modify 4FGalNAz on intracellular proteins.
Interestingly, Ac 34FGalNAz yields less “background” chemical labeling of proteins in lysates compared to
Ac 4GalNAz (Figure 2.4) characterized by the Chen lab (Qin et al., 2020). In this process lysine residues
acts as a base for a β-elimination reaction to generate a Michael acceptor that is then trapped by cysteine
residues. One would predict that the strong electron withdrawing character of fluorine would increase the
rate of the elimination reaction. Therefore, the exact reason for the lower levels of background modification
is mysterious. We believe it may result from reduced non-covalent interactions between Ac 34FGalNAz and
the proteins in the lysate, resulting in fewer opportunities for lysine residues to catalyze the elimination.
Finally, we found that Ac 34FGalNAz does not inhibit O-GlcNAc or glycosaminoglycan modifications
(Figure 2.5) unlike Ac 34FGlcNAc (van Wijk et al., 2015). As mentioned above, this result matches well
with our previous in vitro analysis where we demonstrated that modifications on the N-acetyl position of
UDP-GalNAc prevent feedback inhibition of GFAT (Walter et al., 2018). Notably, Ac 4GalNAz-treatment
resulted in increased O-GlcNAc modification as detected by the anti-O-GlcNAc antibody RL2 (Figure
2.5a). We attribute this to likely recognition of O-GlcNAz by RL2.
Taken together, our results are obviously disappointing given our initial goal of creating a MCR
for the core of mucin O-linked glycosylation. However, they do have interesting implications for OGT
biology. First, our discoveries once again highlight the promiscuity of OGT for a variety of UDP-sugar

54
donors, a list that includes the native sugars GlcNAc, GalNAc (Lazarus et al., 2012; Li et al., 2019; Ma et
al., 2018), and glucose, as well as 2-azido-glucose (Shen et al., 2017; Zaro et al., 2017), 6-azido- and 6-
alkynyl-GlcNAc (Chuh et al., 2017; Chuh et al., 2014), 4-deoxy-GlcNAz (Li et al., 2016), and 6-azido-
glucose (Darabedian, Gao, et al., 2018). It is unclear why OGT has avoided evolutionary pressure to only
transfer GlcNAc, and our results suggest that it will be difficult to simply “dial-out” OGT activity as a
strategy to generate selective MCRs for other types of glycosylation. Furthermore, UDP-4FGalNAz is only
accepted by OGT approximately twice as well as UDP-GalNAc but results in notable protein labeling,
suggesting that O-GalNAc placed by OGT may be a more common modification than previously
appreciated. It may also explain some of the nuclear O-GalNAc that has been detected but attributed to
GALNT3 (Cejas et al., 2019).

Methods and Materials
General information
All reagents used for chemical synthesis were purchased from Sigma-Aldrich, Alfa Aesar or EMD
Millipore unless otherwise specified and used without further purification. All anhydrous reactions were
performed under argon or nitrogen atmosphere. Analytical thin-layer chromatography (TLC) was
conducted on EMD Silica Gel 60 F254 plates with detection by ceric ammonium molybdate (CAM),
anisaldehyde or UV. For flash chromatography, 60 Å silica gel (EMD) was utilized.
1
H spectra were
obtained at 400, 500, or 600 MHz on Varian spectrometers Mercury 400, VNMRS-500, or -600. Chemical
shifts are recorded in ppm (δ) relative to solvent. Coupling constants (J) are reported in Hz.
13
C spectra
were obtained at 100, 125, or 150 MHz on the same instruments.

55
Compound 2.1 1-O-Benzyl-N-acetyl-α-D-glucosamine (Wohnig et al., 2016)
To a stirred suspension of commercially available N-acetylglucosamine (10.0 g, 45.2
mmol) in benzyl alcohol (125 mL) at 0 °C, acetyl chloride (10.9 mL, 12.0 g, 152
mmol) was added dropwise. The reaction mixture was stirred for 30 min at rt and
further stirred for 24 h at 65 °C. The benzyl glycoside was precipitated using cold Et 2O and the liquid phase
was discarded. The resulting syrup corresponding to the benzyl glycoside was washed with cold Et 2O,
solubilized in MeOH and neutralized with NaHCO 3 (solid) until pH 7 was achieved. The suspension was
filtered through a short pad of Celite
TM
, further washed with MeOH, and the solvent was removed under
reduced pressure. Recrystallization from EtOH yielded 2 (11.0 g, 78%) as a white solid.
1
H NMR (400
MHz, CD 3OD) δ 7.43 – 7.20 (m, 5H), 4.74 (d, J = 12.0 Hz, 1H), 4.59 (s, 1H), 4.49 (d, J = 12.0 Hz, 1H),
4.00 – 3.56 (m, 4H), 3.41 – 3.27 (m, 2H), 1.94 (s, 3H). HRMS: calc’d. for C 15H 21NNaO 6 (M+Na)
+
334.1267,
found 334.1262.

Compound 2.2 Benzyl 2-Acetamido-4,6-O-benzylidene-2-deoxy-α-D-glucopyranoside

(Wohnig et al.,
2016)
Benzaldehyde (3.46 ml, 23.0 mmol) and p-toluenesulfonic acid (2 g, 11.5 mmol)
were added to a suspension of the starting material 2.1 (6.5 g, 20.88 mmol) in
anhydrous DMF (20 ml). The mixture was stirred at 65°C for 20 h. After this
time the solvent was evaporated under reduced pressure, then the solid residue washed and triturated with
hexane. The residue was then triturated with a warm NaHCO 3 saturated solution. After cooling to room
temperature, the solid was filtered and the solvent evaporated to afford the compound (7.6 g, 91%) as a
solid.
1
H NMR (400 MHz, CDCl 3) δ 7.56 – 7.45 (m, 5H), 7.43 – 7.31 (m, 5H), 5.85 (d, J = 8.9 Hz, 1H),
5.56 (s, 1H), 4.93 (d, J = 3.8 Hz, 1H), 4.77 – 4.67 (m, 1H), 4.49 (d, J = 11.8 Hz, 1H), 4.28 – 4.17 (m, 2H),
3.95 (t, J = 9.6 Hz, 1H), 3.90 – 3.83 (m, 1H), 3.76 (t, J = 10.2 Hz, 1H), 3.65 – 3.55 (m, 2H), 1.99 (s, 3H).
HRMS: calc’d. for C 22H 25NNaO 6 (M+Na)
+
422.1580, found 422.1564.

OBn
O
AcHN
HO
HO
OH
OBn
O
AcHN
HO
O
O
Ph

56
Compound 2.3 Benzyl 2-Acetamido-3-O-benzyl-4,6-O-benzylidene-2-deoxy-α-D-glucopyranoside

(Bera
& Linhardt, 2011)
NaH 60% suspension in mineral oil (1 g, 25.0 mmol) was added portion wise to
a solution of the derivative 2.2 (5 g, 12.5 mmol) and benzyl bromide (3 mL, 25.0
mmol) in THF (150 mL) at 0°C. The reaction mixture was stirred for 24 h, then
the reaction was quenched in cold water and neutralized with formic acid 10%. The solid was filtered,
washed with water and dried under reduced pressure to yield the compound (4.60 g, 75%).
1
H NMR (400
MHz, CDCl 3) δ 7.58 – 7.19 (m, 15H), 5.60 (s, 1H), 5.35 (d, J = 9.3 Hz, 1H), 4.92 (dd, J = 8.1, 4.2 Hz, 2H),
4.67 (dd, J = 27.8, 12.0 Hz, 2H), 4.46 (d, J = 11.8 Hz, 1H), 4.31 (td, J = 9.3, 3.8 Hz, 1H), 4.25 (dd, J = 10.1,
4.7 Hz, 1H), 3.94 – 3.85 (m, 1H), 3.83 – 3.71 (m, 2H), 1.87 (s, 3H).

Compound 2.4 Benzyl 2-Acetamido-3,6-di-O-benzyl-2-deoxy-α-D-glucopyranoside

(Bera & Linhardt,
2011)
BF 3/Et 2O (1.55 mL, 12.6 mmol) was added dropwise to a solution of Et 3SiH (6.7 mL,
42.0 mmol) and compound 2.3 (4.11 g, 8.40 mmol) in dry CH2Cl2 (47 mL) at 0 °C.
After stirring at 0 °C for 2 h, the reaction mixture was quenched with triethylamine
until neutralization, and then purified through flash silica gel column (toluene:acetone 7:3) to yield
compound 2.4 (2.6 g, 63%) as a white solid.
1
H NMR (400 MHz, CDCl 3) δ 7.43 – 7.23 (m, 15H), 5.42 (d,
J = 9.3 Hz, 1H), 4.89 (d, J = 3.8, 1.2 Hz, 1H), 4.79 – 4.67 (m, 3H), 4.59 (q, J = 11.9 Hz, 2H), 4.45 (d, J =
11.7 Hz, 1H), 4.27 (td, J = 10.4, 9.9, 3.7 Hz, 1H), 3.84 – 3.59 (m, 4H), 1.85 (d, J = 1.2 Hz, 3H).

Compound 2.5 Benzyl 2 -acetamido-3,6 -di-O-benzyl-2,4-dideoxy-4-fluoro-α-D-galactopyranoside

(Berkin et al., 2000)
To a solution of the compound 2.4 (4.6 g, 9.36 mmol) in anhydrous DCM (93 mL)
and anhydrous pyridine (15.5 mL) stirred at 0 °C was added triflic anhydride (3.26
mL, 19.65 mmol) dropwise. The solution was stirred under the same conditions for
OBn
O
AcHN
BnO
O
O
Ph
OBn
O
AcHN
BnO
HO
OBn
OBn
O
AcHN
BnO
F
OBn

57
1 h. After that time, the reaction was diluted with DCM, washed with HCl 1M x2, saturated aqueous
NaHCO 3, and brine solution. The organic phase was dried over Na 2SO 4, and evaporated under reduced
pressure. The residue was engaged in the next step without further purification. Tetra-N-butylammonium
fluoride (19.6 g, 74.91 mmol) was added to a solution of the crude triflate derivative (5.84 g, 9.36mmol) in
anhydrous MeCN (172 mL). The mixture was stirred at room temperature for 24 h. After evaporation of
the solvent, the crude reaction mixture was subjected to flash chromatography on silica gel (hexane:acetone
6:4). The resulting impure glycoside was further purified by reversed phase C-18 column chromatography
(H 2O:ACN 60:40 to 0:100 0.1% TFA in 24 min) to afford the compound 2.5 (2.86 g, 62% over 2 steps).
1
H
NMR (400 MHz, CDCl 3) δ 7.37 – 7.19 (m, 15H), 5.36 (d, J = 9.0 Hz, 1H), 4.97 (d, J = 3.7 Hz, 1H), 4.77 –
4.62 (m, 3H), 4.54 (s, 3H), 4.46 (dd, J = 12.0, 7.5 Hz, 2H), 3.74 – 3.55 (m, 3H), 1.87 (s, 3H). HRMS: calc’d.
for C 29H 33FNO 5 (M+H)
+
494.2343, found 494.2324.

Compound 2.6 2-Acetamido-2,4-dideoxy-4-fluoro-D-galactopyranose

(Sharma et al., 1990)
Pd/C (10%, 2.4 g) was added to a solution of 2.5 (2.86 g, 5.79 mmol) in acetic acid
(83 mL). The mixture was vigorously stirred under H 2 atmosphere for 48 h. After
completion by TLC the mixture was filtered over a celite pad and the solvent
evaporated in vacuo. The mixture was purified on a RP C-18 column chromatography (H 2O:ACN 100:0 to
0:100 0.1% TFA in 15 min) to yield the compound 2.6 (1.09 g, 84%).
1
H NMR (400 MHz, CD 3OD) δ 5.12
(d, J = 3.5 Hz, 1H), 4.17 (dd, J = 11.1, 3.5 Hz, 1H), 4.12 – 3.98 (m, 1H), 3.95 – 3.83 (m, 1H), 3.72 – 3.59
(m, 3H).
19
F NMR (376 MHz, CD 3OD) δ -223.29 – -223.68 (m).

Compound 2.7 2-Amino-2,4-dideoxy-4-fluoro-D-galactose hydrochloride (Sharma et al., 1990)
A stirred solution of 2.6 (1.25 g, 5.60 mmol) in 3M HCl (56 mL) was heated at 95-
100°C for 3h. After this time the solvent was evaporated, and the crude was eluted on
a RP C-18 flash chromatography (H 2O:ACN 100:0 to 0:100 0.1% TFA over 15 min)
to yield 2.7 (1.1 g, 90%).
1
H NMR (400 MHz, CD 3OD) δ 5.43 (d, J = 3.5 Hz, 1H), 4.19 – 4.01 (m, 2H),
O
AcHN
HO
F OH
OH
O
NH
2
HO
F OH
OH

58
3.74 – 3.63 (m, 3H), 3.42 – 3.34 (m, 1H).
19
F NMR (376 MHz, CD 3OD) δ -223.89 – -224.34 (m). HRMS:
calc’d. for C 6H 13FNO 4 (M-Cl)
+
182.0829, found 182.0828.

Compound 2.8 2-azidoacetamido-2,4-dideoxy-4-fluoro-D-galactopyranose
Pentafluorophenyl trifluoromethanesulfonate (3.4 mL, 19.79 mmol) was added to a
solution of azido acetic acid (1 g, 9.89 mmol) and anhydrous pyridine (3.6 mL, 44.53
mmol) in DMF (20 mL), then the solution was stirred at room temperature for 18h.
The solvent was partially evaporated and the residue was diluted with Et 2O and washed subsequentially
with 2x aqueous saturated NaHCO 3 and brine. The organic phase was dried over Na 2SO 4, and the solvent
evaporated under reduced pressure. The crude mixture was then subjected to silica gel flash column
chromatography (Hexane:Acetone 8:2) to afford the azido acetate pentafluorophenyl ester. (2 g, 73%) The
azido acetate pentafluorophenyl ester (1.96 g, 7.35 mmol) was added to a mixture of the compound 2.7
(800 mg, 3.68 mmol), and triethylamine (1.3 mL, 9.19 mmol) in MeOH (20 mL). The mixture was stirred
at room temperature for 24 h. The solvent was then evaporated under reduced pressure and the crude
mixture purified by RP C-18 flash chromatography (H 2O:ACN 100:0 to 0:100 0.1% TFA in 25 min) to
afford the compound 2.8. (950 mg, 98%).
1
H NMR (400 MHz, CD 3OD) δ 5.13 (d, J = 3.5 Hz, 1H), 4.20
(dd, J = 11.0, 3.6 Hz, 1H), 4.06 (dt, J = 30.3, 6.7 Hz, 1H), 3.94 – 3.83 (m, 4H), 3.72 – 3.62 (m, 2H).
19
F
NMR (376 MHz, CD 3OD) δ -222.77 (dt, J = 50.8, 29.6 Hz).
13
C NMR (101 MHz, CD 3OD ) δ 169.15,
91.28, 88.15, 71.28, 69.35, 66.68, 61.33, 51.38. HRMS: calc’d. for C 8H 13FN 4NaO 5 (M+Na)
+
287.0768,
found 287.0766.

Compound 2.9 1, 3, 6-tri-O-acetyl-2-azidoacetamido-2,4-dideoxy-4-fluoro-D-galactopyranose
Acetic anhydride (4 mL) was added to a solution of the compound 2.8 (950 mg,
3.60 mmol) in pyridine (8 mL); and the solution was stirred at room temperature
for 24 h. The residue was co-evaporated with toluene, then purified by silica gel
column chromatography (hexane:acetone 7:3) to afford the compound 2.9 (900 mg, 61%) as a yellow-
O
NH
HO
F OH
OH
N
3
O
O
NH
AcO
F OAc
OAc
N
3
O

59
orange amorphous solid.
1
H NMR (400 MHz, CDCl 3) δ 6.41 (d, J = 8.9 Hz, 1H), 6.23 (d, J = 3.6 Hz, 1H),
5.31 – 5.14 (m, 2H), 4.79 – 4.68 (m, 1H), 4.31 – 4.13 (m, 2H), 3.95 (s, 2H), 2.17 (s, 3H), 2.14 (s, 3H), 2.06
(s, 3H).
19
F NMR (376 MHz, CDCl 3) δ -213.65 – -214.08 (m).
13
C NMR (101 MHz, CDCl 3) δ 171.35,
170.47, 168.81, 167.20, 90.73, 86.66, 69.07, 67.93, 61.37, 52.40, 47.02, 20.87, 20.78, 20.70. HRMS: calc’d.
for C 14H 20FN 4O 8 (M+H)
+
391.1265, found 391.1268.

Compound 2.10 2-azidoacetamido-4-fluoro-2, 4-dideoxy-D-galactopyranose 1-(dihydrogen phosphate)
A 1750 μL solution of trGlmU– NahK

(3.5 mg) (Zhai et al., 2012), 4FGalNAz (2.8)
(9.3 mg, 20 mM), ATP (10 mM) and MgCl 2 (5 mM), in 200 mM Tris/HCl buffer (pH
8.0) was incubated at 37 °C for 24 h. The pH of the solution was verified using pH
indicator paper before the addition of the enzyme. After 24 h, the reaction was lyophilized, then resuspended
in 1:1 ACN:H 2O and purified by HPLC SeQuant ZIC-HILIC chromatography column (5 µm, 200A, 150 x
10 mm, EMD Milipore), using a gradient 10% to 40% B over 35 min, (buffer A: ACN, buffer B: 20 mM
NH 4OAc in H 2O) to give the 1-phophate product (2.7 mg, 40%).
1
H NMR (600 MHz, D 2O δ 5.37 – 5.33
(m, 1H), 4.83 (d, J = 50.8 Hz, 1H), 4.21 – 4.10 (m, 2H), 4.01 (d, J = 16.3 Hz, 1H), 3.94 (d, J = 16.1 Hz,
1H), 3.71 – 3.66 (m, 1H), 1.79 (s, 2H).
31
P NMR (243 MHz, D 2O) δ 0.86.
19
F NMR (564 MHz, D 2O) δ -
220.66 (dt, J = 50.7, 30.5 Hz).
13
C NMR (151 MHz, D 2O) δ 181.35, 171.05, 92.99, 90.23, 70.01, 60.06,
51.68, 23.16. HRMS: calc’d. for C 8H 13FN 4O 8P (M-H)
-
343.0455, found 343.0459.

Compound 2.11 Uridine 5′- Diphospho-(2-azidoacetamido-4-fluoro-1, 2, 4-dideoxy-D-galactopyranosyl)
A 2500 μL solution of trGlmU– NahK (5 mg), 2.10 (17.2 mg, 20 mM), ATP (10
mM),UTP (10 mM), inorganic pyrophosphatase (5 Units) and MgCl 2 (5 mM), in 200
mM Tris/HCl buffer (pH 8.0) was incubated at 37 °C for 24 h. The pH of the solution
was verified using pH indicator paper before the addition of the enzyme. After 24 h, the reaction was
lyophilized, then resuspended in 5:5 ACN:H 2O and purified by HPLC SeQuant ZIC-HILIC
O
NH
HO
F OH
N
3
O
OPO
3
-2
O
NH
HO
F OH
N
3
O
OUDP

60
chromatography column (5 µm, 200A, 150 x 10 mm, EMD Milipore), using a gradient 10% to 40% B over
35 min, (buffer A: ACN, buffer B: 20 mM NH 4OAc in H 2O) to give UDP-4FGalNaz (3 mg, 28%).
1
H NMR
(400 MHz, D 2O) δ 7.80 (d, J = 8.1 Hz, 1H), 5.85 – 5.78 (m, 1H), 4.30 – 3.87 (m, 4H), 3.72 – 3.55 (m, 2H),
3.53 – 3.35 (m, 2H), 3.20 (s, 2H), 1.76 (s, 6H), 1.19 – 1.08 (m, 1H).
31
P NMR (162 MHz, D 2O) δ -11.40 (d,
J = 20.5 Hz), -13.23 (d, J = 21.1 Hz).
19
F NMR (376 MHz, D 2O) δ -220.79 (dt, J = 50.0, 30.2 Hz).
13
C NMR
(151 MHz, D 2O) δ 171.13, 166.21, 151.79, 141.65, 102.60, 94.34, 89.22 (d, J = 210.6 Hz), 83.15, 83.09,
73.69, 72.02, 69.61, 65.00, 62.44, 59.84, 51.57, 50.03. HRMS: calc’d. for C 17H 24FN 6O 16P 2 (M-H)
-
649.0708,
found 649.0706.

Cell culture
CHO cells (ATCC) were cultured in Ham’s F12K media (Genesee Scientific) enriched with 10%
fetal bovine serum (FBS, Atlanta Biologics). Jurkat cells (ATCC) were cultured in RPMI (Genesee
Scientific) enriched with 10% FBS. All cell lines were incubated at 37°C with 5.0% CO 2 in a humidified
incubator.

Metabolic labeling
To cells at 80-85% confluency, media containing Ac 4GalNAz, Ac 34FGalNAz (1,000 X stock in
DMSO), or DMSO vehicle was added as indicated for 16 h. For longer treatment (3 days), media with
Ac 4GalNAz, Ac 34FGalNAz (1,000 X stock in DMSO), or DMSO vehicle was added to cells at 20-25%
confluency as indicated.

Analysis by in-gel fluorescence
Cells were collected via scraping in PBS and pelleted by centrifugation for 4 min at 2000g at 4°C.
Cells were resuspended in 4% SDS buffer (4% SDS, 150 mM NaCl, 50 mM TEA pH 7.4) with Complete,
Mini, EDTA-free Protease Inhibitor Cocktail Tablets (Roche, 5 mg mL
-1
) and tip sonicated at 35%
amplitude for 20 sec, 5 sec on 5 sec off, and centrifuged for 10 min at 10,000g. The supernatant was

61
collected and protein concentration determined by BCA assay. Protein concentration normalized to 1 μg
μL
-1
. To 200 μg of protein normalized to 1% SDS, 12 μL of freshly made click chemistry cocktail was
added and gently vortexed and allowed to sit at room temperature in the dark for 1 h [Alkyne-TAMRA tag
(Click Chemistry tools, 100 μM, 10 mM stock solution in DMSO); tris(2-carboxyethyl)phosphine
hydrochloride (TCEP) (1 mM, 50 mM freshly prepared stock solution in water); tris[(1-benzyl-1-H-1,2,3-
triazol-4-yl)methyl]amine (TBTA) (100 μM, 10 mM stock solution in DMSO); CuSO4·5H2O (1 mM, 50
mM freshly prepared stock solution in water)]. Proteins were precipitated using ice-cold methanol and
placed at -20°C for at least 2 h before being spun down (10 min, 10,000g at 4°C). The supernatant was
poured off and the protein pellet was allowed to air dry for 5-10 min before 50 μL 4% SDS buffer was
added and the samples were bath sonicated for complete dissolution. To the samples, 50 μL SDS-free 2X
loading buffer (100 mM Tris, 20% glycerol, 0.2% bromophenol blue, 1.4% β-mercaptoethanol, pH 6.8)
was added and then boiled at 95°C for 5 min and 40 μg loaded per lane for SDS-PAGE (Criterion TGX
4−20% Gel, Bio-Rad) separation. Following separation, gels were scanned on a Typhoon 9400 Variable
Mode Imager (GE Healthcare) using a 532 nm for excitation and 30 nm bandpass filter centered at 610 nm
for detection.

Cell-surface labeling by flow cytometry with DBCO-Biotin
CHO cells were treated at 20-25% confluency with Ac 4GalNAz, Ac 34FGalNAz, or DMSO for 3
days in triplicate. Cells were collected using 10 mM EDTA in PBS (pH 7.4) for 10 min at 37°C after gently
washing cells in PBS. Cells were pelleted (5 min, 800g at 4°C) and washed three times with ice-cold PBS.
Cells were resuspended in 200 μL of 60 μM DBCO-biotin in PBS and allowed to reacted for 1 h at room
temperature before pelleting and washing three times with ice-cold PBS as previously stated. Pellet was
resuspended in ice-cold PBS containing avidin conjugated fluorescein isothiocynate (FITC) at 5 μg mL
-1

(Sigma) and incubated on ice for 30 min before pelleting and washing three times with ice-cold PBS. Cells
were resuspended in 500 μL PBS containing propidium iodide (2.5 μg mL
-1
) for 30 min for dead cell

62
exclusion and then 10,000 cells were analyzed on a BD SORP LSRII Flow Cytometer using the 488 nm
argon laser.

Cell-surface labeling by flow cytometry with DBCO-FLAG
CHO cells were treated at 20-25% confluency with Ac 4GalNAz, Ac 34FGalNAz, or DMSO for 3
days in triplicate at which time cells were harvested as previously described using 10 mM EDTA in PBS
(pH 7.4), pelleted, and washed with ice-cold 1% FBS in PBS three times (5 min, 800g at 4°C). Cells were
resuspended in 250 μM DBCO-PEG 4-FLAG (Jena Bioscience) in 1% FBS in PBS and incubated for 1 h at
room temperature and subsequently washed three times in ice-cold 1% FBS in PBS. The cell pellet was
resuspended in FITC-anti-FLAG (Sigma) diluted 1:900 in 1% FBS in PBS for 30 min on ice. Cells were
pelleted and washed three times before resuspension in 500 μL 1% FBS in PBS containing 2.5 μg mL
-1

propidium iodide for dead cell exclusion and 10,000 cells were analyzed.

Cell-surface labeling by flow cytometry with AFDye 488 DBCO
CHO cells were treated at 20-25% confluency with Ac 4GalNAz, Ac 34FGalNAz, or DMSO in
triplicate for 3 days before collection via Cell Dissociation Buffer Enzyme-Free PBS-based (Gibco) for 10
min at 37°C and pelleting via centrifugation (5 min, 800g at 4°C). Cells were washed three times with ice-
cold 1% FBS in PBS before resuspension in 50 μM AFDye 488 DBCO (Click Chemistry Tools) for 1 h at
room temperature. Cells were pelleted and washed three times as previously stated and resuspended in 500
μL 1% FBS in PBS. Dead cells were excluded using 2.5 μg mL
-1
propidium iodide and 10,000 cells were
analyzed.

