Direct characterization of functional consequences of O-GlcNAc through protein semi-synthesis

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Request accessible transcript

Transcript (if available)

Content DIRECT CHARACTERIZATION OF FUNCTIONAL CONSEQUENCES OF
O-GLCNAC THROUGH PROTEIN SEMI-SYNTHESIS
by
Aaron John Tan Balana
A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CHEMISTRY)
December 2021
Copyright 2021 Aaron John Tan Balana
ii
Sugar we’re going down swinging.
F.O.B.
iii
Dedication

Because expressing gratitude is not enough,
I dedicate this and all past and future achievements
to Ricky, Ellen, Katrina, and Michael—
my living testaments of Divine, selfless,
and unconditional love and providence.

iv
Acknowledgments
I truly feel immensely fortunate to have undergone doctoral training in an era when scientific
communication and collaboration are as efficient and productive as can be. I owe a deep sense of
gratitude to technicians, graduate students, postdocs, and principal investigators who have directly
or indirectly contributed their expertise to the investigations detailed in this dissertation.
Collaborators for specific projects are henceforth mentioned within the footnotes of corresponding
chapters, but I also want to thank Dr. Shuxing Li (Nanobiophysics Core Facility), Dr. Matthew
Mecklenburg (Center for Nanoimaging), Dr. Terry Takahashi, Dr. Claire Cato and the Stevens
Lab, Dr. Garrett Gross and the Arnold Lab, Dr. Allan Kershaw, Michael Nonezyan, David Hong
(the FedEx guy), Magnolia Benitez, and Michele Dea—all of whom have been invaluable
resources during my time at USC. I also want to thank Silvia Cortes and Dr. Ansgar Siemer (USC-
HSC), Antonieta Salguero-Rivera and Dr. Phil Cole (Harvard), the lab of Dr. Kelvin Luk (UPenn),
the lab of Dr. Lorena Saelices (UT Southwestern), and the lab of Dr. Balyn Zaro (UC San
Francisco) for meaningful collaborations and consultations in other projects not included in this
manuscript. I also owe gratitude to my committee members Dr. Valery Fokin, and Dr. Megan
Fieser for their supervision, and most especially Dr. Peter Qin for being a constant day-to-day
resource for me within the TRF community, and Dr. Susan Forsburg for her efforts in bringing
together our T32 chemical biology interface cohort.
Looking back at how much I have learned in the last five years, I ascribe my achievements to those
who have taken the time and patience to impart knowledge and share their experiences upon me.
I want to thank Dr. Paul Levine, Dr. Kelly Chuh, Dr. Anna Batt, Dr. Cesar de Leon, and Dr. Narek
Darabedian for taking me, a wide-eyed and inexperienced student, under their tutelage. I have
aspired to pay it forward, hence teaching and mentorship have been an meaningful facet of my
graduate school experience. I want to thank my mentees Marisol and Mariana Navarro, John
Miggins, Andreas Langen as well as the other participants of the 2020 Undergraduate Chemical
Biology Workshop. I have learned a lot from teaching you, and I have so much pride and faith in
what you have achieved and what you will accomplish in the future. I also want to thank the Burg
Foundation, Dr. Thomas Bertolini, and the Chem322B Spring 2020 undergraduate students for the
opportunity to teach as a student lecturer. The experience of delivering large class lectures as well
as navigating the sudden adjustments required by the pandemic lockdown has really instilled a
confidence in my abilities as a communicator and educator.
I owe a great deal of appreciation and gratitude for the support of my community of Filipino
scientists who had been instrumental in the paradigm shift I underwent when deciding my career
path. As a pre-med undergraduate student, I was naively convinced that a medical doctorate is the
sole profession that would make the best use of my intellectual faculties. I am grateful to Dr. Noel
Quiming, Dr. Voltaire Organo, Dr. Maricon Carrillo, and the entire faculty of the Department of
Physical Sciences and Mathematics at the University of the Philippines Manila for recognizing my
potential and convincing me that research and teaching are fulfilling avenues through which I can
contribute to society. I am happy to have seen that they were right—I have yet to wake up to a day
when I regret the decision to defer my medical school slot, and at this point I’m almost certain that
day will not come. Likewise, I also want to thank my UP Manila friends around the world whom
I shared the experience of doing graduate school with: Paul Sanchez, Jojo Reyes, Dmitri Cordova,
Miguel de Jesus, Jireh Sacramento, Kevin Sison, Sarah Sibug, Jet Torres, Camille Trinidad, Bea
v
Parcutela, Fatsy Cruz, Edward Hilvano, Carmina Ladra, Jannelle Casanova, Marlon Duro,
Markville Bautista and many more. Thank you for being inspiring, affirming and encouraging; I
hope I have been these to you as well.
I constantly struggled with spending enough time to keep in touch with family and friends. In spite
of this, the warmth of their care never faltered, from the provisions and care packages, to rapidly-
organized reunions whenever geographically allowed. Many thanks too even for the sporadic
messages and small talks that assure me I have people who think about and care for me here in the
US and halfway across the globe. To my grandma, all my uncles, aunts, cousins, nieces, nephews,
and oldest of friends (Celina Penaflorida, Patrick Monfort, Micha Aldea, Iman Tagudina,
Catherine Tan, Janzy Maano, Kai Mendoza, among others)—thank you for not letting time nor
distance make strangers of us.
A well-known adage goes: “find something you love and you’ll never work a day in your life.”
This has really been my truth as a graduate student, thanks to the people I got to work with on a
daily basis. I thank the first of my US friends, Nicholas Bashian, Nikki Pedowitz, Emma Jackson,
Ben Fortman, Renata Miranda, and Bianca Espinosa for helping me learn and adjust to foreign
culture since way back when I was just a rotation student. When I joined the Pratt lab, it has served
as an incubator for scientific growth but also for a tremendous amount of emotional and personal
transformation. To everyone I’ve had the pleasure of working with in this lab, thank you for the
innumerable coffee breaks, Trader Joe’s runs, happy hours, brunch meals, KBBQ and hotpot
dinners, Wednesday Active People (W.A.P.) activities, seminars, conferences, movie and TV
show nights, parties, and glamping retreats we shared. I look forward to grander reunions and
reconnections in our future. I am especially fond of the generation of Pratt lab members I helped
mentor: Stuart Moon, Moira Morales, Afraah Javed, and Eldon Hard—thank you for the trust and
the respect, and most of all for making me feel younger than my age betrays. I am proud to have
had you as co-workers, and more importantly, friends.
Living in Los Angeles has been a crucial catalyst for my self-discovery and self-improvement.
This is where I (re)discovered my love for food, theater, film, photography, nature, music, fitness,
and social service. Here, I found a volleyball community who may have been oblivious to what I
do on a day-to-day basis, but have been instrumental to keeping my sanity. Here in LA, I have also
met the most well-rounded and most selfless people I have ever known, Bryce Tappan, Keying
Chen, Geo Rangel, with whom every moment spent is enriching and fulfilling and time unwasted.
I thank the city for bringing me these people, and these people for bringing me these experiences.
Finally, I want to thank Matt for being a one-of-a-kind advisor. I initially joined the lab completely
inspired but deeply intimidated by his scientific accomplishments. I am so fortunate to have
evolved this admiration to mentorship and friendship. There is so much to be grateful—for looking
at all my data good or bad, for taking my video calls outside work hours in order to troubleshoot
experiments, for arguing about protocols and criticizing papers, for writing manuscripts side-by-
side, for giving me independence in pursuing my own interests, for watching senseless movies and
videos, and even for worrying about my personal and health concerns. You have greatly shaped
how I do and think about science, but your impact on my life has stretched beyond that. Most of
all, I am grateful for the confidence you have in my talent, and I truly hope I can live up to it.
vi
Table of Contents

Epigraph ii
Dedication iii
Acknowledgments iv
List of Figures viii
Abstract x
Chapter 1: O-GlcNAcylated peptides and proteins for structural and functional studies 1
1.1 Introduction 1
1.2 Methods for the preparation of O-GlcNAc modified peptides and proteins 3
1.3 Synthetic polypeptides applied to the study of O-GlcNAc cycling enzymes 6
1.4 Structural and functional studies of O-GlcNAcylated substrates 11
1.5 Other applications for synthetic O-GlcNAc peptides 14
1.6 Conclusions 17
1.7 Chapter references 18

Chapter 2: O-GlcNAcylation of High Mobility Group Box 1 (HMGB1) alters its DNA
binding and DNA damage processing activities 32
2.1 Introduction 33
2.2 HMGB1 is endogenously O-GlcNAc-modified, and the major site of
modification is S100 35
2.3 Semi-synthesis of O-GlcNAc HMGB1(gS100) 38
2.4 O-GlcNAcylation at S100 reduces interaction with negatively supercoiled DNA 41
2.5 O-GlcNAcylation at S100 enhances HMGB1 oligomerization on four-way
junction and nucleosomal DNA 43
2.6 O-GlcNAcylation at S100 improves HMGB1 ability to circularize linear DNA 48
2.7 Loss-of-function O-GlcNAc mutant of HMGB1 at position 100 exhibits
altered biochemical behavior 51
2.8 O-GlcNAc modification of HMGB1 results in error-prone processing of DNA
lesions 53
2.9 Conclusions 57
2.10 Materials and methods 61
2.11 Chapter references 81

Chapter 3: Mechanistic roles for altered O-GlcNAcylation in neurodegenerative disorders 94
3.1 Introduction 94
3.2 Aberrant mechanisms in Alzheimer’s and Parkinson’s diseases 97
3.3 O-GlcNAc is a dynamic PTM that is essential for brain health but is
dysregulated in NDs 100
3.4 Tools for studying the mechanistic roles of O-GlcNAc 103
vii
3.5 O-GlcNAc is a multifaceted inhibitor of protein aggregation 108
3.6 Interplay with pathological phosphorylation 122
3.7 O-GlcNAc is synaptic health, vesicular transport and trafficking 127
3.8 O-GlcNAc and autophagy 129
3.9 O-GlcNAc and mitochondrial health 132
3.10 O-GlcNAc in inflammation and cell death 134
3.11 Conclusions 137
3.12 Chapter references 140

Chapter 4: O-GlcNAc modification of small heat shock proteins enhances their
anti-amyloid chaperone activity 188
4.1 Introduction 189
4.2 Synthesis of O-GlcNAc modified HSP27 193
4.3 O-GlcNAc improves HSP27 chaperone activity against α-synuclein amyloid
formation 195
4.4 O-GlcNAc modification is a conserved mechanism for sHSP activation
against α-synuclein amyloid formation 198
4.5 O-GlcNAc activates all three sHSPs against Aβ(1-42) amyloid formation 202
4.6 O-GlcNAc disrupts the ACD-IXI interaction and increases the size of HSP27
oligomers 206
4.7 Overall O-GlcNAc levels are reduced in Alzheimer’s disease but sHSP
modification is maintained or increased 210
4.8 Conclusions 212
4.9 Materials and methods 214
4.10 Chapter references 235

References 246

Appendices 325
Appendix A: Characterization of HMGB1 proteins 325
Appendix B: Regression fits of densitometry experiments 329
Appendix C: Characterization of small heat shock proteins 332

viii
List of Figures
Figure 1-1: O-GlcNAc modification and methods to prepare
site-specifically modified proteins 4
Figure 1-2: Structural characterization of O-GlcNAc transferase
(OGT) and O-GlcNAcase (OGA) 10
Figure 1-3: Protein synthesis for studying O-GlcNAc biochemistry 14
Figure 1-4: Determining O-GlcNAc stoichiometry using mass
shifting 16
Figure 2-1: HMGB1 is O-GlcNAc-modified at S100 and S107
in cells 37
Figure 2-2: Ser100 is at the HMGB1-DNA binding interface 38
Figure 2-3: Semi-synthesis of HMGB1(gS100) 40
Figure 2-4: S100 O-GlcNAcylation alters HMGB1 interactions
on supercoiled DNA 43
Figure 2-5: S100 O-GlcNAcylation alters HMGB1 oligomerization
on DNA 45
Figure 2-6: S100 O-GlcNAcylation alters HMGB1 ability
to circularize linear DNA 49
Figure 2-7: S100A mutation exhibits biochemical properties
distinct from unmodified or HMGB1(gS100) variants 52
Figure 2-8: Binding of HMGB1 variants to a 57-bp ICL-damaged
DNA substrate 53
Figure 2-9: O-GlcNAc modification of HMGB1 results in error-prone
processing of TFO-directed ICLs in human U2OS whole
cell extracts 55
Figure 3-1: Chemical approaches to decipher roles of O-GlcNAc in
Neurodegeneration 101
Figure 3-2: The process of protein aggregation 109
ix
Figure 3-3: O-GlcNAc is a multifaceted modulator of protein
Aggregation 121

Figure 3-4: O-GlcNAc influences multiple mechanisms in
neurodegeneration 136

Figure 4-1: O-GlcNAc modification and the small heat shock
proteins (sHSPs) 192

Figure 4-2: O-GlcNAcylated HSP27 is a better chaperone against
α-synuclein amyloid aggregation 194

Figure 4-3: O-GlcNAc neither improves nor diminishes the activity
of HSP27 against seeded α-synuclein aggregation 198

Figure 4-4: Synthetic route to O-GlcNAc αAC and αBC 199

Figure 4-5: O-GlcNAc improves the anti- α-synuclein chaperone
activity of αAC 200

Figure 4-6: O-GlcNAc improves the anti- α-synuclein chaperone
activity of αBC 201

Figure 4-7: O-GlcNAcylation is a global activator of HSP27,
αAC, and αBC chaperone activity against Aβ(1-42)
amyloid aggregation 203

Figure 4-8: Stoichiometry studies on the effect of O-GlcNAc on
HSP27 chaperone activity 205

Figure 4-9: O-GlcNAcylation blocks the IXI/ACD HSP27 domain-
Interaction and increases the size of HSP27 oligomers 207

Figure 4-10: Ab initio structure of wild-type HSP27 209

Figure 4-11: Global O-GlcNAc is lower in Alzheimer’s disease
But is increased or maintained on HSP27 and αBC 211

x
Abstract

O-GlcNAcylation is a uniquely dynamic form of protein glycosylation that involves the addition
of the monosaccharide N-acetylglucosamine (GlcNAc) onto serine/threonine hydroxyl moieties.
As a posttranslational modification (PTM) that is responsive to cellular milieu, O-GlcNAcylation
can impact the structure and function of target proteins under certain physiologically abnormal and
disease states. While diverse methods can probe variegated aspects of O-GlcNAcylation,
understanding how this PTM directly impacts its protein substrates can only be done through
careful preparation and testing of homogeneously modified proteins. To this end, protein ligation
techniques, specifically native chemical ligation (NCL) and expressed protein ligation (EPL),
prove useful for the preparation of site-specifically O-GlcNAcylated proteins. This work describes
the preparation of O-GlcNAc-modified variants of the high mobility group box 1 (HMGB1)
protein as well as members of the small heat shock protein (sHSP) family namely heat shock
protein 27 (HSP27), and alpha crystallins A and B (αAc and αBc, respectively). Through
subsequent in vitro biochemistry, it is demonstrated that O-GlcNAc can alter endogenous functions
of proteins and can modulate of protein-DNA and protein-protein interactions. These biochemical
findings illustrate potential relevance and role of this modification in cancer biogenesis and
neurodegeneration, highlighting the utility of protein semi-synthesis as a chemical tool that can
provide valuable insight into biological problems.
1
Chapter 1: O-GlcNAcylated peptides and proteins for structural and
functional studies*

O-GlcNAcylation is an enzymatic post-translational modification occurring in hundreds of protein
substrates. This modification occurs through the addition of the monosaccharide N-
acetylglucosamine to serine and threonine residues on intracellular proteins in the cytosol, nucleus,
and mitochondria. As a highly dynamic form of modification, changes in O-GlcNAc levels
coincide with alterations in metabolic state, the presence of stressors, and cellular health. At the
protein level, the consequences of the sugar modification can vary, thus necessitating biochemical
investigations on protein-specific and site-specific effects. To this end, enzymatic and chemical
methods to “encode” the modification have been developed and the utilization of these synthetic
glycopeptides and glycoproteins has since been instrumental in the discovery of the mechanisms
by which O-GlcNAcylation can affect a diverse array of biological processes.

1.1 Introduction
O-GlcNAcylation is a post-translational modification (PTM) of intracellular proteins
wherein the protein is attached to a monomer of 𝛽-N-acetylglucosamine (GlcNAc) through the
side chains of serine and threonine residues (Figure 1-1a). Akin to protein phosphorylation, this
modification is highly dynamic. Throughout a substrate’s lifetime, O-GlcNAc can be added and
removed cyclically by O-GlcNAc transferase (OGT) and O-GlcNAc hydrolase (OGA),
respectively. OGT relies on its catalytic region, comprised of its N-Cat and C-Cat domains, for its
_________________________

*Stuart Moon (University of Southern California) contributed to the writing of this review chapter.
2
transferase activity, while its interactions with substrates are mediated by a number of
tetratricopeptide repeat (TPR) domains. OGA contains an N-terminal catalytic glycoside hydrolase
domain fused by a stalk domain to a pseudo histone acetyltransferase (HAT) domain (Joiner, Li,
et al., 2019). The levels of O-GlcNAc are highly responsive to the metabolic state of the cell
because OGT uses the high-energy UDP-GlcNAc donor which is produced via the hexosamine
biosynthetic pathway, intimately linking global O-GlcNAc levels to the metabolic state of the cell
(Walgren et al., 2003). The disease state of the cell also impacts global O-GlcNAcylation as
evidenced by the detection of perturbed modification levels in many cancers and
neurodegenerative diseases (Z. Ma et al., 2013; Pinho et al., 2019). This modification imparts its
functional effects on substrates in a variety of ways dependent on the protein’s biochemical and
biophysical properties. By competing with phosphorylation on the same Ser/Thr residues, O-
GlcNAcylation can modulate protein function through PTM cross-talk (Hart et al., 2011). The
modification can also have profound effect on the protein-protein interactions of its substrates
(Tarbet et al., 2017).

This review seeks to consolidate current literature concerning the site-specific effects of
protein O-GlcNAcylation. We first present an overview of various techniques used to precisely
encode the PTM onto polypeptides. Then, we review studies that use these modified polypeptides
to examine the structure and function of OGT and OGA. We then summarize research by our lab
and others into the biochemistry and biophysics of O-GlcNAc modified proteins. Finally, we
highlight where the properties of O-GlcNAc have been exploited in non-native contexts.

3
1.2 Methods for the preparation of O-GlcNAc modified peptides and proteins
The earliest method described to produce highly homogeneous O-GlcNAcylated
polypeptides involves the enzymatic modification of protein substrates using in vitro reactions
with purified OGT (Lubas & Hanover, 2000). Originally this technique involved the expression
and purification of OGT and a putative substrate protein and their subsequent in vitro incubation.
This approach proved useful on a variety of peptide and protein substrates and led to the
characterization of the kinetic parameters for OGT’s variable catalytic activities towards different
substrates (Shen et al., 2012); however, it requires the relatively difficult expression and refolding
of OGT. As an alternative, a OGT and substrate co-expression approach was developed to work
in culture in E. coli (Lim et al., 2002) and eukaryotic systems (Rexach et al., 2010) where both
proteins are expressed prior to a single lysis and isolation step. Further optimizations (Han et al.,
2015) led to improved efficiency and yield of protein expression and modification stoichiometry.
More recently, the E. coli system also incorporated overexpression of hexosamine biosynthetic
pathway enzymes GlmM and GlmU for better UDP-GlcNAc availability required during in vivo
OGT modification (Gao et al., 2018).

The major downsides to these enzymatic modification approaches is the resulting
heterogeneity of the protein product and the presence of remaining unmodified substrate. The
addition of O-GlcNAc by OGT is substoichiometric leading to varying levels of non-incorporation
depending on protein substrate. While the completeness of the in vitro modification can be pushed
with longer incubation, less stable proteins can degrade, precipitate, or lose activity with extended

4

Figure 1-1. O-GlcNAc modification and methods to prepare site-specifically modified
proteins. a) O-GlcNAc modification is the dynamic addition of N-acetylglucosamine to
serine/threonine side-chains of intracellular proteins. b) Posttranslational mutagenesis can be used
to transform a cysteine residue into an S-linked analog of O-GlcNAc. c) Solid-phase peptide
synthesis used alone or in combination with protein ligation techniques can be used to prepare O-
GlcNAc modified peptides and proteins.
5
reaction times. In co-expression systems, the modification can also be removed by endogenous
glycosidases (Goodwin et al., 2013) further contributing to lower modification efficiencies.
Another source of heterogeneity stems from the fact that for a number of known substrates, OGT
can modify multiple serine and threonine modification sites within the protein sequence.
Enzymatic approaches hence result in a mixture of unmodified, singly- and multiply-modified
proteins that are ultimately challenging to purify as the sugar modification does minimal alteration
to the protein’s size, polarity, or charge.

Hence for investigations requiring highly homogeneous and site-specifically O-GlcNAc
modified peptides or proteins, chemical methods have proven to be more useful. One proposed
method is posttranslational mutagenesis which involves the chemoselective installation of the
GlcNAc sugar onto engineered dehydroalanine residues on a target protein (Chalker et al., 2012)
(Figure 1-1b). While this method is arguably the simplest and most straightforward way to install
the modification, it does not perfectly recapitulate O-GlcNAc modification as the sugar is linked
either through a cysteine thio-linkage (Lercher et al., 2015) or a homohomoserine O-
linkage(Wright et al., 2016) that is one carbon longer than found in nature. Most importantly,
posttranslational mutagenesis causes racemization at the α-carbon generating an often inseparable
mixture of diastereomer that may have different biochemistry.

The only method for site-specific and homogeneous O-GlcNAc modification of
polypeptides, to date, is the installation of sugar-modified amino acid building blocks during solid
phase peptide synthesis (Figure 1-1c). These O-GlcNAcylated Fmoc-serine or threonine
monomers can be prepared using a variety of available synthetic routes (De Leon et al., 2018), but
6
are also conveniently available for purchase from commercial sources. To overcome the size
limitations of peptide synthesis, chemical ligation techniques have also been employed to
synthesize longer polypeptides or full-length proteins (Figure 1-1c). The gold standard in the field
is native chemical ligation (NCL), which involves the reaction of a peptide C-terminal thioester
with an N-terminal cysteine containing peptide resulting in the formation of the native amide bond
(Dawson et al., 1994). An extension of this technique, expressed protein ligation (EPL), enables
the recombinant production of protein C-terminal thioesters, dramatically extending the scope of
this approach (Muir et al., 1998). As a robust and flexible techniques, NCL/ EPL have been the
most widely used method to prepare a number of site-specifically O-GlcNAc-modified full-length
proteins.

1.3 Synthetic polypeptides applied to the study of O-GlcNAc cycling enzymes
A composite model of the full-length human OGT was determined in 2011 both as a binary
complex with UDP, and in a ternary complex with a casein kinase II-derived peptide substrate
(Lazarus et al., 2011) (Figure 1-2a). For this structure, a truncated version of the enzyme with 4.5
of the 13 TPRs was used during the crystallization experiments and the TPR region was modeled
in from a separate structure (Jínek et al., 2004). Although complex formation with the UDP-
GlcNAc sugar donor was also attempted in this work, the hydrolysis of the sugar precluded the
crystallization process. In order to include the sugar moiety in the structural characterization, an
O-GlcNAcylated peptide from substrate TAB1 was used (Schimpl et al., 2012). Alternatively, the
use of a 5S-GlcNAc sugar analog previously shown to inhibit OGT activity (Gloster et al., 2011)
enabled successful crystallization of complexes of OGT with UDP-5SGlcNAc and various
substrate peptides (Lazarus et al., 2012, 2013; Schimpl et al., 2012). In these experiments,
7
obtaining a crystal structure in the presence of synthetic peptide substrates was important in
characterizing the distinct binding modes of OGT as it reveals the peptide-binding cleft not seen
in the OGT-UDP or OGT-UDP-5SGlcNAc complexes.

While these structures definitively describe the UDP-GlcNAc binding pocket and the
catalytic residues, the basis for how OGT recognizes its peptide substrates is less understood.
Given that OGT does not appear to have a strict sequence preference for residues near the
serine/threonine acceptor site, cataloging its substrates (Chalkley et al., 2009) has been a useful
approach to determine potential contributing factors for recognition. Through in vitro modification
of a 720-member synthetic peptide library (Pathak et al., 2015), it was demonstrated that there is
some degree of amino acid preference at the -3 to 2 sites of the peptide, suggesting that OGT’s
catalytic domain surrounding this substrate region imposes some selectivity constraints. This
peptide library modification approach was also miniaturized to a microarray format (Shi et al.,
2016) for high-throughput identification of novel OGT substrates. Also contributing to substrate
recognition is the participation of the TPR region where the extended TPR interacts with the
solvent-exposed region of protein substrates through a “ladder” of asparagine residues (Clarke et
al., 2008; Rafie et al., 2017). This was corroborated in a microarray analysis of >6000 proteins
showing that asparagine-to-alanine mutations in the TPR ladder results in retention OGT activity
in shorter peptides but not full-length proteins (Z. G. Levine et al., 2018). Moreover, a similar
protein microarray analysis was also utilized to demonstrate that additional aspartic acid residues
in the TPR also contribute to substrate recognition (Joiner, Levine, et al., 2019).

8
Knowledge of OGT’s catalytic site was used to guide the development of small molecule
OGT inhibitors through 5S-GlcNAc derivatization (T.-W. W. Liu et al., 2018; Worth et al., 2019)
or structure-guided medicinal chemistry (Y. Liu et al., 2017; Martin et al., 2018). In addition,
synthetic peptides have also been proposed as OGT inhibitors. Noting that the sugar moiety in
UDP-GlcNAc does not contribute to its binding to OGT, a short peptide with an acceptor serine
was linked directly to UDP with a carbon chain tether (Borodkin et al., 2014). Termed goblins
(OGT bisubstrate-linked inhibitors), these bisubstrate-peptide conjugates were able to inhibit
OGT activity, albeit having lower affinities compared to small molecule inhibitors. By replacing
the serine with cysteine in the peptide portion to generate S-linked UDP-peptide conjugates, a
newer generation of goblins was developed with improved affinities comparable to the best
performing OGT inhibitors (Rafie et al., 2018); however, their bi-substrate nature yields poor cell
permeability. Another modification on this approach removed the diphosphate of UDP as a
strategy to improve cellular permeability leading to peptides conjugated to uridine-like scaffolds
with some inhibitory activity but relatively weak affinity (Zhang et al., 2018).

For structural studies on OGA, three separate groups concurrently published similar apo
and inhibitor-bound crystal structures (Elsen et al., 2017; Li, Li, Lu, et al., 2017; Roth et al., 2017).
Both groups utilized truncated versions of OGA that lack the C-terminal HAT domain of yet
unknown significance for its activity. These structures show a homodimeric configuration where
the stalk domain of one OGA molecule is enclosed by the alpha helical barrel of the catalytic
domain of the sister molecule. This interface appears to form the substrate-binding cleft as the co-
crystal with the transition state analog inhibitor Thiamet-G (Yuzwa et al., 2008) shows the
pyranose ring of the inhibitor sitting at this interface. In addition to the inhibitor-bound structure,
9
Li et. al. also obtained a crystal structure of an O-GlcNAcylated p53 peptide bound to catalytically-
inactive OGA (Figure 1-2b). This structure identified multiple key residues that strongly interacted
with the GlcNAc moiety as well as a hydrophobic substrate cleft that contributes to the p53 peptide
side chain recognition. Interestingly, later co-crystallization experiments of OGA with four other
glycopeptides (Li, Li, Hu, et al., 2017) revealed that while the GlcNAc conformation generally
remains the same, the different peptides can be bound in a variety of modalities, rationalizing
OGA’s adaptability to deglycosylate a diverse array of sequences.

A recent development in the field is the discovery that cysteine residues can also undergo
enzymatic GlcNAc modification to form thio-linked S-GlcNAc sites. Notably, S-GlcNAcylation
was previously proposed as an artificial strategy to prepare metabolically stable GlcNAc modified
peptides and proteins (Ohnishi et al., 2000; Tarrant et al., 2012). Through a proteomics approach,
S-GlcNAcylation was shown to occur in living systems while in vitro OGT modification of
substrate peptides whose serine acceptors were replaced with cysteines confirmed that this process
occurs enzymatically (Maynard et al., 2016). With the use of an S-GlcNAcylated synthetic peptide
and a semi-synthetic protein, the stability of this modification towards human OGA removal was
demonstrated in in vitro hydrolysis experiments (De Leon et al., 2017). Computational and
biochemical analyses were also used to demonstrate that S-GlcNAc is a suitable structural and
functional mimic for O-GlcNAc, at least in certain cases. This mimetic approach was later used to
study the consequence of Ser-405 O-GlcNAc modification in OGA (Gorelik et al., 2019). An OGA
peptide bearing a cysteine GlcNAc modification was similarly found to be more stable in in vitro
hydrolysis experiments with bacterial CpOGA compared to its O-GlcNAc counterpart. Genetically
converting OGA’s serine-405 to cysteine in mammalian cells through CRISPR technology showed
10
that in vivo S-GlcNAcylation results in higher modification stoichiometry as a consequence of its
nonhydrolyzable nature, with a level of upregulation equivalent to OGA chemical inhibition.
Importantly, this genetic substitution led to the discovery that GlcNAc modification at position
405 reduces OGA’s stability and half-life compared to the unmodified enzyme.

Figure 1-2. Structural characterization of O-GlcNAc transferase (OGT) and O-GlcNAcase
(OGA). Synthetic (glyco)peptides played key roles in helping determine the biochemistry of OGT
and OGA using structural biology.
11
1.4 Structural and functional studies of O-GlcNAcylated substrates
O-GlcNAc can influence its substrates through its interplay with protein phosphorylation.
The first semi-synthetic O-GlcNAcylated protein was generated using SPPS and EPL to study this
cross-talk in the context of kinase CK2 (Tarrant et al., 2012). In this case, the authors took
advantage of the O- to S-substitution mentioned above to produce a stable O-GlcNAc mimic for
cell microinjection studies. They showed that phosphorylation at T344 improved the stability of
the protein, and that S-GlcNAcylation at S347 block the endogenous phosphorylation at T344,
resulting in CK2 degredation. Additionally, the presence of the glycan lead to an altered kinase
substrate profile compared to wild-type and phosphorylated variants, presumably via contacts with
CK2 substrates. To further study the cross-talk between these PTMs, the Pieters lab developed a
synthetic peptide microarray to identify peptides that could be modified by both Jak2 and OGT
(Sharif et al., 2019; Shi et al., 2017). They discovered that the phosphorylation (pY364) of a
peptide corresponding to ZO-3 significantly impeded its O-GlcNAcylation (gS369) due to
disruption of peptide-OGT contacts, whereas the inverse was not found to be true. A further study
added to this finding by showing that phosphorylation of the ZO-3 peptide inhibited O-GlcNAc
hydrolysis by OGA, while dephosphorylation was only slightly impacted by the presence of the
glycan. With these findings and their own, Leney and coworkers used kinetic-based mass
spectrometry assays to determine and validate a specific cross-talk motif: (pS/pT)P(V/A/T)(gS/gT)
(Leney et al., 2017). This motif is highly identified in the phosphoproteome, and it can be used to
identify putative O-GlcNAcylation sites, particularly those with the potential for phosphorylation
interplay.

12
Additionally, O-GlcNAc modification can also impart its functional effects by positively
or negatively influencing the abilities of its substrates to interact with their binding partners. The
Davis lab studied these consequences on histone stability and function (Lercher et al., 2015; Raj
et al., 2016). Semisynthetic O-GlcNAcylated histones were generated by expressing H2A or H2B
with a cysteine mutations capable of conversion to dehydroalanine before introduction of an S-
GlcNAc monomer via a Michael addition (Figure 1-3a). Glycosylation of H2A at T101
destabilizes its interaction with H2B, while modification of H2B's S112 recruits the FACT
complex, both of which significantly aid in transcription elongation. The Boyce group, attempting
to determine protein interactors with O-GlcNAc with synthetic, OGT-treated, biotinylated
peptides, identified the 14-3-3 family of proteins (Toleman et al., 2018). Further structural studies
showed that this interaction is mediated through extensive hydrogen bonding between the glycan
and 14-3-3 isoform binding pockets. Two of our own recent studies also examine interactions
impacted by O-GlcNAc modification. In our study of the O-GlcNAc modification of caspase-8,
we generated O-GlcNAc-modified peptides derived from the sequences surrounding the protein’s
self-cleavage/activation sites (Chuh et al., 2017). O-GlcNAcylated peptides were significantly
resistant to active caspase-8 cleavage, presumably via the obscuring of the cleavage sites by the
glycans. We also used SPPS and EPL to generate 𝛼-synuclein variants modified at T72 and at T87
and studied their interactions with the protease calpain (P. M. Levine et al., 2017). The presence
of these glycans modified calpain binding as evidenced by changes in cleavage sites: both
modifications obviated nearby cleavage sites, while glycosylation at T72 resulted in the
appearance of a new cleavage site, implying that this modification both stabilizes and destabilizes
different protein-protein interactions simultaneously.

13
A particularly important facet of these interaction effects is their implications in
neurodegenerative disorders. A number of identified O-GlcNAcylation substrates participate in
amyloidogenic pathways, often with the modification imparting anti-amyloid effects. One such
protein is tau, the aggregation of which leads to Alzheimer’s disease pathology. Frenkel-Pinter et
al. used SPPS to construct O-GlcNAc-modified peptides corresponding to PHF6, a hexamer
required for tau oligomer formation (Frenkel-Pinter et al., 2018). These modified peptides
aggregated to a far lesser degree than the unmodified control peptides, and, more importantly,
inhibited the aggregation extent and kinetics of unmodified peptides in co-aggregation
experiments. Further, the Hackenberger group has also used SPPS, NCL, and EPL to generate
S400-glycosylated tau, which can be used to study the PTM’s effect on aggregation using a full-
length variant (Schwagerus et al., 2016) (Figure 1-3b). Our group has also studied the aggregatory
effects of O-GlcNAcylation of 𝛼-synuclein, the Parkinson’s disease analog of tau. Recently, we
used EPL and SPPS to construct full-length, O-GlcNAcylated variants of ɑ-synuclein (gT72,
gT75, gT81, gT87, and triply-modified gT72/gT75/gT81) and used these proteins to show that O-
GlcNAc modification is extremely inhibitory to the aggregation process, but to site-dependent
extents (P. M. Levine, Galesic, et al., 2019; Lewis et al., 2017; Marotta et al., 2015). Also, we
showed that these PTMs can alter the architecture of the aggregates that form and can also impact
their relative cytotoxicity in primary neurons. These effects are presumably due to the hydrophilic
glycan’s disruption of the hydrophobic interactions required for aggregation.
14

Figure 1-3. Protein synthesis for studying O-GlcNAc biochemistry. a) Posttranslational
mutagenesis was used to install O-GlcNAc analogs onto the the histone proteins H2A and H2B,
allowing the effects of site-specific O-GlcNAc on nucleosome biology. b) Protein ligation was
used to generate O-GlcNAc modified versions of α-synuclein, showing that these glycans have
site-specific effects on amyloid formation. The synthesis of α-synuclein with O-GlcNAc at
threonine 72 is shown as an example.

1.5 Other applications for synthetic O-GlcNAc peptides
While various chemical and biological methods have been developed for the detection,
enrichment, and identification of O-GlcNAc substrates, the most convenient and highly used
technique is through the use of antibodies during Western blotting, immunoprecipitation, ELISAs,
or tissue staining(J. Ma & Hart, 2014). A number of these antibodies are pan-selective and are able
to recognize GlcNAc regardless of the protein sequence or identity (Tashima & Stanley, 2014).
For the production of such antibodies, various antigens have been used during immunization
including nuclear pore complex fractions(Snow et al., 1987) or synthetic glycopeptides (Comer et
al., 2001; Teo et al., 2010). Unfortunately, some of these antibodies suffer from selectivity by
15
cross-reacting with terminal residues in complex glycans(J. Ma & Hart, 2014). Furthermore, these
antibodies possibly do not exhibit true “pan” selectivity based on non-reactivity to bona fide O-
GlcNAc-modified synthetic proteins (P. M. Levine, Galesic, et al., 2019). In order to improve
sensitivity, as well as to allow site-specific detection, protein-specific antibodies have also been
developed for a number of substrates again with the use of synthetic glycopeptides (Gorelik & van
Aalten, 2020).

The extent to which O-GlcNAc modification affects protein function is closely tied to its
stoichiometry, which varies widely from substrate to substrate. Traditional mass spectrometry
techniques can precisely identify sites of modification, but are unable to determine modification
number on a particular protein under a given set of conditions. To this end, our lab (in collaboration
with the Hsieh-Wilson lab) optimized a Western blotting assay capable of determining
modification stoichiometry (Darabedian et al., 2018; Rexach et al., 2010). Briefly, in this
technique, endogenously O-GlcNAcylated proteins in cell lysates are appended with azide-labeled
galactose monomers via a selectively-mutated galactosyltransferase. These azide handles can then
be linked to DBCO-functionalized PEG, resulting in gel-shifting mass tags proportional to the
modification’s stoichiometry which are visualizable via Western blotting. To optimize this
protocol, we used EPL to generate an HA-tagged ubiquitin thioester which we reacted with either
an unmodified or O-GlcNAcylated small peptide prepared via SPPS. This enabled us to have a
100% modified protein control to test different conditions and optimize the overall protocol
(Figure 1-4).

16

Figure 1-4. Determining O-GlcNAc stoichiometry using mass shifting. Synthetic,
homogeneously O-GlcNAc modified ubiquitin was used to optimize conditions for
chemoenzymatic mass-shifting of O-GlcNAc modified proteins.

Finally, O-GlcNAc modifications have also been introduced to pharmacologically-active
peptides as a strategy to modulate their therapeutic potential. Notably, these peptides are non-
native substrates for O-GlcNAcylation by OGT. Inspired by the observation that O-GlcNAc
modifications improve the stability of certain substrates against proteolytic cleavage (P. M. Levine
et al., 2017), the addition of the sugar to GPCR peptide agonists GLP-1 (glucagon-like peptide)
and PTHRP (parathyroid hormone receptor peptide) was proposed as a potentially generalizable
peptide engineering strategy to improve serum half-lives (P. M. Levine, Balana, et al., 2019)
Indeed, the strategy worked in certain peptide variants without adversely affecting potency or
affinity for the receptor. In addition, the production of the bacteriostatic Lactobacillus plantarum
di-GlcNAcylated 43-mer peptide glycocin F has also been described (Amso et al., 2018). Glycocin
F is naturally GlcNAc modified by the bacterial glycosyltransferases at Ser19 and Cys43. Using a
sophisticated semi-synthesis strategy, variants of glycocin F were prepared and tested for
differences in antibacterial activities. Interestingly, a glycocin F variant that had O- to S-GlcNAc
17
substitution showed improved biological activity likely as a consequence of enhanced stability of
S-GlcNAc against hydrolysis by bacterial glycosidases.

1.6 Conclusions
O-GlcNAc modifications play myriad roles in a number of different cellular processes by
imposing varied biochemical and biophysical characteristics on its substrates. By leveraging a
chemical protein synthesis toolbox, researchers can generate homogeneously modified proteins
for the interrogation of modification consequences. These techniques have facilitated studies into
the readers, writers, and erasers of O-GlcNAc modification, as well as the direct impacts on its
substrates themselves. Further, semisynthesis of O-GlcNAcylated proteins has enabled the
optimization of techniques to study the endogenous modification and has allowed for the
modulation of polypeptide-based therapeutics. Together, these works highlight the utility of
protein semi-synthesis to probe the biological implications of protein PTMs and establish that O-
GlcNAcylation is highly multifaceted in terms of its substrates and its effects.

18
1.7 Chapter references

Amso, Z., Bisset, S. W., Yang, S.-H. H., Harris, P. W. R. R., Wright, T. H., Navo, C. D., Patchett,
M. L., Norris, G. E., & Brimble, M. A. (2018). Total chemical synthesis of glycocin F and
analogues: S-glycosylation confers improved antimicrobial activity. Chemical Science, 9(6),
1686–1691. https://doi.org/10.1039/c7sc04383j

Borodkin, V. S., Schimpl, M., Gundogdu, M., Rafie, K., Dorfmueller, H. C., Robinson, D. A., &
Van Aalten, D. M. F. (2014). Bisubstrate UDP-peptide conjugates as human O-GlcNAc transferase
inhibitors. Biochemical Journal, 457(3), 497–502. https://doi.org/10.1042/BJ20131272

Chalker, J. M., Lercher, L., Rose, N. R., Schofield, C. J., & Davis, B. G. (2012). Conversion of
Cysteine into Dehydroalanine Enables Access to Synthetic Histones Bearing Diverse Post-
Translational Modifications. Angewandte Chemie International Edition, 51(8), 1835–1839.
https://doi.org/10.1002/anie.201106432

Chalkley, R. J., Thalhammer, A., Schoepfer, R., & Burlingame, A. L. (2009). Identification of
protein O-GlcNAcylation sites using electron transfer dissociation mass spectrometry on native
peptides. Proceedings of the National Academy of Sciences, 106(22), 8894–8899.
https://doi.org/10.1073/pnas.0900288106

19
Chuh, K. N., Batt, A. R., Zaro, B. W., Darabedian, N., Marotta, N. P., Brennan, C. K., Amirhekmat,
A., & Pratt, M. R. (2017). The New Chemical Reporter 6-Alkynyl-6-deoxy-GlcNAc Reveals O-
GlcNAc Modification of the Apoptotic Caspases That Can Block the Cleavage/Activation of
Caspase-8. Journal of the American Chemical Society, 139(23), 7872–7885.
https://doi.org/10.1021/jacs.7b02213

Clarke, A. J., Hurtado-Guerrero, R., Pathak, S., Schüttelkopf, A. W., Borodkin, V., Shepherd, S.
M., Ibrahim, A. F. M. M., & van Aalten, D. M. F. F. (2008). Structural insights into mechanism
and specificity of O-GlcNAc transferase. The EMBO Journal, 27(20), 2780–2788.
https://doi.org/10.1038/emboj.2008.186

Comer, F. I., Vosseller, K., Wells, L., Accavitti, M. A., & Hart, G. W. (2001). Characterization of
a Mouse Monoclonal Antibody Specific for O-Linked N-Acetylglucosamine. Analytical
Biochemistry, 293(2), 169–177. https://doi.org/10.1006/abio.2001.5132

Darabedian, N., Thompson, J. W., Chuh, K. N., Hsieh-Wilson, L. C., & Pratt, M. R. (2018).
Optimization of Chemoenzymatic Mass Tagging by Strain-Promoted Cycloaddition (SPAAC) for
the Determination of O-GlcNAc Stoichiometry by Western Blotting. Biochemistry, 57(40), 5769–
5774. https://doi.org/10.1021/acs.biochem.8b00648

Dawson, P. E., Muir, T. W., Clark-Lewis, I., & Kent, S. B. (1994). Synthesis of proteins by native
chemical ligation. Science, 266(5186), 776 LP – 779. https://doi.org/10.1126/science.7973629

20
De Leon, C. A., Lang, G., Saavedra, M. I., & Pratt, M. R. (2018). Simple and Efficient Preparation
of O- and S-GlcNAcylated Amino Acids through InBr3-Catalyzed Synthesis of β-N-
Acetylglycosides from Commercially Available Reagents. Organic Letters, 20(16), 5032–5035.
https://doi.org/10.1021/acs.orglett.8b02182

De Leon, C. A., Levine, P. M., Craven, T. W., & Pratt, M. R. (2017). The Sulfur-Linked Analogue
of O-GlcNAc (S-GlcNAc) Is an Enzymatically Stable and Reasonable Structural Surrogate for O-
GlcNAc at the Peptide and Protein Levels. Biochemistry, 56(27), 3507–3517.
https://doi.org/10.1021/acs.biochem.7b00268

Elsen, N. L., Patel, S. B., Ford, R. E., Hall, D. L., Hess, F., Kandula, H., Kornienko, M., Reid, J.,
Selnick, H., Shipman, J. M., Sharma, S., Lumb, K. J., Soisson, S. M., & Klein, D. J. (2017).
Insights into activity and inhibition from the crystal structure of human O-GlcNAcase. Nature
Chemical Biology, 13(6), 613–615. https://doi.org/10.1038/nchembio.2357

Frenkel-Pinter, M., Richman, M., Belostozky, A., Abu-Mokh, A., Gazit, E., Rahimipour, S., &
Segal, D. (2018). Distinct Effects of O-GlcNAcylation and Phosphorylation of a Tau-Derived
Amyloid Peptide on Aggregation of the Native Peptide. Chemistry – A European Journal, 24(53),
14039–14043. https://doi.org/10.1002/chem.201802209

Gao, H., Shi, M., Wang, R., Wang, C., Shao, C., Gu, Y., & Yu, W. (2018). A widely compatible
expression system for the production of highly O-GlcNAcylated recombinant protein in
Escherichia coli. Glycobiology, 28(12), 949–957. https://doi.org/10.1093/glycob/cwy077
21
Gloster, T. M., Zandberg, W. F., Heinonen, J. E., Shen, D. L., Deng, L., & Vocadlo, D. J. (2011).
Hijacking a biosynthetic pathway yields a glycosyltransferase inhibitor within cells. Nature
Chemical Biology, 7(3), 174–181. https://doi.org/10.1038/nchembio.520

Goodwin, O. Y., Thomasson, M. S., Lin, A. J., Sweeney, M. M., & Macnaughtan, M. A. (2013).
E. coli sabotages the in vivo production of O-linked β-N-acetylglucosamine-modified proteins.
Journal of Biotechnology, 168(4), 315–323. https://doi.org/10.1016/j.jbiotec.2013.10.008

Gorelik, A., Bartual, S. G., Borodkin, V. S., Varghese, J., Ferenbach, A. T., & van Aalten, D. M.
F. F. (2019). Genetic recoding to dissect the roles of site-specific protein O-GlcNAcylation. Nature
Structural & Molecular Biology, 26(11), 1071–1077. https://doi.org/10.1038/s41594-019-0325-8

Gorelik, A., & van Aalten, D. M. F. (2020). Tools for functional dissection of site-specific O-
GlcNAcylation. RSC Chemical Biology, 1(3), 98–109. https://doi.org/10.1039/d0cb00052c

Han, C., Shan, H., Bi, C., Zhang, X., Qi, J., Zhang, B., Gu, Y., & Yu, W. (2015). A highly effective
and adjustable dual plasmid system for O-GlcNAcylated recombinant protein production in E.
coli. Journal of Biochemistry, 157(6), 477–484. https://doi.org/10.1093/jb/mvv006

Hart, G. W., Slawson, C., Ramirez-Correa, G., & Lagerlof, O. (2011). Cross talk between O-
GlcNAcylation and phosphorylation: roles in signaling, transcription, and chronic disease. Annual
Review of Biochemistry, 80, 825–858. https://doi.org/10.1146/annurev-biochem-060608-102511

22
Jínek, M., Rehwinkel, J., Lazarus, B. D., Izaurralde, E., Hanover, J. A., & Conti, E. (2004). The
superhelical TPR-repeat domain of O-linked GlcNAc transferase exhibits structural similarities to
importin α. Nature Structural & Molecular Biology, 11(10), 1001–1007.
https://doi.org/10.1038/nsmb833

Joiner, C. M., Levine, Z. G., Aonbangkhen, C., Woo, C. M., & Walker, S. (2019). Aspartate
Residues Far from the Active Site Drive O-GlcNAc Transferase Substrate Selection. Journal of
the American Chemical Society, 141(33), 12974–12978. https://doi.org/10.1021/jacs.9b06061

Joiner, C. M., Li, H., Jiang, J., & Walker, S. (2019). Structural characterization of the O-GlcNAc
cycling enzymes: insights into substrate recognition and catalytic mechanisms. Current Opinion
in Structural Biology, 56, 97–106. https://doi.org/https://doi.org/10.1016/j.sbi.2018.12.003

Lazarus, M. B., Jiang, J., Gloster, T. M., Zandberg, W. F., Whitworth, G. E., Vocadlo, D. J., &
Walker, S. (2012). Structural snapshots of the reaction coordinate for O-GlcNAc transferase.
Nature Chemical Biology, 8(12), 966–968. https://doi.org/10.1038/nchembio.1109

Lazarus, M. B., Jiang, J., Kapuria, V., Bhuiyan, T., Janetzko, J., Zandberg, W. F., Vocadlo, D. J.,
Herr, W., & Walker, S. (2013). HCF-1 Is Cleaved in the Active Site of O-GlcNAc Transferase.
Science, 342(6163), 1235–1239. https://doi.org/10.1126/science.1243990

23
Lazarus, M. B., Nam, Y., Jiang, J., Sliz, P., & Walker, S. (2011). Structure of human O-GlcNAc
transferase and its complex with a peptide substrate. Nature, 469(7331), 564–567.
https://doi.org/10.1038/nature09638

Leney, A. C., El Atmioui, D., Wu, W., Ovaa, H., & Heck, A. J. R. (2017). Elucidating crosstalk
mechanisms between phosphorylation and O-GlcNAcylation. Proceedings of the National
Academy of Sciences, 114(35), E7255 LP-E7261. https://doi.org/10.1073/pnas.1620529114

Lercher, L., Raj, R., Patel, N. A., Price, J., Mohammed, S., Robinson, C. V., Schofield, C. J., &
Davis, B. G. (2015). Generation of a synthetic GlcNAcylated nucleosome reveals regulation of
stability by H2A-Thr101 GlcNAcylation. Nature Communications, 6, 7978.
https://doi.org/10.1038/ncomms8978

Levine, P. M., Balana, A. T., Sturchler, E., Koole, C., Noda, H., Zarzycka, B., Daley, E. J., Truong,
T. T., Katritch, V., Gardella, T. J., Wootten, D., Sexton, P. M., McDonald, P., & Pratt, M. R.
(2019). O-GlcNAc Engineering of GPCR Peptide-Agonists Improves Their Stability and in Vivo
Activity. Journal of the American Chemical Society, 141(36), 14210–14219.
https://doi.org/10.1021/jacs.9b05365

Levine, P. M., De Leon, C. A., Galesic, A., Balana, A., Marotta, N. P., Lewis, Y. E., & Pratt, M.
R. (2017). O-GlcNAc modification inhibits the calpain-mediated cleavage of α-synuclein.
Bioorganic & Medicinal Chemistry, 25(18), 4977–4982.
https://doi.org/10.1016/j.bmc.2017.04.038
24
Levine, P. M., Galesic, A., Balana, A. T., Mahul-Mellier, A.-L. L., Navarro, M. X., De Leon, C.
A., Lashuel, H. A., & Pratt, M. R. (2019). α-Synuclein O-GlcNAcylation alters aggregation and
toxicity, revealing certain residues as potential inhibitors of Parkinson’s disease. Proceedings of
the National Academy of Sciences, 116(5), 1511–1519. https://doi.org/10.1073/pnas.1808845116

Levine, Z. G., Fan, C., Melicher, M. S., Orman, M., Benjamin, T., & Walker, S. (2018). O-GlcNAc
Transferase Recognizes Protein Substrates Using an Asparagine Ladder in the Tetratricopeptide
Repeat (TPR) Superhelix. Journal of the American Chemical Society, 140(10), 3510–3513.
https://doi.org/10.1021/jacs.7b13546

Lewis, Y. E., Galesic, A., Levine, P. M., De Leon, C. A., Lamiri, N., Brennan, C. K., & Pratt, M.
R. (2017). O-GlcNAcylation of α-Synuclein at Serine 87 Reduces Aggregation without Affecting
Membrane Binding. ACS Chemical Biology, 12(4), 1020–1027.
https://doi.org/10.1021/acschembio.7b00113

Li, B., Li, H., Hu, C.-W. W., & Jiang, J. (2017). Structural insights into the substrate binding
adaptability and specificity of human O-GlcNAcase. Nature Communications, 8(1), 1–5.
https://doi.org/10.1038/s41467-017-00865-1

Li, B., Li, H., Lu, L., & Jiang, J. (2017). Structures of human O-GlcNAcase and its complexes
reveal a new substrate recognition mode. Nature Structural & Molecular Biology, 24(4), 362–369.
https://doi.org/10.1038/nsmb.3390

25
Lim, Hong, K., Ha, C. H., & Chang, H. I. (2002). Production of O-GlcNAc Modified Recombinant
proteins in Escherichia coli. Journalof Microbiology and Biotechnology, 12(2), 306–311.
https://doi.org/10.1590/S1415-47572004000300022

Liu, T.-W. W., Zandberg, W. F., Gloster, T. M., Deng, L., Murray, K. D., Shan, X., & Vocadlo,
D. J. (2018). Metabolic Inhibitors of O-GlcNAc Transferase That Act In Vivo Implicate Decreased
O-GlcNAc Levels in Leptin-Mediated Nutrient Sensing. Angewandte Chemie International
Edition, 57(26), 7644–7648. https://doi.org/10.1002/anie.201803254

Liu, Y., Ren, Y., Cao, Y., Huang, H., Wu, Q., Li, W., Wu, S., & Zhang, J. (2017). Discovery of a
Low Toxicity O-GlcNAc Transferase (OGT) Inhibitor by Structure-based Virtual Screening of
Natural Products. Scientific Reports, 7(1), 1–11. https://doi.org/10.1038/s41598-017-12522-0

Lubas, W. A., & Hanover, J. A. (2000). Functional Expression of O -linked GlcNAc Transferase.
Journal of Biological Chemistry, 275(15), 10983–10988.
https://doi.org/10.1074/jbc.275.15.10983

Ma, J., & Hart, G. W. (2014). O-GlcNAc profiling: from proteins to proteomes. Clinical
Proteomics, 11(1), 1–16. https://doi.org/10.1186/1559-0275-11-8

Ma, Z., Vocadlo, D. J., & Vosseller, K. (2013). Hyper-O-GlcNAcylation is anti-apoptotic and
maintains constitutive NF-κB activity in pancreatic cancer cells. The Journal of Biological
Chemistry, 288(21), 15121–15130. https://doi.org/10.1074/jbc.M113.470047
26
Marotta, N. P., Lin, Y. H., Lewis, Y. E., Ambroso, M. R., Zaro, B. W., Roth, M. T., Arnold, D.
B., Langen, R., & Pratt, M. R. (2015). O-GlcNAc modification blocks the aggregation and toxicity
of the protein α-synuclein associated with Parkinson’s disease. Nature Chemistry, 7(11), 913–920.
https://doi.org/10.1038/nchem.2361

Martin, S. E. S. S., Tan, Z.-W. W., Itkonen, H. M., Duveau, D. Y., Paulo, J. A., Janetzko, J., Boutz,
P. L., Törk, L., Moss, F. A., Thomas, C. J., Gygi, S. P., Lazarus, M. B., & Walker, S. (2018).
Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors. Journal of the
American Chemical Society, 140(42), 13542–13545. https://doi.org/10.1021/jacs.8b07328

Maynard, J. C., Burlingame, A. L., & Medzihradszky, K. F. (2016). Cysteine S-linked N-
acetylglucosamine (S-GlcNAcylation), a new post-translational modification in Mammals.
Molecular and Cellular Proteomics, 15(11), 3405–3411.
https://doi.org/10.1074/mcp.M116.061549

Muir, T. W., Sondhi, D., & Cole, P. A. (1998). Expressed protein ligation: A general method for
protein engineering. Proceedings of the National Academy of Sciences, 95(12), 6705–6710.
https://doi.org/10.1073/pnas.95.12.6705

Ohnishi, Y., Ichikawa, M., & Ichikawa, Y. (2000). Facile synthesis of N-Fmoc-serine-S-GlcNAc:
a potential molecular probe for the functional study of O-GlcNAc. Bioorganic & Medicinal
Chemistry Letters, 10(11), 1289–1291. https://doi.org/10.1016/s0960-894x(00)00223-7

27
Pathak, S., Alonso, J., Schimpl, M., Rafie, K., Blair, D. E., Borodkin, V. S., Schüttelkopf, A. W.,
Albarbarawi, O., & Van Aalten, D. M. F. F. (2015). The active site of O-GlcNAc transferase
imposes constraints on substrate sequence. Nature Structural and Molecular Biology, 22(9), 744–
749. https://doi.org/10.2210/pdb5bnw/pdb

Pinho, T. S., Correia, S. C., Perry, G., Ambrósio, A. F., & Moreira, P. I. (2019). Diminished O-
GlcNAcylation in Alzheimer’s disease is strongly correlated with mitochondrial anomalies.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1865(8), 2048–2059.
https://doi.org/https://doi.org/10.1016/j.bbadis.2018.10.037

Rafie, K., Gorelik, A., Trapannone, R., Borodkin, V. S., & Van Aalten, D. M. F. (2018). Thio-
Linked UDP-Peptide Conjugates as O-GlcNAc Transferase Inhibitors. Bioconjugate Chemistry,
29(6), 1834–1840. https://doi.org/10.1021/acs.bioconjchem.8b00194

Rafie, K., Raimi, O., Ferenbach, A. T., Borodkin, V. S., Kapuria, V., & van Aalten, D. M. F. F.
(2017). Recognition of a glycosylation substrate by the O-GlcNAc transferase TPR repeats. Open
Biology, 7(6), 170078. https://doi.org/10.1098/rsob.170078

Raj, R., Lercher, L., Mohammed, S., & Davis, B. G. (2016). Synthetic Nucleosomes Reveal that
GlcNAcylation Modulates Direct Interaction with the FACT Complex. Angewandte Chemie
(International Ed. in English), 55(31), 8918–8922. https://doi.org/10.1002/anie.201603106

28
Rexach, J. E., Rogers, C. J., Yu, S.-H. H., Tao, J., Sun, Y. E., & Hsieh-Wilson, L. C. (2010).
Quantification of O-glycosylation stoichiometry and dynamics using resolvable mass tags. Nature
Chemical Biology, 6(9), 645–651. https://doi.org/10.1038/nchembio.412

Roth, C., Chan, S., Offen, W. A., Hemsworth, G. R., Willems, L. I., King, D. T., Varghese, V.,
Britton, R., Vocadlo, D. J., & Davies, G. J. (2017). Structural and functional insight into human
O-GlcNAcase. Nature Chemical Biology, 13(6), 610–612. https://doi.org/10.1038/nchembio.2358

Schimpl, M., Zheng, X., Borodkin, V. S., Blair, D. E., Ferenbach, A. T., Schüttelkopf, A. W.,
Navratilova, I., Aristotelous, T., Albarbarawi, O., Robinson, D. A., Macnaughtan, M. A., & van
Aalten, D. M. F. F. (2012). O-GlcNAc transferase invokes nucleotide sugar pyrophosphate
participation in catalysis. Nature Chemical Biology, 8(12), 969–974.
https://doi.org/10.1038/nchembio.1108

Schwagerus, S., Reimann, O., Despres, C., Smet-Nocca, C., & Hackenberger, C. P. R. (2016).
Semi-synthesis of a tag-freeO-GlcNAcylated tau protein by sequential chemoselective ligation.
Journal of Peptide Science, 22(5), 327–333. https://doi.org/10.1002/psc.2870

Sharif, S., Shi, J., Ruijtenbeek, R., & Pieters, R. J. (2019). Study of cross talk between
phosphatases and OGA on a ZO-3-derived peptide. Amino Acids, 51(4), 739–743.
https://doi.org/10.1007/s00726-019-02699-1

29
Shen, D. L., Gloster, T. M., Yuzwa, S. A., & Vocadlo, D. J. (2012). Insights into O-linked N-
acetylglucosamine (O-GlcNAc) processing and dynamics through kinetic analysis of O-GlcNAc
transferase and O-GlcNAcase activity on protein substrates. Journal of Biological Chemistry,
287(19), 15395–15408. https://doi.org/10.1074/jbc.M111.310664

Shi, J., Sharif, S., Ruijtenbeek, R., & Pieters, R. J. (2016). Activity Based High-Throughput
Screening for Novel O-GlcNAc Transferase Substrates Using a Dynamic Peptide Microarray.
PLOS ONE, 11(3), e0151085. https://doi.org/10.1371/journal.pone.0151085

Shi, J., Tomašič, T., Sharif, S., Brouwer, A. J., Anderluh, M., Ruijtenbeek, R., & Pieters, R. J.
(2017). Peptide microarray analysis of the cross-talk between O-GlcNAcylation and tyrosine
phosphorylation. FEBS Letters, 591(13), 1872–1883. https://doi.org/10.1002/1873-3468.12708

Snow, C. M., Senior, A., & Gerace, L. (1987). Monoclonal antibodies identify a group of nuclear
pore complex glycoproteins. The Journal of Cell Biology, 104(5), 1143–1156.
https://doi.org/10.1083/jcb.104.5.1143

Tarbet, H. J., Toleman, C. A., & Boyce, M. (2017). A Sweet Embrace: Control of Protein–Protein
Interactions by O-Linked β-N-Acetylglucosamine. Biochemistry, 57(1), 13–21.
https://doi.org/10.1021/acs.biochem.7b00871

30
Tarrant, M. K., Rho, H.-S. S., Xie, Z., Jiang, Y. L., Gross, C., Culhane, J. C., Yan, G., Qian, J.,
Ichikawa, Y., Matsuoka, T., Zachara, N., Etzkorn, F. A., Hart, G. W., Jeong, J. S., Blackshaw, S.,
Zhu, H., & Cole, P. A. (2012). Regulation of CK2 by phosphorylation and O-GlcNAcylation
revealed by semisynthesis. Nature Chemical Biology, 8(3), 262–269.
https://doi.org/10.1038/nchembio.771

Tashima, Y., & Stanley, P. (2014). Antibodies that detect o-linked β-D-N-Acetylglucosamine on
the extracellular domain of cell surface glycoproteins. Journal of Biological Chemistry, 289(16),
11132–11142. https://doi.org/10.1074/jbc.M113.492512

Teo, C. F., Ingale, S., Wolfert, M. A., Elsayed, G. A., Nöt, L. G., Chatham, J. C., Wells, L., &
Boons, G.-J. J. (2010). Glycopeptide-specific monoclonal antibodies suggest new roles for O-
GlcNAc. Nature Chemical Biology, 6(5), 338–343. https://doi.org/10.1038/nchembio.338

Toleman, C. A., Schumacher, M. A., Yu, S.-H., Zeng, W., Cox, N. J., Smith, T. J., Soderblom, E.
J., Wands, A. M., Kohler, J. J., & Boyce, M. (2018). Structural basis of O-GlcNAc recognition by
mammalian 14-3-3 proteins. Proceedings of the National Academy of Sciences, 115(23), 5956 LP
– 5961. https://doi.org/10.1073/pnas.1722437115

Walgren, J. L. E. E., Vincent, T. S., Schey, K. L., & Buse, M. G. (2003). High glucose and insulin
promote O-GlcNAc modification of proteins, including α-tubulin. American Journal of
Physiology-Endocrinology and Metabolism, 284(2), E424–E434.
https://doi.org/10.1152/ajpendo.00382.2002
31

Worth, M., Hu, C. W., Li, H., Fan, D., Estevez, A., Zhu, D., Wang, A., & Jiang, J. (2019). Targeted
covalent inhibition of: O -GlcNAc transferase in cells. Chemical Communications, 55(88), 13291–
13294. https://doi.org/10.1039/c9cc04560k

Wright, T. H., Bower, B. J., Chalker, J. M., Bernardes, G. J. L. L., Wiewiora, R., Ng, W. L. W.-
L., Raj, R., Faulkner, S., Vallee, M. R. J., Phanumartwiwath, A., Coleman, O. D., Thezenas, M.-
L., Khan, M., Galan, S. R. G. G., Lercher, L., Schombs, M. W., Gerstberger, S., Palm-Espling, M.
E., Baldwin, A. J., … Davis, B. G. (2016). Posttranslational mutagenesis: A chemical strategy for
exploring protein side-chain diversity. Science, 354(6312), aag1465–aag1465.
https://doi.org/10.1126/science.aag1465

Yuzwa, S. A., Macauley, M. S., Heinonen, J. E., Shan, X., Dennis, R. J., He, Y., Whitworth, G.
E., Stubbs, K. A., McEachern, E. J., Davies, G. J., & Vocadlo, D. J. (2008). A potent mechanism-
inspired O-GlcNAcase inhibitor that blocks phosphorylation of tau in vivo. Nature Chemical
Biology, 4(8), 483–490. https://doi.org/10.1038/nchembio.96

Zhang, H., Tomašič, T., Shi, J., Weiss, M., Ruijtenbeek, R., Anderluh, M., & Pieters, R. J. (2018).
Inhibition of: O -GlcNAc transferase (OGT) by peptidic hybrids. MedChemComm, 9(5), 883–887.
https://doi.org/10.1039/c8md00115d

32
Chapter 2: O-GlcNAcylation of high mobility group box 1 (HMGB1) alters
its DNA binding and DNA damage processing activities*
Protein O-GlcNAcylation is an essential and dynamic regulator of myriad cellular processes,
including DNA replication and repair. Proteomic studies have identified the multifunctional
nuclear protein HMGB1 as O-GlcNAcylated providing a potential link between this modification
and DNA damage responses. Here, we verify the protein’s endogenous modification at S100 and
S107 and found that the major modification site is S100, a residue that can potentially influence
HMGB1-DNA interactions. Using synthetic protein chemistry, we generated site-specifically O-
GlcNAc-modified HMGB1 at S100 and characterized biochemically the effect of the sugar
modification on its DNA binding activity. We found that O-GlcNAc alters HMGB1 binding to
linear, nucleosomal, supercoiled, cruciform, and interstrand cross-linked damaged DNA, generally
resulting in enhanced oligomerization on these DNA structures. Using cell-free extracts, we also
found that O-GlcNAc reduces the ability of HMGB1 to facilitate DNA repair, resulting in error-
prone processing of damaged DNA. Our results expand our understanding of the molecular
consequences of O-GlcNAc and how it affects protein-DNA interfaces. Importantly, our work may
also support a link between upregulated O-GlcNAc levels and increased rates of mutations in
certain cancer states.
_________________________
*Stuart Moon (University of Southern California), Anirban Mukherjee (Vasquez Lab, University of Texas at Austin) and Harsh
Nagpal (Fierz Lab, Ecole Polytechnique Fédérale de Lausanne) contributed to the work presented in this chapter.
33
2.1 Introduction
O-GlcNAcylation is a posttranslational modification in higher-order eukaryotic organisms
involving the addition of a single N-acetylglucosamine (GlcNAc) sugar moiety onto serine and
threonine residues of protein substrates. Unlike other types of glycosylation whose targets are
routed towards the cell surface, O-GlcNAc substrates remain intracellular where the
glycosyltransferase that adds the modification (O-GlcNAc transferase or OGT) and the
glycosidase that removes it (O-GlcNAcase or OGA) also reside. This enzymatic cycling means
that akin to protein phosphorylation, O-GlcNAcylation can be transient, reversible, and sensitive
to the cellular conditions (Bond & Hanover, 2015). O-GlcNAc levels are nutrient- and stress-
responsive, and their misregulation at a global level is implicated in cellular abnormalities and
disease states. At the protein level, O-GlcNAc acts beyond simply adding bulk to the modified
side chains as direct interrogations on specific protein targets demonstrate that GlcNAc can act as
molecular “grease or glue” that can modulate protein interfaces (X. Yang & Qian, 2017). Thus, O-
GlcNAc can influence protein folding, inhibit protein aggregation, participate in posttranslational
modification (PTM) crosstalk, and regulate protein-protein interactions.

O-GlcNAcylation is highly enriched in the nucleus where various chromatin modifiers,
transcription factors, scaffold proteins, and nucleocytoplasmic enzymes are known to be modified.
Posttranslational modifications on these targets affect diverse cellular processes such as DNA
replication, cell cycle control, transcriptional regulation, epigenetics, and DNA repair processes
(Bond & Hanover, 2015; Hanover et al., 2012). Recently, the chromosomal protein high mobility
group box 1 (HMGB1, previously HMG1 in older publications) was identified as a substrate for
O-GlcNAcylation, specifically at serines 100 and 107 (Woo et al., 2018) (Figure 2-1a). HMGB1
34
is a non-histone chromosomal protein that participates in various cellular functions. Its protein
sequence is composed of two DNA-binding HMG-box domains (Boxes A and B) joined by a short
linker region and is terminated by a flexible tail of an uninterrupted stretch of aspartic and glutamic
acid residues (M E Bianchi et al., 1992; Knapp et al., 2004). Each HMG box is characterized by a
tri-helical L-shaped fold that contours to DNA substrates (Webb & Thomas, 1999). Both HMG
boxes also have high proportions of basic residues that interact with the DNA backbone, as well
as specific helix residues that can intercalate between DNA bases (Michael Stros & Muselıkova,
2000). These structural features impart HMGB1 with a preference for distorted, non-B-form DNA
structures. Specifically, HMGB1 has shown higher affinity in vitro for supercoiled DNA (Sheflin
& Spaulding, 1989), DNA minicircles (Webb et al., 2001), looped DNA (Gaillard et al., 2008;
Štros et al., 1994), cisplatin-DNA adducts (Jung & Lippard, 2003), and 4-way junction DNA
(Marco E Bianchi et al., 1989) over linear forms. HMGB1 is also able to induce torsional and
topological alterations upon binding linear DNA by causing bending, kinking, looping, and
supercoiling processes (Sabine S. Lange & Vasquez, 2009). This preference for noncanonical
DNA structures allows HMGB1 to act as a “DNA chaperone” by working with histone proteins to
facilitate chromatin organization, (Travers et al., 1994) or with other nuclear proteins for
transcriptional co-regulation (Mantovani et al., 1998; Sutrias-Grau et al., 1999) and DNA damage
recognition and repair (Sabine S. Lange & Vasquez, 2009). For instance, HMGB1 has been shown
to function as a co-factor in nucleotide excision repair (NER), facilitating error-free repair on both
psoralen interstrand and UV-induced intrastrand crosslinks (S S Lange et al., 2008).

Here we examined the consequences of HMGB1 O-GlcNAcylation to its DNA binding
properties and its role in DNA damage processing. We first confirmed that the protein is O-
35
GlcNAc modified in human non-small cell lung carcinoma, H1299 cells and identified the major
modification site to be serine 100. We then utilized selenocysteine-based expressed protein ligation
(EPL) to prepare homogeneously O-GlcNAcylated HMGB1 at S100 (gS100). We demonstrated
through in vitro biochemistry that the modification alters HMGB1’s ability to interact with known
DNA substrates such as four-way junction DNA, negatively supercoiled DNA, and nucleosomal
DNA. Several of these substrates are model scaffolds for damaged DNA or intermediates of DNA
repair pathways, suggesting that O-GlcNAc may play a role in DNA damage processing. We tested
this possibility in a cell-free assay and demonstrated that O-GlcNAc resulted in a loss of HMGB1’s
known ability to facilitate error-free repair of interstrand cross-linked DNA.