Detection of cell-surface GAGs by flow cytometry
CHO cells were treated at 20-25% confluency with Ac 4GalNAz, Ac 34FGalNAz, or DMSO in
triplicate for 3 days at which time cells were collected using Cell Dissociation Buffer Enzyme-Free PBS-
based (Gibco) for 10 min at 37°C and collected by centrifugation (5 min, 1,000g at 4°C). Cells were fixed

63
in 4% paraformaldehyde in PBS on ice for 10 min and pelleted (5 min, 1,000g at 4°C) before being washed
twice in ice-cold PBS. Primary antibodies (HS4C3 at 1:20; IO3H10 at 1:10; GD3A12 at 1:10)

(van Wijk
et al., 2015; van Wijk et al., 2013) were diluted in FACS buffer (0.2% BSA in PBS) and incubated with
cells for 1 h at 4°C. Cells were then washed 2 times with ice-cold PBS before incubation with anti-VSV
(P5D4) at 1:10 dilution in FACS buffer for 45 min at 4°C and then washed twice in ice-cold PBS. Goat
anti-Mouse IgG (H+L), Alexa Fluor 488 conjugate antibody (Sigma) was diluted 1:500 in FACS buffer and
incubated with cells for 45 min at 4°C. Cells were washed twice with ice-cold PBS before resuspension in
500 μL PBS for flow cytometry analysis. A total of 10,000 cells were analyzed on a BD SORP LSRII Flow
Cytometer using the 488 nm argon laser.

RL2 blotting
CHO cells were treated at 80-85% confluency for 16h treatment or 20-25% confluency for 3 day
treatment with Ac 4GalNAz, Ac 34FGalNAz, or DMSO before collected via scrapping in PBS and pelleting
by centrifugation (4 min, 2,000 g at 4°C). Cells were resuspended in 4% SDS lysis buffer supplemented
with cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Tablets before tip sonication on ice (20%
amplitude, 15 sec pulse, 5 sec on 5 sec off), and centrifugation (10 min, 10,000g at 4°C). Supernatant was
collected and protein concentration was determined using BCA assay and normalized to 2 mg mL
-1
using
SDS-free 2X loading buffer (100 mM Tris, 20% glycerol, 0.2% bromophenol blue, 1.4% β-
mercaptoethanol, pH 6.8). The mixtures was boiled at 95°C for 5 min before loading 30 μg per lane for
SDS-PAGE separation. Following separation, proteins were transferred to a PVDF membrane (Bio-Rad)
using manufacturer’s protocols. The blot was then washed in TBST once for 10 min before blocking for 1
h at rt in OneBlock Western-CL Blocking Buffer (Genessee Scientific). The blot was then incubated at 4°C
for 16 h with anti-RL2 antibody (Thermo Scientific) at 1:5000 dilution in blocking buffer. The blot was
washed three times with TBST for 5 min each before incubation with anti-Mouse for 1 h at rt at 1:10000 in

64
blocking buffer. The blot was imaged using ECL reagents after washing with TBST three times for 5 min
each.

Beta-elimination
CHO wells were treated at 20-25% confluency with Ac 4GalNAz, Ac 34FGalNAz, or DMSO at 50
μM for 3 days before harvesting with Cell Dissociation Buffer Enzyme-Free PBS-based (Gibco) for 10 min
at 37°C and collected by centrifugation (4 min, 2,000g at 4°C) and washed twice with PBS. Cells were
resuspended in 4% SDS lysis buffer (4% SDS, 150 mM NaCl, 50 mM TEA pH 7.4) supplemented with
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Tablets (Roche, 5 mg mL
-1
) and tip sonicated on
ice at 20% amplitude for 15 sec pulse, 5 sec on and 5 sec off. Supernatant was collected after centrifugation
(10 min, 10000g at 4°C) and protein concentration determined via BCA assay (Pierce, Thermo Scientific).
Protein was either normalized to 2 mg mL
-1
, and to 100 μg freshly made click chemistry cocktail (7 μL)
was added [Alkyne-biotin tag (Click Chemistry tools, 100 μM, 10 mM stock solution in DMSO); tris(2-
carboxyethyl)- phosphine hydrochloride (TCEP) (1 mM, 50 mM freshly prepared stock solution in water);
tris[(1-benzyl-1-H-1,2,3-triazol-4-yl)methyl]- amine (TBTA) (100 μM, 10 mM stock solution in DMSO);
CuSO4· 5H2O (1 mM, 50 mM freshly prepared stock solution in water)] after normalization to 1% SDS
using SDS-free buffer (10 mM TEA pH 7.4, 150 mM NaCl) and 1.25% SDS buffer (2.5% SDS, 10 mM
TEA pH 7.4, 150 mM NaCl) for streptavidin horseradish peroxidase (Strep-HRP), or 100 μg of DMSO
treatment was diluted to 2 mg mL
-1
using SDS-free 2X loading buffer (100 mM Tris, 20% glycerol, 0.2%
bromophenol blue, 1.4% β-mercaptoethanol, pH 6.8) for RL2 analysis. Click reactions were gently
vortexed and allowed to sit at rt for 1 h before addition of 1 mL of ice-cold methanol and placement at -
20°C for 2h for protein precipitation. The reactions were then centrifuged for 10 min at 10,000g at 4°C,
supernatant poured off, and protein pellets allowed to air dry for 10 min. Protein was resuspended in 50 μL
4% SDS buffer and gently sonicated in a bath sonicator and 50 μL of 2x SDS-free loading buffer was added
to the mixture. The samples were boiled at 95°C for 5 min before 5 μg of proteins for Strep-HRP analysis
and 15 μg of protein for RL2 analysis were loaded per lane for separation via SDS-PAGE (Criterion TGX

65
4−20% Gel, Bio-Rad). Proteins were transferred to PVDF membrane (Bio-Rad) using manufacturer’s
protocols and then washed in TBST for 10 min one time. Blot was incubated either in H 2O or 55mM NaOH
at 40°C for 24 h. Blots were then washed with TBST 3X 5 min each and blocked for 1 h at room temperature
in OneBlock Western-CL Blocking Buffer (Genessee Scientific). RL2 analysis was incubated overnight at
4°C with anti-RL2 diluted 1:5000 in blocking buffer, washed 3x in TBST, and then incubated for 1 h at rt
with anti-Mouse 1:10000 in blocking buffer. Strep-HRP analysis was incubated at rt for 1 h with Strep-
HRP diluted 1:5000 in blocking buffer. Blots were washed with TBST 3X 5 min each before imaging using
ECL reagents.

MTT assay
CHO cells (2.5 x10
4
cells) were plated per well in a 96-well poly-D-lysine coated dish for 24h
before treatment with DMSO, Ac 4GalNAz, or Ac 34FGalNAz at 50 µM for 3 days. CellTiter 96 Aqueous
Non-Radioactive Cell Proliferation assay (Promega) was provided according to manufacturer’s protocol.
Absorbance at 490 nm was read using a BioTek Synergy H4Multi-Mode Microplate reader.

Glycoproteomics
Chemical enrichment of glycoproteins and sample preparation for IsoTag
The cell-pellets were lysed on ice by probe tip sonication in 1 × PBS + 2% SDS (0.5 mL),
containing EDTA-free Pierce HaltTM protease inhibitor cocktail. Debris were removed from the cellular
lysate by centrifugation (20,000 × g) for 20 min at 4°C and the supernatant transferred to a new Eppendorf
tube. A BCA protein assay (Pierce) was performed and protein concentration was adjusted to 7.5 μg/μL
with lysis buffer. Protein lysate (3 mg, 400 μL) was treated with a pre-mixed solution of the click chemistry
reagents [100 μL; final concentration of 200 μM IsoTaG silane probe (3:1 heavy:light mixture), 500 μM
CuSO4, 100 μM THPTA, 2.5 mM sodium ascorbate] and the reaction was incubated for 3.5 h at 24°C. The
click reaction was quenched by a methanol-chloroform protein precipitation [aqueous
phase/methanol/chloroform = 4:4:1 (v/v/v)]. The protein pellet was allowed to air dry for 5 min at 24°C.

66
The dried pellet was resuspended in 1 × PBS + 1% SDS (400 μL) by probe tip sonication and then diluted
in PBS (1.6 mL) to a final concentration of 0.2% SDS. Streptavidin-agarose resin [400 μL, washed with
PBS (3 × 1 mL)] were added to the protein solution and the resulting mixture was incubated for 12 h at
24°C with rotation. The beads were washed using spin columns with 8 M urea (5 × 1 mL), and PBS (5 × 1
mL). The washed beads were resuspended in 500 μL PBS containing 10 mM DTT and incubated at 37°C
for 30 min, followed by addition of 20 mM iodoacetamide for 30 min at 37°C in the dark. The reduced and
alkylated beads were collected by centrifugation (1,500 × g) and resuspended in 520 μL PBS. Urea (8 M,
32 μL) and trypsin (1.5 μg) was added to the resuspended beads and digestion was performed for 16 h at
37°C with rotation. Supernatant was collected and the beads were washed three times with PBS (200 μL)
and distilled water (2 × 200 μL). Washes were combined with the supernatant digest to form the trypsin
fractions for protein identification. The IsoTaG silane probe was cleaved with 2% formic acid/water (2 ×
200 μL) for 30 min at 24°C with rotation and the eluent was collected. The beads were washed with 50%
acetonitrile-water + 1% formic acid (2 × 500 μL), and the washes were combined with the eluent to form
the cleavage fraction for site level identification. The trypsin and cleavage fractions were dried in a vacuum
centrifuge and desalted using C18 tips following the manufacturer’s instructions. Trypsin fractions were
resuspended in 50 mM TEAB (20 μL) and the corresponding amine-based TMT 10-plex (5 μL) was added
to the samples and reacted for 1 h at 24°C. The reactions were quenched with 2 µl of a 5% hydroxylamine
solution and combined. The combined mixture was concentrated and fractionated into six samples using a
High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific). All samples were stored at
-20 °C until analysis.

Mass spectrometry parameters used for glycoproteomics and data analysis
A Thermo Scientific EASY-nLC 1000 system was coupled to an Orbitrap Fusion Tribrid with a
nano-electrospray ion source. Mobile phases A and B were water with 0.1% (vol/vol) formic acid and
acetonitrile with 0.1% (vol/vol) formic acid, respectively. For the trypsin fractions, peptides were separated

67
using a linear gradient from 4% to 32% B within 50 min, followed by an increase to 50% B within 10 min
and further to 98% B within 10 min and re-equilibration. The following instrument parameters were used
as previously described (Ge et al., 2021). For the cleavage fractions, peptides were separated with a linear
gradient from 5 to 30% B within 95 min, followed by an increase to 50% B within 15 min and further to
98% B within 10 min, and re-equilibration. The instrument parameters were set as previously described
with minor modifications (Darabedian, Yang, et al., 2018). Briefly, MS1 spectra were recorded from m/z
400-2,000 Da. If glyco-fingerprint ions (126.055, 138.055, 144.07, 168.065, 186.076, 204.086, 274.092,
and 292.103) were observed in the HCD spectra, ETD (250ms) with supplemental activation (35%) was
performed in a subsequent scan on the same precursor ion selected for HCD. Other relevant parameters of
EThcD include isolation window (3 m/z), use calibrated charge-dependent ETD parameters (True),
Orbitrap resolution (50k), first mass (100 m/z), and inject ions for all available parallelizable time (True).
The raw data was processed using Proteome Discoverer 2.4 (Thermo Fisher Scientific). For the trypsin
fraction, the data were searched against the UniProt/SwissProt human (Homo sapiens) protein database
(20,355 proteins, downloaded on Feb. 21, 2019) and contaminant proteins using the Sequest HT algorithm.
Searches were performed as previously described.
8
For the cleavage fraction, both HCD and EThcD spectra
were searched against the proteome identified in the trypsin fraction using Byonic algorithms. The searches
were performed with the following guidelines: trypsin as enzyme, 3 missed cleavages allowed; 10 ppm
mass error tolerance on precursor ions; 0.02 Da mass error tolerance on fragment ions. Intact glycopeptide
searches allowed for the 6 most common tagged O-glycan (rare 1) on cysteine, serine, and threonine.
Methionine oxidation (common 1) and cysteine carbaminomethylation (common 1) were set as variable
modifications with a total common max of 3, rare max of 1. Glycopeptide spectral assignments passing a
FDR of 1% at the peptide spectrum match level based on a target decoy database were kept. Singly modified
glycopeptides assigned from EThCD spectra passing a 1% FDR and possessing a delta modification score
of greater than or equal to ten were considered highly confident glycosites.

68
Data availability
The MS data were deposited at the ProteomeXchange Consortium

(Vizcaíno et al., 2014) via the
PRIDE partner repository and are available with the identifier PXD0XXXX.

hGalK2 assay
Recombinant human GalK2 was prepared and purified according to literature (Thoden & Holden,
2005). Recombinant GalK2 (0.005 mg mL
-1
for GalNAc, 0.05 mg mL
-1
for 4FGalNAz) was incubated with
GalNAc (0.005-0.8 mM) or 4FGalNAz (0.4-20 mM) in triplicate in 1 mL reaction buffer (60 mM
sodium/potassium phosphate, 1.5 mM PEP, 80 mM KCl, 2 mM EDTA, 10 mM MgCl2, pH 7.0) containing
ATP (0.7 mM), NADPH (0.125 mM), pyruvate kinase (35 units), and lactate dehydrogenase (50 units) at
37°C. Reactions were monitored at 340 nm using a Beckman Coulter DU-640 spectrophotometer.

AGX1 protein expression and purification
The coding sequence of human AGX1 was cloned into pTriEX 6 with an N-terminus GST-tag
(https://doi.org/10.1073/pnas.2007297117), a 3C cleavage site and a C-terminal FLAG tag, using a
BamHI/BglII cloning strategy. A previously established AGX1-FLAG construct was used as template
(https://doi.org/10.1016/j.molcel.2020.03.030), and the primers
CCCTAAGCTTGGATCCCATGAACATTAATGACCTCAAACTCACG (fwd) and
GCTCGGTACCAGATCTTCACTTGTCGTCATCGTCTTTGTAGTCAA (rev) for PCR. Plasmid
assembly was performed using the In-Fusion HD Cloning Kit (Takara, Kusatsu, Japan). Recombinant
baculovirus was generated based on the flashBACTM system system (Oxford Expression Technologies,
Oxford, UK). Sf21 cells were transfected with transfer plasmid and flashBAC™ DNA using Fugene HD
(Promega, Madison, USA) according to manufacturer’s instructions.
AGX1 was expressed first by seeding Sf21 cells (2x106 cells/mL) and incubating at 27 °C. The
following day, cells were infected with viral stocks (P3) using a MOI of 2. After incubation for 3 days, cells

69
were harvested (2000 x g, 5 min, 4 °C) and stored at -80 °C. Pellets were thawed at room temperature and
resuspended in 50 mL cold AGX1 Lysis Buffer (50 mM Hepes (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1
mM DTT) with cOmplete protease inhibitors (Roche, Penzberg, Germany) and BaseMuncher mix
(1:10,000, Expedeon, Cambridge, UK), and left at 4 °C for 1 h. Cells were then lysed by sonication using
a Sonifier 450 (Branson, Hampton, USA) prior to ultra-centrifugation (30 000 rpm, 30 min). The
supernatant was collected and incubated overnight with 0.5 mL per sample of pre-equilibrated the Lysis
Buffer (50mM Hepes pH 7.5; 150 mM NaCl; 1 mM EDTA; 1 mM DTT, 10% (v/v) glycerol) and GST-4B
Sepharose beads (Sigma Aldrich, St. Louis, USA). The supernatant was then collected (FT) (2000 x g, 3
min, 4 °C) and washed twice with 10 CV of the same Buffer. An aliquot of 100 µL HRV 3C protease
(produced in-house) and 2 CV of Lysis Buffer containing 10% (v/v) glycerol was added to the beads before
incubating at 4 °C for 5 h. The supernatant was collected (E1) and the digestion was repeated three times
to obtain (E2-E4). E1-E4 were pooled and concentrated to 2 mL using an AmiconTM Ultra®15 30K
centrifugal tube. The concentrated sample was injected onto an ÄKTATM Pure system, running a
SuperdexTM S200 16/600 gel filtration column (GE Life Sciences, Marlborough, USA), collecting 1 mL
fractions in AGX1 Lysis Buffer containing 10% (v/v) glycerol. Fractions were pooled, concentrated using
an AmiconTM Ultra®15 30K centrifugal tube, concentration measured by Nanodrop® (1.94 mg/mL),
sample diluted twice in a freezing buffer (25 mM Hepes pH 7.5; 40% (v/v) Glycerol; 1 mM DTT) and
stored at -80°C.

AGX1 assay
Enzyme and time dependence experiments were run to assure initial rates (approx. 5-15% turnover)
of reactions. For acceptor substrate GalNAc-1-phosphate Michaelis-Menten kinetics, reaction mixtures
containing 5 mM UTP, 0-5 mM GalNAc-1-P, 4 nM AGX1 and PmPpA (1.6 µg mL-1 or 3 U mL-1, Chemily
Glycoscience) were prepared in buffer containing MgCl2 (5 mM), Tris/HCl (75 mM, pH 8), BSA (1 mg
mL-1) in a final volume of 15 µL. Reaction mixtures were incubated at 37 °C for 30-60 min and reactions
stopped by boiling at 95 °C for 10 s and 2-fold dilution with water. Samples were briefly centrifuged and

70
supernatants were transferred to a new tube. Samples were run on a UPLC (ACQUITY, Waters) equipped
with UPLC BEH Glycan column (1.7 µm, 2.1x100 mm) and gradient of 90-55% Buffer B over 17 min
(Buffer A: 10 mM Ammonium formate, pH 4.5; Buffer B: Acetonitrile: water 90:10, 10 mM Ammonium
formate). Product formation was monitored at 262 nm, confirmed by mass detection in negative mode and
determined by UV peak integration. Data points were calibrated to a standard curve of 0-1.25 mM UDP-
GalNAc (Sigma) produced by serial dilution in final assay buffer. Blanks with enzymatic mixture and no
substrate were included in each set of experiments to account for potential noise signal at product retention
time. Michaelis-Menten parameters were calculated from plots of initial rate constant at each substrate
concentration by nonlinear regression using SigmaPlot 14.0 (Systat Software) of three independent
experiments.
Acceptor substrate 4F-GalNAz-1-phosphate kinetics experiments were carried out as above, except
that the reaction mixtures contained 0-10 mM 4F-GalNAz-1-phosphate and 125 nM AGX1. Reaction
mixtures were incubated for 2 h and reactions stopped by addition of an equal volume of acetonitrile (15
µL) and supernatants were run on UPLC (ACQUITY, Waters) on a gradient of 90-65 % Buffer B over 17
min. Michaelis-Menten curves were calculated using Prism 9.1 (Graphpad, San Diego, USA) based on three
independent experiments.

GALNT plasmids
The plasmid hT1-pKN55 encoding a truncated version of human GALNT1 (41-559 amino acids)
between the Mlu 1 and Age 1 sites was provided by Lawrence A. Tabak (National Institute of Health). The
sequence encoding a truncated version of human GALNT2 (75-572 amino acids) between the Mlu 1 and
Age 1 sites from the vector hT2-pIMKF4, provided by Lawrence A. Tabak was cloned into the Mlu 1-Age
1 sites of pKN55 vector to create the hT2-pKN55 vector (Fritz et al., 2004).

71
GALNT expression screening
The protein was expressed and purified using Pichia pastoris according to previously published
methods (Dikiy et al., 2018). Briefly, electroporation-competent Pichia pastoris strain protease-deficient
SMD1163 was prepared for electroporation. Vectors were linearized with Sac I and electroporated into
competent cells by using a Bio-Rad Gene Pulsar set at 1,500 V, 25 mF, and 200 ohms. Cells were grown
for 3 days at 30 °C on minimal dextrose plates (1.34 % yeast nitrogen base, 2% dextrose, 0.00004% biotin)
lacking histidine. Individual colonies were grown in 2 ml of YPG-case medium (1 % yeast extract/2 %
peptone/1.34 % yeast nitrogen base/1 % glycerol/1 % casamino acids/0.00004% biotin/100 mM potassium
phosphate, pH 6) in 24-well plates. Cells were grown at 250 rpm in an orbital shaker at 28 °C for 18-24 h
and centrifuged at 2,000 × g for 5-10 min. The supernatant was replaced with 0.4 mL of YPM-case medium
(1 % yeast extract/2 % peptone/1.34 % yeast nitrogen base/0.5 % methanol/1% casamino acids/0.00004%
biotin/100 mM potassium phosphate, pH 7) to induce protein expression. Cells were cultured for an
additional 20-24 h at 20 °C, centrifuged, and the supernatants were analyzed for protein expression by SDS-
PAGE. Clones with best protein expression and enzyme activity were identified and stored as a glycerol
stock at -80 C and streaked onto fresh MDH (1.34 % yeast nitrogen base, 2 % dextrose, 0.00004% biotin,
0.004 % histidine) plate as needed. To prepare a culture for a glycerol stock, a loopful of the clone was used
to inoculate YPD (1 % yeast extract, 2 % peptone, 2 % dextrose). The culture was incubated 24 h at 28 C
with shaking. Clones were stored in cryovials with a final glycerol concentration of 25 %.

GALNT purification
The glycerol stock was streaked onto MDH agar plate and incubated for 2 days at 28 °C. This plate
could be stored at 4 °C for one month and used for starter cultures. A loopful of freshly streaked cells from
MDH plate was used to inoculate 5 mL YPG-case medium and cells were grown at 250 rpm in an orbital
shaker at 28 °C overnight. Next day, the entire starter culture was added to 100 mL YPG-case medium and
cells were grown at 250 rpm in an orbital shaker at 28 °C for 24 h. This 100 mL culture was added to 1 L
YPG-case medium and cells were grown at 250 rpm in an orbital shaker at 28 °C for 24 h until reaching

72
saturation (OD 600 of ~20) and then cells were pelleted in sterile 1 L bottles at 4000 rcf for 30 min. The
supernatant was removed and cell pellets were gently resuspend in 750 mL of YPM-case media without
methanol. Cells were cultured at 28 C for 6 additional hours with shaking to metabolize any remaining
glycerol, then induced with 0.5 % methanol. Cell were cultured at 20 C for another 18 h with shaking. Cells
were centrifuged at 4000 rcf for 15 min and the supernatant collected. Protease inhibitor cocktail (4x sigma
fast tablets) was added. The supernatant was concentrated using Amicon filters (MW cutoff 30KDa) or the
protein was salted out using ammonium sulfate. Concentrated protein was resuspended in 50 - 80 mL of
Wash 1 Buffer (20 mM sodium phosphate pH 7.5; 0.2 M NaCl) and incubated with 20 mL Ni-NTA beads
for 1 h at 4 C. The supernatant was removed and the Ni-NTA was washed with wash buffer 1 (2X), followed
by wash buffer 2 (20 mM sodium phosphate pH 7.5; 0.2 M NaCl, 5 mM imidazole). Then, the purified
enzyme was eluted using elute buffer (20 mM sodium phosphate pH 7.5; 0.2 M NaCl, 100 mM imidazole).
The eluted enzyme was then desalted and concentrated using Amicon filters (MW cutoff 30KDa) by
replacing the elution buffer with 50 mM Tris HCl (pH 7.4) containing 10 % glycerol. GALNT enzyme was
aliquoted, flash frozen and stored at -80 C.

In vitro GALNT assay
GALNT1 and GALNT2 activity were determined in vitro with the UDP-Glo assay (Promega,
V6961). The UDP-Glo assay was performed largely as outlined by the manufacturer. Assays were
performed in white 96-well plates (Costar, 3912), and reaction volumes were 25 µL. MUC5Ac (GenScript,
sequence: GTTPSPVPTTSTTSAP) was used as the peptide acceptor for all reactions. Reactions contained
the following components: 10 nM GALNT1 or 150 nM GALNT2, 50 µM MUC5Ac, 50 µM UDP-sugar
(ultrapure UDP-GalNAc (Promega, V7081) or UDP-4FGalNAz), and buffer (25 mM Tris-HCl pH 7.4, 10
mM MnCl 2, 5 mM -mercaptoethanol, 0.01% Triton). Reactions were incubated at room temperature for one
hour, then quenched by the addition of 25 µL of UDP-Glo nucleotide detection reagent. The quenched
reactions were mixed briefly by pipetting and incubated in the dark for one hour at room temperature prior
to reading luminescence using BioTek Cytation5. UDP release was quantified using a standard curve of

73
UDP (Promega, V698A). All reactions were run in triplicate. Data were analyzed by Microsoft Excel and
Prism 9 (GraphPad).

In vitro ncOGT activity assay
ncOGT activity was determined in vitro with the UDP-Glo assay (Promega, V6961) using
recombinant ncOGT. ncOGT was purified as described previously (Rodriguez & Kohler, 2014).

Briefly,
the pET24b plasmid encoding OGT, provided by Suzanne Walker (Harvard Medical School), was used to
produce recombinant OGT in Escherichia coli (Lazarus et al., 2011). ncOGT was purified using an
immobilized metal ion affinity chromatography column (Qiagen, 30410) according to the manufacturer's
instructions. Protein purity was estimated by Coomassie staining. ncOGT was >80% pure. The UDP-Glo
assay was performed largely as outlined by the manufacturer. Assays were performed in white 96-well
plates (Costar, 3912), and reaction volumes were 25 µL. CKII3K (GenScript, sequence:
KKKYPGGSTPVSSANMM) was used as the peptide acceptor for all reactions. Reactions contained the
following components: 300 nM ncOGT, 125 µM CKII3K, 40 µM UDP-sugar (ultrapure UDP-GlcNAc
(Promega, V7071), ultrapure UDP-GalNAc (Promega, V7081), UDP-GlcNAz, or UDP-4FGalNAz), and
buffer (150 mM NaCl, 1 mM EDTA, 2.5 mM TCEP, and 25 mM Tris-HCl, pH 7.4). Reactions were
incubated at room temperature for one hour and quenched by the addition of 25 µL of UDP-Glo nucleotide
detection reagent. The quenched reactions were mixed briefly by pipetting and incubated in the dark for
one hour at room temperature prior to reading luminescence. UDP release was quantified using a standard
curve of UDP (Promega, V698A). All reactions were run in triplicate. Data were analyzed by Microsoft
Excel and Prism 9 (GraphPad).

5SGlcNAc competition
CHO cells were treated at 20-25% confluency with OGT inhibitor, Ac 45SGlcNAc at 200 μM for
24 h before a media change and treatment with 50 μM Ac 34FGalNAz for another 24 h. Cells were collected
via scraping before pelleting and lysing as described previously using 4% SDS lysis supplemented with

74
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Tablets (Roche, 5 mg mL
-1
). Lysate was
centrifuged for 10 min, 10,000g at 4°C and protein concentration was determined via BCA assay (Pierce,
Thermo Scientific). To 200 μg of protein, freshly made 12 μL click chemistry cocktail mixture was added
after normalized to 1% SDS and allowed to react in the dark for 1 h before protein precipitation using ice-
cold methanol and placed at -20°C for at least 2 h. The reaction mixtures were spun down (10 min, 10,000g
at 4°C) and supernatant was poured off. The protein pellets were allowed to air dry for 5-10 min before
addition of 50 μL of 4% SDS buffer and bath sonication to ensure complete dissolution. To the samples,
50 μL of SDS-free 2X loading buffer was added and samples were boiled for 5 min at 95°C. Proteins were
visualized by in-gel fluorescence after 40 μg of protein were loaded per lane for SDS-PAGE separation.
After separation, fluorescence was visualized via scanning on a Typhoon 9400 Variable Mode Imager (GE
Healthcare) using a 532 nm for excitation and 30 nm bandpass filter centered at 610 nm for detection.

75
Chapter 2 References

Barthel, S. R., Antonopoulos A Fau - Cedeno-Laurent, F., Cedeno-Laurent F Fau - Schaffer, L., Schaffer L
Fau - Hernandez, G., Hernandez G Fau - Patil, S. A., Patil Sa Fau - North, S. J., . . . Dimitroff, C. J. (2011).
Peracetylated 4-fluoro-glucosamine reduces the content and repertoire of N- and O-glycans without direct
incorporation. (1083-351X (Electronic)).
Bera, S., & Linhardt, R. J. (2011). Design and synthesis of unnatural heparosan and chondroitin building
blocks. (1520-6904 (Electronic)).
Berkin, A., Szarek Wa Fau - Kisilevsky, R., & Kisilevsky, R. (2000). Synthesis of 4-deoxy-4-fluoro
analogues of 2-acetamido-2-deoxy-D-glucose and 2-acetamido-2-deoxy-D-galactose and their effects on
cellular glycosaminoglycan biosynthesis. (0008-6215 (Print)).
Boyce, M., Carrico, I. S., Ganguli, A. S., Yu, S.-H., Hangauer, M. J., Hubbard, S. C., . . . Bertozzi, C. R.
(2011). Metabolic cross-talk allows labeling of O-linked β-N-acetylglucosamine-modified
proteins via the N-acetylgalactosamine salvage pathway. Proceedings of the National Academy
of Sciences, 108(8), 3141.
Cejas, R. B., Lorenz, V., Garay, Y. C., & Irazoqui, F. J. (2019). Biosynthesis of O-N-acetylgalactosamine
glycans in the human cell nucleus. (1083-351X (Electronic)).
Chuh, K. N., Batt, A. R., Zaro, B. W., Darabedian, N., Marotta, N. P., Brennan, C. K., . . . Pratt, M. A.-O.
(2017). The New Chemical Reporter 6-Alkynyl-6-deoxy-GlcNAc Reveals O-GlcNAc Modification of the
Apoptotic Caspases That Can Block the Cleavage/Activation of Caspase-8. (1520-5126 (Electronic)).

76
Chuh, K. N., Zaro Bw Fau - Piller, F., Piller F Fau - Piller, V., Piller V Fau - Pratt, M. R., & Pratt, M. R.
(2014). Changes in metabolic chemical reporter structure yield a selective probe of O-GlcNAc
modification. (1520-5126 (Electronic)).
Darabedian, N., Gao, J., Chuh, K. N., Woo, C. M., & Pratt, M. R. (2018). The Metabolic Chemical Reporter
6-Azido-6-deoxy-glucose Further Reveals the Substrate Promiscuity of O-GlcNAc Transferase and
Catalyzes the Discovery of Intracellular Protein Modification by O-Glucose. (1520-5126 (Electronic)).
Darabedian, N., Yang, B., Ding, R., Cutolo, G., Zaro, B. W., Woo, C. M., & Pratt, M. R. (2018). O-
Acetylated Chemical Reporters of Glycosylation Can Display Metabolism-Dependent Background
Labeling of Proteins but Are Generally Reliable Tools for the Identification of Glycoproteins. (2296-2646
(Print)).
Debets, M. A.-O., Tastan, O. A.-O. X., Wisnovsky, S. P., Malaker, S. A.-O., Angelis, N. A.-O., Moeckl, L.
K. R., . . . Schumann, B. A.-O. (2020). Metabolic precision labeling enables selective probing of O-linked
N-acetylgalactosamine glycosylation. (1091-6490 (Electronic)).
Dikiy, I., Clark, L. D., Gardner, K. H., & Rosenbaum, D. M. (2018). Isotopic Labeling of Eukaryotic
Membrane Proteins for NMR Studies of Interactions and Dynamics. (1557-7988 (Electronic)).
Fritz, T. A., Hurley Jh Fau - Trinh, L.-B., Trinh Lb Fau - Shiloach, J., Shiloach J Fau - Tabak, L. A., &
Tabak, L. A. (2004). The beginnings of mucin biosynthesis: the crystal structure of UDP-
GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferase-T1. (0027-8424 (Print)).

77
Ge, Y. A.-O., Ramirez, D. A.-O., Yang, B. A.-O., D'Souza, A. A.-O., Aonbangkhen, C. A.-O., Wong, S.
A.-O., & Woo, C. A.-O. (2021). Target protein deglycosylation in living cells by a nanobody-fused split O-
GlcNAcase. (1552-4469 (Electronic)).
Hang, H. C., Yu, C., Kato, D. L., & Bertozzi, C. R. (2003). A metabolic labeling approach toward proteomic
analysis of mucin-type O-linked glycosylation. Proceedings of the National Academy of Sciences, 100(25),
14846.
Hevey, R. A.-O. (2019). Bioisosteres of Carbohydrate Functional Groups in Glycomimetic Design. LID -
10.3390/biomimetics4030053 [doi] LID - 53. (2313-7673 (Electronic)).
Jackson, E. G., Pedowitz, N. J., Pratt, M. R., & Barchi, J. J. (2021). 3.12 - Metabolic Engineering of
Glycans. In (pp. 275-287). Elsevier.
Lazarus, M. B., Jiang J Fau - Gloster, T. M., Gloster Tm Fau - Zandberg, W. F., Zandberg Wf Fau -
Whitworth, G. E., Whitworth Ge Fau - Vocadlo, D. J., Vocadlo Dj Fau - Walker, S., & Walker, S. (2012).
Structural snapshots of the reaction coordinate for O-GlcNAc transferase. (1552-4469 (Electronic)).
Lazarus, M. B., Nam Y Fau - Jiang, J., Jiang J Fau - Sliz, P., Sliz P Fau - Walker, S., & Walker, S. (2011).
Structure of human O-GlcNAc transferase and its complex with a peptide substrate. (1476-4687
(Electronic)).
Li, J., Wang, J., Wen, L., Zhu, H., Li, S., Huang, K., . . . Wang, P. G. (2016). An OGA-Resistant Probe
Allows Specific Visualization and Accurate Identification of O-GlcNAc-Modified Proteins in Cells. (1554-
8937 (Electronic)).

78
Li, S., Wang, J., Zang, L., Zhu, H., Guo, J., Zhang, J., . . . Li, J. (2019). Production of Glycopeptide
Derivatives for Exploring Substrate Specificity of Human OGA Toward Sugar Moiety. (2296-2646 (Print)).
Ma, X., Liu P Fau - Yan, H., Yan H Fau - Sun, H., Sun H Fau - Liu, X., Liu X Fau - Zhou, F., Zhou F Fau
- Li, L., . . . Zhang, L. (2018). Substrate specificity provides insights into the sugar donor recognition
mechanism of O-GlcNAc transferase (OGT). (1932-6203 (Electronic)).
Nguyen, S. S., & Prescher, J. A. (2020). Developing bioorthogonal probes to span a spectrum of reactivities.
4(9), 476-489.
Parker, C. G., & Pratt, M. R. (2020). Click Chemistry in Proteomic Investigations. (1097-4172
(Electronic)).
Pedowitz, N. J., & Pratt, M. R. (2021). Design and synthesis of metabolic chemical reporters for the
visualization and identification of glycoproteins. RSC Chemical Biology, 2(2), 306-321.
Qin, K., Zhang, H., Zhao, Z., & Chen, X. (2020). Protein S-Glyco-Modification through an Elimination-
Addition Mechanism. (1520-5126 (Electronic)).
Qin, W., Qin, K., Fan, X., Peng, L., Hong, W., Zhu, Y., . . . Chen, X. A.-O. (2018). Artificial Cysteine S-
Glycosylation Induced by Per-O-Acetylated Unnatural Monosaccharides during Metabolic Glycan
Labeling. (1521-3773 (Electronic)).
Rodriguez, A. C., & Kohler, J. J. (2014). Recognition of diazirine-modified O-GlcNAc by human O-
GlcNAcase. (2040-2503 (Print)).

79
Schumann, B., Malaker, S. A., Wisnovsky, S. P., Debets, M. F., Agbay, A. J., Fernandez, D., . . . Bertozzi,
C. R. (2020). Bump-and-Hole Engineering Identifies Specific Substrates of Glycosyltransferases in Living
Cells. (1097-4164 (Electronic)).
Sharma, M., Bernacki Rj Fau - Paul, B., Paul B Fau - Korytnyk, W., & Korytnyk, W. (1990). Fluorinated
carbohydrates as potential plasma membrane modifiers. Synthesis of 4- and 6-fluoro derivatives of 2-
acetamido-2-deoxy-D-hexopyranoses. (0008-6215 (Print)).
Shen, D. L., Liu, T. W., Zandberg, W., Clark, T., Eskandari, R., Alteen, M. G., . . . Vocadlo, D. A.-O.
(2017). Catalytic Promiscuity of O-GlcNAc Transferase Enables Unexpected Metabolic Engineering of
Cytoplasmic Proteins with 2-Azido-2-deoxy-glucose. (1554-8937 (Electronic)).
Thoden, J. B., & Holden, H. M. (2005). The molecular architecture of human N-acetylgalactosamine kinase.
(0021-9258 (Print)).
van Wijk, X. M., Lawrence, R., Thijssen, V. L., van den Broek, S. A., Troost, R., van Scherpenzeel, M., . .
. van Kuppevelt, T. H. (2015). A common sugar-nucleotide-mediated mechanism of inhibition of
(glycosamino)glycan biosynthesis, as evidenced by 6F-GalNAc (Ac3). (1530-6860 (Electronic)).
van Wijk, X. M., Thijssen, V. L., Lawrence, R., van den Broek, S. A., Dona, M., Naidu, N., . . . van
Kuppevelt, T. H. (2013). Interfering with UDP-GlcNAc metabolism and heparan sulfate expression using
a sugar analogue reduces angiogenesis. (1554-8937 (Electronic)).
Vizcaíno, J. A., Deutsch, E. W., Wang, R., Csordas, A., Reisinger, F., Ríos, D., . . . Hermjakob, H. (2014).
ProteomeXchange provides globally coordinated proteomics data submission and dissemination. (1546-
1696 (Electronic)).

80
Vocadlo, D. J., Hang, H. C., Kim, E.-J., Hanover, J. A., & Bertozzi, C. R. (2003). A chemical approach for
identifying O-GlcNAc-modified proteins in cells. Proceedings of the National Academy of
Sciences, 100(16), 9116.
Walter, L. A., Batt, A. R., Darabedian, N., Zaro, B. W., & Pratt, M. A.-O. (2018). Azide- and Alkyne-
Bearing Metabolic Chemical Reporters of Glycosylation Show Structure-Dependent Feedback Inhibition
of the Hexosamine Biosynthetic Pathway. (1439-7633 (Electronic)).
Wohnig, S., Spork, A. P., Koppermann, S. A.-O., Mieskes, G., Gisch, N., Jahn, R. A.-O., & Ducho, C. A.-
O. (2016). Total Synthesis of Dansylated Park's Nucleotide for High-Throughput MraY Assays. (1521-
3765 (Electronic)).
Yu, S. H., Boyce M Fau - Wands, A. M., Wands Am Fau - Bond, M. R., Bond Mr Fau - Bertozzi, C. R.,
Bertozzi Cr Fau - Kohler, J. J., & Kohler, J. J. (2012). Metabolic labeling enables selective
photocrosslinking of O-GlcNAc-modified proteins to their binding partners. (1091-6490 (Electronic)).
Zaro, B. W., Batt, A. R., Chuh, K. N., Navarro, M. X., & Pratt, M. A.-O. (2017). The Small Molecule 2-
Azido-2-deoxy-glucose Is a Metabolic Chemical Reporter of O-GlcNAc Modifications in Mammalian
Cells, Revealing an Unexpected Promiscuity of O-GlcNAc Transferase. (1554-8937 (Electronic)).
Zaro, B. W., Yang Yy Fau - Hang, H. C., Hang Hc Fau - Pratt, M. R., & Pratt, M. R. (2011). Chemical
reporters for fluorescent detection and identification of O-GlcNAc-modified proteins reveal glycosylation
of the ubiquitin ligase NEDD4-1. (1091-6490 (Electronic)).

81
Zhai, Y., Liang M Fau - Fang, J., Fang J Fau - Wang, X., Wang X Fau - Guan, W., Guan W Fau - Liu, X.-
W., Liu Xw Fau - Wang, P., . . . Wang, F. (2012). NahK/GlmU fusion enzyme: characterization and one-
step enzymatic synthesis of UDP-N-acetylglucosamine. (1573-6776 (Electronic)).

82
Chapter 3: Anomeric fatty-acid functionalization prevents non-enzymatic S-
glycosylation by monosaccharide metabolic chemical reporters*

Introduction
Glycosylation is a family of co- and post-translational modifications (PTMs) that describe the
addition of one or more monosaccharides onto specific protein residues. Most protein glycosylation events
fall into one of three subgroups: N-linked glycosylation, mucin O-linked glycosylation, and O-GlcNAc
modifications (Varki A., 2015-2017). Glycoproteins are present in all cells with functions including
immune recognition (Rabinovich et al., 2012), protein stability(Levine & Walker, 2016), cell signaling
(Jonckheere & Van Seuningen, 2010; Singh & Hollingsworth, 2006), and cellular trafficking (Helenius &
Aebi, 2004).
Despite a clear link between proper glycoprotein dynamics and cell development, glycosylation is
challenging to study due to the intrinsic heterogeneity associated with oligosaccharide motifs (Varki A.,
2015-2017; Zhu et al., 2020). Fortunately, metabolic chemical reporters (MCRs) have emerged as powerful
tools for studying glycosylation and glycoproteins (Pedowitz & Pratt, 2021). MCRs work by exploiting
endogenous monosaccharide salvage pathways present in all eukaryotic organisms (Ishihara H Fau -
Massaro et al., 1968).
Nichole Pedowitz (USC) and Justin Overhulse (USC) contributed to the work presented in this chapter.
Figure 3.1. Workflow for treatment with metabolic chemical reporters (MCRs). Living cells are treated with
carbohydrate analogs functionalized with an azide or alkyne. These reporter molecules are incorporated on to
proteins allowing for the selective tagging and/or enrichment of labeled proteins. Tagged proteins can be visualized
using in-gel fluorescence.

83
With this strategy, researchers can introduce small abiotic functional groups such as azides and alkynes that
can participate in bioorthogonal reactions to introduce tags that allow for the identification and visualization
of glycoproteins in biologically relevant contexts (Figure 3.1) (Meldal & Tornøe, 2008; Parker & Pratt,
2020).
Carbohydrate MCRs are introduced to cells as per-O-acetylated monosaccharides allowing for their
passive diffusion across the cell membrane (Figure 3.2a) (Laughlin & Bertozzi, 2007; Sarkar et al., 1995).
The O-acetyl groups can then be removed by endogenous esterase enzymes to release a free sugar ready to
enter its associated salvage pathway. From here, MCRs are metabolized into high-energy nucleotide
diphosphate (NDP) sugar donors that serve as substrates for various glycosyltransferases generating labeled
glycoproteins (Mathew et al., 2012). Acetyl groups mask polar hydroxyls which greatly enhances cellular
uptake allowing for robust labeling with relatively low treatment concentrations. This practice remained
unquestioned until a recent study by the Chen lab reported that treatment with per-O-acetylated MCRs
resulted in a significant number of chemically labeled cysteine residues in a process termed S-glycosylation
(Figure 3.2a) (Qin et al., 2018). A follow-up mechanistic investigation showed that non-specific chemical

Figure 3.2 Per-O-acetylated sugars can chemically modify cysteine residues. (a) Per-O-acetylated sugars passively
diffuse across the cell membrane where they are deacetylated by esterase enzymes. (Top) Endogenous salvage pathway
enzymes metabolize sugar molecules to corresponding UDP sugar donors that enzymatically label cells. A detailed
scheme of GlcNAc salvage pathway metabolism is shown in Fig. S2. (Bottom) Once the anomeric acetate is removed,
sugars exist in an equilibrium between linear and ring conformations. In its linear confirmation, partially acetylated
molecules can be covalently added to native cysteine residues resulting in non-specific chemical labeling. A detailed
scheme of this mechanism can be found in Fig. S3. (b) General synthetic approach to synthesize fatty acid
functionalized MCRs. (1) Per-O-acetylated sugars form a stable oxazoline intermediate. (2) C3, C4, and C6 acetates
are deprotected. (3) Carboxylic acids are coupled, opening the oxazoline and forming fatty acid functionalized sugar
molecules.

84
labeling follows an elimination-addition reaction. Once the anomeric acetyl is removed, monosaccharides
exist in an equilibrium between their linear and ring conformations (Figures 3.2a and 3.3). When linear,
the presence of acetyl groups at the C3 and C4 positions facilitate a β-elimination reaction susceptible to
addition from endogenous thiols (Figure 3.3) (Qin et al., 2020). The resulting covalent adducts are
indistinguishable from enzymatic labeling events without advanced mass-spectrometry (MS) analysis,
convoluting results from routine labeling experiments. The Chen lab solved this in the case of N-
azidoacetyl-galactosamine (GalNAz) through the selective installation of propyl-esters at the 1- and 6-
hydroxyl groups (Hao et al., 2019; Qin et al., 2020). However, the selective installation of esters can require
multiple steps that may not be universal for different monosaccharide structures.
Other past work has demonstrated that synthesizing MCRs with a single large hydrophobic
functional group maintains the lipophilicity required for cell permeability (Liu et al., 2018). We rationalized
that this approach could be used to circumvent non-specific chemical background labeling. Specifically,
we reasoned that designing MCRs with fatty acids on the anomeric position (Figure 3.2b) would still be
removable by esterases with the resulting product lacking the C3 and C4 acetyl groups necessary to facilitate
of S-glycosylation. This approach also maintains the freedom to functionalize the other positions with
abiotic groups allowing for a continued development of diverse MCRs.

Figure 3.3 Proposed mechanism of non-enzymatic S-glycosylation. (a) Once per-O-acetylated sugars are
deacetylated at the anomeric position (b) the resulting hemiacetal exists in equilibrium between its open and closed
confirmations. (c) Open sugars can undergo β-elimination reaction with a proximal base resulting in a double bond
forming between the C3 and C4 carbons. (d) Acetyl migration between the C4 and C5 position generates two isomers
in equilibrium. (e) α,β-Unsaturated aldehydes are susceptible to Michael-addition with endogenous thiols. (f) A final
ring closer generates 3-thiol furanose and pyranose adducts.

85
Here, we describe a proof-of-concept study using two well characterized O-GlcNAc MCRs: N-
pentynyl-glucosamine (GlcNAlk) and 6-azido-6-deoxy-N-acetyl-glucosamine (6AzGlcNAc) (Chuh et al.,
2014; Zaro et al., 2011). We demonstrate that functionalizing both GlcNAlk and 6AzGlcNAc with 6-carbon
fatty acids on the anomeric position maintains their ability to label mammalian cells. Importantly, we show
that these derivatives have almost undetectable levels of background labeling in cell lysates compared to
both their per-O-acetylated and free-OH counterparts. Finally, we confirm the largely enzymatic nature of
GlcNAlk labeling by showing that expression of a mutant biosynthetic enzyme that can better accommodate
the large N-acetyl-group, AGX1(F383G), dramatically improves the labeling efficiency. Taken together,
we believe that this approach can be widely adopted to circumvent chemical labeling in experiments using
MCRs.

Results and Discussion
Fatty acid functionalized metabolic chemical reporters label proteins in mammalian cells
To test the labeling efficiency of fatty acid functionalized MCRs, we synthesized a series of
GlcNAlk derivatives with acyl chains increasing in length from four to six carbons (3.4-6, Figure 3.4a).

Figure 3.4 Characterization of GlcNAlk derivatives. (a) Structures of GlcNAlk derivatives (b) Labeling efficiency for
GlcNAlk derivatives increases with increasing fatty acid chain length; HeLa cells were treated with 200 μM of indicated
MCR for 72 h (c) 1-Hex-GlcNAlk labeling is concentration dependent. HeLa cells were treated with 1-Hex-GlcNAlk at
concentrations from 0 - 200 μM for 72 h (d) 1-Hex-GlcNAlk labeling is time dependent. HeLa cells were treated with 1-
Hex-GlcNAlk (200 μM) for 0 - 72 h.

86
HeLa cells were metabolically labeled with 200 μM of each reporter for 72 h. Cells were then harvested,
washed, and lysed. Soluble protein fractions were reacted with an azide functionalized TAMRA dye (Az-
TAMRA) using copper-catalyzed azide-alkyne cycloaddition (CuAAC). In-gel fluorescence scanning
showed successful labeling of all three derivatives with increasing efficiency corresponding to increasing
chain length of the fatty acid substituent (Figure 3.4b). 1-Hex-GlcNAlk (6) labels cells at the highest level
consistent with it having the most lipophilic character and therefore is most likely to passively diffuse into
the cell. Importantly, all three qualitatively label the same subset of proteins consistent with each being
converted into the same metabolic substrate; UDP-GlcNAlk. To test the concentration dependence of 6,
HeLa cells were treated with various concentrations to 200 μM for 72 h. Cells were lysed and subjected to
CuAAC with Az-TAMRA (Figure 3.4c). In-gel fluorescence scanning revealed that labeling with 6 starts
with treatment concentrations as low as 25 μM and increases up to 200 μM. Next, we examined the kinetics
of protein labeling. HeLa cells were treated with 6 (200 μM) for different lengths of time followed by
CuAAC and analysis by in-gel fluorescence (Figure 3.4d). Labeling was detectable at 12 h with marginal
increases up to 72 h.
After determining that fatty acid functionalization of GlcNAlk results in robust labeling, we wanted
to confirm that this approach can be broadly applied with other known MCRs. We synthesized a hexanoic

Figure 3.5 Characterization of 1-Hex-6AzGlcNAc. (a) 1-Hex-6AzGlcNAc labeling is concentration dependent.
HeLa cells were treated with 1-Hex-6AzGlcNAc at concentrations from 0 - 200 μM for 24 h. Labeling qualitatively
measured using in-gel fluorescence. (b) 1-Hex-6AzGlcNAc labeling is time dependent. HeLa cells were treated with
1-Hex-6AzGlcNAc (200 μM) for 0 - 72 h. Labeling qualitatively measured using in-gel fluorescence.

87
acid analog of the O-GlcNAc selective MCR 6AzGlcNAc termed 1-Hex-6AzGlcNAc (11). 1-Hex-
6AzGlcNAc was characterized in HeLa cells. First, HeLa cells were treated with 11 for different lengths of
time followed by lysis and CuAAC with an alkyne functionalized TAMRA tag (Alk-TAMRA) for analysis
using in-gel fluorescence scanning (Figure 3.5a). The results of this experiment demonstrate that labeling
was detectable at 12 h and peaked between 24 h and 48 h. We then performed a concentration course by
treating HeLa cells with various concentrations of 11 for 24 h (Figure 3.5b). Analysis by in-gel
fluorescence show labeling efficiency is dose-dependent, a characteristic consistent with other MCRs.
To explore the effect of different cellular metabolisms on labeling efficiency, we treated a panel of
cell lines (Figure 3.6a and b). In addition to HeLa cells, NIH3T3 cells and CHO cells were treated with
200 μM of 6 or 11 for 72 and 24 h, respectively. Cells were all lysed and subjected to CuAAC with either
Az-TAMRA or Alk-TAMRA and analyzed via in-gel fluorescence scanning. There was robust labeling
over background for both reporters in all cell lines. A qualitative evaluation of the banding patterns showed
a diverse pattern and intensity of modified proteins for both reporters consistent with different expression
profiles in each cell line. Notably, labeling efficiency in NIH3T3 cells was the lowest for both reporters

Figure 3.6 1-Hex-GlcNAlk and 1-Hex-6AzGlcNAc cell panel. (a) 1-Hex-GlcNAlk labeling efficiency is variable
across different mammalian cell lines. HeLa, NIH3T3, and CHO cells were treated with 200 μM 1-Hex-GlcNAlk for
72 h. Labeling qualitatively measured using in-gel fluorescence. (b) 1-Hex-6AzGlcNAc labeling efficiency is variable
across different mammalian cell lines. HeLa, NIH3T3, and CHO cells were treated with 200 μM 1-Hex-6AzGlcNAc
for 24 h. Labeling qualitatively measured using in-gel fluorescence.

88
whereas 6 labels HeLa cells the highest over background and 11 labels CHO cells the highest over
background.
Finally, we tested the metabolic labeling efficiency of 6 and 11 compared to fully unprotected
GlcNAlk and 6AzGlcNAc, respectively (Figure 3.7a and b). HeLa cells were treated with 200 μM of the
indicated reporter followed by lysis and CuAAC. Labeled proteins were visualized with in-gel fluorescence
scanning. Both 6 and 11 label more efficiently than their corresponding free sugar. However, qualitatively
they labeled the same pattern of proteins. These results demonstrate the importance maintaining a ratio of
hydrophilicity and lipophilicity to passively diffuse across the cell membrane and efficiently label cells but
also serve as validation that the MCR-labeled proteins are enzymatic substrates as the free sugars do not
participate in non-enzymatic background labeling (Qin et al., 2018).
Replacement of per-O-acetyl protecting groups with a 1-O-hexanoic ester prevents non-enzymatic S-
glycosylation
To access the potential for 1-Hex-GlcNAlk (6) and 1-Hex-6AzGlcNAc (11) to participate in non-
specific chemical modification of cysteine residues, we incubated these compounds at concentrations of 0.2
mM or 2 mM in HeLa cell lysates under the conditions reported to result in S-glycosylation (Qin et al.,
2018). For comparison, HeLa cell lysates were also incubated with free sugar (GlcNAlk and 6AzGlcNAc)
and per-O-acetylated sugar (Ac 4GlcNAlk and Ac 36AzGlcNAc) (Figure 3.8a-d). All conditions were

Figure 3.7 1-Hex-GlcNAlk and 1-Hex-6AzGlcNAc are incorporated more efficiently than GlcNAlk and
6AzGlcNAc, respectively. (a) 1-Hex-GlcNAlk labels more efficiently than GlcNAlk. HeLa cells were treated with
200 μM of either GlcNAlk or 1-Hex-GlcNAlk for 72 h. Labeling qualitatively measured using in-gel fluorescence.
(b) 1-Hex-6AzGlcNAc labels more efficiently than 6AzGlcNAc. HeLa cells were treated with 200 μM of either
6AzGlcNAc or 1-Hex-6AzGlcNAc for 24 h. Labeling qualitatively measured using in-gel fluorescence.