2.2 HMGB1 is endogenously O-GlcNAc-modified, and the major site of modification is S100
We found the O-GlcNAc status of HMGB1 from multiple proteomics studies that
employed a variety of detection methods (Hahne et al., 2013; Ramirez et al., 2020; C. F. Teo et
al., 2010). In a glycosite mapping study of primary human T cell proteins, a tryptic glycopeptide
was detected corresponding to residues 97-112, in which two serine residues at positions 100 and
107 (S100 & S107) were found to be O-GlcNAc-modified (Woo et al., 2018). This study utilized
the metabolic chemical reporter Ac
4
GalNAz to enrich and identify O-GlcNAc sites. However,
because reporters of this type can result in increased metabolic flux (Pedowitz & Pratt, 2021), we
first wanted to confirm that HMGB1 is endogenously O-GlcNAcylated. We employed
chemoenzymatic detection of endogenously O-GlcNAc modified proteins from H1299 cells (Clark
et al., 2008). Protein lysates were first subjected to enzymatic modification by an engineered
galactosyltransferase, GalT(Y289L) which transfers an azide-bearing N-azidoacetyl-
galactosamine residue, GalNAz, to O-GlcNAc moieties. The azide tag of the resulting disaccharide
36
allowed for further functionalization with a biotin handle through a Cu(I)-catalyzed click
reaction(Rostovtsev et al., 2002) using an alkyne-azo-biotin reagent (Y.-Y. Yang et al., 2010).
Following streptavidin agarose enrichment and washing of non-binders, proteins were eluted
through the reduction of the azo linker. Subsequent SDS-PAGE separation and Western blotting
enabled detection of bona fide O-GlcNAc modified proteins including HMGB1, and the highly O-
GlcNAcylated Nup62 protein as positive control (Figure 2-1b). Notably, the non-O-GlcNAcylated
β-actin was not enriched in our pulldown lanes.

In order to confirm that modification occurs at S100 and S107, and to compare the relative
amounts of modifications at these two sites, we analyzed variants of HMGB1 bearing serine to
alanine mutations at these positions. H1299 cells were co-transfected with a FLAG-tagged mutant,
either HMGB1(S100A) or HMGB1(S107A), and an HA-tagged wild-type HMGB1(WT) as an
internal positive control. Following cell lysis, we again performed chemoenzymatic labeling and
biotin pulldown to enrich the O-GlcNAcome. We imaged our inputs and pulldowns simultaneously
during Western blotting and normalized the signal of the FLAG mutant to the HA control (Figure
2-1c). Importantly, an HA-HMGB1(WT) versus FLAG-HMGB1(WT) control experiment showed
no effect on pulldown efficiency, indicating that any loss in signal is from reduced O-
GlcNAcylation of our mutants. Consistent with the published proteomics data, both the S100A
and S107A mutations resulted in reduction of the enrichment, confirming that O-GlcNAcylation
occurs at both of these sites. The S100A mutant resulted in a greater loss of O-GlcNAcylation than
the S107A mutant, indicating higher modification stoichiometry at the S100 site. Simultaneous
mutation of both putative sites in the FLAG-HMGB1(AA) mutant reduced the pulldown efficiency
to insignificant levels, indicating that these two residues are the main sites for O-GlcNAcylation.
37

Figure 2-1. HMGB1 is O-GlcNAc-modified at S100 and S107 in cells. (a) HMGB1 has two
high mobility group domains (Boxes A and B) and a highly acidic tail. Previous proteomic studies
localize O-GlcNAc modification of HMGB1 on the B Box domain. (b) Chemoenzymatic labeling
and biotin pulldown confirm that HMGB1 is O-GlcNAc modified in H1299 cells. O-
GlcNAcylated proteins where enriched using chemoenzymatic labeling and bioorthogonal
reaction with a cleavable biotin-tag. Nup62 and β-actin pulldowns are shown as positive and
negative controls, respectively. (c) The major sites of HMGB1 O-GlcNAc modification are S100
and S107. H1299 cells were transfected with HA-tagged wild-type HMGB1 and FLAG-tagged S-
to-A mutant HMGB1 and lysates were subjected to chemoenzymatic labeling and pulldown. HA
and FLAG immunoblot signals were imaged simultaneously to allow quantitative comparison
using densitometry. Bar graphs represent means of two separate biological experiments, error bars
represent ±SEM. Statistical significance was calculating using two-tailed Student’s t-test. (d) Top,
structure of HMGB1 B Box domain (yellow) bound to bent DNA (white) in a V(D)J recombination
complex (PDB: 6CIJ). Bottom, S100 points into the DNA interface and is only a few residues
away from a known, conserved intercalating residue (F103).

The S100 glycosite is located at the first helix of the Box B domain where it points towards
the bound DNA, based on a solution NMR structure of the human HMGB1 B box domain in
complex with duplex DNA (Stott et al., 2006) and crystal structures of HMGB1 bending the DNA
38
in a V(D)J recombination complex (PDB:6CIJ, Figure 2-2) (Kim et al., 2018) and of the
Drosophila ortholog HMG-D structure bound to linear DNA (Murphy IV et al., 1999). Notably, it
is only a few residues away from a conserved intercalating residue F103 (Figure 2-2, right). Variant
analysis at position 100 of HMG-domain containing proteins also identified this serine as a key
determining residue for binding certain DNA structures in a sequence-independent fashion
(Murphy IV et al., 1999). Taken altogether, this information led us to hypothesize that O-
GlcNAcylation at this S100 could alter HMGB1 interactions with DNA, and potentially affect
downstream processes where these interactions are necessary.

Figure 2-2. Ser100 is at the HMGB1-DNA binding interface. Left, structure of HMGB1 B Box
domain (yellow) bound to bent DNA (white) in a V(D)J recombination complex (PDB: 6CIJ).
Right, S100 points into the DNA interface and is only a few residues away from a known,
conserved intercalating residue (F103).

2.3 Semi-synthesis of O-GlcNAc HMGB1(gS100)
Currently, the only way to study the site-specific consequences of O-GlcNAc on protein
function is to generate homogeneously-modified protein and subject it to direct biochemical testing
(Balana et al., 2021). For this purpose, our lab utilizes expressed protein ligation (EPL) (Agouridas
et al., 2019; Thompson & Muir, 2020) to prepare and study a variety of proteins (Muir et al., 1998).
39
This ligation technique traditionally involves the reaction between one peptide fragment bearing
an N-terminal cysteine residue as the nucleophile, and another bearing a C-terminal thioester as
the leaving group. HMGB1 incidentally has three cysteine residues that can theoretically be useful
for EPL reactions: C23, C45, and C106. However, none of these sites are conveniently located for
the incorporation of O-GlcNAcylated serine at position 100. Hence, we used a cysteine surrogate,
selenocysteine (Sec), that would allow us to use a nearby alanine (A94) as a ligation site.
Selenocysteine at this position would initially facilitate the ligation reaction, after which it could
be converted back to alanine chemoselectively through a radical deselenization reaction (Dardashti
& Metanis, 2017; Metanis et al., 2010).

As schematized in (Figure 2-3a), we prepared HMGB1(gS100) using a 3-fragment, 2-
ligation strategy. We first used E. coli to recombinantly express N-terminal residues 1-93 fused to
an intein domain from Anabaena variabilis (AvaE) (Shah et al., 2012). Thiolysis of the intein by
the addition of sodium mercaptoethanesulfonate (MesNa) afforded the N-terminal thioester
fragment 1. Subsequent analyses by MALDI-MS demonstrated that the initiator methionine had
been completely removed. We then used solid phase peptide synthesis to prepare the middle
fragment 2 corresponding to residues 94-105. This peptide has three important features: an alanine-
to-selenocysteine substitution at position 94 (Sec94), a tri-O-acetyl-protected O-GlcNAcylated
serine residue at position 100, and a C-terminal hydrazide group. Finally, we also prepared C-
terminal fragment 3 through the hydrolysis of a recombinantly-expressed HMGB1(106-215)-
AvaE fusion protein. Again, cleavage of initiator methionine from this intein fusion protein was
efficient. All fragments were purified by semi-preparative reversed phase HPLC (RP-HPLC).

40

Figure 2-3. Semi-synthesis of HMGB1(gS100). (a) Synthetic scheme outlining the preparation
of O-GlcNAcylated HMGB1. Synthetic peptide 2 was incubated with thioester 1. The ligation
product was deselenized in the same pot before purification. The resulting product 4 was activated
and converted to a thioester prior to the addition of recombinant fragment 3. The ligation product
was purified prior to deprotection of the O-acetate protecting groups of the sugar moiety to obtain
HMGB1(gS100). (b) Characterization of synthetic HMGB1(gS100) using analytical RP-HPLC
(C4 analytical, 0-70% Solvent B over 60 mins) and MALDI-MS.
41
Fragments 1 and 2 were subjected to EPL conditions resulting in facile formation of
ligation product. Following buffer exchange to remove the ligation catalyst MPAA, addition of
TCEP converted Sec94 to A94 corresponding to intermediate product 4. This product was purified
by RP-HPLC, and the C-terminal hydrazide was then converted to a thioester using azide
activation and thiol displacement (Fang et al., 2011). Addition of fragment 3 to the same pot
resulted in the formation of ligation product. After purification and deprotection of the sugar’s O-
acetyl protecting groups, we obtained HMGB1(gS100) at >95% purity by analytical RP-HPLC
(Figure 2-3b). At each step of the synthesis, fragments, intermediates, and products were
characterized by MALDI mass spectrometry to confirm their identities (Appendix A-1 and A-2).
Unmodified HMGB1 was also prepared from hydrolysis of its corresponding intein fusion
followed by RP-HPLC (Appendix A-3). Notably, circular dichroism of recombinant unmodified
HMGB1 and semi-synthetic HMGB1(gS100) showed closely overlapping spectra suggesting that
O-GlcNAc does not cause dramatic changes to secondary structure (Appendix A-3).

2.4 O-GlcNAcylation at S100 reduces interaction with negatively supercoiled DNA
HMGB1 engages different binding modes and structural features when interacting with
different DNA structures (Štros, 2010). In the case of supercoiled DNA, the major mechanism
involves ionic interactions with the DNA backbone for torsion conservation. These interactions
are mediated by basic residues within the individual HMG box domains. The isolated Box A, with
its higher proportion of basic residues, exhibits slightly higher affinity for supercoiled DNA (S.-
H. H. Teo et al., 1995) compared to the isolated B Box. However, in the isolated B Box, mutation
of K96 or R97 to alanine causes a loss in affinity for supercoiled DNA, confirming the importance
of net charges for this interaction (Michael Stros & Muselıkova, 2000). An additional mechanism
42
for the isolated B Box DNA-binding is the intercalation of F103, which can insert into distorted
portions of the DNA. Again, mutation of this position to a less bulky serine residue reduces the
ability of the isolated B Box domain to introduce supercoils onto DNA (Michael Stros &
Muselıkova, 2000).

In order to determine the consequence of O-GlcNAc on supercoiled DNA binding, we used
a well-established assay to compare the abilities of our protein variants to protect supercoiled DNA
from topoisomerase I-mediated relaxation. Given that HMGB1 is known to interact preferentially
to negative over positive supercoils (Sheflin & Spaulding, 1989), we isolated negatively
supercoiled pUC19 plasmid from bacteria and pre-incubated it with varying amounts of HMGB1
or HMGB1(gS100). Prokaryotic topoisomerase I, which can only relax negative supercoils
(Champoux, 2001), was then added to these complexes to initiate relaxation of the DNA. We then
digested the proteins with Proteinase K and the resulting DNA topoisomers were resolved in a
fluorophore-free agarose gel followed by staining with the high-sensitivity GelRed dye. The
pUC19 plasmid alone runs as expected, showing a major band corresponding to the supercoiled
form and smaller amounts of nicked and relaxed isomers. Addition of topoisomerase I In the
absence of HMGB1 efficiently converted most of the supercoiled plasmid into relaxed forms as
well as bands that we attribute to positively-supercoiled forms (Sheflin & Spaulding, 1989) (Figure
2-4). As expected from previous studies, increasing amounts of HMGB1 prevented this relaxation,
with HMGB1 preserving virtually all of the negatively supercoiled DNA at a 200-fold molar
excess. Interestingly, HMGB1(gS100) had a reduced ability to prevent relaxation, and this was
most evident when comparing the topoisomer distributions at a molar ratio of <100:1. We repeated
the experiment and confirmed that O-GlcNAcylation increased the amount of HMGB1 required
43
to maintain negative supercoils. S100’s proximity to both the basic patch and F103 indicates that
O-GlcNAc may be interfering with these interactions, resulting in the reduced efficiency of
supercoiled DNA binding.

Figure 2-4. S100 O-GlcNAcylation alters HMGB1 interactions on supercoiled DNA. (a)
Negatively-supercoiled DNA (10 nM were pre-incubated with HMGB1 or HMGB1(gS100) before
treatment with Topoisomerase I. HMGB1(gS100) binds less to negatively-supercoiled DNA than
unmodified HMGB1 based on the higher molar ratio needed to preserve supercoiled structures.

2.5 O-GlcNAcylation at S100 enhances HMGB1 oligomerization on four-way junction and
nucleosomal DNA
HMGB1 exhibits high affinity for damaged DNA and intermediates of DNA repair. One
representative structure specifically recognized by HMGB1 is the four-way junction (4WJ) or
cruciform DNA (Marco E Bianchi et al., 1989). 4WJs recapitulate the biological structure of
Holliday crossover junctions, key intermediates during homologous recombination and homology-
directed double-strand break repair (Brázda et al., 2011; Eichman et al., 2002). 4WJ DNA consists
of four half-complementary strands that form four duplexes or “arms” leaving a junction or “hole”
at the center. Mechanistic studies of HMGB1-4WJ binding demonstrated that the isolated Box A
and B domains can individually bind 4WJ DNA with similar affinities (M E Bianchi et al., 1992).
44
In the full-length protein where both domains are present, the more basic A box occupies the hole
where the DNA is most distorted, while the B box interacts with one of the arm regions of the
cruciform (Webb & Thomas, 1999). Notably, this higher affinity exhibited by the A box over the
B box when the didomain is present is a common feature of HMGB1 binding to other highly
distorted DNA structures (Dunham & Lippard, 1997; Jung & Lippard, 2003; Ohndorf et al., 1999).
After the formation of the stable 1:1 complex, additional HMGB1 will oligomerize producing
higher molecular weight HMGB1-4WJ complexes (Weir et al., 1993). HMGB1 oligomerization
occurs as well on other structures including supercoiled, linear, and circular DNA, and the B box
and its flanking linker regions appears to be the major contributor to this process (S.-H. H. Teo et
al., 1995).

HMGB1 has been shown to bind with nanomolar affinity to 4WJ DNA using gel
retardation or electrophoretic mobility shift assays (EMSA) (Marco E Bianchi et al., 1989). We
similarly utilized EMSAs to establish the effect of HMGB1 O-GlcNAcylation to 4WJ binding. We
first prepared 4WJ DNA using published single-strand sequences (Marco E Bianchi et al., 1989)
and added these to varying amounts of HMGB1 or HMGB1(gS100) to allow complex formation.
Separation by native polyacrylamide gel electrophoresis and subsequent staining with GelRed
enabled the visualization of HMGB1-4WJ complexes. At lower molar equivalents, we observed a
shift of the free probe (Figure 2-5a) to a slower-migrating band (marked “I”), representing a stable
1:1 complex of HMGB1 with 4WJ DNA. Further increase in HMGB1 equivalents resulted in
HMGB1 oligomerization visualized as unresolved staining that appeared higher than complex I
(Figure 2-5a). We did not observe a dramatic difference in the ability of HMGB1 and
HMGB1(gS100) to form complex I, with both variants showing comparable amounts of bound
45

Figure 2-5. S100 O-GlcNAcylation alters HMGB1 oligomerization on DNA. (a) Four-way
junction DNA (100 nM, “free probe”) is bound by HMGB1 to form a slower-migrating complex
“I.” At higher molar ratios, oligomerization results in even slower migration and streaking on the
gel. HMGB1(gS100) exhibits higher oligomerization propensity than unmodified HMGB1. (b)
Histones and 601 DNA (either 147 bp or 218 bp) were formed into mononucleosomes (“MN”, 50
nM) and subjected to complexation with HMGB1. HMGB1(gS100) binds 147 bp nucleosomes
better than HMGB1 (top) and this effect is more pronounced in the 218 bp nucleosomes (bottom)
46
DNA at lower molar ratios. In separate EMSA experiments where we utilized a more gradual
HMGB1 titration gradient, we confirmed that 1:1 binding affinity is not affected by O-GlcNAc
(Appendix B-1). On the other hand, the oligomerization process is more drastically altered by the
O-GlcNAc modification as the HMGB1(gS100) variant formed larger oligomer complexes more
readily (Figure 2-5a). We estimate that this enhancement in oligomerization is about 4-fold, based
on the similarity in staining pattern between the 200:1 HMGB1:4WJ and the 50:1
HMGB1(gS100):4WJ lanes and in the higher ratio lanes that follow. Importantly, we observed the
same difference in oligomerization in a replicate experiment.

HMGB1 also binds to nucleosomal DNA to displace other proteins already present on
chromatin or to reconfigure the region for subsequent binding of other DNA-associated proteins
(Ju et al., 2006; Štros, 2010). Binding predominantly occurs near the entry/exit sites of the
nucleosomes rather than the less accessible histone-bound DNA (Thomas & Stott, 2012). The
presence of linker DNA further enhances binding by facilitating protein oligomerization (Ura et
al., 1996). In order to test whether O-GlcNAc affects the binding of HMGB1, we again used
EMSAs to visualize HMGB1-mononucleosome complexes. Briefly, we purified and refolded
histones and assembled mononucleosomes using either 147 bp or 218 bp DNA bearing the 601
nucleosome positioning sequence. Mononucleosomes were then incubated with varying amounts
of HMGB1 and complexes were resolved with native polyacrylamide gel electrophoresis followed
by GelRed staining.

Using mononucleosomes assembled with the minimal DNA length (147 bp, Figure 2-5b,
top), HMGB1 exhibited weak binding with diffuse bands forming only at molar ratios of 50 or
47
more. HMGB1(gS100) showed slightly better binding/oligomerization evident from the relatively
faster disappearance of the unbound nucleosomes. As expected, binding was generally enhanced
when using mononucleosomes assembled with the longer 218 bp DNA (Figure 2-5b, bottom), with
HMGB1 requiring lower molar ratios for complexation. With these nucleosomes, we observed a
more pronounced effect of O-GlcNAcylation; the unbound nucleosome band completely shifted
at a molar ratio of 20:1 HMGB1(gS100) compared to 50:1 for the unmodified variant. Given that
the effect is more defined when extended linear DNA is present and when higher HMGB1 amounts
are used, our results point to enhanced oligomerization as the major effect of O-GlcNAcylation
similar to what we have seen in the 4WJ binding studies. Taken together, these data suggest that
O-GlcNAc modification improves HMGB1 binding/oligomerization on both 4WJ and
nucleosomal DNA.

The enhancement in oligomerization we observed for HMGB1(gS100) is distinct from the
effects of B box mutations that affect direct protein-DNA interactions. Specifically, K96A and
R97A mutants of the isolated B Box showed decreased affinity for 4WJs while the intercalation
mutant F103S demonstrated neither loss in affinity nor gain in oligomerization propensity
(Michael Stros & Muselıkova, 2000). Hence, while we cannot rule out the possibility that O-
GlcNAc affects these ionic and intercalation interactions, it is possible that the enhancement
towards oligomerization occurs through additional mechanisms. For instance, cross-linking
studies have shown that HMGB1 oligomerization is dependent on the presence of DNA, and can
occur via intermolecular protein-protein interactions likely through the flanking linker regions of
the B Box domain (S. Teo et al., 1995). Given that O-GlcNAc is known to relieve protein interfaces
48
on certain protein targets, the release of these surfaces may afford additional protein-protein
interactions that can result in the enhanced oligomerization we observed in our experiments.

2.6 O-GlcNAcylation at S100 improves HMGB1 ability to circularize linear DNA
Although HMGB1 binding is greater for distorted DNA structures, HMGB1 is also able to
bend and kink linear DNA. Structural studies have shown that HMG-box domain-containing
proteins (Lnenicek-Allen et al., 1996; Murphy IV et al., 1999; Stott et al., 2006) can introduce a
wide range of bending angles (around 30°-130°), with HMGB1 capable of bending the backbone
up to 90°. One biochemical approach widely used to examine this property is through ring closure/
circularization assays wherein the bending activity of multiple HMGB1 molecules on short, linear
DNA drives the formation of DNA minicircles (M Stros, 1998). We used a circularization assay
(Figure 2-6a) to compare the relative abilities of HMGB1 and HMGB1(gS100) to circularize a
short (123-bp) fragment that was pre-digested with KpnI to generate sticky ends. Addition of T4
ligase would result in a mixture of linear (L2, L3,…) and cyclic (C2, C3,…) DNA products
containing multiple copies of the 123-bp sequence. To isolate the cyclic products, Exonuclease III
(Exo) can be added resulting in the digestion of linear DNA. When the 123-bp DNA is initially
incubated with HMGB1 prior to T4 ligation, DNA bending and oligomerization by HMGB1 will
facilitate intramolecular cyclization leading to the formation of Exo-resistant 123-bp cyclic
products termed minicircles (Pil et al., 1993; S. Teo et al., 1995).

We quantified the amount of minicircles formed by measuring the band intensities at
different HMGB1:DNA ratios. As expected, the amount of minicircles increased with increasing
molar ratios of HMGB1 but decreased after reaching a maximum (Figure 2-6b). This fall-off is
49

Figure 2-6. S100 O-GlcNAcylation alters HMGB1 ability to circularize linear DNA. (a)
Schematic of the DNA circularization assay. DNA (123 bp, 125 nM) can be ligated by T4 ligase
to form linear (L1, L2,…) and cyclic (C1, C2, …) products. In the presence of HMGB1, DNA
bending allows formation of Exonuclease III-resistant DNA minicircles. (b) The amount of
HMGB1 required to form the maximum amount of minicircles (indicated by *) is lower for
HMGB1(gS100) than unmodified protein. For quantification of this and a replicate experiment,
please see Appendix B-2. All results shown in this figure are representative of at least 2
experiments.

consistent with results from other studies and has been rationalized as the consequence of excess
HMGB1 preventing proper alignment of the ends and/or preventing access to the T4 DNA ligase
(M Stros, 1998). We performed this assay using both HMGB1 and HMGB1(gS100) and quantified
replicate experiments to determine the effect of O-GlcNAcylation. Regression fitting of specific
binding using the pre-maximum region of the curves allowed us to calculate and compare the
amounts of HMGB1 or HMGB1(gS100) required to produce half-maximal amount of minicircles
50
(Appendix B-2). Interestingly, HMGB1(gS100) demonstrated a significant reduction in this value
(4.903 versus 33.504, p=0.0002) suggesting enhanced DNA bending.

The circularization assay has been used as a direct readout of DNA bending. However,
there are multiple molecular events that lead to the formation of DNA minicircles. These events
include (1) the initial low-affinity binding of HMGB1 to linear DNA, (2) introduction of the DNA
bend, (3) higher-affinity binding of HMGB1 to distorted DNA, and (4) protein oligomerization.
Given that full-length HMGB1 has a binding footprint of only about 20 bp DNA (Sheflin &
Spaulding, 1989), it would take multiple HMGB1 molecules to bring together the DNA ends for
efficient circularization. Thus, protein oligomerization (Pil et al., 1993) appears to be the major
contributing process for the formation of minicircles in this assay. This is supported by the
observation that the same structural determinants that modulate oligomerization of the B box (i.e.
the flanking linker regions) are also crucial for its ability to form DNA minicircles and for its
binding to pre-formed DNA minicircles (Grasser et al., 1998; M Stros, 1998). Given our results
from the 4WJ and nucleosome binding studies, it is likely that the enhancement in circularization
we observed for HMGB1(gS100) is a consequence of its improved oligomerization ability. Indeed,
regression fitting of the data in Appendix B-2 also determined a significant (P=0.0022) 2-fold
increase in the Hill cooperativity coefficient for HMGB1(gS100) over the unmodified variant,
which we interpret as enhanced binding of subsequent monomers akin to oligomerization.

51
2.7 Loss-of-function O-GlcNAc mutant of HMGB1 at position 100 exhibits altered
biochemical behavior
A convenient way to study the functional consequences of O-GlcNAcylation in living
systems is by introducing serine/threonine-to-alanine mutations to the O-GlcNAcylated site of the
protein of interest. Any phenotype associated with the use of such mutants can then be reasonably
ascribed to the chronic loss of the protein’s O-GlcNAc status. We envisioned that this approach in
living systems would allow us to investigate the functional effects of HMGB1 O-GlcNAcylation
in chromatin-related processes. In order to confirm that the introduction of an alanine mutation at
position 100 does not exhibit any perturbations to the biochemical behavior of HMGB1, we
expressed and purified HMGB1(S100A) and subjected this protein to the same experiments
described in previous sections. In DNA supercoiling assays, HMGB1(S100A) minimally affected
the ability of HMGB1 to bind and protect negatively supercoiled DNA from Topoisomerase I
relaxation (Figure 2-7a). However, in the EMSA with the 4WJ DNA substrate, HMGB1(S100A)
behaved differently from wild-type, unmodified HMGB1 (Figure 2-7b) with its complexes closely
resembling those formed by HMGB1(gS100) at higher molar ratios. At lower stoichiometries,
HMGB1(S100A) exhibited a significant reduction in binding affinity for the formation of 1:1
HMGB1-4WJ complexes (Appendix B-1) compared to either unmodified HMGB1 or
HMGB1(gS100). Additionally, in DNA circularization assays, HMGB1(S100A) exhibited a half-
maximal ratio closer to the HMGB1(gS100) rather than the unmodified variant (Figure 2-7c,
Appendix B-2). Together, these data demonstrate that the S100A substitution has a direct effect
on the biochemical behavior of HMGB1, strongly indicating that the expression of this loss-of-
function mutant cannot be used in living systems to accurately study the functional role of HMGB1
O-GlcNAcylation.
52

Figure 2-7. S100A mutation exhibits biochemical properties distinct from unmodified or
HMGB1(gS100) variants. (a) HMGB1(S100A) mutant shows comparable ability to preserve
negative supercoils as unmodified HMGB1 control. (b) HMGB1(S100A) exhibits enhanced
oligomerization on 4-way junction DNA over unmodified HMGB1. The effect of the mutation is
similar to the effect of S100 O-GlcNAcylation as in Figure 2-5a. (c) The amount of
HMGB1(S100A) required to form maximum number of minicircles is indicated by *. The
saturation binding curves and half-maximal ratio for minicircle formation is similar to
HMGB1(gS100). For quantification of this and a replicate experiment, please see Appendix B-2.
All results shown in this figure are representative of at least 2 experiments.

53
2.8 O-GlcNAc modification of HMGB1 results in error-prone processing of DNA lesions
Given the well-documented role of HMGB1 in DNA damage repair pathways and our
observations demonstrating how O-GlcNAc alters HMGB1 interactions with DNA structures that
represent targets or intermediates of repair mechanisms, we next tested whether HMGB1(gS100)
participates differentially in the repair or processing of DNA lesions. We have shown previously
that HMGB1 binds a 57-bp ICL-damaged DNA substrate with high affinity and specificity (Reddy
et al., 2005). Using the same EMSA conditions, we found that O-GlcNAc results in increased
oligomerization (Figure 2-8) similar to our findings with other DNA structures. In contrast,
HMGB1(S100A) behaves similarly to unmodified protein.

Figure 2-8. Binding of HMGB1 variants to a 57-bp ICL-damaged DNA substrate. Psoralen
triplex-forming oligos were added to radiolabeled 57-bp DNA and irradiated with UVA to form
triplex ICL DNA (1 nM). Ten or 100 molar equivalents of each HMGB1 variant were used during
complex formation. Complexes were resolved by native polyacrylamide gel electrophoresis and
visualized using a phosphorimager.

54
In order to investigate the biological consequence of this altered affinity in the context of
DNA damage processing, we then utilized a cell-free assay (Mukherjee & Vasquez, 2016) wherein
purified HMGB1 can be added into cell extracts from which endogenous HMGB1 protein has been
depleted. To these extracts, the interstrand crosslinked (ICL) reporter plasmid pSupFG1 is
introduced. The cell extracts are then activated and DNA processing is allowed to proceed.
Mutation frequencies on the reporter plasmid can then be determined through blue-white screening
(Mukherjee & Vasquez, 2016). Importantly, the ICL is introduced onto the reporter plasmid
through a triplex-forming oligonucleotide (TFO) which allows specific targeting of a defined
region in the plasmid (Mukherjee & Vasquez, 2016). This allowed us to assess the types of
mutations that persist at the end of the assay.

To deplete HMGB1, we used siRNA treatment of human osteosarcoma U2OS cells
resulting in ~90% depletion of HMGB1 (Figure 2-9a). Although no detectable increase in mutation
frequencies was observed in the undamaged plasmid as a result of the HMGB1-knockdown, ICL-
damaged plasmids showed ~30-fold induction in mutagenesis in HMGB1-depleted extracts
compared to ~4-fold with wild-type extracts (Figure 2-9c), confirming the role of HMGB1 in error-
free processing of these lesions in U2OS extracts. We then supplemented HMGB1-depleted
extracts with unmodified HMGB1, HMGB1(gS100), and HMGB1(S100A) int the DNA repair
assays (Figure 2-9b). Complementing the HMGB1 depleted extracts with recombinant HMGB1
resulted in the expected lower level of mutagenesis in ICL-damaged plasmids (~7-fold),
comparable to the mutagenesis yielded from wild type extracts. This demonstrates that addback of
purified proteins can act as a surrogate for depleted HMGB1. Interestingly, complementing the
extract with HMGB1(gS100) reduced the error-free processing of ICL-damaged plasmids
55

Figure 2-9. O-GlcNAc modification of HMGB1 results in error-prone processing of the
TFO-directed ICLs in human U2OS whole cell extract. (a) Immunoblot demonstrating siRNA-
mediated depletion of HMGB1 in U2OS cell extract. (b) Immunoblot demonstrating
supplementation of HMGB1-depleted extract with purified HMGB1, HMGB1(gS100), and
HMGB1(S100A) proteins. Wild-type, non-HMGB1 depleted extract was used as control. (c)
Mutagenesis assays showing spontaneous mutation frequencies (undamaged plasmid) and TFO-
directed ICL induced mutation frequencies (ICL-damaged plasmid) using HMGB1-depleted cell
extracts without or with HMGB1/ HMGB1(gS100), or HMGB1(S100A) protein add-back. The
error bars indicate ± SD. P-values were calculated from one-way ANOVA followed by post hoc
Tukey. (d) Mutation spectra generated from sequencing N=10 mutant colonies from each of the
experimental groups in B.
56

resulting in high mutation frequencies comparable to HMGB1-depleted extracts. Further, we found
that the background mutation frequency in undamaged plasmid was also significantly higher when
the extracts were supplemented with HMGB1(gS100) compared to all other experiments (Figure
2-9c). These results suggest an increase in spontaneous replication errors, a reduction in the
processing of DNA damage, or a combination of these when HMGB1 is O-GlcNAcylated.
Meanwhile, complementing the HMGB1 depleted extracts with HMGB1(S100A) protein also
resulted in a reduction of mutation frequencies in ICL-damaged plasmid, although the magnitude
of reduction was less than when wild-type HMGB1 was used, suggesting somewhat less efficient
ICL processing in the mutant. In contrast to HMGB1(gS100), the background mutation frequency
of undamaged plasmid from HMGB1(S100A) addback was unaffected.

We also sequenced the mutations in the mutation-reporter plasmids to characterize the
mutation spectra as a function of the addback experiments. The sequencing results across the
different experiments revealed four distinct types of mutations (Figure 2-9d). Base substitutions,
insertions, and small deletions were mostly localized to and around the targeted thymine base in
the TFO-binding region of sequences isolated from wild-type extract. In addition to these types of
mutations, sequences recovered from HMGB1 depleted extracts also showed multiple consecutive
AàC transversions and TàC transitions in the TFO-binding region, resulting in what we termed
“C-tracts.” Sequences from both the HMGB1 and HMGB1(S100A) supplemented groups showed
the presence of all four types of mutations at different frequencies. Interestingly, no base
substitutions were detected in mutants from the HMGB1(gS100)-supplemented group. Although
our limited sequencing data precludes assessment of statistical significance of differences in the
observed mutation spectra, taking together the results from these experiments suggests that O-
57
GlcNAcylation of HMGB1 interferes with the repair of ICL-damaged DNA, resulting in error-
prone processing and potentially altered mutation signatures.

2.9 Conclusions
Through protein semi-synthesis and biochemistry, we discovered that the PTM O-GlcNAc
changes the way HMGB1 interacts with different types of DNA structures. These alterations likely
occur by influencing known features that determine HMGB1-DNA interactions specifically (1)
the ability to form ionic interactions with the basic linker region located N-terminally of the S100
O-GlcNAc site, and (2) HMGB1’s oligomerization propensity. The positive charges from the K96
and R97 residues are important for HMGB1 binding to negatively supercoiled DNA and given that
O-GlcNAc at S100 reduces the affinity of HMGB1 for negatively supercoiled DNA, the sugar
moiety may be interfering with the ionic interactions required from this basic region. Interestingly,
the S100A mutation does not cause the same loss in affinity for negatively supercoiled DNA
suggesting that O-GlcNAc’s effect on the ionic interactions may be based on its bulk. On the other
hand, oligomerization on 4WJ, nucleosomal, and short linear DNA (in circularization assays) is
highly enhanced by O-GlcNAc, and this effect is comparable to the enhancement in
oligomerization by the S100A mutation in all three assays. Importantly, the distinct behaviors of
HMGB1(gS100) and HMGB1(S100A) in our biochemical experiments indicate that loss-of-
function mutation experiments in living systems may not faithfully interrogate the consequences
of O-GlcNAcylation.

We also discovered that the perturbations in HMGB1-DNA interactions translate to
alterations in activity during DNA damage processing. We observed that while unmodified
58
HMGB1 can efficiently participate in NER-dependent processing of ICL-damaged plasmids (S S
Lange et al., 2008; Mukherjee & Vasquez, 2016), O-GlcNAcylation at S100 abolishes this activity.
We previously proposed that HMGB1’s participation in NER occurs at least in part via damage-
specific architectural modification, i.e. through induction of negative supercoiling in ICL-damaged
plasmids(Mukherjee & Vasquez, 2016). The observation that HMGB1(gS100) suffers from a loss
in affinity for negative supercoils in our biochemical studies may partially explain the loss in error-
free processing. On the other hand, HMGB1(S100A), which essentially performed similarly to
unmodified HMGB1 in in vitro negative supercoiling assays, also demonstrated a milder loss in
DNA processing efficiency. This indicates that other mechanisms may also be at play. We
hypothesize that the increased oligomerization propensity of HMGB1(gS100) and
HMGB1(S100A) may also contribute to inefficient DNA damage processing, for instance by
sequestering the damage site from repair proteins or by interfering with the formation of productive
protein complexes such as that with the NER co-factor XPA (Mukherjee & Vasquez, 2016).
Importantly, we have found that the oligomerization of HMGB1(gS100) on an ICL-damaged DNA
substrate is markedly enhanced (Figure 2-8) and this effect is not recapitulated by the
HMGB1(S100A) mutant albeit having demonstrated increased oligomerization on other DNA
structures. This further highlights the insufficiency of this mutant as a tool for studying the effects
of O-GlcNAc.

While speculative, our results may have implications for O-GlcNAc in cancer. The overall
levels of O-GlcNAcylation are increased in tumors and cancer cells compared to healthy tissue
(Fardini et al., 2013), and O-GlcNAc promotes tumor survival and tumorigenesis in xenografts (de
Queiroz et al., 2014; Fardini et al., 2013). However, evidence for O-GlcNAc contributing to the
59
initiation of cancer is much more limited. Given our results, we postulate that increased O-
GlcNAcylation of HMGB1 may contribute to the accumulation of DNA mutations in cells, thus
promoting the transition from healthy to diseased states.

Notably, the S100 residue is also known to be phosphorylated (Mertins et al., 2014;
Wilson-Grady et al., 2013). Given that the interplay between O-GlcNAc and phosphorylation is
widely documented for different proteins (Hart et al., 2011), reciprocal crosstalk between these
two PTMs can occur wherein the presence of O-GlcNAc may block the ability of HMGB1 to be
phosphorylated or vice versa. This may have important implications especially if phosphorylation
affects HMGB1 in a different or opposite manner than what we observed for O-GlcNAc.
Importantly, not all PTMs can induce dramatic alterations to protein structure and function, for
instance phosphorylation studies of the HMGB1-related protein HMGN1 has recently shown mild
to neutral effects on DNA binding (Niederacher et al., 2021). Thus, understanding the direct effects
of phosphorylation of HMGB1 at S100 will be a critical point of interest for future studies, as well
as understanding the dynamics of these two PTMs in the context of living systems.

HMGB1 is a jack-of-all-trades protein within the nucleus, hence our approach could enable
future investigations on the consequences of O-GlcNAc to HMGB1’s participation in other nuclear
processes. Additionally, since the discovery of a proinflammatory function when HMGB1 is
released extracellularly by necrotic cells (Harris & Andersson, 2004), it has also been annotated
with numerous roles and functions in immune activation and signaling, and is more recently widely
studied as a molecule-of-interest in diverse clinical contexts (Bertheloot & Latz, 2017; Harris et
60
al., 2012). Our synthetic strategy may be extended to study these other functions (Mandke &
Vasquez, 2019), as well as other PTMs (e.g. phosphorylation at S100) that occur within this region.

61
2.10 Materials and methods
General
All solvents and reagents were purchased from commercial sources and used without any
further purification. All aqueous solutions were prepared using ultrapure laboratory grade water
(deionized, filtered, and sterilized) obtained from an in-house water purification system. Growth
media were prepared, sterilized, stored, and used according to the instructions of the manufacturer.
Antibiotics were prepared as stock solutions at a concentration of 1000× (100 mg/mL ampicillin
sodium salt) and stored at -20 °C. All bacterial growth media and cultures were handled using
sterile conditions under an open flame. Protein concentrations were determined by the Pierce BCA
Protein Assay Kit (Thermo Fisher Scientific). Reversed-phase high-performance liquid
chromatography (RP-HPLC) was performed using an Agilent Technologies 1200 Series HPLC
instruments with a diode array detector with semi-preparative and analytical C4 or C18 columns
from Higgins Analytical. The following reversed-phase chromatography solvents were used:
Solvent A, 0.1% TFA in H
2
O; solvent B, 0.1% TFA and 90% ACN in H
2
O. Mass spectra were
acquired on an API 150EX LC/MS-MS system (Applied Biosystems/MDS SCIEX) or a Daltonics
Autoflex MALDI-TOF (Bruker) using α-cyano-4-hydroxycinnamic acid (HCCA) as matrix.
Oligonucleotides were ordered from commercial sources (IDT DNA) with the standard desalting
and purification methods. Statistical testing was performed using GraphPad Prism 8.

Molecular cloning and plasmids
Constructs for mammalian expression were derived from the pcDNA3.1-FLAG-HMGB1
vector, a gift from Yasuhiko Kawakami (Addgene plasmid #31609; RRID:Addgene_31609). This
expression vector was used as is as the wild-type variant. S100A, S107A, and double mutants of
62
the FLAG-HMGB1 construct were prepared using QuikChange Site-Directed mutagenesis kit
(Agilent) following manufacturer protocol. An HA-tagged HMGB1 mammalian overexpression
vector was constructed using standard restriction digestion-based cloning methods. The insert was
amplified with PCR overhang to append a 5’ AgeI cut site and HA-tag and 3’ HindIII cut site. This
insert was digested and ligated back into the same pcDNA3.1 backbone of the FLAG-HMGB1
construct using T7 ligase. Sequences were confirmed via Sanger sequencing (Laragen) using CMV
primers.

Codon-optimized HMGB1 gene for E. coli expression was designed with and synthesized
by Genscript. Inserts corresponding to full-length protein, 1-93, and 106-215 were amplified using
overhang PCR to attach 5’ NdeI and 3’ Bpu10I cut sites using KOD HotStart Master Mix (EMD
Millipore). Inserts were digested with restriction enzymes (NEB), and ligated with T4 DNA ligase
(NEB) onto a pTXB1 vector that was digested and treated with calf intestine phosphatase. The
pTXB1 vector allows fusion of a C-terminal intein-6xHis tag for affinity purification. DNA
ligations were transformed onto high efficiency DH5ɑ competent cells (NEB) and selected on
ampicillin plates. Correct clones bearing the intended inserts were determined by restriction
enzyme digestion and Sanger sequencing (Laragen) using T7 and T7-reverse primers.

Expression and purification of GalT(Y289L)
pET23a GalT Y289L plasmid (P. Qasba, National Cancer Institute) was transformed into
BL21 E. coli. Three 500 mL Terrific Broth cultures (EMD Millipore, total 1.5 L media) with 100
ug/mL ampicillin was inoculated starter culture grown overnight at 37 °C. The TB cultures were
grown at 37 °C to an OD of 0.60 and induced with 1mM isopropyl β-D-1-thiogalacto-pyranoside
63
(Carbosynth) for 4 h at 37 °C. Cells were harvested by centrifugation for 15 minutes at 6,000g,
4°C. Cell pellets were resuspended in 30 mL of resuspension buffer (25% sucrose w/v in
Dulbecco’s Phosphate Buffered Saline). The resuspended cells were divided into 6 x 5 mL
fractions and each fraction was sonicated (30 s pulse, 30 s rest, 12 min total) on ice. The lysates
were pooled and diluted to 500 mL with ice-cold suspension buffer. The protein in inclusion bodies
were harvested by centrifugation (20 min, 20,000g, 4 °C). Inclusion bodies were washed 8 times
by repeated cycles of addition of 200 mL suspension buffer, vigorous vortexing, and
centrifugation. Washing was deemed complete when the pellet turned white. Inclusion bodies were
then washed one last time with 200 mL cold wash buffer (10 mM phosphate, pH 7.0) and harvested
by centrifugation. The protein was released from inclusion bodies by first resuspending in 14 mL
of cold H
2
O followed by the addition of solid guanidine HCl and Na
2
SO
3
(final concentrations of
5 M GnHCl and 300 mM Na
2
SO
3
). The solution was vortexed vigorously and diluted to 25 mL
with cold H
2
O. Freshly made 2-nitro-5-sulfothio-benzonate (NTSB) solution (50 mM DTNB, 1 M
Na
2
SO
3
in water pH 8.0) was then added with vigorous vortex mixing to sulfonate free thiols. The
solution gradually changed color from dark orange to pale yellow, suggesting completeness of the
reaction. The protein was precipitated with cold H
2
O (250 mL) at which point the sulfonated
protein precipitated and was centrifuged immediately (30 min, 10,000g, 4 °C). The protein pellet
was washed thrice with cycles of resuspension in cold water and centrifugation. Finally, the protein
pellet was resuspended in 14 mL of cold H
2
O and solid guanidine HCl was added. The solution
was vortexed to resuspend completely and centrifuged at 5,000g for 15 mins at room temperature.
Protein concentration was adjusted to 1 mg/mL with a 5M GuHCl solution so that the OD at 275
nm is around 2.0. This solution was slowly diluted 10-fold by the addition of ice-cold refolding
buffer (5 mM EDTA, 4 mM cysteamine, 2 mM cystamine, 100 mM Tris base, pH 8.0) with gentle,
64
continuous swirling. Refolding was allowed to proceed for 48 h at 4 °C without agitation. Refolded
protein was dialyzed twice into cold, ultrapure water for 24 hours each. Precipitated protein was
removed by centrifugation (15,000 g, 15 mins at 4°C). Protein was concentrated first with pressure
concentrators using a 10K ultracel regenerated cellulose filter, and finally with Amicon 10kDa
MWCO centrifugal filters. Protein was buffer exchanged to 10 mM Tris base, pH 8.0 buffer, and
final protein concentration was adjusted to 1 mg/mL. Enzyme purity was assessed by SDS-PAGE
and activity through chemoenzymatic labeling and fluorescence detection.

Chemoenzymatic pulldown of endogenously O-GlcNAc modified proteins
Human non-small cell lung carcinoma, H1299 cells (ATCC) were grown in RPMI media
supplemented with 10% FBS, at 37°C under 5% CO
2.
Cells at 90% confluency were collected by
trypsinization, resuspension in Dulbecco’s Phosphate Buffered Saline (DPBS, Corning), and
centrifugation. Cell pellets were washed twice with DPBS. Cell pellets were initially resuspended
in 0.05% SDS buffer (0.05% SDS, 5 mM MgCl
2
, 10 mM triethanolamine, pH 7.4) onto which
Benzonase (Sigma) was added to reduce viscosity. After 30 minutes incubation on ice, 4% SDS
buffer (4% SDS, 150 mM NaCl, 50 mM TEA, pH 7.4) was added. The solution was bath sonicated,
centrifuged, and the supernatant was collected. Protein concentration was determined, and the
lysate was diluted to 1 mg/mL in 1% SDS chemoenzymatic transfer buffer (1% SDS, 20 mM
HEPES, pH 7.9). Proteins were then precipitated through methanol chloroform precipitation, first
by the addition of 3X methanol, 0.75X chloroform, and 2X water. The suspension was centrifuged,
and the top layer was carefully removed, after which the protein pellet at the interface was washed
with 2.25X methanol. Following centrifugation, the pellet was dried and then subjected to
chemoenzymatic transfer.
65
The protein precipitate was resuspended in 1% SDS chemoenzymatic transfer buffer.
Concentrations were determined using BCA assay and 1 mg of total protein was used during the
chemoenzymatic labeling. To set up the transfer, protein concentrations were adjusted to 2.5
mg/mL by diluting in 1% SDS chemoenzymatic transfer buffer to a final volume of 400 uL. The
following reagents were added then added: 390 µL of H
2
O, 800 µL of labeling buffer (2.5X:
5%NP-40, 125 mM NaCl, 50 mM HEPES, pH 7.9), 110 µL of 100 mM MnCl
2
, 150 µL of UDP-
GalNAz (0.5 mM in 10 mM HEPES, pH 7.9). After vortexing, 112.5 µL of GalT(Y289L) enzyme
were added and the reactions were mixed by swirling with the pipet tip gently. Reactions were
incubated for 4 °C without agitation. After 20 hours, 185 µL of 600 mM iodoacetamide in H
2
O
were added to each reaction (50 mM final concentration) and reactions were incubated in the dark
at room temperature for 30 min in order to cap reactive cysteines. Proteins were then precipitated
from the mixture by methanol-chloroform precipitation.

Protein pellets were air dried and resuspended first in 4% SDS TEA buffer (4% SDS, 600
mM NaCl, 200 mM triethanolamine, pH 7.4) at 4 mg/mL protein concentration. Inputs were
prepared by taking 50 µg of protein and adding the same volume of 2X loading buffer (20%
glycerol, 0.2% bromophenol blue, 1.4% β-mercaptoethanol) to a final protein concentration of 2
mg/mL. The protein concentrations were diluted with water to 1 mg/mL protein at 1% final SDS
concentration. Freshly made CuAAC master mix were then added so that the final reactions
contained 100 µM alkyne-azo-biotin, 1 mM TCEP, 100 µM TBTA, and 1 mM CuSO
4
:5H
2
O. After
1h in the dark, EDTA was added (5 mM final concentration) to quench the reaction, and the
proteins were again precipitated by methanol-chloroform precipitation.

66
For the biotin pulldown of O-GlcNAcylated proteins, pellets were dissolved in 4% SDS
TEA buffer and resuspended completely by boiling and bath sonication. The SDS and protein
concentrations were adjusted to 0.2% and 0.5 mg/mL respectively, and 50 µL Neutravidin beads
(ThermoFisher Scientific) pre-washed in 0.2% SDS TEA buffer were added. Beads were subjected
to full rotation for 1.5 h, collected, then washed with 30 mL of wash buffer (1% SDS in PBS, pH
7.4) using a vacuum manifold. Beads were transferred to dolphin-nosed tubes, into which 100 µL
of elution buffer (25 mM sodium dithionite, 1% SDS in PBS, pH 7.4) were added. Proteins were
eluted at room temperature for 30 min. Elutions were collected by spinning down the beads (2000g
for 3 min) and transferring the supernatant into a fresh tube. Addition of elution buffer was
repeated one more time, and elutions were pooled. Eluted proteins were precipitated by the
addition of 4X volume of cold methanol and incubation at -20 °C over 2 hours. Enriched proteins
were collected, the supernatant was removed, and the pellets were air-dried. Enriched proteins
were resuspended in 15 µL of 4% SDS TEA buffer and 15 µL of 2X loading buffer, boiled, and
stored for SDS-PAGE and immunoblotting.

FLAG- and HA- mutant chemoenzymatic pulldown
H1299 cells cells grown at 80% confluency were contransfected with 18 μg pcDNA3.1
FLAG-HMGB1 (wild-type or mutant) and 2 μg pcDNA3.1 HA-HMGB1 (wild-type) DNA using
Lipofectamine 2000 (Invitrogen) according to manufacturer’s standard protocol. The DNA
amounts were previously optimized to result in comparable signal production during the
immunoblotting step. Cells were collected by trypsinization 16 hours post-transfection and
subjected to the same chemoenzymatic pulldown experiment described above. During SDS-
67
PAGE, 10 μg of inputs were loaded while half of the volume of the pulldown sample were loaded
per well.

For imaging of the immunoblots, both FLAG- and HA-blots were imaged simultaneously
to enable quantification and normalization. Protein levels were quantified using the signal volume
tool on the ChemiDoc Image Lab software. Normalized IP signals were calculated by dividing the
densitometric value of the pulldown band by the input band for the same sample. To compare
normalized IP values, an average of the normalized IP values for the HA (wild-type) experiments
was calculated and used as baseline. The normalized IP values of the mutant experiments were
then divided by this average to obtain the pulldown efficiency ratio shown in Figure 2-1c.

SDS-PAGE and Western Blotting
Gel samples were bath sonicated and boiled for 10 min prior to running SDS-PAGE on
precast 4-20% polyacrylamide gels (BioRad) with Tris-Glycine running buffer (BioRad).
Separated proteins were transferred on PVDF membranes using a semi-dry transfer apparatus at
20V for 1 hour. After transfer, membranes were blocked for 1 h at room temperature using
OneBlock Western-FL Blocking Buffer (Genesee Scientific). Primary antibody incubation was
performed by the addition of antibodies diluted in OneBlock buffer (Anti-HMGB1 1:5,000 CST
3935; Anti-Beta Actin 1:10,000 Sigma A2066; Anti-Nup62 1:5,000 BD Bioscience 610497; Anti-
FLAG 1:1,000 CST 2368; Anti-HA 1:1,000 CST 3724). Primary antibody was incubated at 4 °C
overnight with rocking. Antibody solution was removed and membranes were washed with TBST
(137 mM NaCl, 20 mM Tris, 0.1% Tween-20, pH 7.6, Cell Signaling Technology) for 10 mins,
repeated three times. HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (1:10,000,
68
Jackson ImmunoResearch) in OneBlock buffer were added to the membranes followed by
incubation at room temperature for 1 hour with rocking. Membranes were washed with TBST
three times for 10 minutes each. Membranes were then developed with Western ECL Substrates
(Biorad) and imaged using a ChemiDoc XRS+ Imager (Bio-Rad). Densitometric analyses were
performed using BioRad Image Lab software. For membranes that were re-probed by consecutive
addition of primary antibodies (from orthogonal source organisms), 1% sodium azide w/v in
OneBlock buffer was added during the blocking and primary antibody incubation steps to
deactivate any bound HRP-conjugated secondary antibodies.

Generation of HMGB1 1-93 Thioester (1)
BL21(DE3) (EMD Millipore) cells were transformed with HMGB1(1-93)AvaE-6xHis
fusion plasmid DNA using heat shock method and transformants were selected on ampicillin
plates. A starter culture was grown overnight at 37°C overnight from a single colony. 3L of terrific
broth were then inoculated with the overnight culture and grown to an OD
600
of 0.6-0.8 at 37 °C
while being shaken at 250 rpm. Protein expression was induced by the addition of IPTG at a final
concentration of 0.5 mM. Induction was allowed to proceed overnight at 16°C with shaking at 250
rpm. Cells were harvested at 6,000g, and resulting pellets were resuspended in lysis buffer (20 mM
NaH
2
PO
4
, 250 mM NaCl, 1 mM TCEP, 5 mM imidazole, and 2 mM PMSF, pH 7.5). The slurry
was tip sonicated on ice (75% amplitude, 30s on, 30s off, total of 6 minutes) and clarified by
centrifugation (7000g for 60 min at 4 °C). Supernatants were loaded onto Co-NTA agarose beads
(Genessee Scientific) and washed extensively (20 mM NaH
2
PO
4
, 250 mM NaCl, 2 mM TCEP, 20
mM imidazole pH 7.5). Protein was eluted (20 mM NaH
2
PO
4
, 250 mM NaCl, 1 mM TCEP, 250
mM imidazole, pH 7.5) and dialyzed into DPBS to remove excess imidazole. The intein was
69
removed through transthioesterification by the addition of sodium mercaptoethanesulfonate
(MESNa) a final concentration of 250 mM at pH 7 prior to overnight incubation at room
temperature. Fragment 1 thioester was finally purified by reversed phase liquid chromatography
and pure proteins were characterized by analytical RP-HPLC and mass spectrometry. Purified
proteins were freeze-dried prior to storage. Typical yield: 5 mg of fragment (1) per L of culture.

Generation of HMGB1 Ac
3
GlcNAc Ser100 Sec94-105NHNH
2
(2)
Standard manual Fmoc-based solid phase peptide synthesis were used. 2-chlorotrityl resin
(Anaspec) was functionalized with the C-terminal hydrazide according to published protocol
(Zheng et al., 2013). Commercially available N-Fmoc and side-chain- protected amino acids (10
equiv, Advanced ChemTech) were activated for 5 min with HBTU (10 equiv, Novabiochem) and
N,N-diisopropylethylamine (DIEA) (20 equiv) and coupled to the resin for 1h with constant
agitation. Protected O-GlcNAcylated serine was prepared as O-pentafluorophenyl (Pfp)-activated
esters as previously described(De Leon et al., 2018) and 2 equivalents were used during coupling
without HBTU or DIEA. After each coupling, the resin was washed and the terminal Fmoc group
was removed with 20% v/v piperidine in dimethylformamide (DMF) for 15 mins. Deprotection
step was repeated by the addition of fresh 20% piperidine. The final selenocysteine residue was
added from a commercially-available para-methoxybenzyl-protected Fmoc amino acid
(ChemImpex) that was also pre-activated and couples as an O-Pfp ester. The final Fmoc group on
selenocysteine was removed as described above. Peptides were then cleaved from the resin by the
addition of standard cleavage cocktail (95:2.5:2.5 TFA/H
2
O/triisopropylsilane) supplemented with
1.3 eq of dithiobis(5-nitropyridine) (DTNP, Sigma) for 4 h at room temperature. The peptides were
precipitated in pre-cooled ether and incubated overnight (−80 °C). The peptides were collected by
70
centrifugation (10 min, 5000g, 4 °C), and resuspended in 50:50 acetonitrile:H
2
O, flash frozen, and
lyophilized. The crude peptide mixture was purified by RP-HPLC (Solvent A = 0.1%
trifluoroacetic acid in H
2
O; B = 0.1% trifluoroacetic acid, 10% H
2
O, 90% acetonitrile) over a C18
semipreparative column (Higgins Analytical). Peptide purity was confirmed by analytical RP-
HPLC and characterized by ESI and MALDI-MS. 8 mg of purified fragment (2) was isolated from
a 0.1 mmol scale synthesis.

Generation of HMGB1 106-215 (3)
BL21(DE3)-pLysS (EMD Millipore) cells were transformed with HMGB1(106-215)-
AvaE-6xHis fusion plasmid DNA. Expression and His-tag purification were performed as above
for the 1-93 construct. After dialysis of the fusion protein, the intein domain was hydrolyzed by
the addition of 250 mM dithiothreitol. The pH of the solution was adjusted to >8 and the mixture
was incubated at 37°C with rotation for 48h. The reaction was acidified by the addition of
perchloric acid to 5% v/v final concentration. Precipitated protein was removed and the
supernatant contained mostly the desired fragment. Methoxylamine was added to 150 mM to
deprotect the N-terminal cysteine and the pH was adjusted to 4. After 24h incubation at room
temperature, Fragment 3 was purified by RP-HPLC over a C4 semipreparative column. Peptide
purity was confirmed by analytical RP-HPLC and the identity was determined by ESI and
MALDI-MS. Typical yield: 1 mg of fragment (3) per L of culture.

Ligation and deselenization generating HMGB1 Ac
3
GlcNAc Ser100 1-105NHNH
2
(4)
Fragment 1 (11 mg, 1.10 μmol, 4mM final concentration, 1 eq) and fragment 2 (2 mg, 1.11
μmol, 4 mM final concentration, 1 eq) were dissolved in 250 μL of degassed ligation buffer (6M
71
guanidine HCl, 100 mM phosphate, 100 mM L-ascorbic acid, 50 mM TCEP, 250 mM
mercaptophenylacetic acid, pH 7). Reaction was monitored by analytical C4 RP-HPLC and
ligation product was detected after 1h. After 16h, the mixture was buffer exchanged 1000-fold into
6M guanidine HCl, 100 mM phosphate pH 6 to remove MPAA. Dithiothreitol was added to a final
concentration of 25 mM and the mixture was incubated for 10 mins to fully reduce the
selenocysteine residues. Solid TCEP was added to a final concentration of 100 mM and the pH
was adjusted to 5. Analytical RP-HPLC and ESI-MS were used to monitor the conversion of
selenocysteine to alanine. After 4 hours, deselenization was deemed complete and fragment 4 was
purified by semipreparative RP-HPLC on a C4 column. Purity of the product and identity were
confirmed by analytical RP-HPLC and MALDI-MS, respectively. Total isolated yield: 4.15 mg.

Ligation and acetate deprotection generating full-length O-GlcNAc Ser100 HMGB1
Fragment 4 (4.15 mg) was dissolved in 110 μL of 6M guanidine HCl, 200 mM phosphate,
pH 3 buffer and cooled to -20°C. To this was added 10 μL of 0.5M NaNO
2
solution (50 mM final
concentration) and the reaction was stirred at this temperature. After 15 mins, 3.2 mg of solid
MPAA was added. The pH was adjusted to 6.5 and the solution was warmed to room temperature.
Fragment 3 (3 mg) in 110 uL 6M guanidine HCl, 200 mM phosphate, pH 6.5 buffer was added to
begin protein ligation. The pH was carefully adjusted to 7. At this point, the reaction is 1 mM in
each fragment 200 mM in MPAA. Ligation product was detected after 1 hour by analytical RP-
HPLC and ESI-MS. Ligation product was purified by semi-preparative HPLC and freeze dried to
obtain 3.4 mg of product. To remove the O-acetyl protecting groups, this protein was dissolved in
5% hydrazine monohydrate in H
2
O and incubated for 1 hour at room temperature. The reaction
72
was quenched with 5% acetic acid, and fully reduced by the addition of solid TCEP before
purification over C4 semi-preparative RP-HPLC. Final isolated yield: 1.6 mg.

Expression of full-length unmodified HMGB1 and S100A mutant
BL21(DE3)-pLysS (EMD Millipore) cells were transformed with HMGB1(1-215)-AvaE-
6xHis fusion plasmid DNA, either wild-type or the S100A mutant. Expression and His-tag
purification were performed as above. After dialysis of the fusion protein, the intein domain was
hydrolyzed by the addition of 250 mM dithiothreitol. The pH of the solution was adjusted to >8
and the mixture was incubated at 37°C with rotation for 48h. The reaction was acidified by the
addition of perchloric acid to 5% v/v final concentration. Precipitated protein was removed and
the supernatant contained mostly the desired fragment. Full-length HMGB1 protein was purified
by RP-HPLC over C4 semipreparative column. Peptide purity was confirmed by analytical RP-
HPLC and the identity was determined by ESI and MALDI-MS. Typical yield: 1 mg of unmodified
HMGB1 or 0.5 mg HMGB1(S100A) per L of culture.

Refolding and circular dichroism
Freeze dried HMGB1 or HMGB1(gS100) were refolded by resuspending in 10 mM Tris,
1 mM EDTA, 50 mM NaCl, 0.5 mM DTT, pH 7.4. Protein concentrations were determined using
A
280
absorbance using Abs 0.1% (g/L) = 0.865 (calculated from sequence), and adjusted to 5 uM
with the same buffer. Samples were placed in 1 mm path length quartz cuvette and far UV spectra
(190 nm-250 nm) were obtained by averaging three scans with a 50 nm min
-1
scanning speed, 1
nm bandwidth, 1 nm step size, and data integral speed of 4 sec. The blank buffer readings were
subtracted for all samples, and the data were converted into mean residue ellipticity.
73
Topoisomerase I Supercoiling Assay
pUC19 DNA was propagated in E. coli DH5α cells and isolated by standard miniprep
techniques (QIAGEN). Indicated amounts of HMGB1 and pUC19 (150 ng) were mixed in low
ionic strength buffer (10 mM potassium acetate, 4 mM Tris acetate, 2 mM magnesium acetate, 1
mM DTT, 20 ug/mL bovine serum albumin, pH 7.9) and incubated at room temperature. After 20
mins, 0.2 units of E. coli Topoisomerase I (NEB) were added and the reaction was incubated at
37°C for 1 hour. Reaction was deproteinized with the addition of Proteinase K to a final
concentration of 100 μg/mL and further incubation at 37°C for an additional hour. The samples
were ran on 1% agarose gel without any dye at 50V for 3 hours. The gel was stained with GelRed
(Biotium) according to manufacturer instructions and imaged using ChemiDoc XRS+ Imager
(Bio-Rad).

Four-way junction electrophoretic mobility shift assay
Single strand oligonucleotides were ordered from IDT DNA and were based on published
sequences known to form cruciforms that HMGB1 binds with high affinity(Marco E Bianchi et
al., 1989):

Strand 1: 5’ – CCCTATAACCCCTGCATTGAATTCCAGTCTGATAA – 3’
Strand 2: 5’ – GTAGTCGTGATAGGTGCAGGGGTTATAGGG – 3’
Strand 3: 5’ – AACAGTAGCTGTTATTCGAGCTCGCGCCCTATCACGACTA – 3’
Strand 4: 5’ – TTTATCAGACTGGAATTCAAGCGCGAGCTCGAATAACAGCTACTGT – 3’

74
Four-way junction DNA was prepared by dissolving equimolar amounts of the four strand
DNA in annealing buffer (10 mM Tris, 50 mM NaCl, 1 mM EDTA, pH 8). The mixture was heated
to 95°C for 5 mins and slowly cooled to room temperature over 45 mins. Formation of the junction
was confirmed by agarose gel electrophoresis. For the gel retardation assay, pre-cast 5% Tris-
borate-EDTA gel (BioRad) was pre-run in 0.5X TBE buffer (Thermo Fisher) for 2 hours on ice.
During this time, complexes were formed by combining cruciform DNA (100 nM final
concentration) with indicated amounts of HMGB1 or its variants 1X binding buffer (25mM Tris-
HCl, 1 mM EDTA, 50 mM NaCl, 2% glycerol, 1 mM DTT, 0.1 mg/mL bovine serum albumin).
Protein-DNA complexes (10 uL total volume) were incubated on ice for 30 mins, after which 2 uL
of 6X native gel loading dye (NEB). Complexes were separated by running the gel at 100V for 1.5
hours on ice. After electrophoresis, the gel was stained with GelRed and imaged. For densitometry
quantifications, ImageLab (Biorad) software was used for band quantification of bound and
unbound fraction of DNA. Data analysis was performed using GraphPad Prism 8 using nonlinear
regression fitting of saturation binding.

Expression and purification of recombinant histones
Histones were expressed and purified as described in Kilic et al. (Kilic et al., 2015). Briefly,
individual wild-type human histones were cloned into pet15b plasmid vectors and expressed in
BL21 DE3 plysS cells. Cells were grown in LB media containing 100 μg/mL ampicillin and 35
μg/mL chloramphenicol at 37°C until the OD600 reached 0.6. Expression was induced by IPTG
addition to a final concentration of 0.5 mM. After 3 h expression, cells were harvested by
centrifugation and resuspended in lysis buffer (20 mM Tris pH 7.5, 1 mM EDTA, 200 mM NaCl,
1 mM βMe, Roche protease inhibitor) and frozen. Cells were lysed by freeze-thawing and
75
sonication. Inclusion bodies were harvested by centrifugation. The inclusion body pellet was
washed once with 7.5 mL of lysis buffer containing 1% Triton and once without. Inclusion body
pellets were resolubilized in resolubilization buffer (6 M GdmCl, 20 mM Tris pH 7.5, 1 mM
EDTA, 1 mM βMe) and dialyzed into urea buffer (7 M urea, 10 mM Tris, 1 mM EDTA, 0.1 M
NaCl, 5 mM 1 mM βMe, pH 7.5). Histones were purified by cation exchange chromatography
using a HiTrap SP HP 5 mL column (GE Healthcare). Fractions were analyzed by SDS-PAGE and
pooled, followed by dialysis into water and lyophilization. Final purification was performed by
preparative RP-HPLC. Purified histones were lyophilized and stored at −20°C until used for
octamer refolding.

Mononucleosome (MN) nucleosome formation
Nucleosomes were prepared following Dyer et al. (Dyer et al., 2003). Typically, 1-5 μg of
147bp or 218bp 601 DNA was combined with purified refolded octamers at experimentally
determined ratios (1:1 to 1:2, DNA to histone octamer) in 30 μl TE (10 mM Tris-HCl pH 7.5, 1
mM EDTA) supplemented with 2 M KCl. These were added to a micro-dialysis unit (Thermo
Scientific, Slide-A-Lyzer – 10,000 MWCO), then dialyzed in TE buffer (10 mM Tris pH 7.5, 0.1
mM EDTA pH 8.0) with a linear gradient from 2 M to 10 mM KCl for 16-18 h, and finally kept
in TEK10 buffer (10 mM Tris pH 7.5, 0.1 mM EDTA pH 8.0, 10 mM KCl) for another 1 h.
Samples were then spun at 20’000 x g for 10 min at 4°C and the supernatant was kept on ice. To
determine the quality of MN assemblies, 0.6% Agarose 0.25 x TB gels were run at 90 V on ice for
90 min.

76
Nucleosome electrophoretic mobility shift assays
EMSAs to determine HMGB1 or HMGB1(gS100) binding to DNA were done in EMSA
buffer (20mM Tris-HCl, 100mM KCl, 1mM DTT), with 10 μL total volume. Typically, 800 nM
stocks of DNA or nucleosomes were mixed with HMGB1 or HMGB1(gS100) to a final
concentration of ~50nM DNA/nucleosome and indicated protein concentration. Reactions were
mixed by pipetting and left for 30 min on icee. Sucrose was added to a final concentration of 5%
and reactions were loaded onto 5% Polyacrylamide gels run in 0.25 x TBE at 100 V for 60 min.
Images were taken using ChemiDoc MP (Biorad).

218bp – 601 sequence:
ATTCGCACACTGTGCCAAGTACTTACTCGTGCGCCCTGGAGAATCCCGGTGCCGAGG
CCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCC
CCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATAC
TGCAGAGATCTCACGAGCCATGGAGTACTTGGTCTCAAACCGCAAGCT

147bp – 601 sequence
GCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCG
CTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCT
AGTCTCCAGGCACGTGTCAGATATATACATCCTGTCG

DNA circularization assay
A pcDNA3 vector was modified to contain a 123bp segment flanked by 5’ and 3’ KpnI
digestion sites. After propagation in DH5ɑ and isolation by miniprep, the plasmid was digested
77
with KpnI enzyme (NEB) and the 123 bp fragment was gel purified. This fragment was further
amplified by PCR (KOD Hotstart, EMD Millipore), KpnI digested, gel purified, and ethanol
precipitated to concentrate the DNA. 100 ng of this DNA was mixed with indicated amounts of
HMGB1 in 1X T4 DNA ligase buffer (10X stock from NEB; 1X final concentrations: 50 mM Tris-
HCl, 10 mM MgCl
2,
0.1 mM ATP, 1 mM DTT, pH 7.5). After complex formation on ice for 20
minutes, 2 units of T4 DNA ligase (NEB) was added per experiment and incubated at room
temperature for 1 hour. The enzyme was heat inactivated at 65°C for 20 mins. 20 units of
Exonuclease II (NEB) were added per reaction. After incubation at 37°C for 30 mins, the reactions
were deproteinized with Proteinase K (100 μg/mL final concentration) at 37°C for 1 hour. DNA
samples were ran on 2% agarose gels (cast without ethidium bromide) at 100 V for 1 hour. Gels
were stained with GelRed and imaged accordingly. Densitometric quantitation were performed
using a ChemiDoc XRS+ Imager with the BioRad Image Lab software. Signal volumes were
normalized to the maximum signal for each experiment and reported as %Maximum minicircles
in Appendix B-2. Nonlinear regression fitting of saturation binding with Hill coefficient was
performed using GraphPad Prism 8.

Triplex-directed ICL formation
Triplex forming oligonucleotide (TFO)-directed site specific interstrand cross links on 57
base pair duplex substrates were prepared as we have described previously (Reddy et al., 2005).
Briefly, triplex substrates were formed by incubating radiolabeled 57 bp duplexes (10
-6
M) with
psoralen-conjugated 30 mer TFOs (10
-6
M) in a triplex binding buffer [10 mM Tris-HCl, pH 7.6,
10 mM MgCl
2
, and 10% (vol/vol) glycerol] at 37 °C for 16 h. Samples were irradiated with 1.8
78
J/cm
2
of UVA (365 nm) to form psoralen ICLs. The efficiency of triplex-ICL formation was
assessed at ~50%.