89
subjected to CuAAC with either Az-TAMRA in lysates treated with alkyne-bearing probes or Alk-TAMRA
in lysates treated with azide-bearing probes. HeLa cells incubated with per-O-acetylated reporters resulted
in robust labeling over background, consistent with the results of previous studies investigating S-
glycosylation (Qin et al., 2018). However, HeLa cells incubated with hexanoic functionalized reporters
demonstrate negligible lysate labeling supporting a model where substituents on the anomeric position of
carbohydrate MCRs do not facilitate the elimination-addition mechanism necessary for S-glycosylation to
proceed.
Notably, lysates incubated with free sugars result in higher background labeling than the
corresponding hexanoic derivatives. We attribute this labeling to separate non-enzymatic covalent
modification through glycation. Glycation occurs between the aldehyde present in the open sugar
conformation and nucleophilic residues such as lysine and has been purposefully detected using azide-
containing free sugars (Maksimovic et al., 2020). In cell lysates, free sugars can exist in an equilibrium
between linear and ring confirmations and therefore can readily participate in glycation events. Conversely,
the hexanoic acid protecting the 1-hydroxyl mitigates any potential background glycation in the 1-Hex-
MCR derivatives.

Figure 3.8 Neither 1-Hex-GlcNAlk nor 1-Hex-6AzGlcNAc chemically modify cell lysates. (a) Structures of GlcNAlk
derivatives used for experiments (b) Non-denatured HeLa cell lysate was treated with GlcNAlk, Ac4GlcNAlk, or 1-
Hex-GlcNAlk (c) Structures of 6AzGlcNAc derivatives used for experiments (d) Non-denatured HeLa cell lysate was
treated with 6AzGlcNAc, Ac46AzGlcNAc, or 1-Hex-6AzGlcNAc.

90
1-Hex-GlcNAlk labeling increases in cells expressing mutant AGX1 (F383G)
Previous work demonstrates that unnatural sugars with bulky substituents at the N-acetyl position
are poor substrates for both isoforms of UDP-GlcNAc pyrophosphorylase (AGX1/2), the enzyme
responsible for converting GlcNAc-1-P to UDP-GlcNAc in the GlcNAc salvage pathway (Yu et al., 2012).
The X-ray crystal structure of human AGX1 verifies that the N-acetyl group of GlcNAc-1-P resides in a
compact hydrophobic pocket. Mutant AGX1 (F383G) solves this problem by expanding the enzymes
binding pocket.
We therefore decided to use AGX1 (F383G) expression as a proxy for whether 1-Hex-GlcNAlk
labeling is largely enzymatic in nature. If this is the case, we reasoned that AGX1 (F383G) would result in
improved synthesis of UDP-GlcNAlk and higher protein labeling by glycosyltransferases. Accordingly,
HeLa and NIH3T3 cells expressing AGX1 (F383G) were treated with 200 μM of 6 for 72 h (Figure 3.9a
and b). Cells were then lysed andreacted with Az-TAMRA using CuAAC. Analysis with in-gel
fluorescence scanning shows a large increase in protein labeling compared to their wild-type counterpart

Figure 3.9 1-Hex-GlcNAlk labeling increases in cells expressing mutant AGX1. NIH3T3 (a) and HeLa (b) cells
expressing AGX1(F383G) show higher labeling efficiency when treated with 1-Hex-GlcNAlk than those expressing
endogenous wild-type AGX1.

91
strongly suggesting that our 1-Hex-MCRs efficiently diffuse into cells and largely result in enzyme-
dependent modification of proteins.
Conclusion
The discovery that per-O-acetylated MCRs have the potential to result in chemical labeling in a
process termed S-glycosylation calls in to question the validity of conclusions drawn from the use of these
tools. Work toward understanding the mechanism indicates that acetate groups on the C3 and C4 position
facilitates the elimination-addition reaction thought to drive the covalent bond formation between
endogenous cysteine residues and unnatural sugar molecules resulting in adducts indistinguishable
enzymatic labeling events in many routine experiments.
Here, we propose a solution in the design and synthesis of MCRs functionalized with hexanoic acid
at the anomeric position. We reasoned that a single long acyl chain would maintain the lipophilicity
necessary for passive diffusion across the cell membrane while remaining a substrate for esterase enzymes
to cleave and release an active molecule. To test this, we synthesized two MCRs: 1-Hex-GlcNAlk and 1-
Hex-6AzGlcNAc. When characterized in HeLa cells, both exhibited robust labeling over background in a
concentration and time dependent manner (Figures 3.4 and 3.5). Importantly, cell lysates incubated with
these reporters show negligible non-specific chemical labeling validating our hypothesis (Figure 3.8).
Finally, we found that AGX1(F383G) expression dramatically improves the modification of proteins upon
1-Hex-GlcNAlk treatment (Figure 3.9). Because wild-type AGX1 is a known bottleneck for the
transformation of N-acetyl-modified MCRs to their corresponding UDP-sugar donors, this result indicates
that our labeling is overwhelmingly due to enzymatic protein modification. The results of this study nicely
complement the work of the Chen lab and others and offer an alternative approach to the design and
synthesis of future carbohydrate MCRs that avoid confounding background chemical-modification of
cysteine residues.

92
Methods and Materials
General Reagent Information
Unless otherwise indicated, all solvents and reagents were purchased from commercial sources
(MilliporeSigma, VWR, etc.) and used without further purification. All aqueous solutions were prepared
using ultra-pure MilliQ water (deionized, filtered, sterilized) obtained from an in-house ELGA water
purification system. All silica gel column chromatography was performed using 60 Å silica gel
(MilliporeSigma) and all thin-layer chromatography performed using 60 Å, F254 silica gel plates
(MilliporeSigma) with detection by ceric ammonium molybdate (CAM), ninhydrin, or triphenylphosphine
(PPh 3) + ninhydrin staining solutions, and/or UV light.

Synthesis of known small molecules
Known compounds Ac 4GlcNAlk (Zaro et al., 2011) Ac 36AzGlcNAc (Chuh et al., 2014) were
synthesized according to literature procedures. Both were dissolved in DMSO as 1,000 X stocks.

General procedure for carboxylic acid coupling
Oxazoline molecules (GlcNAlk Oxazoline and GlcNAc Oxazoline) were resuspended in a 10:1
mixture of anhydrous ACN and DMF in a canonical round bottom flask with a stir bar. 1 equiv of carboxylic
acid was added to the flask before the reaction mixture was placed in a Milestone Ethos Synth Microwave
Synthesis Labstation. All reactions were carried out under nitrogen, fitted with a reflux condenser and
balloon filled with dry nitrogen gas. All microwave reaction times included a five-minute ramp to 80 °C (a
maximum power of 300-400 watts). The reaction was then stirred for 28 min at 80 °C (stabilized power
220-260 watts). The reaction mixture changed color after 10 min of stirring. After the microwave reactions
were complete, the reaction mixtures were allowed to cool for 5-10 min to room temperature before being
concentrated and purified by reverse phase chromatography with a C18 column (100 Å, 30 μM, Biotage
Isolera) using a 0-30% B linear gradient over 10 column volumes (buffer A: H 2O + 0.1% TFA, buffer B:

93
ACN + 0.1% TFA) at a flow rate of 25 ml min
-1
. Product elution was monitored via UV absorbance at a
wavelength of 210 nm. Fractions containing product were lyophilized to dryness before characterization.

N-4-methoxybenzaldehyde-glucosamine
Commercially available glucosamine (5.0 g, 23.20 mmol) was dissolved in 1 M NaOH (25 ml) and
4-methoxybenzaldehyde (2.8 ml, 23.00 mmol) was added dropwise with vigorous stirring. Reaction
mixture was stirred for 5 min before being placed on ice for 1 h. The precipitate was dried via filtration and
washed with water (2X) and a 1:1 mixture of methanol:diethyl ether (2X). The precipitate was then allowed
to dry overnight and used without further purification or characterization to afford the compound (3.909 g,
57% yield) as a white powder.

1,3,4,6-tetra-O-acetyl-N-4-methoxybenzaldehyde-glucosamine
N-4-methoxybenzaldehyde-glucosamine (3.909 g, 13.15 mmol) was dissolved in pyridine (14 ml).
Acetic anhydride (7.5ml, 78.81 mmol) was added and the reaction was allowed to stir for 16 h at room
temperature at which point it was poured over ice-cold water. The precipitate was filtered and washed with
water (2X) and diethyl ether (2X) and allowed to dry overnight to afford the compound (3.85 g, 63% yield)
as a white powder and used without further purification or characterization.

1,3,4,6-tetra-O-acetyl-glucosamine
1,3,4,6-tetra-O-acetyl-N-4-methoxybenzaldehyde-glucosamine (3.85 g, 8.288 mmol) was
dissolved in acetone (20.4 ml) at reflux. To the reaction, 5 M HCl (2.04 ml, 10% volume of acetone) was
added dropwise. The precipitate was filtered and washed with acetone (2X) and ether (2X) and allowed to
3.1

94
dry overnight to afford the compound (2.199 g, 69% yield) as a white powder without further purification
or characterization.

Compound 3.1 1,3,4,6-tetra-O-acetyl-N-acetyl-4-pentynyl-glucosamine
1,3,4,6-tetra-O-acetyl-glucosamine (2.199 g, 5.73 mmol) was dissolved in DCM over ice.
Triethylamine (2 ml, 14.325 mmol) and 4-pentynoic acid (730 mg, 7.45 mmol) was added and allowed to
stir for 10 min. Ethylcarbodiimide hydrochloride (2.196 g, 11.46 mmol) was added and the reaction was
allowed to warm to room temperature over 16 h. The mixture was then diluted with DCM and washed with
1 M HCl (1X), saturated sodium bicarbonate (1X), water (1X), and brine (1X) and the organic phase was
dried over sodium sulfate. The compound was purified via silica gel column chromatography with 2%
MeOH/DCM to afford the compound (2.060 g, 84% yield) as a white powder.
1
H NMR (400 MHz, CDCl 3)
δ 6.25 – 6.13 (m, 1H), 5.69 (d, J = 8.8 Hz, 1H), 5.22 (dd, J = 10.6, 9.4 Hz, 1H), 5.08 (t, J = 9.6 Hz, 1H),
4.39 – 4.18 (m, 2H), 4.10 (dd, J = 12.4, 2.2 Hz, 1H), 3.89 – 3.78 (m, 1H), 2.45 (ddd, J = 8.9, 5.1, 2.5 Hz,
2H), 2.30 (t, J = 6.9 Hz, 2H), 2.08 (d, J = 0.8 Hz, 3H), 2.05 (d, J = 0.9 Hz, 3H), 2.01 (d, J = 1.6 Hz, 6H).
13
C NMR (101 MHz, CDCl 3) δ 171.17, 171.09, 170.66, 169.53, 169.36, 92.42, 82.60, 72.69, 72.50, 69.46,
68.15, 61.75, 52.65, 35.36, 20.93, 20.73, 20.69, 20.55, 14.80. Characterization data agree with previously
reported data (Zaro et al., 2011).

Compound 3.2 2-pentynyl-(3,4,6-tri-O-acetyl-1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-oxazoline
Compound 3.1 (1.03 g, 2.41 mmol) was dissolved in anhydrous DCM (12.5 ml) under
an atmosphere of N 2 (g). Trimethylsilyl triflate (523 μl, 2.89 mmol) was added
dropwise at room temperature and the reaction was heated to 50 °C for 12 h. Once
judged complete by TLC (30:70 acetone:hexanes), the reaction was removed from
heat and neutralized by adding triethylamine (505 μl, 3.62 mmol) and allowing the
reaction to stir at room temperature for 30 min at which point it was concentrated and column purified using
a gradient from 10-30% acetone in hexanes. Fractions containing the product were combined and

95
concentrated yielding Ac 3GlcNAlk Oxazoline as a pale yellow oil in 88% yield (774.7 mg).
1
H NMR (400
MHz, CDCl 3) δ 5.99 (d, J = 7.4 Hz, 1H), 5.32 – 5.27 (m, 1H), 4.91 (dt, J = 9.3, 0.6 Hz, 1H), 4.23 – 4.10
(m, 3H), 3.77 – 3.68 (m, 1H), 2.68 – 2.53 (m, 4H), 2.11 – 2.06 (m, 9H), 1.98 (d, J = 2.4 Hz, 1H).
13
C NMR
(101 MHz, CDCl 3) δ 170.56, 169.49, 169.15, 167.67, 99.45, 99.43, 82.11, 70.23, 70.21, 69.64, 68.35, 67.51,
67.50, 64.74, 63.24, 27.46, 20.88, 20.80, 20.72, 15.17. ESI-MS calcd. for C 17H 21NNaO 8 (M + Na)
+
m/z
390.1165, found m/z 390.1197.

Compound 3.3 2-pentynyl-(1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-2-oxazoline
Compound 3.2 (735 mg, 2 mmol) was cooled to 0 °C in an ice-water bath. 7 N
ammonia in MeOH (40 ml) was added under an atmosphere of N 2 (g) and the reaction
was allowed to stir for 2 h. Reaction progress was monitored by TLC using 10%
MeOH in EtOAc. Once judged complete, the reaction was concentrated and used in
subsequent steps without purification assuming 100% yield. Crude is a yellow oil.
1
H NMR (400 MHz, CD 3OD) δ 6.08 (d, J = 7.3 Hz, 1H), 4.06 – 4.01 (m, 1H), 3.90 (t, J = 3.9 Hz, 1H), 3.80
(dd, J = 12.0, 2.5 Hz, 1H), 3.67 (dd, J = 12.1, 5.9 Hz, 1H), 3.57 – 3.53 (m, 1H), 3.45 – 3.36 (m, 2H), 2.58
(q, J = 3.0 Hz, 4H), 2.34 (d, J = 0.9 Hz, 1H), 1.97 (s, 1H).
13
C NMR (101 MHz, CD 3OD) δ 168.14, 101.38,
81.63, 73.63, 73.19, 69.36, 69.31, 67.06, 61.99, 27.23, 14.38. ESI-MS calcd. for C 11H 16NO 5 (M + H)
+
m/z
242.0950, found m/z 242.1038.

Compound 3.4 β-1-butyryl-N-4-pentynyl-glucosamine
Compound 3.3 (241 mg, 1 mmol) was coupled with butyric acid (91.8 μL,
1 mmol) using the General Procedure for Carboxylic Acid Coupling
described above to afford 4 as a light yellow solid (104 mg, 30% yield).
1
H NMR (400 MHz, CD 3OD) δ 5.60 (d, J = 8.8 Hz, 1H), 3.88 – 3.84 (m,
1H), 3.84 – 3.82 (m, 1H), 3.71 – 3.66 (m, 1H), 3.39 – 3.34 (m, 3H), 3.25 (p, J = 1.6 Hz, 2H), 2.49 – 2.40
(m, 4H), 2.40 – 2.31 (m, 2H), 2.31 – 2.17 (m, 2H), 1.60 (p, J = 7.4 Hz, 2H), 0.93 (t, J = 7.4 Hz, 3H).
13
C

96
NMR (126 MHz, CD 3OD) δ 173.02, 172.25, 92.76, 82.18, 77.46, 74.23, 70.17, 68.78, 60.97, 54.66, 35.48,
34.93, 17.67, 14.22, 12.47. ESI-MS calcd. for C
15
H
23
NNaO
7
(M + Na)
+
m/z 357.1375, found m/z 345.1381.

Compound 3.5 β-1-valeroyl-N-4-pentynyl-glucosamine
Compound 3.3 (241 mg, 1 mmol) was coupled with valeric acid (109
μL, 1 mmol) using the General Procedure for Carboxylic Acid Coupling
described above to afford 5 as a light yellow solid (165 mg, 45% yield).
1
H NMR (400 MHz, CD 3OD) δ 5.60 (d, J = 8.8 Hz, 1H), 3.88 – 3.84
(m, 1H), 3.84 – 3.82 (m, 1H), 3.71 – 3.66 (m, 1H), 3.54 – 3.48 (m, 1H), 3.39 – 3.36 (m, 2H), 3.30 (p, J =
1.7 Hz, 1H), 2.99 (d, J = 0.5 Hz, 1H), 2.86 (d, J = 0.8 Hz, 1H), 2.48 – 2.38 (m, 4H), 2.33 (td, J = 7.3, 1.8
Hz, 2H), 2.22 (t, J = 2.5 Hz, 1H), 1.93 (s, 1H), 1.57 (tt, J = 8.7, 6.9 Hz, 2H), 1.40 – 1.27 (m, 2H), 0.91 (t, J
= 7.3 Hz, 3H).
13
C NMR (101 MHz, CD 3OD) δ 172.91, 172.42, 92.76, 82.18, 77.44, 74.21, 70.15, 68.81,
60.97, 54.64, 34.93, 33.32, 26.36, 21.76, 14.23, 12.63. ESI-MS calcd. for C
16
H
25
NNaO
7
(M + Na)
+
m/z
366.1529, found m/z 366.1538.

Compound 3.6 β-1-hexanoyl-N-4-pentynyl-glucosamine
Compound 3.3 (273 mg, 1.13 mmol) was coupled with hexanoic
acid (141 μL, 1.13 mmol) using the General Procedure for
Carboxylic Acid Coupling described above to afford 6 as a light
yellow solid (200 mg, 47% yield).
1
H NMR (400 MHz, CD 3OD)
δ 5.59 (dd, J = 8.8, 0.7 Hz, 1H), 3.91 – 3.80 (m, 2H), 3.69 (dd, J = 12.1, 4.9 Hz, 1H), 3.49 (d, J = 10.3 Hz,
1H), 3.39 – 3.33 (m, 2H), 2.51 – 2.37 (m, 4H), 2.32 (td, J = 7.4, 1.5 Hz, 2H), 2.23 – 2.20 (m, 1H), 1.59 (p,
J = 7.5 Hz, 2H), 1.40 – 1.22 (m, 4H), 0.91 (t, J = 7.0 Hz, 3H).
13
C NMR (126 MHz, CD 3OD) δ 172.91,
172.43, 92.78, 82.15, 77.46, 74.22, 70.17, 68.80, 60.97, 54.66, 34.95, 33.56, 30.92, 23.95, 21.96, 14.25,
12.82. ESI-MS calcd. for C
17
H
27
NNaO
7
(M + Na)
+
m/z 380.1685, found m/z 380.1680.

97
Compound 3.7 2-methyl-(3,4,6-tri-O-acetyl-1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-2-oxazoline
Commercially available Ac 4GlcNAc (1.50 g, 3.85 mmol) was was dissolved in
anhydrous DCM (20 ml) under an atmosphere of N 2 (g). Trimethylsilyl triflate (850
μl, 4.62 mmol) was added drop-wise at room temperature and the reaction was
heated to 50 °C for 12 h. Once judged complete by TLC (30:70 acetone:hexanes),
the reaction was removed from heat and neutralized by adding triethylamine (800 μl, 5.78 mmol) and
allowing the reaction to stir at room temperature for 30 min at which point it was concentrated and column
purified using a gradient from 10-30% acetone in hexanes. Fractions containing the product were combined
and concentrated yielding Ac 3GlcNAc Oxazoline as a pale yellow oil in 87% yield (1.10 g).
1
H NMR (400
MHz, CDCl 3) δ 6.05 (d, J = 7.3 Hz, 1H), 4.02 (dddd, J = 7.4, 3.7, 1.8, 1.1 Hz, 1H), 3.93 – 3.76 (m, 3H),
3.65 (dd, J = 12.0, 6.1 Hz, 2H), 3.54 (ddd, J = 9.0, 3.6, 1.1 Hz, 1H), 3.41 – 3.26 (m, 4H), 2.05 (d, J = 1.7
Hz, 3H). Characterization data agree with previously reported data (Noguchi et al., 2009).

Compound 3.8 2-methyl-(1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-2-oxazoline
Compound 3.7 (329 mg, 0.995 mmol) was cooled to 0 °C in an ice-water bath. 7 N
ammonia in MeOH (20 ml) was added under an atmosphere of N 2 (g) and the reaction
was allowed to stir for 2 h. Reaction progress was monitored by TLC using 10%
MeOH in EtOAc. Once judged complete, the reaction was concentrated and used in subsequent steps
without purification assuming 100% yield. Crude is an orange oil.
1
H NMR (400 MHz, CD 3OD) δ 5.97 (d,
J = 7.3 Hz, 1H), 3.94 (dddd, J = 7.4, 3.7, 1.8, 1.1 Hz, 1H), 3.85 – 3.67 (m, 3H), 3.57 (dd, J = 12.0, 6.1 Hz,
2H), 3.46 (ddd, J = 9.0, 3.6, 1.1 Hz, 1H), 1.97 (d, J = 1.7 Hz, 3H). Characterization data agree with
previously reported data (Noguchi et al., 2009).

98
Compound 3.9 β-1-hexanoyl-N-acetyl-glucosamine
Compound 3.8 (1.00 g, 4.95 mmol) was coupled with hexanoic acid
(125 μL, 1 mmol) using the General Procedure for Carboxylic Acid
Coupling described above to afford 6 as a white solid (885 mg, 56%
yield).
1
H NMR (400 MHz, CD 3CN) δ 6.37 (d, J = 9.1 Hz, 1H), 5.56
(dd, J = 8.9, 1.8 Hz, 1H), 3.78 – 3.67 (m, 2H), 3.64 – 3.54 (m, 1H), 3.46 (dd, J = 10.0, 8.0 Hz, 1H), 3.40 –
3.27 (m, 2H), 2.37 – 2.24 (m, 2H), 2.17 – 2.12 (m, 3H), 1.86 (d, J = 1.8 Hz, 3H), 1.57 (p, J = 7.3 Hz, 2H),
1.38 – 1.23 (m, 4H), 0.94 – 0.85 (m, 3H).
13
C NMR (101 MHz, CD 3CN) δ 92.56, 77.02, 74.47, 70.57, 61.44,
54.62, 33.72, 30.80, 24.15, 22.25, 21.99, 13.17. ESI-MS calcd. for C
14
H
25
NNaO
7
(M + Na)
+
m/z 342.1529,
found m/z 342.1535.

Compound 3.10 β-1-hexanoyl-6-O-p-methylbenzenesulfonate-N-acetyl-glucosamine
Compound 3.9 (200 mg, 0.625 mmol) was dried under high-vac in a
round bottom flask fitted with a stir bar for 3 h at which point it was
resuspended in anhydrous pyridine (5 ml) under N 2 (g). This solution
was then cooled to -20 °C in an acetone dry-ice bath. In a separate
round bottom flask, freshly recrystallized 4-toluenesulfonyl chloride (143 mg, 0.752 mmol) was dissolved
in anhydrous pyridine (1 ml) and added dropwise to the cooled solution of 9. The reaction was allowed to
warm to RT slowly overnight. After 24 h, the reaction was stopped and column purified using a mobile
phase of 2.5% MeOH in EtOAc to afford 105 mg of 10 as a white solid in 37% yield.
1
H NMR (400 MHz,
CD3OD) δ 7.81 (d, J = 6.5 Hz, 2H), 7.45 (d, J = 8.0 Hz, 2H), 5.54 (d, J = 8.8 Hz, 1H), 4.36 (d, J = 10.9 Hz,
1H), 4.20 (dd, J = 10.9, 5.6 Hz, 1H), 3.78 (t, J = 9.1 Hz, 1H), 3.56 – 3.48 (m, 1H), 3.48 – 3.43 (m, 1H), 2.48
(s, 3H), 2.35 (t, J = 7.1 Hz, 2H), 1.95 (s, 3H), 1.62 (q, J = 7.4 Hz, 2H), 1.42 – 1.29 (m, 5H), 0.98 – 0.89 (m,
3H).
13
C NMR (101 MHz, CD3OD) δ 172.34, 172.28, 147.39, 141.54, 130.18, 126.72, 92.71, 77.47, 74.27,

99
70.10, 60.94, 54.73, 33.53, 30.86, 24.06, 21.94, 21.45, 20.30, 12.83. ESI-MS calcd. for C
21
H
31
NNaO
9
S (M
+ Na)
+
m/z 496.1617, found m/z 496.1621.

Compound 3.11 β-1-hexanoyl-6-azido-6-deoxy-N-acetyl-glucosamine
Compound 3.10 (70 mg, 0.148 mmol) was dissolved in anhydrous
DMF (3 ml) under N 2 (g). The reaction mixture was warmed to 50 °C
in an oil bath before sodium azide (48 mg, 0.739 mmol) was added.
The reaction was allowed to stir for 24 h before being judged
complete by TLC (15% MeOH in EtOAc) at which point it was cooled to RT and the solvent was removed.
Crude material was column purified using a mobile phase of 2.5% MeOH in EtOAc to afford 11 as a yellow
solid (33.3 mg, 65% yield).
1
H NMR (500 MHz, CD3OD) δ 5.61 (d, J = 8.8 Hz, 1H), 3.85 (dd, J = 10.4, 8.9
Hz, 1H), 3.56 – 3.50 (m, 2H), 3.44 (dtd, J = 11.5, 5.9, 1.9 Hz, 1H), 3.40 – 3.33 (m, 1H), 2.36 – 2.25 (m,
2H), 1.96 (s, 3H), 1.61 (p, J = 7.3 Hz, 2H), 1.32 (ddt, J = 11.5, 7.7, 5.0 Hz, 4H), 0.91 (t, J = 7.0 Hz, 3H).
13
C NMR (126 MHz, CD 3OD) δ 172.29, 172.26, 92.49, 76.28, 74.06, 70.95, 54.60, 50.95, 33.53, 33.49,
31.04, 30.79, 24.37, 24.15, 21.99, 21.92, 21.48, 12.83, 12.80. ESI-MS calcd. for C
14
H
24
N
4
NaO
6
(M + Na)
+

m/z 367.1594, found m/z 367.1589.

Compound 3.12 N-4-pentynyl-glucosamine
Compound 3.1 (100 mg, 0.234 mmol) was cooled in an ice-water bath to 0 °C
before being dissolved in 7 N ammonia in MeOH (5 ml) and stirred for 3 h. Once
judged complete by TLC (10% MeOH in EtOAc), the reaction was concentrated
and column purified using 5% MeOH in EtOAc to afford 12 as a white solid (30
mg, 50% yield).
1
H NMR (400 MHz, D 2O) δ 5.06 (d, J = 3.5 Hz, 1H), 4.58 (d, J = 8.3 Hz, 1H), 3.80 – 3.69
(m, 4H), 3.65 (d, J = 5.2 Hz, 1H), 3.62 (dt, J = 4.5, 2.2 Hz, 1H), 3.60 – 3.53 (m, 1H), 3.43 – 3.38 (m, 1H),
3.38 – 3.29 (m, 2H), 2.38 – 2.37 (m, 5H), 2.24 – 2.21 (m, 1H).
13
C NMR (126 MHz, D 2O) δ 170.66, 94.58,

100
90.71, 75.91, 73.58, 71.52, 70.58, 69.96, 69.80, 60.67, 60.50, 56.70, 54.03, 51.93, 51.67. ESI-MS calcd.
for C 11H 17NNaO 6 (M + Na)
+
m/z 282.0954, found m/z 282.0960.

Compound 3.13 6-azido-6-deoxy-N-acetyl-glucosamine
Ac 36AzGlcNAc (100 mg, 0.267 mmol) was cooled in an ice-water bath to 0 °C
before being dissolved in 7 N ammonia in MeOH (5 ml) and stirred for 3 h. Once
judged complete by TLC (10% MeOH in EtOAc), the reaction was concentrated
and column purified using 5% MeOH in EtOAc to afford 13 as a white solid (45
mg, 68% yield).
1
H NMR (500 MHz, CD 3OD) δ 5.13 (d, J = 3.5 Hz, 1H), 3.97 (ddd, J = 9.8, 6.0, 2.5 Hz,
1H), 3.88 (dd, J = 10.6, 3.5 Hz, 1H), 3.70 (dd, J = 10.6, 8.8 Hz, 1H), 3.53 (dd, J = 13.1, 2.5 Hz, 1H), 3.42
(dd, J = 13.2, 5.9 Hz, 1H), 3.38 – 3.35 (m, 1H), 1.96 (s, 4H), 1.31 (s, 2H).
13
C NMR (101 MHz, D 2O) δ
174.67, 174.43, 94.87, 90.80, 74.40, 73.58, 70.77, 70.46, 70.43, 70.16, 56.55, 53.92, 50.85, 50.77, 22.07,
21.80. ESI-MS calcd. for C 8H 15N4O 5 (M + H)
+
m/z 247.0964, found m/z 247.1043.

Cell culture
HeLa cell line (ATCC) was propagated in Dulbecco’s modified eagle medium (DMEM, Genesee
Scientific) supplemented with 10% fetal bovine serum (FBS, Atlanta Biologics). Mouse embryonic
fibroblast cell line NIH3T3 (ATCC) was propagated in DMEM supplemented with 10% calf serum (CS,
Atlanta Biologics). Chinese hamster ovarian cells (CHO-K1, ATCC) were grown in Ham’s F12K
supplemented with 10% FBS. HeLa cells stably expressing AGX1(F383G) were propagated in DMEM +
10% FBS. NIH3T3 cells stably expressing AGX1(F383G) were propagated in DMEM + 10% CS. All cells
were grown in a humidified incubator at 37 °C and 5% CO 2 atmosphere.

101
Metabolic labeling
GlcNAlk Derivative Chain Length
HeLa cells were grown to 50% confluency in 6-well plates before being treated with DMSO, 1-
But-GlcNAlk (200 μM), 1-Val-GlcNAlk (200 μM), or 1-Hex-GlcNAlk (200 μM). After 72 h, cells were
harvested and subjected to click chemistry using the general procedure described below.

Time Course
HeLa cells were grown to 50% confluency in 6-well plates before being treated with 1-
HexGlcNAlk (200 μM)or 1-Hex-6AzGlcNAc (200 μM) for 0, 12, 24, 48, or 72 h after which cells were
harvested and subjected to click chemistry using the general procedure described below.

Concentration Course
HeLa cells were grown to 80% confluency in 6-well plates before being treated with DMSO, 1-
HexGlcNAlk (25, 50, 100, 150, or 200 μM), or 1-Hex-6AzGlcNAc (50, 100, 150 or 200 μM). After 72 h
or 24 h, respectively, cells were harvested and subjected to click chemistry using the general procedure
described below.

Cell Panel
HeLa, NIH3T3, and CHO cells were grown to 80% confluency in 6-well plates before being treated
with DMSO, 1-Hex-GlcNAlk (200 μM), or 1-Hex-6AzGlcNAc (200 μM). After 72 h or 24 h, respectively,
cells were harvested and subjected to click chemistry using the general procedure described below.

1-Hex vs Free OH
HeLa cells were grown to 80% confluency in 6-well plates before being treated with DMSO,
GlcNAlk (200 μM), 1-Hex-GlcNAlk (200 μM), 6AzGlcNAc (200 μM), or 1-Hex-6AzGlcNAc (200 μM).

102
After 72 h for GlcNAlk analogs or 24 h for 6AzGlcNAc analogs, cells were harvested and subjected to
click chemistry using the general procedure described below.

AGX1 Mutants
HeLa and NIH3T3 cells expressing AGX1 (F383G) were grown to 80% confluency in 6-well plates
before being treated with DMSO vehicle, 1-Hex-GlcNAlk (200 μM), or 1-Hex-6AzGlcNAc (200 μM).
After 72 or 24 h, respectively, cells were harvested and subjected to click chemistry using the general
procedure described below.

General procedure for click chemistry
Cells were collected via trypsinization, washed with DPBS, and pelleted via centrifugation
at 2,000 g for 4 min at 4 °C. Cells were resuspended in 4% SDS buffer (4% SDS, 150 mM NaCl, 50 mM
TEA for azide-containing MCRs, 50 mM HEPES for alkyne-containing MCRs, pH 7.4) supplemented with
Complete, Mini, EDTA-free Protease Inhibitor Cocktail Tablets (Roche, 5 mg ml
-1
) before lysis via tip
sonication at 25% amplitude for 15 sec, 5 sec on 5 sec off, and centrifuged for 10 min at 10,000 g. The
supernatant was collected, and protein concentration was determined via BCA assay (Pierce, Thermo
Scientific). Normalized to 1 μg μL
-1
, 200 μg protein was normalized to 1% SDS buffer and 12 μL of freshly
made click chemistry cocktail [Alkyne-TAMRA tag or Azide-TAMRA tag (Click Chemistry Tools, 100
μM, 10 mM stock solution in DMSO); tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (1 mM, 50
mM freshly prepared stock solution in water); tris[(1-benzyl-1-H-1,2,3-triazol-4-yl)methyl]amine (TBTA,
100 μM, 10 mM stock solution in DMSO); CuSO4·5H2O (1 mM, 50 mM freshly prepared stock solution
in water)] was added, gently vortexed, and then allowed to react in the dark for 1 h. Ice-cold methanol was
added and the reaction was placed at -20°C for at least 2 h to precipitate proteins before centrifugation for
10 min at 10,000 g, 4 °C. The supernatant was poured off and protein pellets were allowed to air dry for 5-
10 min before being resuspended in 50 μL 4% SDS buffer and bath sonicated for complete dissolution.

103
After bath sonication, 50 μL of SDS-free 2X loading buffer (100 mM Tris, 20% glycerol, 0.2%
bromophenol blue, 1.4% β-mercaptoethanol, pH 6.8) and samples were boiled for 5 min at 95°C. For SDS-
PAGE (Criterion TGX 4−20% Gel, Bio-Rad) separation, 40 μg was added per lane. After separation, gels
were scanned on Typhoon 9400 Variable Mode Imager (GE Healthcare) using a 532 nm for excitation and
30 nm bandpass filter centered at 610 nm for detection.

Background lysate labeling
HeLa cells were grown to 80% confluency in a 10 cm dish before being harvested by trypsinization
and washed two times with ice cold PBS (5 min, 2,000 X g, 4 °C). The resulting pellet was resuspended in
700 μL of ice-cold PBS supplemented with 5 mg ml
-1
Protease Inhibitor and lysed via tip sonication on ice
for 45 s (15 s on, 10 s off). Cell lysates were clarified via centrifugation (10 min, 10,000 X g, 4 °C) and the
supernatant was transferred to a fresh 1.5 ml tube on ice. Protein concentration was normalized using a
BCA assay (Pierce, Thermo Scientific) and diluted to 2 mg ml
-1
. Reporter molecules (20 and 200 mM stocks
in DMSO) or DMSO control were added to 100 μL (200 μg) of lysate on ice. For 1-Hex-GlcNAlk
experiments, HeLa lysate was treated with the following seven conditions: DMSO control, 0.2 mM
GlcNAlk, 2 mM GlcNAlk, 0.2 mM Ac 4GlcNAlk, 2 mM Ac 4GlcNAlk, 0.2 mM 1-Hex-GlcNAlk, 2 mM 1-
Hex-GlcNAlk. For 1-Hex-6AzGlcNAc experiments, HeLa lysate was treated with the following seven
conditions: DMSO control, 0.2 mM 6AzGlcNAc, 2 mM 6AzGlcNAc, 0.2 mM Ac 46AzGlcNAc, 2 mM
Ac 46AzGlcNAc, 0.2 mM 1-Hex-6AzGlcNAc, or 2 mM 1-Hex-6AzGlcNAc. Treated cell lysates were
incubated at 37 °C for 2 h. Proteins were precipitated by the addition of 800 μL of ice cold MeOH and
stored at -80 °C overnight. Precipitated proteins were pelleted via centrifugation (10 min, 13,000 X g, 4
°C). Supernatant was decanted and proteins were resuspended in 200 μL of 1% SDS buffer (4% SDS, 150
mM NaCl, 50 mM TEA for azide-containing MCRs, 50 mM HEPES for alkyne-containing MCRs, pH 7.4)
and submitted to CuAAC as described in the General Procedure for Click Chemistry section above.

104
Chapter 3 References

Chuh, K. N., Zaro Bw Fau - Piller, F., Piller F Fau - Piller, V., Piller V Fau - Pratt, M. R., & Pratt, M. R.
(2014). Changes in metabolic chemical reporter structure yield a selective probe of O-GlcNAc
modification. (1520-5126 (Electronic)).
Hao, Y., Fan, X., Shi, Y., Zhang, C., Sun, D. E., Qin, K., . . . Chen, X. A.-O. (2019). Next-generation
unnatural monosaccharides reveal that ESRRB O-GlcNAcylation regulates pluripotency of mouse
embryonic stem cells. (2041-1723 (Electronic)).
Helenius, A., & Aebi, M. (2004). Roles of N-linked glycans in the endoplasmic reticulum. (0066-4154
(Print)).
Ishihara H Fau - Massaro, D. J., Massaro Dj Fau - Heath, E. C., & Heath, E. C. (1968). The metabolism
of L-fucose. 3. The enzymatic synthesis of beta-L-fucose 1-phosphate. (0021-9258 (Print)).
Jonckheere, N., & Van Seuningen, I. (2010). The membrane-bound mucins: From cell signalling to
transcriptional regulation and expression in epithelial cancers. (1638-6183 (Electronic)).
Laughlin, S. T., & Bertozzi, C. R. (2007). Metabolic labeling of glycans with azido sugars and subsequent
glycan-profiling and visualization via Staudinger ligation. (1750-2799 (Electronic)).
Levine, Z. G., & Walker, S. (2016). The Biochemistry of O-GlcNAc Transferase: Which Functions Make
It Essential in Mammalian Cells? (1545-4509 (Electronic)).

105
Liu, T. W., Zandberg, W. A.-O., Gloster, T. A.-O., Deng, L., Murray, K. D., Shan, X., & Vocadlo, D. A.-
O. (2018). Metabolic Inhibitors of O-GlcNAc Transferase That Act In Vivo Implicate Decreased O-
GlcNAc Levels in Leptin-Mediated Nutrient Sensing. (1521-3773 (Electronic)).
Maksimovic, I. A.-O., Zheng, Q. A.-O., Trujillo, M. N., Galligan, J. A.-O., & David, Y. A.-O. (2020). An
Azidoribose Probe to Track Ketoamine Adducts in Histone Ribose Glycation. (1520-5126 (Electronic)).
Mathew, M. P., Tan E Fau - Shah, S., Shah S Fau - Bhattacharya, R., Bhattacharya R Fau - Adam
Meledeo, M., Adam Meledeo M Fau - Huang, J., Huang J Fau - Espinoza, F. A., . . . Yarema, K. J.
(2012). Extracellular and intracellular esterase processing of SCFA-hexosamine analogs: implications for
metabolic glycoengineering and drug delivery. (1464-3405 (Electronic)).
Meldal, M., & Tornøe, C. W. (2008). Cu-catalyzed azide-alkyne cycloaddition. (1520-6890 (Electronic)).
Noguchi, M., Tanaka T Fau - Gyakushi, H., Gyakushi H Fau - Kobayashi, A., Kobayashi A Fau - Shoda,
S.-i., & Shoda, S. (2009). Efficient synthesis of sugar oxazolines from unprotected N-acetyl-2-amino
sugars by using chloroformamidinium reagent in water. (1520-6904 (Electronic)).
Parker, C. G., & Pratt, M. R. (2020). Click Chemistry in Proteomic Investigations. (1097-4172
(Electronic)).
Pedowitz, N. J., & Pratt, M. R. (2021). Design and synthesis of metabolic chemical reporters for the
visualization and identification of glycoproteins. RSC Chemical Biology, 2(2), 306-321.
Qin, K., Zhang, H., Zhao, Z., & Chen, X. (2020). Protein S-Glyco-Modification through an Elimination-
Addition Mechanism. (1520-5126 (Electronic)).

106
Qin, W., Qin, K., Fan, X., Peng, L., Hong, W., Zhu, Y., . . . Chen, X. A.-O. (2018). Artificial Cysteine S-
Glycosylation Induced by Per-O-Acetylated Unnatural Monosaccharides during Metabolic Glycan
Labeling. (1521-3773 (Electronic)).
Rabinovich, G. A., van Kooyk Y Fau - Cobb, B. A., & Cobb, B. A. (2012). Glycobiology of immune
responses. (1749-6632 (Electronic)).
Sarkar, A. K., Fritz Ta Fau - Taylor, W. H., Taylor Wh Fau - Esko, J. D., & Esko, J. D. (1995).
Disaccharide uptake and priming in animal cells: inhibition of sialyl Lewis X by acetylated Gal beta 1--
>4GlcNAc beta-O-naphthalenemethanol. (0027-8424 (Print)).
Singh, P. K., & Hollingsworth, M. A. (2006). Cell surface-associated mucins in signal transduction.
(0962-8924 (Print)).
Varki A., C. R. D., Esko J.D., Stanley P., Hart G.W., Aebi M., Darvill A.G., Kinoshita T., Packer N.H.,
Prestegard J.H., Schnaar R.L., Seeberger P.H., editors. (2015-2017). Essentials of Glycobiology (3rd ed.).
Cold Spring Harbor Laboratory Press.
Yu, S. H., Boyce M Fau - Wands, A. M., Wands Am Fau - Bond, M. R., Bond Mr Fau - Bertozzi, C. R.,
Bertozzi Cr Fau - Kohler, J. J., & Kohler, J. J. (2012). Metabolic labeling enables selective
photocrosslinking of O-GlcNAc-modified proteins to their binding partners. (1091-6490 (Electronic)).
Zaro, B. W., Yang Yy Fau - Hang, H. C., Hang Hc Fau - Pratt, M. R., & Pratt, M. R. (2011). Chemical
reporters for fluorescent detection and identification of O-GlcNAc-modified proteins reveal glycosylation
of the ubiquitin ligase NEDD4-1. (1091-6490 (Electronic)).

107
Zhu, H., Aloor, A., Ma, C., Kondengaden, S. M., & Wang, P. G. (2020). Mass Spectrometric Analysis of
Protein Glycosylation. In Glycan-Based Cellular Communication: Techniques for Carbohydrate-Protein
Interactions (Vol. 1346, pp. 169-203). American Chemical Society.

108
Chapter 4: Synthesis and application of other metabolic chemical reporters

Introduction
Metabolic chemical reporters (MCRs) are analogues of monosaccharides containing one of two
small, chemically reactive groups (Jackson et al., 2021). These MCRs allow for the visualization,
identification, and characterization of glycoproteins within cells and some living multicellular organisms.
The cellular enzymes utilize MCRs in their biosynthetic pathways and glycosyltransferases incorporate
them on to glycoproteins. A bioorthogonal reaction utilizes the small chemically-reactive groups on MCRs
to attach visualization or affinity tags. The following compounds and their in vitro characterization have
been synthesized for projects not previously discussed.

1-OH and 6-OH GlcNAlk and GlcNAz

Figure 4.1 Synthesis of C6-OH GlcNAlk and GlcNAz a) Methanol and 20% TEA O.N. b) TBSCl, imidazole,
pyridine O.N. c) Acetic anhydride and pyridine O.N. d) 1M TBAF in THF,THF, 0°C, O.N. and C1-OH GlcNAlk and
GlcNAz e) hydrazine acetate, DMF 5 h
O
OH
AcO
AcO
OAc
NH
O
R
O
OAc
AcO
AcO
OH
NH
O
R
O
OAc
AcO
AcO
OAc
NH
O
R
O
OH
HO
HO
OH
NH
O
R
O
OTBS
HO
HO
OH
NH
O
R
O
OTBS
AcO
AcO
OAc
NH
O
R
a
b
c
d
e
R = N
3
or
109
Research by the Yarema lab found that deprotected carbohydrates at the C1 and C6 positions
exhibited different levels of toxicity (Aich et al., 2008). The C1-OH carbohydrates showed increase toxicity
in cells whereas the C6-OH showed decreased toxicity in comparison to the per-O-acetylated reporters.
Here we synthesized the C1-OH and C6-OH Ac3GlcNAz and Ac3GlcNAlk (Figure 4.1) and tested their
toxicity and labeling within NIH3T3 and HeLa cells. Standard CuAAC protocols were used to tag our
reporters with a fluorescent tag and MTT assay was used to determine toxicity within both cell lines. Both
C1-OH reporters found either similar or increased labeling at 4 h and 16 h of treatment in HeLas and

Figure 4.2 A variety of proteins are labeled with C1-OH and C6-OH GlcNAlk, GlcNAz, and 2AzGlc (200 μM) in
A) NIH3T3 cells and B) HeLa cells over 4 h and 16 h. Cell lysates were subjected to CuAAC using azide-rhodamine
or alkyne-rhodamine, respectively, for protein separation and visualization using in-gel fluorescence scanning.

110
NIH3T3 cells while the C6-OH reporters found decreased labeling (Figure 4.2). However, the C1-OH
reporters showed increased toxicity to cells, similar to data from the Yarema lab, while C6-OH showed
significantly less toxicity to cells (Figure 4.3).

Ac34AzGalNAc
Mucin-type O-linked glycosylation is the most abundant form of O-linked glycosylation in higher
eukaryotes (Jackson et al., 2021). Characterized by the addition of N-acetylgalactosamine to serine and
threonine residues of membrane-bound and secreted proteins, mucin-type O-linked glycosylation is
important in the protection of cells, cell-to-cell signaling, and cellular homeostasis. The enzyme UDP-
galactose/glucose 4-epimerase (GALE) allows MCRs into the enzyme pathway for incorporation into
mucin-type glycoproteins by epimerizing the C4 of N-acetylglucosamine based reporters into their N-

Figure 4.3 MTS assay in NIH3T3 and HeLa cell lines. Cells were treated in triplicate with each reporter for 16 h
and readings were normalized to no treatment conditions.
111
acetylgalactosamine epimers. This epimerization allows for various MCRs to be non-specific reporters of
any of the three main categories of glycosylation. While previous research has found MCRs that are specific
for O-GlcNAcylation, none such reporter has been identified for mucin-type glycosylation specifically. In
considering GALE, we hypothesized that incorporating the chemically-reactive azide moiety at the C4
position of N-acetylgalactosamine would not only allow for biorthogonal reactions after incorporation by
endogenous enzymes in the pathway but would also prevent compatibility with GALE and therefore prevent
the epimer. Here we show the synthesis of Ac34AzGalNAc (Figure 4.4) and the subsequent in vitro labeling
of proteins. In NIH3T3 cells, we found no significant protein labeling above background (Figure 4.5).

Figure 4.4 Synthesis of Ac34AzGalNAc a) Benzaldehyde dimethylacetal, p-TsOH, DMF, 50°C, 4 h b) Acetic
anhydride, pyridine, O.N, c) 80% AcOH, 50°C, 4h d) TBSCl, imidazole, pyridine O.N. e) Triflic anhydride, pyridine,
dichloromethane f) Sodium azide, DMF g) 80% AcOH, 50°C, 4h h) Acetic anhydride, pyridine, O.N.
O
OH
OH
HO
HO
NHAc
O
OH
HO
NHAc
O
O
Ph
O
OAc
OTBS
TfO
AcO
NHAc
O
OAc
OTBS
AcO
NHAc
N
3
O
OAc
OH
AcO
NHAc
N
3
O
OAc
AcO
NHAc
O
O
Ph
O
OAc
OH
HO
AcO
NHAc
O
OAc
OTBS
HO
AcO
NHAc
O
OAc
OAc
AcO
NHAc
N
3
a b
c
d
e
f
g
h
112

Methods and Materials
General Reagent Information
All solvents and reagents were purchased from commercial sources (Sigma, VWR, etc.) and used
without further purification unless otherwise indicated. Ultra-pure MilliQ water was obtained from an in-
house ELGA water purification system and used for all aqueous solutions. Silica gel column
chromatography was performed using 60 Å silica gel (MilliporeSigma). All thin-layer chromatrography
was performed using 60 Å, F254 silica gel plates (MilliporeSigma) and compounds detected by ceric
ammonium molybdate (CAM), ninhdryine, or triphenylphosphine followed by ninhydrine straining
solutions.

Compound 4.1 N-acetyl-4-pentynylglucosamine
Ac4GlcNAlk (Zaro et al., 2011) was synthesized according to literature
procedures. Ac4GlcNAlk (1.0 g, 2.339 mmol) was dissolved in anhydrous
methanol (26.6 mL) under nitrogen at RT. Triethylamine (5.3 mL) was added to
the solution and allowed to stir overnight at RT in the dark. The reaction mixture was concentrated down

Figure 4.5 Ac34AzGalNAc shows no labeling in NIH3T3 cells above background at 200 μM. Ac4GalNAz was
used as a positive control for labeling.
O
OH
HO
HO
OH
NH
O
113
and purified by silica gel column chromatography (15% methanol/dichloromethane) to afford the product
(548.6, 91% yield) as a white powder.

Compound 4.2 1,3,4-Tri-O-Acetyl-6-Tert-Butyldimethylsilyl-N-acetyl-4-pentynylglucosamine
Compound 4.1 (548.6 mg, 2.132 mmol) was dissolved in anhydrous pyridine
(19.4 mL) under nitrogen at RT. Imidazole (510 mg, 7.563 mmol) and tert-
butyldimethylsilyl chloride (50% w/v in toluene, 1.08 ml, 3.151 mmol) were
added and allowed to stir overnight. Acetic anhydride (1.91 mL, 20.17 mmol) and 4-dimethylaminopyridine
(30.8 mg, 0.2521 mmol) were added and allowed to stir overnight. The reaction was diluted with ethyl
acetate and washed with sodium bicarbonate (1X), H2O (1X), and brine (1X). The organic layer was dried
over sodium sulfate and concentrated. The compound was purified by silica gel column chromatography
(30% ethyl acetate/hexanes) to afford the compound (514.6 mg, 40.9% yield) as a yellow oil.
1
H NMR (400
MHz, Chloroform-d) δ 6.17 (d, J = 3.7 Hz, 1H), 5.69 (d, J = 8.9 Hz, 1H), 5.63 (d, J = 8.8 Hz, 0H), 5.27 –
5.11 (m, 2H), 4.43 (ddd, J = 10.5, 8.9, 3.7 Hz, 1H), 3.81 (ddd, J = 9.7, 4.4, 2.6 Hz, 1H), 3.66 (dd, J = 5.2,
3.5 Hz, 2H), 2.45 (td, J = 6.6, 1.9 Hz, 3H), 2.36 – 2.29 (m, 3H), 2.14 (s, 3H), 2.08 – 1.95 (m, 9H), 0.85 (s,
12H).

Compound 4.3 1,3,4-Tri-O-Acetyl-N-acetyl-4-pentynylglucosamine
Compound 4.2 (514.6 mg, 1.029 mmol) was dissolved in THF (5.4 mL) on ice.
Acetic acid (21.4 mL) was added followed by TBAF (1.0 M in THF, 21.4 mL)
and allowed to warm to room temperature overnight. The reaction was diluted
with ethyl acetate and washed with sodium bicarbonate (2X), H2O (1X), and brine (1X) before the organic
layer was dried over sodium sulfate and concentrated. The compound was purified by silica gel
chromatography (35% acetone/hexanes) to afford the compound (296.5 mg, 75% yield) as a yellow oil.
1
H
NMR (400 MHz, Chloroform-d) δ 6.20 (d, J = 3.7 Hz, 1H), 6.15 (d, J = 3.7 Hz, 4H), 5.81 (d, J = 9.4 Hz,
5H), 5.64 (d, J = 8.8 Hz, 1H), 5.29 (d, J = 11.1 Hz, 1H), 5.15 (dd, J = 11.1, 9.3 Hz, 5H), 4.59 (dd, J = 12.5,
O
OH
AcO
AcO
OAc
NH
O
O
OTBS
AcO
AcO
OAc
NH
O
114
3.3 Hz, 5H), 4.46 – 4.36 (m, 5H), 4.18 (dd, J = 12.5, 2.3 Hz, 4H), 3.88 – 3.79 (m, 6H), 3.70 – 3.57 (m, 8H),
2.52 – 2.43 (m, 13H), 2.38 – 2.29 (m, 12H), 2.17 (s, 12H), 2.14 (s, 15H), 2.12 (s, 11H), 1.98 (s, 2H).