DNA-protein binding assays
To assess DNA-protein complex formation, 10
-9
M DNA substrate was incubated with
indicated amounts of HMGB1, HMGB1(gS100) or HMGB1(S100A) proteins separately in DNA
binding buffer (25 mM Tris-HCl pH 7.6, 100 mM NaCl, 1 mM DTT, 5 mM EDTA, 100 μg/mL
BSA, 0.01% Nonidet P-40, and 10% glycerol) in a 10 μl reaction volume. Reactions were
subsequently incubated for 20 minutes at 30° C. The DNA-protein complexes were then resolved
on 6% native polyacrylamide (acrylamide:bis acrylamide = 37.5:1) gels in 1× TBE (89 mM Tris-
borate, pH 8.0, 2 mM EDTA) buffer for 2 hours at 4° C. Subsequently, gels were dried, exposed
overnight and visualized using a phosphorimager.

siRNA transfection and Mutagenesis assay
Triplex forming oligonucleotide (TFO) AG30 was synthesized and HPLC purified by
Midland Certified Reagent Co. (Midland, TX) as previously described (Christensen et al., 2004).
The triplex-directed ICL containing pSupFG1 reporter plasmid was prepared and purified as
previously described (Mukherjee & Vasquez, 2016). siRNA transfection was performed as
described before (Mukherjee & Vasquez, 2016). Briefly, HMGB1 depleted whole cell extract was
prepared by reverse transfection of HMGB1 siRNA (Dharmacon, Lafayette, CO) into human
osteosarcoma U2OS cells with RNAiMAX (ThermoFisher, Waltham, MA) as per manufacturer
recommended protocol. Twenty-four hours later a second round of transfection was performed
(forward transfection). Forty-eight hours later after the second transfection, cells were collected
79
and extracts were prepared using the NE-PER Nuclear and Cytoplasmic Extraction Reagent Kit
(ThermoFisher, Waltham, MA) following manufacturer recommended protocol. Depletion of
HMGB1 in the extract was assessed by immunoblot as described before(Mukherjee & Vasquez,
2016). Concentration of HMGB1 in wild type U2OS extract was determined by creating a standard
curve from immunoblot and similar levels of recombinant HMGB1, O-GlcNAc-modified HMGB1
and S100A-HMGB1 were added to the HMGB1 depleted extract for mutagenesis assays.

Mutagenesis assays were performed as described before (Christensen et al., 2004). To
determine the effect of O-GlcNAc modification of HMGB1 and the S100A mutant compared to
HMGB1 in the processing of ICL-induced or UVC-induced DNA lesions, 300 ng of untreated
pSupFG1 plasmid (P) and TFO-directed ICL-induced pSupFG1 (P-ICL) were separately incubated
in 125 μg of whole cell extract in 60 mM KCl, 7.5 mM MgCl2, 0.9 mM DTT, 0.4 mM EDTA, 2
mM ATP, 20 μM each of dGTP, dCTP, dTTP and 8 μM dATP, 40 mM phosphocreatine, 2.5 μg
creatine phosphokinase (Type I, Sigma), 3.4% glycerol and 18 μg BSA. The HMGB1 depleted
extracts were separately supplemented with recombinant HMGB1, HMGB1(gS100), or
HMGB1(S100A). Wild type U2OS extract was used as a positive control. Plasmids were incubated
for 4 hours at 37°C in the extracts. Reactions were terminated by adding 2 μL of proteinase K (20
mg/mL) and 4 μL of 20% SDS per reaction and incubated for 4 hours at 65°C. Plasmids were then
purified by phenol:chloroform:isoamyl alcohol extraction and ethanol precipitation with 0.3M
sodium acetate (pH 5.2). Subsequently, the DNA was resuspended in 20 μL nuclease-free water.
To remove the non-replicated plasmids and asses complete processing, the plasmids were further
treated with 2 μL DpnI restriction endonuclease (BIO-RAD, Hercules, CA) for 2 hours at 37°C
followed by another round of phenol:chloroform:isoamyl alcohol extraction and ethanol
80
precipitation. Subsequently, the DNA samples were resuspended in 20 μL nuclease-free water and
transformations were performed immediately. Mutations generated as a result of DNA damage
processing were identified by transforming 30 μL E. coli MBM7070 electrocompetent cells
(Lucigen, Middleton, WI) with 2 μl of the resuspended DNA followed by plating on XGAL,
ampicillin and IPTG plates for blue/white screening. Sixteen hours post transformation, plates
were collected and colonies were counted. A blue colony represents a functional SupF gene and a
white colony represents a mutated SupF gene. Mutation frequencies were determined by dividing
the total number of mutated white colonies by the total number of colonies. Three individual
experiments were performed for each of the samples and >20,000 colonies were counted per
experiment. Mutation spectra was determined by isolating the mutated plasmids and direct
sequencing of the plasmids.

81
2.11 Chapter references

Agouridas, V., El Mahdi, O., Diemer, V., Cargoët, M., Monbaliu, J. C. M., & Melnyk, O. (2019).
Native Chemical Ligation and Extended Methods: Mechanisms, Catalysis, Scope, and Limitations.
Chemical Reviews, 119(12). https://doi.org/10.1021/acs.chemrev.8b00712

Balana, A. T., Moon, S. P., & Pratt, M. R. (2021). O-GlcNAcylated peptides and proteins for
structural and functional studies. Current Opinion in Structural Biology, 68, 84–93.
https://doi.org/https://doi.org/10.1016/j.sbi.2020.12.005

Bertheloot, D., & Latz, E. (2017). HMGB1, IL-1α, IL-33 and S100 proteins: Dual-function
alarmins. Cellular and Molecular Immunology, 14(1), 43–64. https://doi.org/10.1038/cmi.2016.34

Bianchi, M E, Falciola, L., Ferrari, S., & Lilley, D. M. (1992). The DNA binding site of HMG1
protein is composed of two similar segments (HMG boxes), both of which have counterparts in
other eukaryotic regulatory proteins. Embo J, 11(3), 1055–1063.
http://www.ncbi.nlm.nih.gov/pubmed/1547772%5Cnhttp://www.ncbi.nlm.nih.gov/pmc/articles/P
MC556546/pdf/emboj00088-0262.pdf

Bianchi, Marco E, Beltrame, M., & Paonessa, G. (1989). Specific Recognition of Cruciform DNA
by Nuclear Protein HMG1. Science, 243(4894), 1056–1059.

Bond, M. R., & Hanover, J. A. (2015). A little sugar goes a long way: The cell biology of O-
GlcNAc. Journal of Cell Biology, 208(7), 869–880. https://doi.org/10.1083/jcb.201501101
82
Brázda, V., Laister, R. C., Jagelská, E. B., & Arrowsmith, C. (2011). Cruciform structures are a
common DNA feature important for regulating biological processes. BMC Molecular Biology, 12.
https://doi.org/10.1186/1471-2199-12-33

Champoux, J. J. (2001). DNA Topoisomerases: Structure, Function, and Mechanism. Annu Rev
Biochem, 70, 369–413.

Christensen, L. A., Conti, C. J., Fischer, S. M., & Vasquez, K. M. (2004). Mutation Frequencies
in Murine Keratinocytes as a Function of Carcinogenic Status. Molecular Carcinogenesis,
133(November 2003), 122–133. https://doi.org/10.1002/mc.20026

Clark, P. M., Dweck, J. F., Mason, D. E., Hart, C. R., Buck, S. B., Peters, E. C., Agnew, B. J., &
Hsieh-wilson, L. C. (2008). Direct In-Gel Fluorescence Detection and Cellular Imaging of O -
GlcNAc-Modified Proteins. 11576–11577.

Dardashti, R. N., & Metanis, N. (2017). Revisiting ligation at selenomethionine: Insights into
native chemical ligation at selenocysteine and homoselenocysteine. Bioorganic and Medicinal
Chemistry, 25(18), 4983–4989. https://doi.org/10.1016/j.bmc.2017.05.006

De Leon, C. A., Lang, G., Saavedra, M. I., & Pratt, M. R. (2018). Simple and Efficient Preparation
of O- and S-GlcNAcylated Amino Acids through InBr3-Catalyzed Synthesis of β-N-
Acetylglycosides from Commercially Available Reagents. Organic Letters, 20(16), 5032–5035.
https://doi.org/10.1021/acs.orglett.8b02182
83
de Queiroz, R. M., Carvalho, É., & Dias, W. B. (2014). O-GlcNAcylation: The Sweet Side of the
Cancer. In Frontiers in Oncology (Vol. 4, p. 132).
https://www.frontiersin.org/article/10.3389/fonc.2014.00132

Dunham, S. U., & Lippard, S. J. (1997). DNA sequence context and protein composition modulate
HMG-domain protein recognition of cisplatin-modified DNA. Biochemistry, 36(38), 11428–
11436. https://doi.org/10.1021/bi9709452

Dyer, P. N., Edayathumangalam, R. S., White, C. L., Bao, Y., Chakravarthy, S., Muthurajan, U.
M., & Luger, K. B. T.-M. in E. (2003). Reconstitution of Nucleosome Core Particles from
Recombinant Histones and DNA. In Chromatin and Chromatin Remodeling Enzymes, Part A (Vol.
375, pp. 23–44). Academic Press. https://doi.org/https://doi.org/10.1016/S0076-6879(03)75002-2

Eichman, B. F., Ortiz-Lombardía, M., Aymamí, J., Coll, M., & Ho, P. S. (2002). The inherent
properties of DNA four-way junctions: Comparing the crystal structures of holliday junctions.
Journal of Molecular Biology, 320(5), 1037–1051. https://doi.org/10.1016/S0022-
2836(02)00540-5

Fang, G. M., Li, Y. M., Shen, F., Huang, Y. C., Li, J. Bin, Lin, Y., Cui, H. K., & Liu, L. (2011).
Protein chemical synthesis by ligation of peptide hydrazides. Angewandte Chemie - International
Edition, 50(33), 7645–7649. https://doi.org/10.1002/anie.201100996

84
Fardini, Y., Dehennaut, V., Lefebvre, T., & Issad, T. (2013). O-GlcNAcylation: A New Cancer
Hallmark? Frontiers in Endocrinology, 4, 99. https://doi.org/10.3389/fendo.2013.00099

Gaillard, C., Borde, C., Gozlan, J., Maréchal, V., & Strauss, F. (2008). A high-sensitivity method
for detection and measurement of HMGB1 protein concentration by high-affinity binding to DNA
hemicatenanes. PLoS ONE, 3(8). https://doi.org/10.1371/journal.pone.0002855

Grasser, K. D., Teo, S. H., Lee, K. B., Broadhurst, R. W., Rees, C., Hardman, C. H., & Thomas,
J. O. (1998). DNA-binding properties of the tandem HMG boxes of high-mobility-group protein
1 (HMG1). European Journal of Biochemistry, 253(3), 787–795. https://doi.org/10.1046/j.1432-
1327.1998.2530787.x

Hahne, H., Sobotzki, N., Nyberg, T., Helm, D., Borodkin, V. S., van Aalten, D. M. F., Agnew, B.,
& Kuster, B. (2013). Proteome Wide Purification and Identification of O-GlcNAc-Modified
Proteins Using Click Chemistry and Mass Spectrometry. Journal of Proteome Research, 12(2),
927–936. https://doi.org/10.1021/pr300967y

Hanover, J. A., Krause, M. W., & Love, D. C. (2012). Bittersweet memories: Linking metabolism
to epigenetics through O-GlcNAcylation. Nature Reviews Molecular Cell Biology, 13(5), 312–
321. https://doi.org/10.1038/nrm3334

85
Harris, H. E., & Andersson, U. (2004). The nuclear protein HMGB1 as a proinflammatory
mediator. European Journal of Immunology, 34(6), 1503–1512.
https://doi.org/10.1002/eji.200424916

Harris, H. E., Andersson, U., & Pisetsky, D. S. (2012). HMGB1: A multifunctional alarmin driving
autoimmune and inflammatory disease. Nature Reviews Rheumatology, 8(4), 195–202.
https://doi.org/10.1038/nrrheum.2011.222

Hart, G. W., Slawson, C., Ramirez-Correa, G., & Lagerlof, O. (2011). Cross talk between O-
GlcNAcylation and phosphorylation: roles in signaling, transcription, and chronic disease. Annual
Review of Biochemistry, 80, 825–858. https://doi.org/10.1146/annurev-biochem-060608-102511

Ju, B.-G., Lunyak, V. V, Perissi, V., Garcia-Bassets, I., Rose, D. W., Glass, C. K., & Rosenfeld,
M. G. (2006). A Topoisomerase IIß-Mediated dsDNA Break Required for Regulated
Transcription. Science, 312(5781), 1798 LP – 1802. https://doi.org/10.1126/science.1127196

Jung, Y., & Lippard, S. J. (2003). Nature of full-length HMGB1 binding to cisplatin-modified
DNA. Biochemistry, 42(9), 2664–2671. https://doi.org/10.1021/bi026972w

Kilic, S., Bachmann, A. L., Bryan, L. C., & Fierz, B. (2015). Multivalency governs HP1α
association dynamics with the silent chromatin state. Nature Communications, 6, 7313.
https://doi.org/10.1038/ncomms8313

86
Kim, M. S., Chuenchor, W., Chen, X., Cui, Y., Zhang, X., Zhou, Z. H., Gellert, M., & Yang, W.
(2018). Cracking the DNA Code for V(D)J Recombination. Molecular Cell, 70(2), 358-370.e4.
https://doi.org/10.1016/j.molcel.2018.03.008

Knapp, S., Müller, S., Digilio, G., Bonaldi, T., Bianchi, M. E., & Musco, G. (2004). The long
acidic tail of high mobility group box 1 (HMGB1) protein forms an extended and flexible structure
that interacts with specific residues within and between the HMG boxes. Biochemistry, 43(38),
11992–11997. https://doi.org/10.1021/bi049364k

Lange, S S, Mitchell, D. L., & Vasquez, K. M. (2008). High mobility group protein B1 enhances
DNA repair and chromatin modification after DNA damage. Proceedings of the National Academy
of Sciences of the United States of America, 105(30), 10320–10325.
https://doi.org/10.1073/pnas.0803181105

Lange, Sabine S., & Vasquez, K. M. (2009). HMGB1: The Jack-of-all-trades protein is a master
DNA repair mechanic. Molecular Carcinogenesis, 48(7), 571–580.
https://doi.org/10.1002/mc.20544

Lnenicek-Allen, M., Read, C. M., & Crane-Robinson, C. (1996). The DNA bend angle and binding
affinity of an HMG box increased by the presence of short terminal arms. Nucleic Acids Research,
24(6), 1047–1051. https://doi.org/10.1093/nar/24.6.1047

87
Mandke, P., & Vasquez, K. M. (2019). Interactions of high mobility group box protein 1 (HMGB1)
with nucleic acids: Implications in DNA repair and immune responses. DNA Repair, 83, 102701.
https://doi.org/https://doi.org/10.1016/j.dnarep.2019.102701

Mantovani, F., Covaceuszach, S., Rustighi, A., Sgarra, R., Heath, C., Goodwin, G. H., &
Manfioletti, G. (1998). NF-κB mediated transcriptional activation is enhanced by the architectural
factor HMGI-C. Nucleic Acids Research, 26(6), 1433–1439. https://doi.org/10.1093/nar/26.6.1433

Mertins, P., Yang, F., Liu, T., Mani, D. R., Petyuk, V. A., Gillette, M. A., Clauser, K. R., Qiao, J.
W., Gritsenko, M. A., Moore, R. J., Levine, D. A., Townsend, R., Erdmann-Gilmore, P., Snider,
J. E., Davies, S. R., Ruggles, K. V, Fenyo, D., Kitchens, R. T., Li, S., … Carr, S. A. (2014).
Ischemia in tumors induces early and sustained phosphorylation changes in stress kinase pathways
but does not affect global protein levels. Molecular & Cellular Proteomics : MCP, 13(7), 1690–
1704. https://doi.org/10.1074/mcp.M113.036392

Metanis, N., Keinan, E., & Dawson, P. E. (2010). Traceless Ligation of Cysteine Peptides Using
Selective Deselenization. Angewandte Chemie International Edition, 49(39), 7049–7053.
https://doi.org/https://doi.org/10.1002/anie.201001900

Muir, T. W., Sondhi, D., & Cole, P. A. (1998). Expressed protein ligation: A general method for
protein engineering. Proceedings of the National Academy of Sciences, 95(12), 6705–6710.
https://doi.org/10.1073/pnas.95.12.6705

88
Mukherjee, A., & Vasquez, K. M. (2016). HMGB1 interacts with XPA to facilitate the processing
of DNA interstrand crosslinks in human cells. Nucleic Acids Research, 44(3), 1151–1160.
https://doi.org/10.1093/nar/gkv1183

Murphy IV, F. V., Murphy, F. V, Sweet, R. M., & Churchill, M. E. A. (1999). The structure of a
chromosomal high mobility group protein-DNA complex reveals sequence-neutral mechanisms
important for non-sequence-specific DNA recognition. The EMBO Journal, 18(23), 6610–6618.
https://doi.org/10.1093/emboj/18.23.6610

Niederacher, G., Urwin, D., Dijkwel, Y., Tremethick, D. J., Rosengren, K. J., Becker, C. F. W., &
Conibear, A. C. (2021). Site-specific modification and segmental isotope labelling of HMGN1
reveals long-range conformational perturbations caused by posttranslational modifications. RSC
Chemical Biology, 2(2), 537–550. https://doi.org/10.1039/D0CB00175A

Ohndorf, U.-M., Rould, M. A., He, Q., Pabo, C. O., & Lippard, S. J. (1999). Basis for recognition
of cisplatin-modified DNA by high-mobility-group proteins. Nature, 399(6737), 708–712.
https://doi.org/10.1038/21460

Pedowitz, N. J., & Pratt, M. R. (2021). Design and synthesis of metabolic chemical reporters for
the visualization and identification of glycoproteins. RSC Chemical Biology, 2(2), 306–321.
https://doi.org/10.1039/D1CB00010A

89
Pil, P. M., Chow, C. S., & Lippard, S. J. (1993). High-mobility-group 1 protein mediates DNA
bending as determined by ring closures. Proceedings of the National Academy of Sciences, 90(20),
9465–9469. https://doi.org/10.1073/pnas.90.20.9465

Ramirez, D. H., Aonbangkhen, C., Wu, H.-Y., Naftaly, J. A., Tang, S., O’Meara, T. R., & Woo,
C. M. (2020). Engineering a Proximity-Directed O-GlcNAc Transferase for Selective Protein O-
GlcNAcylation in Cells. ACS Chemical Biology, 15(4), 1059–1066.
https://doi.org/10.1021/acschembio.0c00074

Reddy, M. C., Christensen, J., & Vasquez, K. M. (2005). Interplay between Human High Mobility
Group Protein 1 and Replication Protein A on Psoralen-Cross-linked DNA. Biochemistry, 44(11),
4188–4195. https://doi.org/10.1021/bi047902n

Rostovtsev, V. V, Green, L. G., Fokin, V. V, & Sharpless, K. B. (2002). A stepwise huisgen
cycloaddition process: Copper(I)-catalyzed regioselective “ligation” of azides and terminal
alkynes. Angewandte Chemie - International Edition, 41(14), 2596–2599.
https://doi.org/10.1002/1521-3773(20020715)41:14<2596::AID-ANIE2596>3.0.CO;2-4

Shah, N. H., Dann, G. P., Vila-Perelló, M., Liu, Z., & Muir, T. W. (2012). Ultrafast protein splicing
is common among cyanobacterial split inteins: Implications for protein engineering. Journal of the
American Chemical Society, 134(28), 11338–11341. https://doi.org/10.1021/ja303226x

90
Sheflin, L. G., & Spaulding, S. W. (1989). High Mobility Group Protein 1 Preferentially Conserves
Torsion in Negatively Supercoiled DNA. Biochemistry, 28(13), 5658–5664.
https://doi.org/10.1021/bi00439a048

Stott, K., Tang, G. S. F., Lee, K. B., & Thomas, J. O. (2006). Structure of a Complex of Tandem
HMG Boxes and DNA. Journal of Molecular Biology, 360(1), 90–104.
https://doi.org/10.1016/j.jmb.2006.04.059

Štros, M. (2010). HMGB proteins: Interactions with DNA and chromatin. Biochimica et
Biophysica Acta - Gene Regulatory Mechanisms, 1799(1–2), 101–113.
https://doi.org/10.1016/j.bbagrm.2009.09.008

Štros, M., Štokrová, J., & Thomas, J. O. (1994). Dna looping by the HMG-box domains of HMG1
and modulation of DNA binding by the acidic C-terminal domain. Nucleic Acids Research, 22(6),
1044–1051. https://doi.org/10.1093/nar/22.6.1044

Stros, M. (1998). DNA Bending by the Chromosomal Protein HMG1 and Its High Mobility Group
Box Domains. The Journal of Biological Chemistry, 273(17), 10355–10361.
papers2://publication/uuid/C6A1AC1E-CEA8-4F05-863D-16F1AAA1F2EF

91
Stros, Michael, & Muselıkova, E. (2000). A Role of Basic Residues and the Putative Intercalating
Phenylalanine of the HMG-1 Box B in DNA Supercoiling and Binding to Four-way DNA
Junctions. Journal of Biological Chemistry, 275(46), 35699–35707.
https://doi.org/10.1074/jbc.M007167200

Sutrias-Grau, M., Bianchi, M. E., & Bernues, J. (1999). High Mobility Group Protein 1 Interacts
Specifically with the Core Domain of Human TATA Box-binding Protein and Interferes with
Transcription Factor IIB within the Pre-initiation Complex. 274(3), 1628–1634.
https://doi.org/10.1074/jbc.274.3.1628

Teo, C. F., Ingale, S., Wolfert, M. A., Elsayed, G. A., Nöt, L. G., Chatham, J. C., Wells, L., &
Boons, G.-J. (2010). Glycopeptide-specific monoclonal antibodies suggest new roles for O-
GlcNAc. Nature Chemical Biology, 6(5), 338–343. https://doi.org/10.1038/nchembio.338

Teo, S.-H. H., Grasser, K. D., & Thomas, J. O. (1995). Differences in the DNA-Binding Properties
of the HMG Box Domains of HMG1 and the Sex-Determining Factor SRY. European Journal of
Biochemistry, 230(3), 943–950. https://doi.org/10.1111/j.1432-1033.1995.0943g.x

Teo, S., Grasser, K. D., Hardman, C. H., Broadhurst, R. W., Laue, E. D., & Thomas, J. O. (1995).
Two mutations in the HMG-box with very different structural consequences provide insights into
the nature of binding to four-way junction DNA. 14(15), 3844–3853.
https://doi.org/10.1002/j.1460-2075.1995.tb00054.x

92
Thomas, J. O., & Stott, K. (2012). H1 and HMGB1: modulators of chromatin structure.
Biochemical Society Transactions, 40(2), 341–346. https://doi.org/10.1042/BST20120014

Thompson, R. E., & Muir, T. W. (2020). Chemoenzymatic Semisynthesis of Proteins. Chemical
Reviews, 120(6), 3051–3126. https://doi.org/10.1021/acs.chemrev.9b00450

Travers, A. A., Ner, S. S., & Churchill, M. E. A. (1994). DNA chaperones: A solution to a
persistence problem? Cell, 77(2), 167–169. https://doi.org/10.1016/0092-8674(94)90306-9

Ura, K., Nightingale, K., & Wolffe, A. P. (1996). Differential association of HMG1 and linker
histones B4 and H1 with dinucleosomal DNA: structural transitions and transcriptional repression.
Embo J, 15(18), 4959–4969.

Webb, M., Payet, D., Lee, K. B., Travers, A. A., & Thomas, J. O. (2001). Structural requirements
for cooperative binding of HMG1 to DNA minicircles. Journal of Molecular Biology, 309(1), 79–
88. https://doi.org/10.1006/jmbi.2001.4667

Webb, M., & Thomas, J. O. (1999). Structure-specific binding of the two tandem HMG boxes of
HMG1 to four-way junction DNA is mediated by the A domain. Journal of Molecular Biology,
294(2), 373–387. https://doi.org/10.1006/jmbi.1999.3150

93
Weir, H. M., Kraulis, P. J., Hill, C. S., Raine, A. R. C., Laue, E. D., & Thomas, J. O. (1993).
Structure of the HMG box motif in the B-domain of HMG1. EMBO Journal, 12(4), 1311–1319.

Wilson-Grady, J. T., Haas, W., & Gygi, S. P. (2013). Quantitative comparison of the fasted and
re-fed mouse liver phosphoproteomes using lower pH reductive dimethylation. Methods, 61(3),
277–286. https://doi.org/https://doi.org/10.1016/j.ymeth.2013.03.031

Woo, C. M., Lund, P. J., Huang, A. C., Davis, M. M., Bertozzi, C. R., & Pitteri, S. J. (2018).
Mapping and Quantification of Over 2000 O-linked Glycopeptides in Activated Human T Cells
with Isotope-Targeted Glycoproteomics (Isotag). Molecular &Amp; Cellular Proteomics,
17(4), 764 LP – 775. https://doi.org/10.1074/mcp.RA117.000261

Yang, X., & Qian, K. (2017). Protein O-GlcNAcylation: Emerging mechanisms and functions.
Nature Reviews Molecular Cell Biology, 18(7), 452–465. https://doi.org/10.1038/nrm.2017.22

Yang, Y.-Y., Grammel, M., Raghavan, A. S., Charron, G., & Hang, H. C. (2010). Comparative
Analysis of Cleavable Azobenzene-Based Affinity Tags for Bioorthogonal Chemical Proteomics.
Chemistry & Biology, 17(11), 1212–1222.
https://doi.org/https://doi.org/10.1016/j.chembiol.2010.09.012

Zheng, J.-S., Tang, S., Qi, Y.-K., Wang, Z.-P., & Liu, L. (2013). Chemical synthesis of proteins
using peptide hydrazides as thioester surrogates. Nature Protocols, 8(12), 2483–2495.
https://doi.org/10.1038/nprot.2013.152
94
Chapter 3: Mechanistic roles for altered O-GlcNAcylation in
neurodegenerative disorders
Neurodegenerative diseases such as Alzheimer’s and Parkinson’s remain highly prevalent and
incurable disorders. A major challenge in fully understanding and combating the progression of
these diseases is the complexity of the network of processes that lead to progressive neuronal
dysfunction and death. An ideal therapeutic avenue is conceivably one that could address many if
not all of these multiple misregulated mechanisms. Over the years, chemical intervention for the
upregulation of the endogenous posttranslational modification (PTM) O-GlcNAc has been
proposed as a potential strategy to slow down the progression of neurodegeneration. Through
development and application of tools that allow dissection of the mechanistic roles of this PTM,
there is now a growing body of evidence that O-GlcNAc influences a variety of important
neurodegeneration-pertinent mechanisms, with an overall protective effect. As a PTM that is
appended onto numerous proteins that participate in protein quality control and homeostasis,
metabolism, bioenergetics, neuronal communication, inflammation, and programmed death, O-
GlcNAc has demonstrated beneficence in animal models of neurodegenerative diseases, and its
upregulation is now being pursued in multiple clinical studies.
3.1 Introduction
Neurodegenerative disorders (NDs) are characterized by late-onset decline in cognitive,
memory or motor functions. Diseases that fall in this category such as Alzheimer’s disease (AD),
Parkinson’s disease (PD), Huntington’s disease (HD), and amyotrophic lateral sclerosis (ALS)
have diverse clinical presentations, but they share a set of altered cellular processes and
95
biochemical pathways that define progressive and pathological hallmarks in NDs (Jellinger, 2010).
A common and likely early event that leads to neurodegeneration is the misfolding of proteins
generating amyloid-type aggregates (Ross & Poirier, 2004). Importantly, specific forms of NDs
correlate to specific identities of proteins that aggregate, and the identification of these proteins in
patient brains is often a key step during clinical diagnoses. Specifically, tau and amyloid β peptides
are the predominant protein aggregators in AD, while α-Synuclein is implicated in PD (Ross &
Poirier, 2004). The specific initial localization of protein aggregates within the brain widely varies;
however, their prion-like transmission and spread from cell-to-cell or brain region-to-brain region
are well-documented (Soto & Pritzkow, 2018). Fibrillar aggregates of these proteins can
subsequently recruit other non-proteinaceous components such as nucleic acids, membranes, and
other organelles into intracellular inclusions (e.g. neurofibrillary tangles in AD, Lewy bodies in
PD) or extracellular deposits (amyloid plaques in AD). The irregular presence of these assemblies
may be causative towards the disruption of intra- and intercellular membrane trafficking, leading
to the downstream weakening of synaptic communications between neurons (Wishart et al., 2006).
In many NDs, mitochondrial health is also compromised, leading to impaired bioenergetics,
metabolism, and oxidative stress responses (Johri & Beal, 2012). Immune and inflammatory
hyperactivation is also observed in aging, and the presence of excess neuroinflammatory molecules
also negatively impacts neuronal health (Guzman-Martinez et al., 2019). Ultimately, NDs are also
characterized by increased neuronal death and atrophy of distinct brain regions, consequential to
uncontrolled autophagic, apoptotic, or necrotic pathways (Gorman, 2008).

Also linked to the progression of NDs is aberrant patterns in protein posttranslational
modifications (PTMs), such as in the overall levels of O-GlcNAcylation. O-GlcNAc is an
96
intracellular form of glycosylation involving the addition of the monosaccharide N-acetyl-D-
glucosamine (GlcNAc) onto serine or threonine residues of thousands of proteins. It is an essential
form of modification that is absolutely required during embryogenesis and development of higher
eukaryotes (Bond & Hanover, 2015). At the protein level, this sugar modification can modulate
protein interfaces, with important outcomes protein targets’ structure, function, ability to form
intra- or intermolecular interactions, or the propensity to be modified with other forms of PTMs.
Thus, O-GlcNAc modifications have important roles in regulating cellular processes and pathways
including signal transduction, protein homeostasis (proteostasis), transcriptional regulation, and
cytoskeletal organization (X. Yang & Qian, 2017).

Global O-GlcNAc levels are typically found to be misregulated in AD patient brains
compared to age-matched controls. Significant efforts have been made to understand this link, with
the current hypotheses being that O-GlcNAc has an overall protective role against
neurodegeneration and that the observed downregulation may be detrimental to neuronal health.
Consequently, pharmacological upregulation of O-GlcNAc is currently being explored as a
potential therapeutic strategy to slow the progression of NDs. In this review, we summarize the
body of work that describes mechanistic roles for O-GlcNAc in neurodegeneration. We briefly
present biochemical tools and techniques that have been useful for understanding the roles of O-
GlcNAc (Figure 3-1). We then present the evidence that O-GlcNAc has a multifaceted effect in
neurodegeneration by modulating processes such as protein aggregation, PTM crosstalk,
mitochondrial and bioenergetics regulation, vesicular transport, neuroinflammation, and neuronal
death pathways. Focus is afforded to AD and PD given that these are the most prevalent forms of
97
NDs, and that a large majority of work on O-GlcNAc and neurodegeneration is based on these
disorders.

3.2 Aberrant mechanisms in Alzheimer’s and Parkinson’s diseases
3.2.1 Alzheimer’s disease
Alzheimer’s disease is the most common form of ND and is the leading cause of dementia
(Kocahan & Doğan, 2017). The progression of the disease is slow, initially characterized by early
changes in neurotransmitter expression, reduction of neutrophil counts and synaptic death (Braak
et al., 1993). During later stages, AD patients show large-scale neuronal death and brain atrophy
(Yankner, 1996). Given that most of the neuronal death occurs at the hippocampus, the main
clinical presentation includes memory defects and other forms of cognitive decline. AD is linked
to a multitude of risk factors including family history, lifestyle (sleep patterns, alcohol
consumption, history of head trauma, etc.), and vascular conditions (diabetes, hypertension,
stroke), but the major risk factor is age with the likelihood of developing AD rising exponentially
after the age of 65 (Qiu et al., 2009). Less than 1% of AD cases are also linked to genetic factors,
although these correlations are rather complex and likely involve multiple genes(Bird, 2008). As
of yet, AD is incurable and treatment strategies merely address the symptoms or slow down its
progression (Se Thoe et al., 2021).

The misfolding and aggregation of amyloid beta (Aβ) peptides or tau protein are believed
to be early processes in the sequence of biochemical events leading to neuronal death. Different
species in this misfolding process, either oligomeric or fibrillar, have been shown to elicit
neurotoxicity, although the main contributor to pathology remains to be conclusively determined.
98
These protein aggregates mature and co-accumulate with other components into either
extracellular deposits (amyloid plaques) or intracellular inclusions (neurofibrillary tangles, NFTs)
that are resistant to normal proteostatic responses. The postmortem identification of these
structures is a defining step that accompanies clinical evaluation during diagnoses although
presence of plaques or NFTs can also be found in asymptomatic patients. NFTs also bear large
amounts of hyperphosphorylated tau, and this hyperphosphorylation has been suggested to
interfere with tau’s endogenous role of stabilizing microtubule filaments. Dissociation of tau from
scaffolding and transport structures not only reduces its localization to dendritic spines that are
essential for proper synaptic function, but also increases the pool of misfolded monomers that can
feed into the protein aggregation cascade (T. Guo et al., 2020). The formation of aggregates and
inclusions also drive further disruptions of other cellular organelles and neuronal processes
(Gendreau & Hall, 2013; Reiss et al., 2018). Mitochondrial structure is markedly altered in AD
brains, resulting in decreased mitochondrial respiration and ATP production as well as elevated
oxidative stress (Abolhassani et al., 2017). Pathological Aβ and tau aggregates also cause an
upregulation in the proliferation and activation of astrocytes and microglia. This increased
neuroinflammation (“gliosis”) has been argued as a protective response, although it has also been
proposed to aggravate neuronal atrophy by amplifying pro-inflammatory molecules that signal
downstream cell death pathways (Pekny et al., 2014).

3.2.2 Parkinson’s disease
The second most common form of ND is Parkinson’s disease which is characterized by
various types of motor deficits including gait and posture impairment, bradykinesia (slowness of
movement), muscle rigidity, and resting tremors (Maiti et al., 2017; Poewe et al., 2017). Similar
99
to AD, neuronal loss is also observed but occurs mostly on dopaminergic neurons in the substantia
nigra pars compacta. Since this brain region supplies dopamine to the basal ganglia circuit, reduced
dopamine levels is also observed in the striatum of the brain. This reduction causes excessive firing
of neurons, making it difficult for PD patients to control their movements (Alexander, 2004). Risk
for PD is also multifactorial and includes family history, exposure to environmental toxins, and
most predominantly, aging. Genetics also plays a role, with over 20 different genes correlated to
increased risk(Maiti et al., 2017). PD is also incurable, although fortunately life expectancy is
similar for unaffected people.

Protein aggregation of the small protein α-Synuclein (αSyn) is proposed as an early
contributor to the progression of PD. Gene dosage effects have been observed in a subset of PD
patients, wherein duplications of the SNCA gene encoding for αSyn were proposed to contribute
to PD progression through modest increases in αSyn protein expression levels(Chartier-Harlin et
al., 2004; Ibanez et al., 2004). Additionally, familial mutations in the SNCA gene are linked to
early onset forms of PD, and these mutants (e.g. A53T, A30P, E46K, and H50Q) typically exhibit
increased aggregation propensities in vitro (Conway et al., 1998, 2000; Giasson et al., 1999; Peng
et al., 2017). Intracellular, filamentous aggregates of αSyn recruit other proteins, organelles, and
membranes, and mature into intracellular inclusions such as Lewy bodies (LBs) or Lewy neurites
(LNs) (Fares et al., 2021). Analogous to amyloid plaques or NFTs in AD, LBs and LNs are the
hallmark structures identified in postmortem analyses of PD patient brains. Extensive
phosphorylation of αSyn specifically at Ser129 is detected in LBs, and this marker is commonly
used to detect these structures in immunohistochemical experiments and clinical diagnoses
(Oueslati, 2016). αSyn in LBs is also heavily ubiquitylated (Tofaris et al., 2003), which may
100
indicate resistance against degradation due to impairment of proteostatic mechanisms such as the
ubiquitin-proteasome system, molecular chaperone networks, and autophagy-lysosomal pathways.
Recapitulation of LB formation in model systems also disrupt normal mitochondrial processes and
induce synaptic dysfunctions (Mahul-Mellier et al., 2020), consistent with clinical findings in PD
patients. The increased production of inflammatory enzymes in DA neurons of postmortem PD
brains also suggests neuroinflammation as a key event that may ultimately lead to neuronal injury
and death (A. L. Bartels & Leenders, 2010).

3.3 O-GlcNAc is a dynamic PTM that is essential for brain health but is dysregulated in NDs
Levels of O-GlcNAc within cells are controlled by the cycling enzymes O-GlcNAc
transferase (OGT) which adds the sugar, and O-GlcNAc hydrolase (OGA) which removes it
(Figure 3-1a). These two enzymes are responsible for the modification of thousands of proteins in
the human proteome. Transcriptional or translational control over the protein levels of these
enzymes can thus effect changes to global O-GlcNAc levels. Additionally, O-GlcNAc levels also
respond to changes in nutrient concentrations due to OGT’s utilization of the high energy sugar
donor UDP-GlcNAc. This metabolite is a product of the hexosamine biosynthetic pathway which
integrates sugar, nucleotide, and amino acid metabolism, although salvage pathways are also
available (Love & Hanover, 2005). Given these multiple possible avenues for regulation, O-
GlcNAc is dynamic and is known to respond to various stimuli including metabolic flux and
cellular stress. Along with NDs, global O-GlcNAc levels are also misregulated in other diseases
such as cancer and diabetes.

101

Figure 3-1. Chemical approaches to decipher roles of O-GlcNAc in neurodegeneration. a. O-
GlcNAc is a posttranslational modification that is regulated by the enzymatic activity of the
cycling enzymes OGT and OGA, and the availability of the sugar donor UDP-GlcNAc produced
from the hexosamine biosynthetic pathway (HBP). Inhibitors of the HBP enzyme GFAT or of
OGT (in red dotted circles) lower O-GlcNAc levels in cells or animals, while inhibitors of OGA
(in blue dotted circle) increase O-GlcNAc. b. Native and expressed protein ligations enable the
preparation of homogeneously O-GlcNAcylated proteins. This involves the chemoselective
reaction between a peptide fragment bearing a C-terminal thioester and another fragment with an
N-terminal thiol (such as that in cysteines). These fragments can be prepared by recombinant
expression or solid-phase peptide synthesis (SPPS), with SPPS also enabling precise installation
of O-GlcNAcylated serine/ threonine residues.
102
O-GlcNAc is an evolutionarily conserved modification among eukaryotes and has
ubiquitous presence across different cell types (Kreppel et al., 1997). Among different types of
tissues, O-GlcNAc levels are highest in the brain consistent with the high glucose consumption of
this organ (Mergenthaler et al., 2013), as well as increased expression levels and enzymatic activity
of the cycling enzymes OGT and OGA(Akimoto et al., 2003; Gao et al., 2001; Kreppel et al., 1997;
Okuyama & Marshall, 2003). Importantly, defects in the chromosome regions coding for both
OGT (Xq13) and OGA (10q24) are associated with neurological disorders (Ertekin-Taner et al.,
2000; Shafi et al., 2000; Willems et al., 2017), suggesting a role for O-GlcNAc in neuronal health.
Indeed, early studies identifying and characterizing O-GlcNAcylated proteins in the brain
indicated potential participation of this modification in synaptosome formation and intracellular
signaling, key processes for normal neuronal communication (Cole & Hart, 2001; Khidekel et al.,
2004). Recent proteomics studies that aim to identify O-GlcNAc substrates have also shown that
the major aggregating proteins in AD (tau and the amyloid-beta precursor protein) and PD (αSyn)
are also O-GlcNAc modified in the brain (Wulff-Fuentes et al., 2021), suggesting a likely direct
effect of O-GlcNAc to the process of protein aggregation.

The development of pan-O-GlcNAc antibodies for Western blotting or
immunohistochemical applications has enabled convenient spatiotemporal quantification of O-
GlcNAc levels from different biological samples (Ma & Hart, 2014). In mammals, O-GlcNAc
remains high from embryonic stage until birth, but levels drop throughout aging (Y. Liu et al.,
2012). In AD patients, O-GlcNAc levels are consistently found to be lower than age-matched
controls (Aguilar et al., 2017; Balana et al., 2021; Liu et al., 2004, 2009; Pinho et al., 2019). This
downregulation is concomitant to impairment of glucose utilization (Borghammer et al., 2012;
103
Kapogiannis & Mattson, 2011; Merlini et al., 2011) as well as decreased OGT expression levels
(A. C. Wang et al., 2016). Contrarily, an increase in O-GlcNAc levels in AD patients has also been
reported by a number of groups, and was rationalized by a measured downregulation in OGA
expression (Förster et al., 2014; Griffith & Schmitz, 1995). With the use of a more sophisticated
and sensitive method, a quantitative proteomics analysis of O-GlcNAcylated proteins in AD versus
control patient brains has found that instead of a uniform change in modification for all OGT
substrates, the up- or downregulation is protein-specific (S. Wang et al., 2017). These specific
alterations were proposed to occur either through direct changes in O-GlcNAc stoichiometry, or
in combination with changes in protein expression levels. Importantly, proteins that were found to
have decreased O-GlcNAcylation have roles in axonal polarity, membrane integrity, and synaptic
health—again indicating a role for O-GlcNAc in the maintenance of normal neuronal functions.
Interestingly, the same proteomics study found no abundance changes in either OGT or OGA
expression. Taken altogether, O-GlcNAc is invariably dysregulated in NDs, and a lack of
consensus among different studies regarding the trend may simply reflect non-standard and
incomparable experimental and reporting methods. Possible causes for these discrepancies may be
difference in the selection of tissue sample, disease staging, handling procedures (e.g. biopsy time,
use of OGT/OGA inhibitors, etc.), or detection techniques, among others.

3.4 Tools for studying the mechanistic roles of O-GlcNAc
One approach to studying the role of O-GlcNAc in model organisms is through gene
knockout through targeting of the enzymes OGT or OGA. However, given that O-GlcNAc is
ubiquitous (Kreppel et al., 1997; Lubas et al., 1997) and is important in cell cycle progression (C.
Liu & Li, 2018), OGT knockout causes mitotic arrest and neolethality, rendering long-term
104
experiments and observations nonviable (O’Donnell et al., 2004). Constitutive neuron-specific
knockout of OGT in mice hence resulted in severe developmental abnormalities and shortened life
spans compared to littermates (O’Donnell et al., 2004). These mice were also unable to develop
normal locomotive functions and had increased levels hyperphosphorylated tau. Thus, instead of
embryonic knockout, delayed conditional knockout (cKO) of OGT was also developed and applied
to study the post-developmental importance of O-GlcNAc in the excitatory neurons of mice (A.
C. Wang et al., 2016). Forebrain specific knockout of OGT caused progressive neurodegeneration
as evidenced by Aβ-peptide accumulation, tau hyperphosphorylation, protein aggregation,
neuroinflammation, neuronal death and memory impairment. Taken together, these indicators
suggest a link between O-GlcNAc and Alzheimer’s disease progression. More recently,
conditional knockout of OGT and OGA was also used to look at the function of O-GlcNAc in
dopaminergic neurons (Lee et al., 2020). Reduced O-GlcNAc in the OGT-cKO mice caused
degeneration of dopamine neurons, severe motor deficits, and premature death. On the other hand,
upregulation of O-GlcNAc in OGA-cKO mice was not detrimental and even alleviated the adverse
biochemical and functional effects induced by αSyn overexpression. This work similarly
illustrates a role for O-GlcNAc in the dopamine system and its potential significance in combatting
the progression of Parkinson’s disease.

O-GlcNAc levels may also be up or downregulated temporally through genetic (RNAi) or
chemical inhibition of the enzymes that regulate the modification. Small molecule inhibition of
the enzyme glutamine fructose-6-phosphate amidotransferase (GFAT), the key enzyme in the
hexosamine biosynthetic pathway that generates the sugar donor UDP-GlcNAc (Fei Liu et al.,
2009), enables indirect metabolic downregulation of O-GlcNAc levels. Injection of the GFAT
105
inhibitor 6-diazo-5-oxo-L-norleucine (DON) onto rat brains resulted in ~50% reduction in global
O-GlcNAc levels and an accompanying increase in tau phosphorylation. It is critical to note that
DON is not a GFAT-specific inhibitor but rather a glutamine-mimicking agonist, and its rather
simple and electrophilic structure results in engagement and covalent modification of various
glutamine-utilizing enzymes (Pinkus, 1977). DON is also cytotoxic although its use as a
chemotherapeutic is still currently being considered (Lemberg et al., 2018). Over the years,
substantial research efforts have been given towards the development of chemical inhibitors for
OGT and OGA (Figure 3-1a), not only for their broad utility in O-GlcNAc related studies but
importantly for their potential therapeutic use. For a more comprehensive summary of these OGT
and OGA inhibitors, please refer to a recent review by Alteen et. al from the Vocadlo lab (Alteen
et al., 2021). Structure-based design of OGT inhibitors have led to the discovery of Ac
4
5SGlcNAc,
a peracetylated 5-thio version of N-acetylglucosamine that is capable of lowering O-GlcNAc
levels in cellular assays. Given its modest potency and low aqueous solubility, its use in in vivo
studies has been rather limited. Modified versions of the Ac
4
5SGlcNAc scaffold have been
proposed that improve on its pharmacokinetic properties, one of which is the 5SGlcNHex variant
that has since found use in rodent studies (T.-W. W. Liu et al., 2018). More recently, high-
throughput screens have also identified a number of compounds with improved potency although
improvements on toxicity and solubility are still needed (Martin et al., 2018). On the other hand,
OGA inhibitor development has been more fruitful and a number of these inhibitors have been
used to study links between O-GlcNAc in models of NDs. Early OGA inhibitors included
PUGNAc and streptozotocin (STZ), although PUGNAc was later shown to inhibit lysosomal
hexosaminidases (Macauley et al., 2005) while STZ was shown to exhibit toxicity (K. Liu et al.,
2002). More recently, mechanism-based inhibitors such as NButGT and Thiamet-G (ThG) have
106
been designed for improved selectivity and pharmacokinetics, with the latter exhibiting a high
potency of K
i
=2.1 nM and 1850000-fold selectivity for OGA over hexosaminidase B (Cekic et al.,
2016). ThG has since been a widely adapted tool for in vitro, in cellulo, or in vivo studies given
the simplicity in its synthetic preparation and its commercial availability (Yuzwa et al., 2008).
Notably, administering ThG to different mice models of AD (Borghgraef et al., 2013; Graham et
al., 2014; Hastings et al., 2017; Shen et al., 2012; Yuzwa et al., 2012) or PD (Lee et al., 2020) has
shown protective effects against cognitive and motor decline. Consequently, the drug MK-8719
(developed by Alectos and Merck) is based on the ThG structure and is currently being investigated
in clinical trials for tau-related diseases (“tauopathies”) (Sandhu et al., 2016; Selnick et al., 2019).
Preclinical data in mice models of tauopathy showed neuroprotection against brain atrophy (X.
Wang et al., 2020), supporting the hypothesis that upregulation of O-GlcNAc could be beneficial
to brain health. Similar trials based on OGA inhibition are also being actively pursued by Eli Lilly
(Kielbasa et al., 2020) and Asceneuron (J. M. Ryan et al., 2018), although the structures of their
small molecules remain undisclosed.

While methods that regulate global O-GlcNAc levels are useful in determining the system-
wide effects on cells, tissues, or organisms, they often do not determine direct functional effects
on individual proteins. Thus, in vitro biochemistry on purified proteins provide complementary
insight for the dissection of complex pathways. These types of experiments require preparation of
O-GlcNAcylated peptides or proteins that would be amenable to subsequent biochemical or
biophysical studies. A convenient way to prepare O-GlcNAc modified proteins involves enzymatic
modification of purified substrates with purified OGT (Lubas & Hanover, 2000). A modification
of this approach involves in vivo modification, where both OGT and the target protein substrate
107
are co-overexpressed in E. coli (Lim et al., 2002) or eukaryotic systems (Rexach et al., 2010). In
the latter approach, O-GlcNAcylation occurs within cells, and O-GlcNAcylated proteins can be
isolated after cell lysis and protein purification. Notably, both methods have been applied on tau,
generating O-GlcNAcylated tau that were subsequently used for the evaluation of O-GlcNAc’s
effects to the protein’s aggregation propensity (Shen et al., 2012; Yuzwa et al., 2012; Yuzwa,
Cheung, et al., 2014). The co-overexpression approach has also been applied to ɑ-Synuclein (J.
Zhang et al., 2017).

Enzymatic preparation of O-GlcNAc modified proteins suffers from poor reaction
efficiency, resulting in substoichiometric modification of substrates. Additionally, given that OGT
can modify multiple serine and threonine sites on a single polypeptide chain, heterogeneous
mixtures of unmodified, singly and multiply O-GlcNAcylated proteins are often produced from
these enzymatic reactions. These complications thus prevent conclusive evaluation of the full and
site-specific effects of O-GlcNAc modifications. As of yet, homogeneously and site-specifically
O-GlcNAcylated purified proteins can only be prepared through semi-synthesis. Peptide fragments
corresponding to different regions of the protein are initially prepared either through recombinant
expression or solid phase peptide synthesis (SPPS). Notably, SPPS enables precise installation of
the O-GlcNAc monomers with the use of O-GlcNAcylated Fmoc-serine or threonine monomers.
In order to assemble the full protein, fragments are then joined together through any of the
available chemoselective protein ligation techniques, most prominent of which are native chemical
ligation (Agouridas et al., 2019; Dawson et al., 1994) (NCL) or expressed protein ligation (Muir
et al., 1998; Thompson & Muir, 2020) (EPL) strategies (Figure 3-1b). Importantly, our lab has
108
specialized in the application of EPL onto a number of ND-related proteins to study the role of O-
GlcNAc in the process of protein aggregation.

3.5 O-GlcNAc is a multifaceted inhibitor of protein aggregation
The assembly of specific proteins into fibrillar, β-sheet rich structures (typically
referred to as “amyloids”) is a detrimental gain-of-function phenomenon observed in many
NDs(Ross & Poirier, 2004). The process is well-characterized biochemically and is generally
known to occur via a multi-step mechanism (Figure 3-2) characterized by a sigmoidal increase in
aggregate formation (Arosio et al., 2015). An initial lag phase represents the primary nucleation
step where monomers initially associate to form oligomers (Buell et al., 2014). These oligomers
can be amorphous or structured and can exist with high persistence and abundance in solution
(Dear et al., 2020). Through molecular reorganization, the nucleation step is completed when
oligomers slowly undergo conformational rearrangement to form highly organized protofibrils
(Cremades et al., 2012). Protofibrils have tightly packed β-sheet stacking and can rapidly undergo
extension by acting as “seeds” where monomers can add onto their exposed ends. The presence of
small amounts of seeds is catalytic, resulting in the exponential increase in aggregate mass.
Additionally, some forms of amyloids can also catalyze through a secondary nucleation
mechanism in which monomers use the hydrophobic surfaces of fibrils to form new oligomers or
protofibers (Törnquist et al., 2018). Hence, the fibril growth step is a much faster process than
nucleation and the mere addition of seeds to monomers shortens or completely eliminates the lag
phase, drastically speeding up the formation of fibers. Fibrils also associate laterally and mature
as straight or twisted filamentous structures (Vilar et al., 2008).

109

Figure 3-2. The process of protein aggregation. Soluble, monomeric proteins implicated in NDs
can slowly undergo a nucleation step to form compact β-sheet rich oligomers. These oligomers
undergo molecular rearrangements and structural transitions to generate protofibrillar seeds.
Protofibrils can then catalyze rapid amplification of protein aggregates through a much faster
extension step. Mature amyloid fibers are routinely found in extracellular deposits called plaques
in AD, or in intracellular inclusions such as neurofibrillary tangles (NFTs) in AD or Lewy bodies
(LBs) in PD.

Fibrillar aggregates were traditionally considered as the major source of toxicity to neurons.
However, given that oligomers are formed earlier at higher concentrations, and exhibit greater
solubility and faster mobility, recent theories suggest that oligomers are likely the major
contributor of toxicity in proteinopathies (Verma et al., 2015). Nonetheless, intermediates,
including fibers and smaller oligomers, have been demonstrated to contribute to a cascade of toxic
effects (Karran et al., 2011) and without a known biological relevance for ND-related amyloids in
the brain (Greenwald & Riek, 2010).

3.5.1 Amyloid beta
Aβ pertains to peptides ~40 amino acids in length that are produced from the proteolytic
post-processing of the amyloid precursor protein (APP). APP is a transmembrane protein with
most of its length residing in the extracellular space. APP can be synthesized as three alternative
splicing variants of 695, 751 or 770 residues. The 695 amino acid variant is primarily expressed
110
in the brain where it likely participates in the formation and repair of synapses (Gupta et al., 2010).
APP can generate multiple proteolytic fragments via the proteolytic activity of α-, β-, and γ-
secretases. Importantly, mutations in the genes encoding for APP or for components of the γ-
secretase complex (presenilin; PSEN1 and PSEN2) are linked to increased amyloid load and early
onset AD (Bekris et al., 2010).

Two distinct processing pathways generate different sets of fragments from APP (Figure
3-3a). First, in the non-amyloidogenic pathway, newly synthesized APP is transported from the
Golgi network to axons where it inserts into the cell membrane. Here, some APP molecules are
processed by α-secretase which cuts within the extracellular domain to release a soluble sAPPα
fragment while retaining the C-terminal fragment (CTFα) bound to the membrane. Notably,
sAPPα produced from the non-amyloidogenic pathway has been shown to have memory-
enhancing effects (Meziane et al., 1998). A second cleavage by γ-secretase complex on CTFα
forms fragments p3 and the intracellular domain (ICD) of APP, both of which are also non-
amyloidogenic. Any unprocessed, intact APP gets re-internalized through clathrin-mediated
endocytosis into endosomes where the alternative amyloidogenic pathway takes place. β-secretase
releases a soluble sAPPβ fragment from the extracellular domain during the initial step of the
processing, again leaving a membrane-bound C-terminal fragment (CTFβ). However, during the
succeeding γ-secretase cleavage event, Aβ40 or Aβ42 peptides are released (instead of p3) from
CTFβ. As the endosomes recycle to the cell surface, Aβ peptides are released extracellularly
(O’Brien & Wong, 2011). Production of Aβ peptides has unknown biological relevance and
appears to be dispensable for normal physiological functions (P. Ryan et al., 2019). However, Aβ
monomers can aggregate to form oligomers and fibrillar forms, both of which have been shown to
111
elicit neurotoxicity through multiple downstream mechanisms (Chen et al., 2017). Of the two
forms, Aβ40 is produced in greater amounts although the Aβ42 variant aggregates much faster in
vitro and is the major component of amyloid plaques in AD brains (Kuperstein et al., 2010). Thus,
reducing Aβ production for instance through downregulation of the amyloidogenic proteolysis
events is hypothesized to be a beneficial strategy to slow down AD progression (Macleod et al.,
2015).

Altering O-GlcNAc in various models indicates a beneficial role for limiting the formation
of amyloidogenic peptides. In OGT conditional knockout mice, loss of O-GlcNAc in the brain
resulted in an increase of Aβ load (A. C. Wang et al., 2016). In a mouse model of AD expressing
5 familial AD-linked mutations (5xFAD), treatment with the OGA inhibitor NButGT decreased
Aβ production and attenuated neuroinflammation and memory impairment (Kim et al., 2013). This
work also reported reduced γ-secretase complex activity in CHO cells overexpressing the Swedish
mutant of APP (swAPP) that is known to enhance Aβ production. This reduction was proposed to
be via the direct O-GlcNAc modification of the γ-secretase component domain nicastrin at Ser708
which potentially reduces the complex’s proteolytic activity. Similarly, in bigenic tau/APP
overexpressing mice (TAPP), ThG treatment also reduced Aβ42 levels and amyloid plaque load
and consequently prevented cognitive decline (Yuzwa, Shan, et al., 2014).

Direct O-GlcNAcylation of APP has also been detected (Griffith et al., 1995). In cultured
neuronal cell line SH-SY5Y, OGA knockdown by siRNA or chemical inhibition by PUGNAc
increased direct O-GlcNAcylation of APP, and resulted in greater secretion of the sAPPɑ fragment
that is likely beneficial for neuronal excitability, synaptic plasticity, and memory functions
112
(Jacobsen & Iverfeldt, 2011). Later, it was determined that the modification sites (Thr291, Thr292,
Thr576) (Alfaro et al., 2012; Chun et al., 2017) are not in the residues that eventually become part
of Aβ peptides (597-638), but are in a region that could influence amyloidogenic processing and
trafficking. Treatment of swAPP-overexpressing HeLa cells with PUGNAc increased APP
trafficking into the plasma membrane and inhibited endocytosis, resulting in greater non-
amyloidogenic processing (Chun et al., 2015). This effect was subsequently shown to be dependent
on the O-GlcNAcylation of APP at Thr576 (Chun et al., 2017). In summary, while no evidence
has shown that O-GlcNAc directly affects the aggregation of Aβ, O-GlcNAc appears capable of
limiting the production and accumulation of these amyloidogenic peptides. O-GlcNAc is also
proposed to alter processing and trafficking, although this model is not universally supported as
studies in primary neurons and other cultured cells (Yuzwa, Shan, et al., 2014) as well as in the
5xFAD rodent model (J. Park et al., 2021) found no difference in APP processing.

3.5.2 Tau
Tau is a microtubule-associated protein that assists in the polymerization of tubulin and
stabilizes pre-formed microtubule structures. In cells, the protein localizes in the axons of growing
and mature neurons, indicating a likely role in neuronal communication. Tau proteins isolated from
the brain consist of 6 different isoforms formed from the alternative splicing of the microtubule-
associated protein tau (MAPT) gene transcript. These isoforms differ in the number of N-terminal
repeats (0N,1N or 2N) in the acidic amino-terminal region that is known to interact with
membranes, and in the number of imperfect repeats (3R or 4R, where the presence of repeat 2 is
variable) in the C-terminal microtubule binding region (MTBR). Thus, the longest isoform is
designated 2N4R (Figure 3-3b) and is 441 amino acids in length, while the shortest isoform 0N3R
113
is 352 residues long. In solution, tau retains stability, solubility, and tubulin binding activity even
after exposure to harsh temperature or pH conditions, indicating a highly unstructured monomer
conformation (Jebarupa et al., 2018; Weingarten et al., 1975). These properties are expected of
highly hydrophilic proteins, and indeed tau has a high proportion of polar amino acids, few
hydrophobic and aromatic residues, a high isoelectric point (pI) and highly positive charge at
physiological pH (Goedert et al., 1989).

Fibrillized tau is found as the predominant component of NFTs, intracellular inclusions
that are one of the pathological markers of AD. Given the relative size of NFTs with respect to the
neuronal body, fibrillar tau was originally proposed as the predominant source of neurotoxicity.
However, more recent theories hypothesize that soluble oligomeric tau are likely more toxic and
more easily transmissible, consistent with the observed cell-to-cell transmission and propagation
of tau aggregates (Shafiei et al., 2017). While soluble tau can be phosphorylated at a stoichiometry
of 2-3 moles phosphates per molecule, aggregated tau is hyperphosphorylated at >3-fold higher
stoichiometries. Immunohistochemical detection of hyperphosphorylated tau is commonly used
to establish the presence of NFTs in biological samples (J. Z. Wang et al., 2013). Structurally,
aggregated tau in NFTs are β-sheet rich fibrillar aggregates mostly in the paired helical filament
(PHF) and minimally the straight filament (SF) forms (Crowther, 1991). In high resolution
structures of PHFs and SFs obtained from AD brains, repeats R3 and R4 of the MTBR form the
compact core of the filaments (Fitzpatrick et al., 2017), indicating that the MTBR is an important
region during nucleation. The exact mechanism of PHF formation from tau monomers is poorly
understood both in vivo and in vitro, partly because of the difficulty in aggregating purified tau
even at very high concentrations (Crowther et al., 1994). However, conditions that counteract the
114
cationic character of the protein such as the addition of phosphate groups during phosphorylation
have been shown necessary to induce aggregation (Alonso et al., 2001). Addition of negatively
charged sulfated glycosaminoglycans (heparin) (Goedert et al., 1996) or fatty acids (Wilson &
Binder, 1997) to purified tau have thus been used to generate and study filaments in vitro, although
aggregates generated in the presence of these additives do not resemble ex vivo PHFs obtained
from AD brains (W. Zhang et al., 2019).

O-GlcNAcylated tau was first detected in bovine brains at a high stoichiometry averaging
4 moles GlcNAc per mole of tau (Arnold et al., 1996). The sites were not initially identified, but
it was proposed that O-GlcNAcylation occurs at more than 12 possible sites. Through the use of
in vitro enzymatic modification, mass spectrometry and NMR spectroscopy, two separate groups
found that purified OGT modifies tau at a total of 7 potential sites: Thr123, Ser185, Ser191,
Ser400, Ser409, Ser412, and Ser413 (Bourré et al., 2018; Yuzwa et al., 2011). Of these, Thr123
and Ser400 were identified as major sites of modification. The Ser400 modification site was also
detected in brains of normal rats and the JNPL3 mouse model of tauopathy (Morris et al., 2015; Z.
Wang et al., 2010), while Ser262 was found to be the predominant modification site in AD brains
(S. Wang et al., 2017). Rabbit polyclonal and monoclonal IgGs have since been developed for O-
GlcNAc S400 tau, and have since been used to confirm the presence of O-GlcNAc modified tau
in various in vitro and in vivo studies (Cameron et al., 2013; Yuzwa et al., 2011). The most current
entry on the O-GlcNAc database (Wulff-Fuentes et al., 2021) lists a total of 19 modification sites
identified in more than 20 different studies using multiple different human cell types.

115
The role of O-GlcNAc in inhibiting tau aggregation was demonstrated in a number of
studies that utilized OGA inhibition to upregulate the modification in mice models of tauopathies.
The JNPL3 transgenic mice expresses the 0N4R isoform bearing a tauopathy-related P301L
mutation, resulting in NFT development in various regions of the brain ultimately causing neuronal
loss and astrogliosis (J. Lewis et al., 2000). Long-term treatment (36 weeks) of JNPL3 mice with
ThG increased brain O-GlcNAc levels, blocked neuron loss, slowed down the development of
motor deficits, and maintained normal body weight, presumably through preservation of skeletal
muscle health (Yuzwa et al., 2012). The authors also noted that the long-term ThG treatment on
wild-type mice with the same genetic background did not result in adverse effects on weight,
appetite, or motor neuron counts. The amount of O-GlcNAc tau also increased and consequently,
less insoluble tau was isolated in ThG-treated JNPL3 mice compared to untreated JNPL3 controls.
Similarly, immunohistochemical analysis of ThG-treated JNPL3 mice showed reduction in the
formation of NFTs. Given that the levels of hyperphosphorylation remained comparable between
ThG-treated and untreated mice, it was proposed that the inhibition of oligomerization by O-
GlcNAc occurs independently of its crosstalk with phosphorylation. ThG was also tested in
Tau.P301L mice that express the P301L mutation, another validated pre-clinical model for
tauopathies (Borghgraef et al., 2013). A similar reduction in NFT formation was detected in treated
mice compared to placebo, and this trend corresponded with the improvement of breathing and
airway defects. The authors did not find direct O-GlcNAcylation on tau protein and thus suggested
an indirect mechanism for decreased NFT formation. More recently, the rTg4510 transgenic
mouse model that also expresses the P301L mutant has been used extensively for OGA inhibition
studies. Two separate groups found that acute (14 days) and chronic (4 months) ThG treatment
increased global and tau-specific O-GlcNAc levels and resulted in less NFT formation (Graham
116
et al., 2014; Hastings et al., 2017). Interestingly, while O-GlcNAcylated tau was detected in the
pathological tau fraction of JNPL3 mice, Hastings et. al. reported that O-GlcNAcylation is mostly
found in soluble but not aggregated tau in this rTg4510 model. Importantly, the rTg4510 model
was also used to validate the ThG-derived OGA inhibitor MK-8719 during pre-clinical studies,
where treatment with MK-8719 resulted in increased brain O-GlcNAc, reduction in pathological
tau, and attenuation of brain atrophy and forebrain volume loss (X. Wang et al., 2020). Altogether,
these in vivo studies illustrate the protective and potentially therapeutic effects of OGA inhibition.
This is also further supported by a cell-based study demonstrating that the opposite regulation is
detrimental, as loss of O-GlcNAc via OGT inhibition resulted in greater tau aggregation (Lim et
al., 2015).

That a number of mass spectrometry and immunohistochemistry-based studies indicate
bona fide O-GlcNAcylation of tau raised the question of whether the modification directly affects
its aggregation property. To explore this hypothesis, aggregation studies on purified O-
GlcNAcylated tau have also been performed. Yuzwa et. al. generated O-GlcNAcylated tau
(residues 244-441) corresponding to the aggregation-prone MTBR and the C-terminal tail where
the O-GlcNAc modifications are known to occur (Yuzwa et al., 2012). The N-terminal region was
truncated in order to enable heparin-induced aggregation in vitro at reasonable time scales.
Recombinant co-overexpression with OGT and subsequent purification resulted in 50%
modification efficiency at a mixture of sites as assessed by mass spectrometry. O-GlcNAc
modified tau exhibited slower aggregation kinetics and formed less aggregates compared to an
unmodified preparation. Mutation of Ser400 to alanine reduced the extent of O-GlcNAcylation on
tau and completely abolished the inhibitory effect on aggregation, suggesting that this is the major
117
modification site that plays a role in tau oligomerization. Later, the same group generated O-
GlcNAcylated full-length tau again through recombinant modification (Yuzwa, Cheung, et al.,
2014). O-GlcNAcylation of tau was shown to inhibit both the nucleation and extension steps of
heparin-induced aggregation. Importantly, O-GlcNAc did not interfere with tau’s ability to interact
with tubulin in microtubule polymerization assays, nor did it change the global fold of the protein
in solution as determined by FRET experiments. Subsequent NMR studies on a truncated 353-408
region further confirmed the minimal effect of O-GlcNAc on tau’s conformation and solubility.
These results demonstrate that O-GlcNAc directly inhibits the aggregation of tau without affecting
intrinsic structure and microtubule-related functions. This could rationalize, at least in part, the
reduction in the amount of pathological aggregates observed in in vivo OGA inhibition
experiments.

3.5.3 α-Synuclein
Alpha synuclein (αSyn) is a small protein, 140 amino acids in size, found in presynaptic
terminals of neurons or vesicle-enriched subcellular regions (Iwai et al., 1995; Kahle et al., 2000)
Its primary sequence is composed of imperfect repeats of consensus sequence KTKEGV clustered
at the N-terminal half of the primary sequence (Ueda et al., 1993). The N-terminal residues (1-60)
also bear a high frequency of lysine residues making this region highly amphipathic. Meanwhile,
the C-terminal tail (residues 96-140) is highly acidic and imparts a low isoelectric point to the full-
length protein, consequently stabilizing it against hydrophobic collapse over a wide range of pH.
Recombinantly expressed αSyn hence behaves as an unstructured monomer in solution, although
native electrophoresis and cross-linking studies of αSyn isolated in vivo have been used to show
that it may exist as stable low molecular weight oligomers predominantly forming alpha helical
118
tetramers (T. Bartels et al., 2011; Dettmer et al., 2015). In vitro, monomeric αSyn interacts with
synthetic lipids to cause membrane remodeling (Jiang et al., 2013). This association is mediated
by the N-terminal domain with its repeat regions assuming an extended alpha helical conformation
upon lipid binding (Ulmer et al., 2005). Hence, while the exact role of this protein in
neurobiological process is not fully understood, its neuronal localization, ability to associate with
lipids, and regulation of synaptic transmission all indicate roles in vesicle formation, trafficking,
or cargo release (Lashuel et al., 2013). Additionally, its C-terminal tail also has implicated roles in
nuclear localization, metal binding, or mediation of protein-protein interactions (Emamzadeh,
2016).

Historically, αSyn was discovered and characterized as a 35-amino acid segment that tightly
interacts with SDS-resistant deposits isolated from Alzheimer’s disease (AD) patient brains (Ueda
et al., 1993). Since this peptide did not match the sequence of the AD-linked peptide amyloid β,
the peptide was tentatively called the non-amyloid component (NAC). This peptide was later
mapped as residues 61-95 of the full-length αSyn, characterized by a highly hydrophobic amino
acid composition that explains its propensity to co-deposit with other amyloidogenic proteins.
Indeed, it is widely demonstrated that purified αSyn can aggregate extensively, and that the NAC
region is essential for aggregation (H.-T. Li et al., 2002; Ueda et al., 1993). Following its discovery
in AD plaques and development of immunohistochemical tools for its detection, αSyn was
identified as the principal component of abnormal inclusions such as Lewy bodies (LBs) and Lewy
neurites (LNs), and glial cytoplasmic inclusions (GCIs) (W. Yang & Yu, 2017). αSyn detected
from these inclusions are subject to numerous modifications including phosphorylation at Ser129
(pS129), ubiquitination, and truncations (Mahul-Mellier et al., 2020; Schmid et al., 2013). Like
119
tau, αSyn aggregates have also been implicated in a number of NDs collectively known as
synucleinopathies which include Parkinson’s disease (PD), multiple systems atrophy (MSA) and
dementia with Lewy bodies (DLB). Importantly, the type of synucleinopathy and the
accompanying pathology exhibited by patients correlate with various factors such as the type of
inclusions found during postmortem analyses and the type of cells affected (Peng et al., 2018).
More recently, high resolution structure studies also provide evidence that alterations in the
atomic-scale structure of ɑSyn fibrils may also correlate with the variable clinical presentations
observed in these synucleinopathies (Schweighauser et al., 2020).

ɑSyn is consistently identified as O-GlcNAc modified in multiple proteomics studies, with
up to nine different modification sites (Figure 3-3b) detected from rodent mice brains (Alfaro et
al., 2012; Morris et al., 2015; Z. Wang et al., 2010) or human tissue (S. Wang et al., 2017; Z. Wang
et al., 2009). Five of these modification sites are found within the NAC region, thus having the
potential to modulate the aggregation of ɑSyn monomers. Using mice in which OGA was
conditionally knocked out in dopaminergic neurons, upregulated O-GlcNAc levels were found to
be protective against the neurodegeneration induced by the overexpression of either wild-type or
mutant A53T ɑSyn (Lee et al., 2020). pS129 levels were also significantly reduced, indicating
decreased maturation of αSyn aggregates. These measures associated with elevated O-GlcNAc
were also consistent with improvements in synaptic transmission, dopamine function, and motor
learning. The authors also noted that chronically upregulated O-GlcNAc levels do not negatively
affect neuronal structures. In contrast, conditional knockout of OGT showed detrimental effects,
suggesting the essentiality of O-GlcNAc to dopamine neuron health and survival. Importantly,
neuroprotective effects against ɑSyn overexpression were also observed when O-GlcNAc is
120
upregulated by ThG treatment, suggesting that pharmacological approaches could be a fruitful
intervention in synucleinopathies.