Compound 4.4 N-azidoacetyl-glucosamine
GlcNAZ was synthesized in the same manner as 4.1 starting with Ac4GlcNAz
(Vocadlo et al., 2003) synthesized according to literature.

Compound 4.5 1,3,4-Tri-O-Acetyl-6-Tert-Butyldimethylsilyl-N-azidoacetyl-glucosamine
Ac36TBSGlcNAz was synthesized same as 4.2.
1
H NMR (400 MHz,
Chloroform-d) δ 6.37 (d, J = 8.8 Hz, 1H), 6.18 (d, J = 3.7 Hz, 1H), 5.71 (d, J =
8.6 Hz, 0H), 5.32 – 5.09 (m, 2H), 4.37 (ddd, J = 10.8, 8.9, 3.8 Hz, 1H), 3.90 –
3.81 (m, 2H), 3.71 – 3.58 (m, 2H), 2.16 (s, 3H), 2.03 (s, 3H), 2.02 – 1.96 (m, 2H), 0.91 – 0.79 (m, 13H).
Compound 4.6 1,3,4-Tri-O-Acetyl-N-azidoacetyl-glucosamine
Ac3GlcNAz was synthesized in the same manner as 4.3.
1
H NMR (400 MHz,
Chloroform-d) δ 6.33 (d, J = 8.9 Hz, 1H), 6.09 (d, J = 3.7 Hz, 1H), 5.21 (dd, J =
11.0, 9.6 Hz, 1H), 5.09 – 4.95 (m, 2H), 4.29 (ddd, J = 11.0, 8.8, 3.7 Hz, 1H), 3.99
(q, J = 7.1 Hz, 1H), 3.83 – 3.77 (m, 3H), 3.73 – 3.66 (m, 1H), 3.52 (ddd, J = 45.5, 13.5, 5.9 Hz, 3H), 2.07
(s, 3H), 1.96 (s, 3H), 1.94 (s, 3H).

Compound 4.7 4,6-O-benzylidene-N-acetylglucosamine
N-acetylglucosamine (5.0g, 22.50 mmol) was dissolved in DMF (45 mL) and
benzaldehyde dimethyl acetal (4.05 mL, 27.00 mmol) and 4-toluensulfonic acid
(315 mg, 1.656mmol) was added. The reaction was placed under reduced pressure of 100 mbar at 50°C for
3 h. Reaction was then concentrated and column purified at 5% methanol/dichloromethane to afford the
compound (5.21 g, 75% yield) as a white powder.
1
H NMR (400 MHz, Chloroform-d) δ 7.47 – 7.40 (m,
O
OH
HO
NHAc
O
O
Ph
O
OH
HO
HO
OH
NH
O
N
3
O
OTBS
AcO
AcO
OAc
NH
O
N
3
O
OH
AcO
AcO
OAc
NH
O
N
3
115
1H), 7.39 – 7.32 (m, 2H), 5.70 (d, J = 8.8 Hz, 0H), 5.52 (s, 1H), 5.18 (dd, J = 10.5, 9.5 Hz, 0H), 4.41 – 4.24
(m, 1H), 3.85 – 3.71 (m, 1H), 3.61 (td, J = 9.7, 4.9 Hz, 0H), 2.10 (d, J = 12.4 Hz, 3H).

Compound 4.8 1,3-Di-O-acetyl 4,6-O-benzylidene-N-acetylglucosamine
Compound 4.7 (1.237 g, 4.000 mmol) was dissolved in pyridine (16 mL) with
acetic anhydride (1.13 mL, 12.00 mmol) and 4-dimethylaminopyridine (49 mg,
0.4000 mmol) and allowed to react for 16 h at room temperature. Reaction mixture was diluted with ethyl
acetate and washed with sodium bicarbonate (1X), water (1X), and brine (1X) and dried over sodium sulfate
and concentrated. Product was recrystallized from 200 proof ethanol to afford compound (556.9 mg, 36%
yield) as a white powder.
1
H NMR (400 MHz, Chloroform-d) δ 7.51 – 7.42 (m, 1H), 7.38 – 7.30 (m, 1H),
6.15 (d, J = 3.8 Hz, 0H), 5.69 (dd, J = 8.9, 4.6 Hz, 1H), 5.55 (s, 1H), 5.33 (dd, J = 10.7, 9.6 Hz, 0H), 4.47
(ddd, J = 10.7, 9.0, 3.8 Hz, 1H), 4.31 (dd, J = 10.4, 4.8 Hz, 1H), 3.99 – 3.85 (m, 1H), 3.78 (q, J = 10.0 Hz,
1H), 2.20 (s, 1H), 2.13 – 2.04 (m, 2H), 1.94 (d, J = 3.2 Hz, 2H).
Compound 4.9 1,3-Di-O-acetyl N-acetylglucosamine
Compound 4.8 (250 mg, 0.6355 mmol) was dissolved in 80% acetic acid (2.5 mL)
at 50°C and allowed to react for 4 h. Reaction was concentrated down and then
purified at 5% methanol/dichloromethane to afford compound (130 mg, 67% yield) as a yellow oil.
1
H
NMR (400 MHz, Chloroform-d) δ 6.15 (d, J = 3.6 Hz, 1H), 5.68 (dd, J = 8.8, 0.7 Hz, 0H), 5.13 (dd, J =
11.0, 9.2 Hz, 1H), 5.02 (t, J = 9.7 Hz, 1H), 4.32 (dddd, J = 10.8, 8.8, 3.6, 1.5 Hz, 1H), 4.22 – 4.13 (m, 1H),
3.98 – 3.87 (m, 1H), 3.87 – 3.80 (m, 2H), 3.72 (d, J = 9.8 Hz, 1H), 2.19 – 2.14 (m, 3H), 2.13 – 2.08 (m,
6H), 1.93 (t, J = 1.4 Hz, 5H).

Compound 4.10 1,3-Di-O-acetyl 6-Tert-butyldimethylsilyl N-acetylglucosamine
Compound 4.9 (100 mg, 0.3276 mmol) was dissolved in pyridine (2.5 mL) at room
temperature. TBSCl (50% w/v in toluene, 0.14 mL, 0.3931mmol) and imidazole
(67 mg, 0.9828 mmol) were added and allowed to react for 16 h at room temperature. Reaction was diluted
O
OAc
AcO
NHAc
O
O
Ph
O
OAc
OH
HO
AcO
NHAc
O
OAc
OTBS
HO
AcO
NHAc
116
with ethyl acetate and washed with sodium bicarbonate (1X), water (1X), and brine (1X) before drying over
sodium sulfate and concentrated down. Compound was purified at 80% ethyl acetate/hexanes to afford the
compound (107.6 mg, 78% yield) as a yellow oil.
1
H NMR (400 MHz, Chloroform-d) δ 6.07 (d, J = 3.6
Hz, 1H), 5.57 (d, J = 8.7 Hz, 0H), 5.06 (ddd, J = 10.6, 8.9, 1.5 Hz, 1H), 4.95 (dd, J = 10.7, 8.9 Hz, 0H),
4.22 (dddd, J = 10.8, 8.9, 3.7, 1.5 Hz, 1H), 4.05 (dd, J = 7.1, 1.3 Hz, 1H), 3.89 – 3.80 (m, 1H), 3.72 (tdd, J
= 19.8, 9.1, 5.0 Hz, 5H), 2.13 – 1.80 (m, 17H).

Compound 4.11 1,3-Di-O-acetyl 4-Azido 6-Tert-butyldimethylsilyl N-acetylglucosamine
Compound 4.10 (107.6 mg, 0.2567 mmol) was dissolved in pyridine (0.23 mL) and
dichloromethane (0.23 mL) and cooled to -10°C. Triflic anhydride (60.4 μL, 0.3594
mmol) was added slowly and allowed to react for 1.5 h at 0°C. Reaction mixture was diluted with
dichloromethane and washed with 1M HCl (1X), sodium bicarbonate (1X), and water (1X) and dried over
sodium sulfate before being concentrated down. Compound was used as is and immediately submitted to
next reaction. Compound was dissolved in DMF (1 mL) and sodium azide (33.4 mg, 0.5134 mmol) was
added and allowed to react for 16 h at room temperature at which time it was concentrated down. Reaction
was then dissolved in ethyl acetate and washed with sodium bicarbonate (1X), water (1X), and brine (1X)
and then dried over sodium sulfate and concentrated. Compound was colum purified at 75% ethyl
acetate/hexanes to afford compound (53.9 mg, 47%) as a yellow oil.
1
H NMR (400 MHz, Chloroform-d) δ
6.04 (d, J = 3.7 Hz, 1H), 5.56 (d, J = 8.7 Hz, 0H), 5.37 (d, J = 9.3 Hz, 1H), 5.26 (dd, J = 11.3, 3.5 Hz, 1H),
5.14 (dd, J = 11.0, 3.6 Hz, 0H), 4.69 (ddd, J = 11.2, 9.3, 3.7 Hz, 1H), 4.44 – 4.27 (m, 0H), 4.10 – 3.97 (m,
2H), 3.88 (ddd, J = 8.2, 5.8, 1.6 Hz, 1H), 3.72 – 3.59 (m, 3H), 2.07 (s, 0H), 1.98 (s, 1H), 1.88 (d, J = 3.8
Hz, 4H), 0.91 – 0.76 (m, 19H), 0.11 – -0.05 (m, 10H).

O
OAc
OTBS
AcO
NHAc
N
3
117
Compound 4.12 1,3,6-Tri-O-acetyl 4-Azido N-acetylglucosamine
Compound 4.11 (1.17 g, 2.645 mmol) was dissolved in 80% acetic acid and heated
to 50°C for 4 h before being concentrated down and submitted to next reaction.
Compound was then dissolved in pyridine (10 mL) and acetic anhydride (1.25 mL, 13.22 mmol) was added
and allowed to react at room temperature for 16 h. Reaction was diluted with ethyl acetate and washed with
sodium bicarbonate (1X), water (1X), and brine (1X) and dried over sodium sulfate. The mixture was
concentrated and column purified at 70% ethyl acetate/hexanes to afford the final compound (345.8mg,
35% yield) as a yellow oil.
1
H NMR (400 MHz, Chloroform-d) δ 6.13 (d, J = 3.7 Hz, 1H), 5.29 (dd, J =
11.3, 3.5 Hz, 1H), 4.82 – 4.72 (m, 1H), 4.29 – 4.07 (m, 4H), 2.17 – 2.12 (m, 6H), 2.10 – 2.06 (m, 5H), 1.94
(dd, J = 3.5, 0.7 Hz, 4H).

Cell culture
NIH3T3 cells were cultured in high glucose DMEM media enriched with 10% fetal calf serum.
HeLa cells were cultured in high glucose DMEM media enriched with 10% fetal bovine serum. All cell
lines were incubated at 37°C with 5.0% CO2 in a humidified incubator.

Metabolic labeling and in-gel fluorescence scanning
To cells at 80-85% confluency, MCRs (1,000 x stock in DMSO) or DMSO were added and
incubated for up to 16h as indicated. Cells were collected via trypsinization and pelleted by centrifugation
(2,000 g, 4 min at 4°C). Cells were lysed in 4% SDS buffer (4% SDS, 150 mM NaCl, 50 mM TEA for
azide-containing MCRs, 50 mM HEPES for alkyne-containing MCRs, pH 7.4) containing Complete, Mini,
EDTA-free Protease Inhibitor Cocktail Tablets (Roche, 5mg/mL) and tip sonicated at 25% amplitude for
15 sec, 5 sec on 5 sec off and centrifuged at 10,000g for 10 min. Supernatant was collected and protein
concentration was determined via BCA Assay (Pierce, Thermo Scientific). Protein was normalized to 1 μg
μL
-1
and 12 μL of freshly made click chemistry cocktail [Alkyne-TAMRA tag or Azide-TAMRA tag (Click
Chemistry tools, 100 μM, 10 mM stock solution in DMSO); tris(2-carboxyethyl)phosphine hydrochloride
O
OAc
OAc
AcO
NHAc
N
3
118
(TCEP) (1 mM, 50 mM freshly prepared stock solution in water); tris[(1-benzyl-1-H-1,2,3-triazol-4-
yl)methyl]amine (TBTA) (100 μM, 10 mM stock solution in DMSO); CuSO4·5H2O (1 mM, 50 mM freshly
prepared stock solution in water)] was added to 200 μg of protein after normalization to 1% SDS. Reactions
were gently vortexed and allowed to react for 1 h in the dark. Ice-cold methanol was added to precipitate
proteins and placed at -20°C for at least 2 h and then spun down at 10,000 g for 10 min at 4°C. Supernatant
was poured off and the protein pellet was allowed to air dry for 5-10 min. To the protein pellet, 50 μL 4%
SDS buffer (4% SDS, 150 mM NaCl, 50 mM TEA for azide-containing MCRs, 50 mM HEPES for alkyne-
containing MCRs, pH 7.4) was added and the pellet was bath sonicated for complete dissolution. After bath
sonication, 50 μL SDS-free 2X loading buffer (100 mM Tris, 20% glycerol, 0.2% bromophenol blue, 1.4%
β-mercaptoethanol, pH 6.8) was added. Samples were boiled for 5 min at 95°C and 40 μg of protein was
added per lane for SDS-PAGE (Criterion TGX 4−20% Gel, Bio-Rad) separation. After separation, gels
were scanned on a Typhoon 9400 Variable Mode Imager (GE Healthcare) using a 532 nm for excitation
and 30 nm bandpass filter centered at 610 nm for detection.

MTT assay
To a 96-well plate, 5,000 cells were counted and plated per well 24 h before treatment. Media
was exchanged for media containing the MCR at 200 μM or DMSO vehicle and incubated for 16 h at
which time 20 μL of CellTiter 96 aqueous non-radioactive cell proliferation assay (Promega, Madison,
WI) was added and incubated for 1.5 h. Absorbance at 490 nm was read using a BioTek Synergy
H4Multi-Mode Microplate reader.
119
Chapter 4 References

Aich, U., Campbell Ct Fau - Elmouelhi, N., Elmouelhi N Fau - Weier, C. A., Weier Ca Fau -
Sampathkumar, S. G., Sampathkumar Sg Fau - Choi, S. S., Choi Ss Fau - Yarema, K. J., & Yarema, K. J.
(2008). Regioisomeric SCFA attachment to hexosamines separates metabolic flux from cytotoxicity and
MUC1 suppression. (1554-8937 (Electronic)).
Jackson, E. G., Pedowitz, N. J., Pratt, M. R., & Barchi, J. J. (2021). 3.12 - Metabolic Engineering of
Glycans. In (pp. 275-287). Elsevier.
Vocadlo, D. J., Hang, H. C., Kim, E.-J., Hanover, J. A., & Bertozzi, C. R. (2003). A chemical approach
for identifying O-GlcNAc-modified proteins in cells. Proceedings of the National Academy
of Sciences, 100(16), 9116.
Zaro, B. W., Yang, Y.-Y., Hang, H. C., & Pratt, M. R. (2011). Chemical reporters for fluorescent
detection and identification of O-GlcNAc-modified proteins reveal glycosylation of the ubiquitin ligase
NEDD4-1. Proceedings of the National Academy of Sciences, 108(20), 8146.

120
References
Agard, N. J., Prescher Ja Fau - Bertozzi, C. R., & Bertozzi, C. R. (2004). A strain-promoted [3 + 2] azide-
alkyne cycloaddition for covalent modification of biomolecules in living systems. (0002-7863 (Print)).

Agarwal, K., Kaul R Fau - Garg, M., Garg M Fau - Shajahan, A., Shajahan A Fau - Jha, S. K., Jha Sk Fau
- Sampathkumar, S.-G., & Sampathkumar, S. G. (2013). Inhibition of mucin-type O-glycosylation through
metabolic processing and incorporation of N-thioglycolyl-D-galactosamine peracetate (Ac5GalNTGc).
(1520-5126 (Electronic)).

Aich, U., Campbell Ct Fau - Elmouelhi, N., Elmouelhi N Fau - Weier, C. A., Weier Ca Fau - Sampathkumar,
S. G., Sampathkumar Sg Fau - Choi, S. S., Choi Ss Fau - Yarema, K. J., & Yarema, K. J. (2008).
Regioisomeric SCFA attachment to hexosamines separates metabolic flux from cytotoxicity and MUC1
suppression. (1554-8937 (Electronic)).

Akan, I., Olivier-Van Stichelen, S., Bond, M. R., & Hanover, J. A.-O. (2018). Nutrient-driven O-GlcNAc
in proteostasis and neurodegeneration. (1471-4159 (Electronic)).

Allen, J. G., Mujacic, M., Frohn, M. J., Pickrell, A. J., Kodama, P., Bagal, D., . . . McCarter, J. D. (2016).
Facile Modulation of Antibody Fucosylation with Small Molecule Fucostatin Inhibitors and Cocrystal
Structure with GDP-Mannose 4,6-Dehydratase. (1554-8937 (Electronic)).

Andres, J. L., Rönnstrand L Fau - Cheifetz, S., Cheifetz S Fau - Massagué, J., & Massagué, J. (1991).
Purification of the transforming growth factor-beta (TGF-beta) binding proteoglycan betaglycan. (0021-
9258 (Print)).

121
Banerjee, P. S., Lagerlöf, O., & Hart, G. W. (2016). Roles of O-GlcNAc in chronic diseases of aging. (1872-
9452 (Electronic)).

Bansil, R., Stanley E Fau - LaMont, J. T., & LaMont, J. T. (1995). Mucin biophysics. (0066-4278 (Print)).

Barchi, J. J., Jr. (2013). Mucin-type glycopeptide structure in solution: past, present, and future. (1097-0282
(Electronic)).

Barthel, S. R., Antonopoulos A Fau - Cedeno-Laurent, F., Cedeno-Laurent F Fau - Schaffer, L., Schaffer L
Fau - Hernandez, G., Hernandez G Fau - Patil, S. A., Patil Sa Fau - North, S. J., . . . Dimitroff, C. J. (2011).
Peracetylated 4-fluoro-glucosamine reduces the content and repertoire of N- and O-glycans without direct
incorporation. (1083-351X (Electronic)).

Beahm, B. J., Dehnert Kw Fau - Derr, N. L., Derr Nl Fau - Kuhn, J., Kuhn J Fau - Eberhart, J. K., Eberhart
Jk Fau - Spillmann, D., Spillmann D Fau - Amacher, S. L., . . . Bertozzi, C. R. (2014). A visualizable chain-
terminating inhibitor of glycosaminoglycan biosynthesis in developing zebrafish. (1521-3773 (Electronic)).

Becker, D. J., & Lowe, J. B. (2003). Fucose: biosynthesis and biological function in mammals. (0959-6658
(Print)).

Bera, S., & Linhardt, R. J. (2011). Design and synthesis of unnatural heparosan and chondroitin building
blocks. (1520-6904 (Electronic)).

Berkin, A., Szarek Wa Fau - Kisilevsky, R., & Kisilevsky, R. (2000). Synthesis of 4-deoxy-4-fluoro
analogues of 2-acetamido-2-deoxy-D-glucose and 2-acetamido-2-deoxy-D-galactose and their effects on
cellular glycosaminoglycan biosynthesis. (0008-6215 (Print)).

122

Billings, P. C., & Pacifici, M. (2015). Interactions of signaling proteins, growth factors and other proteins
with heparan sulfate: mechanisms and mysteries. (1607-8438 (Electronic)).

Bond Mr Fau - Hanover, J. A., & Hanover, J. A. (2015). A little sugar goes a long way: the cell biology of
O-GlcNAc. (1540-8140 (Electronic)).

Boyce, M., Carrico Is Fau - Ganguli, A. S., Ganguli As Fau - Yu, S.-H., Yu Sh Fau - Hangauer, M. J.,
Hangauer Mj Fau - Hubbard, S. C., Hubbard Sc Fau - Kohler, J. J., . . . Bertozzi, C. R. (2011a). Metabolic
cross-talk allows labeling of O-linked beta-N-acetylglucosamine-modified proteins via the N-
acetylgalactosamine salvage pathway. (1091-6490 (Electronic)).

Boyce, M., Carrico Is Fau - Ganguli, A. S., Ganguli As Fau - Yu, S.-H., Yu Sh Fau - Hangauer, M. J.,
Hangauer Mj Fau - Hubbard, S. C., Hubbard Sc Fau - Kohler, J. J., . . . Bertozzi, C. R. (2011b). Metabolic
cross-talk allows labeling of O-linked beta-N-acetylglucosamine-modified proteins via the N-
acetylgalactosamine salvage pathway. (1091-6490 (Electronic)).

Breidenbach, M. A., Gallagher Je Fau - King, D. S., King Ds Fau - Smart, B. P., Smart Bp Fau - Wu, P.,
Wu P Fau - Bertozzi, C. R., & Bertozzi, C. R. (2010). Targeted metabolic labeling of yeast N-glycans with
unnatural sugars. (1091-6490 (Electronic)).

Brockhausen, I., Ernst, B., Hart, G. W., & Sinay, P. (2000). Biosynthesis of the O-Glycan Chains of Mucins
and Mucin-Type Glycoproteins (Vol. 3). John Wiley and Sons, Inc.

123
Brown, J. R., Fuster, M. M., & Esko, J. D. (2003). Glycoside Primers and Inhibitors of Glycosylation.
Carbohydrate-Based Drug Discovery, 883-898. (Wiley Online Books)

Burkart, M. D., Vincent Sp Fau - Düffels, A., Düffels A Fau - Murray, B. W., Murray Bw Fau - Ley, S. V.,
Ley Sv Fau - Wong, C. H., & Wong, C. H. (2000). Chemo-enzymatic synthesis of fluorinated sugar
nucleotide: useful mechanistic probes for glycosyltransferases. (0968-0896 (Print)).

Bülow, H. E., & Hobert, O. (2006). The molecular diversity of glycosaminoglycans shapes animal
development. (1081-0706 (Print)).

Cejas, R. B., Lorenz, V., Garay, Y. C., & Irazoqui, F. J. (2019). Biosynthesis of O-N-acetylgalactosamine
glycans in the human cell nucleus. (1083-351X (Electronic)).

Choi, J. A.-O., Wagner Ljs Auid- Orcid: --- Fau - Timmermans, S. B. P. E., Timmermans, S., Malaker Sa
Auid- Orcid: --- Fau - Schumann, B., Schumann B Fau - Gray, M. A., Gray Ma Fau - Debets, M. F., . . .
Bertozzi, C. A.-O. (2019). Engineering Orthogonal Polypeptide GalNAc-Transferase and UDP-Sugar Pairs.
(1520-5126 (Electronic)).

Christianson, H. C., & Belting, M. (2014). Heparan sulfate proteoglycan as a cell-surface endocytosis
receptor. (1569-1802 (Electronic)).

Chuh, K. N., Batt, A. R., Zaro, B. W., Darabedian, N., Marotta, N. P., Brennan, C. K., . . . Pratt, M. A.-O.
(2017). The New Chemical Reporter 6-Alkynyl-6-deoxy-GlcNAc Reveals O-GlcNAc Modification of the
Apoptotic Caspases That Can Block the Cleavage/Activation of Caspase-8. (1520-5126 (Electronic)).

124
Chuh, K. N., Zaro Bw Fau - Piller, F., Piller F Fau - Piller, V., Piller V Fau - Pratt, M. R., & Pratt, M. R.
(2014). Changes in metabolic chemical reporter structure yield a selective probe of O-GlcNAc
modification. (1520-5126 (Electronic)).

Cole, C. M., Yang, J., Šečkutė, J., & Devaraj, N. K. (2013). Fluorescent live-cell imaging of metabolically
incorporated unnatural cyclopropene-mannosamine derivatives. (1439-7633 (Electronic)).

D. Burkart, M., P. Vincent, S., & Wong, C.-H. (1999). An efficient synthesis of CMP-3-fluoroneuraminic
acid. Chemical Communications(16), 1525-1526.

Darabedian, N., Gao, J., Chuh, K. N., Woo, C. M., & Pratt, M. R. (2018). The Metabolic Chemical Reporter
6-Azido-6-deoxy-glucose Further Reveals the Substrate Promiscuity of O-GlcNAc Transferase and
Catalyzes the Discovery of Intracellular Protein Modification by O-Glucose. (1520-5126 (Electronic)).

Darabedian, N., Yang, B., Ding, R., Cutolo, G., Zaro, B. W., Woo, C. M., & Pratt, M. R. (2018). O-
Acetylated Chemical Reporters of Glycosylation Can Display Metabolism-Dependent Background
Labeling of Proteins but Are Generally Reliable Tools for the Identification of Glycoproteins. (2296-2646
(Print)).

Debets, M. A.-O., Tastan, O. A.-O. X., Wisnovsky, S. P., Malaker, S. A.-O., Angelis, N. A.-O., Moeckl, L.
K. R., . . . Schumann, B. A.-O. (2020). Metabolic precision labeling enables selective probing of O-linked
N-acetylgalactosamine glycosylation. (1091-6490 (Electronic)).

Dehnert, K. W., Baskin Jm Fau - Laughlin, S. T., Laughlin St Fau - Beahm, B. J., Beahm Bj Fau - Naidu,
N. N., Naidu Nn Fau - Amacher, S. L., Amacher Sl Fau - Bertozzi, C. R., & Bertozzi, C. R. (2012). Imaging
the sialome during zebrafish development with copper-free click chemistry. (1439-7633 (Electronic)).

125

Dikiy, I., Clark, L. D., Gardner, K. H., & Rosenbaum, D. M. (2018). Isotopic Labeling of Eukaryotic
Membrane Proteins for NMR Studies of Interactions and Dynamics. (1557-7988 (Electronic)).

Dorfmueller, H. C., Borodkin Vs Fau - Blair, D. E., Blair De Fau - Pathak, S., Pathak S Fau - Navratilova,
I., Navratilova I Fau - van Aalten, D. M. F., & van Aalten, D. M. (2011). Substrate and product analogues
as human O-GlcNAc transferase inhibitors. (1438-2199 (Electronic)).

Douaiher, J., Succar, J., Lancerotto, L., Gurish, M. F., Orgill, D. P., Hamilton, M. J., . . . Stevens, R. L.
(2014). Development of mast cells and importance of their tryptase and chymase serine proteases in
inflammation and wound healing. (1557-8445 (Electronic)).

Dube, D. H., Prescher Ja Fau - Quang, C. N., Quang Cn Fau - Bertozzi, C. R., & Bertozzi, C. R. (2006).
Probing mucin-type O-linked glycosylation in living animals. (0027-8424 (Print)).

Eklund, L., Piuhola J Fau - Komulainen, J., Komulainen J Fau - Sormunen, R., Sormunen R Fau -
Ongvarrasopone, C., Ongvarrasopone C Fau - Fássler, R., Fássler R Fau - Muona, A., . . . Pihlajaniemi, T.
(2001). Lack of type XV collagen causes a skeletal myopathy and cardiovascular defects in mice. (0027-
8424 (Print)).

Feng, L., Hong S Fau - Rong, J., Rong J Fau - You, Q., You Q Fau - Dai, P., Dai P Fau - Huang, R., Huang
R Fau - Tan, Y., . . . Chen, X. (2013). Bifunctional unnatural sialic acids for dual metabolic labeling of cell-
surface sialylated glycans. (1520-5126 (Electronic)).

Ferrer, C. M., Sodi, V. L., & Reginato, M. J. (2016). O-GlcNAcylation in Cancer Biology: Linking
Metabolism and Signaling. (1089-8638 (Electronic)).

126

Fritz, T. A., Hurley Jh Fau - Trinh, L.-B., Trinh Lb Fau - Shiloach, J., Shiloach J Fau - Tabak, L. A., &
Tabak, L. A. (2004). The beginnings of mucin biosynthesis: the crystal structure of UDP-
GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferase-T1. (0027-8424 (Print)).

Funderburgh, J. L. (2002). Keratan sulfate biosynthesis. (1521-6543 (Print)).

Ge, Y. A.-O., Ramirez, D. A.-O., Yang, B. A.-O., D'Souza, A. A.-O., Aonbangkhen, C. A.-O., Wong, S.
A.-O., & Woo, C. A.-O. (2021). Target protein deglycosylation in living cells by a nanobody-fused split O-
GlcNAcase. (1552-4469 (Electronic)).

Gloster, T. M., Zandberg Wf Fau - Heinonen, J. E., Heinonen Je Fau - Shen, D. L., Shen Dl Fau - Deng,
L., Deng L Fau - Vocadlo, D. J., & Vocadlo, D. J. (2011). Hijacking a biosynthetic pathway yields a
glycosyltransferase inhibitor within cells. (1552-4469 (Electronic)).

Gross, B. J., Swoboda Jg Fau - Walker, S., & Walker, S. (2008). A strategy to discover inhibitors of O-
linked glycosylation. (1520-5126 (Electronic)).

Guan, W., Cai L Fau - Fang, J., Fang J Fau - Wu, B., Wu B Fau - George Wang, P., & George Wang, P.
(2009). Enzymatic synthesis of UDP-GlcNAc/UDP-GalNAc analogs using N-acetylglucosamine 1-
phosphate uridyltransferase (GlmU). (1364-548X (Electronic)).

Handel, T. M., Johnson Z Fau - Crown, S. E., Crown Se Fau - Lau, E. K., Lau Ek Fau - Proudfoot, A. E.,
& Proudfoot, A. E. (2005). Regulation of protein function by glycosaminoglycans--as exemplified by
chemokines. (0066-4154 (Print)).

127
Hang, H. C., & Bertozzi, C. R. (2005). The chemistry and biology of mucin-type O-linked glycosylation.
(0968-0896 (Print)).

Hang, H. C., Yu C Fau - Kato, D. L., Kato Dl Fau - Bertozzi, C. R., & Bertozzi, C. R. (2003). A metabolic
labeling approach toward proteomic analysis of mucin-type O-linked glycosylation. (0027-8424 (Print)).

Hao, Y., Fan, X., Shi, Y., Zhang, C., Sun, D. E., Qin, K., . . . Chen, X. A.-O. (2019). Next-generation
unnatural monosaccharides reveal that ESRRB O-GlcNAcylation regulates pluripotency of mouse
embryonic stem cells. (2041-1723 (Electronic)).

Heise, T., Pijnenborg, J. F. A., Büll, C., van Hilten, N., Kers-Rebel, E. D., Balneger, N., . . . Boltje, T. A.-
O. (2019). Potent Metabolic Sialylation Inhibitors Based on C-5-Modified Fluorinated Sialic Acids. (1520-
4804 (Electronic)).

Helenius, A., & Aebi, M. (2004). Roles of N-linked glycans in the endoplasmic reticulum. (0066-4154
(Print)).

Hevey, R. A.-O. (2019). Bioisosteres of Carbohydrate Functional Groups in Glycomimetic Design. LID -
10.3390/biomimetics4030053 [doi] LID - 53. (2313-7673 (Electronic)).

Hsu, T. L., Hanson Sr Fau - Kishikawa, K., Kishikawa K Fau - Wang, S.-K., Wang Sk Fau - Sawa, M.,
Sawa M Fau - Wong, C.-H., & Wong, C. H. (2007). Alkynyl sugar analogs for the labeling and visualization
of glycoconjugates in cells. (0027-8424 (Print)).

Iozzo, R. V. (1998). Matrix proteoglycans: from molecular design to cellular function. (0066-4154 (Print)).

128
Ishihara H Fau - Massaro, D. J., Massaro Dj Fau - Heath, E. C., & Heath, E. C. (1968). The metabolism of
L-fucose. 3. The enzymatic synthesis of beta-L-fucose 1-phosphate. (0021-9258 (Print)).

Jackson, E. G., Pedowitz, N. J., Pratt, M. R., & Barchi, J. J. (2021). 3.12 - Metabolic Engineering of
Glycans. In (pp. 275-287). Elsevier.

Jensen, P. H., Kolarich D Fau - Packer, N. H., & Packer, N. H. (2010). Mucin-type O-glycosylation--putting
the pieces together. (1742-4658 (Electronic)).

Joiner, C. M., Li, H., Jiang, J., & Walker, S. (2019). Structural characterization of the O-GlcNAc cycling
enzymes: insights into substrate recognition and catalytic mechanisms. (1879-033X (Electronic)).

Jonckheere, N., & Van Seuningen, I. (2010). The membrane-bound mucins: From cell signalling to
transcriptional regulation and expression in epithelial cancers. (1638-6183 (Electronic)).

Kayser, H., Zeitler R Fau - Kannicht, C., Kannicht C Fau - Grunow, D., Grunow D Fau - Nuck, R., Nuck
R Fau - Reutter, W., & Reutter, W. (1992). Biosynthesis of a nonphysiological sialic acid in different rat
organs, using N-propanoyl-D-hexosamines as precursors. (0021-9258 (Print)).

Keppler, O. T., Horstkorte R Fau - Pawlita, M., Pawlita M Fau - Schmidt, C., Schmidt C Fau - Reutter, W.,
& Reutter, W. (2001). Biochemical engineering of the N-acyl side chain of sialic acid: biological
implications. (0959-6658 (Print)).

King, D. T., Males, A., Davies, G. J., & Vocadlo, D. J. (2019). Molecular mechanisms regulating O-linked
N-acetylglucosamine (O-GlcNAc)-processing enzymes. (1879-0402 (Electronic)).

129
Kirkbride, K. C., Townsend Ta Fau - Bruinsma, M. W., Bruinsma Mw Fau - Barnett, J. V., Barnett Jv Fau
- Blobe, G. C., & Blobe, G. C. (2008). Bone morphogenetic proteins signal through the transforming growth
factor-beta type III receptor. (0021-9258 (Print)).

Kizuka, Y., Funayama, S., Shogomori, H., Nakano, M., Nakajima, K., Oka, R., . . . Taniguchi, N. (2016).
High-Sensitivity and Low-Toxicity Fucose Probe for Glycan Imaging and Biomarker Discovery. (2451-
9448 (Electronic)).

Korpetinou, A., Skandalis, S. S., Labropoulou, V. T., Smirlaki, G., Noulas, A., Karamanos, N. K., &
Theocharis, A. D. (2014). Serglycin: at the crossroad of inflammation and malignancy. (2234-943X (Print)).

Lairson, L. L., Henrissat B Fau - Davies, G. J., Davies Gj Fau - Withers, S. G., & Withers, S. G. (2008).
Glycosyltransferases: structures, functions, and mechanisms. (0066-4154 (Print)).

Laughlin, S. T., & Bertozzi, C. R. (2007). Metabolic labeling of glycans with azido sugars and subsequent
glycan-profiling and visualization via Staudinger ligation. (1750-2799 (Electronic)).

Lazarus, M. B., Jiang J Fau - Gloster, T. M., Gloster Tm Fau - Zandberg, W. F., Zandberg Wf Fau -
Whitworth, G. E., Whitworth Ge Fau - Vocadlo, D. J., Vocadlo Dj Fau - Walker, S., & Walker, S. (2012).
Structural snapshots of the reaction coordinate for O-GlcNAc transferase. (1552-4469 (Electronic)).

Lazarus, M. B., Nam Y Fau - Jiang, J., Jiang J Fau - Sliz, P., Sliz P Fau - Walker, S., & Walker, S. (2011a).
Structure of human O-GlcNAc transferase and its complex with a peptide substrate. (1476-4687
(Electronic)).

130
Lazarus, M. B., Nam Y Fau - Jiang, J., Jiang J Fau - Sliz, P., Sliz P Fau - Walker, S., & Walker, S. (2011b).
Structure of human O-GlcNAc transferase and its complex with a peptide substrate. (1476-4687
(Electronic)).

Levine, Z. G., & Walker, S. (2016). The Biochemistry of O-GlcNAc Transferase: Which Functions Make
It Essential in Mammalian Cells? (1545-4509 (Electronic)).

Lewis, K. A., Gray Pc Fau - Blount, A. L., Blount Al Fau - MacConell, L. A., MacConell La Fau - Wiater,
E., Wiater E Fau - Bilezikjian, L. M., Bilezikjian Lm Fau - Vale, W., & Vale, W. (2000). Betaglycan binds
inhibin and can mediate functional antagonism of activin signalling. (0028-0836 (Print)).

Li, J., Wang, J., Wen, L., Zhu, H., Li, S., Huang, K., . . . Wang, P. G. (2016). An OGA-Resistant Probe
Allows Specific Visualization and Accurate Identification of O-GlcNAc-Modified Proteins in Cells. (1554-
8937 (Electronic)).

Li, S., Wang, J., Zang, L., Zhu, H., Guo, J., Zhang, J., . . . Li, J. (2019). Production of Glycopeptide
Derivatives for Exploring Substrate Specificity of Human OGA Toward Sugar Moiety. (2296-2646 (Print)).

Lin, F. L., Hoyt Hm Fau - van Halbeek, H., van Halbeek H Fau - Bergman, R. G., Bergman Rg Fau -
Bertozzi, C. R., & Bertozzi, C. R. (2019). Mechanistic investigation of the staudinger ligation. (0002-7863
(Print)).

Liu, T. W., Zandberg, W. A.-O., Gloster, T. A.-O., Deng, L., Murray, K. D., Shan, X., & Vocadlo, D. A.-
O. (2018). Metabolic Inhibitors of O-GlcNAc Transferase That Act In Vivo Implicate Decreased O-
GlcNAc Levels in Leptin-Mediated Nutrient Sensing. (1521-3773 (Electronic)).

131
Luchansky, S. J., Goon S Fau - Bertozzi, C. R., & Bertozzi, C. R. (2004). Expanding the diversity of
unnatural cell-surface sialic acids. (1439-4227 (Print)).

Ma, X., Li, H., He, Y., & Hao, J. (2017). The emerging link between O-GlcNAcylation and neurological
disorders. (1420-9071 (Electronic)).

Ma, X., Liu P Fau - Yan, H., Yan H Fau - Sun, H., Sun H Fau - Liu, X., Liu X Fau - Zhou, F., Zhou F Fau
- Li, L., . . . Zhang, L. (2018). Substrate specificity provides insights into the sugar donor recognition
mechanism of O-GlcNAc transferase (OGT). (1932-6203 (Electronic)).

Ma, Z., & Vosseller, K. (2013). O-GlcNAc in cancer biology. (1438-2199 (Electronic)).

Macauley, M. S., Arlian, B. M., Rillahan, C. D., Pang, P. C., Bortell, N., Marcondes, M. C., . . . Paulson, J.
C. (2014). Systemic blockade of sialylation in mice with a global inhibitor of sialyltransferases. (1083-
351X (Electronic)).

Mahal, L. K., Charter Nw Fau - Angata, K., Angata K Fau - Fukuda, M., Fukuda M Fau - Koshland, D. E.,
Jr., Koshland De Jr Fau - Bertozzi, C. R., & Bertozzi, C. R. (2001). A small-molecule modulator of poly-
alpha 2,8-sialic acid expression on cultured neurons and tumor cells. (0036-8075 (Print)).

Mahal, L. K., Yarema Kj Fau - Bertozzi, C. R., & Bertozzi, C. R. (1997). Engineering chemical reactivity
on cell surfaces through oligosaccharide biosynthesis. (0036-8075 (Print)).

Maksimovic, I. A.-O., Zheng, Q. A.-O., Trujillo, M. N., Galligan, J. A.-O., & David, Y. A.-O. (2020). An
Azidoribose Probe to Track Ketoamine Adducts in Histone Ribose Glycation. (1520-5126 (Electronic)).

132
Martin, S. A.-O., Tan, Z. W., Itkonen, H. M., Duveau, D. Y., Paulo, J. A., Janetzko, J. A.-O., . . . Walker,
S. A.-O. X. (2018). Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors.
(1520-5126 (Electronic)).

Mathew, M. P., Tan E Fau - Shah, S., Shah S Fau - Bhattacharya, R., Bhattacharya R Fau - Adam Meledeo,
M., Adam Meledeo M Fau - Huang, J., Huang J Fau - Espinoza, F. A., . . . Yarema, K. J. (2012).
Extracellular and intracellular esterase processing of SCFA-hexosamine analogs: implications for
metabolic glycoengineering and drug delivery. (1464-3405 (Electronic)).

Mayer, A., Gloster Tm Fau - Chou, W. K., Chou Wk Fau - Vocadlo, D. J., Vocadlo Dj Fau - Tanner, M.
E., & Tanner, M. E. (2011). 6''-Azido-6''-deoxy-UDP-N-acetylglucosamine as a glycosyltransferase
substrate. (1464-3405 (Electronic)).

Mbua, N. E., Guo J Fau - Wolfert, M. A., Wolfert Ma Fau - Steet, R., Steet R Fau - Boons, G.-J., & Boons,
G. J. (2011). Strain-promoted alkyne-azide cycloadditions (SPAAC) reveal new features of glycoconjugate
biosynthesis. (1439-7633 (Electronic)).

Meldal, M., & Tornøe, C. W. (2008). Cu-catalyzed azide-alkyne cycloaddition. (1520-6890 (Electronic)).

Mitchell, M. L., Tian F Fau - Lee, L. V., Lee Lv Fau - Wong, C.-H., & Wong, C. H. (2002). Synthesis and
evaluation of transition-state analogue inhibitors of alpha-1,3-fucosyltransferase. (1433-7851 (Print)).

Morawski, M., Brückner G Fau - Arendt, T., Arendt T Fau - Matthews, R. T., & Matthews, R. T. (2012).
Aggrecan: Beyond cartilage and into the brain. (1878-5875 (Electronic)).

133
Neves, A. A., Stöckmann H Fau - Harmston, R. R., Harmston Rr Fau - Pryor, H. J., Pryor Hj Fau - Alam,
I. S., Alam Is Fau - Ireland-Zecchini, H., Ireland-Zecchini H Fau - Lewis, D. Y., . . . Brindle, K. M. (2011).
Imaging sialylated tumor cell glycans in vivo. (1530-6860 (Electronic)).

Nguyen, S. S., & Prescher, J. A. (2020). Developing bioorthogonal probes to span a spectrum of reactivities.
4(9), 476-489.

Niederwieser, A., Späte Ak Fau - Nguyen, L. D., Nguyen Ld Fau - Jüngst, C., Jüngst C Fau - Reutter, W.,
Reutter W Fau - Wittmann, V., & Wittmann, V. (2013). Two-color glycan labeling of live cells by a
combination of Diels-Alder and click chemistry. (1521-3773 (Electronic)).

Noguchi, M., Tanaka T Fau - Gyakushi, H., Gyakushi H Fau - Kobayashi, A., Kobayashi A Fau - Shoda,
S.-i., & Shoda, S. (2009). Efficient synthesis of sugar oxazolines from unprotected N-acetyl-2-amino sugars
by using chloroformamidinium reagent in water. (1520-6904 (Electronic)).

Norris, A. J., Whitelegge Jp Fau - Strouse, M. J., Strouse Mj Fau - Faull, K. F., Faull Kf Fau - Toyokuni,
T., & Toyokuni, T. (2004). Inhibition kinetics of carba- and C-fucosyl analogues of GDP-fucose against
fucosyltransferase V: implication for the reaction mechanism. (0960-894X (Print)).

O'Donnell, N., Zachara Ne Fau - Hart, G. W., Hart Gw Fau - Marth, J. D., & Marth, J. D. (2004). Ogt-
dependent X-chromosome-linked protein glycosylation is a requisite modification in somatic cell function
and embryo viability. (0270-7306 (Print)).

Okeley, N. M., Alley Sc Fau - Anderson, M. E., Anderson Me Fau - Boursalian, T. E., Boursalian Te Fau
- Burke, P. J., Burke Pj Fau - Emmerton, K. M., Emmerton Km Fau - Jeffrey, S. C., . . . Senter, P. D. (2013).
Development of orally active inhibitors of protein and cellular fucosylation. (1091-6490 (Electronic)).

134

Ortiz-Meoz, R. F., Jiang, J., Lazarus, M. B., Orman, M., Janetzko, J., Fan, C., . . . Walker, S. (2015). A
small molecule that inhibits OGT activity in cells. (1554-8937 (Electronic)).

Parker, C. G., & Pratt, M. R. (2020). Click Chemistry in Proteomic Investigations. (1097-4172
(Electronic)).

Patterson, D. M., Jones Ka Fau - Prescher, J. A., & Prescher, J. A. (2014). Improved cyclopropene reporters
for probing protein glycosylation. (1742-2051 (Electronic)).

Patterson, D. M., Nazarova La Fau - Prescher, J. A., & Prescher, J. A. (2014). Finding the right
(bioorthogonal) chemistry. (1554-8937 (Electronic)).

Patterson, D. M., Nazarova La Fau - Xie, B., Xie B Fau - Kamber, D. N., Kamber Dn Fau - Prescher, J. A.,
& Prescher, J. A. (2012). Functionalized cyclopropenes as bioorthogonal chemical reporters. (1520-5126
(Electronic)).

Pedowitz, N. J., & Pratt, M. R. (2021). Design and synthesis of metabolic chemical reporters for the
visualization and identification of glycoproteins. RSC Chemical Biology, 2(2), 306-321.

Pomin, V. H., & Mulloy, B. (2018). Glycosaminoglycans and Proteoglycans. (1424-8247 (Print)).

Prescher, J. A., & Bertozzi, C. R. (2006). Chemical technologies for probing glycans. (0092-8674 (Print)).

Prescher, J. A., Dube Dh Fau - Bertozzi, C. R., & Bertozzi, C. R. (2004). Chemical remodelling of cell
surfaces in living animals. (1476-4687 (Electronic)).

135

Qin, K., Zhang, H., Zhao, Z., & Chen, X. (2020). Protein S-Glyco-Modification through an Elimination-
Addition Mechanism. (1520-5126 (Electronic)).

Qin, W., Qin, K., Fan, X., Peng, L., Hong, W., Zhu, Y., . . . Chen, X. A.-O. (2018). Artificial Cysteine S-
Glycosylation Induced by Per-O-Acetylated Unnatural Monosaccharides during Metabolic Glycan
Labeling. (1521-3773 (Electronic)).

Rabinovich, G. A., van Kooyk Y Fau - Cobb, B. A., & Cobb, B. A. (2012). Glycobiology of immune
responses. (1749-6632 (Electronic)).

Rabuka, D., Hubbard Sc Fau - Laughlin, S. T., Laughlin St Fau - Argade, S. P., Argade Sp Fau - Bertozzi,
C. R., & Bertozzi, C. R. (2006). A chemical reporter strategy to probe glycoprotein fucosylation. (0002-
7863 (Print)).

Rillahan, C. D., Antonopoulos A Fau - Lefort, C. T., Lefort Ct Fau - Sonon, R., Sonon R Fau - Azadi, P.,
Azadi P Fau - Ley, K., Ley K Fau - Dell, A., . . . Paulson, J. C. (2012). Global metabolic inhibitors of sialyl-
and fucosyltransferases remodel the glycome. (1552-4469 (Electronic)).

Rodriguez, A. C., & Kohler, J. J. (2014). Recognition of diazirine-modified O-GlcNAc by human O-
GlcNAcase. (2040-2503 (Print)).

Rostovtsev, V. V., Green Lg Fau - Fokin, V. V., Fokin Vv Fau - Sharpless, K. B., & Sharpless, K. B. (2002).
A stepwise huisgen cycloaddition process: copper(I)-catalyzed regioselective "ligation" of azides and
terminal alkynes. (1433-7851 (Print)).

136
Row Rd Fau - Prescher, J. A., & Prescher, J. A.-O. (2018). Constructing New Bioorthogonal Reagents and
Reactions. (1520-4898 (Electronic)).

Sarkar, A. K., Fritz Ta Fau - Taylor, W. H., Taylor Wh Fau - Esko, J. D., & Esko, J. D. (1995). Disaccharide
uptake and priming in animal cells: inhibition of sialyl Lewis X by acetylated Gal beta 1-->4GlcNAc beta-
O-naphthalenemethanol. (0027-8424 (Print)).

Sawa, M., Hsu Tl Fau - Itoh, T., Itoh T Fau - Sugiyama, M., Sugiyama M Fau - Hanson, S. R., Hanson Sr
Fau - Vogt, P. K., Vogt Pk Fau - Wong, C.-H., & Wong, C. H. (2006
). Glycoproteomic probes for fluorescent imaging of fucosylated glycans in vivo. (0027-8424 (Print)).

Saxon, E., & Bertozzi, C. R. (2000). Cell surface engineering by a modified Staudinger reaction. (0036-
8075 (Print)).

Schimpl, M., Zheng X Fau - Borodkin, V. S., Borodkin Vs Fau - Blair, D. E., Blair De Fau - Ferenbach, A.
T., Ferenbach At Fau - Schüttelkopf, A. W., Schüttelkopf Aw Fau - Navratilova, I., . . . van Aalten, D. M.
(2012). O-GlcNAc transferase invokes nucleotide sugar pyrophosphate participation in catalysis. (1552-
4469 (Electronic)).

Schultz, V. L., Zhang, X., Linkens, K., Rimel, J., Green, D. E., DeAngelis, P. L., & Linhardt, R. A.-O.
(2017). Chemoenzymatic Synthesis of 4-Fluoro-N-Acetylhexosamine Uridine Diphosphate Donors: Chain
Terminators in Glycosaminoglycan Synthesis. (1520-6904 (Electronic)).

Schumann, B., Malaker, S. A., Wisnovsky, S. P., Debets, M. F., Agbay, A. J., Fernandez, D., . . . Bertozzi,
C. R. (2020). Bump-and-Hole Engineering Identifies Specific Substrates of Glycosyltransferases in Living
Cells. (1097-4164 (Electronic)).

137

Schwarz, F., & Aebi, M. (2011). Mechanisms and principles of N-linked protein glycosylation. (1879-033X
(Electronic)).

Shafi, R., Iyer Sp Fau - Ellies, L. G., Ellies Lg Fau - O'Donnell, N., O'Donnell N Fau - Marek, K. W., Marek
Kw Fau - Chui, D., Chui D Fau - Hart, G. W., . . . Marth, J. D. (2000). The O-GlcNAc transferase gene
resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny. (0027-
8424 (Print)).

Sharma, M., Bernacki Rj Fau - Paul, B., Paul B Fau - Korytnyk, W., & Korytnyk, W. (1990). Fluorinated
carbohydrates as potential plasma membrane modifiers. Synthesis of 4- and 6-fluoro derivatives of 2-
acetamido-2-deoxy-D-hexopyranoses. (0008-6215 (Print)).

Shen, D. L., Liu, T. W., Zandberg, W., Clark, T., Eskandari, R., Alteen, M. G., . . . Vocadlo, D. A.-O.
(2017). Catalytic Promiscuity of O-GlcNAc Transferase Enables Unexpected Metabolic Engineering of
Cytoplasmic Proteins with 2-Azido-2-deoxy-glucose. (1554-8937 (Electronic)).

Sinclair, D. A., Syrzycka M Fau - Macauley, M. S., Macauley Ms Fau - Rastgardani, T., Rastgardani T Fau
- Komljenovic, I., Komljenovic I Fau - Vocadlo, D. J., Vocadlo Dj Fau - Brock, H. W., . . . Honda, B. M.
(2009). Drosophila O-GlcNAc transferase (OGT) is encoded by the Polycomb group (PcG) gene, super sex
combs (sxc). (1091-6490 (Electronic)).

Singh, P. K., & Hollingsworth, M. A. (2006). Cell surface-associated mucins in signal transduction. (0962-
8924 (Print)).

138
Soares da Costa, D., Reis, R. L., & Pashkuleva, I. (2017). Sulfation of Glycosaminoglycans and Its
Implications in Human Health and Disorders. (1545-4274 (Electronic)).

Soriano Del Amo, D., Wang W Fau - Jiang, H., Jiang H Fau - Besanceney, C., Besanceney C Fau - Yan,
A. C., Yan Ac Fau - Levy, M., Levy M Fau - Liu, Y., . . . Wu, P. (2010). Biocompatible copper(I) catalysts
for in vivo imaging of glycans. (1520-5126 (Electronic)).

Späte, A. K., Bußkamp H Fau - Niederwieser, A., Niederwieser A Fau - Schart, V. F., Schart Vf Fau -
Marx, A., Marx A Fau - Wittmann, V., & Wittmann, V. (2014). Rapid labeling of metabolically engineered
cell-surface glycoconjugates with a carbamate-linked cyclopropene reporter. (1520-4812 (Electronic)).

Tabak, L. A. (2010). The role of mucin-type O-glycans in eukaryotic development. (1096-3634
(Electronic)).

Ten Hagen, K. G., Fritz Ta Fau - Tabak, L. A., & Tabak, L. A. (2003). All in the family: the UDP-
GalNAc:polypeptide N-acetylgalactosaminyltransferases. (0959-6658 (Print)).

Thoden, J. B., & Holden, H. M. (2005). The molecular architecture of human N-acetylgalactosamine kinase.
(0021-9258 (Print)).