In order to study the direct and site-specific consequences of O-GlcNAcylation on ɑSyn,
our group prepared and characterized semi-synthetic O-GlcNAc modified ɑSyn proteins. Initial
work on O-GlcNAcylated Thr72 ɑSyn (gT72) demonstrated that the modification inhibits the
nucleation but not the extension step of aggregation, without affecting the ability of monomers to
induce curvature on lipids (Marotta et al., 2015). A follow up work on O-GlcNAc Ser87 ɑSyn
(gS87) site found a similar effect on nucleation (Y. E. Lewis et al., 2015), although it was noted
that the gT72 variant had a more significant degree of inhibition. The gT72 and gS87 proteins were
also later used to show that O-GlcNAc can inhibit proteolytic cleavage by calpain with potential
implications for the formation of aggregation-prone truncation fragments in PD (Levine et al.,
2017).

Given the site-specific effects observed for gT72 and gS87 ɑSyn, a parallel characterization of 4
different sites (Thr72, Thr75, Thr81, and Ser87) was performed (Levine et al., 2019). All of the
O-GlcNAc modified ɑSyn variants showed no difference from unmodified ɑSyn in their ability to
interact with lipid membranes. In aggregation assays, O-GlcNAcylation was found to be generally
inhibitory during the nucleation step, with the gT75 and gT81 variants showing the greatest
reduction in aggregates formed. Notably, gT72 and gS87 ɑSyn were able to form amyloids that
are likely different from those formed by unmodified monomers, as evidenced by transmission
electron microscopy and limited proteolysis with Proteinase K. During the extension step, O-
GlcNAc was also generally inhibitory, although the gT72 variant showed minimal inhibition
121

Figure 3-3. O-GlcNAc is a multifaceted modulator of protein aggregation. a. The amyloid
precursor protein (APP) can undergo two alternative processing mechanisms through the action of
ɑ-, β-, and γ- secretases. The amyloidogenic pathway is pertinent in AD as it generates Aβ peptides
that are highly prone towards aggregation. APP O-GlcNAcylation at Thr576 as well as O-
GlcNAcylation of a γ-secretase subunit are known to favor the non-amyloidogenic pathway. b.
Tau and ɑSyn are O-GlcNAc modified at multiple sites. O-GlcNAcylation of these two proteins
have been shown to inhibit both nucleation and extension steps of amyloid formation.
122
consistent with the previous study. In addition to studying single O-GlcNAc modifications, a
triply-modified variant (3Xg) was also synthesized, bearing O-GlcNAc at positions Thr72, Thr75
and Thr81. The 3Xg ɑSyn showed complete blocking of the nucleation and extension steps, and
the triple modification was also able to overcome the higher aggregation propensity of the A53T
mutant, indicating that the effect of O-GlcNAc is cumulative. The 3Xg protein was also able to
block the extension of unmodified ɑSyn in trans. Importantly, these inhibitory effects observed
during in vitro aggregation experiments were recapitulated in the reduction in toxicity observed
when these proteins were co-treated with pre-formed fibers onto primary neurons. Collectively,
biochemical work on semi-synthetic proteins supports a direct role for O-GlcNAc in inhibiting the
aggregation of ɑSyn, and this effect was also observed by an independent group using
recombinantly O-GlcNAcylated ɑSyn (J. Zhang et al., 2017).

3.6 Interplay with pathological phosphorylation
Like O-GlcNAcylation, protein phosphorylation is an enzymatic modification that is
dynamic and responsive to changes in cellular milieu. Phosphorylation modifications are added by
kinases on hydroxyl groups of tyrosine, serine or threonine residues, the latter two also being the
addition sites for O-GlcNAc. Thus, O-GlcNAc and phosphorylation engage in various forms of
interplay, where the presence of one can influence the addition and the downstream effect(s) of
the other (Hart et al., 2011). At the enzyme level, O-GlcNAc modifications of specific kinases
have been shown to affect their catalysis, substrate selectivity, and downstream signaling cascades
(Schwein & Woo, 2020). The opposite is also true, where phosphorylation on OGT or OGA has
been suggested to modulate enzymatic activity and ability to form protein-protein interactions with
their targets (Beausoleil et al., 2004; Whelan et al., 2008). At the substrate end, some Ser/Thr
123
residues are sites for competitive modification by both O-GlcNAc or phosphorylation, leading to
a reciprocal relationship with often opposite downstream effects (Figure 3-4a). In addition to
reciprocal effects, modification at one site of the substrate may also affect the propensity of a
proximal or distal residue to be modified, and these crosstalk avenues may have positive or
negative functional effects (van der Laarse et al., 2018).

3.6.1 Tau
Tau has over 80 tyrosine, serine, or threonine residues in its primary sequence that are
potential phosphorylation sites. Phosphorylation of soluble tau can influence its role in neurite
outgrowth and axon transport by modulating the affinity of tau for microtubules(Johnson &
Stoothoff, 2004). Phosphorylation of soluble tau may hence be a physiologically relevant
mechanism to dynamically tune these processes within cells. On the other hand, pathological
aggregates of tau in AD is invariably hyperphosphorylated at stoichiometries 3 to 4-fold higher
than in soluble tau from healthy controls (Köpke et al., 1993). A number of phosphorylation sites
are specifically and abnormally enriched such as Ser199, Ser202, Thr205, and Ser422, among
others (Neddens et al., 2018). Although the sequence of events in the progression of AD is not
completely clear, in vitro studies suggest that hyperphosphorylation is likely an event that precedes
aggregation, as phosphorylation of tau accelerates its fibrillization while dephosphorylation
greatly reduces oligomerization propensity (Alonso et al., 2001).

Shortly after the discovery of tau O-GlcNAcylation, its competitive crosstalk with
phosphorylation has been suggested (Arnold et al., 1996). Early mechanistic investigations by the
Gong lab using metabolically active rat brain slices showed that upregulation of O-GlcNAc with
124
PUGNAc increased protein O-GlcNAcylation and reduced tau phosphorylation at Ser199, Thr212,
Ser262, Ser396, and Ser422 (Fei Liu et al., 2004). In this study, a downregulation in O-GlcNAc
levels and increase in tau phosphorylation in AD brains were also observed and were linked to
dysregulated glucose metabolism. Subsequent work by the same group further demonstrated that
short-term fasting in mice decreased O-GlcNAc levels and consequently increased tau hyper-
phosphorylation (Xu Li et al., 2006). Notably, forebrain-specific genetic knockout of OGT in mice
also resulted in increased tau hyperphosphorylation (A. C. Wang et al., 2016).

On the other hand, studies on different mice models of tauopathies utilizing OGA inhibition
showed conflicting effects on tau phosphorylation. Treatment of JNPL3 mice with ThG caused no
reduction in phosphorylation of either soluble or pathological tau species even though O-
GlcNAcylated tau levels increased (Yuzwa et al., 2012). Given that there was also a significant
decrease in aggregated tau and NFTs in ThG-treated JNPL3 mice, O-GlcNAc was thus proposed
to directly inhibit the oligomerization of tau even when tau is phosphorylated. On the other hand,
ThG treatment of rTg4510 mice resulted in decreased tau hyperphosphorylation in aggregates but
not in the soluble fraction (Graham et al., 2014; Hastings et al., 2017). Hastings et. al. also reported
that O-GlcNAc tau was only detected in the soluble, less phosphorylated fraction of tau, and this
was also reflected in an independent ex vivo study of AD brains (Fei Liu et al., 2004) as well as
cell culture-based studies on human neuroblastomas and tau-overexpressing HEK cells (Lefebvre
et al., 2003; Lim et al., 2015). It was proposed that the relatively weaker effect of O-GlcNAc
towards hyperphosphorylation in JNPL3 mice merely reflects differences in the rodent models
used. The rTg4510 model is characterized by higher penetrance of tauopathy due to higher
125
overexpression levels of tau, thus resulting in the more pronounced manifestations of tau-related
phenotypes in this transgenic line (Yuzwa & Vocadlo, 2014).

In the context of global O-GlcNAc alterations via genetic or chemical knockdown, changes
in the O-GlcNAc state of multiple kinases can contribute to the interplay between tau
phosphorylation and O-GlcNAcylation. These indirect enzyme-level mechanisms of crosstalk are
more complex to analyze, although some attempt has been made (Yu et al., 2012). Meanwhile,
direct mechanisms for crosstalk based on substrate-level inhibition of phosphorylation by O-
GlcNAc have also been elucidated from in vitro studies. For instance, Ser400 O-GlcNAcylation
was shown to inhibit both reciprocal phosphorylation at Ser 400, and adjacent phosphorylations at
Ser396 and Ser404 by CDK2 and GSK3β kinases (Smet-Nocca et al., 2011). Conversely,
constitutive phosphorylation at either Ser396, 400 or 404 inhibited O-GlcNAc modification of a
tau peptide by purified OGT. A recent NMR study also found that O-GlcNAcylation of tau at
Ser400 minimally decreased Ser404 phosphorylation by rat brain extracts but not under conditions
of hyperphosphorylation by the ERK2 kinase (Bourré et al., 2018).

3.6.2 α-Synuclein
Within its primary sequence, αSyn can be phosphorylated at the N-terminal Tyr39, the
NAC-associated Ser87, and the C-terminal Tyr121, Tyr125, Ser129, Tyr133, and Tyr136 residues,
through the involvement of multiple kinases (Negro et al., 2002; Oueslati, 2016; Paleologou et al.,
2010). These phosphorylation events have been shown to site-specifically modulate membrane
binding, aggregation kinetics, aggregate morphology, and neurotoxicity. Similar to tau, aggregated
forms of αSyn in pathological inclusions bear a distinct phosphorylation signature primarily
126
characterized by an enrichment of phosphorylated Ser129 (pS129) and some phosphorylated Ser87
residues. In fact, while in normal brains only 4% of total αSyn bears pS129, this number is
estimated at 90% in αSyn-staining PD brain deposits (Anderson et al., 2006; Fujiwara et al., 2002).
The consequence of this modification in the context of disease progression is still under debate
with some models suggesting that it promotes aggregation and neurotoxicity, while some point to
its role as a neuroprotective modification (Xu et al., 2015). However, evidence suggests that pS129
accumulates in aggregated rather than monomer species of αSyn, suggesting that it is a potential
response mechanism after initiation of intracellular aggregation (Mahul-Mellier et al., 2020;
Mbefo et al., 2010; Waxman & Giasson, 2008). Nonetheless, its accumulation in synucleinopathies
makes pS129 a convenient marker that is widely useful for diagnosis and disease staging, despite
recent arguments that pS129 by itself is an insufficient indicator of inclusion body formation and
its accompanying pathologies (Fares et al., 2021; Mahul-Mellier et al., 2020).

Neuron-specific conditional knockout of OGA in αSyn-overexpressing mice decreased the
accumulation of pS129 modifications (Lee et al., 2020). In the same study, a similar reduction of
pS129 levels was also observed following ThG treatment of αSyn overexpressing mice. Although
this appears to be a negative crosstalk phenomenon, it is likely that the reduction in pS129 is due
to O-GlcNAc’s inhibition of αSyn aggregation resulting in the formation of fewer species that are
the targeted for Ser129 phosphorylation. More direct evidence of crosstalk between
phosphorylation and O-GlcNAcylation on αSyn has also been investigated through the use of
semi-synthetic O-GlcNAcylated protein (Marotta et al., 2015). In vitro phosphorylation assays
using Thr72 O-GlcNAcylated αSyn modulated the activity of three different kinases studied:
casein kinase 1 (CK1), polo-like kinase 1 (PLK1), and G-receptor kinase 5 (GRK5).
127
Phosphorylation on S87 by CK1 was slightly enhanced by O-GlcNAc, while phosphorylation on
S129 by all three kinases was inhibited. Thus, while the physiological consequences of these
phosphorylation events are still unclear, O-GlcNAc appears capable of imparting another layer of
influence on the progression of synucleinopathies.

3.7 O-GlcNAc in synaptic health, vesicular transport and trafficking
The synapse is the major information transfer region of neurons and the maintenance of
synaptic health is important for central nervous system processes. Neuronal communication across
synapses occurs through transfer of signals either as electrical information in the form of ions or
chemical information in the form of neurotransmitters (Pereda, 2014). Aside from
neurotransmitters, synapses also facilitate intra- and extracellular trafficking of other biomolecules
when synaptic vesicles are either internalized (endocytosis) or released (exocytosis) along with
their cargo(Saheki & De Camilli, 2012). In NDs, dysfunctional processes that occur on synapses
and synaptic vesicles, collectively known as synaptopathies, are proposed to be events that
progress downstream of proteotoxic stress (Taoufik et al., 2018). Notably, the major amyloid
proteins Aβ, tau, and αSyn are synapse-associated, as well as other proteins that are genetically
linked to NDs including presenilin(Kelleher 3rd & Shen, 2017) in AD, and parkin (Sassone et
al., 2017) and LRRK2 (Piccoli et al., 2011) in PD.

Not only is O-GlcNAc highest in the brain among all other organs, it is also highly enriched
in synapses (Cole & Hart, 2001). Given the genetic link between OGT and OGA mutations and
developmental or neurological disabilities (Ertekin-Taner et al., 2000; Shafi et al., 2000; Willems
et al., 2017), O-GlcNAc has been long proposed to play a role in vesicular trafficking and signaling
128
(Cole & Hart, 2001; Khidekel et al., 2004). In mice, conditional knockout of OGT downregulates
neurotransmitter co-transmission at dopamine synapses (Lee et al., 2020). In contrast, conditional
knockout of OGA does not alter baseline synaptic parameters such as spontaneous firing,
membrane excitability, and input resistance. Instead, the increase in O-GlcNAc levels enhanced
the transmission of neurotransmitters at dopamine terminals when excitatory input is applied.

Mechanisms involving specific synaptic proteins and the consequences of their O-GlcNAc
modification have also been studied. As mentioned in a previous section, inhibition of endocytosis
by O-GlcNAc was observed and found important for APP processing, where reduced APP
internalization resulted in less amyloidogenic products (Chun et al., 2015, 2017). Clathrin-
associated protein AP180 (previously AP-3) was also previously discovered to be O-
GlcNAcylated at its structural domain (Murphy et al., 1994). Interestingly, a reduction in O-
GlcNAcylated AP180 protein was subsequently detected in AD brains compared to controls (Yao
& Coleman, 1998). The same group also determined that the loss in detectable O-GlcNAcylated
AP180 is due to a loss in the overall AP180 levels, and thus proposed that O-GlcNAc in AD brains
may play a role in stabilizing AP180 against proteolytic degradation (Yao & Coleman, 1998).
Since AP180 is known to associate with clathrin-coated synaptic vesicles for recycling and
maintaining a pool of releasable vesicles (Morgan et al., 1999), it was suggested that the loss of
this modification results in a loss of clathrin-coated vesicles in synapses during neurodegeneration.
Another O-GlcNAcylated protein, synapsin, was also studied for its role in hippocampal plasticity
(Tallent et al., 2009). Synapsins are proteins that tether synaptic vesicles onto the cytoskeleton to
regulate vesicle release, and they are known to be heavily O-GlcNAcylated at multiple sites that
flank phosphorylation sites (Cole & Hart, 1999; Vosseller et al., 2006). Upregulation of O-GlcNAc
129
levels with the OGA chemical inhibitor NPentGT resulted in an increase in phosphorylation of
synapsin (Tallent et al., 2009). Phosphorylation activates synapsins, promoting the movement of
synaptic vesicles from reserve to releasable mode. Thus, O-GlcNAc-related synapsin activation
rationalized the observed increase in in vivo hippocampal plasticity in NPentGT-treated brain
slices.

The transport and transmission of protein amyloids from cell-to-cell also contributes to the
spread of pathologies in NDs (Peng et al., 2020; Soto & Pritzkow, 2018). Cellular experiments
have shown that tau or αSyn aggregates added exogenously can be internalized by cells and in
turn seed the intracellular pool of monomers (Luk et al., 2009; Strang et al., 2018). This effect is
also recapitulated in vivo with direct injection of pre-formed protein fibrils in live mice resulting
in neurodegeneration (B. Zhang et al., 2019). Neurons that internalize protein aggregates further
propagate the pathology to healthy neurons, through mechanisms involving initial release via
exocytosis or cell death, followed by endocytosis by neighboring cells (Figure 3-4b) (Vasili et al.,
2019). Given the previously described effects of O-GlcNAc in modulating endocytosis, Tavassoly
et. al. investigated the effects of global O-GlcNAc upregulation in the uptake and spread of αSyn
aggregates (Tavassoly et al., 2020). Their group found that O-GlcNAc upregulation either via ThG
treatment or OGA siRNA knockdown resulted in less endocytosis of exogenous αSyn fibrils by
SK-N-SH cultured neuroblastomas, H4 neurogliomas and primary mouse cortical neurons. The
opposite effect was observed when O-GlcNAc was downregulated via treatment with the OGT
inhibitor 5S-GlcNHex, resulting in greater uptake. Importantly, this regulation of endocytosis may
be specific to αSyn fibrils (or other conformationally-similar amyloids), as internalization of other
general ligands for endocytosis were not affected by O-GlcNAc alterations.
130
3.8 O-GlcNAc and autophagy
Another inducible response mechanism against the proteotoxic stress induced by protein
aggregates is autophagy wherein cytosolic proteins, protein complexes, or organelles undergo non-
specific, lysosome-dependent clearance. Various types of autophagy pathways are described
(Parzych & Klionsky, 2014), but the most common associated with the degradation of proteins is
macroautophagy. In this pathway, targets for clearance are initially transferred to lysosomal
membranes where they bind to lysosome-associated membrane proteins. This results in
engulfment and sequestration of the target to form an autophagosome. The autophagosome then
fuses with lysosomes, translocating the cargo destined for degradation into the lysosomal lumen
where proteases perform degradation. Given that impaired autophagy is observed in NDs, and the
amyloid products of Aβ (Wei et al., 2019), tau (Krüger et al., 2012), and α-Synuclein (Choi et al.,
2020) have all been demonstrated as targets for autophagy, it is proposed that increasing autophagy
flux may be a protective and beneficial mechanism against neurodegeneration (Menzies et al.,
2017).

O-GlcNAc is a well-documented regulator of autophagy, although whether the effect is
promotive or inhibitory appears to be highly context-dependent. Genetic studies by Guo et. al.
showed that OGT knockdown in C. elegans and HeLa cells upregulated autophagy by directly
promoting autophagosome formation and maturation (B. Guo et al., 2014), suggesting that O-
GlcNAc is a negative regulator of autophagy. In genetic studies using Drosophila, the same
inhibitory function for O-GlcNAc was found and was proposed to occur through the O-
GlcNAcylation of the kinase Akt and the transcription factor FOXO, both known upstream
regulators of autophagy (S. Park et al., 2015). O-GlcNAc also inhibited autophagy in
131
cardiomyocytes of diabetic mice (Marsh et al., 2013). On the other hand, O-GlcNAc was found to
be essential for the initiation and activation of autophagy in mammalian cells and mouse livers
(Ruan et al., 2017), as well as in SH-SY5Y cells(Jo et al., 2016).

In the context of neurodegeneration, ThG treatment of rat primary cortical neurons
decreased autophagic flux and correlated with αSyn accumulation (Wani et al., 2017). In this
study, Wani et. al. showed that ThG treatment also enhanced the phosphorylation of the
mechanistic target of rapamycin (mTOR), a key regulatory kinase that acts as a hub for sensing of
stimuli that triggers autophagy as well as for controlling downstream steps in autophagy
(Schmeisser & Parker, 2019). Specifically, phosphorylation of mTOR activates it, and in this
activated form, it signals to downregulate autophagy-related processes (Dossou & Basu, 2019). In
contrast, the Vocadlo lab reported that pharmacological upregulation of O-GlcNAc in
neuroblastoma N2a cells, primary rat neurons, and rat brains stimulated autophagy without causing
observable toxic effects (Zhu et al., 2018). In two mice models of AD, ThG treatment also resulted
in enhanced autophagosome formation and autophagic flux which correlated with a decrease in
pathological tau species. They further argued that the activation of autophagy was mTOR-pathway
independent as phosphorylation of mTOR was not altered in their ThG treatment experiment.

The conflicting opinions about O-GlcNAc’s effect on autophagy may stem from the
complexity of the process, and the presence of multiple nodes in the pathway that O-GlcNAc may
influence. In an earlier paper, Wang and Hanover used C. elegans models of tauopathy-, Aβ-, and
polyglutamine expansion-induced proteotoxic stress to demonstrate that OGT or OGA loss of
function mutants showed the same effect of induction of autophagy as measured by the production
132
of autophagosome marker LGG-1 (P. Wang et al., 2012). They hence suggested that O-GlcNAc
cycling enzymes regulate multiple steps in the autophagic flux, both in the upstream signals as
well as the downstream targets. Indeed, there are more than 30 core autophagy-related proteins
and numerous proteins that interact in complex regulatory networks and pathways. Some of these
proteins are known to be O-GlcNAcylated and limited studies on some of these do indicate
contradictory effects. For instance, alanine mutants of the autophagy regulator SNAP-29 that could
not be O-GlcNAcylated promoted autophagy, suggesting that O-GlcNAc inhibits flux at this point
in the pathway (B. Guo et al., 2014). On the other hand, O-GlcNAcylation of ATG4B (a cysteine
protease) increases its proteolytic activity and promotes autophagy (Jo et al., 2016). Taken
altogether, O-GlcNAc can have variable consequences in autophagy activation at multiple distinct
points, and the restoration of misregulated O-GlcNAc levels in NDs to optimal level could be
critical for protein homeostasis.

3.9 O-GlcNAc and mitochondrial health
The mitochondrion is a multipurpose organelle that functions in ATP production,
generation and balance of reactive oxygen species (ROS), biosynthesis of amino acids, steroids,
and fatty acids, calcium homeostasis, and apoptosis (Johri & Beal, 2012). Mitochondria are
numerous and dynamic, and are constantly undergoing fragmentation, swelling, fusion, fission,
and recycling under the regulation of multiple proteins and the cytoskeletal network. Mitochondria
also house a distinct set of genetic information referred to as mitochondrial DNA (mtDNA) which
encodes for electron transport chain proteins (ATP synthase, cytochromes, and NADH
dehydroogenases), transfer RNAs, and ribosomal RNAs (Taylor & Turnbull, 2005). Due to the
high energy requirement of neurons, mitochondrial health, availability and proper distribution are
133
necessary for normal brain functions. Thus, deletions and mutations in mtDNA are identified in
PD (Bender et al., 2006) and AD (Coskun et al., 2004), as well as functional alterations in genome-
coded mitochondrial-associated proteins such as presenilins in AD and PINK1 and parkin in PD
(Ge et al., 2020).

Based on its ability to act as a nutrient sensor, O-GlcNAc is hypothesized to play a role in
mitochondrial dynamics and function. Sustained up or downregulation of O-GlcNAc levels have
been shown to alter mitochondrial structure, proteome composition, cellular respiration, and ROS
production, suggesting that optimal O-GlcNAc levels are important for normal activity (Tan et al.,
2014, 2017). One mechanistic insight that links O-GlcNAc and mitochondrial dynamics is based
on the work of Pekkurnaz et. al. where they found that O-GlcNAc modification of the protein
Milton regulates the motility of mitochondria, and this regulation is responsive to glucose
availability (Pekkurnaz et al., 2014). Milton is an adaptor protein that connects kinesin to
mitochondria-associated dynein motors and facilitates mitochondrial movement. Under elevated
glucose levels, Milton is O-GlcNAcylated resulting in a decrease in the mobility of mitochondria
and their accumulation at regions of increased glucose concentrations. The authors then proposed
that in the context of neurons, intensive energy and glucose utilization at synapses would cause
the localization of mitochondria at pre- and post-synapses, with the beneficial effect of increased
ATP availability for neuronal communication processes. This essential function of O-
GlcNAcylation on Milton is potentially altered in neurodegenerative disorders consistent with
impaired glucose metabolism. Additionally, an independently described significance of O-
GlcNAc to mitochondrial function in neurons is its potential role in the regulation of ATP synthase
activity. O-GlcNAcylation of ATP synthase subunit 5α (ATP5A) was detected at Thr432 and
134
found to be lower in AD brains (Cha et al., 2015). Moreover, direct binding of ATP5A to Aβ
peptides was proposed to hinder its ability to be modified by the mitochondrial splicing variant of
OGT (mOGT). Treatment of HeLa cells with Aβ resulted in decreased ATP5A O-GlcNAcylation,
ATP production, and ATP synthase activity. Importantly, treatment with ThG significantly
reversed the effect of Aβ treatment and restored ATP production homeostasis.

3.10 O-GlcNAc in inflammation and cell death
Another prominent feature in NDs is the elevation of chronic inflammatory reactions and
immune activation propagated by glial cells, typically referred to as gliosis. Microglia and
astrocytes are types of glial cells that serve to support and protect neuronal cells. One of their
functions in the innate immune response is to activate response mechanisms against “danger
signals” such as residual molecules from foreign bodies (i.e. viruses and microorganisms) as well
as natively produced molecules including proteins, complement factors, cytokines, chemokines,
glycation end products, etc. (Guzman-Martinez et al., 2019). In response to sensing these signals,
glia alter expression and production of surface markers (e.g. major histocompatibility complex II),
receptors, proinflammatory cytokines, tumor necrosis factor alpha, and other cytotoxic factors
including superoxide radicals, nitric oxide, and reactive oxygen species. Activated glia transmit
these proinflammatory molecules through communication with neurons, and the balance in this
cascade draws the line between neurotoxicity and beneficial effects. In AD, inflammation can also
signal neurons to undergo a programmed cell death mechanism known as necroptosis, and an
uncontrolled amplification of this effect results in large scale neuronal death and brain atrophy in
AD patients (Caccamo et al., 2017).

135
Loss of O-GlcNAc has been linked to an upregulation of inflammation in neurons (A. C.
Wang et al., 2016) while OGA inhibition in 5xFAD rodents elicited downregulation of
neuroinflammation (Kim et al., 2013). Whether these observations are due to O-GlcNAc’s role in
processes that precede inflammation or O-GlcNAc directly and independently influence
inflammatory pathways remains unclear from these studies. In more specific investigations, O-
GlcNAc appears able to elicit both pro- or anti-inflammatory effects depending on cell type and
protein target of modification (Y. Li et al., 2019). Some immune-related proteins that O-GlcNAc
activates are NF-κB (W. H. Yang et al., 2008), Sp1 (Donovan et al., 2014), and STAT3 (Xinghui
Li et al., 2017)—transcription factors that enhance the production of proinflammatory peptides
and proteins. On the other hand, O-GlcNAcylation of receptor-interacting protein kinase 3
(RIPK3) has been shown to downregulate innate immune signaling and necroptosis (Xinghui Li
et al., 2019), and this mechanism has important implications in AD. RIPK3 is a kinase that forms
a complex with RIPK1 to form the core necroptosis-inducing signaling complex known as the
necrosome (Figure 3-4c). The necrosome then acts through the mixed lineage kinase domain–like
pseudo-kinase (MLKL) to signal necroptosis by causing breakdown of membranes and release of
cell contents. Li et. al. initially found that O-GlcNAcylation of RIPK3 at Thr467 in mouse
macrophages inhibited its ability to form a complex with RIPK1, hence limiting the formation of
the necrosome and its downstream immune signaling (Xinghui Li et al., 2019). More recently, this
mechanism was also investigated in the context of AD (J. Park et al., 2021). In AD brains,
increased necroptosis correlated with a decrease in global O-GlcNAc levels. In OGA-
haploinsufficient (OGA
+/-
) 5xFAD mice, the elevated O-GlcNAc levels (compared to OGA
+/+

5xFAD) also correlated with a decrease in RIPK1 binding to RIPK3, reduction in the release of

136

Figure 3-4. O-GlcNAc influences multiple mechanisms in neurodegeneration. a. O-GlcNAc
participates in various forms of crosstalk with phosphorylation. Some modification sites can be
modified by both types of PTM, leading to direct reciprocal relationship wherein the presence of
one prevents the addition of the other. The presence of a PTM on one site can also affect a proximal
or distal modification site. Specific O-GlcNAc sites on tau and αSyn are known to inhibit
phosphorylation at different sites, and vice versa. b. Cell-to-cell propagation of neurons occur
through release of aggregates by an affected neuron, followed by uptake of surrounding neurons.
The process of endocytosis of exogenous aggregates is inhibited by upregulation of O-GlcNAc. c.
Necroptosis is a programmed form of cell death that is initiated by the formation of a RIPK1-
RIPK3 complex that signals downstream toward inflammation and necrosis. O-GlcNAc inhibits
the formation of the RIPK1-RIPK3 complex, resulting in reduced neuroinflammation and
necroptosis.

137
necroptosis related factors, restoration of normal mitochondrial function, and suppression of
gliosis. Importantly, the reduction in necroptosis and cell death also correlated with the
amelioration of cognitive decline, further substantiating the protective and potentially therapeutic
role of O-GlcNAc in AD and other NDs.

3.11 Conclusions
The potential utility of O-GlcNAc upregulation as a preventive or curative therapy
currently being explored in clinical trials appears promising given the abundance of evidence that
demonstrates a multilateral influence of O-GlcNAc on neurodegeneration-related processes.
Although the major contributing mechanism is unclear and undetermined, multiple pathways
likely combine to cause an overall beneficial effect. Importantly, careful consideration also needs
to be given to the safety and tolerability of long-term increases in O-GlcNAcylation. This is
especially true given the wide scope of proteins and pathways affected by this PTM. Concerns
have been raised regarding the possibility that altering with O-GlcNAc levels could result in
metabolic dysregulation. This has been supported by the discovery that a single nucleotide
polymorphism in the gene encoding for OGA (potentially resulting in decreased OGA expression)
correlates with a higher incidence of type II diabetes (Lehman et al., 2005). Long-term PUGNAc
treatment has also been shown to cause insulin resistance in rat skeletal muscle (Arias et al., 2004).
This this has not been widely reproducible, as treatment of 3T3-L1 adipocytes and rodents with
the more specific inhibitor NButGT did not induce the same effect (Macauley et al., 2008, 2010).
Most recent data in mice and humans also show high tolerability for MK-8719 (Sandhu et al.,
2016). This observation might be explained by the fact that OGT and OGA expression are
reciprocally regulated to allow cells to maintain a moderate range of O-GlcNAc modifications (Z.
138
Zhang et al., 2014). Therefore, it is possible that healthy tissue may be able to adjust to OGA
inhibition through downregulation of OGT, potentially limiting the development of long-term
complications. It is also possible that pro-drug versions of OGA inhibitors might be created to
allow for more targeted OGA inhibition in the brain. However, it is an important future goal to test
these possibilities as these compounds move into the clinic. Another important future goal is the
development of diagnostics that can detect neurodegenerative diseases at early stages before
significant protein aggregation, spread, and the associated toxicity has accumulated. This advance
would allow OGA inhibitors to be applied at the appropriate time to allow for increased O-GlcNAc
to prevent protein aggregation, as later application may not help clear already aggregated protein
and it is not even clear if removing amyloids after they form is beneficial.

Outside of the area of OGA inhibitor development and testing, future work should continue
to focus on discovering and characterizing the effect of O-GlcNAc on the myriad untested substrate
proteins. This work should span protein biochemistry, cell biology, and animal experiments to
provide a holistic view on the many different pathways and processes that are likely
simultaneously altered by changes in O-GlcNAc levels. For example, the molecular mechanisms
by which O-GlcNAc inhibits the formation of Tau and α-synuclein amyloids is still somewhat
mysterious and our work suggests that the mechanism does not seem to be simply the presence of
a hydrophilic polyol (Galesic et al., 2021). Additionally, for those O-GlcNAc sites that do not
completely inhibit protein aggregation more research is needed to determine whether these
modifications might change the amyloid structure to form different aggregate “strains” that might
have altered pathogenicity. It is also very likely that O-GlcNAc has beneficial effects by altering
proteins apart from those that directly form amyloids, and these potential mechanisms need to be
139
identified and characterized. Anecdotally, we have found important biochemical consequences of
site-specific O-GlcNAc on all of the modified proteins that we have made, suggesting that there is
significant information yet to be learned. We hope that this encourages others to join the still
relatively small field exploring O-GlcNAc as a protective modification in neurodegenerative
diseases.
140
3.12 Chapter References

Abolhassani, N., Leon, J., Sheng, Z., Oka, S., Hamasaki, H., Iwaki, T., & Nakabeppu, Y. (2017).
Molecular pathophysiology of impaired glucose metabolism, mitochondrial dysfunction, and
oxidative DNA damage in Alzheimer’s disease brain. Mechanisms of Ageing and Development,
161, 95–104. https://doi.org/10.1016/j.mad.2016.05.005

Agouridas, V., El Mahdi, O., Diemer, V., Cargoët, M., Monbaliu, J. C. M., & Melnyk, O. (2019).
Native Chemical Ligation and Extended Methods: Mechanisms, Catalysis, Scope, and Limitations.
Chemical Reviews, 119(12). https://doi.org/10.1021/acs.chemrev.8b00712

Aguilar, A. L., Hou, X., Wen, L., Wang, P. G., & Wu, P. (2017). A Chemoenzymatic Histology
Method for O-GlcNAc Detection. ChemBioChem, 18(24), 2416–2421.
https://doi.org/https://doi.org/10.1002/cbic.201700515

Akimoto, Y., Comer, F. I., Cole, R. N., Kudo, A., Kawakami, H., Hirano, H., & Hart, G. W. (2003).
Localization of the O-GlcNAc transferase and O-GlcNAc-modified proteins in rat cerebellar
cortex. Brain Research, 966(2), 194–205. https://doi.org/10.1016/S0006-8993(02)04158-6

Alexander, G. E. (2004). Biology of Parkinson’s disease: pathogenesis and pathophysiology of a
multisystem neurodegenerative disorder. Dialogues in Clinical Neuroscience, 6(3), 259–280.
https://doi.org/10.31887/DCNS.2004.6.3/galexander

141
Alfaro, J. F., Gong, C. X., Monroe, M. E., Aldrich, J. T., Clauss, T. R. W., Purvine, S. O., Wang,
Z., Camp, D. G., Shabanowitz, J., Stanley, P., Hart, G. W., Hunt, D. F., Yang, F., & Smith, R. D.
(2012). Tandem mass spectrometry identifies many mouse brain O-GlcNAcylated proteins
including EGF domain-specific O-GlcNAc transferase targets. Proceedings of the National
Academy of Sciences of the United States of America, 109(19), 7280–7285.
https://doi.org/10.1073/pnas.1200425109

Alonso, A. D. C., Zaidi, T., Novak, M., Grundke-Iqbal, I., & Iqbal, K. (2001).
Hyperphosphorylation induces self-assembly of τ into tangles of paired helical filaments/straight
filaments. Proceedings of the National Academy of Sciences of the United States of America,
98(12), 6923–6928. https://doi.org/10.1073/pnas.121119298

Alteen, M. G., Tan, H. Y., & Vocadlo, D. J. (2021). Monitoring and modulating O-GlcNAcylation:
assays and inhibitors of O-GlcNAc processing enzymes. Current Opinion in Structural Biology,
68, 157–165. https://doi.org/10.1016/j.sbi.2020.12.008

Anderson, J. P., Walker, D. E., Goldstein, J. M., de Laat, R., Banducci, K., Caccavello, R. J.,
Barbour, R., Huang, J., Kling, K., Lee, M., Diep, L., Keim, P. S., Shen, X., Chataway, T.,
Schlossmacher, M. G., Seubert, P., Schenk, D., Sinha, S., Gai, W. P., & Chilcote, T. J. (2006).
Phosphorylation of Ser-129 Is the Dominant Pathological Modification of α-Synuclein in Familial
and Sporadic Lewy Body Disease*. Journal of Biological Chemistry, 281(40), 29739–29752.
https://doi.org/https://doi.org/10.1074/jbc.M600933200

142
Arias, E. B., Kim, J., & Cartee, G. D. (2004). Prolonged Incubation in PUGNAc Results in
Increased Protein O-Linked Glycosylation and Insulin Resistance in Rat Skeletal Muscle.
Diabetes, 53(4), 921 LP – 930. https://doi.org/10.2337/diabetes.53.4.921

Arnold, C. S., Johnson, G. W., Cole, R. N., Dong, D. L.-Y., Lee, M., & Hart, G. W. (1996). The
Microtubule-associated Protein Tau Is Extensively Modified with O-linked N-
acetylglucosamine*. Journal of Biological Chemistry, 271(46), 28741–28744.
https://doi.org/https://doi.org/10.1074/jbc.271.46.28741

Arosio, P., Knowles, T. P. J., & Linse, S. (2015). On the lag phase in amyloid fibril formation.
Physical Chemistry Chemical Physics : PCCP, 17(12), 7606–7618.
https://doi.org/10.1039/c4cp05563b

Balana, A. T., Levine, P. M., Craven, T. W., Mukherjee, S., Pedowitz, N. J., Moon, S. P.,
Takahashi, T. T., Becker, C. F. W., Baker, D., & Pratt, M. R. (2021). O-GlcNAc modification of
small heat shock proteins enhances their anti-amyloid chaperone activity. Nature Chemistry.
https://doi.org/10.1038/s41557-021-00648-8

Bartels, A. L., & Leenders, K. L. (2010). Cyclooxygenase and neuroinflammation in Parkinson’s
disease neurodegeneration. Current Neuropharmacology, 8(1), 62–68.
https://doi.org/10.2174/157015910790909485

143
Bartels, T., Choi, J. G., & Selkoe, D. J. (2011). α-Synuclein occurs physiologically as a helically
folded tetramer that resists aggregation. Nature, 477(7362), 107–111.
https://doi.org/10.1038/nature10324

Beausoleil, S. A., Jedrychowski, M., Schwartz, D., Elias, J. E., Villén, J., Li, J., Cohn, M. A.,
Cantley, L. C., & Gygi, S. P. (2004). Large-scale characterization of HeLa cell nuclear
phosphoproteins. Proceedings of the National Academy of Sciences of the United States of
America, 101(33), 12130–12135. https://doi.org/10.1073/pnas.0404720101

Bekris, L. M., Yu, C.-E., Bird, T. D., & Tsuang, D. W. (2010). Genetics of Alzheimer disease.
Journal of Geriatric Psychiatry and Neurology, 23(4), 213–227.
https://doi.org/10.1177/0891988710383571

Bender, A., Krishnan, K. J., Morris, C. M., Taylor, G. A., Reeve, A. K., Perry, R. H., Jaros, E.,
Hersheson, J. S., Betts, J., Klopstock, T., Taylor, R. W., & Turnbull, D. M. (2006). High levels of
mitochondrial DNA deletions in substantia nigra neurons in aging and Parkinson disease. Nature
Genetics, 38(5), 515–517. https://doi.org/10.1038/ng1769

Bird, T. D. (2008). Genetic aspects of Alzheimer disease. Genetics in Medicine, 10(4), 231–239.
https://doi.org/10.1097/GIM.0b013e31816b64dc

Bond, M. R., & Hanover, J. A. (2015). A little sugar goes a long way: The cell biology of O-
GlcNAc. Journal of Cell Biology, 208(7), 869–880. https://doi.org/10.1083/jcb.201501101
144
Borghammer, P., Hansen, S. B., Eggers, C., Chakravarty, M., Vang, K., Aanerud, J., Hilker, R.,
Heiss, W. D., Rodell, A., Munk, O. L., Keator, D., & Gjedde, A. (2012). Glucose metabolism in
small subcortical structures in Parkinson’s disease. Acta Neurologica Scandinavica, 125(5), 303–
310. https://doi.org/10.1111/j.1600-0404.2011.01556.x

Borghgraef, P., Menuet, C., Theunis, C., Louis, J. V., Devijver, H., Maurin, H., Smet-Nocca, C.,
Lippens, G., Hilaire, G., Gijsen, H., Moechars, D., & Van Leuven, F. (2013). Increasing brain
protein O-GlcNAcylation mitigates breathing defects and mortality of Tau.P301L mice. PLoS
ONE, 8(12), 1–13. https://doi.org/10.1371/journal.pone.0084442

Bourré, G., Cantrelle, F. X., Kamah, A., Chambraud, B., Landrieu, I., & Smet-Nocca, C. (2018).
Direct crosstalk between O-GlcNAcylation and phosphorylation of tau protein investigated by
NMR spectroscopy. Frontiers in Endocrinology, 9(OCT), 1–13.
https://doi.org/10.3389/fendo.2018.00595

Braak, H., Braak, E., & Bohl, J. (1993). Staging of Alzheimer-Related Cortical Destruction.
European Neurology, 33(6), 403–408. https://doi.org/10.1159/000116984

Buell, A. K., Galvagnion, C., Gaspar, R., Sparr, E., Vendruscolo, M., Knowles, T. P. J., Linse, S.,
& Dobson, C. M. (2014). Solution conditions determine the relative importance of nucleation and
growth processes in -synuclein aggregation. Proceedings of the National Academy of Sciences,
111(21), 7671–7676. https://doi.org/10.1073/pnas.1315346111

145
Caccamo, A., Branca, C., Piras, I. S., Ferreira, E., Huentelman, M. J., Liang, W. S., Readhead, B.,
Dudley, J. T., Spangenberg, E. E., Green, K. N., Belfiore, R., Winslow, W., & Oddo, S. (2017).
Necroptosis activation in Alzheimer’s disease. Nature Neuroscience, 20(9), 1236–1246.
https://doi.org/10.1038/nn.4608

Cameron, A., Giacomozzi, B., Joyce, J., Gray, A., Graham, D., Ousson, S., Neny, M., Beher, D.,
Carlson, G., O’Moore, J., Shearman, M., & Hering, H. (2013). Generation and characterization of
a rabbit monoclonal antibody site-specific for tau O-GlcNAcylated at serine 400. FEBS Letters,
587(22), 3722–3728. https://doi.org/10.1016/j.febslet.2013.09.042

Cekic, N., Heinonen, J. E., Stubbs, K. A., Roth, C., He, Y., Bennet, A. J., McEachern, E. J., Davies,
G. J., & Vocadlo, D. J. (2016). Analysis of transition state mimicry by tight binding
aminothiazoline inhibitors provides insight into catalysis by human O-GlcNAcase. Chemical
Science, 7(6), 3742–3750. https://doi.org/10.1039/C6SC00370B

Cha, M. Y., Cho, H. J., Kim, C., Jung, Y. O., Kang, M. J., Murray, M. E., Hong, H. S., Choi, Y.
J., Choi, H., Kim, D. K., Choi, H., Kim, J., Dickson, D. W., Song, H. K., Cho, J. W., Yi, E. C.,
Kim, J., Jin, S. M., & Mook-Jung, I. (2015). Mitochondrial ATP synthase activity is impaired by
suppressed O-GlcNAcylation in Alzheimer’s disease. Human Molecular Genetics, 24(22), 6492–
6504. https://doi.org/10.1093/hmg/ddv358

146
Chartier-Harlin, M.-C., Kachergus, Jennifer Roumier, C., Mouroux, V., Douay, X., Lincoln, S.,
Levecque, C., Larvor, L., Andrieux, J., Hulihan, M., Waucquier, N., Defebvre, D., Amouyel, P.,
& Farrer, M. (2004). α-synuclein locus duplication as a cause of familial Parkinson’s disease.
Lancet, 364(9440), 1167–1169.

Chen, G. F., Xu, T. H., Yan, Y., Zhou, Y. R., Jiang, Y., Melcher, K., & Xu, H. E. (2017). Amyloid
beta: Structure, biology and structure-based therapeutic development. Acta Pharmacologica
Sinica, 38(9), 1205–1235. https://doi.org/10.1038/aps.2017.28

Choi, I., Zhang, Y., Seegobin, S. P., Pruvost, M., Wang, Q., Purtell, K., Zhang, B., & Yue, Z.
(2020). Microglia clear neuron-released α-synuclein via selective autophagy and prevent
neurodegeneration. Nature Communications, 11(1), 1386. https://doi.org/10.1038/s41467-020-
15119-w

Chun, Y. S., Kwon, O. H., & Chung, S. (2017). O-GlcNAcylation of amyloid-β precursor protein
at threonine 576 residue regulates trafficking and processing. Biochemical and Biophysical
Research Communications, 490(2), 486–491. https://doi.org/10.1016/j.bbrc.2017.06.067

Chun, Y. S., Park, Y., Oh, H. G., Kim, T. W., Yang, H. O., Park, M. K., & Chung, S. (2015). O-
GlcNAcylation promotes non-amyloidogenic processing of amyloid-β protein precursor via
inhibition of endocytosis from the plasma membrane. Journal of Alzheimer’s Disease, 44(1), 261–
275. https://doi.org/10.3233/JAD-140096

147
Cole, R. N., & Hart, G. W. (1999). Glycosylation Sites Flank Phosphorylation Sites on Synapsin
I. Journal of Neurochemistry, 73(1), 418–428. https://doi.org/https://doi.org/10.1046/j.1471-
4159.1999.0730418.x

Cole, R. N., & Hart, G. W. (2001). Cytosolic O-glycosylation is abundant in nerve terminals.
Journal of Neurochemistry, 79(5), 1080–1089. https://doi.org/10.1046/j.1471-4159.2001.00655.x

Conway, K. A., Harper, J. D., & Lansbury, P. T. (1998). Accelerated in vitro fibril formation by a
mutant α-synuclein linked to early-onset Parkinson disease. Nature Medicine, 4(11), 1318–1320.
https://doi.org/10.1038/3311

Conway, K. A., Lee, S. J., Rochet, J. C., Ding, T. T., Williamson, R. E., & Lansbury, P. T. (2000).
Acceleration of oligomerization, not fibrillization, is a shared property of both α-synuclein
mutations linked to early-onset Parkinson’s disease: Implications for pathogenesis and therapy.
Proceedings of the National Academy of Sciences of the United States of America, 97(2), 571–576.
https://doi.org/10.1073/pnas.97.2.571

Coskun, P. E., Beal, M. F., & Wallace, D. C. (2004). Alzheimer's brains harbor somatic
mtDNA control-region mutations that suppress mitochondrial transcription and replication.
Proceedings of the National Academy of Sciences of the United States of America, 101(29), 10726
LP – 10731. https://doi.org/10.1073/pnas.0403649101

148
Cremades, N., Cohen, S. I. A., Deas, E., Abramov, A. Y., Chen, A. Y., Orte, A., Sandal, M.,
Clarke, R. W., Dunne, P., Aprile, F. A., Bertoncini, C. W., Wood, N. W., Knowles, T. P. J.,
Dobson, C. M., & Klenerman, D. (2012). Direct observation of the interconversion of normal and
toxic forms of α-synuclein. Cell, 149(5), 1048–1059. https://doi.org/10.1016/j.cell.2012.03.037

Crowther, R. A. (1991). Straight and paired helical filaments in Alzheimer disease have a common
structural unit. Proceedings of the National Academy of Sciences of the United States of America,
88(6), 2288–2292. https://doi.org/10.1073/pnas.88.6.2288

Crowther, R. A., Olesen, O. F., Smith, M. J., Jakes, R., & Goedert, M. (1994). Assembly of
Alzheimer-like filaments from full-length tau protein. FEBS Letters, 337(2), 135–138.
https://doi.org/10.1016/0014-5793(94)80260-2

Dawson, P. E., Muir, T. W., Clark-Lewis, I., & Kent, S. B. (1994). Synthesis of proteins by native
chemical ligation. Science, 266(5186), 776 LP – 779. https://doi.org/10.1126/science.7973629

Dear, A. J., Michaels, T. C. T., Meisl, G., Klenerman, D., Wu, S., Perrett, S., Linse, S., Dobson,
C. M., & Knowles, T. P. J. (2020). Kinetic diversity of amyloid oligomers. Proceedings of the
National Academy of Sciences of the United States of America, 117(22), 28–31.
https://doi.org/10.1073/pnas.1922267117

149
Dettmer, U., Newman, A. J., Von Saucken, V. E., Bartels, T., & Selkoe, D. (2015). KTKEGV
repeat motifs are key mediators of normal α-synuclein tetramerization: Their mutation causes
excess monomers and neurotoxicity. Proceedings of the National Academy of Sciences of the
United States of America, 112(31), 9596–9601. https://doi.org/10.1073/pnas.1505953112

Donovan, K., Alekseev, O., Qi, X., Cho, W., & Azizkhan-Clifford, J. (2014). O-GlcNAc
modification of transcription factor Sp1 mediates hyperglycemia-induced VEGF-A upregulation
in retinal cells. Investigative Ophthalmology & Visual Science, 55(12), 7862–7873.
https://doi.org/10.1167/iovs.14-14048

Dossou, A. S., & Basu, A. (2019). The Emerging Roles of mTORC1 in Macromanaging
Autophagy. Cancers, 11(10), 1422. https://doi.org/10.3390/cancers11101422

Emamzadeh, F. N. (2016). Alpha-synuclein structure, functions, and interactions. Journal of
Research in Medical Sciences : The Official Journal of Isfahan University of Medical Sciences,
21, 29. https://doi.org/10.4103/1735-1995.181989

Ertekin-Taner, N., Graff-Radford, N., Younkin, L. H., Eckman, C., Baker, M., Adamson, J.,
Ronald, J., Blangero, J., Hutton, M., & Younkin, S. G. (2000). Linkage of plasma Aβ42 to a
quantitative locus on chromosome 10 in late-onset Alzheimer’s disease pedigrees. Science,
290(5500), 2303–2304. https://doi.org/10.1126/science.290.5500.2303

150
Fares, M. B., Jagannath, S., & Lashuel, H. A. (2021). Reverse engineering Lewy bodies: how far
have we come and how far can we go? Nature Reviews Neuroscience.
https://doi.org/10.1038/s41583-020-00416-6

Fitzpatrick, A. W. P., Falcon, B., He, S., Murzin, A. G., Murshudov, G., Garringer, H. J., Crowther,
R. A., Ghetti, B., Goedert, M., & Scheres, S. H. W. (2017). Cryo-EM structures of tau filaments
from Alzheimer’s disease. Nature, 547(7662), 185–190. https://doi.org/10.1038/nature23002

Förster, S., Welleford, A. S., Triplett, J. C., Sultana, R., Schmitz, B., & Butterfield, D. A. (2014).
Increased O-GlcNAc levels correlate with decreased O-GlcNAcase levels in Alzheimer disease
brain. Biochimica et Biophysica Acta - Molecular Basis of Disease, 1842(9), 1333–1339.
https://doi.org/10.1016/j.bbadis.2014.05.014

Fujiwara, H., Hasegawa, M., Dohmae, N., Kawashima, A., Masliah, E., Goldberg, M. S., Shen, J.,
Takio, K., & Iwatsubo, T. (2002). α-Synuclein is phosphorylated in synucleinopathy lesions.
Nature Cell Biology, 4(2), 160–164. https://doi.org/10.1038/ncb748

Galesic, A., Rakshit, A., Cutolo, G., Pacheco, R. P., Balana, A. T., Moon, S. P., & Pratt, M. R.
(2021). Comparison of N-Acetyl-Glucosamine to Other Monosaccharides Reveals Structural
Differences for the Inhibition of α-Synuclein Aggregation. ACS Chemical Biology, 16(1), 14–19.
https://doi.org/10.1021/acschembio.0c00716

151
Gao, Y., Wells, L., Comer, F. I., Parker, G. J., & Hart, G. W. (2001). Dynamic O-glycosylation of
nuclear and cytosolic proteins: Cloning and characterization of a neutral, cytosolic β-N-
acetylglucosaminidase from human brain. Journal of Biological Chemistry, 276(13), 9838–9845.
https://doi.org/10.1074/jbc.M010420200

Ge, P., Dawson, V. L., & Dawson, T. M. (2020). PINK1 and Parkin mitochondrial quality control:
a source of regional vulnerability in Parkinson’s disease. Molecular Neurodegeneration, 15(1), 20.
https://doi.org/10.1186/s13024-020-00367-7

Gendreau, K. L., & Hall, G. F. (2013). Tangles, Toxicity, and Tau Secretion in AD - New
Approaches to a Vexing Problem. Frontiers in Neurology, 4, 160.
https://doi.org/10.3389/fneur.2013.00160

Giasson, B. I., Uryu, K., Trojanowski, J. Q., & Lee, V. M. Y. (1999). Mutant and wild type human
α-synucleins assemble into elongated filaments with distinct morphologies in vitro. Journal of
Biological Chemistry, 274(12), 7619–7622. https://doi.org/10.1074/jbc.274.12.7619

Goedert, M., Jakes, R., Spillantini, M. G., Hasegawa, M., Smith, M. J., & Crowther, R. A. (1996).
Assembly of microtubule-associated protein tau into Alzheimer-like filaments induced by
sulphated glycosaminoglycans. Nature, 383(6600), 550–553. https://doi.org/10.1038/383550a0

152
Goedert, M., Spillantini, M. G., Potier, M. C., Ulrich, J., & Crowther, R. A. (1989). Cloning and
sequencing of the cDNA encoding an isoform of microtubule-associated protein tau containing
four tandem repeats: differential expression of tau protein mRNAs in human brain. EMBO Journal,
8(2), 393–399. https://doi.org/10.1002/j.1460-2075.1989.tb03390.x

Gorman, A. M. (2008). Neuronal cell death in neurodegenerative diseases: recurring themes
around protein handling. Journal of Cellular and Molecular Medicine, 12(6A), 2263–2280.
https://doi.org/10.1111/j.1582-4934.2008.00402.x

Graham, D. L., Gray, A. J., Joyce, J. A., Yu, D., O’Moore, J., Carlson, G. A., Shearman, M. S.,
Dellovade, T. L., & Hering, H. (2014). Increased O-GlcNAcylation reduces pathological tau
without affecting its normal phosphorylation in a mouse model of tauopathy. Neuropharmacology,
79, 307–313. https://doi.org/10.1016/j.neuropharm.2013.11.025

Greenwald, J., & Riek, R. (2010). Biology of Amyloid: Structure, Function, and Regulation.
Structure, 18(10), 1244–1260. https://doi.org/https://doi.org/10.1016/j.str.2010.08.009

Griffith, L. S., Mathes, M., & Schmitz, B. (1995). β-Amyloid precursor protein is modified with
O-linked N-acetylglucosamine. Journal of Neuroscience Research, 41(2), 270–278.
https://doi.org/https://doi.org/10.1002/jnr.490410214

153
Griffith, L. S., & Schmitz, B. (1995). O-Linked N-Acetylglucosamine Is Upregulated in Alzheimer
Brains. Biochemical and Biophysical Research Communications, 213(2), 424–431.
https://doi.org/https://doi.org/10.1006/bbrc.1995.2149

Guo, B., Liang, Q., Li, L., Hu, Z., Wu, F., Zhang, P., Ma, Y., Zhao, B., Kovács, A. L., Zhang, Z.,
Feng, D., Chen, S., & Zhang, H. (2014). O-GlcNAc-modification of SNAP-29 regulates
autophagosome maturation. Nature Cell Biology, 16(12), 1215–1226.
https://doi.org/10.1038/ncb3066

Guo, T., Zhang, D., Zeng, Y., Huang, T. Y., Xu, H., & Zhao, Y. (2020). Molecular and cellular
mechanisms underlying the pathogenesis of Alzheimer’s disease. Molecular Neurodegeneration,
15(1), 1–37. https://doi.org/10.1186/s13024-020-00391-7

Gupta, S., Banerjee, P., Laferla, F. M., & Selkoe, D. J. (2010). Alzheimer ’ s Disease : Genes ,
Proteins , and Therapy. 81(2), 741–766.

Guzman-Martinez, L., Maccioni, R. B., Andrade, V., Navarrete, L. P., Pastor, M. G., & Ramos-
Escobar, N. (2019). Neuroinflammation as a Common Feature of Neurodegenerative Disorders.
In Frontiers in Pharmacology (Vol. 10, p. 1008).
https://www.frontiersin.org/article/10.3389/fphar.2019.01008

154
Hart, G. W., Slawson, C., Ramirez-Correa, G., & Lagerlof, O. (2011). Cross talk between O-
GlcNAcylation and phosphorylation: roles in signaling, transcription, and chronic disease. Annual
Review of Biochemistry, 80, 825–858. https://doi.org/10.1146/annurev-biochem-060608-102511

Hastings, N. B., Wang, X., Song, L., Butts, B. D., Grotz, D., Hargreaves, R., Fred Hess, J., Hong,
K. L. K., Huang, C. R. R., Hyde, L., Laverty, M., Lee, J., Levitan, D., Lu, S. X., Maguire, M.,
Mahadomrongkul, V., McEachern, E. J., Ouyang, X., Rosahl, T. W., … Zhang, L. (2017).
Inhibition of O-GlcNAcase leads to elevation of O-GlcNAc tau and reduction of tauopathy and
cerebrospinal fluid tau in rTg4510 mice. Molecular Neurodegeneration, 12(1), 1–16.
https://doi.org/10.1186/s13024-017-0181-0

Ibanez, P., Bonnet, A., Debarges, B., Lohmann, E., Tison, F., Pollak, P., Agid, Y., Durr, A., &
Brice, A. (2004). Causal relation between alpha-synuclein gene duplication and familial
Parkinson’s disease. Lancet, 364(9440), 1169–1171.

Iwai, A., Masliah, E., Yoshimoto, M., Ge, N., Flanagan, L., Rohan de Silva, H. A., Kittel, A., &
Saitoh, T. (1995). The precursor protein of non-Aβ component of Alzheimer’s disease amyloid is
a presynaptic protein of the central nervous system. Neuron, 14(2), 467–475.
https://doi.org/10.1016/0896-6273(95)90302-X

Jacobsen, K. T., & Iverfeldt, K. (2011). O-GlcNAcylation increases non-amyloidogenic
processing of the amyloid-β precursor protein (APP). Biochemical and Biophysical Research
Communications, 404(3), 882–886. https://doi.org/10.1016/j.bbrc.2010.12.080
155
Jebarupa, B., Muralidharan, M., Arun, A., Mandal, A. K., & Mitra, G. (2018). Conformational
heterogeneity of tau: Implication on intrinsic disorder, acid stability and fibrillation in Alzheimer’s
disease. Biophysical Chemistry, 241, 27–37. https://doi.org/10.1016/j.bpc.2018.07.005

Jellinger, K. A. (2010). Basic mechanisms of neurodegeneration: A critical update. Journal of
Cellular and Molecular Medicine, 14(3), 457–487. https://doi.org/10.1111/j.1582-
4934.2010.01010.x

Jiang, Z., De Messieres, M., & Lee, J. C. (2013). Membrane remodeling by α-synuclein and effects
on amyloid formation. Journal of the American Chemical Society, 135(43), 15970–15973.
https://doi.org/10.1021/ja405993r

Jo, Y. K., Park, N. Y., Park, S. J., Kim, B. G., Shin, J. H., Jo, D. S., Bae, D. J., Suh, Y. A., Chang,
J. H., Lee, E. K., Kim, S. Y., Kim, J. C., & Cho, D. H. (2016). O-GlcNAcylation of ATG4B
positively regulates autophagy by increasing its hydroxylase activity. Oncotarget, 7(35), 57186–
57196. https://doi.org/10.18632/oncotarget.11083

Johnson, G. V. W., & Stoothoff, W. H. (2004). Tau phosphorylation in neuronal cell function and
dysfunction. Journal of Cell Science, 117(24), 5721 LP – 5729. https://doi.org/10.1242/jcs.01558

Johri, A., & Beal, M. F. (2012). Mitochondrial dysfunction in neurodegenerative diseases. The
Journal of Pharmacology and Experimental Therapeutics, 342(3), 619–630.
https://doi.org/10.1124/jpet.112.192138
156
Kahle, P. J., Neumann, M., Ozmen, L., Müller, V., Jacobsen, H., Schindzielorz, A., Okochi, M.,
Leimer, U., Van Der Putten, H., Probst, A., Kremmer, E., Kretzschmar, H. A., & Haass, C. (2000).
Subcellular localization of wild-type and Parkinson’s disease-associated mutant α-synuclein in
human and transgenic mouse brain. Journal of Neuroscience, 20(17), 6365–6373.
https://doi.org/10.1523/jneurosci.20-17-06365.2000

Kapogiannis, D., & Mattson, M. P. (2011). Disrupted energy metabolism and neuronal circuit
dysfunction in cognitive impairment and Alzheimer’s disease. The Lancet Neurology, 10(2), 187–
198. https://doi.org/10.1016/S1474-4422(10)70277-5

Karran, E., Mercken, M., & Strooper, B. De. (2011). The amyloid cascade hypothesis for
Alzheimer’s disease: An appraisal for the development of therapeutics. Nature Reviews Drug
Discovery, 10(9), 698–712. https://doi.org/10.1038/nrd3505

Kelleher 3rd, R. J., & Shen, J. (2017). Presenilin-1 mutations and Alzheimer’s disease.
Proceedings of the National Academy of Sciences of the United States of America, 114(4), 629–
631. https://doi.org/10.1073/pnas.1619574114

Khidekel, N., Ficarro, S. B., Peters, E. C., & Hsieh-Wilson, L. C. (2004). Exploring the O-GlcNAc
proteome: Direct identification of O-GlcNAc-modified from the brain. Proceedings of the
National Academy of Sciences of the United States of America, 101(36), 13132–13137.
https://doi.org/10.1073/pnas.0403471101

157
Kielbasa, W., Phipps, K. M., Tseng, J., Natanegara, F., Cheng, E., Monk, S. A., Bundgaard, C.,
Kevin, D. B., Nuthall, H. N., McDonald, N., Lindsay-Scott, P., Dreyfus, N., Hawk, M. K., Warner,
S., Biglan, K., Gilmore, J. A., Zhang, X., Mergott, D. J., & Lowe, S. L. (2020). A single ascending
dose study in healthy volunteers to assess the safety and PK of LY3372689, an inhibitor of O-
GlcNAcase (OGA) enzyme. Alzheimer’s & Dementia, 16(S9), 40473.
https://doi.org/10.1002/alz.040473

Kim, C., Nam, D. W., Park, S. Y., Song, H., Hong, H. S., Boo, J. H., Jung, E. S., Kim, Y., Baek,
J. Y., Kim, K. S., Cho, J. W., & Mook-Jung, I. (2013). O-linked β-N-acetylglucosaminidase
inhibitor attenuates β-amyloid plaque and rescues memory impairment. Neurobiology of Aging,
34(1), 275–285. https://doi.org/10.1016/j.neurobiolaging.2012.03.001

Kocahan, S., & Doğan, Z. (2017). Mechanisms of Alzheimer’s Disease Pathogenesis and
Prevention: The Brain, Neural Pathology, N-methyl-D-aspartate Receptors, Tau Protein and Other
Risk Factors. Clinical Psychopharmacology and Neuroscience : The Official Scientific Journal of
the Korean College of Neuropsychopharmacology, 15(1), 1–8.
https://doi.org/10.9758/cpn.2017.15.1.1

Köpke, E., Tung, Y. C., Shaikh, S., Alonso, A. C., Iqbal, K., & Grundke-Iqbal, I. (1993).
Microtubule-associated protein tau. Abnormal phosphorylation of a non-paired helical filament
pool in Alzheimer disease. Journal of Biological Chemistry, 268(32), 24374–24384.
https://doi.org/https://doi.org/10.1016/S0021-9258(20)80536-5

158
Kreppel, L. K., Blomberg, M. A., & Hart, G. W. (1997). Dynamic glycosylation of nuclear and
cytosolic proteins: Cloning and characterization of a unique O-GlcNAc transferase with multiple
tetratricopeptide repeats. Journal of Biological Chemistry, 272(14), 9308–9315.
https://doi.org/10.1074/jbc.272.14.9308

Krüger, U., Wang, Y., Kumar, S., & Mandelkow, E.-M. (2012). Autophagic degradation of tau in
primary neurons and its enhancement by trehalose. Neurobiology of Aging, 33(10), 2291–2305.
https://doi.org/https://doi.org/10.1016/j.neurobiolaging.2011.11.009

Kuperstein, I., Broersen, K., Benilova, I., Rozenski, J., Jonckheere, W., Debulpaep, M.,
Vandersteen, A., Segers-Nolten, I., Van Der Werf, K., Subramaniam, V., Braeken, D., Callewaert,
G., Bartic, C., D’Hooge, R., Martins, I. C., Rousseau, F., Schymkowitz, J., & De Strooper, B.
(2010). Neurotoxicity of Alzheimer’s disease Aβ peptides is induced by small changes in the Aβ42
to Aβ40 ratio. EMBO Journal, 29(19), 3408–3420. https://doi.org/10.1038/emboj.2010.211

Lashuel, H. A., Overk, C. R., Oueslati, A., & Masliah, E. (2013). The many faces of α-synuclein:
From structure and toxicity to therapeutic target. Nature Reviews Neuroscience, 14(1), 38–48.
https://doi.org/10.1038/nrn3406

159
Lee, B. E., Kim, H. Y., Kim, H. J., Jeong, H., Kim, B. G., Lee, H. E., Lee, J., Kim, H. B., Lee, S.
E., Yang, Y. R., Yi, E. C., Hanover, J. A., Myung, K., Suh, P. G., Kwon, T., & Kim, J. I. (2020).
O-GlcNAcylation regulates dopamine neuron function, survival and degeneration in Parkinson
disease. Brain : A Journal of Neurology, 143(12), 3699–3716.
https://doi.org/10.1093/brain/awaa320

Lefebvre, T., Ferreira, S., Dupont-Wallois, L., Bussière, T., Dupire, M.-J., Delacourte, A.,
Michalski, J.-C., & Caillet-Boudin, M.-L. (2003). Evidence of a balance between phosphorylation
and O-GlcNAc glycosylation of Tau proteins—a role in nuclear localization. Biochimica et
Biophysica Acta (BBA) - General Subjects, 1619(2), 167–176.
https://doi.org/https://doi.org/10.1016/S0304-4165(02)00477-4

Lehman, D. M., Fu, D.-J., Freeman, A. B., Hunt, K. J., Leach, R. J., Johnson-Pais, T., Hamlington,
J., Dyer, T. D., Arya, R., Abboud, H., Göring, H. H. H., Duggirala, R., Blangero, J., Konrad, R. J.,
& Stern, M. P. (2005). A Single Nucleotide Polymorphism in MGEA5 Encoding O-GlcNAc–
selective N-Acetyl-β-dGlucosaminidase Is Associated With Type 2 Diabetes in Mexican
Americans. Diabetes, 54(4), 1214 LP – 1221. https://doi.org/10.2337/diabetes.54.4.1214

Lemberg, K. M., Vornov, J. J., Rais, R., & Slusher, B. S. (2018). We're Not “DON” Yet:
Optimal Dosing and Prodrug Delivery of <em>6-Diazo-5-oxo-L-norleucine</em>
Molecular Cancer Therapeutics, 17(9), 1824 LP – 1832. https://doi.org/10.1158/1535-7163.MCT-
17-1148

160
Levine, P. M., De Leon, C. A., Galesic, A., Balana, A., Marotta, N. P., Lewis, Y. E., & Pratt, M.
R. (2017). O-GlcNAc modification inhibits the calpain-mediated cleavage of α-synuclein.
Bioorganic and Medicinal Chemistry, 25(18), 4977–4982.
https://doi.org/10.1016/j.bmc.2017.04.038

Levine, P. M., Galesic, A., Balana, A. T., Mahul-Mellier, A.-L. L., Navarro, M. X., De Leon, C.
A., Lashuel, H. A., & Pratt, M. R. (2019). α-Synuclein O-GlcNAcylation alters aggregation and
toxicity, revealing certain residues as potential inhibitors of Parkinson’s disease. Proceedings of
the National Academy of Sciences, 116(5), 1511–1519. https://doi.org/10.1073/pnas.1808845116

Lewis, J., McGowan, E., Rockwood, J., Melrose, H., Nacharaju, P., Van Slegtenhorst, M., Gwinn-
Hardy, K., Murphy, M. P., Baker, M., Yu, X., Duff, K., Hardy, J., Corral, A., Lin, W.-L., Yen, S.-
H., Dickson, D. W., Davies, P., & Hutton, M. (2000). Neurofibrillary tangles, amyotrophy and
progressive motor disturbance in mice expressing mutant (P301L) tau protein. Nature Genetics,
25(4), 402–405. https://doi.org/10.1038/78078

Lewis, Y. E., Galesic, A., Levine, P. M., De Leon, C. A., Lamiri, N., Brennan, C. K., Pratt, M. R.,
(2015). O-GlcNAcylation of α-Synuclein at Serine 87 Reduces Aggregation without Affecting
Membrane Binding. ACS Chemical Biology, 7(4), 327–333. https://doi.org/10.1002/psc.2870

161
Li, H.-T., Du, H.-N., Tang, L., Hu, J., & Hu, H.-Y. (2002). Structural transformation and
aggregation of human α-synuclein in trifluoroethanol: Non-amyloid component sequence is
essential and β-sheet formation is prerequisite to aggregation. Biopolymers, 64(4), 221–226.
https://doi.org/https://doi.org/10.1002/bip.10179

Li, Xinghui, Gong, W., Wang, H., Li, T., Attri, K. S., Lewis, R. E., Kalil, A. C., Bhinderwala, F.,
Powers, R., Yin, G., Herring, L. E., Asara, J. M., Lei, Y. L., Yang, X., Rodriguez, D. A., Yang,
M., Green, D. R., Singh, P. K., & Wen, H. (2019). O-GlcNAc Transferase Suppresses
Inflammation and Necroptosis by Targeting Receptor-Interacting Serine/Threonine-Protein
Kinase 3. Immunity, 50(3), 576-590.e6. https://doi.org/10.1016/j.immuni.2019.01.007

Li, Xinghui, Zhang, Z., Li, L., Gong, W., Lazenby, A. J., Swanson, B. J., Herring, L. E., Asara, J.
M., Singer, J. D., & Wen, H. (2017). Myeloid-derived cullin 3 promotes STAT3 phosphorylation
by inhibiting OGT expression and protects against intestinal inflammation. The Journal of
Experimental Medicine, 214(4), 1093–1109. https://doi.org/10.1084/jem.20161105

Li, Xu, Lu, F., Wang, J.-Z., & Gong, C.-X. (2006). Concurrent alterations of O-GlcNAcylation
and phosphorylation of tau in mouse brains during fasting. European Journal of Neuroscience,
23(8), 2078–2086. https://doi.org/https://doi.org/10.1111/j.1460-9568.2006.04735.x

Li, Y., Xie, M., Men, L., & Du, J. (2019). O-GlcNAcylation in immunity and inflammation: An
intricate system (Review). International Journal of Molecular Medicine, 44(2), 363–374.
https://doi.org/10.3892/ijmm.2019.4238
162
Lim, Hong, K., Ha, C. H., & Chang, H. I. (2002). Production of O-GlcNAc Modified Recombinant
proteins in Escherichia coli. Journalof Microbiology and Biotechnology, 12(2), 306–311.
https://doi.org/10.1590/S1415-47572004000300022

Lim, S., Haque, M. M., Nam, G., Ryoo, N., Rhim, H., & Kim, Y. K. (2015). Monitoring of
intracellular tau aggregation regulated by OGA/OGT inhibitors. International Journal of
Molecular Sciences, 16(9), 20212–20224. https://doi.org/10.3390/ijms160920212

Liu, C., & Li, J. (2018). O-GlcNAc: A Sweetheart of the Cell Cycle and DNA Damage Response.
Frontiers in Endocrinology, 9, 415. https://doi.org/10.3389/fendo.2018.00415

Liu, F., Iqbal, K., Grundke-Iqbal, I., Hart, G. W., & Gong, C.-X. (2004). O-GlcNAcylation
regulates phosphorylation of tau: A mechanism involved in Alzheimer’s disease. Proceedings of
the National Academy of Sciences, 101(29), 10804–10809.
https://doi.org/10.1073/pnas.0400348101

Liu, Fei, Iqbal, K., Grundke-Iqbal, I., Hart, G. W., & Gong, C. X. (2004). O-GlcNAcylation
regulates phosphorylation of tau: A mechanism involved in Alzheimer’s disease. Proceedings of
the National Academy of Sciences of the United States of America, 101(29), 10804–10809.
https://doi.org/10.1073/pnas.0400348101

163
Liu, Fei, Shi, J., Tanimukai, H., Gu, J., Gu, J., Grundke-Iqbal, I., Iqbal, K., & Gong, C. X. (2009).
Reduced O-GlcNAcylation links lower brain glucose metabolism and tau pathology in
Alzheimer’s disease. Brain, 132(7), 1820–1832. https://doi.org/10.1093/brain/awp099

Liu, K., Paterson, A. J., Konrad, R. J., Parlow, A. F., Jimi, S., Roh, M., Chin, E., & Kudlow, J. E.
(2002). Streptozotocin, an O-GlcNAcase inhibitor, blunts insulin and growth hormone secretion.
Molecular and Cellular Endocrinology, 194(1), 135–146.
https://doi.org/10.1016/S0303-7207(02)00155-7

Liu, T.-W. W., Zandberg, W. F., Gloster, T. M., Deng, L., Murray, K. D., Shan, X., & Vocadlo,
D. J. (2018). Metabolic Inhibitors of O-GlcNAc Transferase That Act In Vivo Implicate Decreased
O-GlcNAc Levels in Leptin-Mediated Nutrient Sensing. Angewandte Chemie International
Edition, 57(26), 7644–7648. https://doi.org/10.1002/anie.201803254

Liu, Y., Li, X., Yu, Y., Shi, J., Liang, Z., Run, X., Li, Y., Dai, C. ling, Grundke-Iqbal, I., Iqbal, K.,
Liu, F., & Gong, C. X. (2012). Developmental regulation of protein O-GlcNAcylation, O-GlcNAc
transferase, and O-GlcNAcase in mammalian brain. PLoS ONE, 7(8), 1–13.
https://doi.org/10.1371/journal.pone.0043724

Love, D. C., & Hanover, J. A. (2005). The hexosamine signaling pathway: deciphering the “O-
GlcNAc code”. Science’s STKE : Signal Transduction Knowledge Environment, 2005(312), 10–
14. https://doi.org/10.1126/stke.3122005re13

164
Lubas, W. A., Frank, D. W., Krause, M., & Hanover, J. A. (1997). O-linked GlcNAc transferase
is a conserved nucleocytoplasmic protein containing tetratricopeptide repeats. Journal of
Biological Chemistry, 272(14), 9316–9324. https://doi.org/10.1074/jbc.272.14.9316

Lubas, W. A., & Hanover, J. A. (2000). Functional Expression of O -linked GlcNAc Transferase.
Journal of Biological Chemistry, 275(15), 10983–10988.
https://doi.org/10.1074/jbc.275.15.10983

Luk, K. C., Song, C., O'Brien, P., Stieber, A., Branch, J. R., Brunden, K. R., Trojanowski,
J. Q., & Lee, V. M.-Y. (2009). Exogenous α-synuclein fibrils seed the formation of Lewy body-
like intracellular inclusions in cultured cells. Proceedings of the National Academy of Sciences,
106(47), 20051 LP – 20056. https://doi.org/10.1073/pnas.0908005106

Ma, J., & Hart, G. W. (2014). O-GlcNAc profiling: from proteins to proteomes. Clinical
Proteomics, 11(1), 1–16. https://doi.org/10.1186/1559-0275-11-8

Macauley, M. S., Bubb, A. K., Martinez-Fleites, C., Davies, G. J., & Vocadlo, D. J. (2008).
Elevation of Global O-GlcNAc Levels in 3T3-L1 Adipocytes by Selective Inhibition of O-
GlcNAcase Does Not Induce Insulin Resistance*. Journal of Biological Chemistry, 283(50),
34687–34695. https://doi.org/https://doi.org/10.1074/jbc.M804525200

165
Macauley, M. S., Shan, X., Yuzwa, S. A., Gloster, T. M., & Vocadlo, D. J. (2010). Elevation of
Global O-GlcNAc in Rodents Using a Selective O-GlcNAcase Inhibitor Does Not Cause Insulin
Resistance or Perturb Glucohomeostasis. Chemistry & Biology, 17(9), 949–958.
https://doi.org/https://doi.org/10.1016/j.chembiol.2010.07.005

Macauley, M. S., Stubbs, K. A., & Vocadlo, D. J. (2005). O-GlcNAcase catalyzes cleavage of
thioglycosides without general acid catalysis. Journal of the American Chemical Society, 127(49),
17202–17203. https://doi.org/10.1021/ja0567687

Macleod, R., Hillert, E. K., Cameron, R. T., & Baillie, G. S. (2015). The role and therapeutic
targeting of α-, β-and γ-secretase in Alzheimer’s disease. Future Science OA, 1(3).
https://doi.org/10.4155/fso.15.9

Mahul-Mellier, A.-L. L., Burtscher, J., Maharjan, N., Weerens, L., Croisier, M., Kuttler, F., Leleu,
M., Knott, G. W., & Lashuel, H. A. (2020). The process of Lewy body formation, rather than
simply α-synuclein fibrillization, is one of the major drivers of neurodegeneration. Proceedings of
the National Academy of Sciences of the United States of America, 117(9), 4971–4982.
https://doi.org/10.1073/pnas.1913904117

Maiti, P., Manna, J., Dunbar, G. L., Maiti, P., & Dunbar, G. L. (2017). Current understanding of
the molecular mechanisms in Parkinson’s disease: Targets for potential treatments. Translational
Neurodegeneration, 6(1), 1–35. https://doi.org/10.1186/s40035-017-0099-z

166
Marotta, N. P., Lin, Y. H., Lewis, Y. E., Ambroso, M. R., Zaro, B. W., Roth, M. T., Arnold, D.
B., Langen, R., & Pratt, M. R. (2015). O-GlcNAc modification blocks the aggregation and toxicity
of the protein α-synuclein associated with Parkinson’s disease. Nature Chemistry, 7(11), 913–920.
https://doi.org/10.1038/nchem.2361

Marsh, S. A., Powell, P. C., Dell’italia, L. J., & Chatham, J. C. (2013). Cardiac O-GlcNAcylation
blunts autophagic signaling in the diabetic heart. Life Sciences, 92(11), 648–656.
https://doi.org/10.1016/j.lfs.2012.06.011

Martin, S. E. S. S., Tan, Z.-W. W., Itkonen, H. M., Duveau, D. Y., Paulo, J. A., Janetzko, J., Boutz,
P. L., Törk, L., Moss, F. A., Thomas, C. J., Gygi, S. P., Lazarus, M. B., & Walker, S. (2018).
Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors. Journal of the
American Chemical Society, 140(42), 13542–13545. https://doi.org/10.1021/jacs.8b07328

Mbefo, M. K., Paleologou, K. E., Boucharaba, A., Oueslati, A., Schell, H., Fournier, M.,
Olschewski, D., Yin, G., Zweckstetter, M., Masliah, E., Kahle, P. J., Hirling, H., & Lashuel, H. A.
(2010). Phosphorylation of synucleins by members of the polo-like kinase family. Journal of
Biological Chemistry, 285(4), 2807–2822. https://doi.org/10.1074/jbc.M109.081950

167
Menzies, F. M., Fleming, A., Caricasole, A., Bento, C. F., Andrews, S. P., Ashkenazi, A.,
Füllgrabe, J., Jackson, A., Jimenez Sanchez, M., Karabiyik, C., Licitra, F., Lopez Ramirez, A.,
Pavel, M., Puri, C., Renna, M., Ricketts, T., Schlotawa, L., Vicinanza, M., Won, H., …
Rubinsztein, D. C. (2017). Autophagy and Neurodegeneration: Pathogenic Mechanisms and
Therapeutic Opportunities. Neuron, 93(5), 1015–1034.
https://doi.org/10.1016/j.neuron.2017.01.022

Mergenthaler, P., Lindauer, U., Dienel, G. A., & Meisel, A. (2013). Sugar for the brain: The role
of glucose in physiological and pathological brain function. Trends in Neurosciences, 36(10), 587–
597. https://doi.org/10.1016/j.tins.2013.07.001

Merlini, M., Meyer, E. P., Ulmann-Schuler, A., & Nitsch, R. M. (2011). Vascular β-amyloid and
early astrocyte alterations impair cerebrovascular function and cerebral metabolism in transgenic
arcAβ mice. Acta Neuropathologica, 122(3), 293–311. https://doi.org/10.1007/s00401-011-0834-
y

Meziane, H., Dodart, J. C., Mathis, C., Little, S., Clemens, J., Paul, S. M., & Ungerer, A. (1998).
Memory-enhancing effects of secreted forms of the β-amyloid precursor protein in normal and
amnestic mice. Proceedings of the National Academy of Sciences of the United States of America,
95(21), 12683–12688. https://doi.org/10.1073/pnas.95.21.12683

168
Morgan, J. R., Zhao, X., Womack, M., Prasad, K., Augustine, G. J., & Lafer, E. M. (1999). A Role
for the Clathrin Assembly Domain of AP180 in Synaptic Vesicle Endocytosis. The Journal of
Neuroscience, 19(23), 10201 LP – 10212. https://doi.org/10.1523/JNEUROSCI.19-23-
10201.1999

Morris, M., Knudsen, G. M., Maeda, S., Trinidad, J. C., Ioanoviciu, A., Burlingame, A. L., &
Mucke, L. (2015). Tau post-translational modifications in wild-type and human amyloid precursor
protein transgenic mice. Nature Neuroscience, 18(8), 1183–1189. https://doi.org/10.1038/nn.4067

Muir, T. W., Sondhi, D., & Cole, P. A. (1998). Expressed protein ligation: A general method for
protein engineering. Proceedings of the National Academy of Sciences, 95(12), 6705–6710.
https://doi.org/10.1073/pnas.95.12.6705

Murphy, J. E., Hanover, J. A., Froehlich, M., DuBois, G., & Keen, J. H. (1994). Clathrin assembly
protein AP-3 is phosphorylated and glycosylated on the 50-kDa structural domain. Journal of
Biological Chemistry, 269(33), 21346–21352. https://doi.org/10.1016/s0021-9258(17)31968-3

Neddens, J., Temmel, M., Flunkert, S., Kerschbaumer, B., Hoeller, C., Loeffler, T., Niederkofler,
V., Daum, G., Attems, J., & Hutter-Paier, B. (2018). Phosphorylation of different tau sites during
progression of Alzheimer’s disease. Acta Neuropathologica Communications, 6(1), 52.
https://doi.org/10.1186/s40478-018-0557-6

169
Negro, A., Brunati, A. M., Donella-Deana, A., Massimino, M. L., & Pinna, L. A. (2002). Multiple
phosphorylation of α-synuclein by protein tyrosine kinase Syk prevents eosin-induced
aggregation. The FASEB Journal, 16(2), 1–22. https://doi.org/https://doi.org/10.1096/fj.01-
0517fje

O’Brien, R. J., & Wong, P. C. (2011). Amyloid precursor protein processing and Alzheimer’s
disease. Annual Review of Neuroscience, 34, 185–204. https://doi.org/10.1146/annurev-neuro-
061010-113613

O’Donnell, N., Zachara, N. E., Hart, G. W., & Marth, J. D. (2004). Ogt-Dependent X-
Chromosome-Linked Protein Glycosylation Is a Requisite Modification in Somatic Cell Function
and Embryo Viability. Molecular and Cellular Biology, 24(4), 1680–1690.
https://doi.org/10.1128/mcb.24.4.1680-1690.2004

Okuyama, R., & Marshall, S. (2003). UDP-N-acetylglucosaminyl transferase (OGT) in brain
tissue: Temperature sensitivity and subcellular distribution of cytosolic and nuclear enzyme.
Journal of Neurochemistry, 86(5), 1271–1280. https://doi.org/10.1046/j.1471-4159.2003.01939.x

Oueslati, A. (2016). Implication of Alpha-Synuclein Phosphorylation at S129 in
Synucleinopathies: What Have We Learned in the Last Decade? Journal of Parkinson’s Disease,
6(1), 39–51. https://doi.org/10.3233/JPD-160779

170
Paleologou, K. E., Oueslati, A., Shakked, G., Rospigliosi, C. C., Kim, H. Y., Lamberto, G. R.,
Fernandez, C. O., Schmid, A., Chegini, F., Gai, W. P., Chiappe, D., Moniatte, M., Schneider, B.
L., Aebischer, P., Eliezer, D., Zweckstetter, M., Masliah, E., & Lashuel, H. A. (2010).
Phosphorylation at S87 is enhanced in synucleinopathies, inhibits α-synuclein oligomerization,
and influences synuclein-membrane interactions. Journal of Neuroscience, 30(9), 3184–3198.
https://doi.org/10.1523/JNEUROSCI.5922-09.2010

Park, J., Ha, H.-J., Chung, E. S., Baek, S. H., Cho, Y., Kim, H. K., Han, J., Sul, J. H., Lee, J., Kim,
E., Kim, J., Yang, Y. R., Park, M., Kim, S. H., Arumugam, T. V., Jang, H., Seo, S. W., Suh, P.-
G., & Jo, D.-G. (2021). O -GlcNAcylation ameliorates the pathological manifestations of
Alzheimer’s disease by inhibiting necroptosis . Science Advances, 7(3), eabd3207.
https://doi.org/10.1126/sciadv.abd3207

Park, S., Lee, Y., Pak, J. W., Kim, H., Choi, H., Kim, J., Roth, J., & Cho, J. W. (2015). O-GlcNAc
modification is essential for the regulation of autophagy in Drosophila melanogaster. Cellular and
Molecular Life Sciences, 72(16), 3173–3183. https://doi.org/10.1007/s00018-015-1889-z

Parzych, K. R., & Klionsky, D. J. (2014). An overview of autophagy: morphology, mechanism,
and regulation. Antioxidants & Redox Signaling, 20(3), 460–473.
https://doi.org/10.1089/ars.2013.5371

171
Pekkurnaz, G., Trinidad, J. C., Wang, X., Kong, D., & Schwarz, T. L. (2014). Glucose regulates
mitochondrial motility via Milton modification by O-GlcNAc transferase. Cell, 158(1), 54–68.
https://doi.org/10.1016/j.cell.2014.06.007

Pekny, M., Wilhelmsson, U., & Pekna, M. (2014). The dual role of astrocyte activation and
reactive gliosis. Neuroscience Letters, 565, 30–38.
https://doi.org/https://doi.org/10.1016/j.neulet.2013.12.071

Peng, C., Gathagan, R. J., Covell, D. J., Medellin, C., Stieber, A., Robinson, J. L., Zhang, B.,
Pitkin, R. M., Olufemi, M. F., Luk, K. C., Trojanowski, J. Q., & Lee, V. M. (2018). Cellular milieu
imparts distinct pathological α-synuclein strains in α-synucleinopathies. Nature.
https://doi.org/10.1038/s41586-018-0104-4

Peng, C., Gathagan, R. J., & Lee, V. M.-Y. (2017). Distinct alpha-Synuclein strains and
implications for heterogeneity among alpha-Synucleinopathies. Neurobiology of Disease.
https://doi.org/10.1016/j.nbd.2017.07.018

Peng, C., Trojanowski, J. Q., & Lee, V. M. Y. (2020). Protein transmission in neurodegenerative
disease. Nature Reviews Neurology, 16(4), 199–212. https://doi.org/10.1038/s41582-020-0333-7
Pereda, A. E. (2014). Electrical synapses and their functional interactions with chemical synapses.
Nature Reviews Neuroscience, 15(4), 250–263. https://doi.org/10.1038/nrn3708

172
Piccoli, G., Condliffe, S. B., Bauer, M., Giesert, F., Boldt, K., De Astis, S., Meixner, A., Sarioglu,
H., Vogt-Weisenhorn, D. M., Wurst, W., Gloeckner, C. J., Matteoli, M., Sala, C., & Ueffing, M.
(2011). LRRK2 controls synaptic vesicle storage and mobilization within the recycling pool. The
Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 31(6), 2225–2237.
https://doi.org/10.1523/JNEUROSCI.3730-10.2011

Pinho, T. S., Correia, S. C., Perry, G., Ambrósio, A. F., & Moreira, P. I. (2019). Diminished O-
GlcNAcylation in Alzheimer’s disease is strongly correlated with mitochondrial anomalies.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1865(8), 2048–2059.
https://doi.org/https://doi.org/10.1016/j.bbadis.2018.10.037

Pinkus, L. M. B. T.-M. in E. (1977). [45] Glutamine binding sites. In M. W. Edited by William B.
Jakoby (Ed.), Affinity labeling (Vol. 46, pp. 414–427). Academic Press.
https://doi.org/https://doi.org/10.1016/S0076-6879(77)46049-X

Poewe, W., Seppi, K., Tanner, C. M., Halliday, G. M., Brundin, P., Volkmann, J., Schrag, A. E.,
& Lang, A. E. (2017). Parkinson disease. Nature Reviews Disease Primers, 3, 1–21.
https://doi.org/10.1038/nrdp.2017.13

Qiu, C., Kivipelto, M., & von Strauss, E. (2009). Epidemiology of Alzheimer’s disease:
occurrence, determinants, and strategies toward intervention. Dialogues in Clinical Neuroscience,
11(2), 111–128. https://doi.org/10.31887/DCNS.2009.11.2/cqiu

173
Reiss, A. B., Arain, H. A., Stecker, M. M., Siegart, N. M., & Kasselman, L. J. (2018). Amyloid
toxicity in Alzheimer’s disease. Reviews in the Neurosciences, 29(6), 613–627.
https://doi.org/doi:10.1515/revneuro-2017-0063

Rexach, J. E., Rogers, C. J., Yu, S.-H. H., Tao, J., Sun, Y. E., & Hsieh-Wilson, L. C. (2010).
Quantification of O-glycosylation stoichiometry and dynamics using resolvable mass tags. Nature
Chemical Biology, 6(9), 645–651. https://doi.org/10.1038/nchembio.412

Ross, C. A., & Poirier, M. A. (2004). Protein aggregation and neurodegenerative disease. Nature
Medicine, 10(7), S10. https://doi.org/10.1038/nm1066

Ruan, H. Bin, Ma, Y., Torres, S., Zhang, B., Feriod, C., Heck, R. M., Qian, K., Fu, M., Li, X.,
Nathanson, M. H., Bennett, A. M., Nie, Y., Ehrlich, B. E., & Yang, X. (2017). Calcium-dependent
O-GlcNAc signaling drives liver autophagy in adaptation to starvation. Genes and Development,
31(16), 1655–1665. https://doi.org/10.1101/gad.305441.117

Ryan, J. M., Quattropani, A., Abd-Elaziz, K., den Daas, I., Schneider, M., Ousson, S., Neny, M.,
Sand, A., Hantson, J., Permanne, B., Wiessner, C., & Beher, D. (2018). O1-12-05: PHase 1 Study
In Healthy Volunteers Of The O-Glcnacase Inhibitor ASN120290 As A Novel Therapy For
Progressive Supranuclear Palsy And Related Tauopathies. Alzheimer’s & Dementia,
14(7S_Part_4), P251–P251. https://doi.org/https://doi.org/10.1016/j.jalz.2018.06.2400

174
Ryan, P., Xu, M., Davey, A. K., Danon, J. J., Mellick, G. D., Kassiou, M., & Rudrawar, S. (2019).
O-GlcNAc Modification Protects against Protein Misfolding and Aggregation in
Neurodegenerative Disease. ACS Chemical Neuroscience, 10(5), 2209–2221.
https://doi.org/10.1021/acschemneuro.9b00143

Saheki, Y., & De Camilli, P. (2012). Synaptic vesicle endocytosis. Cold Spring Harbor
Perspectives in Biology, 4(9), a005645–a005645. https://doi.org/10.1101/cshperspect.a005645

Sandhu, P., Lee, J., Ballard, J., Walker, B., Ellis, J., Marcus, J., Toolan, D., Dreyer, D., McAvoy,
T., Duffy, J., Michener, M., Valiathan, C., Trainor, N., Savage, M., McEachern, E., Vocadlo, D.,
Smith, S. M., & Struyk, A. (2016). P4-036: Pharmacokinetics and Pharmacodynamics to Support
Clinical Studies of MK-8719: an O-Glcnacase Inhibitor for Progressive Supranuclear Palsy.
Alzheimer’s & Dementia, 12(7S_Part_21), P1028–P1028.
https://doi.org/https://doi.org/10.1016/j.jalz.2016.06.2125

Sassone, J., Serratto, G., Valtorta, F., Silani, V., Passafaro, M., & Ciammola, A. (2017). The
synaptic function of parkin. Brain, 140(9), 2265–2272. https://doi.org/10.1093/brain/awx006

Schmeisser, K., & Parker, J. A. (2019). Pleiotropic effects of mTOR and autophagy during
development and aging. Frontiers in Cell and Developmental Biology, 7(SEP), 1–11.
https://doi.org/10.3389/fcell.2019.00192

175
Schmid, A. W., Fauvet, B., Moniatte, M., & Lashuel, H. A. (2013). Alpha-synuclein post-
translational modifications as potential biomarkers for Parkinson disease and other
synucleinopathies. Molecular & Cellular Proteomics : MCP, 12(12), 3543–3558.
https://doi.org/10.1074/mcp.R113.032730

Schweighauser, M., Shi, Y., Tarutani, A., Kametani, F., Murzin, A. G., Ghetti, B., Matsubara, T.,
Tomita, T., Ando, T., Hasegawa, K., Murayama, S., Yoshida, M., Hasegawa, M., Scheres, S. H.
W., & Goedert, M. (2020). Structures of α-synuclein filaments from multiple system atrophy.
Nature, February, 2020.02.05.935619. https://doi.org/10.1101/2020.02.05.935619

Schwein, P. A., & Woo, C. M. (2020). The O-GlcNAc Modification on Kinases. ACS Chemical
Biology, 15(3), 602–617. https://doi.org/10.1021/acschembio.9b01015

Se Thoe, E., Fauzi, A., Tang, Y. Q., Chamyuang, S., & Chia, A. Y. Y. (2021). A review on
advances of treatment modalities for Alzheimer’s disease. Life Sciences, 276, 119129.
https://doi.org/https://doi.org/10.1016/j.lfs.2021.119129

Selnick, H. G., Hess, J. F., Tang, C., Liu, K., Schachter, J. B., Ballard, J. E., Marcus, J., Klein, D.
J., Wang, X., Pearson, M., Savage, M. J., Kaul, R., Li, T. S., Vocadlo, D. J., Zhou, Y., Zhu, Y.,
Mu, C., Wang, Y., Wei, Z., … McEachern, E. J. (2019). Discovery of MK-8719, a Potent O-
GlcNAcase Inhibitor as a Potential Treatment for Tauopathies. Journal of Medicinal Chemistry,
62(22), 10062–10097. https://doi.org/10.1021/acs.jmedchem.9b01090

176
Shafi, R., Iyer, S. P. N., Ellies, L. G., O’Donnell, N., Marek, K. W., Chui, D., Hart, G. W., &
Marth, J. D. (2000). The O-GlcNAc transferase gene resides on the X chromosome and is essential
for embryonic stem cell viability and mouse ontogeny. Proceedings of the National Academy of
Sciences of the United States of America, 97(11), 5735–5739.
https://doi.org/10.1073/pnas.100471497

Shafiei, S. S., Guerrero-Muñoz, M. J., & Castillo-Carranza, D. L. (2017). Tau Oligomers:
Cytotoxicity, Propagation, and Mitochondrial Damage. Frontiers in Aging Neuroscience, 9, 83.
https://doi.org/10.3389/fnagi.2017.00083

Shen, D. L., Gloster, T. M., Yuzwa, S. A., & Vocadlo, D. J. (2012). Insights into O-linked N-
acetylglucosamine (O-GlcNAc) processing and dynamics through kinetic analysis of O-GlcNAc
transferase and O-GlcNAcase activity on protein substrates. Journal of Biological Chemistry,
287(19), 15395–15408. https://doi.org/10.1074/jbc.M111.310664

Smet-Nocca, C., Broncel, M., Wieruszeski, J. M., Tokarski, C., Hanoulle, X., Leroy, A., Landrieu,
I., Rolando, C., Lippens, G., & Hackenberger, C. P. R. (2011). Identification of O-GlcNAc sites
within peptides of the Tau protein and their impact on phosphorylation. Molecular BioSystems,
7(5), 1420–1429. https://doi.org/10.1039/c0mb00337a

Soto, C., & Pritzkow, S. (2018). Protein misfolding, aggregation, and conformational strains in
neurodegenerative diseases. Nature Neuroscience, 21(10), 1332–1340.
https://doi.org/10.1038/s41593-018-0235-9
177
Strang, K. H., Croft, C. L., Sorrentino, Z. A., Chakrabarty, P., Golde, T. E., & Giasson, B. I. (2018).
Distinct differences in prion-like seeding and aggregation between Tau protein variants provide
mechanistic insights into tauopathies. The Journal of Biological Chemistry, 293(7), 2408–2421.
https://doi.org/10.1074/jbc.M117.815357

Tallent, M. K., Varghis, N., Skorobogatko, Y., Hernandez-Cuebas, L., Whelan, K., Vocadlo, D.
J., & Vosseller, K. (2009). In vivo modulation of O-GIcNAc levels regulates hippocampal synaptic
plasticity through interplay with phosphorylation. Journal of Biological Chemistry, 284(1), 174–
181. https://doi.org/10.1074/jbc.M807431200

Tan, E. P., McGreal, S. R., Graw, S., Tessman, R., Koppel, S. J., Dhakal, P., Zhang, Z., Machacek,
M., Zachara, N. E., Koestler, D. C., Peterson, K. R., Thyfault, J. P., Swerdlow, R. H.,
Krishnamurthy, P., DiTacchio, L., Apte, U., & Slawson, C. (2017). Sustained O-GlcNAcylation
reprograms mitochondrial function to regulate energy metabolism. Journal of Biological
Chemistry, 292(36), 14940–14962. https://doi.org/10.1074/jbc.M117.797944

Tan, E. P., Villar, M. T., E, L., Lu, J., Selfridge, J. E., Artigues, A., Swerdlow, R. H., & Slawson,
C. (2014). Altering O-Linked β-N-Acetylglucosamine Cycling Disrupts Mitochondrial Function*.
Journal of Biological Chemistry, 289(21), 14719–14730.
https://doi.org/https://doi.org/10.1074/jbc.M113.525790

178
Taoufik, E., Kouroupi, G., Zygogianni, O., & Matsas, R. (2018). Synaptic dysfunction in
neurodegenerative and neurodevelopmental diseases: an overview of induced pluripotent stem-
cell-based disease models. Open Biology, 8(9), 180138. https://doi.org/10.1098/rsob.180138

Tavassoly, O., Yue, J., & Vocadlo, D. J. (2020). Pharmacological inhibition and knockdown of O-
GlcNAcase reduces cellular internalization of α-synuclein preformed fibrils. FEBS Journal, 1–19.
https://doi.org/10.1111/febs.15349

Taylor, R. W., & Turnbull, D. M. (2005). Mitochondrial DNA mutations in human disease. Nature
Reviews Genetics, 6(5), 389–402. https://doi.org/10.1038/nrg1606

Thompson, R. E., & Muir, T. W. (2020). Chemoenzymatic Semisynthesis of Proteins. Chemical
Reviews, 120(6), 3051–3126. https://doi.org/10.1021/acs.chemrev.9b00450

Tofaris, G. K., Razzaq, A., Ghetti, B., Lilley, K. S., & Spillantini, M. G. (2003). Ubiquitination of
α-Synuclein in Lewy Bodies Is a Pathological Event Not Associated with Impairment of
Proteasome Function*. Journal of Biological Chemistry, 278(45), 44405–44411.
https://doi.org/https://doi.org/10.1074/jbc.M308041200

Törnquist, M., Michaels, T. C. T., Sanagavarapu, K., Yang, X., Meisl, G., Cohen, S. I. A.,
Knowles, T. P. J., & Linse, S. (2018). Secondary nucleation in amyloid formation. Chemical
Communications, 54(63), 8667–8684. https://doi.org/10.1039/C8CC02204F

179
Ueda, K., Fukushima, H., Masliah, E., Xia, Y. U., Iwai, A., Yoshimoto, M., Otero, D. A. C.,
Kondo, J., Ihara, Y., & Saitoh, T. (1993). Molecular cloning of cDNA encoding an unrecognized
component of amyloid in Alzheimer disease (neurodegeneration/chaperone/amyloid P/A4
protein/neuritic plaque). Proc. Natl. Acad. Sci. USA, 90(December), 11282–11286.

Ulmer, T. S., Bax, A., Cole, N. B., & Nussbaum, R. L. (2005). Structure and dynamics of micelle-
bound human α-synuclein. Journal of Biological Chemistry, 280(10), 9595–9603.
https://doi.org/10.1074/jbc.M411805200

van der Laarse, S. A. M., Leney, A. C., & Heck, A. J. R. (2018). Crosstalk between
phosphorylation and O-GlcNAcylation: friend or foe. FEBS Journal, 285(17), 3152–3167.
https://doi.org/10.1111/febs.14491

Vasili, E., Dominguez-Meijide, A., & Outeiro, T. F. (2019). Spreading of α-Synuclein and Tau: A
Systematic Comparison of the Mechanisms Involved. Frontiers in Molecular Neuroscience, 12,
107. https://doi.org/10.3389/fnmol.2019.00107

Verma, M., Vats, A., & Taneja, V. (2015). Toxic species in amyloid disorders: Oligomers or
mature fibrils. Annals of Indian Academy of Neurology, 18(2), 138–145.
https://doi.org/10.4103/0972-2327.144284

180
Vilar, M., Chou, H. T., Lührs, T., Maji, S. K., Riek-Loher, D., Verel, R., Manning, G., Stahlberg,
H., & Riek, R. (2008). The fold of α-synuclein fibrils. Proceedings of the National Academy of
Sciences of the United States of America, 105(25), 8637–8642.
https://doi.org/10.1073/pnas.0712179105

Vosseller, K., Trinidad, J. C., Chalkley, R. J., Specht, C. G., Thalhammer, A., Lynn, A. J.,
Snedecor, J. O., Guan, S., Medzihradszky, K. F., Maltby, D. A., Schoepfer, R., & Burlingame, A.
L. (2006). O-Linked N-Acetylglucosamine Proteomics of Postsynaptic Density Preparations
Using Lectin Weak Affinity Chromatography and Mass Spectrometry *. Molecular & Cellular
Proteomics, 5(5), 923–934. https://doi.org/10.1074/mcp.T500040-MCP200

Wang, A. C., Jensen, E. H., Rexach, J. E., Vinters, H. V., & Hsieh-Wilson, L. C. (2016). Loss of
O-GlcNAc glycosylation in forebrain excitatory neurons induces neurodegeneration. Proceedings
of the National Academy of Sciences of the United States of America, 113(52), 15120–15125.
https://doi.org/10.1073/pnas.1606899113

Wang, J. Z., Xia, Y. Y., Grundke-Iqbal, I., & Iqbal, K. (2013). Abnormal hyperphosphorylation
of tau: Sites, regulation, and molecular mechanism of neurofibrillary degeneration. Journal of
Alzheimer’s Disease, 33(SUPPL. 1). https://doi.org/10.3233/JAD-2012-129031

181
Wang, P., Lazarus, B. D., Forsythe, M. E., Love, D. C., Krause, M. W., & Hanover, J. A. (2012).
O-GlcNAc cycling mutants modulate proteotoxicity in Caenorhabditis elegans models of human
neurodegenerative diseases. Proceedings of the National Academy of Sciences, 109(43), 17669 LP
– 17674. https://doi.org/10.1073/pnas.1205748109

Wang, S., Yang, F., Petyuk, V. A., Shukla, A. K., Monroe, M. E., Gritsenko, M. A., Rodland, K.
D., Smith, R. D., Qian, W. J., Gong, C. X., & Liu, T. (2017). Quantitative proteomics identifies
altered O-GlcNAcylation of structural, synaptic and memory-associated proteins in Alzheimer’s
disease. Journal of Pathology, 243(1), 78–88. https://doi.org/10.1002/path.4929

Wang, X., Li, W., Marcus, J., Pearson, M., Song, L., Smith, K., Terracina, G., Lee, J., Hong, K.
L. K., Lu, S. X., Hyde, L., Chen, S. C., Kinsley, D., Melchor, J. P., Rubins, D. J., Meng, X.,
Hostetler, C. E., Sur, C., Zhang, L., … Smith, S. M. (2020). MK-8719, a novel and selective O-
GlcNAcase inhibitor that reduces the formation of pathological tau and ameliorates
neurodegeneration in a mouse model of tauopathy. Journal of Pharmacology and Experimental
Therapeutics, 374(2), 252–263. https://doi.org/10.1124/jpet.120.266122

Wang, Z., Park, K., Comer, F., Hsieh-Wilson, L. C., Saudek, C. D., & Hart, G. W. (2009). Site-
specific GlcNAcylation of human erythrocyte proteins: Potential biomarker(s) for diabetes.
Diabetes, 58(2), 309–317. https://doi.org/10.2337/db08-0994

182
Wang, Z., Udeshi, N. D., O’Malley, M., Shabanowitz, J., Hunt, D. F., & Hart, G. W. (2010).
Enrichment and site mapping of O-linked N-acetylglucosamine by a combination of
chemical/enzymatic tagging, photochemical cleavage, and electron transfer dissociation mass
spectrometry. Molecular and Cellular Proteomics, 9(1), 153–160.
https://doi.org/10.1074/mcp.M900268-MCP200

Wani, W. Y., Ouyang, X., Benavides, G. A., Redmann, M., Cofield, S. S., Shacka, J. J., Chatham,
J. C., Darley-Usmar, V., & Zhang, J. (2017). O-GlcNAc regulation of autophagy and α-synuclein
homeostasis; implications for Parkinson’s disease. Molecular Brain, 10(1), 32.
https://doi.org/10.1186/s13041-017-0311-1

Waxman, E. A., & Giasson, B. I. (2008). Specificity and Regulation of Casein Kinase-Mediated
Phosphorylation of α-Synuclein. Journal of Neuropathology & Experimental Neurology, 67(5),
402–416. https://doi.org/10.1097/NEN.0b013e3186fc995

Wei, Y., Zhou, J., Wu, J., & Huang, J. (2019). ERβ promotes Aβ degradation via the modulation
of autophagy. Cell Death & Disease, 10(8), 565. https://doi.org/10.1038/s41419-019-1786-8

Weingarten, M. D., Lockwood, A. H., Hwo, S. Y., & Kirschner, M. W. (1975). A protein factor
essential for microtubule assembly. Proceedings of the National Academy of Sciences, 72(5), 1858
LP – 1862. https://doi.org/10.1073/pnas.72.5.1858

183
Whelan, S. A., Lane, M. D., & Hart, G. W. (2008). Regulation of the O-Linked β-N-
Acetylglucosamine Transferase by Insulin Signaling*. Journal of Biological Chemistry, 283(31),
21411–21417. https://doi.org/https://doi.org/10.1074/jbc.M800677200

Willems, A. P., Gundogdu, M., Kempers, M. J. E., Giltay, J. C., Pfundt, R., Elferink, M., Loza, B.
F., Fuijkschot, J., Ferenbach, A. T., Van Gassen, K. L. I., Van Aalten, D. M. F., & Lefeber, D. J.
(2017). Mutations in N-acetylglucosamine (O-GlcNAc) transferase in patients with X-linked
intellectual disability. Journal of Biological Chemistry, 292(30), 12621–12631.
https://doi.org/10.1074/jbc.M117.790097

Wilson, D. M., & Binder, L. I. (1997). Free fatty acids stimulate the polymerization of tau and
amyloid beta peptides. In vitro evidence for a common effector of pathogenesis in Alzheimer’s
disease. The American Journal of Pathology, 150(6), 2181–2195.
https://pubmed.ncbi.nlm.nih.gov/9176408

Wishart, T. M., Parson, S. H., & Gillingwater, T. H. (2006). Synaptic vulnerability in
neurodegenerative disease. Journal of Neuropathology and Experimental Neurology, 65(8), 733–
739. https://doi.org/10.1097/01.jnen.0000228202.35163.c4

Wulff-Fuentes, E., Berendt, R. R., Massman, L., Danner, L., Malard, F., Vora, J., Kahsay, R., &
Olivier-Van Stichelen, S. (2021). The human O-GlcNAcome database and meta-analysis.
Scientific Data, 8(1), 25. https://doi.org/10.1038/s41597-021-00810-4

184
Xu, Y., Deng, Y., & Qing, H. (2015). The phosphorylation of α-synuclein: development and
implication for the mechanism and therapy of the Parkinson’s disease. Journal of Neurochemistry,
135(1), 4–18. https://doi.org/https://doi.org/10.1111/jnc.13234

Yang, W. H., Park, S. Y., Nam, H. W., Kim, D. H., Kang, J. G., Kang, E. S., Kim, Y. S., Lee, H.
C., Kim, K. S., & Cho, J. W. (2008). NFkappaB activation is associated with its O-GlcNAcylation
state under hyperglycemic conditions. Proceedings of the National Academy of Sciences of the
United States of America, 105(45), 17345–17350. https://doi.org/10.1073/pnas.0806198105

Yang, W., & Yu, S. (2017). Synucleinopathies: common features and hippocampal manifestations.
Cellular and Molecular Life Sciences, 74(8), 1485–1501. https://doi.org/10.1007/s00018-016-
2411-y

Yang, X., & Qian, K. (2017). Protein O-GlcNAcylation: Emerging mechanisms and functions.
Nature Reviews Molecular Cell Biology, 18(7), 452–465. https://doi.org/10.1038/nrm.2017.22

Yankner, B. A. (1996). Mechanisms of Neuronal Degeneration in Alzheimer’s Disease. Neuron,
16(5), 921–932. https://doi.org/https://doi.org/10.1016/S0896-6273(00)80115-4

Yao, P. J., & Coleman, P. D. (1998). Reduced O-glycosylated clathrin assembly protein AP180:
Implication for synaptic vesicle recycling dysfunction in Alzheimer’s disease. Neuroscience
Letters, 252(1), 33–36. https://doi.org/10.1016/S0304-3940(98)00547-3

185
Yu, Y., Zhang, L., Li, X., Run, X., Liang, Z., Li, Y., Liu, Y., Lee, M. H., Grundke-Iqbal, I., Iqbal,
K., Vocadlo, D. J., Liu, F., & Gong, C.-X. (2012). Differential Effects of an O-GlcNAcase
Inhibitor on Tau Phosphorylation. PLOS ONE, 7(4), e35277.
https://doi.org/10.1371/journal.pone.0035277

Yuzwa, S. A., Cheung, A. H., Okon, M., McIntosh, L. P., & Vocadlo, D. J. (2014). O-GlcNAc
Modification of tau Directly Inhibits Its Aggregation without Perturbing the Conformational
Properties of tau Monomers. Journal of Molecular Biology, 426(8), 1736–1752.
https://doi.org/10.1016/j.jmb.2014.01.004

Yuzwa, S. A., Macauley, M. S., Heinonen, J. E., Shan, X., Dennis, R. J., He, Y., Whitworth, G.
E., Stubbs, K. A., McEachern, E. J., Davies, G. J., & Vocadlo, D. J. (2008). A potent mechanism-
inspired O-GlcNAcase inhibitor that blocks phosphorylation of tau in vivo. Nature Chemical
Biology, 4(8), 483–490. https://doi.org/10.1038/nchembio.96

Yuzwa, S. A., Shan, X., Jones, B. A., Zhao, G., Woodward, M. L., Li, X., Zhu, Y., McEachern, E.
J., Silverman, M. A., Watson, N. V., Gong, C. X., & Vocadlo, D. J. (2014). Pharmacological
inhibition of O-GlcNAcase (OGA) prevents cognitive decline and amyloid plaque formation in
bigenic tau/APP mutant mice. Molecular Neurodegeneration, 9, 42. https://doi.org/10.1186/1750-
1326-9-42

186
Yuzwa, S. A., Shan, X., Macauley, M. S., Clark, T., Skorobogatko, Y., Vosseller, K., & Vocadlo,
D. J. (2012). Increasing O-GlcNAc slows neurodegenerationand stabilizes tau against aggregation.
Nature Chemical Biology, 8(4), 393–399. https://doi.org/10.1038/nchembio.797

Yuzwa, S. A., & Vocadlo, D. J. (2014). O-GlcNAc and neurodegeneration: Biochemical
mechanisms and potential roles in Alzheimer’s disease and beyond. Chemical Society Reviews,
43(19), 6839–6858. https://doi.org/10.1039/c4cs00038b

Yuzwa, S. A., Yadav, A. K., Skorobogatko, Y., Clark, T., Vosseller, K., & Vocadlo, D. J. (2011).
Mapping O-GlcNAc modification sites on tau and generation of a site-specific O-GlcNAc tau
antibody. Amino Acids, 40(3), 857–868. https://doi.org/10.1007/s00726-010-0705-1

Zhang, B., Kehm, V., Gathagan, R., Leight, S. N., Trojanowski, J. Q., Lee, V. M.-Y., & Luk, K.
C. (2019). Stereotaxic Targeting of Alpha-Synuclein Pathology in Mouse Brain Using Preformed
Fibrils. Methods in Molecular Biology (Clifton, N.J.), 1948, 45–57. https://doi.org/10.1007/978-1-
4939-9124-2_5

Zhang, J., Lei, H., Chen, Y., Ma, Y. T., Jiang, F., Tan, J., Zhang, Y., & Li, J. Da. (2017). Enzymatic
O-GlcNAcylation of α-synuclein reduces aggregation and increases SDS-resistant soluble
oligomers. Neuroscience Letters, 655, 90–94. https://doi.org/10.1016/j.neulet.2017.06.034

187
Zhang, W., Falcon, B., Murzin, A. G., Fan, J., Crowther, R. A., Goedert, M., & Scheres, S. H. W.
(2019). Heparin-induced tau filaments are polymorphic and differ from those in Alzheimer’s and
Pick’s diseases. ELife, 8, e43584. https://doi.org/10.7554/eLife.43584

Zhang, Z., Tan, E. P., VandenHull, N. J., Peterson, K. R., & Slawson, C. (2014). O-GlcNAcase
Expression is Sensitive to Changes in O-GlcNAc Homeostasis. Frontiers in Endocrinology, 5,
206. https://doi.org/10.3389/fendo.2014.00206

Zhu, Y., Shan, X., Safarpour, F., Erro Go, N., Li, N., Shan, A., Huang, M. C., Deen, M., Holicek,
V., Ashmus, R., Madden, Z., Gorski, S., Silverman, M. A., & Vocadlo, D. J. (2018).
Pharmacological Inhibition of O-GlcNAcase Enhances Autophagy in Brain through an mTOR-
Independent Pathway. ACS Chemical Neuroscience, 9(6), 1366–1379.
https://doi.org/10.1021/acschemneuro.8b00015

188
Chapter 4: O-GlcNAc modification of small heat shock proteins enhances
their anti-amyloid chaperone activity*
A major role for the intracellular posttranslational modification O-GlcNAc appears to be the
inhibition of protein aggregation. Most of the previous studies in this area have focused on O-
GlcNAc modification of the amyloid-forming proteins themselves. Here, we use synthetic protein
chemistry to discover that O-GlcNAc also activates the anti-amyloid activity of certain small heat
shock proteins (sHSPs), a potentially more important modification event that can act broadly and
substoichiometrically. More specifically, we find that O-GlcNAc increases the ability of sHSPs to
block the amyloid formation of both α-synuclein and Aβ(1-42). Mechanistically, we show that O-
GlcNAc near the sHSP IXI-domain prevents its ability to intramolecularly compete with substrate
binding. Finally, we find that although O-GlcNAc levels are globally reduced in Alzheimer’s
disease brains, the modification of relevant sHSPs is either maintained or increased, suggesting a
mechanism to maintain these potentially protective O-GlcNAc modifications. Our results have
important implications for neurodegenerative diseases associated with amyloid formation and
potentially other areas of sHSP biology.
_________________________
*Paul Levine, Nichole Pedowitz, Stuart Moon, Terry Takahashi (University of Southern California), Timothy Craven (Baker Lab,
University of Washington at Seattle), and Somnath Mukherjee (Becker Lab, University of Vienna) contributed to the work
presented in this chapter.

189
4.1 Introduction
O-GlcNAcylation (Figure 4-1a), the addition of the monosaccharide N-acetylglucosamine
(GlcNAc), is an intracellular posttranslational modification (PTM) that occurs on serine and
threonine residues (Figure 4-1a) (Yang & Qian, 2017). The installation of this PTM is catalyzed
by the enzyme O-GlcNAc transferase (OGT) and it is removed by the glycosidase O-GlcNAcase
(OGA). These enzymes are required for embryonic development in mice and Drosophila. A
variety of proteins have been shown to be O-GlcNAc modified including regulators of
transcription and translation, signaling proteins, and metabolic enzymes. The biochemical
consequences of most of these modifications are unknown, but limited analyses demonstrated that
O-GlcNAc modification can change protein localization, stability, molecular interactions, and
activity. One emerging role for O-GlcNAcylation is the inhibition of protein aggregation and the
progression of neurodegenerative diseases (Wani et al., n.d.). For example, tissue specific loss of
O-GlcNAc through knockout of OGT in neurons results in neurodegeneration (A. C. Wang et al.,
2016). Additionally, O-GlcNAc levels in the brains of Alzheimer’s disease patients is lower than
in the brains of age-matched controls (Aguilar et al., 2017; F. Liu et al., 2004; Fei Liu et al., 2009;
Pinho et al., 2019). A hallmark of neurodegeneration is the accumulation of misfolded proteins
(e.g., tau in Alzheimer’s and α-synuclein in Parkinson’s disease) that form toxic amyloids.
Notably, treatment of mice with a small-molecule inhibitor of OGA increases O-GlcNAc in the
brain and slows the progressive formation of tau amyloids in models of Alzheimer!s disease
(Yuzwa et al., 2012). O-GlcNAc modifications of tau or α-synuclein also directly inhibits the
aggregation of these proteins in vitro (Levine et al., 2019; Lewis et al., 2017; Marotta et al., 2015;
Yuzwa et al., 2014). These results suggest that O-GlcNAc may play a protective role by directly

190
preventing the aggregation of such proteins and that loss of these modifications may be a factor in
the onset of the associated diseases.

Another factor that protects from neurodegeneration is the activity of heat shock proteins,
a family of molecular chaperones that are upregulated in response to cellular stress (Hartl et al.,
2011). The small heat shock proteins (sHSPs) are a subset of chaperones that are ATP-independent
and function by binding to unfolded/misfolded proteins to prevent their aggregation (Haslbeck et
al., 2019). All sHSPs contain a conserved central α-crystallin domain (ACD) and variable N-
terminal and C-terminal domains (Figure 4-1b) (Kappé et al., 2003; Kriehuber et al., 2010). All of
these domains contribute to the formation of large and dynamic protein oligomers that are critical
for chaperone activities (Baldwin et al., 2011, 2012; Hochberg et al., 2014; Jehle et al., 2010;
McDonald et al., 2012). Of particular interest in neurodegeneration, the ACD contains a cleft that
appears to be the major site of binding to amyloid-forming proteins, including Aβ(1-42), tau, and
α-synuclein (Cox et al., 2016, 2018; Delbecq et al., 2012; Freilich et al., 2018; Hochberg et al.,
2014; Kudva et al., 1997; Mainz et al., 2015; Raman et al., 2005; Rekas et al., 2004). Three human
sHSPs - HSP27, αA-crystallin (αAC), and αB-crystallin (αBC) - that have this anti-amyloidogenic
activity also contain a tripeptide sequence known as the IXI motif in their C-terminal domains
(Figure 4-1b). The IXI motif can interconvert between an ACD bound form, where the IXI
tripeptide is loosely bound to β4-β8 cleft, and an unstructured form in solution (Baldwin et al.,
2011; Delbecq et al., 2012; Freilich et al., 2018; Jehle et al., 2010). This IXI-ACD interaction is
not required for the formation of large oligomers, but mutants of the IXI motif can have
consequences on oligomer stability and dynamics (Freilich et al., 2018; Hilton et al., 2013; Pasta
et al., 2004). For example, a structure of an HSP27 oligomer containing 24 monomers

191
(PDB:6DV5) shows the IXI of one monomer reaching over to interact with the ACD cleft of a
neighboring monomer (Nappi et al., 2020). This type of neighboring interaction is also seen in a
tetramer of HSPB2/HSPB3 (A. R. Clark et al., 2018). Additionally, the contact between the cleft
and the IXI-motif can block protein-protein interactions between the sHSP and other proteins,
including amyloid substrates (Freilich et al., 2018; Hochberg et al., 2014; Rauch et al., 2017).
Therefore, the dynamic regulation of this interaction is proposed to be key contributor to
controlling the activity of these sHSPs. Notably, HSP27, αAC, and αBC have been long known to
be O-GlcNAc modified (Guo et al., 2012; Rambaruth et al., 2012; Roquemore et al., 1992; S.
Wang et al., 2017), and proteomic analysis from cells and tissues has localized endogenous O-
GlcNAc modifications to residues very near the IXI domains (Figure 4-1c) (Deracinois et al., 2018;
Li et al., 2019; Roquemore et al., 1992; S. Wang et al., 2017). This led us to hypothesize that O-
GlcNAc modification of these sHSPs may inhibit the IXI-ACD interaction and increase their anti-
amyloidogenic activity.

Here, we used a combination of synthetic protein chemistry and biochemical analysis to
confirm this hypothesis. We first used protein semisynthesis to construct HSP27 bearing individual
O-GlcNAc modifications at all four previously identified sites. We then showed that all of these
O-GlcNAc events improve the chaperone activity of HSP27 against the amyloid aggregation of α-
synuclein and that the two modification sites closest to the IXI domain, including the conserved
Thr184, displayed the largest increase in this activity. We then applied protein semisynthesis to
prepare αAC with O-GlcNAc at residue 162 and αBC with O-GlcNAc at either residue 162 or
170. Similar to HSP27, O-GlcNAc of αAC and αBC improved their anti-amyloid activity against
α-synuclein. We then focused on the the conserved site of modification between all three sHSPs,

192

Figure 4-1. O-GlcNAc modification and the small heat shock proteins (sHSPs). a) O-
GlcNAcylation is added to serine and threonine residues of intracellular proteins by O-GlcNAc
transferase (OGT) and can be reversed by O-GlcNAcase (OGA). b) Domain structure of a subset
of sHSPs, which contains an N-terminal region responsible for protein oligomerization and some
chaperone activity, an α-crystallin domain (ACD) that binds to hydrophobic segments, and a C-
terminal IXI-domain that regulates the sHSP activity through interactions with the ACD. c) All
three sHSPs with a C-terminal IXI domain are O-GlcNAcylated near this sequence in cells and
tissues. d) Sequence alignment of the three IXI domains shows a conserved O-GlcNAcylation site
(in blue) directly C-terminal to the IXI motif.

193
Thr184 in HSP27 and residue 162 αAC/αBC, to (Figure 4-1d) as it may represent an evolutionarily
conserved activation mechanism. We used these proteins to test the possibility that O-GlcNAc
would also improve chaperone activity against Aβ(1-42) aggregation and found that all three
modified proteins are indeed better chaperones. Because the sHSPs function as oligomers, we also
mixed unmodified and O-GlcNAc modified HSP27 at different ratios and found that as little as
25% O-GlcNAcylated monomers is sufficient to induce the increased chaperone activity. We then
tested whether multiple O-GlcNAc modifications would further improve the chaperone activity of
HSP27 by synthesizing a protein bearing O-GlcNAc at all four modification sites simultaneously.
Interestingly, this protein was not a better chaperone compared to the single modification at
Thr184. Next, we used a variety of biophysical techniques and modeling to show that the O-
GlcNAcylated IXI domain of HSP27 does indeed display reduced binding to its ACD, providing
a mechanism that supports our observations. Finally, we show that while overall O-GlcNAc is
reduced in AD patients compared to age-matched controls, O-GlcNAc on HSP27 is increased in
AD and modification of αBC is maintained. Taken together, our results demonstrate that O-
GlcNAc increases the anti-amyloid activity of certain sHSPs and that this protective modification
may play important roles in neurodegenerative diseases. Coupled with our previous work on α-
synuclein and the work of others on tau, we believe that O-GlcNAc is a multifaceted inhibitor of
amyloid aggregation.

4.2 Synthesis of O-GlcNAc modified HSP27.
In order to directly test the effect of O-GlcNAc at Thr174, Ser176, Thr184, and Ser187 on
HSP27 structure and function, we first individually synthesized these modified proteins using

194

Figure 4-2. O-GlcNAcylated HSP27 is a better chaperone against α-synuclein amyloid
aggregation. a) Unmodified and differentially O-GlcNAcylated versions of HSP27 were
retrosynthetically deconstructed into a recombinant protein thioester and peptides prepared by
solid phase peptide synthesis. b) α-Synuclein alone (50 μM) or in the presence of HSP27 or the
indicated O-GlcNAcylated HSP27 proteins (1 μM) was subjected to aggregation conditions
(agitation at 37 °C). After different lengths of time, aliquots were removed and analyzed by ThT
fluorescence (λ
ex
= 450 nm, λ
em
= 482 nm). The y-axis shows fold change in fluorescence compared
with α-synuclein alone at t = 0 h. Results are mean ±SEM of n=3 independent experiments.
Statistical significance was determined using a one-way ANOVA test followed by Dunnet’s test
(α-synuclein alone or plus HSP27 versus O-GlcNAcylated proteins). c) The same reactions were
analyzed by TEM after 168 h. d) The same reactions were subjected to the indicated concentrations
of proteinase-K (PK) for 30 min before separation by SDS-PAGE and visualization by Coomassie
staining. The persistence of bands correlates with the amount of amyloid formation.

195
expressed protein ligation (EPL) (Muir et al., 1998). Traditional EPL relies on a native chemical
ligation reaction (NCL) that occurs between a C-terminal thioester and an N-terminal cysteine
residue, yielding a native amide bond. HSP27 does not contain a strategically useful cysteine
residue close to any of the O-GlcNAc modification sites, so we decided to introduce one at position
173 in the primary sequence, an alanine residue in the native protein. This cysteine mutation
allowed us to retrosynthetically deconstruct HSP27 into two fragments, a recombinant protein
thioester (1) and synthetic peptides (2-6) containing an N-terminal cysteine residue required for
ligation (Figure 4-2a and Appendix C-1). After purification, incubation of 1 with either peptide 2-
6 in ligation buffer resulted in facile formation of the ligation products. Finally, we performed
radical-mediated desulfurization to convert the cysteine required for ligation into the native alanine
residue, yielding unmodified and four site-specifically O-GlcNAc modified HSP27 proteins:
gT174, gS176, gT184, gS187. HSP27 does contain one native cysteine residue at position 137,
which is also converted to alanine in the desulfurization reaction. However, loss of Cys137 has
been exploited in the past for semisynthetic access to HSP27 (Matveenko et al., 2016), as well as
to prevent the formation of covalent HSP27 dimers through a disulfide-bond. This disulfide acts
as a regulator of HSP27 activity under different oxidative environments, but is also a complicating
factor for the purification and storage of this protein that we wanted to avoid (Alderson et al.,
2019).

4.3 O-GlcNAc improves HSP27 chaperone activity against α-synuclein amyloid formation.
As noted above, α-synuclein forms toxic amyloids in Parkinson’s disease, and HSP27
inhibits this process. Therefore, we tested whether O-GlcNAc modification of HSP27 improved
the inhibition of α-synuclein aggregation by mixing unmodified HSP27 or one of the O-GlcNAc

196
versions (at 1 μM concentration) with α-synuclein (50 μM). We chose this ratio of chaperone to
client protein because it results in some but not complete inhibition of α-synuclein aggregation by
unmodified HSP27. We then subjected these protein mixtures to aggregation conditions (agitation
at 1,000 rpm, 37 °C) for 7 days. α-Synuclein (50 μM) alone was used as a control. The formation
of α-synuclein amyloids was then measured using three different assays. First, we employed the
dye thioflavin-T (ThT), which becomes fluorescent in the presence of amyloid fibers (Figure 4-
2b). As expected, unmodified Hsp27 inhibited the aggregation of α-synuclein. Consistent with our
hypothesis, all of the O-GlcNAc versions of Hsp27 were better aggregation inhibitors, with
HSP27(gT176) and HSP27(gT184) having the largest, and statistically significant effect. Second,
we used transmission electron microscopy (TEM) to visualize any aggregates that did form (Figure
4-2c). We visualized long fibers for α-synuclein alone but smaller amyloid fibers in the presence
of unmodified HSP27, and this effect was more pronounced in the presence of HSP27(gT174) or
HSP27(gS187). Finally, we found that the best aggregation inhibitors in the ThT assay,
HSP27(gS176) and HSP27(gT184), appeared to only form amorphous aggregates. Third, we used
proteinase K (PK) digestion to examine the stability of the α-synuclein aggregates. PK displays
broad selectivity in the α-synuclein primary sequence and will completely degrade the unfolded
protein. However, when amyloids are formed, they inhibit the accessibility of the aggregated
region to PK, resulting in stabilized fragments that can be visualized by SDS-PAGE. The resulting
banding pattern of the stabilized fragments provides a low resolution picture of the protease-
resistant core of the aggregates. Using this assay, we further confirmed that O-GlcNAc HSP27 is
better at inhibiting the formation of α-synuclein amyloids (Figure 4-2d). In particular, we
discovered that HSP27(gT174) and HSP27(gS187) showed a similar banding pattern as α-
synuclein aggregated alone but with reduced intensity of the PK-resistant bands. However, in the

197
presence of HSP27(gS176) or HSP27(gT184), we could only detect very faint bands that were
stable to PK, indicating minimal amounts of amyloid formation. Importantly, the banding pattern
from α-synuclein aggregated alone is highly consistent with the known core of α-synuclein
amyloids (Luk et al., 2016). Taken together, these data show that O-GlcNAc results in a site-
specific increase in HSP27 chaperone activity against the initial stages of α-synuclein aggregation.
We believe that O-GlcNAc at Thr184 has the greatest effect on chaperone activity because it is
right next to the IXI sequence while the other modifications are more distant.

Amyloid aggregation occurs through two broadly-defined steps. The first is nucleation of
monomeric protein into aggregates, which is slower and the process we investigated above. The
second step involves the extension of amyloid seeds by additional monomer and has faster kinetics.
HSP27 is also capable of inhibiting this seeded aggregation step (Cox et al., 2018; Selig et al.,
2020). To test whether O-GlcNAc also improves the activity of HPS27 against fibril elongation,
we repeated the α-synuclein aggregation experiments (50 uM monomer concentration) in the
presence of 5% pre-formed fibers (2.5 uM) that served as seeds for monomer addition and analyzed
aggregation by ThT fluorescence (Figure 4-3). The lack of a lag phase in the kinetic profile
confirms that under these conditions, aggregate formation is mainly through extension of the pre-
formed fibers rather than through monomer primary nucleation. Upon addition of unmodified
HSP27, we saw a reduction in the initial slope of the fluorescence increase compared to the no
HSP27 control, demonstrating its inhibition of the rate of fibril extension. In addition, the total
amount of aggregates is also reduced based on the ThT reading at the final time point. The
inhibition of extension rates and reduction in total aggregates are both dependent on the
concentration of HSP27, in agreement with literature (Cox et al., 2018). In contrast to the

198
aggregation of monomers in Figure 4-2, we did not observe any additional chaperone activity using
HSP27(gT184). Notably, however, O-GlcNAc modification did not diminish the activity of
HSP27. We believe that these results are consistent with a recently published model showing that
the N- and C-terminal domains are also important for binding to amyloid fibers other than the
ACD (Selig et al., 2020).

Fig. 4-3. O-GlcNAc neither improves nor diminishes the activity of HSP27 against seeded
α-synuclein aggregation. α-Synuclein monomers (50 μM) and the indicated ratios of HSP27 or
HSP27(gT184) were mixed with α-synuclein preformed fibres (2.5 μM, 5%). The reactions were
placed in a plate reader and aggregation was detected by ThT fluorescence (λex = 450 nm, λem =
482 nm).

4.4 O-GlcNAc modification is a conserved mechanism for sHSP activation against α-
synuclein amyloid formation.
We next used protein semisynthesis to prepare O-GlcNAc modified versions of αAC and
αBC. Specifically, αAC was retrosynthetically deconstructed into an N-terminal thioester (7),
residues 1-141, and two peptides (8 & 9) (Figure 4-4 and Appendix C-2). Protein 7 was obtained
using recombinant expression with the intein technology described above. Peptide thioester 8 was
prepared using SPPS on Dawson resin (Blanco-Canosa & Dawson, 2008), while glycopeptide 9

199
was synthesized on Wang resin with an N-terminal selenocysteine residue. We then performed an
NCL reaction between peptides 8 and 9, to yield residues 142-173 of αAC, followed by
deprotection of the resulting N-terminal cysteine. Through a subsequent EPL reaction with protein
thioester 7, we obtained the full-length sequence of O-GlcNAc modified αAC. The selenocysteine
was then selectively transformed to the native alanine in αAC to yield the O-GlcNAc protein with
no primary sequence mutations (Metanis et al., 2010). In this case, we required the use of two
peptide segments because the recombinant expression of αAC residues 1-156 as an intein fusion
resulted in a product that could not be separated by RP-HPLC. Similarly, we prepared αBC from
two fragments (Figure 4-4 and Appendix C-3). The first was an intein fusion to residues 1-154 of
αBC (10), while the second were synthetic glycopeptides of residues 155-175 (11 & 12). αBC
contains no convenient cysteine nor alanine residues; therefore, we chose to employ γ-thioproline
as the cysteine surrogate at the EPL junction (Shang et al., 2011). Because αBC does not contain
any cysteine residues, we then employed desulfurization to generate glycosylated αBC with no
mutations. To obtain the unmodified version of the α-crystallin proteins, we expressed them as
full-length N-terminal fusions to an intein and used hydrolysis to remove the intein tag (Appendix
C-2 and C-3).

Figure 4-4. Synthetic route to O-GlcNAc αAC and αBC. O-GlcNAc modified αAC and αBC
were retrosynthetically deconstructed into recombinant protein thioesters and peptides prepared
by solid phase peptide synthesis

200
With these proteins in hand, we next tested the potential for O-GlcNAcylation to increase
the chaperone activity of αAC or αBC against α-synuclein amyloid formation. First, we subjected
α-synuclein to the aggregation conditions described above in the absence or presence of either
unmodified αAC or αAC(gS162) Again, we performed these aggregation reactions at a 50:1 ratio
of α-synuclein to chaperone as this resulted in some but not total inhibition of α-synuclein
aggregation by unmodified αAC. Analysis by ThT, TEM, and PK cleavage showed that O-

Figure 4-5. O-GlcNAc improves the anti-α-synuclein chaperone activity of αAC. O-GlcNAc
modified αAC is a better chaperone against α-synuclein amyloid aggregation. α-Synuclein
amyloid formation was measured by ThT fluorescence (n=3 independent experiments), TEM
imaging, and PK digestion in the absence or presence of αAC or αAC(gS162) as in Figure 4-2.

201
GlcNAc αAC was, as predicted, more capable of inhibiting α-synuclein amyloid formation than
the unmodified protein (Figure 4-5). Similarly, we tested the effect of O- GlcNAc on αBC at either
Thr162 or Thr170 by ThT fluorescence (Figure 4-6). In this case, we performed the reaction at a
75:1 ratio of α-synuclein to chaperone. Consistent with the HSP27 and αAC data, we found that
both O-GlcNAc modified versions of αBC, αBC(gT162) and αBC(gT170), were better
chaperones than the unmodified protein. At this protein ratio, the kinetics of α-synuclein

Figure 4-6. O-GlcNAc improves the anti-α-synuclein chaperone activity of αBC. a) O-
GlcNAc αBC is also a better chaperone against α-synuclein amyloid aggregation. α-Synuclein
amyloid formation was measured by ThT fluorescence as in Figure 4-2 (n=3 independent
experiments). b) At a lower ratio, αBC is a strong inhibitor of α-synuclein amyloid aggregation
with or without O-GlcNAcylation. α-Synuclein amyloid formation was measured by ThT
fluorescence (n=3 independent experiments), TEM imaging, and PK digestion in the absence or
presence of αBC or αBC(gT162) as in Figure 4-2. The y-axis shows fold change in fluorescence
compared with α-synuclein alone at t = 0 h. All results are mean "SEM of experimental replicates
(n=3). Statistical significance was determined using a one-way ANOVA test followed by Tukey!s
test. N.S. We attribute the reduced levels of α-synuclein in lane #4 of “No αBC” to protein loading.

202
aggregation were inhibited, but the ThT fluorescence suggested that a similar amount of amyloids
formed by the end of the assay. Therefore, we chose to focus on the αBC O- GlcNAc site, T162,
that is conserved in all three chaperones and performed another aggregation reaction at a 50:1 α-
synuclein to αBC ratio (Figure 4-6b). We performed an aggregation reaction at a 50:1 ratio, and
analysis by ThT, TEM, and PK cleavage demonstrated that both αBC and αBC(gT162) completely
inhibited α-synuclein amyloid formation. Together, these data show that O-GlcNAc is a conserved
mechanism for the activation of this class of sHSPs.

4.5 O-GlcNAc activates all three sHSPs against Aβ(1-42) amyloid formation.
sHSPs have also been shown to inhibit the amyloid aggregation of the Aβ(1-42) peptide
associated with Alzheimer’s disease, raising the possibility that O-GlcNAcylation of these sHSPs
may be a beneficial modification in multiple neurodegenerative diseases. To test this hypothesis,
we individually mixed Aβ(1-42) with either unmodified sHSP or HSP27(gT184), αAC(gS162),
or αBC(gT162). In the cases of HSP27 and αBC, we performed these reactions with 10 μM Aβ(1-
42) and 1 μM sHSP, while αAC was used at 2 μM. Once again these ratios were chosen because
they showed a difference between Aβ(1-42) alone and in the presence of the unmodified
chaperone. We subjected these mixtures to a ThT plate-reader assay and quantified the onset time
of amyloid formation (Figure 4-7a). As seen in previous publications, Aβ(1-42) alone formed
amyloids very quickly and then precipitated from the reaction solution, resulting in first an increase
and subsequent decrease in ThT fluorescence. As expected, we observed a delay in the aggregation
of Aβ(1-42) in the presence of any of the unmodified sHSPs. In the case of the O-GlcNAc modified
proteins, we found an even longer onset time for all three sHSPs. Next, to test whether the overall
levels of Aβ(1-42) aggregates were different at the end of the aggregation assays, we used dot-

203

Figure 4-7. O-GlcNAcylation is a global activator of HSP27, αAC, and αBC chaperone
activity against Aβ(1-42) amyloid aggregation. a) Aβ(1-42) alone (10 μM) or in the presence of
sHSP or the indicated O-GlcNAcylated sHPS protein (1 μM for HPS27 and αBC or 2 μM for
αAC) was subjected to aggregation conditions (agitation at 37 °C in a plate reader). Every 5 min,
ThT fluorescence (λ
ex
= 450 nm, λ
em
= 482 nm) was measured. The y-axis shows fold change in
fluorescence compared with the same conditions at t = 0 h. Onset-times were obtained by
measuring the time required for fluorescence to reach 3-times the initial reading. Onset-time results
are mean ±SEM of n=4 independent experiments. b) The same aggregation reactions were
analyzed by dot-blotting against Aβ(1-42) amyloids (clone M98).

blotting with an antibody (clone M98) that recognizes Aβ(1-42) amyloids (Figure 4-7b). In all
three replicates, we found that addition of the unmodified chaperones or O-GlcNAc modified
HSP27 did not notably reduce the overall amount of amyloids, demonstrating that these

204
chaperones only slow the kinetics of Aβ(1-42) aggregation under these conditions. In contrast,
with the addition of αAC(gS162) and αBC(gT162), we observed reduced amyloid levels,
suggesting that these proteins may be able to reduce the total amounts of aggregation.

Next, we tested whether O-GlcNAc could improve the activity of sHSPs when it is present
at substoichiometric levels in the chaperone oligomers. Accordingly, we incubated different ratios
of unmodified HSP27 and HSP27(gT184) for 1 h at 37 °C, which results in subunit exchange and
the formation of mixed oligomers with 0, 25, 50, 75, 100% O-GlcNAc. We then initiated separate
aggregation reactions with 10 μM Aβ(1-42) and 2 μM of the different ratios of O-GlcNAc
modified HSP27 and measured amyloid formation by ThT fluorescence (Figure 4-8a). Strikingly,
we found that as little as 25% HSP27(gT184) in the mixed oligomer was able to significantly
increase the onset time of amyloid formation and observed a fairly linear correlation between the
amounts of O-GlcNAcylation and the delay in Aβ(1-42) amyloid formation. These data
demonstrate that the increased chaperone activity induced by this modification is not confined to
α-synuclein, but is instead a general anti-amyloid feature, and that it can act substoichiometrically.
Finally, we explore the possibility that O-GlcNAc could have an additive effect on HSP27 activity
by synthesizing the quadruply O-GlcNAc modified protein bearing glycosylation at each of the
four sites, termed HSP27(g4X) (Appendix C-4). We then compared HSP27(g4X) to
HSP27(gT184) against Aβ(1-42) aggregation and found that multiple O-GlcNAc modifications to
not further enhance the activity of HSP27 (Figure 4-8b).

205

Figure 4-8. Stoichiometry studies on the effect of O-GlcNAc on HSP27 chaperone activity. a)
O-GlcNAcylation activates HSP27 chaperone activity in a substoichiometric fashion. Aβ(1-42)
alone (10 μM) or in the presence of HSP27 or the indicated ratios of HSP27/HSP27(gT184) (2
μM) was subjected to aggregation conditions and analysis as in (a). Onset-time results are mean
±SEM of n=3 independent experiments. b) Multiple O-GlcNAc modifications do not further
enhance the activity of HSP27. Aβ(1-42) alone (10 μM) or in the presence of HSP27(gT184) or
HSP27(g4X) (1 μM) was subjected to aggregation conditions and analysis as in (a). Onset-time
results are mean ±SEM of n=4 independent experiments. In all experiments, statistical significance
was determined using a one-way ANOVA test followed by Tukey’s test.

206
4.6 O-GlcNAc disrupts the ACD-IXI interaction and increases the size of HSP27 oligomers.
Next, we set out to test the molecular mechanisms behind O-GlcNAc activation of HSP27
by first examining whether this modification inhibits the binding of the IXI sequence to the
chaperone cleft of the ACD. In the case of the unmodified IXI sequence, previous experiments
showed that the intermolecular interaction between the HSP27’s native IXI peptide
(
178
EITIPVTFE
186
) and the ACD was too weak to measure reliably (Freilich et al., 2018). However,
introduction of a Phe to His mutation at position 185, giving
178
EITIPVTHE
186
, overcame this
limitation (Freilich et al., 2018). Accordingly, we synthesized N-terminally biotinylated peptides
corresponding to this improved sequence or the glycopeptide with an O-GlcNAc at Thr184. We
then individually immobilized these peptides on a streptavidin-coated microfluidic chip and used
surface plasmon resonance (SPR) to measure the binding of monomeric HSP27 ACD to these
surfaces (Figure 4-9a). In the case of the unmodified peptide, we observed a K
D
of 3.14 ± 0.63 μM.
In contrast, we detected no binding of the ACD to the O-GlcNAc modified peptide. In fact, we
saw a negative binding response, which we attribute to a non-specific interaction between the ACD
and streptavidin that was blocked by the glycopeptide, as we observed in the raw. As confirmation,
we synthesized the same two peptides without biotin and measured their binding to the ACD by
isothermal titration calorimetry (ITC) (Figure 4-9b). Using this technique, we found a K
D
of 14.3
± 1.2 μM for the unmodified peptide and again essentially no binding to the O-GlcNAcylated
variant. Importantly, our measured binding constant for the unmodified peptide is very close to the
published value of 11.5 μM (Freilich et al., 2018). We believe that the apparent total loss of the
gT184 peptide may explain why we do not see an additional benefit from multiple O-GlcNAc
modifications against Aβ aggregation.

207

Figure 4-9. O-GlcNAcylation blocks the IXI/ACD HSP27 domain-interaction and increases
the size of HSP27 oligomers. a) The indicated biotinylated IXI or O-GlcNAcylated-IXI peptides
were immobilized on a streptavidin-coated SPR chip and the binding of the recombinant HSP27
ACD was measured using surface plasmon resonance (SPR) and the binding constants were
determined using Biacore T100 analysis software. The data is representative of two independent
experiments. b) The corresponding non-biotinylated peptide were titrated against the HSP27 ACD
and the binding constant was determined using MicroCal PEAQ-ITC analysis software. The data
is representative of two independent experiments. c) HSP27 or HSP27(gT184) were analyzed by
SEC-MALS showing a larger size and distribution of HSP27(gT184) oligomers compared to
unmodified HSP27.

208
To complement our binding data and to better understand how O-GlcNAc modification
could be enhancing HSP27 chaperone activity, we used computational modeling to interrogate
HSP27 folding. The structure of an HSP27 monomer was generated using ROSETTA as previously
described (Ovchinnikov et al., 2017), and ab initio modeling was performed on the C-terminal
residues (“CTR”, 171-206) of HSP27 containing the IXI motif. Standard ab initio (Simons et al.,
1999) was performed including fragment insertion and Monte Carlo minimization to enumerate
all low energy backbone conformations. After all the low-energy conformations were enumerated,
for each conformation Thr-184 was replaced with Thr-O-GlcNAc followed by an additional round
of Monte Carlo minimization. The lowest energy structures resulting from this conformational
sampling can be seen in Figure 4-10. As expected, the unmodified protein showed the IXI-domain
occupying the ACD cleft. This bound- state is confirmed in the HSP27 oligomer crystal structure
(Nappi et al., 2020), but is in equilibrium with unbound, unstructured conformations of the C-
terminus. The Montecarlo simulation gives a predicted lowest energy of the CTR. It is very
difficult to predict the presence and relative proportions of other conformations or relative
populations of those conformations. This analysis provides a snapshot the highest probability state
amongst a background of conformational states. In contrast, O-GlcNAcylation at T184 resulted in
a conformation with a loosely-associated IXI-domain and an empty ACD cleft free for substrate
binding. Again, the O-GlcNAc modified C-terminus also probably exists in a range of unstructured
conformations. Taken together, the binding and modeling data strongly suggest that O-GlcNAc
perturbs the interaction with the ACD binding groove, consistent with previous reports that
accessibility to the ACD β4-β8 cleft is important for proper chaperone function of aggregation
prone clients.

209

Figure 4-10. Ab initio structure of wild-type HSP27. ROSETTA predicts the IXI motif
occupying the ACD cleft while O-GlcNAc modified HSP27 does not occupy the ACD cleft.

210
The IXI-ACD interaction can control both the accessibility of the chaperone cleft and the
oligomer size of HSP27. Therefore, we next used size exclusion chromatography linked to multiple
angle light scattering (SEC-MALS) to measure any consequences of O-GlcNAcylation at T184 on
HSP27 oligomer size. We found that HSP27(gT184) forms larger oligomers than the unmodified
protein (Figure 4-9c). Specifically, HSP27(gT184) had an average oligomer size of ~47
monomers, while the unmodified oligomer consisted of only ~28 monomers. Additionally, the
distribution of the HSP27(gT184) oligomer size was larger than that of the unmodified protein.
Again, the size of our unmodified oligomers are in excellent agreement with previously published
data (Freilich et al., 2018). Together, these results are consistent our original hypothesis that O-
GlcNAcylation of the IXI domain inhibits its interaction with the ACD chaperone cleft of sHSPs,
presumably generating a dynamic structure that can more readily bind to hydrophobic segments
and growing amyloid fibers.

4.7 Overall O-GlcNAc levels are reduced in Alzheimer’s disease but sHSP modification is
maintained or increased.
A number of labs have found that the overall levels of O-GlcNAcylation are lower in
Alzheimer’s diseased brains (Aguilar et al., 2017; F. Liu et al., 2004; Fei Liu et al., 2009; Pinho et
al., 2019). Therefore, we were interested in exploring the corresponding O-GlcNAcylation status
of HSP27 and αBC, which are both expressed in the brain. Accordingly, we obtained frozen
samples (Brodmann area 7) from eight Alzheimer’s disease patients and eight age-matched
controls and subjected them to lysis and analysis of global O-GlcNAc levels by dot-blotting
(Figure 4-11a). Consistent with published reports, we observed significantly

211

Figure 4-11. Global O-GlcNAc is lower in Alzheimer’s disease but is increased or maintained
on HSP27 and αBC, respectively. a) Overall O-GlcNAc is lower in Alzheimer’s disease. Brain
samples (Brodmann area 7) from Alzheimer’s patients and age matched controls were analyzed
by dot blotting with a pan anti-O-GlcNAc antibody (RL2). RL2 staining was normalized to loading
(Ponceau stain) and quantitated. b) HSP27 O-GlcNAc modification is increased in Alzheimer’s
disease. O-GlcNAc modified proteins were enriched from Brain samples (Brodmann area 7) from
Alzheimer!s patients and age matched controls using chemoenzymatic labeling and analyzed by
Western blotting against HSP27. Biotin-IP signal was normalized to input levels and quantitated.
c) αBC O-GlcNAc modification is maintained in Alzheimer!s disease. O-GlcNAc modified
proteins were enriched from Brain samples (Brodmann area 7) from Alzheimer!s patients and age
matched controls using chemoenzymatic labeling and analyzed by Western blotting against αBC.
Biotin-IP signal was normalized to input levels and quantitated. In all panels, results are mean
"SEM of n=8 biologically independent samples. Statistical significance was determined using a
two-tailed Welch’s t-test.

212
less O-GlcNAc in the Alzheimer’s disease samples. To measure HSP27 and αBC O-GlcNAc
modification, we took advantage of chemoenzymatic labeling (P. M. Clark et al., 2008) and a
cleavable biotin-tag to enrich modified proteins followed by washing, elution, and Western
blotting. In the case of HSP27, we observed that this protein is overexpressed in Alzheimer’s
disease (data not shown). When we controlled for this difference in protein expression in our
analysis of the O-GlcNAc enrichment, we found that more of HSP27 was O-GlcNAc modified in
Alzheimer’s disease (Figure 4-11b). Performing a similar analysis on αBC, we found that it is O-
GlcNAc modified at similar levels in both sets of samples (Figure 4-11c). With the overall loss of
O-GlcNAc in Alzheimer’s disease, we were surprised by these findings, but the results
demonstrate that O-GlcNAc is not lost equally on all protein substrates in Alzheimer’s disease and
that cells may be armed with a mechanisms to maintain this modification on certain proteins. Given
the increased anti-amyloid activity of O-GlcNAc modified HSP27 and αBC, one can rationalize
why these modifications would be induced upon the stress of amyloid aggregation.

4.8 Conclusions
Our results demonstrate that O-GlcNAc activates the anti-amyloid activity of all three of
the C-terminal IXI-containing sHSPs. We also demonstrate that mechanistically, this is likely due
to a decreased physical interaction between the chaperone cleft of the ACD with the IXI-containing
C-terminus. This decreased interaction also appears to result in the formation of larger HSP27
oligomers. As mentioned in the introduction, a recently deposited crystal structure of an HSP27
oligomer (PDB:6DV5) shows IXI-ACD interactions between different monomers. We believe that
it is likely that these interactions are altered by O-GlcNAc, resulting in a conformational
rearrangement of the oligomer into a more active state. The exact molecular structure of this larger

213
oligomer is something that we plan to pursue in the future. It is also possible that O-GlcNAc
modification of the C-terminal tail increases the solubility of the client-bound chaperone to further
enhance its anti-amyloidogenic activity. Finally, we find that although overall O-GlcNAc levels
are lower in AD, HSP27 modification levels are increased and aBC levels are maintained. These
results suggest a mechanism to retain the increased activity of these chaperones potentially at the
expense of other O-GlcNAc modified proteins, but we plan to explore the details of HSP27
modification by OGT in vitro as a next first step. We also do not know the exact stoichiometry of
these modifications in the relevant cells of the human brain. Analysis of αAC in bovine eyes found
the stoichiometry to be only 2% when measured by mass spectrometry but closer to 50% when
ascertained by high performance anion exchange chromatography (Roquemore et al., 1992). O-
GlcNAc modification of HSP27 is also consistently identified in proteomics experiments from
various groups, indicating that the levels of modification may be reasonable.

Taken together, we believe that these results have important implications for targeting O-
GlcNAc in neurodegenerative diseases. For example, potent inhibitors of OGA are being tested
clinically. However, the focus in these and other pre-clinical studies has largely been on the O-
GlcNAc modified proteins (e.g., tau) that directly form toxic amyloids. Given the
substoichiometric activity of sHSPs, and our demonstration that only a fraction of the sHSP must
be O-GlcNAc modified for improved activity, we speculate that increasing the modification status
of these proteins may have an equally if not more important role for blocking amyloid formation.
Interestingly, we also find that O-GlcNAc does not appear to affect the parallel role for sHSPs in
the maintenance of folded proteins. Specifically, modified HSP27 does not appear to further
stabilize the partially unfolded state of the model client proteins citrate synthase (CS),

214
glyceraldehyde 3-phosphate dehydrogenase (GAPDH), or malate dehydrogenase (MDH) (data not
shown). These proteins aggregate amorphously by a distinct pathway compared to amyloid
forming proteins (Hartl et al., 2011). This result suggests that sHSP O-GlcNAc modification could
function selectively to prevent protein aggregation rather than globally upregulating all of the
protein’s chaperone functions, and it could be explained by the observation that the N-terminal
region of this class of sHSPs may be more important than the ACD for amorphous clients (Mainz
et al., 2015). In summary, we have discovered a new mechanism that further supports a critical
role for O-GlcNAcylation in the prevention and potential treatment of neurodegenerative diseases,
with key implications for the evaluation of OGA inhibitors as they progress through clinical
development.

215
4.9 Materials and methods
General
All solvents and reagents were purchased from commercial sources and used without any
further purification. All aqueous solutions were prepared using ultrapure laboratory grade water
(deionized, filtered, and sterilized) obtained from an in-house ELGA water purification system.
Growth media were prepared, sterilized, stored, and used according to the instructions of the
manufacturer. Antibiotics were prepared as stock solutions at a concentration of 1000× (100
mg/mL ampicillin sodium salt) and stored at -20 °C. All bacterial growth media and cultures were
handled using sterile conditions under an open flame. Protein concentrations were determined by
the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Reversed-phase high-performance
liquid chromatography (RP-HPLC) was performed using an Agilent Technologies 1200 Series
HPLC instrument with a diode array detector with semi-preparative and analytical C4 or C8
columns obtained from Higgins Analytical. Large scale reversed phase liquid chromatographic
purifications were performed on a Biotage Isolera One equipped with SNAP Bio C4 or C18 10g
reversed-phased cartridges. The following reversed-phase chromatography buffers were used:
buffer A, 0.1% TFA in H
2
O; buffer B, 0.1% TFA and 90% ACN in H
2
O. Mass spectra were
acquired on an API 3000 LC/MS-MS system (Applied Biosystems/MDS SCIEX) or a Daltonics
Autoflex MALDI-TOF (Bruker) using α-cyano-4-hydroxycinnamic acid (HCCA) as the matrix.
Gels and blots were resized and cropped using Photoshop CC 2019. Graphs were generated using
Graphpad Prism 8 or 9, and this same program was used for all statistical calculations.

216
Peptide synthesis
Peptides were synthesized using standard Fmoc solid-phase chemistry. Unless otherwise
stated, pre-loaded Wang resins were used as solid supports. Typical coupling reactions utilize
Fmoc-protected amino acids (5 eq.), HBTU (5 eq.) and DIEA (10 eq.) in DMF incubated for 1 h.
For glycosylated serine or threonine residues, 2 eq. of Pfp-activated monomer, prepared as
previously described

(De Leon et al., 2018), in 3 mL of DMF were coupled overnight.
Selenocysteine and 𝛾-thioproline residues were coupled overnight using 2 eq. of Pfp-activated
versions of commercially available para-methoxybenzyl- fmoc-selenocysteine or (2S,4R)-fmoc-
mercaptopyrrolidine amino acids (both from ChemImpex). Upon completion of peptide syntheses,
acetyl groups were deprotected with hydrazine monohydrate (80% v/v in MeOH) twice for 45 min
with mixing. Peptides were then globally deprotected and cleaved (95:2.5:2.5
TFA/H
2
O/triisopropylsilane) for 4 h at room temperature. For selenocysteine containing peptides,
1.3 eq. of dithiobis(5-nitropyridine) (DTNP) was included in the cleavage cocktail. Cleaved
peptides were precipitated out of cold ether, purified by reverse-phase chromatography. and
characterized by ESI-MS. Purity was assessed by analytical HPLC. Purified peptides were
lyophilized and stored at -20 °C until use.

Generation of expression plasmids
HSP27 and αAC expression plasmids were obtained from Addgene (pEGFP-hsp27 wt FL
#17444; pE-SUMO-CRYAA #80756) while αBC plasmid (pET28-HSPB5) was a gift from the
Benesch lab at the University of Oxford. Desired regions were cloned out using overhang PCR to
generate inserts with 5’ NdeI and 3’ Bpu10I cut sites using KOD HotStart Master Mix (EMD
Millipore). After digestion with restriction enzymes (NEB), these were ligated with T4 DNA

217
Ligase (NEB) onto a pTXB1 expression vector at the N-terminus of an AvaE intein bearing a C-
terminal 6xHis tag (Shah et al., 2012). Ligation mixtures were transformed onto high efficiency
DH5α (NEB). After antibiotic selection, plasmids from clones were amplified, purified (QIAGEN
Miniprep kit) and analyzed by restriction enzyme digestion. Sequences were confirmed by Sanger
sequencing (Laragen) using T7 primers.

Protein expression and purification
BL21(DE3) chemically competent Escherichia coli (EMD Millipore) cells were
transformed with intein-fusion plasmid DNA by heat shock and plated on selective LB agar plates
containing 100 μg/mL ampicillin. Single colonies were then inoculated and grown to an OD
600
of
0.6-0.7 at 37 °C while being shaken at 250 rpm. Expression was induced with IPTG at a final
concentration of 1 mM at 37 °C with shaking at 250 rpm for 6 h. After harvesting at 6000g, pellets
were resuspended in lysis buffer (50 mM NaH
2
PO
4
, 300 mM NaCl, 1 mM TCEP, 5 mM imidazole,
6 M GuHCl, and 2 mM PMSF, pH 7.5), tip sonicated, and clarified by centrifugation (7000g for
30 min at 4 °C). Protein lysate was loaded onto Co-NTA agarose beads (Genessee Scientific) and
washed extensively (50 mM NaH
2
PO
4
, 300 mM NaCl, 2 mM TCEP, 20 mM imidazole, 4 M Urea,
pH 7.5). Following washes, protein was eluted (50 mM NaH
2
PO
4
, 300 mM NaCl, 1 mM TCEP,
250 mM imidazole, 4 M Urea, pH 7.5) and dialyzed into PBS to remove excess salts. For protein
thioester generation (HSP27 fragment 1, αAC fragment 7, αBC fragment 10), sodium
mercaptoethanesulfonate (MESNa) was added to a final concentration of 200 mM and pH was
adjusted to 7 prior to overnight incubation at room temperature. For hydrolysis to generate full-
length unmodified αAC, αBC, or the HSP27 ACD, dithiothreitol was added to a final
concentration of 200 mM and the pH was adjusted to 8 before incubating at 37 °C over 48 h.

218
Thiolysis or hydrolysis reactions were purified by reversed phase liquid chromatography and pure
proteins were characterized by analytical RP-HPLC and mass spectrometry. Purified proteins were
then freeze-dried yielding lyophilized powders.

Recombinant α-synuclein was expressed from a pRK172 construct containing human wild-
type sequence. Expression cultures were grown to an OD
600
of 0.6-0.7 prior to induction with 0.5
mM final IPTG concentration for 16 h at room temperature. After harvesting, pellets were flash
frozen in liquid nitrogen then thawed in a 37 °C bacterial incubator for 20 min. After two more
cycles of freeze-thaw, pellets were resuspended in lysis buffer (500 mM NaCl, 100 mM Tris, 10
mM β-mercaptoethanol, 1 mM EDTA, pH 8) and then boiled at 80 °C for 10 min. The bacterial
slurry was then allowed to cool down to room temperature after which time PMSF was added to a
final concentration of 2 mM. The slurry was mixed by vortexing followed by cooling on ice for
30 min. Protein lysate was clarified by centrifugation. The supernatant was then acidified slowly
to pH 3.5 with 1 M HCl, and the solution was incubated on ice to allow proteins to precipitate out.
This suspension was centrifuged, and the resulting supernatant was dialyzed overnight against 1%
acetic acid in degassed ultrapure water. The dialyzed protein solution was clarified by
centrifugation and subjected to RP-HPLC purification, followed by freeze-drying. α-synuclein
was purified to >95% purity by analytical HPLC and characterized by ESI-MS.

Expressed protein ligation to generate HSP27
Each of the peptide fragments 2-6, 14 (1.1 eq) were dissolved in ligation buffer (300 mM
NaH
2
PO
4
, 6 M guanidine HCl, 100 mM MESNa, and 1 mM TCEP, pH 7.4) with 1 eq. of the N-
terminal recombinant thioester 1 (3 mM final concentration) and allowed to react at 37 °C until

219
complete as determined by HPLC. Following completion, the reaction was diluted 4-fold into
desulfurization buffer (200 mM NaH
2
PO
4
, 3 M guanidine HCl, and 300 mM TCEP, pH 7.0)
containing 2% (v/v) ethanethiol, 10% (v/v) tert-butyl-thiol, and the radical initiator VA-061 (as a
0.2 M stock in MeOH). The reaction mixture was stirred at 37 °C for 15 h and then purified by
RP-HPLC to yield synthetic unmodified or glycosylated HSP27 with C137A mutation. Proteins
were analyzed by analytical HPLC for purity, and masses were confirmed by MALDI-TOF MS.
Purified HSP27 variants were lyophilized and stored at -20 °C until use.

Expressed protein ligation to generate αAC
Peptide fragment 9 was synthesized on Wang resin using standard protocols above. Peptide
fragment 10 was synthesized on Dawson resin (Sigma Aldrich) using standard methods, with the
final amino acid coupled using Boc-protected thiazolidine monomer (Advanced Chemtech). After
completion of peptide synthesis, the Dawson resin was activated by incubating with 7.5 eq. of
para-nitrophenylchloroformate for 1.5 h, followed by 10 eq. of DIEA for 30 min. After peptide
cleavage, thiolysis to generate fragment 10 was performed by incubation of the crude peptide
mixture in 3M guanidine HCl, 300 mM NaH
2
PO
4,
200 mM MESNa, pH 7 for 1 h before
purification. Lyophilized fragments 9 (1.1 eq) and 10 (1 eq, 7 mM final concentration) were
resuspended in ligation buffer (100 mM NaH
2
PO
4
, 6 M guanidine HCl, 100 mM L-ascorbic acid,
250 mM MPAA, and 25 mM TCEP, pH 7). After 16 h at room temperature, product was detected
by analytical HPLC and ESI-MS (calculated: 3627.5, found by ESI-MS: 3627.6) when an aliquot
was fully reduced with excess TCEP. The entire reaction mixture was purified by preparative RP-
LC (Biotage) and the product was isolated as a combination of diselenides or MPAA adducts. The
ligation product was then resuspended in deselenization buffer (3M guanidine HCl, 150 mM

220
NaH
2
PO
4
, 25 mM dithiothreitol, 100 mM TCEP, pH 5) and incubated for 4 h at room temperature,
after which methoxylamine hydrochloride was added to a final concentration of 150 mM to open
the thiazolidine ring into a reactive cysteine. After 16 h incubation, the reaction was again purified
by reversed phase chromatography. Finally, this intermediate (2 eq.) was dissolved with the N-
terminal recombinant thioester fragment 7 (1 eq, 2 mM final concentration) in ligation buffer (300
mM NaH
2
PO
4
, 6 M guanidine HCl, 250 mM MPAA, and 25 mM TCEP, pH 7). The reaction was
mixed overnight at room temperature, and product was detected after 16 h. O-GlcNAc S162 αAC
was purified by RP-HPLC followed by freeze-drying and storage as lyophilized powder. Purity
was assessed by analytical HPLC and mass was characterized by MALDI-TOF MS.

Expressed protein ligation to generate αBC
Fragment 10 (1 eq, 3 mM final concentration) and fragment 11 or 12 (3 eq) were dissolved
in ligation buffer (300 mM NaH
2
PO
4
, 6 M guanidine HCl, 250 mM MPAA, and 25 mM TCEP,
pH 7) and allowed to react overnight at room temperature. Product was purified by reversed phase
chromatography and lyophilized. This was then resuspended in desulfurization buffer (200 mM
NaH
2
PO
4
, 3 M guanidine HCl, and 300 mM TCEP, pH 7.0) at a final concentration of 0.5 mg/mL
and allowed to react at 37 °C overnight. Product was purified by RP-HPLC and lyophilized to a
powder. Purified O-GlcNAc T162 αBC was characterized by analytical HPLC and MALDI-TOF
MS.

Refolding
For HSP27 variants, lyophilized proteins were resuspended in 40 mM HEPES·KOH (pH
7.5) at 25 °C for 2 h. For αAC and αBC, lyophilized proteins were resuspended in 6M guanidine-

221
HCl at a concentration of 0.5 mg/mL and dialyzed overnight against 10 mM phosphate buffer, pH
7.4 at 4 °C. Refolded proteins were concentrated and exchanged onto assay buffers using 3K
MWCO Amicon-Ultra 0.5 spin filters (Millipore-Sigma).

α-Synuclein aggregation assays
Lyophilized recombinant α-synuclein was dissolved with bath sonication in reaction buffer
(PBS supplemented with 0.05% sodium azide, pH 7.4). This solution was centrifuged at 20000g
for 20 min at 4°C to remove any pre-formed aggregates, and the supernatant was transferred into
a fresh tube. Following refolding, sHSPs were buffer exchanged into reaction buffer and
concentrated. Protein concentrations of α-synuclein and the sHSPs were determined by BCA
assay. Master mixes were prepared by combining the proteins at the final assay concentrations (50
µM α-synuclein and 1 or 0.67 µM sHSP) before dividing into separate 150 µL reaction replicates.
The samples were incubated at 37 °C with constant agitation (1000 rpm) in a Thermomixer F1.5
(Eppendorf) for 7 days. At each indicated time point, aliquots were obtained and stored at -80 °C
for ThT analysis. In these assay conditions, control aggregation reactions with 1 µM sHSPs (any
of the variants) without α-synuclein resulted in no measurable ThT fluorescence increase over the
duration of the experiment. Samples from the aggregation assay reaction mixture were diluted in
a 96-well plate to a concentration of 1.25 μM with reaction buffer (PBS, pH 7.4 and 0.05% NaN
3
)
containing 10 μM Thioflavin T (dissolved from a 2000x stock prepared in DMSO). Fluorescence
was measured using a Synergy H4 hybrid reader (BioTek) and data was collected using BioTek
Gen5 Data Analysis Software. The plate was shaken on “fast” setting for 3 min, followed by data
collection (λ
ex
= 450 nm, 9 nm band path, λ
em
= 482 nm, 9 nm band path, reading from the bottom

222
of a plate, gain = 100, read height = 5.00 mm). Fluorescence readings at each time point were
normalized to initial fluorescence of pre-aggregation monomers.

Seeded Aggregation Assay
Pre-formed fibrils were assembled at 50 uM in 10 mM phosphate buffer, pH 7.4 for 7 days
with constant agitation (1000 rpm) at 37°C. Fibril formation was confirmed through ThT
fluorescence and proteinase K resistance assays. Seeds were then prepared by dilution of the
assembled fibrils to 25 uM prior to tip sonication at 30% amplitude for 15 seconds total, with 1s
on 1s off pulses. Monomeric alpha synuclein was prepared by resuspending lyophilized protein in
50 mM phosphate buffer, pH 7.4. This solution was bath sonicated for 15 minutes and clarified by
centrifugation at 20,000 g for 30 mins at 4°C. The supernatant was collected and the concentration
was adjusted to 62.5 uM with addition of the phosphate buffer that also contains 62.5 uM of ThT
dye. This monomeric alpha synuclein protein solution was then mixed with pre-plated amounts of
HSP27. Alpha synuclein and HSP27 were then pre-incubated at 37°C for 30 minutes without
agitation. To initiate seeding, the sonicated seeds were added to each well after which the plate
was monitored for ThT fluorescence over 24 hours (5 minute intervals between reads), without
plate mixing, and temperature held at 37°C. Final assay concentrations are 50 uM in monomeric
aSyn, 50 uM ThT dye, 50 mM phosphate, and 2, 0.5 or 0.125 uM HSP27 (as indicated in Figure
4-3). Fluorescence readings at each time point were normalized to initial fluorescence of pre-
aggregation monomers.

223
Transmission electron microscopy of aggregation reactions.
For imaging of protein aggregates, a 10 μL (25 uM concentration) droplet from each
aggregation experiment was deposited on formvar coated copper grid (150 mesh, Electron
Microscopy Sciences) and allowed to sit for 5 min. The excess liquid was removed with filter
paper. Grids were then negatively stained for 2 min with 1% uranyl acetate, washed three times
with 1% uranyl acetate, each time removing excess liquid with filter paper. The grids were dried
for 24 h and then imaged using a JEOL JEM-2100F transmission electron microscope operated
using Controller for JEM-2100 v2.18 software at 200 kV, 60,000x magnification, and an Orius
Pre-GIF CCD.

Proteinase K digestion
Ten micrograms of protein from aggregation reactions were incubated with Proteinase K
(Sigma Aldrich P2308) at the indicated concentrations (Figures 4-3, 4-5, 4-6) for 30 min at 37 °C.
Reactions were quenched by the addition of sample loading buffer (2% final SDS concentration)
and boiling at 95 °C for 10 min. Digestion products were separated by SDS-PAGE using precast
12% Bis-Tris gels (Bio-Rad, Criterion XT) with MES running buffer (Bio-Rad). Bands were
visualized with Coommassie Brilliant Blue (Bio-Rad).

Amyloid beta aggregation assays
Aβ(1-42) (Anaspec) was resuspended in 1% NH
4
OH in PBS at a concentration of 10
mg/mL and sonicated to dissolve. This solution was then diluted to 0.5 mg/mL in PBS, pH 7.4
before aliquoting and storing at -80 °C. During each assay, frozen Aβ was slowly thawed on ice
before removal of pre-formed aggregates with centrifugation at 20,000g for 30 min at 4 °C.

224
Supernatant was diluted to 10 µM in PBS pH 7.4 with 10 µM ThT dye. This Aβ monomer mix
was then divided onto pre-plated sHSPs (previously buffer exchanged into the same assay buffer)
at the indicated concentrations. For the mixed HSP27 assay, mixtures of unmodified and gT184
HSP27 at the indicated ratios (Figure 4-8) were pre-incubated at 37 °C for 1 h before pre-plating
to facilitate subunit exchange. Using a Synergy H4 Hybrid Plate reader, the microplate was kept
at 37 °C and shaken on “fast” setting for 2 min at an interval of 5 min. Reaction was monitored by
reading the fluorescence every 5 min over 16 h using the following parameters: (λ
ex
= 450 nm, 9
nm band path, λ
em
= 482 nm, 9 nm band path, reading from the bottom of a plate, gain = 75, read
height = 5.00 mm). No measurable increase in fluorescence was measured for any of the sHSPs
when incubated without Aβ monomers. Onset was determined using the BioTek Gen5 software
by obtaining the time required to reach three times the initial fluorescence reading.

Amyloid beta fibril dot blotting
Blot samples were prepared by diluting the amyloid beta aggregation reaction at the time
points indicated in Figure 4-7b four-fold into 4% SDS buffer (3% final SDS concentration). For
each spot, a volume corresponding to 10 ng of amyloid beta (based on monomer concentration)
was applied on a dry nitrocellulose membrane, before air-drying for 30 minutes. The membrane
was then blocked with OneBlock Western-FL Blocking Buffer (Genesee Scientific) for 1 hour at
room temperature. Anti-amyloid beta fibril-specific antibody (EMD Millipore, MABN640) was
added at 1:10,000 dilution in OneBlock buffer and incubated for 16 hours at 4°C. The membrane
was washed three times for 5 minutes each in TBST (Cell Signaling Technologies) and secondary
anti-rabbit HRP-conjugated antibody (Jackson) was added at 1:10,000 dilution in OneBlock
buffer. After 1 hour at room temperature, the membrane was washed three times for 5 minutes in

225
TBST, developed with Western ECL Substrates (Biorad) and imaged using a ChemiDoc XRS+
Imager (Bio-Rad)

Surface plasmon resonance
Peptides were synthesized on Wang resin using standard protocols. N-terminal
biotinylation was performed by coupling 1.5 eq. of biotin-PEG4-NHS ester (Click Chemistry
Tools) with 0.5 eq. HOBt in DMF overnight. Peptides were purified to >99% purity by analytical
HPLC and characterized by ESI-MS (unmodified IXI peptide- calculated: 1511.8 Da, found:
1510.8 Da; O-GlcNAc Thr184 IXI peptide- calculated: 1714.9 Da, found: 1715.2 Da). HSP27
alpha crystallin domain (ACD) was purified from hydrolysis of the intein fusion to >99% purity
and characterized by ESI-MS (calculated: 10,751.0 Da, found: 10,751.3 Da).

Experiments were performed on a Biacore T100 system using 10 mM HEPES, 250 mM
NaCl, 3 mM EDTA, 0.05% Tween-20, pH 7.4 (HBST) supplemented with 1 mg/mL bovine serum
albumin (BSA) as the running buffer. Using 100 nM peptide solutions, 20 response units (RU) of
either unmodified or gT184 IXI peptide were immobilized onto the active channels 2 and 4
respectively of a Series S Sensor SA streptavidin chip. Channels 1 and 3 served as reference
channels for unmodified or gT184 IXI peptides, respectively. Lyophilized ACD protein
resuspended in the running buffer was injected to allow a contact time of 45 sec at a flow rate of
90 µL/min. After 120 sec of dissociation with running buffer, surface was regenerated using a 10
mM glycine, pH 2 buffer for 60s. A concentration course of 125 nM to 120 µM was employed and
experiments were repeated three times. Subtracted sensorgrams (active minus reference) were fit
using 1:1 binding models to determine affinity using the Biacore T100 Evaluation Software v2.0.4.

226
Isothermal titration calorimetry
Peptides were synthesized on Wang resin, purified to >99% purity by analytical HPLC and
characterized by ESI-MS (unmodified IXI peptide- calculated: 1038.2 Da, found: 1037.4 Da; O-
GlcNAc Thr184 IXI peptide- calculated: 1241.2 Da, found: 1240.6 Da). Experiments were
performed on a Microcal-PEAQ-ITC system (Malvern) using Microcal-ITC Control Software
v1.0. Lyophilized ACD was resuspended in ITC buffer (50 mM NaH
2
PO
4
, 100 mM NaCl, pH 7.4)
and was placed in the cell at a concentration of 50 µM. Lyophilized IXI peptides were also
resuspended in ITC buffer, adjusted to 1 mM (for unmodified) or 2 mM (for O-GlcNAc Thr184)
and loaded onto the titration syringe. Cells were kept at 25 °C and 19 titration injections were
applied with 120 sec intervals in between. Only control experiments where peptides were titrated
to buffer showed substantial endothermic heats of dilution, hence these control experiments were
used to correct peptide-ACD titrations point-by-point. Raw heats were fit using 1:1 binding models
to determine affinity of ACD-IXI binding. Experiments were repeated twice.

ROSETTA modeling
The PDB structure of HSP27 monomer was generated using the computational
methodology using the Robetta web server (https://robetta.bakerlab.org) as previously reported
(Ovchinnikov et al., 2017). Threonine O-GlcNAc was parameterized in Rosetta identically to our
previous publication

(De Leon et al., 2017). Rosetta monte carlo structure prediction and
optimization was then performed on the C-terminal residues 171-206 with a O-GlcNAc threonine
at position 184. The lowest energy structure using the betanov16 score function are reported.

227
Size exclusion chromatography and multiple angle light scattering (SEC-MALS)
Refolded unmodified or gT184 HSP27 proteins (150 μg each) were buffer exchanged to
SEC buffer (PBS, pH 7.4) and concentrated to 1.5 mg/mL. Size exclusion was carried out on an
Agilent 1200 system equipped with a Shodex 804 column with SEC buffer running at a flow rate
of 0.5 mL/min. Molecular weight determination was performed by MALS using a coupled DAWN
HELEOS light scattering and rEX refractive index detector (Wyatt Technology Corporation). Data
fitting was performed with the Astra v6.1.7.17 software using a pre-set dn/dc of 0.1850 mL/g.

Chemoenzymatic pulldown on human brain samples
Brain samples (stored and frozen at -80 °C until use) were obtained from the NIH
Neurobiobank without any identifiable information and in compliance with their ethical
guidelines. These samples were thawed slowly on ice. Wet tissue mass of each sample was
measured, after which 1 mL of UTS buffer (8M urea, 2M thiourea, 1% SDS) was added per 100
mg of tissue. The samples were then homogenized with 10 pumps of the loose pestle and 10 pumps
of the tight pestle of a Dounce homogenizer. The homogenate was clarified by centrifugation and
proteins from clarified lysate were precipitated using methanol-chloroform precipitation. Briefly,
3X volume of methanol, 0.75X volume of chloroform and 2X volume of water were added to the
clarified lysate followed by vortex mixing and centrifugation. After removal of the aqueous layer,
2.25X volume of methanol were added followed by vortex mixing to wash the pellet. After
centrifugation and removal of the supernatant, protein pellets were air dried and stored for
succeeding experiments. Typical yield from brain samples was 16 mg protein precipitate per 100
mg wet tissue mass (by BCA assay).

228
Precipitated proteins were resuspended in 1% SDS chemoenzymatic transfer buffer
(1%SDS, 20 mM HEPES, pH 7.9) and concentrations were determined using BCA assay. For each
pulldown, 3 mg of total protein was used during the chemoenzymatic labeling. Protein
concentrations were adjusted to 2.5 mg/mL using 1% SDS chemoenzymatic transfer buffer
followed by the addition of the following reagents in this order: 1170 µL of H
2
O, 2400 µL of
labeling buffer (2.5X: 5%NP-40, 125 mM NaCl, 50 mM HEPES, pH 7.9), 330 µL of 100 mM
MnCl
2
, 450 µL of UDP-GalNAz (0.5 mM in 10 mM HEPES, pH 7.9). Reactions were mixed by
vortexing, after which 7.5 µL of GalT(Y289L) expressed in mammalian cells were added and
pipetted up and down to mix gently. Reaction mixtures were incubated for 20 h at 4 °C without
agitation. Reactive cysteines were then capped by the addition of 185 µL of 600 mM
iodoacetamide in H
2
O and incubation in the dark, at room temperature for 30 min. Proteins were
isolated from unreacted reagents by methanol-chloroform precipitation.

Air-dried proteins were resuspended in 4% SDS TEA buffer (4% SDS, 600 mM NaCl, 200
mM triethanolamine, pH 7.4) and inputs were generated by taking an aliquot corresponding to 50
µg of protein and adding the same volume of 2X loading buffer (20% glycerol, 0.2% bromophenol
blue, 1.4% β-mercaptoethanol) to a final protein concentration of 2 mg/mL. The rest of the proteins
were diluted with water to 1 mg/mL protein at 1% SDS concentration before addition of freshly
made CuAAC master mix so that the final reactions contained 100 µM alkyne-azo-biotin, 1 mM
TCEP, 100 µM TBTA, and 1 mM CuSO
4
:5H
2
O. After 1 h incubation in the dark, reactions were
quenched by the addition of EDTA (5 mM final concentration) followed by methanol-chloroform
precipitation and air-drying.

229
For the pulldown of labeled, O-GlcNAc-modified proteins, pellets were dissolved in 4%
SDS TEA buffer and resuspended completely using a bath sonicator. The SDS and protein
concentrations were adjusted to 0.2% and 0.5 mg/mL respectively, prior to the addition of 50 µL
of pre-washed Neutravidin beads (ThermoFisher Scientific) in 0.2% SDS TEA buffer. After
incubation with full rotation for 1.5 h, beads were collected and washed with 30 mL of wash buffer
(1% SDS in PBS, pH 7.4). Beads were then transferred to dolphin-nosed tubes and incubated with
150 µL of elution buffer (25 mM sodium dithionite, 1% SDS in PBS, pH 7.4) for 30 min. Elutions
were collected by gentle centrifugation (2000g for 3 min) and transfer of the supernatant into a
fresh tube. Incubation with elution buffer was repeated one more time. Pooled elutions were
precipitated by the addition of 4X volume of cold methanol and incubation at -20 °C overnight.
Enriched proteins were collected by centrifugation. After removal of the supernatant and air-
drying, enriched protein pellets were resuspended in 150 µL of 4% SDS TEA buffer and 150 µL
of 2X loading buffer.

SDS-PAGE and immunoblotting
Input and pulldown gel samples were bath sonicated, boiled for 10 min, and separated by
SDS-PAGE on precast 4-20% polyacrylamide gels (BioRad). Proteins were then transferred on
PVDF membranes using a semi-dry transfer apparatus. For dot-blotting, each spot was added with
5 ug of brain lysate protein on a nitrocellulose membrane and allowed to air-dry for 1.5 hours
before blocking. Membranes were blocked for 1 h at room temperature using OneBlock Western-
FL Blocking Buffer (Genesee Scientific) after which the membranes were incubated with primary
antibodies (Anti-O-GlcNAc RL2 1:3,000, Thermo MA1-072; Anti-Hsp27 1:3,000, Cell Signaling
Technology #95357; Anti-αBC 1:3,000, Cell Signaling Technology #45584) in blocking buffer at

230
4 °C for 16 h. Membranes were washed with TBST (137 mM NaCl, 20 mM Tris, 0.1% Tween-20,
pH 7.6, Cell Signaling Technology) 3 times for 10 min each, followed by incubation with HRP-
conjugated anti-rabbit or anti-mouse secondary antibodies (1:10,000, Jackson ImmunoResearch
711-035-152 or 715-035-150) in blocking buffer. After 3x10 min washing in TBST, membranes
were developed with Western ECL Substrates (Biorad) and imaged using a ChemiDoc XRS+
Imager (Bio-Rad).

Quantification and comparison of relative amounts of O-GlcNAcylated HSP27 or αBC
During the imaging of the chemoenzymatic pulldown experiments, the input and pulldown
from the same brain sample were imaged simultaneously and quantified using BioRad Image Lab
v4.1 software. This allowed us to calculate a normalized IP signal from each experiment by
dividing the densitometric signal of the pulldown band to that of the input band for each brain
sample.

𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑 𝐼𝑃 =
𝐵𝑖𝑜𝑡𝑖𝑛 𝐼𝑃 𝑠𝑖𝑔𝑛𝑎𝑙
𝐼𝑛𝑝𝑢𝑡 𝑠𝑖𝑔𝑛𝑎𝑙

In order to compare the Normalized IP of each brain sample to each other, we calculated
the average of all the Normalized IP values from the 8 control brain samples and use this as a
reference value. We then divided the Normalized IP value from each brain sample by this average
to obtain the Relative IP values represented by each dot on the graphs in Figures 4-11b and 4-11c.

𝑅𝑒𝑙𝑎𝑡𝑖𝑣𝑒 𝐼𝑃 =
𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑 𝐼𝑃
𝐴𝑣𝑒𝑟𝑎𝑔𝑒 𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑 𝐼𝑃 𝑓𝑜𝑟 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 𝑏𝑟𝑎𝑖𝑛 𝑠𝑎𝑚𝑝𝑙𝑒𝑠

231

Citrate synthase aggregation assays.
The assay was performed according to the literature method with minor modifications

(Mymrikov et al., 2017).

Citrate Synthase (CS) from porcine heart was purchased from Sigma-
Aldrich (Taufkirchen, Germany) as an ammonium sulfate suspension then centrifuged to remove
most of the ammonium sulfate salts and dialyzed against the storage buffer (50 mM Tris·HCl, 2
mM EDTA, pH 8), final concentration 20-30 μM. The accurate concentration was then determined
using bicinchoninic acid (BCA) assay (MW of CS = 48,969 Da) and this stock solution was flash
frozen into liquid nitrogen in small aliquots (200-500 μL) and stored at -80 °C. Amorphous
aggregation of CS was monitored via measuring the absorbance at 400 nm in a SAFAS UVmc2
double-beam UV-Vis spectrophotometer equipped with a temperature controlled multi-cell holder
(SAFAS, Monaco) in 700 μL quartz cuvettes (Hellma Analytics, Germany), 600 μl final volume
in triplicate. CS stock solution (obtained as above) was diluted with 40 mM HEPES·KOH (pH 7.5)
to a final concentration of 2 μM, and the resulting solution was used as such (control) or treated
with Hsp27 variants (0.45 μM final concentration) followed by incubation at 45 °C while
measuring the absorbance at 400 nm over 45 min (600 μl final volume in triplicate). Prior to the
addition, all Hsp27 variants (lyophilized powders) were freshly dissolved into 40 mM
HEPES·KOH (pH 7.5) buffer, the accurate concentrations of these primary stocks and that of CS
were determined via BCA assay and another stock of all Hsp27 samples of concentration 1 mg/mL
was prepared to refold them for 3 h at 25 °C. A baseline correction employing only the assay buffer
(40 mM HEPES·KOH, pH 7.5) was also performed. The raw data were exported from Safas
Monaco SP200 v7.8.3.0 software as Microsoft Excel worksheet and processed using Microsoft
Excel and OriginPro. The results were expressed as average relative UV absorbance at 400 nm,

232
where relative absorption at 400 nm = (absorption at 400nm)/(maximal absorption at 400 nm by
aggregating CS in the absence of a chaperone).

GAPDH aggregation assay
The assay was performed according to the literature method with minor modifications
(Mymrikov et al., 2017). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) from rabbit
muscle was purchased from Sigma-Aldrich (Taufkirchen, Germany) as lyophilized powder and
dissolved into the storage buffer (100 mM sodium phosphate, pH 7.5), final concentration 20-30
μM. The accurate concentration was then determined using bicinchoninic acid (BCA) assay (MW
of GAPDH = 35.8 kDa) and this stock solution was flash frozen into liquid nitrogen in small
aliquots (200-500 μL) and stored at -80 °C. Amorphous aggregation of GAPDH was monitored
via measuring the absorbance at 360 nm in a SAFAS UVmc2 double-beam UV-Vis
spectrophotometer equipped with a temperature controlled multi-cell holder (SAFAS, Monaco) in
700 μL quartz cuvettes (Hellma Analytics, Germany), 600 μl final volume in triplicate. GAPDH
stock solution (obtained as above) was diluted with 100 mM sodium phosphate, pH 7.5 buffer to
a final concentration of 3 μM, and the resulting solution was used as such (control) or treated with
Hsp27 variants (0.60 μM final concentration) followed by incubation at 45 °C while measuring
the absorbance at 360 nm over 60 minutes (600 μl final volume in triplicate). Prior to the addition,
all Hsp27 variants (lyophilized powders) were freshly dissolved into 40 mM HEPES·KOH (pH
7.5) buffer, the accurate concentrations of these primary stocks and that of GAPDH were
determined via BCA assay and another stock of all Hsp27 samples of concentration 1 mg/mL was
prepared to refold them for 3 h at 25 °C. A baseline correction employing only the assay buffer
(100 mM sodium phosphate, pH 7.5) was also performed. The raw data were exported from

233
SAFAS software as Microsoft Excel worksheet and processed using Microsoft Excel and
OriginPro. The results were expressed as average relative UV absorbance at 360 nm, where relative
absorption at 360 nm = (absorption at 360nm)/(maximal absorption at 360 nm by aggregating
GAPDH in the absence of a chaperone).

MDH aggregation assay
The assay was performed according to the literature method with minor modifications
(Mymrikov et al., 2017). Malate dehydrogenase (MDH) from porcine heart was purchased from
Sigma-Aldrich (Taufkirchen, Germany) as lyophilized powder and dissolved into the storage
buffer (100 mM sodium phosphate, pH 7.5), final concentration 20-30 μM. The accurate
concentration was then determined using bicinchoninic acid (BCA) assay (MW of MDH = 36.4
kDa) and this stock solution was flash frozen into liquid nitrogen in small aliquots (200-500 μL)
and stored at -80 °C. Amorphous aggregation of MDH was monitored via measuring the
absorbance at 360 nm in a SAFAS UVmc2 double-beam UV-Vis spectrophotometer equipped
with a temperature controlled multi-cell holder (SAFAS, Monaco) in 700 μL quartz cuvettes
(Hellma Analytics, Germany), 600 μl final volume in triplicate. MDH stock solution (obtained as
above) was diluted with 100 mM sodium phosphate, pH 7.5 buffer to a final concentration of 2
μM, and the resulting solution was used as such (control) or treated with Hsp27 variants (0.25 μM
final concentration) followed by incubation at 45 °C while measuring the absorbance at 360 nm
over 60 minutes (600 μl final volume in triplicate). Prior to the addition, all Hsp27 variants
(lyophilized powders) were freshly dissolved into 40 mM HEPES·KOH (pH 7.5) buffer, the
accurate concentrations of these primary stocks and that of MDH were determined via BCA assay
and another stock of all Hsp27 samples of concentration 1 mg/mL was prepared to refold them for

234
3 h at 25 °C. A baseline correction employing only the assay buffer (100 mM sodium phosphate,
pH 7.5) was also performed. The raw data were exported from SAFAS software as Microsoft Excel
worksheet and processed using Microsoft Excel and OriginPro. The results were expressed as
average relative UV absorbance at 360 nm, where relative absorption at 360 nm = (absorption at
360nm)/(maximal absorption at 360 nm by aggregating MDH in the absence of a chaperone).

235
4.10 Chapter references

Aguilar, A. L., Hou, X., Wen, L., Wang, P. G., & Wu, P. (2017). A Chemoenzymatic Histology
Method for O-GlcNAc Detection. ChemBioChem, 18(24), 2416–2421.
https://doi.org/https://doi.org/10.1002/cbic.201700515

Alderson, T. R., Roche, J., Gastall, H. Y., Dias, D. M., Priti, I., Ying, J., Bax, A., Benesch, J. L.
P., & Baldwin, A. J. (2019). Local unfolding of the HSP27 monomer regulates chaperone activity.
Nature Communications, 2019, 1–16. https://doi.org/10.1038/s41467-019-08557-8

Baldwin, A. J., Hilton, G. R., Lioe, H., Bagnéris, C., Benesch, J. L. P., & Kay, L. E. (2011).
Quaternary dynamics of αb-crystallin as a direct consequence of localised tertiary fluctuations in
the C-terminus. Journal of Molecular Biology, 413(2), 310–320.
https://doi.org/10.1016/j.jmb.2011.07.017

Baldwin, A. J., Walsh, P., Hansen, D. F., Hilton, G. R., Benesch, J. L. P., Sharpe, S., & Kay, L. E.
(2012). Probing dynamic conformations of the high-molecular-weight αb-crystallin heat shock
protein ensemble by NMR spectroscopy. Journal of the American Chemical Society, 134(37),
15343–15350. https://doi.org/10.1021/ja307874r

Blanco-Canosa, J. B., & Dawson, P. E. (2008). An efficient Fmoc-SPPS approach for the
generation of thioester peptide precursors for use in native chemical ligation. Angewandte Chemie
- International Edition, 47(36), 6851–6855. https://doi.org/10.1002/anie.200705471

236
Clark, A. R., Vree Egberts, W., Kondrat, F. D. L., Hilton, G. R., Ray, N. J., Cole, A. R., Carver, J.
A., Benesch, J. L. P., Keep, N. H., Boelens, W. C., & Slingsby, C. (2018). Terminal Regions
Confer Plasticity to the Tetrameric Assembly of Human HspB2 and HspB3. Journal of Molecular
Biology, 430(18), 3297–3310. https://doi.org/10.1016/j.jmb.2018.06.047

Clark, P. M., Dweck, J. F., Mason, D. E., Hart, C. R., Buck, S. B., Peters, E. C., Agnew, B. J., &
Hsieh-wilson, L. C. (2008). Direct In-Gel Fluorescence Detection and Cellular Imaging of O -
GlcNAc-Modified Proteins. 11576–11577.

Cox, D., Selig, E., Griffin, M. D. W., Carver, J. A., & Ecroyd, H. (2016). Small Heat-shock
Proteins Prevent α-synuclein aggregation via transient interactions and their efficacy is affected
by the rate of aggregation. Journal of Biological Chemistry, 291(43), 22618–22629.
https://doi.org/10.1074/jbc.M116.739250

Cox, D., Whiten, D. R., Brown, J. W. P., Horrocks, M. H., Gil, R. S., Dobson, C. M., Klenerman,
D., Van Oijen, A. M., & Ecroyd, H. (2018). The small heat shock protein Hsp27 binds -synuclein
fibrils, preventing elongation and cytotoxicity. Journal of Biological Chemistry, 293(12), 4486–
4497. https://doi.org/10.1074/jbc.M117.813865

De Leon, C. A., Lang, G., Saavedra, M. I., & Pratt, M. R. (2018). Simple and Efficient Preparation
of O- and S-GlcNAcylated Amino Acids through InBr3-Catalyzed Synthesis of β-N-
Acetylglycosides from Commercially Available Reagents. Organic Letters, 20(16), 5032–5035.
https://doi.org/10.1021/acs.orglett.8b02182

237
De Leon, C. A., Levine, P. M., Craven, T. W., & Pratt, M. R. (2017). The Sulfur-Linked Analogue
of O-GlcNAc (S-GlcNAc) Is an Enzymatically Stable and Reasonable Structural Surrogate for O-
GlcNAc at the Peptide and Protein Levels. Biochemistry, 56(27), 3507–3517.
https://doi.org/10.1021/acs.biochem.7b00268

Delbecq, S. P., Jehle, S., & Klevit, R. (2012). Binding determinants of the small heat shock protein,
αb-crystallin: Recognition of the ′IxI′ motif. EMBO Journal, 31(24), 4587–4594.
https://doi.org/10.1038/emboj.2012.318

Deracinois, B., Camoin, L., Lambert, M., Boyer, J.-B., Dupont, E., Bastide, B., & Cieniewski-
Bernard, C. (2018). O-GlcNAcylation site mapping by (azide-alkyne) click chemistry and mass
spectrometry following intensive fractionation of skeletal muscle cells proteins. Journal of
Proteomics, 186, 83–97. https://doi.org/https://doi.org/10.1016/j.jprot.2018.07.005

Freilich, R., Betegon, M., Tse, E., Mok, S. A., Julien, O., Agard, D. A., Southworth, D. R.,
Takeuchi, K., & Gestwicki, J. E. (2018). Competing protein-protein interactions regulate binding
of Hsp27 to its client protein tau. Nature Communications, 9(1), 4563.
https://doi.org/10.1038/s41467-018-07012-4

Guo, K., Gan, L., Zhang, S., Cui, F. J., Cun, W., Li, Y., Kang, N. X., Gao, M. D., & Liu, K. Y.
(2012). Translocation of HSP27 into liver cancer cell nucleus may be associated with
phosphorylation and O-GlcNAc glycosylation. Oncology Reports, 28(2), 494–500.
https://doi.org/10.3892/or.2012.1844

238
Hartl, F. U., Bracher, A., & Hayer-Hartl, M. (2011). Molecular chaperones in protein folding and
proteostasis. Nature, 475(7356), 324–332. https://doi.org/10.1038/nature10317

Haslbeck, M., Weinkauf, S., & Buchner, J. (2019). Small heat shock proteins: Simplicity meets
complexity. Journal of Biological Chemistry, 294(6), 2121–2132.
https://doi.org/10.1074/jbc.REV118.002809

Hilton, G. R., Hochberg, G. K. A., Laganowsky, A., Mcginnigle, S. I., Baldwin, A. J., & Benesch,
J. L. P. (2013). C-terminal interactions mediate the quaternary dynamics of αB-crystallin (R. S.
Lond. & B. B, trans.). Philosophical Transactions of the Royal Society B: Biological Sciences,
368(1617), 1–13. https://doi.org/10.1098/rstb.2011.0405

Hochberg, G. K. A., Ecroyd, H., Liu, C., Cox, D., Cascio, D., Sawaya, M. R., Collier, M. P.,
Stroud, J., Carver, J. A., Baldwin, A. J., Robinson, C. V., Eisenberg, D. S., Benesch, J. L. P., &
Laganowsky, A. (2014). The structured core domain of B-crystallin can prevent amyloid
fibrillation and associated toxicity. Proceedings of the National Academy of Sciences, 111(16),
E1562–E1570. https://doi.org/10.1073/pnas.1322673111

Jehle, S., Rajagopal, P., Bardiaux, B., Markovic, S., Kühne, R., Stout, J. R., Higman, V. A., Klevit,
R. E., Van Rossum, B. J., & Oschkinat, H. (2010). Solid-state NMR and SAXS studies provide a
structural basis for the activation of αb-crystallin oligomers. Nature Structural and Molecular
Biology, 17(9), 1037–1042. https://doi.org/10.1038/nsmb.1891

239
Kappé, G., Franck, E., Verschuure, P., Boelens, W. C., Leunissen, J. A. M., & De Jong, W. W.
(2003). The human genome encodes 10 α-crystallin-related small heat shock proteins: HspB1-10.
Cell Stress and Chaperones, 8(1), 53–61. https://doi.org/10.1379/1466-
1268(2003)8<53:THGECS>2.0.CO;2

Kriehuber, T., Rattei, T., Weinmaier, T., Bepperling, A., Haslbeck, M., & Buchner, J. (2010).
Independent evolution of the core domain and its flanking sequences in small heat shock proteins.
FASEB Journal, 24(10), 3633–3642. https://doi.org/10.1096/fj.10-156992

Kudva, Y. C., Hiddinga, H. J., Butler, P. C., Mueske, C. S., & Eberhardt, N. L. (1997). Small heat
shock proteins inhibit in vitro Aβ1-42 amyloidogenesis. FEBS Letters, 416(1), 117–121.
https://doi.org/10.1016/S0014-5793(97)01180-0

Levine, P. M., Galesic, A., Balana, A. T., Mahul-Mellier, A.-L., Navarro, M. X., De Leon, C. A.,
Lashuel, H. A., & Pratt, M. R. (2019). α-Synuclein O-GlcNAcylation alters aggregation and
toxicity, revealing certain residues as potential inhibitors of Parkinson’s disease. Proceedings of
the National Academy of Sciences, 116(5), 1511–1519. https://doi.org/10.1073/pnas.1808845116

Lewis, Y. E., Galesic, A., Levine, P. M., De Leon, C. A., Lamiri, N., Brennan, C. K., & Pratt, M.
R. (2017). O-GlcNAcylation of α-Synuclein at Serine 87 Reduces Aggregation without Affecting
Membrane Binding. ACS Chemical Biology, 12(4), 1020–1027.
https://doi.org/10.1021/acschembio.7b00113

240
Li, J., Li, Z., Duan, X., Qin, K., Dang, L., Sun, S., Cai, L., Hsieh-Wilson, L. C., Wu, L., & Yi, W.
(2019). An Isotope-Coded Photocleavable Probe for Quantitative Profiling of Protein O-
GlcNAcylation. ACS Chemical Biology, 14(1), 4–10.
https://doi.org/10.1021/acschembio.8b01052

Liu, F., Iqbal, K., Grundke-Iqbal, I., Hart, G. W., & Gong, C.-X. (2004). O-GlcNAcylation
regulates phosphorylation of tau: A mechanism involved in Alzheimer’s disease. Proceedings of
the National Academy of Sciences, 101(29), 10804–10809.
https://doi.org/10.1073/pnas.0400348101

Liu, Fei, Shi, J., Tanimukai, H., Gu, J., Gu, J., Grundke-Iqbal, I., Iqbal, K., & Gong, C. X. (2009).
Reduced O-GlcNAcylation links lower brain glucose metabolism and tau pathology in
Alzheimer’s disease. Brain, 132(7), 1820–1832. https://doi.org/10.1093/brain/awp099

Luk, K. C., Covell, D. J., Kehm, V. M., Zhang, B., Song, I. Y., Byrne, M. D., Pitkin, R. M., Decker,
S. C., Trojanowski, J. Q., & Lee, V. M. Y. (2016). Molecular and Biological Compatibility with
Host Alpha-Synuclein Influences Fibril Pathogenicity. Cell Reports, 16(12), 3373–3387.
https://doi.org/10.1016/j.celrep.2016.08.053

Mainz, A., Peschek, J., Stavropoulou, M., Back, K. C., Bardiaux, B., Asami, S., Prade, E., Peters,
C., Weinkauf, S., Buchner, J., & Reif, B. (2015). The chaperone αb-crystallin uses different
interfaces to capture an amorphous and an amyloid client. Nature Structural and Molecular
Biology, 22(11), 898–905. https://doi.org/10.1038/nsmb.3108

241
Marotta, N. P., Lin, Y. H., Lewis, Y. E., Ambroso, M. R., Zaro, B. W., Roth, M. T., Arnold, D.
B., Langen, R., & Pratt, M. R. (2015). O-GlcNAc modification blocks the aggregation and toxicity
of the protein α-synuclein associated with Parkinson’s disease. Nature Chemistry, 7(11), 913–920.
https://doi.org/10.1038/nchem.2361

Matveenko, M., Cichero, E., Fossa, P., & Becker, C. F. W. (2016). Impaired Chaperone Activity
of Human Heat Shock Protein Hsp27 Site-Specifically Modified with Argpyrimidine. Angewandte
Chemie - International Edition, 55(38), 11397–11402. https://doi.org/10.1002/anie.201605366

McDonald, E. T., Bortolus, M., Koteiche, H. A., & McHaourab, H. S. (2012). Sequence, structure,
and dynamic determinants of Hsp27 (HspB1) equilibrium dissociation are encoded by the N-
terminal domain. Biochemistry, 51(6), 1257–1268. https://doi.org/10.1021/bi2017624

Metanis, N., Keinan, E., & Dawson, P. E. (2010). Traceless Ligation of Cysteine Peptides Using
Selective Deselenization. Angewandte Chemie International Edition, 49(39), 7049–7053.
https://doi.org/https://doi.org/10.1002/anie.201001900

Muir, T. W., Sondhi, D., & Cole, P. A. (1998). Expressed protein ligation: A general method for
protein engineering. Proceedings of the National Academy of Sciences, 95(12), 6705–6710.
https://doi.org/10.1073/pnas.95.12.6705

242
Mymrikov, E. V, Daake, M., Richter, B., Haslbeck, M., & Buchner, J. (2017). The Chaperone
Activity and Substrate Spectrum of Human Small Heat Shock Proteins*. Journal of Biological
Chemistry, 292(2), 672–684. https://doi.org/https://doi.org/10.1074/jbc.M116.760413

Nappi, L., Aguda, A. H., Nakouzi, N. A., Lelj-Garolla, B., Beraldi, E., Lallous, N., Thi, M., Moore,
S., Fazli, L., Battsogt, D., Stief, S., Ban, F., Nguyen, N. T., Saxena, N., Dueva, E., Zhang, F.,
Yamazaki, T., Zoubeidi, A., Cherkasov, A., … Gleave, M. (2020). Ivermectin inhibits HSP27 and
potentiates efficacy of oncogene targeting in tumor models. J Clin Invest, 130, 699–714.

Ovchinnikov, S., Park, H., Varghese, N., Huang, P. S., Pavlopoulos, G. A., Kim, D. E., Kamisetty,
H., Kyrpides, N. C., & Baker, D. (2017). Protein structure determination using metagenome
sequence data. Science, 355(6322), 294–298. https://doi.org/10.1126/science.aah4043

Pasta, S. Y., Raman, B., Ramakrishna, T., & Rao, C. M. (2004). The IXI/V motif in the C-terminal
extension of α-crystallins: Alternative interactions and oligomeric assemblies. Molecular Vision,
10, 655–662.

Pinho, T. S., Correia, S. C., Perry, G., Ambrósio, A. F., & Moreira, P. I. (2019). Diminished O-
GlcNAcylation in Alzheimer’s disease is strongly correlated with mitochondrial anomalies.
Biochimica et Biophysica Acta - Molecular Basis of Disease, 1865(8), 2048–2059.
https://doi.org/10.1016/j.bbadis.2018.10.037

243
Raman, B., Ban, T., Sakai, M., Pasta, S. Y., Ramakrishna, T., Naiki, H., Goto, Y., & Rao, C. M.
(2005). AlphaB-crystallin, a small heat-shock protein, prevents the amyloid fibril growth of an
amyloid beta-peptide and beta2-microglobulin. Biochem J, 392, 573–581.

Rambaruth, N. D., Greenwell, P., & Dwek, M. V. (2012). The lectin Helix pomatia agglutinin
recognizes O-GlcNAc containing glycoproteins in human breast cancer. Glycobiology, 22(6),
839–848. https://doi.org/10.1093/glycob/cws051

Rauch, J. N., Tse, E., Freilich, R., Mok, S. A., Makley, L. N., Southworth, D. R., & Gestwicki, J.
E. (2017). BAG3 Is a Modular, Scaffolding Protein that physically Links Heat Shock Protein 70
(Hsp70) to the Small Heat Shock Proteins. Journal of Molecular Biology, 429(1), 128–141.
https://doi.org/10.1016/j.jmb.2016.11.013

Rekas, A., Adda, C., Aquilina, J., Barnham, K., Sunde, M., Galatis, D., Williamson, N., Masters,
C., Anders, R., Robinson, C., Cappai, R., & Carver, J. (2004). Interaction of the molecular
chaperone alphaB-crystallin with alpha-synuclein: effects on amyloid fibril formation and
chaperone activity. J Mol Biol, 340, 1167–1183.

Roquemore, E. P., Dell, A., Panico, M., Reason, A. J., Savoy, L. A., Wistow, G. J., Zigler Jr, J. S.,
Earles, B. J., & Hart, G. W. (1992). Vertebrate lens alpha-crystallins are modified by O-linked N-
acetylglucosamine. Journal of Biological Chemistry, 267(1), 555–563.

244
Selig, E. E., Zlatic, C. O., Cox, D., Mok, Y. F., Gooley, P. R., Ecroyd, H., & Griffin, M. D. W.
(2020). N- And C-terminal regions of aB-crystallin and Hsp27 mediate inhibition of amyloid
nucleation, fibril binding, and fibril disaggregation. Journal of Biological Chemistry, 295(29),
9838–9854. https://doi.org/10.1074/jbc.ra120.012748

Shah, N. H., Dann, G. P., Vila-Perelló, M., Liu, Z., & Muir, T. W. (2012). Ultrafast protein splicing
is common among cyanobacterial split inteins: Implications for protein engineering. Journal of the
American Chemical Society, 134(28), 11338–11341. https://doi.org/10.1021/ja303226x

Shang, S., Tan, Z., Dong, S., & Danishefsky, S. J. (2011). An advance in proline ligation. Journal
of the American Chemical Society, 133(28), 10784–10786. https://doi.org/10.1021/ja204277b

Simons, K. T., Bonneau, R., Ruczinski, I., & Baker, D. (1999). Ab initio protein structure
prediction of CASP III targets using ROSETTA. Proteins: Structure, Function and Genetics,
37(SUPPL. 3), 171–176. https://doi.org/10.1002/(SICI)1097-0134(1999)37:3+<171::AID-
PROT21>3.0.CO;2-Z

Wang, A. C., Jensen, E. H., Rexach, J. E., Vinters, H. V., & Hsieh-Wilson, L. C. (2016). Loss of
O-GlcNAc glycosylation in forebrain excitatory neurons induces neurodegeneration. Proceedings
of the National Academy of Sciences, 113(52), 15120–15125.
https://doi.org/10.1073/pnas.1606899113

245
Wang, S., Yang, F., Petyuk, V. A., Shukla, A. K., Monroe, M. E., Gritsenko, M. A., Rodland, K.
D., Smith, R. D., Qian, W. J., Gong, C. X., & Liu, T. (2017). Quantitative proteomics identifies
altered O-GlcNAcylation of structural, synaptic and memory-associated proteins in Alzheimer’s
disease. Journal of Pathology, 243(1), 78–88. https://doi.org/10.1002/path.4929

Wani, W. Y., Chatham, J. C., Darley-Usmar, V., McMahon, L. L., & Zhang, J. (n.d.). O-
GlcNAcylation and neurodegeneration. Brain Res. Bull, 133, 80–87.

Yang, X., & Qian, K. (2017). Protein O-GlcNAcylation: Emerging mechanisms and functions.
Nature Reviews Molecular Cell Biology, 18(7), 452–465. https://doi.org/10.1038/nrm.2017.22

Yuzwa, S. A., Cheung, A. H., Okon, M., McIntosh, L. P., & Vocadlo, D. J. (2014). O-GlcNAc
Modification of tau Directly Inhibits Its Aggregation without Perturbing the Conformational
Properties of tau Monomers. Journal of Molecular Biology, 426(8), 1736–1752.
https://doi.org/10.1016/j.jmb.2014.01.004

Yuzwa, S. A., Shan, X., Macauley, M. S., Clark, T., Skorobogatko, Y., Vosseller, K., & Vocadlo,
D. J. (2012). Increasing O-GlcNAc slows neurodegenerationand stabilizes tau against aggregation.
Nature Chemical Biology, 8(4), 393–399. https://doi.org/10.1038/nchembio.797

246
References

Abolhassani, N., Leon, J., Sheng, Z., Oka, S., Hamasaki, H., Iwaki, T., & Nakabeppu, Y. (2017).
Molecular pathophysiology of impaired glucose metabolism, mitochondrial dysfunction, and
oxidative DNA damage in Alzheimer’s disease brain. Mechanisms of Ageing and Development,
161, 95–104. https://doi.org/10.1016/j.mad.2016.05.005

Agouridas, V., El Mahdi, O., Diemer, V., Cargoët, M., Monbaliu, J. C. M., & Melnyk, O. (2019).
Native Chemical Ligation and Extended Methods: Mechanisms, Catalysis, Scope, and Limitations.
Chemical Reviews, 119(12). https://doi.org/10.1021/acs.chemrev.8b00712

Aguilar, A. L., Hou, X., Wen, L., Wang, P. G., & Wu, P. (2017). A Chemoenzymatic Histology
Method for O-GlcNAc Detection. ChemBioChem, 18(24), 2416–2421.
https://doi.org/https://doi.org/10.1002/cbic.201700515

Akimoto, Y., Comer, F. I., Cole, R. N., Kudo, A., Kawakami, H., Hirano, H., & Hart, G. W. (2003).
Localization of the O-GlcNAc transferase and O-GlcNAc-modified proteins in rat cerebellar
cortex. Brain Research, 966(2), 194–205. https://doi.org/10.1016/S0006-8993(02)04158-6

Alderson, T. R., Roche, J., Gastall, H. Y., Dias, D. M., Priti, I., Ying, J., Bax, A., Benesch, J. L.
P., & Baldwin, A. J. (2019). Local unfolding of the HSP27 monomer regulates chaperone activity.
Nature Communications, 2019, 1–16. https://doi.org/10.1038/s41467-019-08557-8

247
Alexander, G. E. (2004). Biology of Parkinson’s disease: pathogenesis and pathophysiology of a
multisystem neurodegenerative disorder. Dialogues in Clinical Neuroscience, 6(3), 259–280.
https://doi.org/10.31887/DCNS.2004.6.3/galexander

Alfaro, J. F., Gong, C. X., Monroe, M. E., Aldrich, J. T., Clauss, T. R. W., Purvine, S. O., Wang,
Z., Camp, D. G., Shabanowitz, J., Stanley, P., Hart, G. W., Hunt, D. F., Yang, F., & Smith, R. D.
(2012). Tandem mass spectrometry identifies many mouse brain O-GlcNAcylated proteins
including EGF domain-specific O-GlcNAc transferase targets. Proceedings of the National
Academy of Sciences of the United States of America, 109(19), 7280–7285.
https://doi.org/10.1073/pnas.1200425109

Alonso, A. D. C., Zaidi, T., Novak, M., Grundke-Iqbal, I., & Iqbal, K. (2001).
Hyperphosphorylation induces self-assembly of τ into tangles of paired helical filaments/straight
filaments. Proceedings of the National Academy of Sciences of the United States of America,
98(12), 6923–6928. https://doi.org/10.1073/pnas.121119298

Alteen, M. G., Tan, H. Y., & Vocadlo, D. J. (2021). Monitoring and modulating O-GlcNAcylation:
assays and inhibitors of O-GlcNAc processing enzymes. Current Opinion in Structural Biology,
68, 157–165. https://doi.org/10.1016/j.sbi.2020.12.008

248
Amso, Z., Bisset, S. W., Yang, S.-H. H., Harris, P. W. R. R., Wright, T. H., Navo, C. D., Patchett,
M. L., Norris, G. E., & Brimble, M. A. (2018). Total chemical synthesis of glycocin F and
analogues: S-glycosylation confers improved antimicrobial activity. Chemical Science, 9(6),
1686–1691. https://doi.org/10.1039/c7sc04383j

Anderson, J. P., Walker, D. E., Goldstein, J. M., de Laat, R., Banducci, K., Caccavello, R. J.,
Barbour, R., Huang, J., Kling, K., Lee, M., Diep, L., Keim, P. S., Shen, X., Chataway, T.,
Schlossmacher, M. G., Seubert, P., Schenk, D., Sinha, S., Gai, W. P., & Chilcote, T. J. (2006).
Phosphorylation of Ser-129 Is the Dominant Pathological Modification of α-Synuclein in Familial
and Sporadic Lewy Body Disease*. Journal of Biological Chemistry, 281(40), 29739–29752.
https://doi.org/https://doi.org/10.1074/jbc.M600933200

Arias, E. B., Kim, J., & Cartee, G. D. (2004). Prolonged Incubation in PUGNAc Results in
Increased Protein O-Linked Glycosylation and Insulin Resistance in Rat Skeletal Muscle.
Diabetes, 53(4), 921 LP – 930. https://doi.org/10.2337/diabetes.53.4.921

Arnold, C. S., Johnson, G. W., Cole, R. N., Dong, D. L.-Y., Lee, M., & Hart, G. W. (1996). The
Microtubule-associated Protein Tau Is Extensively Modified with O-linked N-
acetylglucosamine*. Journal of Biological Chemistry, 271(46), 28741–28744.
https://doi.org/https://doi.org/10.1074/jbc.271.46.28741

249
Arosio, P., Knowles, T. P. J., & Linse, S. (2015). On the lag phase in amyloid fibril formation.
Physical Chemistry Chemical Physics : PCCP, 17(12), 7606–7618.
https://doi.org/10.1039/c4cp05563b

Balana, A. T., Levine, P. M., Craven, T. W., Mukherjee, S., Pedowitz, N. J., Moon, S. P.,
Takahashi, T. T., Becker, C. F. W., Baker, D., & Pratt, M. R. (2021). O-GlcNAc modification of
small heat shock proteins enhances their anti-amyloid chaperone activity. Nature Chemistry.
https://doi.org/10.1038/s41557-021-00648-8

Balana, A. T., Moon, S. P., & Pratt, M. R. (2021). O-GlcNAcylated peptides and proteins for
structural and functional studies. Current Opinion in Structural Biology, 68, 84–93.
https://doi.org/https://doi.org/10.1016/j.sbi.2020.12.005

Baldwin, A. J., Hilton, G. R., Lioe, H., Bagnéris, C., Benesch, J. L. P., & Kay, L. E. (2011).
Quaternary dynamics of αb-crystallin as a direct consequence of localised tertiary fluctuations in
the C-terminus. Journal of Molecular Biology, 413(2), 310–320.
https://doi.org/10.1016/j.jmb.2011.07.017

Baldwin, A. J., Walsh, P., Hansen, D. F., Hilton, G. R., Benesch, J. L. P., Sharpe, S., & Kay, L. E.
(2012). Probing dynamic conformations of the high-molecular-weight αb-crystallin heat shock
protein ensemble by NMR spectroscopy. Journal of the American Chemical Society, 134(37),
15343–15350. https://doi.org/10.1021/ja307874r

250
Bartels, A. L., & Leenders, K. L. (2010). Cyclooxygenase and neuroinflammation in Parkinson’s
disease neurodegeneration. Current Neuropharmacology, 8(1), 62–68.
https://doi.org/10.2174/157015910790909485

Bartels, T., Choi, J. G., & Selkoe, D. J. (2011). α-Synuclein occurs physiologically as a helically
folded tetramer that resists aggregation. Nature, 477(7362), 107–111.
https://doi.org/10.1038/nature10324

Beausoleil, S. A., Jedrychowski, M., Schwartz, D., Elias, J. E., Villén, J., Li, J., Cohn, M. A.,
Cantley, L. C., & Gygi, S. P. (2004). Large-scale characterization of HeLa cell nuclear
phosphoproteins. Proceedings of the National Academy of Sciences of the United States of
America, 101(33), 12130–12135. https://doi.org/10.1073/pnas.0404720101

Bekris, L. M., Yu, C.-E., Bird, T. D., & Tsuang, D. W. (2010). Genetics of Alzheimer disease.
Journal of Geriatric Psychiatry and Neurology, 23(4), 213–227.
https://doi.org/10.1177/0891988710383571

Bender, A., Krishnan, K. J., Morris, C. M., Taylor, G. A., Reeve, A. K., Perry, R. H., Jaros, E.,
Hersheson, J. S., Betts, J., Klopstock, T., Taylor, R. W., & Turnbull, D. M. (2006). High levels of
mitochondrial DNA deletions in substantia nigra neurons in aging and Parkinson disease. Nature
Genetics, 38(5), 515–517. https://doi.org/10.1038/ng1769

251
Bertheloot, D., & Latz, E. (2017). HMGB1, IL-1α, IL-33 and S100 proteins: Dual-function
alarmins. Cellular and Molecular Immunology, 14(1), 43–64. https://doi.org/10.1038/cmi.2016.34

Bianchi, M E, Falciola, L., Ferrari, S., & Lilley, D. M. (1992). The DNA binding site of HMG1
protein is composed of two similar segments (HMG boxes), both of which have counterparts in
other eukaryotic regulatory proteins. Embo J, 11(3), 1055–1063.
http://www.ncbi.nlm.nih.gov/pubmed/1547772%5Cnhttp://www.ncbi.nlm.nih.gov/pmc/articles/P
MC556546/pdf/emboj00088-0262.pdf

Bianchi, Marco E, Beltrame, M., & Paonessa, G. (1989). Specific Recognition of Cruciform DNA
by Nuclear Protein HMG1. Science, 243(4894), 1056–1059.

Bird, T. D. (2008). Genetic aspects of Alzheimer disease. Genetics in Medicine, 10(4), 231–239.
https://doi.org/10.1097/GIM.0b013e31816b64dc

Blanco-Canosa, J. B., & Dawson, P. E. (2008). An efficient Fmoc-SPPS approach for the
generation of thioester peptide precursors for use in native chemical ligation. Angewandte Chemie
- International Edition, 47(36), 6851–6855. https://doi.org/10.1002/anie.200705471

Bond, M. R., & Hanover, J. A. (2015). A little sugar goes a long way: The cell biology of O-
GlcNAc. Journal of Cell Biology, 208(7), 869–880. https://doi.org/10.1083/jcb.201501101

252
Borghammer, P., Hansen, S. B., Eggers, C., Chakravarty, M., Vang, K., Aanerud, J., Hilker, R.,
Heiss, W. D., Rodell, A., Munk, O. L., Keator, D., & Gjedde, A. (2012). Glucose metabolism in
small subcortical structures in Parkinson’s disease. Acta Neurologica Scandinavica, 125(5), 303–
310. https://doi.org/10.1111/j.1600-0404.2011.01556.x

Borghgraef, P., Menuet, C., Theunis, C., Louis, J. V., Devijver, H., Maurin, H., Smet-Nocca, C.,
Lippens, G., Hilaire, G., Gijsen, H., Moechars, D., & Van Leuven, F. (2013). Increasing brain
protein O-GlcNAcylation mitigates breathing defects and mortality of Tau.P301L mice. PLoS
ONE, 8(12), 1–13. https://doi.org/10.1371/journal.pone.0084442

Borodkin, V. S., Schimpl, M., Gundogdu, M., Rafie, K., Dorfmueller, H. C., Robinson, D. A., &
Van Aalten, D. M. F. (2014). Bisubstrate UDP-peptide conjugates as human O-GlcNAc transferase
inhibitors. Biochemical Journal, 457(3), 497–502. https://doi.org/10.1042/BJ20131272

Bourré, G., Cantrelle, F. X., Kamah, A., Chambraud, B., Landrieu, I., & Smet-Nocca, C. (2018).
Direct crosstalk between O-GlcNAcylation and phosphorylation of tau protein investigated by
NMR spectroscopy. Frontiers in Endocrinology, 9(OCT), 1–13.
https://doi.org/10.3389/fendo.2018.00595

Braak, H., Braak, E., & Bohl, J. (1993). Staging of Alzheimer-Related Cortical Destruction.
European Neurology, 33(6), 403–408. https://doi.org/10.1159/000116984

253
Brázda, V., Laister, R. C., Jagelská, E. B., & Arrowsmith, C. (2011). Cruciform structures are a
common DNA feature important for regulating biological processes. BMC Molecular Biology, 12.
https://doi.org/10.1186/1471-2199-12-33

Buell, A. K., Galvagnion, C., Gaspar, R., Sparr, E., Vendruscolo, M., Knowles, T. P. J., Linse, S.,
& Dobson, C. M. (2014). Solution conditions determine the relative importance of nucleation and
growth processes in -synuclein aggregation. Proceedings of the National Academy of Sciences,
111(21), 7671–7676. https://doi.org/10.1073/pnas.1315346111

Caccamo, A., Branca, C., Piras, I. S., Ferreira, E., Huentelman, M. J., Liang, W. S., Readhead, B.,
Dudley, J. T., Spangenberg, E. E., Green, K. N., Belfiore, R., Winslow, W., & Oddo, S. (2017).
Necroptosis activation in Alzheimer’s disease. Nature Neuroscience, 20(9), 1236–1246.
https://doi.org/10.1038/nn.4608

Cameron, A., Giacomozzi, B., Joyce, J., Gray, A., Graham, D., Ousson, S., Neny, M., Beher, D.,
Carlson, G., O’Moore, J., Shearman, M., & Hering, H. (2013). Generation and characterization of
a rabbit monoclonal antibody site-specific for tau O-GlcNAcylated at serine 400. FEBS Letters,
587(22), 3722–3728. https://doi.org/10.1016/j.febslet.2013.09.042

Cekic, N., Heinonen, J. E., Stubbs, K. A., Roth, C., He, Y., Bennet, A. J., McEachern, E. J., Davies,
G. J., & Vocadlo, D. J. (2016). Analysis of transition state mimicry by tight binding
aminothiazoline inhibitors provides insight into catalysis by human O-GlcNAcase. Chemical
Science, 7(6), 3742–3750. https://doi.org/10.1039/C6SC00370B
254
Cha, M. Y., Cho, H. J., Kim, C., Jung, Y. O., Kang, M. J., Murray, M. E., Hong, H. S., Choi, Y.
J., Choi, H., Kim, D. K., Choi, H., Kim, J., Dickson, D. W., Song, H. K., Cho, J. W., Yi, E. C.,
Kim, J., Jin, S. M., & Mook-Jung, I. (2015). Mitochondrial ATP synthase activity is impaired by
suppressed O-GlcNAcylation in Alzheimer’s disease. Human Molecular Genetics, 24(22), 6492–
6504. https://doi.org/10.1093/hmg/ddv358

Chalker, J. M., Lercher, L., Rose, N. R., Schofield, C. J., & Davis, B. G. (2012). Conversion of
Cysteine into Dehydroalanine Enables Access to Synthetic Histones Bearing Diverse Post-
Translational Modifications. Angewandte Chemie International Edition, 51(8), 1835–1839.
https://doi.org/10.1002/anie.201106432

Chalkley, R. J., Thalhammer, A., Schoepfer, R., & Burlingame, A. L. (2009). Identification of
protein O-GlcNAcylation sites using electron transfer dissociation mass spectrometry on native
peptides. Proceedings of the National Academy of Sciences, 106(22), 8894–8899.
https://doi.org/10.1073/pnas.0900288106

Champoux, J. J. (2001). DNA Topoisomerases: Structure, Function, and Mechanism. Annu Rev
Biochem, 70, 369–413.

Chartier-Harlin, M.-C., Kachergus, Jennifer Roumier, C., Mouroux, V., Douay, X., Lincoln, S.,
Levecque, C., Larvor, L., Andrieux, J., Hulihan, M., Waucquier, N., Defebvre, D., Amouyel, P.,
& Farrer, M. (2004). α-synuclein locus duplication as a cause of familial Parkinson’s disease.
Lancet, 364(9440), 1167–1169.
255
Chen, G. F., Xu, T. H., Yan, Y., Zhou, Y. R., Jiang, Y., Melcher, K., & Xu, H. E. (2017). Amyloid
beta: Structure, biology and structure-based therapeutic development. Acta Pharmacologica
Sinica, 38(9), 1205–1235. https://doi.org/10.1038/aps.2017.28

Choi, I., Zhang, Y., Seegobin, S. P., Pruvost, M., Wang, Q., Purtell, K., Zhang, B., & Yue, Z.
(2020). Microglia clear neuron-released α-synuclein via selective autophagy and prevent
neurodegeneration. Nature Communications, 11(1), 1386. https://doi.org/10.1038/s41467-020-
15119-w

Christensen, L. A., Conti, C. J., Fischer, S. M., & Vasquez, K. M. (2004). Mutation Frequencies
in Murine Keratinocytes as a Function of Carcinogenic Status. Molecular Carcinogenesis,
133(November 2003), 122–133. https://doi.org/10.1002/mc.20026

Chuh, K. N., Batt, A. R., Zaro, B. W., Darabedian, N., Marotta, N. P., Brennan, C. K., Amirhekmat,
A., & Pratt, M. R. (2017). The New Chemical Reporter 6-Alkynyl-6-deoxy-GlcNAc Reveals O-
GlcNAc Modification of the Apoptotic Caspases That Can Block the Cleavage/Activation of
Caspase-8. Journal of the American Chemical Society, 139(23), 7872–7885.
https://doi.org/10.1021/jacs.7b02213

Chun, Y. S., Kwon, O. H., & Chung, S. (2017). O-GlcNAcylation of amyloid-β precursor protein
at threonine 576 residue regulates trafficking and processing. Biochemical and Biophysical
Research Communications, 490(2), 486–491. https://doi.org/10.1016/j.bbrc.2017.06.067

256
Chun, Y. S., Park, Y., Oh, H. G., Kim, T. W., Yang, H. O., Park, M. K., & Chung, S. (2015). O-
GlcNAcylation promotes non-amyloidogenic processing of amyloid-β protein precursor via
inhibition of endocytosis from the plasma membrane. Journal of Alzheimer’s Disease, 44(1), 261–
275. https://doi.org/10.3233/JAD-140096

Clark, A. R., Vree Egberts, W., Kondrat, F. D. L., Hilton, G. R., Ray, N. J., Cole, A. R., Carver, J.
A., Benesch, J. L. P., Keep, N. H., Boelens, W. C., & Slingsby, C. (2018). Terminal Regions
Confer Plasticity to the Tetrameric Assembly of Human HspB2 and HspB3. Journal of Molecular
Biology, 430(18), 3297–3310. https://doi.org/10.1016/j.jmb.2018.06.047

Clark, P. M., Dweck, J. F., Mason, D. E., Hart, C. R., Buck, S. B., Peters, E. C., Agnew, B. J., &
Hsieh-wilson, L. C. (2008). Direct In-Gel Fluorescence Detection and Cellular Imaging of O -
GlcNAc-Modified Proteins. 11576–11577.

Clarke, A. J., Hurtado-Guerrero, R., Pathak, S., Schüttelkopf, A. W., Borodkin, V., Shepherd, S.
M., Ibrahim, A. F. M. M., & van Aalten, D. M. F. F. (2008). Structural insights into mechanism
and specificity of O-GlcNAc transferase. The EMBO Journal, 27(20), 2780–2788.
https://doi.org/10.1038/emboj.2008.186

Cole, R. N., & Hart, G. W. (1999). Glycosylation Sites Flank Phosphorylation Sites on Synapsin
I. Journal of Neurochemistry, 73(1), 418–428. https://doi.org/https://doi.org/10.1046/j.1471-
4159.1999.0730418.x

257
Cole, R. N., & Hart, G. W. (2001). Cytosolic O-glycosylation is abundant in nerve terminals.
Journal of Neurochemistry, 79(5), 1080–1089. https://doi.org/10.1046/j.1471-4159.2001.00655.x

Comer, F. I., Vosseller, K., Wells, L., Accavitti, M. A., & Hart, G. W. (2001). Characterization of
a Mouse Monoclonal Antibody Specific for O-Linked N-Acetylglucosamine. Analytical
Biochemistry, 293(2), 169–177. https://doi.org/10.1006/abio.2001.5132

Conway, K. A., Harper, J. D., & Lansbury, P. T. (1998). Accelerated in vitro fibril formation by a
mutant α-synuclein linked to early-onset Parkinson disease. Nature Medicine, 4(11), 1318–1320.
https://doi.org/10.1038/3311

Conway, K. A., Lee, S. J., Rochet, J. C., Ding, T. T., Williamson, R. E., & Lansbury, P. T. (2000).
Acceleration of oligomerization, not fibrillization, is a shared property of both α-synuclein
mutations linked to early-onset Parkinson’s disease: Implications for pathogenesis and therapy.
Proceedings of the National Academy of Sciences of the United States of America, 97(2), 571–576.
https://doi.org/10.1073/pnas.97.2.571

Coskun, P. E., Beal, M. F., & Wallace, D. C. (2004). Alzheimer's brains harbor somatic
mtDNA control-region mutations that suppress mitochondrial transcription and replication.
Proceedings of the National Academy of Sciences of the United States of America, 101(29), 10726
LP – 10731. https://doi.org/10.1073/pnas.0403649101

258
Cox, D., Selig, E., Griffin, M. D. W., Carver, J. A., & Ecroyd, H. (2016). Small Heat-shock
Proteins Prevent α-synuclein aggregation via transient interactions and their efficacy is affected
by the rate of aggregation. Journal of Biological Chemistry, 291(43), 22618–22629.
https://doi.org/10.1074/jbc.M116.739250

Cox, D., Whiten, D. R., Brown, J. W. P., Horrocks, M. H., Gil, R. S., Dobson, C. M., Klenerman,
D., Van Oijen, A. M., & Ecroyd, H. (2018). The small heat shock protein Hsp27 binds -synuclein
fibrils, preventing elongation and cytotoxicity. Journal of Biological Chemistry, 293(12), 4486–
4497. https://doi.org/10.1074/jbc.M117.813865

Cremades, N., Cohen, S. I. A., Deas, E., Abramov, A. Y., Chen, A. Y., Orte, A., Sandal, M.,
Clarke, R. W., Dunne, P., Aprile, F. A., Bertoncini, C. W., Wood, N. W., Knowles, T. P. J.,
Dobson, C. M., & Klenerman, D. (2012). Direct observation of the interconversion of normal and
toxic forms of α-synuclein. Cell, 149(5), 1048–1059. https://doi.org/10.1016/j.cell.2012.03.037

Crowther, R. A. (1991). Straight and paired helical filaments in Alzheimer disease have a common
structural unit. Proceedings of the National Academy of Sciences of the United States of America,
88(6), 2288–2292. https://doi.org/10.1073/pnas.88.6.2288

Crowther, R. A., Olesen, O. F., Smith, M. J., Jakes, R., & Goedert, M. (1994). Assembly of
Alzheimer-like filaments from full-length tau protein. FEBS Letters, 337(2), 135–138.
https://doi.org/10.1016/0014-5793(94)80260-2

259
Darabedian, N., Thompson, J. W., Chuh, K. N., Hsieh-Wilson, L. C., & Pratt, M. R. (2018).
Optimization of Chemoenzymatic Mass Tagging by Strain-Promoted Cycloaddition (SPAAC) for
the Determination of O-GlcNAc Stoichiometry by Western Blotting. Biochemistry, 57(40), 5769–
5774. https://doi.org/10.1021/acs.biochem.8b00648

Dardashti, R. N., & Metanis, N. (2017). Revisiting ligation at selenomethionine: Insights into
native chemical ligation at selenocysteine and homoselenocysteine. Bioorganic and Medicinal
Chemistry, 25(18), 4983–4989. https://doi.org/10.1016/j.bmc.2017.05.006

Dawson, P. E., Muir, T. W., Clark-Lewis, I., & Kent, S. B. (1994). Synthesis of proteins by native
chemical ligation. Science, 266(5186), 776 LP – 779. https://doi.org/10.1126/science.7973629

De Leon, C. A., Lang, G., Saavedra, M. I., & Pratt, M. R. (2018a). Simple and Efficient Preparation
of O- and S-GlcNAcylated Amino Acids through InBr3-Catalyzed Synthesis of β-N-
Acetylglycosides from Commercially Available Reagents. Organic Letters, 20(16), 5032–5035.
https://doi.org/10.1021/acs.orglett.8b02182

De Leon, C. A., Lang, G., Saavedra, M. I., & Pratt, M. R. (2018b). Simple and Efficient Preparation
of O- and S-GlcNAcylated Amino Acids through InBr3-Catalyzed Synthesis of β-N-
Acetylglycosides from Commercially Available Reagents. Organic Letters, 20(16), 5032–5035.
https://doi.org/10.1021/acs.orglett.8b02182

260
De Leon, C. A., Levine, P. M., Craven, T. W., & Pratt, M. R. (2017). The Sulfur-Linked Analogue
of O-GlcNAc (S-GlcNAc) Is an Enzymatically Stable and Reasonable Structural Surrogate for O-
GlcNAc at the Peptide and Protein Levels. Biochemistry, 56(27), 3507–3517.
https://doi.org/10.1021/acs.biochem.7b00268

de Queiroz, R. M., Carvalho, É., & Dias, W. B. (2014). O-GlcNAcylation: The Sweet Side of the
Cancer. In Frontiers in Oncology (Vol. 4, p. 132).
https://www.frontiersin.org/article/10.3389/fonc.2014.00132

Dear, A. J., Michaels, T. C. T., Meisl, G., Klenerman, D., Wu, S., Perrett, S., Linse, S., Dobson,
C. M., & Knowles, T. P. J. (2020). Kinetic diversity of amyloid oligomers. Proceedings of the
National Academy of Sciences of the United States of America, 117(22), 28–31.
https://doi.org/10.1073/pnas.1922267117

Delbecq, S. P., Jehle, S., & Klevit, R. (2012). Binding determinants of the small heat shock protein,
αb-crystallin: Recognition of the ′IxI′ motif. EMBO Journal, 31(24), 4587–4594.
https://doi.org/10.1038/emboj.2012.318

Deracinois, B., Camoin, L., Lambert, M., Boyer, J.-B., Dupont, E., Bastide, B., & Cieniewski-
Bernard, C. (2018). O-GlcNAcylation site mapping by (azide-alkyne) click chemistry and mass
spectrometry following intensive fractionation of skeletal muscle cells proteins. Journal of
Proteomics, 186, 83–97. https://doi.org/https://doi.org/10.1016/j.jprot.2018.07.005

261

Dettmer, U., Newman, A. J., Von Saucken, V. E., Bartels, T., & Selkoe, D. (2015). KTKEGV
repeat motifs are key mediators of normal α-synuclein tetramerization: Their mutation causes
excess monomers and neurotoxicity. Proceedings of the National Academy of Sciences of the
United States of America, 112(31), 9596–9601. https://doi.org/10.1073/pnas.1505953112

Donovan, K., Alekseev, O., Qi, X., Cho, W., & Azizkhan-Clifford, J. (2014). O-GlcNAc
modification of transcription factor Sp1 mediates hyperglycemia-induced VEGF-A upregulation
in retinal cells. Investigative Ophthalmology & Visual Science, 55(12), 7862–7873.
https://doi.org/10.1167/iovs.14-14048

Dossou, A. S., & Basu, A. (2019). The Emerging Roles of mTORC1 in Macromanaging
Autophagy. Cancers, 11(10), 1422. https://doi.org/10.3390/cancers11101422

Dunham, S. U., & Lippard, S. J. (1997). DNA sequence context and protein composition modulate
HMG-domain protein recognition of cisplatin-modified DNA. Biochemistry, 36(38), 11428–
11436. https://doi.org/10.1021/bi9709452

Dyer, P. N., Edayathumangalam, R. S., White, C. L., Bao, Y., Chakravarthy, S., Muthurajan, U.
M., & Luger, K. B. T.-M. in E. (2003). Reconstitution of Nucleosome Core Particles from
Recombinant Histones and DNA. In Chromatin and Chromatin Remodeling Enzymes, Part A (Vol.
375, pp. 23–44). Academic Press. https://doi.org/https://doi.org/10.1016/S0076-6879(03)75002-2

262
Eichman, B. F., Ortiz-Lombardía, M., Aymamí, J., Coll, M., & Ho, P. S. (2002). The inherent
properties of DNA four-way junctions: Comparing the crystal structures of holliday junctions.
Journal of Molecular Biology, 320(5), 1037–1051. https://doi.org/10.1016/S0022-
2836(02)00540-5

Elsen, N. L., Patel, S. B., Ford, R. E., Hall, D. L., Hess, F., Kandula, H., Kornienko, M., Reid, J.,
Selnick, H., Shipman, J. M., Sharma, S., Lumb, K. J., Soisson, S. M., & Klein, D. J. (2017).
Insights into activity and inhibition from the crystal structure of human O-GlcNAcase. Nature
Chemical Biology, 13(6), 613–615. https://doi.org/10.1038/nchembio.2357

Emamzadeh, F. N. (2016). Alpha-synuclein structure, functions, and interactions. Journal of
Research in Medical Sciences : The Official Journal of Isfahan University of Medical Sciences,
21, 29. https://doi.org/10.4103/1735-1995.181989

Ertekin-Taner, N., Graff-Radford, N., Younkin, L. H., Eckman, C., Baker, M., Adamson, J.,
Ronald, J., Blangero, J., Hutton, M., & Younkin, S. G. (2000). Linkage of plasma Aβ42 to a
quantitative locus on chromosome 10 in late-onset Alzheimer’s disease pedigrees. Science,
290(5500), 2303–2304. https://doi.org/10.1126/science.290.5500.2303

Fang, G. M., Li, Y. M., Shen, F., Huang, Y. C., Li, J. Bin, Lin, Y., Cui, H. K., & Liu, L. (2011).
Protein chemical synthesis by ligation of peptide hydrazides. Angewandte Chemie - International
Edition, 50(33), 7645–7649. https://doi.org/10.1002/anie.201100996

263
Fardini, Y., Dehennaut, V., Lefebvre, T., & Issad, T. (2013). O-GlcNAcylation: A New Cancer
Hallmark? Frontiers in Endocrinology, 4, 99. https://doi.org/10.3389/fendo.2013.00099

Fares, M. B., Jagannath, S., & Lashuel, H. A. (2021). Reverse engineering Lewy bodies: how far
have we come and how far can we go? Nature Reviews Neuroscience.
https://doi.org/10.1038/s41583-020-00416-6

Fitzpatrick, A. W. P., Falcon, B., He, S., Murzin, A. G., Murshudov, G., Garringer, H. J., Crowther,
R. A., Ghetti, B., Goedert, M., & Scheres, S. H. W. (2017). Cryo-EM structures of tau filaments
from Alzheimer’s disease. Nature, 547(7662), 185–190. https://doi.org/10.1038/nature23002

Förster, S., Welleford, A. S., Triplett, J. C., Sultana, R., Schmitz, B., & Butterfield, D. A. (2014).
Increased O-GlcNAc levels correlate with decreased O-GlcNAcase levels in Alzheimer disease
brain. Biochimica et Biophysica Acta - Molecular Basis of Disease, 1842(9), 1333–1339.
https://doi.org/10.1016/j.bbadis.2014.05.014

Freilich, R., Betegon, M., Tse, E., Mok, S. A., Julien, O., Agard, D. A., Southworth, D. R.,
Takeuchi, K., & Gestwicki, J. E. (2018). Competing protein-protein interactions regulate binding
of Hsp27 to its client protein tau. Nature Communications, 9(1), 4563.
https://doi.org/10.1038/s41467-018-07012-4

264
Frenkel-Pinter, M., Richman, M., Belostozky, A., Abu-Mokh, A., Gazit, E., Rahimipour, S., &
Segal, D. (2018). Distinct Effects of O-GlcNAcylation and Phosphorylation of a Tau-Derived
Amyloid Peptide on Aggregation of the Native Peptide. Chemistry – A European Journal, 24(53),
14039–14043. https://doi.org/10.1002/chem.201802209

Fujiwara, H., Hasegawa, M., Dohmae, N., Kawashima, A., Masliah, E., Goldberg, M. S., Shen, J.,
Takio, K., & Iwatsubo, T. (2002). α-Synuclein is phosphorylated in synucleinopathy lesions.
Nature Cell Biology, 4(2), 160–164. https://doi.org/10.1038/ncb748

Gaillard, C., Borde, C., Gozlan, J., Maréchal, V., & Strauss, F. (2008). A high-sensitivity method
for detection and measurement of HMGB1 protein concentration by high-affinity binding to DNA
hemicatenanes. PLoS ONE, 3(8). https://doi.org/10.1371/journal.pone.0002855

Galesic, A., Rakshit, A., Cutolo, G., Pacheco, R. P., Balana, A. T., Moon, S. P., & Pratt, M. R.
(2021). Comparison of N-Acetyl-Glucosamine to Other Monosaccharides Reveals Structural
Differences for the Inhibition of α-Synuclein Aggregation. ACS Chemical Biology, 16(1), 14–19.
https://doi.org/10.1021/acschembio.0c00716

Gao, H., Shi, M., Wang, R., Wang, C., Shao, C., Gu, Y., & Yu, W. (2018). A widely compatible
expression system for the production of highly O-GlcNAcylated recombinant protein in
Escherichia coli. Glycobiology, 28(12), 949–957. https://doi.org/10.1093/glycob/cwy077

265
Gao, Y., Wells, L., Comer, F. I., Parker, G. J., & Hart, G. W. (2001). Dynamic O-glycosylation of
nuclear and cytosolic proteins: Cloning and characterization of a neutral, cytosolic β-N-
acetylglucosaminidase from human brain. Journal of Biological Chemistry, 276(13), 9838–9845.
https://doi.org/10.1074/jbc.M010420200

Ge, P., Dawson, V. L., & Dawson, T. M. (2020). PINK1 and Parkin mitochondrial quality control:
a source of regional vulnerability in Parkinson’s disease. Molecular Neurodegeneration, 15(1), 20.
https://doi.org/10.1186/s13024-020-00367-7

Gendreau, K. L., & Hall, G. F. (2013). Tangles, Toxicity, and Tau Secretion in AD - New
Approaches to a Vexing Problem. Frontiers in Neurology, 4, 160.
https://doi.org/10.3389/fneur.2013.00160

Giasson, B. I., Uryu, K., Trojanowski, J. Q., & Lee, V. M. Y. (1999). Mutant and wild type human
α-synucleins assemble into elongated filaments with distinct morphologies in vitro. Journal of
Biological Chemistry, 274(12), 7619–7622. https://doi.org/10.1074/jbc.274.12.7619

Gloster, T. M., Zandberg, W. F., Heinonen, J. E., Shen, D. L., Deng, L., & Vocadlo, D. J. (2011).
Hijacking a biosynthetic pathway yields a glycosyltransferase inhibitor within cells. Nature
Chemical Biology, 7(3), 174–181. https://doi.org/10.1038/nchembio.520

266
Goedert, M., Jakes, R., Spillantini, M. G., Hasegawa, M., Smith, M. J., & Crowther, R. A. (1996).
Assembly of microtubule-associated protein tau into Alzheimer-like filaments induced by
sulphated glycosaminoglycans. Nature, 383(6600), 550–553. https://doi.org/10.1038/383550a0

Goedert, M., Spillantini, M. G., Potier, M. C., Ulrich, J., & Crowther, R. A. (1989). Cloning and
sequencing of the cDNA encoding an isoform of microtubule-associated protein tau containing
four tandem repeats: differential expression of tau protein mRNAs in human brain. EMBO Journal,
8(2), 393–399. https://doi.org/10.1002/j.1460-2075.1989.tb03390.x

Goodwin, O. Y., Thomasson, M. S., Lin, A. J., Sweeney, M. M., & Macnaughtan, M. A. (2013).
E. coli sabotages the in vivo production of O-linked β-N-acetylglucosamine-modified proteins.
Journal of Biotechnology, 168(4), 315–323. https://doi.org/10.1016/j.jbiotec.2013.10.008

Gorelik, A., Bartual, S. G., Borodkin, V. S., Varghese, J., Ferenbach, A. T., & van Aalten, D. M.
F. F. (2019). Genetic recoding to dissect the roles of site-specific protein O-GlcNAcylation. Nature
Structural & Molecular Biology, 26(11), 1071–1077. https://doi.org/10.1038/s41594-019-0325-8

Gorelik, A., & van Aalten, D. M. F. (2020). Tools for functional dissection of site-specific O-
GlcNAcylation. RSC Chemical Biology, 1(3), 98–109. https://doi.org/10.1039/d0cb00052c

Gorman, A. M. (2008). Neuronal cell death in neurodegenerative diseases: recurring themes
around protein handling. Journal of Cellular and Molecular Medicine, 12(6A), 2263–2280.
https://doi.org/10.1111/j.1582-4934.2008.00402.x
267
Graham, D. L., Gray, A. J., Joyce, J. A., Yu, D., O’Moore, J., Carlson, G. A., Shearman, M. S.,
Dellovade, T. L., & Hering, H. (2014). Increased O-GlcNAcylation reduces pathological tau
without affecting its normal phosphorylation in a mouse model of tauopathy. Neuropharmacology,
79, 307–313. https://doi.org/10.1016/j.neuropharm.2013.11.025

Grasser, K. D., Teo, S. H., Lee, K. B., Broadhurst, R. W., Rees, C., Hardman, C. H., & Thomas,
J. O. (1998). DNA-binding properties of the tandem HMG boxes of high-mobility-group protein
1 (HMG1). European Journal of Biochemistry, 253(3), 787–795. https://doi.org/10.1046/j.1432-
1327.1998.2530787.x

Greenwald, J., & Riek, R. (2010). Biology of Amyloid: Structure, Function, and Regulation.
Structure, 18(10), 1244–1260. https://doi.org/https://doi.org/10.1016/j.str.2010.08.009

Griffith, L. S., Mathes, M., & Schmitz, B. (1995). β-Amyloid precursor protein is modified with
O-linked N-acetylglucosamine. Journal of Neuroscience Research, 41(2), 270–278.
https://doi.org/https://doi.org/10.1002/jnr.490410214

Griffith, L. S., & Schmitz, B. (1995). O-Linked N-Acetylglucosamine Is Upregulated in Alzheimer
Brains. Biochemical and Biophysical Research Communications, 213(2), 424–431.
https://doi.org/https://doi.org/10.1006/bbrc.1995.2149

268
Guo, B., Liang, Q., Li, L., Hu, Z., Wu, F., Zhang, P., Ma, Y., Zhao, B., Kovács, A. L., Zhang, Z.,
Feng, D., Chen, S., & Zhang, H. (2014). O-GlcNAc-modification of SNAP-29 regulates
autophagosome maturation. Nature Cell Biology, 16(12), 1215–1226.
https://doi.org/10.1038/ncb3066

Guo, K., Gan, L., Zhang, S., Cui, F. J., Cun, W., Li, Y., Kang, N. X., Gao, M. D., & Liu, K. Y.
(2012). Translocation of HSP27 into liver cancer cell nucleus may be associated with
phosphorylation and O-GlcNAc glycosylation. Oncology Reports, 28(2), 494–500.
https://doi.org/10.3892/or.2012.1844

Guo, T., Zhang, D., Zeng, Y., Huang, T. Y., Xu, H., & Zhao, Y. (2020). Molecular and cellular
mechanisms underlying the pathogenesis of Alzheimer’s disease. Molecular Neurodegeneration,
15(1), 1–37. https://doi.org/10.1186/s13024-020-00391-7

Gupta, S., Banerjee, P., Laferla, F. M., & Selkoe, D. J. (2010). Alzheimer ’ s Disease : Genes ,
Proteins , and Therapy. 81(2), 741–766.

Guzman-Martinez, L., Maccioni, R. B., Andrade, V., Navarrete, L. P., Pastor, M. G., & Ramos-
Escobar, N. (2019). Neuroinflammation as a Common Feature of Neurodegenerative Disorders.
In Frontiers in Pharmacology (Vol. 10, p. 1008).
https://www.frontiersin.org/article/10.3389/fphar.2019.01008

269
Hahne, H., Sobotzki, N., Nyberg, T., Helm, D., Borodkin, V. S., van Aalten, D. M. F., Agnew, B.,
& Kuster, B. (2013). Proteome Wide Purification and Identification of O-GlcNAc-Modified
Proteins Using Click Chemistry and Mass Spectrometry. Journal of Proteome Research, 12(2),
927–936. https://doi.org/10.1021/pr300967y

Han, C., Shan, H., Bi, C., Zhang, X., Qi, J., Zhang, B., Gu, Y., & Yu, W. (2015). A highly effective
and adjustable dual plasmid system for O-GlcNAcylated recombinant protein production in E.
coli. Journal of Biochemistry, 157(6), 477–484. https://doi.org/10.1093/jb/mvv006

Hanover, J. A., Krause, M. W., & Love, D. C. (2012). Bittersweet memories: Linking metabolism
to epigenetics through O-GlcNAcylation. Nature Reviews Molecular Cell Biology, 13(5), 312–
321. https://doi.org/10.1038/nrm3334

Harris, H. E., & Andersson, U. (2004). The nuclear protein HMGB1 as a proinflammatory
mediator. European Journal of Immunology, 34(6), 1503–1512.
https://doi.org/10.1002/eji.200424916

Harris, H. E., Andersson, U., & Pisetsky, D. S. (2012). HMGB1: A multifunctional alarmin driving
autoimmune and inflammatory disease. Nature Reviews Rheumatology, 8(4), 195–202.
https://doi.org/10.1038/nrrheum.2011.222

270
Hart, G. W., Slawson, C., Ramirez-Correa, G., & Lagerlof, O. (2011). Cross talk between O-
GlcNAcylation and phosphorylation: roles in signaling, transcription, and chronic disease. Annual
Review of Biochemistry, 80, 825–858. https://doi.org/10.1146/annurev-biochem-060608-102511

Hartl, F. U., Bracher, A., & Hayer-Hartl, M. (2011). Molecular chaperones in protein folding and
proteostasis. Nature, 475(7356), 324–332. https://doi.org/10.1038/nature10317

Haslbeck, M., Weinkauf, S., & Buchner, J. (2019). Small heat shock proteins: Simplicity meets
complexity. Journal of Biological Chemistry, 294(6), 2121–2132.
https://doi.org/10.1074/jbc.REV118.002809

Hastings, N. B., Wang, X., Song, L., Butts, B. D., Grotz, D., Hargreaves, R., Fred Hess, J., Hong,
K. L. K., Huang, C. R. R., Hyde, L., Laverty, M., Lee, J., Levitan, D., Lu, S. X., Maguire, M.,
Mahadomrongkul, V., McEachern, E. J., Ouyang, X., Rosahl, T. W., … Zhang, L. (2017).
Inhibition of O-GlcNAcase leads to elevation of O-GlcNAc tau and reduction of tauopathy and
cerebrospinal fluid tau in rTg4510 mice. Molecular Neurodegeneration, 12(1), 1–16.
https://doi.org/10.1186/s13024-017-0181-0

Hilton, G. R., Hochberg, G. K. A., Laganowsky, A., Mcginnigle, S. I., Baldwin, A. J., & Benesch,
J. L. P. (2013). C-terminal interactions mediate the quaternary dynamics of αB-crystallin (R. S.
Lond. & B. B, trans.). Philosophical Transactions of the Royal Society B: Biological Sciences,
368(1617), 1–13. https://doi.org/10.1098/rstb.2011.0405

271
Hochberg, G. K. A., Ecroyd, H., Liu, C., Cox, D., Cascio, D., Sawaya, M. R., Collier, M. P.,
Stroud, J., Carver, J. A., Baldwin, A. J., Robinson, C. V., Eisenberg, D. S., Benesch, J. L. P., &
Laganowsky, A. (2014). The structured core domain of B-crystallin can prevent amyloid
fibrillation and associated toxicity. Proceedings of the National Academy of Sciences, 111(16),
E1562–E1570. https://doi.org/10.1073/pnas.1322673111

Ibanez, P., Bonnet, A., Debarges, B., Lohmann, E., Tison, F., Pollak, P., Agid, Y., Durr, A., &
Brice, A. (2004). Causal relation between alpha-synuclein gene duplication and familial
Parkinson’s disease. Lancet, 364(9440), 1169–1171.

Iwai, A., Masliah, E., Yoshimoto, M., Ge, N., Flanagan, L., Rohan de Silva, H. A., Kittel, A., &
Saitoh, T. (1995). The precursor protein of non-Aβ component of Alzheimer’s disease amyloid is
a presynaptic protein of the central nervous system. Neuron, 14(2), 467–475.
https://doi.org/10.1016/0896-6273(95)90302-X

Jacobsen, K. T., & Iverfeldt, K. (2011). O-GlcNAcylation increases non-amyloidogenic
processing of the amyloid-β precursor protein (APP). Biochemical and Biophysical Research
Communications, 404(3), 882–886. https://doi.org/10.1016/j.bbrc.2010.12.080

Jebarupa, B., Muralidharan, M., Arun, A., Mandal, A. K., & Mitra, G. (2018). Conformational
heterogeneity of tau: Implication on intrinsic disorder, acid stability and fibrillation in Alzheimer’s
disease. Biophysical Chemistry, 241, 27–37.
https://doi.org/https://doi.org/10.1016/j.bpc.2018.07.005
272
Jehle, S., Rajagopal, P., Bardiaux, B., Markovic, S., Kühne, R., Stout, J. R., Higman, V. A., Klevit,
R. E., Van Rossum, B. J., & Oschkinat, H. (2010). Solid-state NMR and SAXS studies provide a
structural basis for the activation of αb-crystallin oligomers. Nature Structural and Molecular
Biology, 17(9), 1037–1042. https://doi.org/10.1038/nsmb.1891

Jellinger, K. A. (2010). Basic mechanisms of neurodegeneration: A critical update. Journal of
Cellular and Molecular Medicine, 14(3), 457–487. https://doi.org/10.1111/j.1582-
4934.2010.01010.x

Jiang, Z., De Messieres, M., & Lee, J. C. (2013). Membrane remodeling by α-synuclein and effects
on amyloid formation. Journal of the American Chemical Society, 135(43), 15970–15973.
https://doi.org/10.1021/ja405993r

Jínek, M., Rehwinkel, J., Lazarus, B. D., Izaurralde, E., Hanover, J. A., & Conti, E. (2004). The
superhelical TPR-repeat domain of O-linked GlcNAc transferase exhibits structural similarities to
importin α. Nature Structural & Molecular Biology, 11(10), 1001–1007.
https://doi.org/10.1038/nsmb833

Jo, Y. K., Park, N. Y., Park, S. J., Kim, B. G., Shin, J. H., Jo, D. S., Bae, D. J., Suh, Y. A., Chang,
J. H., Lee, E. K., Kim, S. Y., Kim, J. C., & Cho, D. H. (2016). O-GlcNAcylation of ATG4B
positively regulates autophagy by increasing its hydroxylase activity. Oncotarget, 7(35), 57186–
57196. https://doi.org/10.18632/oncotarget.11083

273
Johnson, G. V. W., & Stoothoff, W. H. (2004). Tau phosphorylation in neuronal cell function and
dysfunction. Journal of Cell Science, 117(24), 5721 LP – 5729. https://doi.org/10.1242/jcs.01558

Johri, A., & Beal, M. F. (2012). Mitochondrial dysfunction in neurodegenerative diseases. The
Journal of Pharmacology and Experimental Therapeutics, 342(3), 619–630.
https://doi.org/10.1124/jpet.112.192138

Joiner, C. M., Levine, Z. G., Aonbangkhen, C., Woo, C. M., & Walker, S. (2019). Aspartate
Residues Far from the Active Site Drive O-GlcNAc Transferase Substrate Selection. Journal of
the American Chemical Society, 141(33), 12974–12978. https://doi.org/10.1021/jacs.9b06061

Joiner, C. M., Li, H., Jiang, J., & Walker, S. (2019). Structural characterization of the O-GlcNAc
cycling enzymes: insights into substrate recognition and catalytic mechanisms. Current Opinion
in Structural Biology, 56, 97–106. https://doi.org/https://doi.org/10.1016/j.sbi.2018.12.003

Ju, B.-G., Lunyak, V. V, Perissi, V., Garcia-Bassets, I., Rose, D. W., Glass, C. K., & Rosenfeld,
M. G. (2006). A Topoisomerase IIß-Mediated dsDNA Break Required for Regulated
Transcription. Science, 312(5781), 1798 LP – 1802. https://doi.org/10.1126/science.1127196

Jung, Y., & Lippard, S. J. (2003). Nature of full-length HMGB1 binding to cisplatin-modified
DNA. Biochemistry, 42(9), 2664–2671. https://doi.org/10.1021/bi026972w

274
Kahle, P. J., Neumann, M., Ozmen, L., Müller, V., Jacobsen, H., Schindzielorz, A., Okochi, M.,
Leimer, U., Van Der Putten, H., Probst, A., Kremmer, E., Kretzschmar, H. A., & Haass, C. (2000).
Subcellular localization of wild-type and Parkinson’s disease-associated mutant α-synuclein in
human and transgenic mouse brain. Journal of Neuroscience, 20(17), 6365–6373.
https://doi.org/10.1523/jneurosci.20-17-06365.2000

Kapogiannis, D., & Mattson, M. P. (2011). Disrupted energy metabolism and neuronal circuit
dysfunction in cognitive impairment and Alzheimer’s disease. The Lancet Neurology, 10(2), 187–
198. https://doi.org/10.1016/S1474-4422(10)70277-5

Kappé, G., Franck, E., Verschuure, P., Boelens, W. C., Leunissen, J. A. M., & De Jong, W. W.
(2003). The human genome encodes 10 α-crystallin-related small heat shock proteins: HspB1-10.
Cell Stress and Chaperones, 8(1), 53–61. https://doi.org/10.1379/1466-
1268(2003)8<53:THGECS>2.0.CO;2

Karran, E., Mercken, M., & Strooper, B. De. (2011). The amyloid cascade hypothesis for
Alzheimer’s disease: An appraisal for the development of therapeutics. Nature Reviews Drug
Discovery, 10(9), 698–712. https://doi.org/10.1038/nrd3505

Kelleher 3rd, R. J., & Shen, J. (2017). Presenilin-1 mutations and Alzheimer’s disease.
Proceedings of the National Academy of Sciences of the United States of America, 114(4), 629–
631. https://doi.org/10.1073/pnas.1619574114

275
Khidekel, N., Ficarro, S. B., Peters, E. C., & Hsieh-Wilson, L. C. (2004). Exploring the O-GlcNAc
proteome: Direct identification of O-GlcNAc-modified from the brain. Proceedings of the
National Academy of Sciences of the United States of America, 101(36), 13132–13137.
https://doi.org/10.1073/pnas.0403471101

Kielbasa, W., Phipps, K. M., Tseng, J., Natanegara, F., Cheng, E., Monk, S. A., Bundgaard, C.,
Kevin, D. B., Nuthall, H. N., McDonald, N., Lindsay-Scott, P., Dreyfus, N., Hawk, M. K., Warner,
S., Biglan, K., Gilmore, J. A., Zhang, X., Mergott, D. J., & Lowe, S. L. (2020). A single ascending
dose study in healthy volunteers to assess the safety and PK of LY3372689, an inhibitor of O-
GlcNAcase (OGA) enzyme. Alzheimer’s & Dementia, 16(S9), 40473.
https://doi.org/10.1002/alz.040473

Kilic, S., Bachmann, A. L., Bryan, L. C., & Fierz, B. (2015). Multivalency governs HP1α
association dynamics with the silent chromatin state. Nature Communications, 6, 7313.
https://doi.org/10.1038/ncomms8313

Kim, C., Nam, D. W., Park, S. Y., Song, H., Hong, H. S., Boo, J. H., Jung, E. S., Kim, Y., Baek,
J. Y., Kim, K. S., Cho, J. W., & Mook-Jung, I. (2013). O-linked β-N-acetylglucosaminidase
inhibitor attenuates β-amyloid plaque and rescues memory impairment. Neurobiology of Aging,
34(1), 275–285. https://doi.org/10.1016/j.neurobiolaging.2012.03.001

276
Kim, M. S., Chuenchor, W., Chen, X., Cui, Y., Zhang, X., Zhou, Z. H., Gellert, M., & Yang, W.
(2018). Cracking the DNA Code for V(D)J Recombination. Molecular Cell, 70(2), 358-370.e4.
https://doi.org/10.1016/j.molcel.2018.03.008

Knapp, S., Müller, S., Digilio, G., Bonaldi, T., Bianchi, M. E., & Musco, G. (2004). The long
acidic tail of high mobility group box 1 (HMGB1) protein forms an extended and flexible structure
that interacts with specific residues within and between the HMG boxes. Biochemistry, 43(38),
11992–11997. https://doi.org/10.1021/bi049364k

Kocahan, S., & Doğan, Z. (2017). Mechanisms of Alzheimer’s Disease Pathogenesis and
Prevention: The Brain, Neural Pathology, N-methyl-D-aspartate Receptors, Tau Protein and Other
Risk Factors. Clinical Psychopharmacology and Neuroscience : The Official Scientific Journal of
the Korean College of Neuropsychopharmacology, 15(1), 1–8.
https://doi.org/10.9758/cpn.2017.15.1.1

Köpke, E., Tung, Y. C., Shaikh, S., Alonso, A. C., Iqbal, K., & Grundke-Iqbal, I. (1993).
Microtubule-associated protein tau. Abnormal phosphorylation of a non-paired helical filament
pool in Alzheimer disease. Journal of Biological Chemistry, 268(32), 24374–24384.
https://doi.org/https://doi.org/10.1016/S0021-9258(20)80536-5

277
Kreppel, L. K., Blomberg, M. A., & Hart, G. W. (1997). Dynamic glycosylation of nuclear and
cytosolic proteins: Cloning and characterization of a unique O-GlcNAc transferase with multiple
tetratricopeptide repeats. Journal of Biological Chemistry, 272(14), 9308–9315.
https://doi.org/10.1074/jbc.272.14.9308

Kriehuber, T., Rattei, T., Weinmaier, T., Bepperling, A., Haslbeck, M., & Buchner, J. (2010).
Independent evolution of the core domain and its flanking sequences in small heat shock proteins.
FASEB Journal, 24(10), 3633–3642. https://doi.org/10.1096/fj.10-156992

Krüger, U., Wang, Y., Kumar, S., & Mandelkow, E.-M. (2012). Autophagic degradation of tau in
primary neurons and its enhancement by trehalose. Neurobiology of Aging, 33(10), 2291–2305.
https://doi.org/https://doi.org/10.1016/j.neurobiolaging.2011.11.009

Kudva, Y. C., Hiddinga, H. J., Butler, P. C., Mueske, C. S., & Eberhardt, N. L. (1997). Small heat
shock proteins inhibit in vitro Aβ1-42 amyloidogenesis. FEBS Letters, 416(1), 117–121.
https://doi.org/10.1016/S0014-5793(97)01180-0

Kuperstein, I., Broersen, K., Benilova, I., Rozenski, J., Jonckheere, W., Debulpaep, M.,
Vandersteen, A., Segers-Nolten, I., Van Der Werf, K., Subramaniam, V., Braeken, D., Callewaert,
G., Bartic, C., D’Hooge, R., Martins, I. C., Rousseau, F., Schymkowitz, J., & De Strooper, B.
(2010). Neurotoxicity of Alzheimer’s disease Aβ peptides is induced by small changes in the Aβ42
to Aβ40 ratio. EMBO Journal, 29(19), 3408–3420. https://doi.org/10.1038/emboj.2010.211

278
Lange, S S, Mitchell, D. L., & Vasquez, K. M. (2008). High mobility group protein B1 enhances
DNA repair and chromatin modification after DNA damage. Proceedings of the National Academy
of Sciences of the United States of America, 105(30), 10320–10325.
https://doi.org/10.1073/pnas.0803181105

Lange, Sabine S., & Vasquez, K. M. (2009). HMGB1: The Jack-of-all-trades protein is a master
DNA repair mechanic. Molecular Carcinogenesis, 48(7), 571–580.
https://doi.org/10.1002/mc.20544

Lashuel, H. A., Overk, C. R., Oueslati, A., & Masliah, E. (2013). The many faces of α-synuclein:
From structure and toxicity to therapeutic target. Nature Reviews Neuroscience, 14(1), 38–48.
https://doi.org/10.1038/nrn3406

Lazarus, M. B., Jiang, J., Gloster, T. M., Zandberg, W. F., Whitworth, G. E., Vocadlo, D. J., &
Walker, S. (2012). Structural snapshots of the reaction coordinate for O-GlcNAc transferase.
Nature Chemical Biology, 8(12), 966–968. https://doi.org/10.1038/nchembio.1109

Lazarus, M. B., Jiang, J., Kapuria, V., Bhuiyan, T., Janetzko, J., Zandberg, W. F., Vocadlo, D. J.,
Herr, W., & Walker, S. (2013). HCF-1 Is Cleaved in the Active Site of O-GlcNAc Transferase.
Science, 342(6163), 1235–1239. https://doi.org/10.1126/science.1243990

279
Lazarus, M. B., Nam, Y., Jiang, J., Sliz, P., & Walker, S. (2011). Structure of human O-GlcNAc
transferase and its complex with a peptide substrate. Nature, 469(7331), 564–567.
https://doi.org/10.1038/nature09638

Lee, B. E., Kim, H. Y., Kim, H. J., Jeong, H., Kim, B. G., Lee, H. E., Lee, J., Kim, H. B., Lee, S.
E., Yang, Y. R., Yi, E. C., Hanover, J. A., Myung, K., Suh, P. G., Kwon, T., & Kim, J. I. (2020).
O-GlcNAcylation regulates dopamine neuron function, survival and degeneration in Parkinson
disease. Brain : A Journal of Neurology, 143(12), 3699–3716.
https://doi.org/10.1093/brain/awaa320

Lefebvre, T., Ferreira, S., Dupont-Wallois, L., Bussière, T., Dupire, M.-J., Delacourte, A.,
Michalski, J.-C., & Caillet-Boudin, M.-L. (2003). Evidence of a balance between phosphorylation
and O-GlcNAc glycosylation of Tau proteins—a role in nuclear localization. Biochimica et
Biophysica Acta (BBA) - General Subjects, 1619(2), 167–176.
https://doi.org/https://doi.org/10.1016/S0304-4165(02)00477-4

Lehman, D. M., Fu, D.-J., Freeman, A. B., Hunt, K. J., Leach, R. J., Johnson-Pais, T., Hamlington,
J., Dyer, T. D., Arya, R., Abboud, H., Göring, H. H. H., Duggirala, R., Blangero, J., Konrad, R. J.,
& Stern, M. P. (2005). A Single Nucleotide Polymorphism in MGEA5 Encoding O-GlcNAc–
selective N-Acetyl-β-dGlucosaminidase Is Associated With Type 2 Diabetes in Mexican
Americans. Diabetes, 54(4), 1214 LP – 1221. https://doi.org/10.2337/diabetes.54.4.1214

280
Lemberg, K. M., Vornov, J. J., Rais, R., & Slusher, B. S. (2018). We're Not “DON” Yet:
Optimal Dosing and Prodrug Delivery of <em>6-Diazo-5-oxo-L-norleucine</em>
Molecular Cancer Therapeutics, 17(9), 1824 LP – 1832. https://doi.org/10.1158/1535-7163.MCT-
17-1148

Leney, A. C., El Atmioui, D., Wu, W., Ovaa, H., & Heck, A. J. R. (2017). Elucidating crosstalk
mechanisms between phosphorylation and O-GlcNAcylation. Proceedings of the National
Academy of Sciences, 114(35), E7255 LP-E7261. https://doi.org/10.1073/pnas.1620529114

Lercher, L., Raj, R., Patel, N. A., Price, J., Mohammed, S., Robinson, C. V., Schofield, C. J., &
Davis, B. G. (2015). Generation of a synthetic GlcNAcylated nucleosome reveals regulation of
stability by H2A-Thr101 GlcNAcylation. Nature Communications, 6, 7978.
https://doi.org/10.1038/ncomms8978

Levine, P. M., Balana, A. T., Sturchler, E., Koole, C., Noda, H., Zarzycka, B., Daley, E. J., Truong,
T. T., Katritch, V., Gardella, T. J., Wootten, D., Sexton, P. M., McDonald, P., & Pratt, M. R.
(2019). O-GlcNAc Engineering of GPCR Peptide-Agonists Improves Their Stability and in Vivo
Activity. Journal of the American Chemical Society, 141(36), 14210–14219.
https://doi.org/10.1021/jacs.9b05365

281
Levine, P. M., De Leon, C. A., Galesic, A., Balana, A., Marotta, N. P., Lewis, Y. E., & Pratt, M.
R. (2017a). O-GlcNAc modification inhibits the calpain-mediated cleavage of α-synuclein.
Bioorganic & Medicinal Chemistry, 25(18), 4977–4982.
https://doi.org/10.1016/j.bmc.2017.04.038

Levine, P. M., Galesic, A., Balana, A. T., Mahul-Mellier, A.-L. L., Navarro, M. X., De Leon, C.
A., Lashuel, H. A., & Pratt, M. R. (2019). α-Synuclein O-GlcNAcylation alters aggregation and
toxicity, revealing certain residues as potential inhibitors of Parkinson’s disease. Proceedings of
the National Academy of Sciences, 116(5), 1511–1519. https://doi.org/10.1073/pnas.1808845116

Levine, Z. G., Fan, C., Melicher, M. S., Orman, M., Benjamin, T., & Walker, S. (2018). O-GlcNAc
Transferase Recognizes Protein Substrates Using an Asparagine Ladder in the Tetratricopeptide
Repeat (TPR) Superhelix. Journal of the American Chemical Society, 140(10), 3510–3513.
https://doi.org/10.1021/jacs.7b13546

Lewis, J., McGowan, E., Rockwood, J., Melrose, H., Nacharaju, P., Van Slegtenhorst, M., Gwinn-
Hardy, K., Murphy, M. P., Baker, M., Yu, X., Duff, K., Hardy, J., Corral, A., Lin, W.-L., Yen, S.-
H., Dickson, D. W., Davies, P., & Hutton, M. (2000). Neurofibrillary tangles, amyotrophy and
progressive motor disturbance in mice expressing mutant (P301L) tau protein. Nature Genetics,
25(4), 402–405. https://doi.org/10.1038/78078

282
Lewis, Y. E., Galesic, A., Levine, P. M., De Leon, C. A., Lamiri, N., Brennan, C. K., & Pratt, M.
R. (2017). O-GlcNAcylation of α-Synuclein at Serine 87 Reduces Aggregation without Affecting
Membrane Binding. ACS Chemical Biology, 12(4), 1020–1027.
https://doi.org/10.1021/acschembio.7b00113

Li, B., Li, H., Hu, C.-W. W., & Jiang, J. (2017). Structural insights into the substrate binding
adaptability and specificity of human O-GlcNAcase. Nature Communications, 8(1), 1–5.
https://doi.org/10.1038/s41467-017-00865-1

Li, B., Li, H., Lu, L., & Jiang, J. (2017). Structures of human O-GlcNAcase and its complexes
reveal a new substrate recognition mode. Nature Structural & Molecular Biology, 24(4), 362–369.
https://doi.org/10.1038/nsmb.3390

Li, H.-T., Du, H.-N., Tang, L., Hu, J., & Hu, H.-Y. (2002). Structural transformation and
aggregation of human α-synuclein in trifluoroethanol: Non-amyloid component sequence is
essential and β-sheet formation is prerequisite to aggregation. Biopolymers, 64(4), 221–226.
https://doi.org/https://doi.org/10.1002/bip.10179

Li, J., Li, Z., Duan, X., Qin, K., Dang, L., Sun, S., Cai, L., Hsieh-Wilson, L. C., Wu, L., & Yi, W.
(2019). An Isotope-Coded Photocleavable Probe for Quantitative Profiling of Protein O-
GlcNAcylation. ACS Chemical Biology, 14(1), 4–10.
https://doi.org/10.1021/acschembio.8b01052

283
Li, Xinghui, Gong, W., Wang, H., Li, T., Attri, K. S., Lewis, R. E., Kalil, A. C., Bhinderwala, F.,
Powers, R., Yin, G., Herring, L. E., Asara, J. M., Lei, Y. L., Yang, X., Rodriguez, D. A., Yang,
M., Green, D. R., Singh, P. K., & Wen, H. (2019). O-GlcNAc Transferase Suppresses
Inflammation and Necroptosis by Targeting Receptor-Interacting Serine/Threonine-Protein
Kinase 3. Immunity, 50(3), 576-590.e6. https://doi.org/10.1016/j.immuni.2019.01.007

Li, Xinghui, Zhang, Z., Li, L., Gong, W., Lazenby, A. J., Swanson, B. J., Herring, L. E., Asara, J.
M., Singer, J. D., & Wen, H. (2017). Myeloid-derived cullin 3 promotes STAT3 phosphorylation
by inhibiting OGT expression and protects against intestinal inflammation. The Journal of
Experimental Medicine, 214(4), 1093–1109. https://doi.org/10.1084/jem.20161105

Li, Xu, Lu, F., Wang, J.-Z., & Gong, C.-X. (2006). Concurrent alterations of O-GlcNAcylation
and phosphorylation of tau in mouse brains during fasting. European Journal of Neuroscience,
23(8), 2078–2086. https://doi.org/https://doi.org/10.1111/j.1460-9568.2006.04735.x

Li, Y., Xie, M., Men, L., & Du, J. (2019). O-GlcNAcylation in immunity and inflammation: An
intricate system (Review). International Journal of Molecular Medicine, 44(2), 363–374.
https://doi.org/10.3892/ijmm.2019.4238

Lim, Hong, K., Ha, C. H., & Chang, H. I. (2002). Production of O-GlcNAc Modified Recombinant
proteins in Escherichia coli. Journalof Microbiology and Biotechnology, 12(2), 306–311.
https://doi.org/10.1590/S1415-47572004000300022

284
Lim, S., Haque, M. M., Nam, G., Ryoo, N., Rhim, H., & Kim, Y. K. (2015). Monitoring of
intracellular tau aggregation regulated by OGA/OGT inhibitors. International Journal of
Molecular Sciences, 16(9), 20212–20224. https://doi.org/10.3390/ijms160920212

Liu, C., & Li, J. (2018). O-GlcNAc: A Sweetheart of the Cell Cycle and DNA Damage Response.
Frontiers in Endocrinology, 9, 415. https://doi.org/10.3389/fendo.2018.00415

Liu, Fei, Iqbal, K., Grundke-Iqbal, I., Hart, G. W., & Gong, C. X. (2004). O-GlcNAcylation
regulates phosphorylation of tau: A mechanism involved in Alzheimer’s disease. Proceedings of
the National Academy of Sciences of the United States of America, 101(29), 10804–10809.
https://doi.org/10.1073/pnas.0400348101

Liu, Fei, Shi, J., Tanimukai, H., Gu, J., Gu, J., Grundke-Iqbal, I., Iqbal, K., & Gong, C. X. (2009).
Reduced O-GlcNAcylation links lower brain glucose metabolism and tau pathology in
Alzheimer’s disease. Brain, 132(7), 1820–1832. https://doi.org/10.1093/brain/awp099

Liu, K., Paterson, A. J., Konrad, R. J., Parlow, A. F., Jimi, S., Roh, M., Chin, E., & Kudlow, J. E.
(2002). Streptozotocin, an O-GlcNAcase inhibitor, blunts insulin and growth hormone secretion.
Molecular and Cellular Endocrinology, 194(1), 135–146.
https://doi.org/https://doi.org/10.1016/S0303-7207(02)00155-7

285
Liu, T.-W. W., Zandberg, W. F., Gloster, T. M., Deng, L., Murray, K. D., Shan, X., & Vocadlo,
D. J. (2018). Metabolic Inhibitors of O-GlcNAc Transferase That Act In Vivo Implicate Decreased
O-GlcNAc Levels in Leptin-Mediated Nutrient Sensing. Angewandte Chemie International
Edition, 57(26), 7644–7648. https://doi.org/10.1002/anie.201803254

Liu, Ying, Li, X., Yu, Y., Shi, J., Liang, Z., Run, X., Li, Y., Dai, C. ling, Grundke-Iqbal, I., Iqbal,
K., Liu, F., & Gong, C. X. (2012). Developmental regulation of protein O-GlcNAcylation, O-
GlcNAc transferase, and O-GlcNAcase in mammalian brain. PLoS ONE, 7(8), 1–13.
https://doi.org/10.1371/journal.pone.0043724

Liu, Yubo, Ren, Y., Cao, Y., Huang, H., Wu, Q., Li, W., Wu, S., & Zhang, J. (2017). Discovery
of a Low Toxicity O-GlcNAc Transferase (OGT) Inhibitor by Structure-based Virtual Screening
of Natural Products. Scientific Reports, 7(1), 1–11. https://doi.org/10.1038/s41598-017-12522-0
Lnenicek-Allen, M., Read, C. M., & Crane-Robinson, C. (1996). The DNA bend angle and binding
affinity of an HMG box increased by the presence of short terminal arms. Nucleic Acids Research,
24(6), 1047–1051. https://doi.org/10.1093/nar/24.6.1047

Love, D. C., & Hanover, J. A. (2005). The hexosamine signaling pathway: deciphering the “O-
GlcNAc code”. Science’s STKE : Signal Transduction Knowledge Environment, 2005(312), 10–
14. https://doi.org/10.1126/stke.3122005re13

286
Lubas, W. A., Frank, D. W., Krause, M., & Hanover, J. A. (1997). O-linked GlcNAc transferase
is a conserved nucleocytoplasmic protein containing tetratricopeptide repeats. Journal of
Biological Chemistry, 272(14), 9316–9324. https://doi.org/10.1074/jbc.272.14.9316

Lubas, W. A., & Hanover, J. A. (2000). Functional Expression of O -linked GlcNAc Transferase.
Journal of Biological Chemistry, 275(15), 10983–10988.
https://doi.org/10.1074/jbc.275.15.10983

Luk, K. C., Covell, D. J., Kehm, V. M., Zhang, B., Song, I. Y., Byrne, M. D., Pitkin, R. M., Decker,
S. C., Trojanowski, J. Q., & Lee, V. M. Y. (2016). Molecular and Biological Compatibility with
Host Alpha-Synuclein Influences Fibril Pathogenicity. Cell Reports, 16(12), 3373–3387.
https://doi.org/10.1016/j.celrep.2016.08.053

Luk, K. C., Song, C., O'Brien, P., Stieber, A., Branch, J. R., Brunden, K. R., Trojanowski, J. Q.,
& Lee, V. M.-Y. (2009). Exogenous α-synuclein fibrils seed the formation of Lewy body-like
intracellular inclusions in cultured cells. Proceedings of the National Academy of Sciences,
106(47), 20051 LP – 20056. https://doi.org/10.1073/pnas.0908005106

Ma, J., & Hart, G. W. (2014). O-GlcNAc profiling: from proteins to proteomes. Clinical
Proteomics, 11(1), 1–16. https://doi.org/10.1186/1559-0275-11-8

287
Ma, Z., Vocadlo, D. J., & Vosseller, K. (2013). Hyper-O-GlcNAcylation is anti-apoptotic and
maintains constitutive NF-κB activity in pancreatic cancer cells. The Journal of Biological
Chemistry, 288(21), 15121–15130. https://doi.org/10.1074/jbc.M113.470047

Macauley, M. S., Bubb, A. K., Martinez-Fleites, C., Davies, G. J., & Vocadlo, D. J. (2008).
Elevation of Global O-GlcNAc Levels in 3T3-L1 Adipocytes by Selective Inhibition of O-
GlcNAcase Does Not Induce Insulin Resistance*. Journal of Biological Chemistry, 283(50),
34687–34695. https://doi.org/https://doi.org/10.1074/jbc.M804525200

Macauley, M. S., Shan, X., Yuzwa, S. A., Gloster, T. M., & Vocadlo, D. J. (2010). Elevation of
Global O-GlcNAc in Rodents Using a Selective O-GlcNAcase Inhibitor Does Not Cause Insulin
Resistance or Perturb Glucohomeostasis. Chemistry & Biology, 17(9), 949–958.
https://doi.org/https://doi.org/10.1016/j.chembiol.2010.07.005

Macauley, M. S., Stubbs, K. A., & Vocadlo, D. J. (2005). O-GlcNAcase catalyzes cleavage of
thioglycosides without general acid catalysis. Journal of the American Chemical Society, 127(49),
17202–17203. https://doi.org/10.1021/ja0567687

Macleod, R., Hillert, E. K., Cameron, R. T., & Baillie, G. S. (2015). The role and therapeutic
targeting of α-, β-and γ-secretase in Alzheimer’s disease. Future Science OA, 1(3).
https://doi.org/10.4155/fso.15.9

288
Mahul-Mellier, A.-L. L., Burtscher, J., Maharjan, N., Weerens, L., Croisier, M., Kuttler, F., Leleu,
M., Knott, G. W., & Lashuel, H. A. (2020). The process of Lewy body formation, rather than
simply α-synuclein fibrillization, is one of the major drivers of neurodegeneration. Proceedings of
the National Academy of Sciences of the United States of America, 117(9), 4971–4982.
https://doi.org/10.1073/pnas.1913904117

Mainz, A., Peschek, J., Stavropoulou, M., Back, K. C., Bardiaux, B., Asami, S., Prade, E., Peters,
C., Weinkauf, S., Buchner, J., & Reif, B. (2015). The chaperone αb-crystallin uses different
interfaces to capture an amorphous and an amyloid client. Nature Structural and Molecular
Biology, 22(11), 898–905. https://doi.org/10.1038/nsmb.3108

Maiti, P., Manna, J., Dunbar, G. L., Maiti, P., & Dunbar, G. L. (2017). Current understanding of
the molecular mechanisms in Parkinson’s disease: Targets for potential treatments. Translational
Neurodegeneration, 6(1), 1–35. https://doi.org/10.1186/s40035-017-0099-z

Mandke, P., & Vasquez, K. M. (2019). Interactions of high mobility group box protein 1 (HMGB1)
with nucleic acids: Implications in DNA repair and immune responses. DNA Repair, 83, 102701.
https://doi.org/https://doi.org/10.1016/j.dnarep.2019.102701

Mantovani, F., Covaceuszach, S., Rustighi, A., Sgarra, R., Heath, C., Goodwin, G. H., &
Manfioletti, G. (1998). NF-κB mediated transcriptional activation is enhanced by the architectural
factor HMGI-C. Nucleic Acids Research, 26(6), 1433–1439. https://doi.org/10.1093/nar/26.6.1433

289
Marotta, N. P., Lin, Y. H., Lewis, Y. E., Ambroso, M. R., Zaro, B. W., Roth, M. T., Arnold, D.
B., Langen, R., & Pratt, M. R. (2015). O-GlcNAc modification blocks the aggregation and toxicity
of the protein α-synuclein associated with Parkinson’s disease. Nature Chemistry, 7(11), 913–920.
https://doi.org/10.1038/nchem.2361

Marsh, S. A., Powell, P. C., Dell’italia, L. J., & Chatham, J. C. (2013). Cardiac O-GlcNAcylation
blunts autophagic signaling in the diabetic heart. Life Sciences, 92(11), 648–656.
https://doi.org/10.1016/j.lfs.2012.06.011

Martin, S. E. S. S., Tan, Z.-W. W., Itkonen, H. M., Duveau, D. Y., Paulo, J. A., Janetzko, J., Boutz,
P. L., Törk, L., Moss, F. A., Thomas, C. J., Gygi, S. P., Lazarus, M. B., & Walker, S. (2018).
Structure-Based Evolution of Low Nanomolar O-GlcNAc Transferase Inhibitors. Journal of the
American Chemical Society, 140(42), 13542–13545. https://doi.org/10.1021/jacs.8b07328

Matveenko, M., Cichero, E., Fossa, P., & Becker, C. F. W. (2016). Impaired Chaperone Activity
of Human Heat Shock Protein Hsp27 Site-Specifically Modified with Argpyrimidine. Angewandte
Chemie - International Edition, 55(38), 11397–11402. https://doi.org/10.1002/anie.201605366

Maynard, J. C., Burlingame, A. L., & Medzihradszky, K. F. (2016). Cysteine S-linked N-
acetylglucosamine (S-GlcNAcylation), a new post-translational modification in Mammals.
Molecular and Cellular Proteomics, 15(11), 3405–3411.
https://doi.org/10.1074/mcp.M116.061549

290
Mbefo, M. K., Paleologou, K. E., Boucharaba, A., Oueslati, A., Schell, H., Fournier, M.,
Olschewski, D., Yin, G., Zweckstetter, M., Masliah, E., Kahle, P. J., Hirling, H., & Lashuel, H. A.
(2010). Phosphorylation of synucleins by members of the polo-like kinase family. Journal of
Biological Chemistry, 285(4), 2807–2822. https://doi.org/10.1074/jbc.M109.081950

McDonald, E. T., Bortolus, M., Koteiche, H. A., & McHaourab, H. S. (2012). Sequence, structure,
and dynamic determinants of Hsp27 (HspB1) equilibrium dissociation are encoded by the N-
terminal domain. Biochemistry, 51(6), 1257–1268. https://doi.org/10.1021/bi2017624

Menzies, F. M., Fleming, A., Caricasole, A., Bento, C. F., Andrews, S. P., Ashkenazi, A.,
Füllgrabe, J., Jackson, A., Jimenez Sanchez, M., Karabiyik, C., Licitra, F., Lopez Ramirez, A.,
Pavel, M., Puri, C., Renna, M., Ricketts, T., Schlotawa, L., Vicinanza, M., Won, H., …
Rubinsztein, D. C. (2017). Autophagy and Neurodegeneration: Pathogenic Mechanisms and
Therapeutic Opportunities. Neuron, 93(5), 1015–1034.
https://doi.org/10.1016/j.neuron.2017.01.022

Mergenthaler, P., Lindauer, U., Dienel, G. A., & Meisel, A. (2013). Sugar for the brain: The role
of glucose in physiological and pathological brain function. Trends in Neurosciences, 36(10), 587–
597. https://doi.org/10.1016/j.tins.2013.07.001

Merlini, M., Meyer, E. P., Ulmann-Schuler, A., & Nitsch, R. M. (2011). Vascular β-amyloid and
early astrocyte alterations impair cerebrovascular function and cerebral metabolism in transgenic
arcAβ mice. Acta Neuropathologica, 122(3), 293–311. https://doi.org/10.1007/s00401-011-0834-
291
Mertins, P., Yang, F., Liu, T., Mani, D. R., Petyuk, V. A., Gillette, M. A., Clauser, K. R., Qiao, J.
W., Gritsenko, M. A., Moore, R. J., Levine, D. A., Townsend, R., Erdmann-Gilmore, P., Snider,
J. E., Davies, S. R., Ruggles, K. V, Fenyo, D., Kitchens, R. T., Li, S., … Carr, S. A. (2014).
Ischemia in tumors induces early and sustained phosphorylation changes in stress kinase pathways
but does not affect global protein levels. Molecular & Cellular Proteomics : MCP, 13(7), 1690–
1704. https://doi.org/10.1074/mcp.M113.036392

Metanis, N., Keinan, E., & Dawson, P. E. (2010). Traceless Ligation of Cysteine Peptides Using
Selective Deselenization. Angewandte Chemie International Edition, 49(39), 7049–7053.
https://doi.org/https://doi.org/10.1002/anie.201001900

Meziane, H., Dodart, J. C., Mathis, C., Little, S., Clemens, J., Paul, S. M., & Ungerer, A. (1998).
Memory-enhancing effects of secreted forms of the β-amyloid precursor protein in normal and
amnestic mice. Proceedings of the National Academy of Sciences of the United States of America,
95(21), 12683–12688. https://doi.org/10.1073/pnas.95.21.12683

Morgan, J. R., Zhao, X., Womack, M., Prasad, K., Augustine, G. J., & Lafer, E. M. (1999). A Role
for the Clathrin Assembly Domain of AP180 in Synaptic Vesicle Endocytosis. The Journal of
Neuroscience, 19(23), 10201 LP – 10212. https://doi.org/10.1523/JNEUROSCI.19-23-
10201.1999

292
Morris, M., Knudsen, G. M., Maeda, S., Trinidad, J. C., Ioanoviciu, A., Burlingame, A. L., &
Mucke, L. (2015). Tau post-translational modifications in wild-type and human amyloid precursor
protein transgenic mice. Nature Neuroscience, 18(8), 1183–1189. https://doi.org/10.1038/nn.4067

Muir, T. W., Sondhi, D., & Cole, P. A. (1998). Expressed protein ligation: A general method for
protein engineering. Proceedings of the National Academy of Sciences, 95(12), 6705–6710.
https://doi.org/10.1073/pnas.95.12.6705

Mukherjee, A., & Vasquez, K. M. (2016). HMGB1 interacts with XPA to facilitate the processing
of DNA interstrand crosslinks in human cells. Nucleic Acids Research, 44(3), 1151–1160.
https://doi.org/10.1093/nar/gkv1183

Murphy IV, F. V., Murphy, F. V, Sweet, R. M., & Churchill, M. E. A. (1999). The structure of a
chromosomal high mobility group protein-DNA complex reveals sequence-neutral mechanisms
important for non-sequence-specific DNA recognition. The EMBO Journal, 18(23), 6610–6618.
https://doi.org/10.1093/emboj/18.23.6610

Murphy, J. E., Hanover, J. A., Froehlich, M., DuBois, G., & Keen, J. H. (1994). Clathrin assembly
protein AP-3 is phosphorylated and glycosylated on the 50-kDa structural domain. Journal of
Biological Chemistry, 269(33), 21346–21352. https://doi.org/10.1016/s0021-9258(17)31968-3

293
Mymrikov, E. V, Daake, M., Richter, B., Haslbeck, M., & Buchner, J. (2017). The Chaperone
Activity and Substrate Spectrum of Human Small Heat Shock Proteins*. Journal of Biological
Chemistry, 292(2), 672–684. https://doi.org/https://doi.org/10.1074/jbc.M116.760413

Nappi, L., Aguda, A. H., Nakouzi, N. A., Lelj-Garolla, B., Beraldi, E., Lallous, N., Thi, M., Moore,
S., Fazli, L., Battsogt, D., Stief, S., Ban, F., Nguyen, N. T., Saxena, N., Dueva, E., Zhang, F.,
Yamazaki, T., Zoubeidi, A., Cherkasov, A., … Gleave, M. (2020). Ivermectin inhibits HSP27 and
potentiates efficacy of oncogene targeting in tumor models. J Clin Invest, 130, 699–714.

Neddens, J., Temmel, M., Flunkert, S., Kerschbaumer, B., Hoeller, C., Loeffler, T., Niederkofler,
V., Daum, G., Attems, J., & Hutter-Paier, B. (2018). Phosphorylation of different tau sites during
progression of Alzheimer’s disease. Acta Neuropathologica Communications, 6(1), 52.
https://doi.org/10.1186/s40478-018-0557-6

Negro, A., Brunati, A. M., Donella-Deana, A., Massimino, M. L., & Pinna, L. A. (2002). Multiple
phosphorylation of α-synuclein by protein tyrosine kinase Syk prevents eosin-induced
aggregation. The FASEB Journal, 16(2), 1–22. https://doi.org/https://doi.org/10.1096/fj.01-
0517fje

Niederacher, G., Urwin, D., Dijkwel, Y., Tremethick, D. J., Rosengren, K. J., Becker, C. F. W., &
Conibear, A. C. (2021). Site-specific modification and segmental isotope labelling of HMGN1
reveals long-range conformational perturbations caused by posttranslational modifications. RSC
Chemical Biology, 2(2), 537–550. https://doi.org/10.1039/D0CB00175A
294
O’Brien, R. J., & Wong, P. C. (2011). Amyloid precursor protein processing and Alzheimer’s
disease. Annual Review of Neuroscience, 34, 185–204. https://doi.org/10.1146/annurev-neuro-
061010-113613

O’Donnell, N., Zachara, N. E., Hart, G. W., & Marth, J. D. (2004). Ogt-Dependent X-
Chromosome-Linked Protein Glycosylation Is a Requisite Modification in Somatic Cell Function
and Embryo Viability. Molecular and Cellular Biology, 24(4), 1680–1690.
https://doi.org/10.1128/mcb.24.4.1680-1690.2004

Ohndorf, U.-M., Rould, M. A., He, Q., Pabo, C. O., & Lippard, S. J. (1999). Basis for recognition
of cisplatin-modified DNA by high-mobility-group proteins. Nature, 399(6737), 708–712.
https://doi.org/10.1038/21460

Ohnishi, Y., Ichikawa, M., & Ichikawa, Y. (2000). Facile synthesis of N-Fmoc-serine-S-GlcNAc:
a potential molecular probe for the functional study of O-GlcNAc. Bioorganic & Medicinal
Chemistry Letters, 10(11), 1289–1291. https://doi.org/10.1016/s0960-894x(00)00223-7

Okuyama, R., & Marshall, S. (2003). UDP-N-acetylglucosaminyl transferase (OGT) in brain
tissue: Temperature sensitivity and subcellular distribution of cytosolic and nuclear enzyme.
Journal of Neurochemistry, 86(5), 1271–1280. https://doi.org/10.1046/j.1471-4159.2003.01939.x

295
Oueslati, A. (2016). Implication of Alpha-Synuclein Phosphorylation at S129 in
Synucleinopathies: What Have We Learned in the Last Decade? Journal of Parkinson’s Disease,
6(1), 39–51. https://doi.org/10.3233/JPD-160779

Ovchinnikov, S., Park, H., Varghese, N., Huang, P. S., Pavlopoulos, G. A., Kim, D. E., Kamisetty,
H., Kyrpides, N. C., & Baker, D. (2017). Protein structure determination using metagenome
sequence data. Science, 355(6322), 294–298. https://doi.org/10.1126/science.aah4043

Paleologou, K. E., Oueslati, A., Shakked, G., Rospigliosi, C. C., Kim, H. Y., Lamberto, G. R.,
Fernandez, C. O., Schmid, A., Chegini, F., Gai, W. P., Chiappe, D., Moniatte, M., Schneider, B.
L., Aebischer, P., Eliezer, D., Zweckstetter, M., Masliah, E., & Lashuel, H. A. (2010).
Phosphorylation at S87 is enhanced in synucleinopathies, inhibits α-synuclein oligomerization,
and influences synuclein-membrane interactions. Journal of Neuroscience, 30(9), 3184–3198.
https://doi.org/10.1523/JNEUROSCI.5922-09.2010

Park, J., Ha, H.-J., Chung, E. S., Baek, S. H., Cho, Y., Kim, H. K., Han, J., Sul, J. H., Lee, J., Kim,
E., Kim, J., Yang, Y. R., Park, M., Kim, S. H., Arumugam, T. V., Jang, H., Seo, S. W., Suh, P.-
G., & Jo, D.-G. (2021). O -GlcNAcylation ameliorates the pathological manifestations of
Alzheimer’s disease by inhibiting necroptosis . Science Advances, 7(3), eabd3207.
https://doi.org/10.1126/sciadv.abd3207

296
Park, S., Lee, Y., Pak, J. W., Kim, H., Choi, H., Kim, J., Roth, J., & Cho, J. W. (2015). O-GlcNAc
modification is essential for the regulation of autophagy in Drosophila melanogaster. Cellular and
Molecular Life Sciences, 72(16), 3173–3183. https://doi.org/10.1007/s00018-015-1889-z

Parzych, K. R., & Klionsky, D. J. (2014). An overview of autophagy: morphology, mechanism,
and regulation. Antioxidants & Redox Signaling, 20(3), 460–473.
https://doi.org/10.1089/ars.2013.5371

Pasta, S. Y., Raman, B., Ramakrishna, T., & Rao, C. M. (2004). The IXI/V motif in the C-terminal
extension of α-crystallins: Alternative interactions and oligomeric assemblies. Molecular Vision,
10, 655–662.

Pathak, S., Alonso, J., Schimpl, M., Rafie, K., Blair, D. E., Borodkin, V. S., Schüttelkopf, A. W.,
Albarbarawi, O., & Van Aalten, D. M. F. F. (2015). The active site of O-GlcNAc transferase
imposes constraints on substrate sequence. Nature Structural and Molecular Biology, 22(9), 744–
749. https://doi.org/10.2210/pdb5bnw/pdb

Pedowitz, N. J., & Pratt, M. R. (2021). Design and synthesis of metabolic chemical reporters for
the visualization and identification of glycoproteins. RSC Chemical Biology, 2(2), 306–321.
https://doi.org/10.1039/D1CB00010A

297
Pekkurnaz, G., Trinidad, J. C., Wang, X., Kong, D., & Schwarz, T. L. (2014). Glucose regulates
mitochondrial motility via Milton modification by O-GlcNAc transferase. Cell, 158(1), 54–68.
https://doi.org/10.1016/j.cell.2014.06.007

Pekny, M., Wilhelmsson, U., & Pekna, M. (2014). The dual role of astrocyte activation and
reactive gliosis. Neuroscience Letters, 565, 30–38.
https://doi.org/https://doi.org/10.1016/j.neulet.2013.12.071

Peng, C., Gathagan, R. J., Covell, D. J., Medellin, C., Stieber, A., Robinson, J. L., Zhang, B.,
Pitkin, R. M., Olufemi, M. F., Luk, K. C., Trojanowski, J. Q., & Lee, V. M. (2018). Cellular milieu
imparts distinct pathological α-synuclein strains in α-synucleinopathies. Nature.
https://doi.org/10.1038/s41586-018-0104-4

Peng, C., Gathagan, R. J., & Lee, V. M.-Y. (2017). Distinct alpha-Synuclein strains and
implications for heterogeneity among alpha-Synucleinopathies. Neurobiology of Disease.
https://doi.org/10.1016/j.nbd.2017.07.018

Peng, C., Trojanowski, J. Q., & Lee, V. M. Y. (2020). Protein transmission in neurodegenerative
disease. Nature Reviews Neurology, 16(4), 199–212. https://doi.org/10.1038/s41582-020-0333-7
Pereda, A. E. (2014). Electrical synapses and their functional interactions with chemical synapses.
Nature Reviews Neuroscience, 15(4), 250–263. https://doi.org/10.1038/nrn3708

298
Piccoli, G., Condliffe, S. B., Bauer, M., Giesert, F., Boldt, K., De Astis, S., Meixner, A., Sarioglu,
H., Vogt-Weisenhorn, D. M., Wurst, W., Gloeckner, C. J., Matteoli, M., Sala, C., & Ueffing, M.
(2011). LRRK2 controls synaptic vesicle storage and mobilization within the recycling pool. The
Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 31(6), 2225–2237.
https://doi.org/10.1523/JNEUROSCI.3730-10.2011

Pil, P. M., Chow, C. S., & Lippard, S. J. (1993). High-mobility-group 1 protein mediates DNA
bending as determined by ring closures. Proceedings of the National Academy of Sciences, 90(20),
9465–9469. https://doi.org/10.1073/pnas.90.20.9465

Pinho, T. S., Correia, S. C., Perry, G., Ambrósio, A. F., & Moreira, P. I. (2019a). Diminished O-
GlcNAcylation in Alzheimer’s disease is strongly correlated with mitochondrial anomalies.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 1865(8), 2048–2059.
https://doi.org/https://doi.org/10.1016/j.bbadis.2018.10.037

Pinho, T. S., Correia, S. C., Perry, G., Ambrósio, A. F., & Moreira, P. I. (2019b). Diminished O-
GlcNAcylation in Alzheimer’s disease is strongly correlated with mitochondrial anomalies.
Biochimica et Biophysica Acta - Molecular Basis of Disease, 1865(8), 2048–2059.
https://doi.org/10.1016/j.bbadis.2018.10.037

Pinkus, L. M. B. T.-M. in E. (1977). [45] Glutamine binding sites. In M. W. Edited by William B.
Jakoby (Ed.), Affinity labeling (Vol. 46, pp. 414–427). Academic Press.
https://doi.org/https://doi.org/10.1016/S0076-6879(77)46049-X
299
Poewe, W., Seppi, K., Tanner, C. M., Halliday, G. M., Brundin, P., Volkmann, J., Schrag, A. E.,
& Lang, A. E. (2017). Parkinson disease. Nature Reviews Disease Primers, 3, 1–21.
https://doi.org/10.1038/nrdp.2017.13

Qiu, C., Kivipelto, M., & von Strauss, E. (2009). Epidemiology of Alzheimer’s disease:
occurrence, determinants, and strategies toward intervention. Dialogues in Clinical Neuroscience,
11(2), 111–128. https://doi.org/10.31887/DCNS.2009.11.2/cqiu

Rafie, K., Gorelik, A., Trapannone, R., Borodkin, V. S., & Van Aalten, D. M. F. (2018). Thio-
Linked UDP-Peptide Conjugates as O-GlcNAc Transferase Inhibitors. Bioconjugate Chemistry,
29(6), 1834–1840. https://doi.org/10.1021/acs.bioconjchem.8b00194

Rafie, K., Raimi, O., Ferenbach, A. T., Borodkin, V. S., Kapuria, V., & van Aalten, D. M. F. F.
(2017). Recognition of a glycosylation substrate by the O-GlcNAc transferase TPR repeats. Open
Biology, 7(6), 170078. https://doi.org/10.1098/rsob.170078

Raj, R., Lercher, L., Mohammed, S., & Davis, B. G. (2016). Synthetic Nucleosomes Reveal that
GlcNAcylation Modulates Direct Interaction with the FACT Complex. Angewandte Chemie
(International Ed. in English), 55(31), 8918–8922. https://doi.org/10.1002/anie.201603106

Raman, B., Ban, T., Sakai, M., Pasta, S. Y., Ramakrishna, T., Naiki, H., Goto, Y., & Rao, C. M.
(2005). AlphaB-crystallin, a small heat-shock protein, prevents the amyloid fibril growth of an
amyloid beta-peptide and beta2-microglobulin. Biochem J, 392, 573–581.
300
Rambaruth, N. D., Greenwell, P., & Dwek, M. V. (2012). The lectin Helix pomatia agglutinin
recognizes O-GlcNAc containing glycoproteins in human breast cancer. Glycobiology, 22(6),
839–848. https://doi.org/10.1093/glycob/cws051

Ramirez, D. H., Aonbangkhen, C., Wu, H.-Y., Naftaly, J. A., Tang, S., O’Meara, T. R., & Woo,
C. M. (2020). Engineering a Proximity-Directed O-GlcNAc Transferase for Selective Protein O-
GlcNAcylation in Cells. ACS Chemical Biology, 15(4), 1059–1066.
https://doi.org/10.1021/acschembio.0c00074

Rauch, J. N., Tse, E., Freilich, R., Mok, S. A., Makley, L. N., Southworth, D. R., & Gestwicki, J.
E. (2017). BAG3 Is a Modular, Scaffolding Protein that physically Links Heat Shock Protein 70
(Hsp70) to the Small Heat Shock Proteins. Journal of Molecular Biology, 429(1), 128–141.
https://doi.org/10.1016/j.jmb.2016.11.013

Reddy, M. C., Christensen, J., & Vasquez, K. M. (2005). Interplay between Human High Mobility
Group Protein 1 and Replication Protein A on Psoralen-Cross-linked DNA. Biochemistry, 44(11),
4188–4195. https://doi.org/10.1021/bi047902n

Reiss, A. B., Arain, H. A., Stecker, M. M., Siegart, N. M., & Kasselman, L. J. (2018). Amyloid
toxicity in Alzheimer’s disease. Reviews in the Neurosciences, 29(6), 613–627.
https://doi.org/doi:10.1515/revneuro-2017-0063

301
Rekas, A., Adda, C., Aquilina, J., Barnham, K., Sunde, M., Galatis, D., Williamson, N., Masters,
C., Anders, R., Robinson, C., Cappai, R., & Carver, J. (2004). Interaction of the molecular
chaperone alphaB-crystallin with alpha-synuclein: effects on amyloid fibril formation and
chaperone activity. J Mol Biol, 340, 1167–1183.

Rexach, J. E., Rogers, C. J., Yu, S.-H. H., Tao, J., Sun, Y. E., & Hsieh-Wilson, L. C. (2010).
Quantification of O-glycosylation stoichiometry and dynamics using resolvable mass tags. Nature
Chemical Biology, 6(9), 645–651. https://doi.org/10.1038/nchembio.412

Roquemore, E. P., Dell, A., Panico, M., Reason, A. J., Savoy, L. A., Wistow, G. J., Zigler Jr, J. S.,
Earles, B. J., & Hart, G. W. (1992). Vertebrate lens alpha-crystallins are modified by O-linked N-
acetylglucosamine. Journal of Biological Chemistry, 267(1), 555–563.

Ross, C. A., & Poirier, M. A. (2004). Protein aggregation and neurodegenerative disease. Nature
Medicine, 10(7), S10. https://doi.org/10.1038/nm1066

Rostovtsev, V. V, Green, L. G., Fokin, V. V, & Sharpless, K. B. (2002). A stepwise huisgen
cycloaddition process: Copper(I)-catalyzed regioselective “ligation” of azides and terminal
alkynes. Angewandte Chemie - International Edition, 41(14), 2596–2599.
https://doi.org/10.1002/1521-3773(20020715)41:14<2596::AID-ANIE2596>3.0.CO;2-4

302
Roth, C., Chan, S., Offen, W. A., Hemsworth, G. R., Willems, L. I., King, D. T., Varghese, V.,
Britton, R., Vocadlo, D. J., & Davies, G. J. (2017). Structural and functional insight into human
O-GlcNAcase. Nature Chemical Biology, 13(6), 610–612. https://doi.org/10.1038/nchembio.2358

Ruan, H. Bin, Ma, Y., Torres, S., Zhang, B., Feriod, C., Heck, R. M., Qian, K., Fu, M., Li, X.,
Nathanson, M. H., Bennett, A. M., Nie, Y., Ehrlich, B. E., & Yang, X. (2017). Calcium-dependent
O-GlcNAc signaling drives liver autophagy in adaptation to starvation. Genes and Development,
31(16), 1655–1665. https://doi.org/10.1101/gad.305441.117

Ryan, J. M., Quattropani, A., Abd-Elaziz, K., den Daas, I., Schneider, M., Ousson, S., Neny, M.,
Sand, A., Hantson, J., Permanne, B., Wiessner, C., & Beher, D. (2018). O1-12-05: PHase 1 Study
In Healthy Volunteers Of The O-Glcnacase Inhibitor ASN120290 As A Novel Therapy For
Progressive Supranuclear Palsy And Related Tauopathies. Alzheimer’s & Dementia,
14(7S_Part_4), P251–P251. https://doi.org/https://doi.org/10.1016/j.jalz.2018.06.2400

Ryan, P., Xu, M., Davey, A. K., Danon, J. J., Mellick, G. D., Kassiou, M., & Rudrawar, S. (2019).
O-GlcNAc Modification Protects against Protein Misfolding and Aggregation in
Neurodegenerative Disease. ACS Chemical Neuroscience, 10(5), 2209–2221.
https://doi.org/10.1021/acschemneuro.9b00143

Saheki, Y., & De Camilli, P. (2012). Synaptic vesicle endocytosis. Cold Spring Harbor
Perspectives in Biology, 4(9), a005645–a005645. https://doi.org/10.1101/cshperspect.a005645

303
Sandhu, P., Lee, J., Ballard, J., Walker, B., Ellis, J., Marcus, J., Toolan, D., Dreyer, D., McAvoy,
T., Duffy, J., Michener, M., Valiathan, C., Trainor, N., Savage, M., McEachern, E., Vocadlo, D.,
Smith, S. M., & Struyk, A. (2016). P4-036: Pharmacokinetics and Pharmacodynamics to Support
Clinical Studies of MK-8719: an O-Glcnacase Inhibitor for Progressive Supranuclear Palsy.
Alzheimer’s & Dementia, 12(7S_Part_21), P1028–P1028.
https://doi.org/https://doi.org/10.1016/j.jalz.2016.06.2125

Sassone, J., Serratto, G., Valtorta, F., Silani, V., Passafaro, M., & Ciammola, A. (2017). The
synaptic function of parkin. Brain, 140(9), 2265–2272. https://doi.org/10.1093/brain/awx006

Schimpl, M., Zheng, X., Borodkin, V. S., Blair, D. E., Ferenbach, A. T., Schüttelkopf, A. W.,
Navratilova, I., Aristotelous, T., Albarbarawi, O., Robinson, D. A., Macnaughtan, M. A., & van
Aalten, D. M. F. F. (2012). O-GlcNAc transferase invokes nucleotide sugar pyrophosphate
participation in catalysis. Nature Chemical Biology, 8(12), 969–974.
https://doi.org/10.1038/nchembio.1108

Schmeisser, K., & Parker, J. A. (2019). Pleiotropic effects of mTOR and autophagy during
development and aging. Frontiers in Cell and Developmental Biology, 7(SEP), 1–11.
https://doi.org/10.3389/fcell.2019.00192

304
Schmid, A. W., Fauvet, B., Moniatte, M., & Lashuel, H. A. (2013). Alpha-synuclein post-
translational modifications as potential biomarkers for Parkinson disease and other
synucleinopathies. Molecular & Cellular Proteomics : MCP, 12(12), 3543–3558.
https://doi.org/10.1074/mcp.R113.032730

Schwagerus, S., Reimann, O., Despres, C., Smet-Nocca, C., & Hackenberger, C. P. R. (2016).
Semi-synthesis of a tag-freeO-GlcNAcylated tau protein by sequential chemoselective ligation.
Journal of Peptide Science, 22(5), 327–333. https://doi.org/10.1002/psc.2870

Schweighauser, M., Shi, Y., Tarutani, A., Kametani, F., Murzin, A. G., Ghetti, B., Matsubara, T.,
Tomita, T., Ando, T., Hasegawa, K., Murayama, S., Yoshida, M., Hasegawa, M., Scheres, S. H.
W., & Goedert, M. (2020). Structures of α-synuclein filaments from multiple system atrophy.
Nature, February, 2020.02.05.935619. https://doi.org/10.1101/2020.02.05.935619

Schwein, P. A., & Woo, C. M. (2020). The O-GlcNAc Modification on Kinases. ACS Chemical
Biology, 15(3), 602–617. https://doi.org/10.1021/acschembio.9b01015

Se Thoe, E., Fauzi, A., Tang, Y. Q., Chamyuang, S., & Chia, A. Y. Y. (2021). A review on
advances of treatment modalities for Alzheimer’s disease. Life Sciences, 276, 119129.
https://doi.org/https://doi.org/10.1016/j.lfs.2021.119129

305
Selig, E. E., Zlatic, C. O., Cox, D., Mok, Y. F., Gooley, P. R., Ecroyd, H., & Griffin, M. D. W.
(2020). N- And C-terminal regions of aB-crystallin and Hsp27 mediate inhibition of amyloid
nucleation, fibril binding, and fibril disaggregation. Journal of Biological Chemistry, 295(29),
9838–9854. https://doi.org/10.1074/jbc.ra120.012748

Selnick, H. G., Hess, J. F., Tang, C., Liu, K., Schachter, J. B., Ballard, J. E., Marcus, J., Klein, D.
J., Wang, X., Pearson, M., Savage, M. J., Kaul, R., Li, T. S., Vocadlo, D. J., Zhou, Y., Zhu, Y.,
Mu, C., Wang, Y., Wei, Z., … McEachern, E. J. (2019). Discovery of MK-8719, a Potent O-
GlcNAcase Inhibitor as a Potential Treatment for Tauopathies. Journal of Medicinal Chemistry,
62(22), 10062–10097. https://doi.org/10.1021/acs.jmedchem.9b01090

Shafi, R., Iyer, S. P. N., Ellies, L. G., O’Donnell, N., Marek, K. W., Chui, D., Hart, G. W., &
Marth, J. D. (2000). The O-GlcNAc transferase gene resides on the X chromosome and is essential
for embryonic stem cell viability and mouse ontogeny. Proceedings of the National Academy of
Sciences of the United States of America, 97(11), 5735–5739.
https://doi.org/10.1073/pnas.100471497

Shafiei, S. S., Guerrero-Muñoz, M. J., & Castillo-Carranza, D. L. (2017). Tau Oligomers:
Cytotoxicity, Propagation, and Mitochondrial Damage. Frontiers in Aging Neuroscience, 9, 83.
https://doi.org/10.3389/fnagi.2017.00083

306
Shah, N. H., Dann, G. P., Vila-Perelló, M., Liu, Z., & Muir, T. W. (2012). Ultrafast protein splicing
is common among cyanobacterial split inteins: Implications for protein engineering. Journal of the
American Chemical Society, 134(28), 11338–11341. https://doi.org/10.1021/ja303226x

Shang, S., Tan, Z., Dong, S., & Danishefsky, S. J. (2011). An advance in proline ligation. Journal
of the American Chemical Society, 133(28), 10784–10786. https://doi.org/10.1021/ja204277b

Sharif, S., Shi, J., Ruijtenbeek, R., & Pieters, R. J. (2019). Study of cross talk between
phosphatases and OGA on a ZO-3-derived peptide. Amino Acids, 51(4), 739–743.
https://doi.org/10.1007/s00726-019-02699-1

Sheflin, L. G., & Spaulding, S. W. (1989). High Mobility Group Protein 1 Preferentially Conserves
Torsion in Negatively Supercoiled DNA. Biochemistry, 28(13), 5658–5664.
https://doi.org/10.1021/bi00439a048

Shen, D. L., Gloster, T. M., Yuzwa, S. A., & Vocadlo, D. J. (2012). Insights into O-linked N-
acetylglucosamine (O-GlcNAc) processing and dynamics through kinetic analysis of O-GlcNAc
transferase and O-GlcNAcase activity on protein substrates. Journal of Biological Chemistry,
287(19), 15395–15408. https://doi.org/10.1074/jbc.M111.310664

Shi, J., Sharif, S., Ruijtenbeek, R., & Pieters, R. J. (2016). Activity Based High-Throughput
Screening for Novel O-GlcNAc Transferase Substrates Using a Dynamic Peptide Microarray.
PLOS ONE, 11(3), e0151085. https://doi.org/10.1371/journal.pone.0151085
307
Shi, J., Tomašič, T., Sharif, S., Brouwer, A. J., Anderluh, M., Ruijtenbeek, R., & Pieters, R. J.
(2017). Peptide microarray analysis of the cross-talk between O-GlcNAcylation and tyrosine
phosphorylation. FEBS Letters, 591(13), 1872–1883. https://doi.org/10.1002/1873-3468.12708

Simons, K. T., Bonneau, R., Ruczinski, I., & Baker, D. (1999). Ab initio protein structure
prediction of CASP III targets using ROSETTA. Proteins: Structure, Function and Genetics,
37(SUPPL. 3), 171–176. https://doi.org/10.1002/(SICI)1097-0134(1999)37:3+<171::AID-
PROT21>3.0.CO;2-Z

Smet-Nocca, C., Broncel, M., Wieruszeski, J. M., Tokarski, C., Hanoulle, X., Leroy, A., Landrieu,
I., Rolando, C., Lippens, G., & Hackenberger, C. P. R. (2011). Identification of O-GlcNAc sites
within peptides of the Tau protein and their impact on phosphorylation. Molecular BioSystems,
7(5), 1420–1429. https://doi.org/10.1039/c0mb00337a

Snow, C. M., Senior, A., & Gerace, L. (1987). Monoclonal antibodies identify a group of nuclear
pore complex glycoproteins. The Journal of Cell Biology, 104(5), 1143–1156.
https://doi.org/10.1083/jcb.104.5.1143

Soto, C., & Pritzkow, S. (2018). Protein misfolding, aggregation, and conformational strains in
neurodegenerative diseases. Nature Neuroscience, 21(10), 1332–1340.
https://doi.org/10.1038/s41593-018-0235-9

308
Stott, K., Tang, G. S. F., Lee, K. B., & Thomas, J. O. (2006). Structure of a Complex of Tandem
HMG Boxes and DNA. Journal of Molecular Biology, 360(1), 90–104.
https://doi.org/10.1016/j.jmb.2006.04.059

Strang, K. H., Croft, C. L., Sorrentino, Z. A., Chakrabarty, P., Golde, T. E., & Giasson, B. I. (2018).
Distinct differences in prion-like seeding and aggregation between Tau protein variants provide
mechanistic insights into tauopathies. The Journal of Biological Chemistry, 293(7), 2408–2421.
https://doi.org/10.1074/jbc.M117.815357

Štros, M. (2010). HMGB proteins: Interactions with DNA and chromatin. Biochimica et
Biophysica Acta - Gene Regulatory Mechanisms, 1799(1–2), 101–113.
https://doi.org/10.1016/j.bbagrm.2009.09.008

Štros, M., Štokrová, J., & Thomas, J. O. (1994). Dna looping by the HMG-box domains of HMG1
and modulation of DNA binding by the acidic C-terminal domain. Nucleic Acids Research, 22(6),
1044–1051. https://doi.org/10.1093/nar/22.6.1044

Stros, M. (1998). DNA Bending by the Chromosomal Protein HMG1 and Its High Mobility Group
Box Domains. The Journal of Biological Chemistry, 273(17), 10355–10361.
papers2://publication/uuid/C6A1AC1E-CEA8-4F05-863D-16F1AAA1F2EF

309
Stros, Michael, & Muselıkova, E. (2000). A Role of Basic Residues and the Putative Intercalating
Phenylalanine of the HMG-1 Box B in DNA Supercoiling and Binding to Four-way DNA
Junctions. Journal of Biological Chemistry, 275(46), 35699–35707.
https://doi.org/10.1074/jbc.M007167200

Sutrias-Grau, M., Bianchi, M. E., & Bernues, J. (1999). High Mobility Group Protein 1 Interacts
Specifically with the Core Domain of Human TATA Box-binding Protein and Interferes with
Transcription Factor IIB within the Pre-initiation Complex. 274(3), 1628–1634.
https://doi.org/10.1074/jbc.274.3.1628

Tallent, M. K., Varghis, N., Skorobogatko, Y., Hernandez-Cuebas, L., Whelan, K., Vocadlo, D.
J., & Vosseller, K. (2009). In vivo modulation of O-GIcNAc levels regulates hippocampal synaptic
plasticity through interplay with phosphorylation. Journal of Biological Chemistry, 284(1), 174–
181. https://doi.org/10.1074/jbc.M807431200

Tan, E. P., McGreal, S. R., Graw, S., Tessman, R., Koppel, S. J., Dhakal, P., Zhang, Z., Machacek,
M., Zachara, N. E., Koestler, D. C., Peterson, K. R., Thyfault, J. P., Swerdlow, R. H.,
Krishnamurthy, P., DiTacchio, L., Apte, U., & Slawson, C. (2017). Sustained O-GlcNAcylation
reprograms mitochondrial function to regulate energy metabolism. Journal of Biological
Chemistry, 292(36), 14940–14962. https://doi.org/10.1074/jbc.M117.797944

310
Tan, E. P., Villar, M. T., E, L., Lu, J., Selfridge, J. E., Artigues, A., Swerdlow, R. H., & Slawson,
C. (2014). Altering O-Linked β-N-Acetylglucosamine Cycling Disrupts Mitochondrial Function*.
Journal of Biological Chemistry, 289(21), 14719–14730.
https://doi.org/https://doi.org/10.1074/jbc.M113.525790

Taoufik, E., Kouroupi, G., Zygogianni, O., & Matsas, R. (2018). Synaptic dysfunction in
neurodegenerative and neurodevelopmental diseases: an overview of induced pluripotent stem-
cell-based disease models. Open Biology, 8(9), 180138. https://doi.org/10.1098/rsob.180138

Tarbet, H. J., Toleman, C. A., & Boyce, M. (2017). A Sweet Embrace: Control of Protein–Protein
Interactions by O-Linked β-N-Acetylglucosamine. Biochemistry, 57(1), 13–21.
https://doi.org/10.1021/acs.biochem.7b00871

Tarrant, M. K., Rho, H.-S. S., Xie, Z., Jiang, Y. L., Gross, C., Culhane, J. C., Yan, G., Qian, J.,
Ichikawa, Y., Matsuoka, T., Zachara, N., Etzkorn, F. A., Hart, G. W., Jeong, J. S., Blackshaw, S.,
Zhu, H., & Cole, P. A. (2012). Regulation of CK2 by phosphorylation and O-GlcNAcylation
revealed by semisynthesis. Nature Chemical Biology, 8(3), 262–269.
https://doi.org/10.1038/nchembio.771

Tashima, Y., & Stanley, P. (2014). Antibodies that detect o-linked β-D-N-Acetylglucosamine on
the extracellular domain of cell surface glycoproteins. Journal of Biological Chemistry, 289(16),
11132–11142. https://doi.org/10.1074/jbc.M113.492512

311
Tavassoly, O., Yue, J., & Vocadlo, D. J. (2020). Pharmacological inhibition and knockdown of O-
GlcNAcase reduces cellular internalization of α-synuclein preformed fibrils. FEBS Journal, 1–19.
https://doi.org/10.1111/febs.15349

Taylor, R. W., & Turnbull, D. M. (2005). Mitochondrial DNA mutations in human disease. Nature
Reviews Genetics, 6(5), 389–402. https://doi.org/10.1038/nrg1606

Teo, C. F., Ingale, S., Wolfert, M. A., Elsayed, G. A., Nöt, L. G., Chatham, J. C., Wells, L., &
Boons, G.-J. (2010a). Glycopeptide-specific monoclonal antibodies suggest new roles for O-
GlcNAc. Nature Chemical Biology, 6(5), 338–343. https://doi.org/10.1038/nchembio.338

Teo, S.-H. H., Grasser, K. D., & Thomas, J. O. (1995). Differences in the DNA-Binding Properties
of the HMG Box Domains of HMG1 and the Sex-Determining Factor SRY. European Journal of
Biochemistry, 230(3), 943–950. https://doi.org/10.1111/j.1432-1033.1995.0943g.x

Teo, S., Grasser, K. D., Hardman, C. H., Broadhurst, R. W., Laue, E. D., & Thomas, J. O. (1995).
Two mutations in the HMG-box with very different structural consequences provide insights into
the nature of binding to four-way junction DNA. 14(15), 3844–3853.
https://doi.org/10.1002/j.1460-2075.1995.tb00054.x

Thomas, J. O., & Stott, K. (2012). H1 and HMGB1: modulators of chromatin structure.
Biochemical Society Transactions, 40(2), 341–346. https://doi.org/10.1042/BST20120014

312
Thompson, R. E., & Muir, T. W. (2020). Chemoenzymatic Semisynthesis of Proteins. Chemical
Reviews, 120(6), 3051–3126. https://doi.org/10.1021/acs.chemrev.9b00450

Tofaris, G. K., Razzaq, A., Ghetti, B., Lilley, K. S., & Spillantini, M. G. (2003). Ubiquitination of
α-Synuclein in Lewy Bodies Is a Pathological Event Not Associated with Impairment of
Proteasome Function*. Journal of Biological Chemistry, 278(45), 44405–44411.
https://doi.org/https://doi.org/10.1074/jbc.M308041200

Toleman, C. A., Schumacher, M. A., Yu, S.-H., Zeng, W., Cox, N. J., Smith, T. J., Soderblom, E.
J., Wands, A. M., Kohler, J. J., & Boyce, M. (2018). Structural basis of O-GlcNAc recognition by
mammalian 14-3-3 proteins. Proceedings of the National Academy of Sciences, 115(23), 5956 LP
– 5961. https://doi.org/10.1073/pnas.1722437115

Törnquist, M., Michaels, T. C. T., Sanagavarapu, K., Yang, X., Meisl, G., Cohen, S. I. A.,
Knowles, T. P. J., & Linse, S. (2018). Secondary nucleation in amyloid formation. Chemical
Communications, 54(63), 8667–8684. https://doi.org/10.1039/C8CC02204F

Travers, A. A., Ner, S. S., & Churchill, M. E. A. (1994). DNA chaperones: A solution to a
persistence problem? Cell, 77(2), 167–169. https://doi.org/10.1016/0092-8674(94)90306-9

313
Ueda, K., Fukushima, H., Masliah, E., Xia, Y. U., Iwai, A., Yoshimoto, M., Otero, D. A. C.,
Kondo, J., Ihara, Y., & Saitoh, T. (1993). Molecular cloning of cDNA encoding an unrecognized
component of amyloid in Alzheimer disease (neurodegeneration/chaperone/amyloid P/A4
protein/neuritic plaque). Proc. Natl. Acad. Sci. USA, 90(December), 11282–11286.

Ulmer, T. S., Bax, A., Cole, N. B., & Nussbaum, R. L. (2005). Structure and dynamics of micelle-
bound human α-synuclein. Journal of Biological Chemistry, 280(10), 9595–9603.
https://doi.org/10.1074/jbc.M411805200

Ura, K., Nightingale, K., & Wolffe, A. P. (1996). Differential association of HMG1 and linker
histones B4 and H1 with dinucleosomal DNA: structural transitions and transcriptional repression.
Embo J, 15(18), 4959–4969.

van der Laarse, S. A. M., Leney, A. C., & Heck, A. J. R. (2018). Crosstalk between
phosphorylation and O-GlcNAcylation: friend or foe. FEBS Journal, 285(17), 3152–3167.
https://doi.org/10.1111/febs.14491

Vasili, E., Dominguez-Meijide, A., & Outeiro, T. F. (2019). Spreading of α-Synuclein and Tau: A
Systematic Comparison of the Mechanisms Involved. Frontiers in Molecular Neuroscience, 12,
107. https://doi.org/10.3389/fnmol.2019.00107

314
Verma, M., Vats, A., & Taneja, V. (2015). Toxic species in amyloid disorders: Oligomers or
mature fibrils. Annals of Indian Academy of Neurology, 18(2), 138–145.
https://doi.org/10.4103/0972-2327.144284

Vilar, M., Chou, H. T., Lührs, T., Maji, S. K., Riek-Loher, D., Verel, R., Manning, G., Stahlberg,
H., & Riek, R. (2008). The fold of α-synuclein fibrils. Proceedings of the National Academy of
Sciences of the United States of America, 105(25), 8637–8642.
https://doi.org/10.1073/pnas.0712179105

Vosseller, K., Trinidad, J. C., Chalkley, R. J., Specht, C. G., Thalhammer, A., Lynn, A. J.,
Snedecor, J. O., Guan, S., Medzihradszky, K. F., Maltby, D. A., Schoepfer, R., & Burlingame, A.
L. (2006). O-Linked N-Acetylglucosamine Proteomics of Postsynaptic Density Preparations
Using Lectin Weak Affinity Chromatography and Mass Spectrometry *. Molecular & Cellular
Proteomics, 5(5), 923–934. https://doi.org/10.1074/mcp.T500040-MCP200

Walgren, J. L. E. E., Vincent, T. S., Schey, K. L., & Buse, M. G. (2003). High glucose and insulin
promote O-GlcNAc modification of proteins, including α-tubulin. American Journal of
Physiology-Endocrinology and Metabolism, 284(2), E424–E434.
https://doi.org/10.1152/ajpendo.00382.2002

315
Wang, A. C., Jensen, E. H., Rexach, J. E., Vinters, H. V., & Hsieh-Wilson, L. C. (2016a). Loss of
O-GlcNAc glycosylation in forebrain excitatory neurons induces neurodegeneration. Proceedings
of the National Academy of Sciences of the United States of America, 113(52), 15120–15125.
https://doi.org/10.1073/pnas.1606899113

Wang, J. Z., Xia, Y. Y., Grundke-Iqbal, I., & Iqbal, K. (2013). Abnormal hyperphosphorylation
of tau: Sites, regulation, and molecular mechanism of neurofibrillary degeneration. Journal of
Alzheimer’s Disease, 33(SUPPL. 1). https://doi.org/10.3233/JAD-2012-129031

Wang, P., Lazarus, B. D., Forsythe, M. E., Love, D. C., Krause, M. W., & Hanover, J. A. (2012).
O-GlcNAc cycling mutants modulate proteotoxicity in Caenorhabditis elegans models of human
neurodegenerative diseases. Proceedings of the National Academy of Sciences, 109(43), 17669 LP
– 17674. https://doi.org/10.1073/pnas.1205748109

Wang, S., Yang, F., Petyuk, V. A., Shukla, A. K., Monroe, M. E., Gritsenko, M. A., Rodland, K.
D., Smith, R. D., Qian, W. J., Gong, C. X., & Liu, T. (2017). Quantitative proteomics identifies
altered O-GlcNAcylation of structural, synaptic and memory-associated proteins in Alzheimer’s
disease. Journal of Pathology, 243(1), 78–88. https://doi.org/10.1002/path.4929

316
Wang, X., Li, W., Marcus, J., Pearson, M., Song, L., Smith, K., Terracina, G., Lee, J., Hong, K.
L. K., Lu, S. X., Hyde, L., Chen, S. C., Kinsley, D., Melchor, J. P., Rubins, D. J., Meng, X.,
Hostetler, C. E., Sur, C., Zhang, L., … Smith, S. M. (2020). MK-8719, a novel and selective O-
GlcNAcase inhibitor that reduces the formation of pathological tau and ameliorates
neurodegeneration in a mouse model of tauopathy. Journal of Pharmacology and Experimental
Therapeutics, 374(2), 252–263. https://doi.org/10.1124/jpet.120.266122

Wang, Z., Park, K., Comer, F., Hsieh-Wilson, L. C., Saudek, C. D., & Hart, G. W. (2009). Site-
specific GlcNAcylation of human erythrocyte proteins: Potential biomarker(s) for diabetes.
Diabetes, 58(2), 309–317. https://doi.org/10.2337/db08-0994

Wang, Z., Udeshi, N. D., O’Malley, M., Shabanowitz, J., Hunt, D. F., & Hart, G. W. (2010).
Enrichment and site mapping of O-linked N-acetylglucosamine by a combination of
chemical/enzymatic tagging, photochemical cleavage, and electron transfer dissociation mass
spectrometry. Molecular and Cellular Proteomics, 9(1), 153–160.
https://doi.org/10.1074/mcp.M900268-MCP200

Wani, W Y, Chatham, J. C., Darley-Usmar, V., McMahon, L. L., & Zhang, J. (n.d.). O-
GlcNAcylation and neurodegeneration. Brain Res. Bull, 133, 80–87.

317
Wani, Willayat Y, Ouyang, X., Benavides, G. A., Redmann, M., Cofield, S. S., Shacka, J. J.,
Chatham, J. C., Darley-Usmar, V., & Zhang, J. (2017). O-GlcNAc regulation of autophagy and α-
synuclein homeostasis; implications for Parkinson’s disease. Molecular Brain, 10(1), 32.
https://doi.org/10.1186/s13041-017-0311-1

Waxman, E. A., & Giasson, B. I. (2008). Specificity and Regulation of Casein Kinase-Mediated
Phosphorylation of α-Synuclein. Journal of Neuropathology & Experimental Neurology, 67(5),
402–416. https://doi.org/10.1097/NEN.0b013e3186fc995

Webb, M., Payet, D., Lee, K. B., Travers, A. A., & Thomas, J. O. (2001). Structural requirements
for cooperative binding of HMG1 to DNA minicircles. Journal of Molecular Biology, 309(1), 79–
88. https://doi.org/10.1006/jmbi.2001.4667

Webb, M., & Thomas, J. O. (1999). Structure-specific binding of the two tandem HMG boxes of
HMG1 to four-way junction DNA is mediated by the A domain. Journal of Molecular Biology,
294(2), 373–387. https://doi.org/10.1006/jmbi.1999.3150

Wei, Y., Zhou, J., Wu, J., & Huang, J. (2019). ERβ promotes Aβ degradation via the modulation
of autophagy. Cell Death & Disease, 10(8), 565. https://doi.org/10.1038/s41419-019-1786-8

Weingarten, M. D., Lockwood, A. H., Hwo, S. Y., & Kirschner, M. W. (1975). A protein factor
essential for microtubule assembly. Proceedings of the National Academy of Sciences, 72(5), 1858
LP – 1862. https://doi.org/10.1073/pnas.72.5.1858
318
Weir, H. M., Kraulis, P. J., Hill, C. S., Raine, A. R. C., Laue, E. D., & Thomas, J. O. (1993).
Structure of the HMG box motif in the B-domain of HMG1. EMBO Journal, 12(4), 1311–1319.

Whelan, S. A., Lane, M. D., & Hart, G. W. (2008). Regulation of the O-Linked β-N-
Acetylglucosamine Transferase by Insulin Signaling*. Journal of Biological Chemistry, 283(31),
21411–21417. https://doi.org/https://doi.org/10.1074/jbc.M800677200

Willems, A. P., Gundogdu, M., Kempers, M. J. E., Giltay, J. C., Pfundt, R., Elferink, M., Loza, B.
F., Fuijkschot, J., Ferenbach, A. T., Van Gassen, K. L. I., Van Aalten, D. M. F., & Lefeber, D. J.
(2017). Mutations in N-acetylglucosamine (O-GlcNAc) transferase in patients with X-linked
intellectual disability. Journal of Biological Chemistry, 292(30), 12621–12631.
https://doi.org/10.1074/jbc.M117.790097

Wilson-Grady, J. T., Haas, W., & Gygi, S. P. (2013). Quantitative comparison of the fasted and
re-fed mouse liver phosphoproteomes using lower pH reductive dimethylation. Methods, 61(3),
277–286. https://doi.org/https://doi.org/10.1016/j.ymeth.2013.03.031

Wilson, D. M., & Binder, L. I. (1997). Free fatty acids stimulate the polymerization of tau and
amyloid beta peptides. In vitro evidence for a common effector of pathogenesis in Alzheimer’s
disease. The American Journal of Pathology, 150(6), 2181–2195.
https://pubmed.ncbi.nlm.nih.gov/9176408

319
Wishart, T. M., Parson, S. H., & Gillingwater, T. H. (2006). Synaptic vulnerability in
neurodegenerative disease. Journal of Neuropathology and Experimental Neurology, 65(8), 733–
739. https://doi.org/10.1097/01.jnen.0000228202.35163.c4

Woo, C. M., Lund, P. J., Huang, A. C., Davis, M. M., Bertozzi, C. R., & Pitteri, S. J. (2018).
Mapping and Quantification of Over 2000 O-linked Glycopeptides in Activated Human T Cells
with Isotope-Targeted Glycoproteomics (Isotag). Molecular &Amp; Cellular Proteomics,
17(4), 764 LP – 775. https://doi.org/10.1074/mcp.RA117.000261

Worth, M., Hu, C. W., Li, H., Fan, D., Estevez, A., Zhu, D., Wang, A., & Jiang, J. (2019). Targeted
covalent inhibition of: O -GlcNAc transferase in cells. Chemical Communications, 55(88), 13291–
13294. https://doi.org/10.1039/c9cc04560k

Wright, T. H., Bower, B. J., Chalker, J. M., Bernardes, G. J. L. L., Wiewiora, R., Ng, W. L. W.-
L., Raj, R., Faulkner, S., Vallee, M. R. J., Phanumartwiwath, A., Coleman, O. D., Thezenas, M.-
L., Khan, M., Galan, S. R. G. G., Lercher, L., Schombs, M. W., Gerstberger, S., Palm-Espling, M.
E., Baldwin, A. J., … Davis, B. G. (2016). Posttranslational mutagenesis: A chemical strategy for
exploring protein side-chain diversity. Science, 354(6312), aag1465–aag1465.
https://doi.org/10.1126/science.aag1465

Wulff-Fuentes, E., Berendt, R. R., Massman, L., Danner, L., Malard, F., Vora, J., Kahsay, R., &
Olivier-Van Stichelen, S. (2021). The human O-GlcNAcome database and meta-analysis.
Scientific Data, 8(1), 25. https://doi.org/10.1038/s41597-021-00810-4
320
Xu, Y., Deng, Y., & Qing, H. (2015). The phosphorylation of α-synuclein: development and
implication for the mechanism and therapy of the Parkinson’s disease. Journal of Neurochemistry,
135(1), 4–18. https://doi.org/https://doi.org/10.1111/jnc.13234

Yang, W. H., Park, S. Y., Nam, H. W., Kim, D. H., Kang, J. G., Kang, E. S., Kim, Y. S., Lee, H.
C., Kim, K. S., & Cho, J. W. (2008). NFkappaB activation is associated with its O-GlcNAcylation
state under hyperglycemic conditions. Proceedings of the National Academy of Sciences of the
United States of America, 105(45), 17345–17350. https://doi.org/10.1073/pnas.0806198105

Yang, W., & Yu, S. (2017). Synucleinopathies: common features and hippocampal manifestations.
Cellular and Molecular Life Sciences, 74(8), 1485–1501. https://doi.org/10.1007/s00018-016-
2411-y

Yang, X., & Qian, K. (2017). Protein O-GlcNAcylation: Emerging mechanisms and functions.
Nature Reviews Molecular Cell Biology, 18(7), 452–465. https://doi.org/10.1038/nrm.2017.22

Yang, Y.-Y., Grammel, M., Raghavan, A. S., Charron, G., & Hang, H. C. (2010). Comparative
Analysis of Cleavable Azobenzene-Based Affinity Tags for Bioorthogonal Chemical Proteomics.
Chemistry & Biology, 17(11), 1212–1222.
https://doi.org/https://doi.org/10.1016/j.chembiol.2010.09.012

Yankner, B. A. (1996). Mechanisms of Neuronal Degeneration in Alzheimer’s Disease. Neuron,
16(5), 921–932. https://doi.org/https://doi.org/10.1016/S0896-6273(00)80115-4
321
Yao, P. J., & Coleman, P. D. (1998). Reduced O-glycosylated clathrin assembly protein AP180:
Implication for synaptic vesicle recycling dysfunction in Alzheimer’s disease. Neuroscience
Letters, 252(1), 33–36. https://doi.org/10.1016/S0304-3940(98)00547-3

Yu, Y., Zhang, L., Li, X., Run, X., Liang, Z., Li, Y., Liu, Y., Lee, M. H., Grundke-Iqbal, I., Iqbal,
K., Vocadlo, D. J., Liu, F., & Gong, C.-X. (2012). Differential Effects of an O-GlcNAcase
Inhibitor on Tau Phosphorylation. PLOS ONE, 7(4), e35277.
https://doi.org/10.1371/journal.pone.0035277

Yuzwa, S. A., Cheung, A. H., Okon, M., McIntosh, L. P., & Vocadlo, D. J. (2014). O-GlcNAc
Modification of tau Directly Inhibits Its Aggregation without Perturbing the Conformational
Properties of tau Monomers. Journal of Molecular Biology, 426(8), 1736–1752.
https://doi.org/10.1016/j.jmb.2014.01.004

Yuzwa, S. A., Macauley, M. S., Heinonen, J. E., Shan, X., Dennis, R. J., He, Y., Whitworth, G.
E., Stubbs, K. A., McEachern, E. J., Davies, G. J., & Vocadlo, D. J. (2008). A potent mechanism-
inspired O-GlcNAcase inhibitor that blocks phosphorylation of tau in vivo. Nature Chemical
Biology, 4(8), 483–490. https://doi.org/10.1038/nchembio.96

322
Yuzwa, S. A., Shan, X., Jones, B. A., Zhao, G., Woodward, M. L., Li, X., Zhu, Y., McEachern, E.
J., Silverman, M. A., Watson, N. V., Gong, C. X., & Vocadlo, D. J. (2014). Pharmacological
inhibition of O-GlcNAcase (OGA) prevents cognitive decline and amyloid plaque formation in
bigenic tau/APP mutant mice. Molecular Neurodegeneration, 9, 42. https://doi.org/10.1186/1750-
1326-9-42

Yuzwa, S. A., Shan, X., Macauley, M. S., Clark, T., Skorobogatko, Y., Vosseller, K., & Vocadlo,
D. J. (2012). Increasing O-GlcNAc slows neurodegenerationand stabilizes tau against aggregation.
Nature Chemical Biology, 8(4), 393–399. https://doi.org/10.1038/nchembio.797

Yuzwa, S. A., & Vocadlo, D. J. (2014). O-GlcNAc and neurodegeneration: Biochemical
mechanisms and potential roles in Alzheimer’s disease and beyond. Chemical Society Reviews,
43(19), 6839–6858. https://doi.org/10.1039/c4cs00038b

Yuzwa, S. A., Yadav, A. K., Skorobogatko, Y., Clark, T., Vosseller, K., & Vocadlo, D. J. (2011).
Mapping O-GlcNAc modification sites on tau and generation of a site-specific O-GlcNAc tau
antibody. Amino Acids, 40(3), 857–868. https://doi.org/10.1007/s00726-010-0705-1

Zhang, B., Kehm, V., Gathagan, R., Leight, S. N., Trojanowski, J. Q., Lee, V. M.-Y., & Luk, K.
C. (2019). Stereotaxic Targeting of Alpha-Synuclein Pathology in Mouse Brain Using Preformed
Fibrils. Methods in Molecular Biology (Clifton, N.J.), 1948, 45–57. https://doi.org/10.1007/978-1-
4939-9124-2_5

323
Zhang, H., Tomašič, T., Shi, J., Weiss, M., Ruijtenbeek, R., Anderluh, M., & Pieters, R. J. (2018).
Inhibition of: O -GlcNAc transferase (OGT) by peptidic hybrids. MedChemComm, 9(5), 883–887.
https://doi.org/10.1039/c8md00115d

Zhang, J., Lei, H., Chen, Y., Ma, Y. T., Jiang, F., Tan, J., Zhang, Y., & Li, J. Da. (2017). Enzymatic
O-GlcNAcylation of α-synuclein reduces aggregation and increases SDS-resistant soluble
oligomers. Neuroscience Letters, 655, 90–94. https://doi.org/10.1016/j.neulet.2017.06.034

Zhang, W., Falcon, B., Murzin, A. G., Fan, J., Crowther, R. A., Goedert, M., & Scheres, S. H. W.
(2019). Heparin-induced tau filaments are polymorphic and differ from those in Alzheimer’s and
Pick’s diseases. ELife, 8, e43584. https://doi.org/10.7554/eLife.43584

Zhang, Z., Tan, E. P., VandenHull, N. J., Peterson, K. R., & Slawson, C. (2014). O-GlcNAcase
Expression is Sensitive to Changes in O-GlcNAc Homeostasis. Frontiers in Endocrinology, 5,
206. https://doi.org/10.3389/fendo.2014.00206

Zheng, J.-S., Tang, S., Qi, Y.-K., Wang, Z.-P., & Liu, L. (2013). Chemical synthesis of proteins
using peptide hydrazides as thioester surrogates. Nature Protocols, 8(12), 2483–2495.
https://doi.org/10.1038/nprot.2013.152

324
Zhu, Y., Shan, X., Safarpour, F., Erro Go, N., Li, N., Shan, A., Huang, M. C., Deen, M., Holicek,
V., Ashmus, R., Madden, Z., Gorski, S., Silverman, M. A., & Vocadlo, D. J. (2018).
Pharmacological Inhibition of O-GlcNAcase Enhances Autophagy in Brain through an mTOR-
Independent Pathway. ACS Chemical Neuroscience, 9(6), 1366–1379.
https://doi.org/10.1021/acschemneuro.8b00015

325

APPENDIX A: Characterization of HMGB1 proteins

326

Appendix A-1. Expressed chemical ligation generating fragment 4. (a) Recombinant fragment 1 and synthetic
peptide 2 react to form ligation product 4. (b) RP-HPLC monitoring of ligation reaction using C4 analytical column,
0-70% solvent B over 60 mins. t=0 trace shows 2 peaks, an early eluting species corresponding to ligation catalyst
mercaptophenylacetic acid (MPAA) and a reactant peak corresponding to fragment 1. t=1 h trace shows formation of
ligation product. After buffer exchange to remove MPAA and treatment with excess TCEP, removal of selenol is
completed in the t=20 h trace. Fragment 4 was purified and submitted to the succeeding step. Identities of peaks
labeled 1 and 4 were confirmed by collecting the fraction and injecting directly on an ESI-MS. Identities of the other
smaller peaks were not determined. (c) Analytical RP-HPLC traces of purified reactants on a C4 column (for fragment
1) or C18 column (for fragment 2) using a gradient of 0-70% solvent B over 60 mins. (d) MALDI-MS characterization
of reactants and intermediates.
327

Appendix A-2. Expressed chemical ligation generating fragment 5. (a) Ligation product 4 was subjected to
hydrazine activation and thioesterification to generate 4b which was reacted with recombinant fragment 3 react to
form ligation product 5. (b) RP-HPLC using C4 analytical column, 0-70% solvent B over 60 mins. Hydrazide
activation trace shows MPAA peak and thioester 4b. t=1 h trace shows addition of fragment 3 formation of ligation
product 5. Product formation was complete in the t=20 h trace. Product 5 was purified and subjected to O-acetate
deprotection to generate HMGB1(gS100). Identities of peaks labeled 4b, 3 and 5 were confirmed by collecting the
fraction and injecting directly on an ESI-MS. Identities of the other smaller peaks were not determined. (c) Analytical
RP-HPLC trace for fragment 3 using a C4 column on a gradient of 0-70% B over 60 mins. (d) MALDI-MS
characterization of reactant 3 and intermediate 5.
328

Appendix A-3. Characterization of unmodified HMGB1. (a) Analytical RP-HPLC trace of recombinant,
unmodified HMGB1 purified from an intein fusion construct using a C4 column, 0-70% solvent B over 60 mins. (b)
MALDI-MS of recombinant, unmodified HMGB1. (c) Top, circular dichroism profiles of unmodified HMGB1 (black,
left) and HMGB1(gS100) (blue, left). Overlaid CD spectra are shown in the bottom panel.

329

APPENDIX B: Regression fits of densitometric experiments

330

Appendix B-1. Low stoichiometry EMSA of HMGB1 with 4WJ DNA. (a) Representative EMSA for four-way
junction DNA (100 nM) incubated with indicated amounts of HMGB1, HMGB1(gS100), or HMGB1(S100A) at low
equivalents. (b) To calculate the fraction of DNA bound at given molar ratio, densitometric measurements for the
shifted bands corresponding to bound DNA were divided by the combined signal from shifted and unshifted bands.
Fraction bound were plotted against molar ratios of HMGB1:DNA and a saturation binding nonlinear regression fit
was calculated using results from N=3 replicates per HMGB1 variant. Solid line represents best-fit curve while dotted
lines indicate 95% confidence interval of the curve. (c) Summary of regression fitting parameters including calculated
binding affinities expressed as molar ratios. P values for comparison of binding affinities were calculated using
pairwise extra-sum-of-squares F test comparison of nested models.
331

Appendix B-2. Nonlinear regression fitting of DNA circularization assay. Densitometric measurements for the
bands corresponding to DNA minicircles were normalized to the maximum minicircles signal for each experiment to
obtain %Maximum minicircles. %Maximum minicircles were plotted against molar ratios of HMGB1:DNA and a
saturation binding (with Hill slope) nonlinear regression fit was calculated using results from N>2 replicates per
HMGB1 variant. For the plots in (a), dots correspond to individual normalized %Maximum minicircles, solid lines
correspond to best-fit line, and dotted lines correspond to boundaries of the 95% CI of the best-fit lines. (b) Summary
of binding parameters obtained from nonlinear regression fitting. P values for comparison of half-max ratios and h
coefficients were calculated using pairwise extra-sum-of-squares F test comparison of nested models.

332

APPENDIX C: Characterization of small heat shock proteins

333

Appendix C-1. Synthesis and characterization of O-GlcNAc modified HSP27. Unmodified and differentially O-
GlcNAc modified versions of HSP27 were retrosynthetically deconstructed into a recombinant protein thioester and
peptides prepared by solid phase peptide synthesis. Analytical RP-HPLC traces and MALDI-TOF-MS of the indicated
synthetic proteins.
334

Appendix C-2. Synthesis and characterization of O-GlcNAc modified αAC. O-GlcNAc modified αAC was
retrosynthetically deconstructed into a recombinant protein thioester and two peptides prepared by solid phase peptide
synthesis. Analytical RP-HPLC traces and MALDI-TOF-MS of the indicated recombinant or synthetic proteins.

335

Appendix C-3. Synthesis and characterization of O-GlcNAc modified αBC. O-GlcNAc modified αBC proteins
were retrosynthetically deconstructed into a recombinant protein thioester and a peptides prepared by solid phase
peptide synthesis. Analytical RP-HPLC traces and MALDI-TOF-MS of the indicated recombinant or synthetic
proteins.

336

Appendix C-4. Synthesis and characterization of quadruply O-GlcNAc modified HSP27. Unmodified and
differentially O-GlcNAcylated versions of HSP27 were retrosynthetically deconstructed into a recombinant protein
thioester and peptides prepared by solid phase peptide synthesis. Analytical RP-HPLC traces and MALDI-TOF-MS
of the indicated synthetic proteins.

Asset Metadata

Creator Balana, Aaron John Tan (author)

Core Title Direct characterization of functional consequences of O-GlcNAc through protein semi-synthesis

Contributor Electronically uploaded by the author (provenance)

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Chemistry

Degree Conferral Date 2021-12

Publication Date 11/01/2021

Defense Date 09/22/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amyloid,neurodegeneration,OAI-PMH Harvest,O-GlcNAc,protein semisynthesis,semi-synthesis

Format application/pdf (imt)

Language English

Advisor Pratt, Matthew (committee chair), Fokin, Valery (committee member), Forsburg, Susan (committee member)

Creator Email aaronbalana@gmail.com,balana@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC16344600

Unique identifier UC16344600

Legacy Identifier etd-BalanaAaro-10189

Document Type Dissertation

Format application/pdf (imt)

Rights Balana, Aaron John Tan

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email uscdl@usc.edu

Abstract (if available)

Abstract O-GlcNAcylation is a uniquely dynamic form of protein glycosylation that involves the addition of the monosaccharide N-acetylglucosamine (GlcNAc) onto serine/threonine hydroxyl moieties. As a posttranslational modification (PTM) that is responsive to cellular milieu, O-GlcNAcylation can impact the structure and function of target proteins under certain physiologically abnormal and disease states. While diverse methods can probe variegated aspects of O-GlcNAcylation, understanding how this PTM directly impacts its protein substrates can only be done through careful preparation and testing of homogeneously modified proteins. To this end, protein ligation techniques, specifically native chemical ligation (NCL) and expressed protein ligation (EPL), prove useful for the preparation of site-specifically O-GlcNAcylated proteins. This work describes the preparation of O-GlcNAc-modified variants of the high mobility group box 1 (HMGB1) protein as well as members of the small heat shock protein (sHSP) family namely heat shock protein 27 (HSP27), and alpha crystallins A and B (αAc and αBc, respectively). Through subsequent in vitro biochemistry, it is demonstrated that O-GlcNAc can alter endogenous functions of proteins and can modulate of protein-DNA and protein-protein interactions. These biochemical findings illustrate potential relevance and role of this modification in cancer biogenesis and neurodegeneration, highlighting the utility of protein semi-synthesis as a chemical tool that can provide valuable insight into biological problems.