Tian, E., & Ten Hagen, K. G. (2009). Recent insights into the biological roles of mucin-type O-
glycosylation. (1573-4986 (Electronic)).

Tian, L., Yang Y Fau - Wysocki, L. M., Wysocki Lm Fau - Arnold, A. C., Arnold Ac Fau - Hu, A., Hu A
Fau - Ravichandran, B., Ravichandran B Fau - Sternson, S. M., . . . Lavis, L. D. (2012). Selective esterase-
ester pair for targeting small molecules with cellular specificity. (1091-6490 (Electronic)).

139

Tornøe, C. W., Christensen C Fau - Meldal, M., & Meldal, M. (2002). Peptidotriazoles on solid phase:
[1,2,3]-triazoles by regiospecific copper(i)-catalyzed 1,3-dipolar cycloadditions of terminal alkynes to
azides. (0022-3263 (Print)).

Trapannone, R., Rafie, K., & van Aalten, D. M. (2016). O-GlcNAc transferase inhibitors: current tools and
future challenges. (1470-8752 (Electronic)).

Trinca, G. M., & Hagan, C. R. (2018). O-GlcNAcylation in women's cancers: breast, endometrial and
ovarian. (1573-6881 (Electronic)).

van Wijk, X. M., Lawrence, R., Thijssen, V. L., van den Broek, S. A., Troost, R., van Scherpenzeel, M., . .
. van Kuppevelt, T. H. (2015). A common sugar-nucleotide-mediated mechanism of inhibition of
(glycosamino)glycan biosynthesis, as evidenced by 6F-GalNAc (Ac3). (1530-6860 (Electronic)).

van Wijk, X. M., Thijssen, V. L., Lawrence, R., van den Broek, S. A., Dona, M., Naidu, N., . . . van
Kuppevelt, T. H. (2013). Interfering with UDP-GlcNAc metabolism and heparan sulfate expression using
a sugar analogue reduces angiogenesis. (1554-8937 (Electronic)).

Varki, A. (2008). Sialic acids in human health and disease. (1471-4914 (Print)).

Varki, A., Cummings, R. D., Esko, J. D., Stanley, P., Hart, G. W., Aebi, M., . . . ., P. H. S. (2015-2017).
Essentials of Glycobiology.

140
Varki A., C. R. D., Esko J.D., Stanley P., Hart G.W., Aebi M., Darvill A.G., Kinoshita T., Packer N.H.,
Prestegard J.H., Schnaar R.L., Seeberger P.H., editors. (2015-2017). Essentials of Glycobiology (3rd ed.).
Cold Spring Harbor Laboratory Press.

Vizcaíno, J. A., Deutsch, E. W., Wang, R., Csordas, A., Reisinger, F., Ríos, D., . . . Hermjakob, H. (2014).
ProteomeXchange provides globally coordinated proteomics data submission and dissemination. (1546-
1696 (Electronic)).

Vocadlo, D. J., Hang Hc Fau - Kim, E.-J., Kim Ej Fau - Hanover, J. A., Hanover Ja Fau - Bertozzi, C. R.,
& Bertozzi, C. R. (2003). A chemical approach for identifying O-GlcNAc-modified proteins in cells. (0027-
8424 (Print)).

Walter, L. A., Batt, A. R., Darabedian, N., Zaro, B. W., & Pratt, M. A.-O. (2018). Azide- and Alkyne-
Bearing Metabolic Chemical Reporters of Glycosylation Show Structure-Dependent Feedback Inhibition
of the Hexosamine Biosynthetic Pathway. (1439-7633 (Electronic)).

Wang, A. C., Jensen, E. H., Rexach, J. E., Vinters, H. V., & Hsieh-Wilson, L. C. (2016). Loss of O-GlcNAc
glycosylation in forebrain excitatory neurons induces neurodegeneration. (1091-6490 (Electronic)).

Wohnig, S., Spork, A. P., Koppermann, S. A.-O., Mieskes, G., Gisch, N., Jahn, R. A.-O., & Ducho, C. A.-
O. (2016). Total Synthesis of Dansylated Park's Nucleotide for High-Throughput MraY Assays. (1521-
3765 (Electronic)).

Worth, M., Hu, C. W., Li, H., Fan, D., Estevez, A. A.-O., Zhu, D., . . . Jiang, J. A.-O. (2019). Targeted
covalent inhibition of O-GlcNAc transferase in cells. (1364-548X (Electronic)).

141
Wu, H. A.-O., & Devaraj, N. A.-O. (2018). Advances in Tetrazine Bioorthogonal Chemistry Driven by the
Synthesis of Novel Tetrazines and Dienophiles. (1520-4898 (Electronic)).

Yang, X., & Qian, K. (2017). Protein O-GlcNAcylation: emerging mechanisms and functions. (1471-0080
(Electronic)).

Yu, S. H., Boyce M Fau - Wands, A. M., Wands Am Fau - Bond, M. R., Bond Mr Fau - Bertozzi, C. R.,
Bertozzi Cr Fau - Kohler, J. J., & Kohler, J. J. (2012). Metabolic labeling enables selective
photocrosslinking of O-GlcNAc-modified proteins to their binding partners. (1091-6490 (Electronic)).

Zachara, N. E. (2018). Critical observations that shaped our understanding of the function(s) of intracellular
glycosylation (O-GlcNAc). (1873-3468 (Electronic)).

Zandberg, W. F., Kumarasamy J Fau - Pinto, B. M., Pinto Bm Fau - Vocadlo, D. J., & Vocadlo, D. J. (2012).
Metabolic inhibition of sialyl-Lewis X biosynthesis by 5-thiofucose remodels the cell surface and impairs
selectin-mediated cell adhesion. (1083-351X (Electronic)).

Zaro, B. W., Batt, A. R., Chuh, K. N., Navarro, M. X., & Pratt, M. A.-O. (2017). The Small Molecule 2-
Azido-2-deoxy-glucose Is a Metabolic Chemical Reporter of O-GlcNAc Modifications in Mammalian
Cells, Revealing an Unexpected Promiscuity of O-GlcNAc Transferase. (1554-8937 (Electronic)).

Zaro, B. W., Yang Yy Fau - Hang, H. C., Hang Hc Fau - Pratt, M. R., & Pratt, M. R. (2011). Chemical
reporters for fluorescent detection and identification of O-GlcNAc-modified proteins reveal glycosylation
of the ubiquitin ligase NEDD4-1. (1091-6490 (Electronic)).

142
Zhai, Y., Liang M Fau - Fang, J., Fang J Fau - Wang, X., Wang X Fau - Guan, W., Guan W Fau - Liu, X.-
W., Liu Xw Fau - Wang, P., . . . Wang, F. (2012). NahK/GlmU fusion enzyme: characterization and one-
step enzymatic synthesis of UDP-N-acetylglucosamine. (1573-6776 (Electronic)).

Zhang, X., Green, D. E., Schultz, V. L., Lin, L., Han, X., Wang, R., . . . Linhardt, R. A.-O. (2017). Synthesis
of 4-Azido-N-acetylhexosamine Uridine Diphosphate Donors: Clickable Glycosaminoglycans. (1520-6904
(Electronic)).

Zhu, H., Aloor, A., Ma, C., Kondengaden, S. M., & Wang, P. G. (2020). Mass Spectrometric Analysis of
Protein Glycosylation. In Glycan-Based Cellular Communication: Techniques for Carbohydrate-Protein
Interactions (Vol. 1346, pp. 169-203). American Chemical Society.

143
Appendix A: NMR Spectra

144

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 12 13 14
f 1 ( ppm )
2 . 0 2
2 . 9 7
1 . 0 0
1 . 4 4
1 . 3 5
Compound 2.9 H
1
NMR of 4-Fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
OH
N
3
O

145

0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0
f 1 ( ppm )
Compound 2.9 C
13
NMR of 4-Fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
OH
N
3
O

146

- 2 9 0 - 2 7 0 - 2 5 0 - 2 3 0 - 2 1 0 - 1 9 0 - 1 7 0 - 1 5 0 - 1 3 0 - 1 1 0 - 9 0 - 7 0 - 5 0 - 3 0 - 1 0 1 0 3 0
f 1 ( ppm )
1 . 0 0
Compound 2.9 F
19
NMR of 4-Fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
OH
N
3
O

147

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4
f 1 ( ppm )
3 . 1 0
6 . 0 6
2 . 0 6
3 . 2 8
1 . 1 5
2 . 2 4
1 . 0 1
1 . 0 0
Compound 2.10 H
1
NMR of 1,3,6-Tri-O-acetyl-4-fluoro-N-azidoacetylglucosamine
O
NH
AcO
F OAc
OAc
N
3
O

148

- 10 0 10 20 30 40 50 60 70 80 90 100 1 10 120 130 140 150 16 0 1 70 180 190 200 210 220 230
f 1 ( ppm )
Compound 2.10 C
13
NMR of 1,3,6-Tri-O-acetyl-4-fluoro-N-azidoacetylglucosamine
O
NH
AcO
F OAc
OAc
N
3
O

149

- 290 - 270 - 250 - 230 - 210 - 190 - 170 - 150 - 130 - 1 10 - 90 - 70 - 50 - 30 - 10 10 30
f 1 ( ppm )
1 . 0 0
Compound 2.10 F
19
NMR of 1,3,6-Tri-O-acetyl-4-fluoro-N-azidoacetylglucosamine
O
NH
AcO
F OAc
OAc
N
3
O

150

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4
f 1 ( ppm )
0 . 6 8
2 . 8 3
0 . 6 4
1 . 2 3
2 . 3 5
1 . 6 9
1 . 0 0
Compound 2.11 H
1
NMR of 1-phosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OPO
3
-2

151

- 10 0 10 20 30 40 50 60 70 80 90 100 1 10 1 20 130 140 150 160 170 180 190 2 00 210 220 230
f 1 ( ppm )
Compound 2.11 C
13
NMR of 1-phosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OPO
3
-2

152

- 3 0 0 - 2 8 0 - 2 6 0 - 2 4 0 - 2 2 0 - 2 0 0 - 1 8 0 - 1 6 0 - 1 4 0 - 1 2 0 - 1 0 0 - 8 0 - 6 0 - 4 0 - 2 0 0 2 0
f 1 ( ppm )
1 . 0 0
Compound 2.11 F
19
NMR of 1-phosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OPO
3
-2

153

- 40 - 30 - 2 0 - 10 0 10 20 30 40 50 60 70 80 90 100 1 10 120 130 140 150 160 170 180 190
f 1 ( ppm )
1 . 0 0
Compound 2.11 P
31
NMR of 1-phosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OPO
3
-2

154

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4
f 1 ( ppm )
1 . 7 5
5 . 7 0
2 . 4 9
4 . 1 8
3 . 7 6
1 1 . 1 9
1 . 9 9
1 . 0 0
Compound 2.12 H
1
NMR of 1-uridine-diphosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OUDP

155

20 25 30 35 40 45 50 55 60 65 70 75 8 0 8 5 9 0 95 100 105 1 1 0
f 1 ( ppm )
Compound 2.12 C
13
NMR of 1-uridine-diphosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OUDP

156

- 2 9 0 - 2 7 0 - 2 5 0 - 2 3 0 - 2 1 0 - 1 9 0 - 1 7 0 - 1 5 0 - 1 3 0 - 1 1 0 - 9 0 - 7 0 - 5 0 - 30 - 10 10 30
f 1 ( ppm )
1 . 0 0
O
NH
HO
F OH
N
3
O
OUDP
Compound 2.12 F
19
NMR of 1-uridine-diphosphate-4-fluoro-N-azidoacetylglucosamine

157

- 4 0 - 3 0 - 2 0 - 1 0 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0
f 1 ( ppm )
0 . 8 5
1 . 0 0
Compound 2.12 P
31
NMR of 1-uridine-diphosphate-4-fluoro-N-azidoacetylglucosamine
O
NH
HO
F OH
N
3
O
OUDP

158

- 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4
f 1 ( pp m )
0 . 8 9
9 . 0 9
4 . 1 9
1 . 0 0
3 . 1 5
0 . 9 6
1 . 0 2
0 . 9 6
Compound 3.2 H
1
NMR of 2-pentynyl-(3,4,6-tri-O-acetyl-1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-oxazoline

159

1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 140 1 5 0 1 6 0 1 7 0
f 1 ( p pm )
Compound 3.2 C
13
NMR of 2-pentynyl-(3,4,6-tri-O-acetyl-1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-oxazoline

160

- 2 - 1 0 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14
f 1 ( p pm )
0 . 9 8
0 . 7 5
3 . 5 8
1 . 1 4
1 . 0 0
1 . 2 0
1 . 1 7
1 . 0 4
1 . 0 0
0 . 9 7
Compound 3.3 H
1
NMR of 2-pentynyl-(1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-2-oxazoline

161

- 10 0 10 20 30 40 50 60 70 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0 2 1 0 2 2 0 2 3 0
f 1 ( ppm )
Compound 3.3 C
13
NMR of 2-pentynyl-(1,2-dideoxy-α-D-glucopyrano)-[2,1-d]-2-oxazoline

162

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4
f 1 ( ppm )
2 . 9 9
2 . 0 6
0 . 7 7
2 . 0 5
4 . 1 6
2 . 1 8
1 . 0 9
1 . 1 5
2 . 0 9
1 . 0 0
Compound 3.4 H
1
NMR of β-1-butyryl-N-4-pentynyl-glucosamine

163

0 10 20 30 40 50 60 70 80 90 100 1 10 120 130 140 150 160 170 180
f 1 ( ppm )
Compound 3.4 C
13
NMR ofβ-1-butyryl-N-4-pentynyl-glucosamine

164

- 1 . 0 - 0 .5 0 .0 0 . 5 1 .0 1 .5 2 . 0 2 . 5 3 . 0 3 . 5 4 . 0 4 . 5 5 . 0 5 . 5 6 . 0 6 . 5 7 . 0
f 1 ( ppm )
3 . 1 6
2 . 2 4
2 . 1 4
0 . 9 5
0 . 7 3
1 . 9 3
4 . 3 3
0 . 7 9
0 . 8 4
1 . 1 3
1 . 8 3
0 . 9 9
1 . 1 3
0 . 8 8
1 . 2 1
1 . 0 0
Compound 3.5 H
1
NMR of β-1-valeroyl-N-4-pentynyl-glucosamine

165

- 1 0 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0 2 1 0 2 2 0 2 3 0
f 1 ( ppm )
Compound 3.5 C
13
NMR of β-1-valeroyl-N-4-pentynyl-glucosamine

166

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 12 13 14
f 1 ( ppm )
2 . 7 9
3 . 7 6
2 . 2 4
0 . 9 8
5 . 8 7
0 . 5 4
2 . 1 6
1 . 1 7
1 . 1 9
2 . 1 0
1 . 0 0
Compound 3.6 H
1
NMR of β-1-hexanoyl-N-4-pentynyl-glucosamine

167

-10 0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230
f1 (ppm)
Compound 3.6 C
13
NMR of β-1-hexanoyl-N-4-pentynyl-glucosamine

168

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 12 13 14
f 1 ( ppm )
2 . 7 8
3 . 8 5
1 . 9 1
2 . 8 3
3 . 2 3
2 . 1 3
2 . 0 7
1 . 0 7
1 . 3 6
1 . 9 3
0 . 9 2
0 . 8 2
Compound 3.9 H
1
NMR of β-1-hexanoyl-N-acetyl-glucosamine

169

- 1 0 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0 2 1 0 2 2 0 2 3 0
f 1 ( ppm )
Compound 3.9 C
13
NMR of β-1-hexanoyl-N-acetyl-glucosamine

170

- 2 - 1 0 1 2 3 4 5 6 7 8 9 10 1 1 1 2 1 3 1 4
f 1 ( ppm )
2 . 7 2
3 . 7 4
1 . 8 3
3 . 0 1
1 . 9 1
3 . 3 4
1 . 9 6
0 . 9 5
1 . 0 0
1 . 9 2
0 . 9 1
2 . 3 2
2 . 2 9
Compound 3.10 H
1
NMR of β-1-hexanoyl-6-O-p-methylbenzenesulfonate-N-acetyl-glucosamine

171

- 10 0 10 20 30 40 50 60 70 80 90 100 1 10 120 130 140 150 160 170 180 190 200 210 220 230
f 1 ( ppm )
Compound 3.10 C
13
NMR of β-1-hexanoyl-6-O-p-methylbenzenesulfonate-N-acetyl-glucosamine

172

- 2 - 1 0 1 2 3 4 5 6 7 8 9 10 1 1 1 2 1 3 1 4
f 1 ( ppm )
3 . 0 0
4 . 2 1
2 . 1 0
2 . 9 9
2 . 0 6
1 . 1 6
1 . 2 7
2 . 2 6
0 . 8 4
0 . 7 1
Compound 3.11 H
1
NMR of β-1-hexanoyl-6-azido-6-deoxy-N-acetyl-glucosamine

173

- 1 0 0 10 20 30 40 50 60 70 80 90 100 1 10 120 130 140 150 160 170 180 190 200 2 10 220 230
f 1 ( ppm )
Compound 3.11 C
13
NMR of β-1-hexanoyl-6-azido-6-deoxy-N-acetyl-glucosamine

174

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3
f 1 ( ppm )
1 2 . 2 1
1 . 2 0
6 . 4 2
3 . 0 9
2 . 5 5
2 . 4 7
2 . 8 8
1 . 0 2
1 . 0 1
2 . 1 7
0 . 5 9
0 . 9 6
0 . 9 8
Compound 4.2 H
1
NMR of 1,3,4-Tri-O-Acetyl-6-Tert-Butyldimethylsilyl-N-acetyl-4-pentynylglucosamine
O
OTBS
AcO
AcO
OAc
NH
O

175

0 10 20 30 40 5 0 60 7 0 80 9 0 1 0 0 1 1 0 1 2 0 1 3 0 1 4 0 1 5 0 1 6 0 1 7 0 1 8 0 1 9 0 2 0 0 2 1 0 2 2 0 2 3 0 2 4 0
f 1 ( pp m )
Compound 4.2 C
13
NMR of 1,3,4-Tri-O-Acetyl-6-Tert-Butyldimethylsilyl-N-acetyl-4-pentynylglucosamine
O
OTBS
AcO
AcO
OAc
NH
O

176

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3
f 1 ( pp m )
1 5 . 1 9
9 . 8 4
4 . 3 7
3 . 2 6
3 . 4 7
1 . 3 1
1 . 0 4
2 . 6 1
0 . 2 7
1 . 0 0
1 . 0 0
O
OTBS
AcO
AcO
OAc
NH
O
N
3
Compound 4.5 H
1
NMR of 1,3,4-Tri-O-Acetyl-6-Tert-Butyldimethylsilyl-N-azidoacetyl-glucosamine

177

- 10 0 10 20 30 40 50 60 70 80 90 100 1 1 0 120 130 140 150 160 170 180 1 90 200 210 220 230
f 1 ( ppm )
Compound 4.5 C
13
NMR of 1,3,4-Tri-O-Acetyl-6-Tert-Butyldimethylsilyl-N-azidoacetyl-glucosamine
O
OTBS
AcO
AcO
OAc
NH
O
N
3

178

- 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3
f 1 ( ppm )
2 . 9 4
1 . 1 3
2 . 3 1
2 . 2 3
1 . 0 5
2 . 2 1
1 . 0 0
3 . 3 1
2 . 1 9
Compound 4.7 H
1
NMR of 4,6-O-benzylidene-N-acetylglucosamine
O
OH
HO
NHAc
O
O
Ph

179

- 1 0 1 2 3 4 5 6 7 8 9 10 1 1 12 13
f 1 ( pp m )
3 . 0 3
3 . 1 8
3 . 1 8
3 . 4 3
1 . 0 8
1 . 2 9
1 . 0 9
1 . 1 1
1 . 1 7
1 . 2 2
1 . 0 0
3 . 7 3
2 . 5 0
Compound 4.8 H
1
NMR of 1,3-Di-O-acetyl 4,6-O-benzylidene-N-acetylglucosamine
O
OAc
AcO
NHAc
O
O
Ph

180

- 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3
f 1 ( pp m )
3 . 8 4
2 . 8 6
2 . 8 6
1 . 4 5
2 . 7 4
2 . 0 7
0 . 6 4
0 . 9 9
0 . 4 7
1 . 0 2
0 . 4 6
1 . 0 0
Compound 4.9 H
1
NMR of 1,3-Di-O-acetyl N-acetylglucosamine
O
OAc
OH
HO
AcO
NHAc

181

- 2 - 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3
f 1 ( pp m )
1 5 . 7 2
5 . 2 6
1 . 2 1
0 . 5 1
1 . 0 9
0 . 2 9
0 . 8 4
0 . 3 0
1 . 0 0
Compound 4.10 H
1
NMR of 1,3-Di-O-acetyl 6-Tert-butyldimethylsilyl N-acetylglucosamine
O
OAc
OTBS
HO
AcO
NHAc

182

-2 -1 0 1 2 3 4 5 6 7 8 9 10 11 12 13
f1 (ppm)
9 . 5 9
1 5 . 7 0
1 . 4 5
2 . 3 6
3 . 6 7
2 . 7 4
4 . 0 3
1 . 2 5
1 . 9 0
0 . 5 6
0 . 8 9
0 . 5 0
1 . 4 2
0 . 9 8
0 . 4 2
0 . 9 8
Compound 4.11 H
1
NMR of 1,3-Di-O-acetyl 4-Azido 6-Tert-butyldimethylsilyl N-acetylglucosamine
O
OAc
OTBS
AcO
NHAc
N
3

183

- 1 0 1 2 3 4 5 6 7 8 9 1 0 1 1 12 13
f 1 ( ppm )
4 . 3 6
5 . 6 4
6 . 9 8
4 . 0 9
0 . 9 2
1 . 0 9
1 . 0 0
Compound 4.12 H
1
NMR of 1,3,6-Tri-O-acetyl 4-Azido N-acetylglucosamine
O
OAc
OAc
AcO
NHAc
N
3

Abstract (if available)

Abstract Bioorthogonal chemistries have revolutionized many fields. For example, metabolic chemical reporters (MCRs) of glycosylation are analogs of monosaccharides that contain bioorthogonal functionality, like azides or alkynes. MCRs are metabolically incorporated into glycoproteins by living systems, and bioorthogonal reactions can be subsequently employed to install visualization and enrichment tags. Unfortunately, most MCRs are not selective for one class of glycosylation (e.g., N-linked vs. O-linked) and often non-enzymatically label cysteine residues, complicating the types of information that can be obtained. We and others have successfully created MCRs that are selective for intracellular O-GlcNAc modification by altering the structure of the MCR and thus biasing it to certain metabolic pathways and/or O-GlcNAc transferase (OGT). Here, we attempt to do the same for the core GalNAc residue of mucin O-linked glycosylation. The most widely applied MCR for mucin O-linked glycosylation, GalNAz, can be enzymatically epimerized at the 4-hydroxyl to give GlcNAz. This results in a mixture of cell-surface and O-GlcNAc labeling. We reasoned that replacing the 4-hydroxyl of GalNAz with a fluorine would lock the stereochemistry of this position in place, causing the MCR to be more selective. After synthesis, we found that 4FGalNAz labels a variety of proteins in mammalian cells and does not perturb endogenous glycosylation pathways unlike 4FGalNAc. However, through subsequent proteomic and biochemical characterization we found that 4FGalNAz does not widely label cell-surface glycoproteins but instead is primarily a substrate for OGT. We also report a solution in the synthesis and characterization of two reporter molecules functionalized at the anomeric position with hexanoic acid: 1-Hex-GlcNAlk and 1-Hex-6AzGlcNAc. Both reporters exhibit robust labeling over background with negligible amounts of non-specific chemical labeling in cell lysates. This strategy serves as a template for the design of future reporter molecules allowing for more reliable interpretation of results.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Optimization of chemical reporters of O-GlcNAc for improved specificity and metabolic mapping

PDF

Development of metabolic chemical reporters for the investigation of protein glycosylation

PDF

O-GlcNAc: development of new inhibitors and investigations into fibroblast contraction

PDF

Direct characterization of functional consequences of O-GlcNAc through protein semi-synthesis

PDF

Uncovering the protective role of protein glycosylation in Parkinson's disease utilizing protein semi-synthesis

PDF

Investigating the role of O-GlcNAcylation in α-synuclein aggregation

PDF

Chemical approaches to investigate O-GlcNAc effects in cellular stress responses

PDF

Development of bioorthogonal probes to reveal proteome modifications

PDF

Using chemistry to reveal the consequences of post translational modifications in cancer

PDF

Using chemical biology approaches to investigate the consequences of protein concentration and activity in cancer cells

PDF

Novel synthesis of β-glycosides for SPPS of GLCNAC glycoproteins and study of their site-specific biochemical and biophysical consequences

PDF

Developing and exploiting small molecules to study O-GlcNAc modification

PDF

Synthesis, characterization and application of chemical tools for investigating the role of O-GlcNAc modification in the development and survival of mammalian cells

PDF

Medicinal chemistry and chemical biology approaches to improve the selectivity and potency of kinase inhibitors

PDF

Development of selective covalent probes to identify and modulate protein targets

PDF

Exploring the structure of G protein-coupled receptors

PDF

Site-specific effects of ubiquitin and ubiquitin-like modifier proteins on α-synuclein aggregation

PDF

Reactivity-based chemical-genetic study of protein kinases

PDF

Adaptive metabolic strategies of Mycobacterium tuberculosis to combat stress from antibiotics and ROS

PDF

Chemical optimization and mechanistic investigation of small-molecule agents for long-term ex vivo expansion of granulocyte-monocyte progenitors

Asset Metadata

Creator Jackson, Emma Grace (author)

Core Title Chemical dissection of monosaccharide metabolic chemical reporter selectivity

Contributor Electronically uploaded by the author (provenance)

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Chemistry

Degree Conferral Date 2021-12

Publication Date 09/13/2021

Defense Date 08/09/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag bioorthogonal reactions,CuAAC,glycosaminoglycans,glycosylation,metabolic chemical inhibitors,metabolic chemical reporter,mucin-type glycosylation,OAI-PMH Harvest,O-GlcNAc

Format application/pdf (imt)

Language English

Advisor Pratt, Matthew (committee chair), Fokin, Valery (committee member), Goodman, Myron (committee member)

Creator Email emma.g.jackson18@gmail.com,emmajack@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15909837

Unique identifier UC15909837

Legacy Identifier etd-JacksonEmm-10054

Document Type Dissertation

Format application/pdf (imt)

Rights Jackson, Emma Grace

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu