University of Southern California Dissertations and Theses

Therapeutic potential of Rhesus theta defensin-1 for the treatment of COVID-19 pneumonia

(USC Thesis Other)

Therapeutic potential of Rhesus theta defensin-1 for the treatment of COVID-19 pneumonia

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

Therapeutic Potential of Rhesus Theta Defensin-1 for the Treatment of COVID-19
Pneumonia

By
A Young Jenny Park

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CLINICAL AND EXPERIMENTAL THERAPEUTICS)

December 2021

Copyright 2021 A Young Jenny Park
ii

Acknowledgements

First and foremost, I would express my sincere appreciation and gratitude to my thesis advisor, Dr. Paul
Beringer, for guiding me through my Ph.D. and providing me with great opportunities to explore various
aspects of both preclinical and clinical pharmacology. This dissertation would not have been possible
without his immense support and mentorship. I would like to also extend my gratitude to my dissertation
committee members, Dr. David Z. D’Argenio and Dr. Stan Louie for their advice and guiding my
research throughout my doctoral studies. Lastly, I would like to thank my family, friends, and my
husband Wesley, for their endless support, love, and encouragement. I would not be the person I am today
without them.

iii

Table of Contents
Acknowledgements .................................................................................................................................. ii
List of Tables ............................................................................................................................................ v
List of Figures ......................................................................................................................................... vi
List of Abbreviations ............................................................................................................................ viii
Abstract .................................................................................................................................................... x
Preface .................................................................................................................................................... xii
Chapter 1: Introduction .......................................................................................................................... 1
Background and Significance ............................................................................................................... 1
Pathogenesis and pathophysiology of SARS-CoV-2 ............................................................................ 1
Clinical manifestation of COVID-19 .................................................................................................... 4
Extrapulmonary effect of COVID-19 ................................................................................................... 7
Molecular mechanism of SARS-CoV-2-induced inflammatory response .......................................... 11
Immunosuppressive agents as adjunctive therapies for COVID-19 ................................................... 15
Host Defense Peptides (HDP)............................................................................................................. 17
Defensins ............................................................................................................................................ 20
Rhesus theta (θ) defensin-1 (RTD-1) .................................................................................................. 20
Antimicrobial activity of RTD-1 ........................................................................................................ 21
Anti-inflammatory activity of RTD-1 ................................................................................................. 21
Potential role of RTD-1 in the treatment of COVID-19 ..................................................................... 23
Therapeutic peptides ........................................................................................................................... 24
Nonlinear pharmacokinetics ............................................................................................................... 26
Summary ............................................................................................................................................. 28
Chapter 2. Rhesus theta (θ)-defensin-1 attenuates endotoxin-induced acute lung injury by
inhibiting proinflammatory cytokines and neutrophil recruitment ............................................. 29
Introduction ......................................................................................................................................... 29
Materials and Methods........................................................................................................................ 31
Results................................................................................................................................................. 36
Discussions ......................................................................................................................................... 44
Chapter 3. Preclinical pharmacokinetics and safety of intravenous RTD-1 .................................... 49
Introduction ......................................................................................................................................... 49
Materials and Methods........................................................................................................................ 50
Results................................................................................................................................................. 62
Discussion ........................................................................................................................................... 82
iv

Chapter 4. Tissue distribution kinetics, spatial distribution profiles, and the effect of RTD-1 in the
liver..................................................................................................................................................... 87
Introduction ......................................................................................................................................... 87
Method and Materials ......................................................................................................................... 88
Results................................................................................................................................................. 97
Discussion ......................................................................................................................................... 104
Chapter 5. Summary & Future Directions ........................................................................................ 111
References ............................................................................................................................................. 113

v

List of Tables
Table 1. Total Exposure of inflammatory markers in mice with LPS induced lung injury treated with
RTD-1 ......................................................................................................................................................... 42
Table 2. Study design of pre-clinical pharmacokinetics and safety of intravenous RTD-1 ....................... 51
Table 3. Summary of general in-life assessments and sample collections ................................................. 52
Table 4. Single dose pharmacokinetics in mice receiving RTD-1 5 mg/kg ............................................... 63
Table 5. Single and multiple dose pharmacokinetics of intravenous RTD-1 in rats .................................. 64
Table 6. Single and multiple dose pharmacokinetics of intravenous RTD-1 in cynomolgus monkeys ..... 68
Table 7. Pharmacokinetics of single dose RTD-1 (3 mg/kg) in vervet ...................................................... 69
Table 8. A comparison of four two-compartmental models with different eliminations or distribution ... 70
Table 9. Hematological results of male and female rats at the end of treatment ........................................ 77
Table 10. Serum biochemical data of male and female rats at the end of treatment .................................. 78
Table 11. Coagulation data of male and female rats at the end of treatment ............................................. 79
Table 12. Summary of NOAEL, LOAEL and gross pathology and clinical observations for RTD-1-
related adverse events ................................................................................................................................. 82
Table 13. Study design of the tissue PK study in male Sprague Dawley rats ............................................ 91
Table 14. Non-compartmental analysis of RTD-1 in various tissues. ........................................................ 99
Table 15. Summary of physicochemical properties and blood binding of RTD-1 ................................... 102

vi

List of Figures
Figure 1. Schematic representation of the SARS-CoV-2 structure and spike (S) protein domain. ............. 3
Figure 2. Extrapulmonary involvement of COVID-19. ............................................................................... 8
Figure 3. Pleiotropic effects of host defense peptides (HDP) .................................................................... 19
Figure 4. The structural feature and amino acid sequence of RTD-1. ....................................................... 20
Figure 5. Mechanisms of anti-inflammatory activity of RTD-1. ............................................................... 23
Figure 6. Plasma RTD-1 concentrations versus time profile ..................................................................... 37
Figure 7. Dose effects of RTD-1 on airway neutrophilia, neutrophil activation, and microvascular
disruption. ................................................................................................................................................... 38
Figure 8. Strength and direction of relationship between neutrophils and airway enzymes. ..................... 39
Figure 9. Dose effects of RTD-1 on airway cytokines and chemokines. ................................................... 40
Figure 10. Dose- and time-dependent effects of RTD-1 on airway neutrophilia, cytokine proteins and
gene expression. .......................................................................................................................................... 41
Figure 11. Time-dependent effect of RTD-1 on airway neutrophilia and cytokines. ................................ 43
Figure 12. Effects of RTD-1 on severity of acute lung injury. .................................................................. 44
Figure 13. Mean (SD) plasma concentration-time profiles of RTD-1. ...................................................... 62
Figure 14. Mean (SD) plasma concentration versus time profiles following a 7-day repeat once daily i.v.
administrations in rats ................................................................................................................................. 64
Figure 15. Mean (SD) plasma concentration versus time profiles following repeated i.v. administrations
of RTD-1 in cynomolgus monkeys. ............................................................................................................ 66
Figure 16. Assessment of dose proportionality of C max and AUC 0-∞ in cynomolgus monkeys following a
single dose administration of RTD-1 (0.3, 1, 3, 10, or 15 mg/kg) .............................................................. 67
Figure 17. Interspecies allometric correlation. ........................................................................................... 71
Figure 18. Mean (SD) density of 14C-RTD-1 in tissues and organs 1 h and 24 h after i.v. administration
in female rats ............................................................................................................................................... 72
Figure 19. Observed concentration-time profiles in plasma and tissues in male rats after i.v. infusion of
RTD-1 at 1, 5, or 10 mg/kg. ...................................................................................................................... 100
Figure 20. Spatial distribution of intravenous RTD-1 over time in male Sprague Dawley rats given 5
mg/kg. ....................................................................................................................................................... 101
vii

Figure 21. Cytotoxicity of RTD-1 in HepaRG cells after 2 h treatment in growth media containing low
serum (1% FBS).. ...................................................................................................................................... 103
Figure 22. Screening of CYP3A4 Induction and inhibition potential of RTD-1 in HepaRG cells. ......... 104
viii

List of Abbreviations
ACE-2 Angiotensin Converting Enzyme-2
ALT Alanine aminotransferase
ADME Absorption, Distribution, Metabolism and Excretion
ALI Acute lung injury
AngII Angiotensin II
Ang1-7 Angiotensin 1-7
AP-1 Activator protein-1
ARDS Acute respiratory distress syndrome
AST Aspartate aminotransferase
AUC Area under the curve
BALF Bronchoalveolar lavage fluid
CK Creatine Kinase
CL Clearance
C max Maximal observed concentration
COVID-19 Coronavirus disease 2019
CRP C-reactive protein
CYP450 Cytochrome P450
DAMP Damage associated molecular pattern
DDI Drug-drug interaction
DEX Dexamethasone
FDA Food Drug Administration
FIH First in human
GLP Good Laboratory Practice
HDP Host defense peptides
HED Humane equivalent dose
IFN-ɣ Interferon-gamma
IL interleukin
IMV Invasive mechanical ventilation
Kb/p Blood-to-plasma ratio
K D Dissociation constant
LL-37 Human cathelicidin
LLOQ Lower limit of quantification
LOAEL Lowest observed adverse effect level
LPS Lipopolysaccharide
MΦ Macrophages
MAPK Mitogen-activated protein kinases
MIP-1α Macrophage inflammatory protein-1α
MRSD Maximum recommended starting dose
MRT Mean residence time
NF-κB Nuclear factor-κ-light chain enhance of activated B cells
NOAEL No observed adverse effect level
NSAIDs Non-steroidal anti-inflammatory drugs
OATP Organic anion transporting polypeptides
PAMP Pathogen-associated molecular patterns
PD Pharmacodynamics
PK Pharmacokinetics
ix

PBPK Physiologically-based pharmacokinetics
PXR Pregnane X receptor
RBC Red blood cells
RFV Rifamycin-SV
RIF Rifampin
RTD-1 Rhesus theta (θ) defensin-1
SARS Severe acute respiratory syndrome
SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2
TACE TNF alpha converting enzyme
TLR Toll-like receptor
TMPRSS2 Transmembrane protease, serine 2
TMDD Target mediated drug disposition
TNF-α Tumor necrosis factor-α
Vss Volume of distribution at steady state
WHO World Health Organization

x

Abstract
Severe illness caused by Coronavirus disease 2019 (COVID-19) is characterized by an overexuberant
inflammatory response resulting in acute respiratory distress syndrome (ARDS) and progressive
respiratory failure. Elevated systemic inflammatory markers, such as IL-6 and CRP, in hospitalized
COVID-19 patients have been linked to poor clinical outcomes. Current immunomodulating agents used
to combat COVID-19-mediated inflammation, such as dexamethasone and tocilizumab, may induce
glucose intolerance, delay viral clearance, and increase the risk of secondary bacterial infection,
underscoring the need for safer immunomodulating treatment. Rhesus theta (θ) defensin-1 (RTD-1) is a
macrocyclic host defense peptide exhibiting dual antimicrobial and immunomodulatory activities.
Previously, RTD-1 treatment was associated with a significant improvement in survival in a murine
model of severe acute respiratory syndrome (SARS-CoV-1) lung disease, which was attributable to its
potent in vivo anti-inflammatory activity.

The overarching objective of this thesis was to investigate the therapeutic potentials of RTD-1 for the
treatment of COVID-19 using endotoxin-induced acute lung injury (ALI) model and to characterize the
plasma and tissue pharmacokinetics and safety of RTD-1 in preclinical species. A single subcutaneous
administration of RTD-1 to a well-established murine model of lipopolysaccharide (LPS)-induced ALI
resulted in significant reductions of neutrophil extravasation and pro-inflammatory cytokines, leading to
attenuation in lung injury. In repeated dose toxicity studies, RTD-1 was well tolerated up to 10 mg/kg and
15 mg/kg in rats and cynomolgus monkeys, respectively. Based on the lack of adverse findings, the no-
observed-adverse-effect-level (NOAEL) was established at 10 mg/kg/day in rats and 15 mg/kg/day in
cynomolgus monkeys. Analysis of single ascending dose studies in rats and cynomolgus monkeys
revealed greater than dose proportional increases in area under the curve extrapolated to infinity (AUC 0-
∞), suggestive of nonlinear PK, particularly at the higher doses. Following a single 5 mg/kg intravenous
xi

(i.v.) dose of RTD-1, volume of distribution (Vss) was large across all species, indicating extensive tissue
distribution, with 1,048, 1,461, 550 mL/kg, in mice, rats and cynomolgus monkeys, respectively. A
biodistribution study of
14
C-RTD-1 in rats confirmed widespread tissue distribution, the liver. The
presence of
14
C-RTD-1 in the urine and feces at 24 h indicates elimination occurs in part via urinary and
biliary excretion. Based on interspecies allometric scaling, the predicted human clearance and Vss are
6.44 L/h and 28.0 L for an adult (70 kg). To achieve plasma exposures associated with therapeutic
efficacy established in a murine model of LPS-induced ALI, the estimated human equivalent dose (HED)
is between 0.36 and 0.83 mg/kg. The excellent safety profile demonstrated in these studies, and the
efficacy observed in the murine models of SARS-CoV-1 and LPS-induced ALI support the clinical
investigation of RTD-1 for treatment of COVID-19. In vivo, RTD-1 was most accumulated in the liver,
kidney, and spleen. The area under the concentration-time curve (AUC) in the tissues increased
proportionally to the dose, suggesting that the tissue distribution of RTD-1 is not responsible for the
nonlinearity observed in the preclinical PK studies. Additional studies are needed to examine whether the
prolonged retention of RTD-1 in the liver could be caused by saturation of the biliary excretion. Lastly,
RTD-1 did not induce hepatocytotoxicity or affect the CYP3A4 enzyme activity, indicating that RTD-1 is
less likely to cause adverse effects in the liver.
xii

Preface

The aim of this dissertation was to provide evidence of therapeutic efficacy of RTD-1 against COVID-19-
induced lung injury and to characterize the pharmacokinetic disposition of RTD-1 in preclinical animals.
We demonstrated that RTD-1 attenuates lung injury through inhibition of pro-inflammatory cytokine
production and neutrophil migration. The preclinical PK studies indicated large volume of distribution
that is suggestive of extensive tissue distribution. Comparisons across dose levels revealed
disproportional increases in the plasma AUC and C max with increasing doses, indicating that RTD-1
follows nonlinear PK. Subsequently, tissue distribution kinetic studies were carried out to examine the
changes in tissue exposures with respect to the dose. Less than dose-proportional increases in RTD-1
exposure was evident between 1- and 5 mg/kg, while greater than dose-proportional observed between 1-
and 10 mg/kg, indicating nonlinear tissue distribution. Furthermore, spatial analysis of the RTD-1
distribution in the liver revealed that most of the RTD-1 is localized to the bile duct at 0.5 h. Consistent
with the quantitative data, the signal intensity was highest at 0.5 h and began to diminish starting at 6 h.
By 24 h, most of the peptide was found in the blood vessels. Thus, this thesis provides evidence of
efficacy and safety of RTD-1 for the treatment of COVID-19 as well as a framework to develop a
mechanistic physiologically based PK (PBPK) model to characterize the complex nonlinear
pharmacokinetic disposition of RTD-1.
This thesis is adapted from the following manuscripts.
1. Jordanna G. Jayne, Timothy J. Bensman, Justin B. Schaal, A Young J. Park, Elza Kimura, Dat Tran,
Michael E. Selsted, and Paul M. Beringer. "Rhesus θ-defensin-1 attenuates endotoxin-induced acute
lung injury by inhibiting proinflammatory cytokines and neutrophil recruitment." American journal of
respiratory cell and molecular biology 58, no. 3 (2018): 310-319.

2. A Young J. Park, Dat Q. Tran, Justin B. Schaal, Virgina Basso, Mengxi Wang, Michael E. Selsted,
and Paul M. Beringer. "Preclinical Pharmacokinetics of Safety of intravenous Rhesus θ-defensin-
1." Antimicrobial agents and chemotherapy (2021) In submission

3. A Young J. Park, Mansour Dughbaj, Brent Beadell, Eunjin Hong, Alireza Abdolvahabi, Ethan
Canfield, Michael E. Selsted, and Paul M. Beringer. “Tissue distribution and excretion of Rhesus θ-
defensin-1.” In preparation.
1

Chapter 1: Introduction
Background and Significance
The coronavirus disease 2019 (COVID-19) is caused by the novel coronavirus, severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2), a single, positive-stranded RNA virus that belongs to the β
genus of the coronaviridae family. It shares approximately 80% sequence homology to the SARS-
coronavirus (SARS-CoV) responsible for the outbreak of SARS in 2002-2003 and 50% homology to the
Middle East respiratory syndrome coronavirus (MERS-CoV), which emerged in Saudi Arabia in 2012 (1-
3). Compared to the two previous coronavirus outbreaks, SARS-CoV-2 has a higher rate of transmission,
with an estimated reproductive rate R(0) of 3-4. Consequently, the exponential growth of COVID-19
cases around the world led the World Health Organization (WHO) to declare the COVID-19 outbreak a
global pandemic in March 2020. As of September 2021, more than 220 million cases have been reported
with approximately 4.6 million deaths worldwide. Although earlier studies reported that COVID-19
transmission is predominantly through close person-to-person contact and large respiratory droplets, an
increasing number of long-range transmissions infers that COVID-19 is likely transmitted by aerosols (4,
5). Despite the rapid development of COVID-19 vaccines, which has significantly reduced the number of
cases, the emergence of variants with higher transmissibility and infectiousness (relative to the original
SARS-CoV-2 strain) and slow vaccination rates have hindered the eradication effort against the disease.
As a consequence, although the risk of disease contraction is low among fully vaccinated individuals,
breakthrough cases have been on the rise. Nonetheless, there is currently no effective treatment available
for COVID-19.

Pathogenesis and pathophysiology of SARS-CoV-2
SARS-CoV-2 contains a genomic RNA which encodes 16 non-structural replicate proteins and four
structural proteins: spike (S), membrane (M), envelop (E) and nucleocapsid (N), with the S protein being
the most immunogenic (Figure 1, image taken from Kumar et al. 2020) (6). The S protein, which is
2

composed of a transmembrane trimetric class I fusion glycoprotein, is located on the surface of the virus
and determines the diversity of coronaviruses and pathogenicity. It contains the receptor-binding domain
and is involved in facilitating viral attachment to the target host entry receptor, angiotensin-converting
enzyme 2 (ACE2), and the subsequent fusion of viral and host cell membranes for entry (2, 7, 8).
Structurally, the S protein is comprised of two functional subunits: surface unit S1, which contains the
receptor binding domain, and the subunit S2, which facilitates the fusion between the viral and host
cellular membrane (Figure 1) (6, 9, 10). Upon viral entry, the S protein undergoes two sequential
proteolytic activations by the host proteases at two cleavage sites, S1/S2 and S2’, to engage with the host
receptor. Among the various host cell proteases capable of priming and activating the S protein,
transmembrane protease serine 2 (TMPRSS2) and furin are regarded as the key proteases involved in the
viral entry (11, 12). Furin is ubiquitously expressed in the human body and cleaves S1/S2 site of the viral
S protein, a step required for subsequent TMPRSS2-mediated activation (7, 13). Subsequently,
TMPRSS2, which is also widely expressed in respiratory and nasal epithelial cells and is often co-
localized on the cell surface with ACE2, cleaves the S2’ site and enables efficient viral entry (8, 14).
Upon entry, SARS-CoV-2 initially establishes infection in the nasal cavity and upper respiratory tract and
rapidly replicates to damage the host cell and organs.

3

Figure 1. Schematic representation of the SARS-CoV-2 structure and spike (S) protein domain.
Image taken from Kumar et al. 2020. (6).
In humans, ACE2 receptor is a transmembrane receptor protein widely expressed throughout the body,
including in the lung, heart, kidney, and in some immune cells such as monocytes and macrophages
(MΦ), and serves as the principal entry receptor for SARS-CoV-2. As the name indicates, its primary
biological function is to regulate renin-angiotensin system (RAS) through angiotensin metabolism,
converting angiotensin II (AngII) into angiotensin 1-7 (Ang1-7). Structural analysis revealed that S protein
of SARS-CoV-2 binds to human ACE2 with 10- to 20-fold higher affinity (~15 nM) compared to that of
SARS-CoV S protein, which explains the higher infectivity and transmissibility with SARS-CoV-2 (15).
Abundant ACE2 expressions in alveolar and bronchial epithelium, and vascular endothelial cells support
the observation that the respiratory tract is the major site of viral entry as well as damage (16-19). In the
initial stage of infection, SARS-CoV-2 targets the epithelium lining the nasal cavity and the upper
respiratory tract, where both ACE2 and TMPRSS2 are highly expressed. Within the lung, ACE2 is
present in respiratory epithelium and alveolar MΦ, as well as neighboring endothelial cells. As the
infection progresses, SARS-CoV-2 migrates down the lower respiratory tract and establishes infection in
the alveolar space, predominantly infecting the alveolar type II cells, also referred to as pneumocytes (20).
In healthy lung, pneumocytes are responsible for preserving airway epithelial barrier and structural
4

integrity to promote proper gas exchange, producing surfactants, and providing local immune defense
against invading microbes. Accordingly, infection and the resulting apoptosis/necrosis of pneumocytes
have detrimental downstream consequences both locally and systemically (21). Furthermore, infection of
vascular endothelial cells leads to endothelial injury and dysfunction, which is reflected by disruption of
the epithelial-endothelial barrier integrity and increases in vascular permeability (22, 23). With vascular
leakage, protein-rich fluid begins to accumulate in the alveolar space, leading to pulmonary edema.
Furthermore, infected, and apoptotic cells, as well as vascular dysfunction, induce leukocyte infiltrations
into the lung, which releases large amounts of pro-inflammatory mediators and toxic products (i.e.
proteases and reactive oxygen species) resulting in severe lung damage. Indeed, spatial analysis of post-
mortem lung tissues from COVID-19 patients found massive leukocyte infiltration and apoptosis-
mediated cell death across all samples, with the highest amount of SARS-CoV-2 in the alveolar epithelial
cells, and extensive alveolar damage as evidenced by apoptosis and fibrosis in the alveolar walls (24).
Collectively, widespread expression of ACE2 in the body, especially in the lung, permits rapid viral
propagation and dictates a wide variety of clinical symptoms and complications.

Clinical manifestation of COVID-19
The earliest report of COVID-19 cases described patients hospitalized with pneumonia-like symptoms,
such as shortness of breath, fever, dry cough, and fatigue (25). We now have a better understanding of the
heterogeneity of COVID-19 related symptoms, which range from asymptomatic cases to life-threatening
respiratory damage and multiple organ failure. It is estimated that asymptomatic transmission accounts for
approximately 50% of transmission (26). In mild cases, individuals commonly experience fever, dry
cough, shortness of breath, sore throat, and fatigue, which last only a few days, while patients with severe
COVID-19 exhibit atypical pneumonia with or without hypoxia (defined as spO2 < 92%), and
progressively develop acute respiratory distress syndrome (ARDS) and/or multiple organ failures (27).
ARDS is the most severe form of ALI and a serious complication of COVID-19 that is associated with
5

high mortality rates. Profound hypoxia and progression to ARDS are largely driven by diffuse alveolar
damage as a result of infected pneumocytes and endothelial cells as well as excessive infiltrations of
neutrophils. As previously discussed, infection of pneumocytes and vascular endothelial cells lead to the
loss of structural integrity of alveoli and increases permeability, thereby impeding alveolar gas exchange
and promoting fluid accumulation (28). Furthermore, reduction of surfactant proteins, such as SFTPA1
and SFTPB, as a consequence of infected pneumocytes, further exacerbates lung injury (29).

For those that develop symptoms, COVID-19 disease progression can be divided into three distinct
stages: asymptomatic, mild symptomatic, and severe symptomatic stages (30). The asymptomatic phase
represents an early stage of infection mainly in the epithelial cells in the nasal cavity and virus incubation
period, which lasts approximately 5-7 days (22). During this time, virus may or may not be detectable
through reverse-transcription polymerase chain reaction (RT-PCR) testing, and patients are typically
asymptomatic. Next, the mild symptomatic stage is characterized by viral replication primarily in the
upper respiratory tract. At this stage, patients begin to develop non-severe COVID-19 symptoms, such as
fever, cough, shortness of breath, and fatigue, lasting 7-10 days after symptom onset. Most COVID-19
patients (~81%) will experience mild symptoms, with infection mostly confined to the upper respiratory
tract (23, 31). A subset of patients (~14%) will progress to the last stage, the severe symptomatic stage,
which is characterized by exuberant systemic inflammation activated by a viral infection, severe
pneumonia, and high viral load (30, 32, 33). About 5-6% of patients become even more critically ill and
eventually progress to develop septic shock, multiple organ failure and/or ARDS.

In the initial stages of the infection, the pathogenesis of COVID-19 is driven by local respiratory
immunity. Local inflammatory response activated through infected pneumocytes and alveolar MΦ, along
with recruited leukocytes, release an excessive amount of inflammatory mediators and reactive oxygen
species, which can cause pulmonary fibrosis as well as other pathophysiological conditions. The
6

continued influx of leukocytes further exacerbates lung damage and augment oxidative stress (24).
Particularly, airways of severe COVID-19 patients are dominated by neutrophils; activated neutrophil
promotes intense inflammatory response by degranulation (which releases neutrophil-derived proteases),
ROS production, cytokine production, and formation of NETs (neutrophil extracellular traps) that drives
further tissue damage and initiate fibrotic process (34). Ground-glass opacity with or without
consolidation, interstitial abnormalities, and vascular enlargement are typical features on chest computed
tomography (CT) scans of hospitalized patients with COVID-19 pneumonia and are indicative of
pulmonary edema and inflammation (35-37). Histological examinations of lung tissues obtained from the
autopsy of patients with severe COVID-19 cases confirmed diffuse alveolar damage, intense pulmonary
inflammation and massive leukocyte infiltrations, and substantial endothelial cell damage and barrier
dysfunctions (38). These pathological events in the respiratory system lead to ALI and ARDS, which
account for the majority of morbidity and mortality in COVID-19 patients. As a result, respiratory failure
is the leading cause of COVID-19-related death.

Epidemiological studies found patients with pre-existing conditions, such as hypertension, diabetes
mellitus, immunosuppression, and cardiovascular diseases, and those age > 65 years are at increased risk
for severe illnesses. For example, Baker et al. found age-related differences in ACE2 expression among
patients requiring mechanical ventilation, where ACE2 expression increased with age, thereby rendering
the elderly patients more susceptible to COVID-19 (39). In addition, secondary bacterial infection in
COVID-19 patients, which occurs in approximately 14.3% of the patient population, has been associated
with worsened prognosis (40, 41).

Interestingly, a subset of patients has reported experiencing a loss of or change in smell and/or taste,
known as anosmia and ageusia/dysgeusia respectively, including those infected yet asymptomatic
individuals (42). However, the underlying mechanism of SARS-CoV-2-mediated olfactory dysfunction is
7

not fully understood. Additionally, some individuals report experiencing prolonged and persistent
COVID-19-related symptoms, often referred to as “long haulers” or “long COVID-19”, which consist of
neurological symptoms, such as “brain fog”, fatigue, palpitations, chills, and headaches (43). So far, little
is known about the pathogenesis of these symptoms or the long-term health consequences of COVID-19.

Extrapulmonary effect of COVID-19
Although the lung is the principal organ affected by COVID-19, several extrapulmonary organs are
adversely affected as well. Increased levels of biochemical parameters, such as alanine aminotransferase
(ALT), aspartate aminotransferase (AST), creatinine, creatine kinase (CK), albumin, among hospitalized
COVID-19 patients show multiorgan involvement (44). Indeed, critically ill patients have been reported
to develop multiple organ injuries and even failures, including spleen atrophy, acute kidney injury, liver
dysfunction, and myocardial injury (45). Likewise, postmortem examinations of COVID-19 patients
confirmed the presence of SARS-CoV-2 in the kidneys, heart, brain, gastrointestinal (GI), and liver,
which also coincide with the tissue distribution of ACE2. In addition to organ injuries, COVID-19
patients are also presented with immunological and hematological complications as a consequence of
dysregulation of immune pathways following SARS-CoV2 infection. While some tissue/organ injuries
are direct results of ACE2 receptor expressions, persistent inflammation elicited by SARS-CoV-2 plays a
substantial role in organ damage (46). Although excessive inflammation was initially believed to be
predominantly restricted to the lung, detection of elevated levels of inflammatory markers in the blood of
severe COVID-19 patients indicates SARS-CoV-2 also triggers a systemic inflammatory reaction, as
depicted in Figure 2 (Image taken from Schultze et al. 2021.) (47). It has been reported that other chronic
inflammatory lung diseases such as chronic obstructive pulmonary disease (COPD) and asthma, are also
accompanied by systemic inflammation (48). Most likely, high concentrations of pro-inflammatory
cytokines in the lung initially leak into the systemic circulation with vascular dysfunction to establish
systemic inflammation. Consequently, systemic inflammation further accelerates lung deterioration as
8

well as worsening of extrapulmonary clinical symptoms. If not managed properly, systemic inflammation
will eventually lead to sepsis, septic shock, and multiple organ dysfunction/failures (47).

Figure 2. Extrapulmonary involvement of COVID-19. Image taken from Schultze et al. 2021. (47).
A robust systemic inflammatory response is a hallmark feature of COVID-19 and plays a prominent role
in the COVID-19 disease progression. Increased systemic inflammatory markers have been shown to be
associated with the disease severity and poor prognosis (49). Critically ill COVID-19 patients have shown
signs of dysfunctional innate and adaptive immune responses, as reflected by excessive neutrophil
activation and profound lymphopenia. Uncontrolled activation of the host immune system in response to
viral infection and amplification leads to excessive release of circulating pro-inflammatory mediators,
known as cytokine storm (CS). CS is potentially fatal and plays a prominent role in the pathogenesis of
9

various severe symptoms of COVID-19. Several studies have directly correlated CS to lung injury and
multiple organ failure in severe COVID-19 patients (35, 50). Specifically, elevated levels of interleukin
(IL)-6, IL-2, IL-1, granulocyte-colony stimulating factor (G-CSF), IP-10, monocyte chemoattractant
protein 1 (MCP1) macrophage inflammatory protein (MIP) 1α, interferon (IFN)-ɣ, and tumor necrosis
factor (TNF)-α, were detected among COVID-19 patients in ICU. (51). These elevated pro-inflammatory
mediators in the blood are likely derived from circulating monocytes/MΦ and neutrophils, which are
activated in response to infected respiratory bronchial epithelial cells and pneumocytes, as well as
resident alveolar MΦ. Accordingly, distinct patterns of elevated pro-inflammatory markers have been
used to predict COVID-19 disease severity and clinical outcomes (52). Early detection of inflammatory
biomarkers has been shown to elevate the risk of developing severe COVID-19 (53). Among the
implicated cytokines, IL-6, in particular, was elevated in 53% of COVID-19 patients and is considered
one of the most important biomarkers of inflammation in COVID-19 (54). IL-6 is a pleiotropic cytokine
known to regulate T cell response, monocyte differentiation, induce further secretions of vascular
endothelial growth factors (VEGF), IL-8, and MIP-1, and reduce E-cadherin expressions on endothelial
cells, which contribute to vascular permeability (55-57).

Clinically, increased serum IL-6 level was predictive of respiratory failure, a need for mechanical
ventilation, and ICU admission in COVID-19 patients (53, 58). Besides IL-6, in vitro studies
demonstrated that among different combinations of cytokines implicated in COVID-19, a specific
combination of TNF-α and IFN-ɣ was responsible for the inflammatory cell death, characterized by
PANoptosis, thus providing a link between cytokine storm and organ damage. PANoptosis induced by
this cytokine combination in vivo closely mimicked the tissue damage and inflammation observed with
COVID-19 patients, and treatment with neutralizing antibodies against these cytokines provided
protection against mortality in SARS-CoV-2-infected mice (59). Furthermore, elevated serum levels of
pro-inflammatory cytokines are accompanied by increased plasma levels of lactate dehydrogenase (LDH)
10

and D-dimer, markers of tissue injury, providing additional associations between cytokine storm and
tissue damage (60). Persistently high levels of circulating pro-inflammatory cytokines also promote the
expression of programmed cell death marker-1 (PD-1) and T cell immunoglobulin and mucin domain-3
(TIM-3) on T cells, which are functional indicators of T cell exhaustion, hindering the appropriate T cell
response for effective viral elimination (61). In addition to the high levels of circulating inflammatory
mediators, increased blood neutrophil counts and their cytotoxic products, such as proteases and NETs are
also found in the plasma of severe COVID-19 patients, further highlighting the systemic influence of the
virus (62-65).

Apart from cytokines and chemokines, one of the most common clinical laboratory abnormalities
observed among hospitalized COVID-19 patients is profound lymphopenia. Persistent lymphopenia is a
telltale sign of dysregulated adaptive immunity and is often associated with poor prognosis in COVID-19
(66). Specifically, reduction in CD4
+
T cells, CD8
+
T cells, B cells, and natural killer (NK) cells, were
reported in severe COVID-19 patients (33). This could partially be explained by ACE2 expressions on
lymphocytes, leading to direct killing by SARS-CoV-2, but could also be, in part, due to systemic release
of pro-inflammatory cytokines triggering lymphocyte apoptosis. A similar observation was reported
among severely septic patients, where elevated pro-inflammatory mediators led to severe lymphopenia
(67). C-reactive protein (CRP), serum ferritin, D-dimer, and procalcitonin are other aberrant blood
parameters found to be significantly increased in sera of COVID-19 patients and are currently used to
predict clinical outcomes in COVID-19 (22, 68, 69). Most notably, CRP was elevated in 86% of COVID-
19 patients and is the most widely used marker to assess inflammatory status (70).

Mounting evidence indicates that patients with severe COVID-19 succumb to the disease primarily due to
the consequences of persistent and exuberant inflammatory responses. Previously, animal models of
11

SARS demonstrated persistent lung inflammation peaking at 14 days post-infection (dpi) despite the viral
clearance after 10 dpi, suggesting that the prolonged and worsening of clinical symptoms in severely ill
patients may be less driven by viral replication but rather caused by persistent and dysregulated
inflammation (71, 72).

Molecular mechanism of SARS-CoV-2-induced inflammatory response
The innate immune system is the first line of host defense against viral infection. Upon infection, the
tissue-resident MΦ and dendritic cells (DC) recognize nonspecific pathogen-associated molecular
patterns (PAMP) (i.e. viral RNA) and/or danger-associated molecular patterns (DAMP) released from
lytic cells. Recognition occurs through PAMP/DAMP binding to pattern recognition receptors (PRR)
expressed on the immune cells, typically toll-like receptors (TLR), NOD-like receptors (NLR), or RIG-I-
like receptors (RLR). Upon detection, PRR activates several intracellular signaling cascades, such as NF-
κB transcription factors and MAPK pathways, leading to the production of pro-inflammatory cytokines
and chemokines. In the context of viral infection, type I interferons (IFN) are particularly upregulated to
mount an effective antiviral response for rapid infection control. If the infection is not resolved in a timely
manner, MΦ and DC prime the adaptive immunity for antigen-specific responses by presenting the viral
antigens to T lymphocytes to initiates T and B cell activation, proliferation, and differentiation (73).
Efficient viral clearance mediated by the adaptive immune system requires functional CD8
+
and CD4
+
T
cells. If the virus is not properly eliminated by the host’s innate and adaptive immune responses,
infections may advance to severe inflammatory response syndrome resulting in systemic injuries and
eventually death.

The exact underlying mechanisms responsible for SARS-CoV-2-mediated disruption in host immune
response and immune evasion are not well understood. Nevertheless, several mechanisms have been
proposed to explain SARS-CoV-2-induced aberrant inflammatory response, as illustrated in Figure 3
12

(74). One mechanism in which SARS-CoV-2 induces inflammatory response is through its direct viral
cytotoxicity. Replication of the positive-strand RNA virus in the host cells triggers the infected cells to
produce chemokines and cytokines to recruit and activate circulating monocytes and neutrophils. This
process goes haywire with SARS-CoV-2 infection, where infected cells, as well as recruited immune
cells, uncontrollably release pro-inflammatory mediators and further amplify inflammatory responses.
Leng et al. discovered through proteomic analysis of lung tissues of deceased patients with COVID-19-
related pneumonia the differential expressions of immune-related proteins when compared to control
samples (29). Upregulation of downstream cytokines/chemokines of NF-κB signaling pathways, such as
IL-6, IL-8, TNF-α, ICAM-1, and CXCL12, as well as activated p65 and p52, which are major subunits of
the canonical and non-canonical NF-κB pathways respectively, were detected in the lung tissues, proving
that overactivations of canonical and non-canonical NF-κB signaling pathways are major drivers of the
COVID-19-related hyperinflammation. Furthermore, SARS-CoV-2 activates the NLRP3 inflammasome
and subsequent caspase-1 in infected monocytes, which is involved in the processing and secretion of IL-
1β and IL-18 as well as pyroptotic cell death (60, 75). Production of IL-1β can further stimulate robust
secretion of other inflammatory cytokines, including TNF-α and IL-6, exacerbating local and systemic
inflammatory state.

A growing body of evidence suggests that SARS-CoV-2 directly activates caspase-8 (59, 76). In vitro,
SARS-CoV-2 infection of lung epithelial cells activated caspase-8 and triggered profound cell death as
well as intense inflammatory responses through its regulation of PANoptosis, which is pro-inflammatory
programmed cell death. Caspase-8 is a master regulator of PANoptosis, and excessive PANoptosis is
responsible for causing organ damage and failure observed in COVID-19 patients. In addition, direct
activation of caspase-8 mediates the processing and secretion of inflammatory cytokines, such as IL-1β
and IL-18, independent of caspase-1 activity (76). Pharmacological inhibition of caspase-8 through Z-
13

IETD-FMK attenuated inflammation in respiratory epithelial cells infected with SARS-CoV-2,
underscoring its role during SARS-CoV-2-induced inflammation.

The majority of pro-inflammatory mediators are produced by the neutrophils and MΦ, and to a certain
extent, by the epithelial cells (77). Single-cell RNA sequencing of peripheral blood mononuclear cells
(PBMCs) from healthy subjects and patients with mild or severe COVID-19 correlates with aberrant
activation of monocytes. The severity of lung injury has also been tied to extensive neutrophil and
macrophage infiltrations in the lungs. Neutrophil activation is an amplifier of lung injury in ARDS as it
produces proteases and reactive oxygen species (ROS), leading to potentially irreversible lung damage
and remodeling. Excessive release of inflammatory mediators as a result of dysregulated immune
response is the major driver of acute lung injury and subsequent acute respiratory distress syndrome (62).
Profound neutrophilia and NETosis are other contributors to progressive lung impairment. NETosis refers
to extracellular web-like structures consisting of DNA, histones, and oxidative enzymes that are released
by neutrophils during apoptosis to immobilize and kill invading pathogens. Inappropriate NETosis can
stimulate an immune response that can lead to chronic inflammation and therefore implicated in acute
lung injury and sepsis. Recent studies have shown that SARS-CoV-2 directly promotes NET release by
neutrophils through ACE2 expression (65). Additional in vitro studies revealed that SARS-CoV-2-
activated neutrophils promoted apoptosis and the pro-fibrotic process of lung epithelial cells by releasing
NETs (65).

SARS-CoV-2, in part, also disrupts the normal host inflammatory response through its E protein, which is
a viroporin involved in viral virulence (78). While the exact mechanism is still poorly understood, E
protein is responsible for activating the NF-κB signaling pathway as well as NLRP3 inflammasome (78,
79). This was corroborated by the finding that the mice infected with SARS-CoV lacking E protein were
14

unable to generate an inflammatory response. Specifically, mice infected with mouse-adapted coronavirus
lacking E protein did not exhibit any significant weight loss or mortality and reduced lung infiltrates with
less NF-κB-mediated inflammation when compared to the mice infected with the wild-type virus (79).
Similarly, SARS-CoV-2 E protein provoked inflammation in vivo and in vitro, presumably through
similar mechanisms as the E protein of SARS-CoV (80).

In addition to the direct effect of SARS-CoV-2 on hyperinflammation, SARS-CoV-2 indirectly promotes
a pro-inflammatory state by altering the availability of the target receptor, ACE2. As previously
mentioned, the main biological function of ACE2 is to maintain RAS homeostasis by converting AngII to
Ang 1-7. This metabolism antagonizes the biological effects of AngII on AngII type 1 receptor (AT 1) and
instead leads to vasodilation, vascular protection, anti-proliferation, and anti-fibrosis, conferring
protection against hypertension and tissue fibrosis (46). Beyond its well-recognized roles in homeostatic
regulation of blood pressure, cardiovascular and renal function, and fluid balance, RAS also plays a
critical role in modulating inflammation. This is mediated through Ang 1-7 binding to Mas receptor, which
leads to inhibition of MAPK/NF-κB signaling cascades and reduction in neutrophil migration and
oxidative stress (81, 82). As a result, high expression of ACE2 receptor in tissues and organs, particularly
the heart and lung, provides protection against injury (7, 19, 83). Conversely, AngII exerts pro-
inflammatory activities through activation of inflammation-related signaling pathways, free radical
generation, protein kinase activation, leukocyte recruitments, and upregulation of cytokines and
chemokines. Therefore, as a result of SARS-CoV-2-mediated ACE2 endocytosis, the reduction in the
cleavage of ACE2 to AngII causes an imbalance in RAS. Consequently, not only does this enhance the
risk of cardiovascular and respiratory diseases, but also promotes a pro-inflammatory environment (84).
Indeed, mice infected with SARS-CoV showed a substantial reduction in ACE2 surface expression in the
lungs (85). This can potentially further augment the pro-inflammatory state during COVID-19 infection
and contribute to multiple organ damage. These detrimental effects extend the dysregulated inflammatory
15

responses described in infected macrophages and neutrophils and promote destructive inflammatory
processes in the lung as well as systemically.

Aside from supportive care, there is currently no antiviral treatment specifically and effectively targeting
SARS-CoV-2. Numerous drugs have been repurposed to treat COVID-19, including remdesivir,
hydroxyquinoline, ivermectin, and lopinavir-ritonavir, yet none of them has proven effective against
SARS-CoV-2 (86, 87). Therefore, targeting cytokine storms to manage COVID-19-related severe
symptoms may provide an avenue to lower morbidity and mortality.

Immunosuppressive agents as adjunctive therapies for COVID-19
Given that aberrant inflammatory response is the leading cause of ARDS and mortality in patients
hospitalized with COVID-19, much attention has been placed on dampening the aberrant inflammation.
In line with this view, several immunomodulating agents have been investigated for their role in the
management of COVID-19 symptoms. The most successful corticosteroid in the treatment of COVID-19
was dexamethasone; a RECOVERY trial demonstrated that dexamethasone treatment led to improvement
in the rate of hospitalization and lower mortality in hospitalized COVID-19 patients receiving invasive
mechanical ventilation (IMV) or receiving supplemental oxygen without IMV when compared to standard
of care alone (88). Similarly, two independent, small trials found methylprednisolone to decrease the
mortality rate, oxygen saturation and inflammatory biomarkers in COVID-19 patients when compared
with those treated with standard of care alone (89, 90). Currently, the CDC’s therapeutic management
guidelines for COVID-19 recommend dexamethasone or other corticosteroids with or without remdesivir
for adults hospitalized with COVID-19 requiring supplemental oxygen or IMV. However, at present,
there is insufficient evidence to indicate whether such therapies provide benefits for those experiencing
milder COVID-19 symptoms or those who do not require supplemental oxygen (91). This may be of
16

concern as early interventions of inflammation likely will improve the patient outcome and survival (92).
In addition, corticosteroids should always be used with caution. Corticosteroid use has shown to be
independently associated with acute liver injury in COVID-19 patients and such injury was associated
with adverse clinical outcomes (93). Moreover, corticosteroid use has been associated with increased
prevalence of glucose intolerance, delayed viral clearance, and elevated risk of secondary bacterial
infections (94-96). Since COVID-19 patients often have multiple underlying medical conditions, the
associated risks with corticosteroid may outweigh the benefit to justify the use in these vulnerable
population.

Beyond corticosteroids, other immunosuppressive agents have been investigated to treat COVID-19
induced cytokine storm, including monoclonal antibodies and inhibitors of inflammatory signaling
pathways. Tocilizumab, a humanized anti-IL-6 receptor monoclonal antibody, garnered the most attention
at the beginning of the pandemic as IL-6 is regarded as one of the most relevant pro-inflammatory
cytokines in SARS-CoV-2 infection and has been used to predict disease severity in hospitalized patients.
However, most recent randomized controlled trial demonstrated that tocilizumab among patients with
COVID-19 pneumonia does not improve clinical outcomes or mortality (97). Likewise, there are
conflicting reports regarding the effect of IL-1 receptor blockade on severe COVID-19 patients. While a
retrospective study demonstrated a reduction in the need for invasive mechanical ventilation in the ICU
and mortality among those with severe COVID-19, a randomized controlled trial revealed a lack of
improvement in clinical outcomes with anakinra, a recombinant IL-1 receptor antagonist, (98, 99).
Regardless of the potential benefits, similar to corticosteroids, prolonged blockade of IL-1 or IL-6 has
been associated with adverse effects, including increased risk of secondary infection, and potential
impairment in viral clearance. Lastly, baricitinib, which acts through selective inhibition of Janus kinase
(JAK) 1 and JAK2, is another immunosuppressive agent that emerged as a potential candidate. During
SARS-CoV-2 infection, IL-6 activates JAK signaling pathways by binding to IL-6 receptor, and
17

excessive activation through IL-6 signaling accelerates organ damage (100). While ACTT-2 study
demonstrated significant improvement with baricitinib treatment in clinical status among patients
receiving high-flow oxygen or NIV when compared to those receiving standard of care alone, baricitinib
was also associated with delayed viral clearance and increased risk of thromboembolism (101, 102).
Thus, the benefit among these currently available immunosuppressive therapies is limited and often
conflicting, and present potentially detrimental adverse effects, highlighting the need for a safer anti-
inflammatory treatment option for COVID-19.

Host Defense Peptides (HDP)
Host defense peptides (HDP), also known as antimicrobial peptides, are short, naturally occurring cationic
and amphipathic peptides that are an integral part of human innate immunity and exhibit a broad range of
biological functions, from controlling infections to resolving harmful inflammation and promoting wound
healing (Figure 3, Image taken from Mookherjee et al. 2020) (103). These are ubiquitously found
throughout the body and exist as either soluble or cell-associated forms (104). One of the major
advantages of HDPs as a potential therapeutic is their low risk of microbial resistance due to the wide
variety of mechanisms of antimicrobial actions it exerts. They have antimicrobial activity against a wide
range of pathogens, including Gram-positive and Gram-negative bacteria, fungi, protozoa, and viruses.
Most HDPs share similar antimicrobial mechanisms of action; the cationic and amphipathic nature of
HDP permits the positively charged amino acid residues of the peptide to bind to the negatively charged
bacterial cell membrane, while hydrophobic residues allow the peptides to directly disrupt and penetrate
the bacterial membrane, leading to pore formation and ultimately cell lysis (105). Some HDPs also
interact with intracellular targets and inhibit crucial cellular processes, such as DNA, cytosolic RNA or
protein synthesis, enzymatic activities, or cell wall synthesis (104, 106-108). The majority of HDP are
packaged and stored in granules of leukocytes and released during granule-phagosome fusion (109, 110).
In some cases, HDPs are released during degranulation or secreted to the site of infection/injury to exert
18

their biological activities. Some HDP are constitutively expressed (i.e. neutrophil defensins, Paneth cell
defensins, hBD-1), while others are induced (hBD2-4) by pro-inflammatory cytokines (i.e. TNF-α) and/or
PAMP/DAMP during infection or injury, through the activations of NF-κB and/or AP-1 signaling
pathways (104, 111, 112).

In addition to the antimicrobial properties, HDPs have immunomodulatory properties, contextually
orchestrating the immune response during infection or injury, to maintain immune homeostasis. It
promotes pro-inflammatory response both directly and indirectly to enhance microbial clearance; directly
by stimulating the transcription of pro-inflammatory genes and indirectly by recruiting effector cells to
the site of infection/inflammation, enhancing phagocytosis, and inhibiting neutrophil apoptosis.
Conversely, HDP can preferentially trigger anti-inflammatory responses during a heightened state of
inflammation by suppressing the production of pro-inflammatory mediators through direct inhibition of
NF-κB and mitogen-activated protein kinase (MAPK) signaling pathways (104). During infection, the
positive charge of HDP enables binding to, and subsequent neutralization of endotoxins, such as LPS,
thereby controlling bacterial-induced inflammation (113). These multifunctional peptides also act as
effector molecules to link between innate and adaptive immunity; they are capable of recruiting adaptive
immune cells and promoting activation and differentiation of DC and Th1 response, to augment the
adaptive immune response during a pathogenic challenge (114, 115). During resolution of infection and
inflammation, HDPs enhance the wound repair process through stimulation and proliferation of
keratinocytes and fibroblast, as well as neovascularization and angiogenesis (116). Over the last decade,
therapeutic potentials of HDP extensively investigated as alternatives or adjuvant therapies to
conventional antibiotics and antifungals in hopes of combating rapidly emerging multidrug-resistant
pathogens. Despite their potent and diverse biological activities, to date, the efficacy of HDP against
SARS-CoV-2 has not yet been investigated.

19

Figure 3. Pleiotropic effects of host defense peptides (HDP). Image taken from Mookherjee et al. 2020.
(103).
In mammals, HDP can be categorized into the two most well-characterized families: cathelicidins and
defensins. HDP belonging to cathelicidins family contain highly conserved “cathelin like” domain, and
are expressed predominantly by neutrophils and epithelial cells (117). To date, LL-37 is the only
cathelicidin known to be produced by humans, and its expression is inducible by the activation of vitamin
D receptor (VDR), which is expressed by various immune and epithelial cells. It is synthesized and stored
in neutrophil granules as an inactive precursor (prepropeptide) and activated through proteolytic cleavage
by serine proteases during degranulation during infection. LL-37 has also been detected in human
wounds, sweats, and airway surface liquids (118).

20

Defensins
Defensins are small, cysteine-rich, tri-disulfide-containing HDP that are divided into three subfamilies, α-
, β-, and θ-defensin, the differences in the position of disulfide bridges and molecular structures (119).
Permeabilization of bacterial membrane is defensin’s key mode of antibacterial action. While humans are
capable of producing α- and β-defensins, θ-defensins are not expressed in humans as a consequence of a
premature stop codon in gene encoding θ-defensins that prevents the translation of the peptide and are
only expressed by certain nonhuman primates. In humans, α- and β-defensins are differentially expressed
throughout the body; α-defensins are highly abundant in granules of neutrophils and intestinal Paneth
cells and are constitutively expressed, whereas β-defensins are predominantly expressed by the mucosal
epithelial cells and play a role in preventing pathogen colonization on the epithelium (111, 112, 120).
Similar to LL-37, human β-defensin-2 (hBD-2) expression is inducible upon activation of VDR as well as
in response to infection/inflammation. θ-defensin is structurally distinct from α- and β-defensins in that it
is naturally cyclized through head-to-tail ligation of two 9-amino acid peptides derived from α-defensin
paralogs and stabilized by three disulfide bonds (121). It was first discovered in leukocytes of rhesus
monkeys and is expressed in other Old-World Monkeys, such as baboons, vervet, and orangutans (112,
122).
Rhesus theta (θ) defensin-1 (RTD-1)

Figure 4. The structural feature and amino acid sequence of RTD-1. Image taken from Schaal et al.
2017. (123).
21

Rhesus theta (θ) defensin-1 (RTD-1) is an 18 amino acid macrocyclic HDP found in the leukocytes of
rhesus macaque (Figure 4, Image taken from Schaal et al. 2017) (123). Of the six isoforms of rhesus
macaque θ-defensins, RTD-1 is the most abundantly expressed θ-defensin in neutrophils of rhesus
monkeys, comprising approximately 50% of the total defensins isolated from the neutrophils (124). RTD-
1 displayed excellent peptide plasma stability and a prolonged plasma half-life in vitro and in vivo studies,
without any hemolytic or cytotoxic effect (125, 126).

Antimicrobial activity of RTD-1
RTD-1 has a low micromolar antimicrobial potency against a broad spectrum of pathogens, including
methicillin-resistant S. aureus (MRSA), E. Coli, P. aeruginosa, C. albicans, and human
immunodeficiency virus 1 (HIV-1) (127-131). The cyclic conformation of RTD-1 is an essential
component for antimicrobial activity and stability. The direct antimicrobial activities of RTD-1 derive
from the permeabilization of the microbial membrane as well as the inhibition of cytosolic β-
galactosidase activity (132). Modest anti-biofilm activity of RTD-1 was observed in mucoid strains of P.
aeruginosa, which are known to form biofilm aggregates as part of the antibiotic resistance mechanism
(128). The antibacterial activity of RTD-1 was 3-fold higher with the cyclic structure when compared to
that of linear analog; the cyclic backbone of RTD-1 allowed the peptide to retain its microbicidal activity
in high salt concentration of up to 150 mM NaCl as well as acidic conditions and conferred stability
against proteolytic degradation (133, 134).

Anti-inflammatory activity of RTD-1
A number of in vivo and in vitro studies demonstrated potent anti-inflammatory properties of RTD-1
(125, 132, 135). In vivo, aerosolized treatment of RTD-1 effectively reduced leukocyte infiltrations and
inflammatory cytokines without significant weight loss in both a murine model of chronic P. aeruginosa
22

lung infection and in cystic fibrosis (ΔF508) mice with chronic P. aeruginosa lung infection (128, 135).
In vitro and ex vivo analyses demonstrated that RTD-1 treatment led to a marked reduction in pro-
inflammatory chemokine and cytokine productions in monocytes and macrophages stimulated with TLR
agonists, as well as in bronchial epithelial cells induced with P. aeruginosa filtrates (125, 135, 136).
Mechanistically, RTD-1 exhibits multiple modes of anti-inflammatory actions. Interestingly, Schaal et al.
demonstrated that the anti-inflammatory activity of RTD-1 is independent of endotoxin neutralization
(125). Rather, RTD-1 inhibits the activations of NF-κB and MAPK signaling pathways through
stimulating the phosphorylation of Akt, which in turn inhibits IκBα degradation and p38 MAPK
phosphorylation, as illustrated in Figure 5 (Image taken from Tongaonkar et al. 2015) (137). Along with
these mechanisms, RTD-1 also acts as a direct, non-competitive inhibitor of TNF-α converting enzyme
(TACE), also known as a disintegrin and metalloproteinase (ADAM)-17, ADAM-10, and human MMP-9
(135, 138). Multiple mechanisms of action employed by RTD-1 to modulate inflammation indicate RTD-
1 treatment may be efficacious in various inflammatory disease models.

23

Figure 5. Mechanisms of anti-inflammatory activity of RTD-1. Image taken from Tongaonkar et al.
2015. (137).

Potential role of RTD-1 in the treatment of COVID-19
As the name indicates, SARS-CoV, the causative agent of SARS pulmonary disease in 2002-2003, and
SARS-CoV-2 are genetically related and share numerous similarities with regards to molecular features,
target host receptor, and mechanisms of actions. Both strains of coronaviruses use S protein to bind to the
host cell receptor ACE2, although the binding affinity to ACE2 substantially differs, and both elicit pro-
inflammatory responses through the activation of NF-κB signaling cascades (139). As a result, common
clinical features associated with these two infections are comparable: persistent fever, dry cough, atypical
pneumonia, airway inflammation, lung pathologies, severe respiratory illness, and multiple organ
involvement. Previously, the therapeutic efficacy of RTD-1 treatment was evaluated in a murine model of
24

SARS (140). Intranasal administration of RTD-1 improved survival without any changes in viral load in
the lungs of treated mice. Remarkable protection against SARS-mediated mortality was accompanied by
significant reductions in pro-inflammatory cytokines (IL-1α, IL-1β, IL-6, MIP1α, and G-CSF). No
significant changes in IFN-ɣ levels with RTD-1 treatment suggest that it likely does not cause viral
clearance delay. Furthermore, mice treated with RTD-1 displayed a moderate level of perivascular
filtrates in the lung that resolved by day 10 while the infected mice developed substantial alveolar edema
and perivascular infiltrates. Therefore, the beneficial effects associated with RTD-1 are most likely
attributed to the attenuation of lung inflammation. This knowledge may be relevant since both SARS-
CoV and SARS-CoV-2 induce inflammation through the activation NF-κB signaling pathway and cause a
similar inflammatory response in the lung and systemically, implying that RTD-1 treatment may also
provide protection against severe COVID-19 and mortality (79).

As previously mentioned, secondary bacterial infection is associated with increased mortality in patients
with COVID-19. This, together with the fact that COVID-19 patients are often treated with
immunosuppressive therapies, lead to an even greater risk of secondary bacterial infection and therefore
health concerns for COVID-19 patients. Accordingly, there is an urgent need for COVID-19 treatment
that suppresses the immune system without predisposing the patients to secondary bacterial infection. The
dual antimicrobial and immunomodulatory properties of RTD-1 address this exact need.

Therapeutic peptides
The most recent data released in April 2021 reported that over 80 peptide drugs are currently on the
market, occupying approximately 7% of the total number of approved drugs (141, 142). The most well-
known, FDA-approved therapeutic peptides are glucagon-like peptide 1 receptor agonist (GLP-1RA)
(liraglutide), and synthetic hormone analogs (leuprolide, goserelin, octreotide, and lanreotide) (143, 144).
25

By definition, peptides are naturally occurring short chains of amino acids that are generally shorter than
50 amino acids in length and molecular weight of less than 10 kDa (145). The size and structure of
therapeutic peptides have a significant impact on pharmacokinetics as well as biodistribution. Molecular
weight, in particular, is an important determinant in elimination mechanisms, as peptides weighing less
than 10 kDa are susceptible to rapid filtration by the kidneys (146). Over the last two decades, peptide-
based therapeutics garnered significant attention as they have major advantages over small molecule
drugs as well as larger biologics. Some advantages of small therapeutic peptides include high affinity and
selectivity for targets with low toxicity profiles, which result from their extremely tight binding to targets
and therefore little to no off-target activities, and low immunogenicity and better membrane permeability
than other larger biologics (147-149). Lastly, peptides are generally not substrates for metabolizing
enzymes (i.e. CYP450), and therefore have a low potential for drug-drug interaction (DDI). Despite these
advantages, a number of limitations have hindered the development of peptides as therapeutics.
Limitations consist of poor stability, particularly those with L-amino acids that are subject to rapid
proteolysis/degradation by proteases and peptidases leading to low bioavailability, physical and chemical
stability (i.e. tendency to form aggregates, adsorption), and rapid renal excretion resulting in short plasma
half-life (148, 150, 151). For these reasons, most therapeutic peptides and proteins are administered by
subcutaneous, intramuscular, or intravenous route (152). Fortunately, advances in biotechnology enabled
modification of peptides to improve its PK properties and make peptides more “druggable”. These
include replacing natural L-amino acids with unnatural D-amino acids to increase resistance to
degradation by proteolytic enzymes, increasing binding affinity to plasma proteins to reduce rapid renal
clearance and prolonging the plasma half-life, and use of excipients to reduce aggregation (151). While
the pharmacokinetic-pharmacodynamic (PK/PD) relationship of synthetic peptides has been extensively
studied in recent years, there is insufficient knowledge regarding the PK/PD relationship of HDP,
particularly the defensins (153).

26

Nonlinear pharmacokinetics
Pharmacokinetics (PK) refers to the study of drug absorption, distribution, metabolism, and excretion as a
function of time. A number of therapeutic peptides and proteins have been shown to exhibit nonlinear PK,
suggesting that we may also anticipate a similar pharmacokinetic behavior with RTD-1. For drugs that
follow linear PK, systemic exposures change by the same factor as the changes in dosages, and the
relationship yields a slope of the linear regression of 1. In contrast, for drugs that follow nonlinear PK,
drug exposures change disproportionally to the dose, with a slope of the linear regression excluding 1.
Nonlinearity in PK can arise in all aspects of absorption, distribution, metabolism, and excretion (ADME)
processes as well as in response to pathological alterations in the body (154). Generally, most drugs at
low doses exhibit first-order (i.e. linear) kinetics but begin to deviate from dose linearity at higher doses
due to the saturation of biological processes involved in ADME. Mechanisms responsible for the lack of
dose proportionality may be nonlinear distribution, which includes processes such as plasma protein
binding, red blood cell partitioning, or tissue binding/partitioning, or nonlinear elimination, such as
enzyme metabolism or target-mediated drug disposition (TMDD). TMDD occurs when the drug binding
to its target with high affinity affects the subsequent disposition of the drug. Specifically, upon the drug
binding to its target, the drug-target complex gets removed, leading to decreases in both available drug
and the target in the body. Nonlinear behavior of therapeutic peptides poses a significant challenge
clinically, particularly if nonlinearity is observed at therapeutic dose ranges, as small dosage adjustment
could yield disproportionate changes in drug exposure that can result in suboptimal drug effects or
unexpected toxicity. This is often driven by the peptide’s high specificity binding to capacity-limited
target receptors/enzymes, yielding dose-dependent decreases in drug clearance (145, 155). Therefore, it is
crucial to identify the mechanisms responsible for nonlinearity in PK to precisely define a dose-exposure
relationship to predict efficacy and safety.

27

The saturation of a clearance mechanism is the most common source of nonlinearity, but nonlinearity can
exist in other saturable, capacity-limited processes in ADME. Nonlinear binding to plasma constituents,
distribution to red blood cells (RBC), cellular uptake, and/or tissue bindings are potential causes of
nonlinearity that can occur during drug distribution. Cyclosporin A, a cyclic polypeptide
immunosuppressant, display nonlinear PK that could be explained, in part, by saturable partitioning to
erythrocytes and nonlinear extravascular tissue binding (156, 157). Plasma protein binding involves drugs
binding to proteins present in the plasma, such as albumin, globulins, α-1-glycoproteins (AAG), or
lipoprotein and depends heavily on the drugs’ physicochemical properties. In general, highly lipophilic
compounds tend to have high affinity for plasma proteins. This parameter, too, can be concentration-
dependent and saturable as a result of low capacity, yet high specificity binding. For example, AAG is
present at relatively low levels in plasma (~1-3%) and has a limited drug-binding site (158, 159). Hence,
drugs that preferentially bind to AAG can easily saturate the binding sites of AAG at high drug
concentrations and exhibit nonlinear distribution kinetics, which can be reflected by dose-dependent
decrease in volume of distribution.

The most well-known elimination mechanism that is associated with nonlinearity is receptor-mediated
elimination, also known as TMDD, a mechanism of elimination employed by many monoclonal
antibodies, growth factors, and therapeutic proteins (160). Drugs exhibiting TMDD as a major elimination
process display nonlinear behavior at low concentrations due to the limited target expression in the body,
but begin to follow linear kinetics at higher concentrations as a result of the saturation of target binding
(160). For example, Chen et al. reported that exenatide, a 39 amino acid peptide, displays a nonlinear
disposition due to target-mediated elimination, as reflected by decreases in elimination and volume of
distribution with increases in the dose in preclinical species (161). Similarly, nonlinear PK dispositions of
other peptides, such as recombinant human interferon (IFN) drugs (e.g. IFN-β1a) and erythropoietin
28

(EPO), were also explained by TMDD, suggesting that this elimination process is commonly observed
with therapeutic peptides (162, 163).

Summary
In summary, RTD-1 possesses a wide range of biological activities, from direct antimicrobial activity to
potent immunomodulation, making it an ideal candidate for the treatment of various inflammatory
diseases including COVID-19-induced cytokine storm. Owing to its potent efficacy and favorable safety
profile, RTD-1 is currently being investigated as a treatment for rheumatoid arthritis and COVID-19.
While RTD-1 does not have direct antiviral activity against SARS-CoV-2, given the importance of
targeting systemic inflammatory response in COVID-19 patients, RTD-1 may be a promising drug
candidate to treat inflammation in COVID-19. Therefore, this thesis aims to examine the therapeutic
potential of RTD-1 for COVID-19 pneumonia and to characterize the plasma and tissue pharmacokinetics
in preclinical species to determine the most appropriate doses for first in human trials.

In chapter 2, we investigate the therapeutic efficacy of RTD-1 in murine model of COVID-19 mediated
ALI and establish the target AUC necessary for therapeutic benefits.
In chapter 3, we characterize the pharmacokinetics and safety of intravenous RTD-1 in preclinical species
and predict the human equivalent doses based on the target AUC previously established by the ALI model
as well as NOAEL established in toxicity studies.
In chapter 4, we explore the distribution kinetics of intravenous RTD-1 in rats, elucidate the mechanism
involved in the hepatocellular uptake of RTD-1, and examine the consequences of RTD-1 exposures in
the liver, specifically the potentials for RTD-1-induced hepatocytotoxicity and CYP3A4-mediated drug-
drug interaction.
29

Chapter 2. Rhesus theta (θ)-defensin-1 attenuates endotoxin-induced acute lung injury by
inhibiting proinflammatory cytokines and neutrophil recruitment
Introduction
Initial SARS-CoV-2 infection is associated with development of mild pathological changes in the lungs
that resembles closely the key pathological features of acute lung injury (ALI). ALI is a clinical syndrome
characterized by rapid onset of airway inflammation, lung edema and impaired gas exchange due to
increase in endothelial permeability, and can develop into more severe form, ARDS with worsening
hypoxemia (164). It can develop in response to a variety of insults including bacterial/viral infections,
sepsis, trauma, or gastric aspiration (165). Leukocytes, particularly the neutrophils, play a critical role in
the pathogenesis of ALI; excessive and prolonged activation of neutrophils and associated oxidants and
proteolytic enzymes cause damage to the pulmonary parenchyma and microvasculature (165). In addition,
proinflammatory cytokines are associated with the severity of ALI, underscoring the importance of
inflammation as a therapeutic target for COVID-19 (166). In a subset of hospitalized COVID-19 patients,
ALI may progress to ARDS, which may result in respiratory failure. Therefore, failure to appropriately
manage the exuberant inflammation in COVID-19 can ultimately increase the risk of irreversible lung
damage and death.

Defensins are cationic HDP that promote essential innate and adaptive immune responses within the
lungs. While first studied for their broad-spectrum activity against bacteria, fungi, and viruses; defensins
also contribute to recruitment of inflammatory cells and activation of adaptive immune responses (115).
Although - and -defensins are critical to mounting an effective immune response to an invading
pathogen, -defensins have been shown to contribute to the pathogenesis of ALI by disrupting the
capillary-epithelial barrier (167). Theta (θ) defensins are macrocyclic HDP found in leukocytes of Old-
World monkeys but lost to man through the evolutionary acquisition of a premature stop codon that
30

aborts translation (122, 168). They are 18 amino acids in length and are formed by the dimeric head-to-
tail ligation of two peptide precursors and further stabilized with three disulfide bonds. Several studies
have demonstrated that RTD-1 exhibits broad spectrum microbicidal activity against viruses, bacteria, and
fungi (127, 128, 131, 133). In contrast to the -defensins which promote pro-inflammatory state, theta
defensins have been shown to exhibit anti-inflammatory activity in vitro (125, 137). Data shows RTD-1
diminishes cytokine production in leukocytes stimulated with a number of TLR agonists including heat-
killed L. monocytogenes (TLR2), flagellin (TLR5), LPS (TLR4) and E. coli (13). Furthermore, RTD-1
treatment significantly reduced inflammatory cytokines in murine models of polymicrobial sepsis and
severe acute respiratory syndrome (SARS) (125, 140). Early pre-clinical investigations in mice, rats, and
chimpanzee demonstrated the safety and non-immunogenicity of RTD-1 (125).

The dual antimicrobial and immunomodulatory properties of RTD-1 provide a unique approach to
treating both infection and inflammation associated with COVID-19. In this study, we sought to
investigate whether the immunomodulatory potential of RTD-1 mitigates leukocyte migrations and
neutrophil-induced lung injury that are implicated in COVID-19 (169). To determine the effect of RTD-1
on COVID-19, mice were treated with RTD-1 30 minutes prior to the initiation of lung inflammation, at
the time of LPS challenge and 12 hours after the initiation of inflammation using the well-established
murine model of intranasal LPS-induced acute lung neutrophilia (169, 170). We evaluated RTD-1
intervention by quantifying airway neutrophil burden and activation, cytokine release, gene expression,
pulmonary vascular leakage, and extent of lung injury. Additionally, in vitro assays investigating
neutrophil chemotaxis and adhesion, as well as LPS-induced alveolar macrophage (MΦ), and human lung
epithelial inflammation provide supportive details on RTD-1 responsive cell populations. We provide
evidence that RTD-1 reduces LPS-induced lung injury by inhibiting neutrophil recruitment and alveolar
MΦ pro-inflammatory cytokine production.

31

Materials and Methods
Animals and husbandry
All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee
(IACUC) at the University of Southern California (Protocols 11676 and 11956). Male, 8-10-week-old
BALB/c mice (Charles River Laboratories, CA) weighing 20-25 g, were housed under specific pathogen-
free conditions with a temperature of 22-24°C and humidity of 60-65%, with 12 h light/dark cycles. The
animals were provided standard laboratory chow and water ad libitum.

Endotoxin, RTD-1, and general reagents.
Pseudomonas aeruginosa lipopolysaccharide was purchased from Sigma (Pa-LPS, MO, USA, Serotype
10, ATCC strain 27316). The hydrochloride salt of RTD-1 (>98%) was synthesized using Fmoc
chemistry as described previously (131, 134, 171). A stock solution was prepared in sterile water and
0.22 μm filter-sterilized and concentration/purity determined by LC-MS. Working solutions were further
prepared in 0.9% Sodium Chloride for injection, USP (Hospira, Lake Forest, IL) for administration to
animals. Turks blood diluting fluid for leukocyte counts was obtained from Ricca Chemical Co
(Arlington, Tx). PBS w/o Ca
+2
, Mg
+2
was purchased from Lonza (Walkersville, MD). Otherwise, unless
specified, materials were purchased from VWR (Radnor, PA).

Experimental procedures
Bacterial LPS instilled intranasally induces acute neutrophilic airway inflammation and lung injury in
mice. The route, time, BALB/c mouse strain, P. aeruginosa bacterial endotoxin type and 1 g endotoxin
amount was based on literature modeling the acute lung injury condition (169, 170) and therapeutic
32

investigations (172-174). Mice were sedated with a single intraperitoneal injection of 100 L of ketamine
80 mg/kg (Hospira, Lake Forest, IL, USA) and xylazine 10 mg/kg (Lloyd, Shenandoah, IA, USA). Acute
lung inflammation was induced by intranasal administration of 1 g of LPS in 50 μL of PBS. In the dose
ranging study, mice were randomly assigned to subcutaneous (s.c.) RTD-1 at 0, 0.2, 1, 5, or 25 mg/kg 0.5
h before LPS challenge (n=6/ group). Mice were euthanized 24 h after LPS challenge.

In an intervention study RTD-1 was administered s.c. post induction of inflammation at 25 mg/kg at the
time of LPS insufflation (T 0) and in a separate group of mice 12 hours post LPS insufflation (T 12).
Dexamethasone (DEX) was administered s.c. at 2 mg/kg at T 0. Mice were euthanized 48 h after LPS
administration (n=9/group). Separately, 3h after LPS administration another group of mice were
euthanized for gene expression (n=6/group). To examine the preventative effect, RTD-1 was administered
s.c. at 5 and 25 mg/kg 0.5 h before LPS challenge. Mice (n=3/ group) were euthanized after 0.5, 1, 3, 7,
24, 48, and 72 h.

Pharmacokinetic studies in mice
Plasma concentrations of RTD-1 at 0.25, 0.5, 1, 7, 24, 48, and 72 h were measured by an LC/MS assay in
LPS challenged mice receiving a single dose of 5 or 25 mg/kg RTD-1 s.c. The area under the curve
(AUC) was calculated with the linear trapezoidal rule.

LC/MS analysis of RTD-1
Approximately 400 L of blood or 2.6 mL Bronchoalveolar lavage fluid (BALF) was collected at 0.25,
0.5, 1, 7, 24, 48, and 72 h after RTD-1 administration. Blood was collected by cardiac puncture into
EDTA-tubes and plasma and BALF prepared by a two-step centrifugation (200 x g for 10 min followed
33

by 23,000 x g for 15 min). Samples were transferred to siliconized tubes and stored at -80°C.
Concentrations of RTD-1 were determined after solid phase extraction (SPE) and quantitation by C18 RP-
HPLC, photodiode array (PDA) detection, with tandem electrospray-ionization mass spectroscopy (ESI-
MS). BALF quantification used exact methods previously described (128). The plasma quantification
method was as follows:100 μL of plasma was diluted 1:10 with 4% H 3PO 4, 10% ACN containing 50 ng
of RTD-2 as internal standard. This was loaded on a 3cc Oasis WCX cartridge (Waters, Milford, MA,
USA) equilibrated in water. Two mL each of 5% NH 4OH, 20% ACN, 1% TFA, and 10% ACN + 1%
TFA washed the cartridge. Elution was performed with 2 mL 1% TFA + 40% ACN. Eluents were
lyophilized, suspended in 100 μL of 10% HOAc, 5% ACN, and chromatographed at 0.3 mL/min on a
Waters C18 X-Bridge BEH C18 2.5 μm 2.1 x 150mm XP column fitted with a VanGuard Pre-Column
BEC C18 (1.7 m; Waters) using a linear 5 to 55% water-acetonitrile gradient containing 0.1% formic
acid. Chromatography was performed on an Acquity H-class UPLC with an analytical PDA detector
using Empower 3 software (Waters, Milford, MA, USA). Quantitative mass spectrometry was performed
on post PDA eluent using a Micromass Quattro Ultima mass spectrometer with Mass Lynx 4.1 (Waters,
Milford, MA, USA). The assay proved to be linear and acceptable with an r >0.98 for the two standard
curves. Accuracy and precision were 99.3% and 0.23% for a middle quality control sample, respectively.

Total and differential cell counts and evaluation of lung edema
BALF was collected by flushing the lungs three times (1, 0.8 and 0.8 mL) with PBS (w/o Ca
+2
and Mg
+2
)
and cOmplete protease inhibitor cocktail (Roche, IN) as suggested by the manufacturer. Mean recovery of
BALF via syringe aspiration was 86%. Collected BALF samples were kept on ice until centrifugation at
360 ×g for 10 min at 4 °C; supernatant was stored at -80 °C. Airway total cell counts were determined for
each BALF sample using Turk blood diluting fluid and a hemocytometer. Approximately 5 x 10
5

cells
were added to a slide chamber, spun in a cytocentrifuge (Shandon, Thermo Scientific, Waltham, MA),
34

and stained using the Diff Quick Stain kit per commercial protocol (Polysciences, Warrington, PA).
Differential cell counts were conducted on 200 cells per slide. Lung edema was assessed by measurement
of total protein concentration in supernatants of BALF using the Bradford assay (Bio-Rad, Hercules, CA)
(170).

BALF and cell culture cytokines
Multiple analyte levels were determined using Milliplex MAP multiplex kits (EMD Millipore, Billerica,
MA) with bead fluorescence readings analyzed on a Bioplex 200 with HTF (BioRad, Hercules, CA).
Frozen samples were thawed on ice and processed per the overnight protocol according to the
manufacturer’s instructions. All plates met reasonable precision (CV ≤ 20%) and samples below the
lower detection limit were extrapolated in order to avoid statistical analysis of zero values. No values
were found above the upper limit of detection.

RT-PCR and expression analysis
Lung tissue was homogenized in RLT buffer (Qiagen, Düsseldorf, Germany) with 143mM 2-
Mercaptoethanol (Amresco). Total RNA was isolated using Qiagen RNA Mini Kits
™
(Qiagen), as per
manufacturer instructions. cDNA was transcribed using iScript™ Reverse Transcription Supermix for
RT-qPCR (Bio-Rad Laboratories, Hercules, CA). Real Time quantitative PCRs were performed using
SsoAdvanced™ Universal SYBR® Green Supermix (BioRad) following the manufacturer’s protocol.
Primers used are listed below (Sigma-Aldrich, St. Louis, MO). These data are representative of three mice
per group each plated in technical triplicates. RT-PCR analysis was performed with a Bio-Rad CFX96.
Copy number were normalized to the housekeeping gene, HPRT, by ΔΔCt method and expression
calculated by relative fold change.
35

Genes Forward Primer Reverse Primer
IL-6 AAGAAATGATGGATGCTACC GAGTTTCTGTATCTCTCTGAAG
MCP-1 CAAGATGATCCCAATGAGTAG TTGGTGACAAAAACTACAGC
IL-1β GGATGATGATGATAACCTGC CATGGAGAATATCACTTGTTGG
TNF-  CTATGTCTCAGCCTCTTCTC CATTTGGGAACTTCTCATCC
MIP-2 GGGTTGACTTCAAGAACATC CCTTGCCTTTGTTCAGTATC
KC AAAGATGCTAAAAGGTGTCC GTATAGTGTTGTCAGAAGCC
HPRT CACAGGACTAGAACACCTGC GCTGGTGAAAAGGACCTCT

BALF MMP and peroxidase activities
BALF obtained from 24 h LPS alone, RTD-1 treated, or PBS untreated mice was assayed for total MMP
activity using a fluorogenic peptide substrate BML-P128 [Dnp-Pro-ß-cyclohexyl-Ala-Gly-Cys(Me)-His-
Ala-Lys(Nma)-NH2] (Enzo life sciences, Farmingdale, NY). A 100 μL reaction mixture containing 50 μL
BALF plus 10 μM substrate was read kinetically over 2 h. Enzymatic reactivity was determined at 340
nm excitation and 440 nm emission on a Synergy H1 Hybrid plate reader (Biotek, Winooski, VT). BALF
peroxidase activity was measured as previously described (175). Briefly, 150 μL TMB substrate solution
was added to 50 μL of BALF and incubated at room temperature for 30 minutes prior to termination with
50 μL 1M H 2SO 4. Plates were read spectrophotometrically at 450 nm (Tecan, CA, USA).

Data and statistical analysis
For statistical analyses, raw data was used except in the case for the POD and migration assays which
have been normalized to untreated controls to minimize the variance. Statistical and graphical analysis
were carried out using STATA 13 (StataCorp, College Station, TX) and GraphPad Prism version 6.0
(GraphPad Software, San Diego, CA). Residual errors of univariate data were inspected for near normal
shape distribution (skewness and kurtosis ±2, histogram) and central tendency. Non-normal data was
subsequently log-transformed and evaluated as described above. The parametric unpaired two-sample t-
36

test or ANOVA with post-hoc analysis P-values were calculated with the Bonferroni multiple-comparison
corrections between LPS treated and untreated groups and reported as either mean ± SD or geometric
mean ± 95% confidence interval (CI). Strength and direction of association between total neutrophils and
POD activity or MMP activity were quantified by Pearson correlation. Non-compartmental analysis
(NCA) of RTD-1 was performed using the Bailer-Satterhwaite method in Kinetica 5.1(Thermo Scientific,
Waltham, MA).

Results
RTD-1 pharmacokinetics in plasma
The mean plasma concentration-time profile following single subcutaneous administration RTD-1 at 5 or
25 mg/kg in mice challenged with LPS are depicted in Figure 6A. The observed mean maximum
concentrations of 342.5 and 1169.9 ng/mL were achieved at 1 h post injection, indicating a rapid systemic
absorption of RTD-1. The disposition of RTD-1 displayed biphasic profile, with a short distribution phase
followed by a prolonged elimination phase, with an apparent terminal half-life of approximately 30 h. A
less than dose proportional increases in the C max (3.4-fold) and AUC 0-72 (2.3-fold) were observed between
the 5 and 25 mg/kg doses (Fig. 6B). The AUC extrapolated to infinity (AUC 0-∞) for 5- and 25 mg/kg were
3,869 and 9001 h*ng/mL, respectively. Airway concentrations of RTD-1 were detectable but were below
the lower limit of quantification (data not shown).
37

Figure 6. Plasma RTD-1 concentrations versus time profile. (A) Plasma disposition of RTD-1 after a
single subcutaneous (s.c.) injection at 5 and 25 mg/kg. Data is represented as median and IQR (n=3-7 per
group). (B) Non-compartmental analysis using sparse sampling approach
RTD-1 reduces airway neutrophil burden and pulmonary edema
After 24 h post LPS challenge, total inflammatory cell counts in BALF increased approximately 32-fold
(p<0.0001) in LPS treated mice compared to sham mice. No mortality was observed in this murine model.
Further analysis of the BALF differential cell counts confirmed that neutrophils were the predominant
infiltrative leukocyte in the airway (>90% of total cells) (Figs. 7A,B). RTD-1 treatment resulted in a
significant reduction in airway neutrophils in RTD-1 treated mice at doses of 5 mg/kg (p<0.01) and 25
mg/kg (p<0.001) but did not affect the airway MΦ counts when compared to LPS untreated mice
(p>0.05) (Fig. 7B).
38

Airway neutrophil activation status in the airway was determined by cell free BALF peroxidase (POD)
activity and global MMP activity. RTD-1 diminished airway peroxidase (Fig. 7C) and MMP9 activity
(Fig. 7D) in a dose-dependent manner in the 5 mg/kg and 25 mg/kg treatment groups when compared
with LPS treated mice (p<0.01). A strong positive association was observed between the total neutrophil
count and POD activity (r = 0.87; p<0.05) (Fig. 8A), or total neutrophil count and global MMP activity (r
= 0.78; p<0.05) (Fig. 8B). Total protein concentrations in BALF were quantified to assess disease severity
and alveolar-capillary barrier leakage induced by LPS. BALF protein levels were increased 3.8-fold
(p<0.001) after LPS challenge in untreated mice compared to sham mice, and RTD-1 treatment led to
significant reductions in protein levels in the 1 mg/kg (p<0.05), 5 mg/kg (p<0.05), and 25 mg/kg
(p<0.001) RTD-1 groups (Fig. 7E).
Figure 7. Dose effects of RTD-1 on airway neutrophilia, neutrophil activation, and microvascular
disruption. To assess RTD-1’s dose response, mice received pre-treatment with 0, 0.2, 1, 5 or 25 mg/kg
s.c. RTD-1 0.5 h prior to 1 g intranasal LPS instillation. BALF was evaluated for (A) Total white blood
cells (WBC), (B) Differential (MAC, MΦ; PMN, polymorphonuclear cells), (C) Peroxidase (POD)
activity, (D) Global MMP activity and (E) Total protein (n= 6/group); mean ± 95% CI; Treatment
compared to control by one-way ANOVA with the Bonferroni’s post-test (*) p<0.05, (**) p<0.01, (***)
p<0.001, (****) p<0.0001.
39

Figure 8. Strength and direction of relationship between neutrophils and airway enzymes. 1 g
intranasal LPS treated mice received pretreatment with 0, 0.2, 1, 5 or 25 mg/kg s.c RTD-1. The
relationships between total neutrophils and (A) POD or (B) MMP activity in BALF were quantified by
Pearson correlation. Note for MMP-9 only 0, 5 and 25 mg kg
-1
RTD-1 treatment groups were available for
analysis.

RTD-1 inhibits LPS-induced inflammatory cytokines/chemokines
Given the positive effects of RTD-1 on lung neutrophilia, pro-inflammatory cytokines at 24 h were
measured from BALF to further evaluate the immunomodulatory activity. Intranasal LPS challenge led to
significant increases in TNF- , IL-1, IL-1, IL-6, MCP-1, KC, MIP1 , and MIP1  in mice compared to
the vehicle control mice (p<0.0001). Significant reductions in IL-1β (p<0.05) and TNF-α (p<0.01) were
observed with RTD-1 treatment at 5 mg/kg and 25 mg/kg when compared with LPS treated mice (Fig.
9A-B). Treatment with the highest treatment dose of RTD-1(25 mg/kg) resulted in a significant decrease
in IL-6 (p<0.05) (Fig. 9C).
0 200 400 600
0
200
400
600
800
1000
Global MMP Activity
Neutrophils (x10
4
)
r

= 0.87
p<0.05
0 50 100 150
0
200
400
600
800
1000
POD Activity
Neutrophils (x10
4
)
r

= 0.78
p<0.05
A.
B.
0 200 400 600
0
200
400
600
800
1000
Global MMP Activity
Neutrophils (x10
4
)
r

= 0.87
p<0.05
0 50 100 150
0
200
400
600
800
1000
POD Activity
Neutrophils (x10
4
)
r

= 0.78
p<0.05
A.
B.
40

Figure 9. Dose effects of RTD-1 on airway cytokines and chemokines. To assess dose response of
RTD-1, mice received pre-treatment with 0, 0.2, 1, 5 or 25 mg/kg RTD-1 0.5 h prior to 1 µg intranasal
LPS instillation and BALF was collected at 24 h. Effect of RTD-1 on cytokines: (A) IL-1, (B) TNF-α,
and (C) IL-6 are shown (n= 6/group); geometric mean ± 95% CI; Treatment compared to control by one-
way ANOVA with the Bonferroni’s post-test (*) p<0.05, (**) p<0.01, (***) p<0.001.

RTD-1 dampens early inflammatory responses in the lung
Given the promising in vivo treatment effect with RTD-1, we performed an exploratory study in LPS
challenged mice to evaluate the time course of the anti-inflammatory activity of RTD-1. Led by in vitro
findings, we evaluated TNF-α, IL-1, IL-6, KC and endogenous anti-inflammatory soluble receptors.
Additionally, MIP-2 was evaluated due to its primary production in the resident MΦ and role in
neutrophil migration to the lung space (176). Comparison of cytokine concentration-time profiles
demonstrated RTD-1 dose-dependently reduced cumulative airway cytokine exposure of MIP-2 (p<0.01),
KC (p<0.001), TNF-α (p<0.001), and IL-1 (p<0.01) compared to LPS untreated controls (Fig. 10A-D)
(Table 1). This reduction in cumulative exposure was largely attributed to an early (3 h) attenuation of
these inflammatory biomarkers.

Next, we evaluated inflammatory cell infiltration into the lung. Treatment with RTD-1 resulted in a
significant dose dependent decrease in airway leukocytes in response to LPS starting as early as 3 h. The
cumulative exposure of neutrophils to the airways was significantly reduced following RTD-1 treatment
at doses of 5- and 25 mg/kg compared with LPS untreated mice (p<0.0001) (Fig. 10E).
41

To investigate whether the reduction in pro-inflammatory mediators at the protein level could be
explained by RTD-1 regulated gene expression, we performed an additional study to assess mRNA levels
between treated (RTD-1, 25 mg/kg) and untreated groups 3 h post endotoxin challenge (n= 6/group).
RTD-1 significantly reduced mRNA levels of TNF-α (-1.560 FC; p<0.01), IL1  (-1.386 FC; p<0.0001),
IL-6 (-1.393 FC; p<0.01), MCP-1 (-3.396 FC; p<0.0001), MIP-2 (-1.496 FC; p<0.001) and KC (-1.277
FC; p<0.01) in mouse whole lung homogenate compared to untreated controls (Fig. 10F).

Figure 10. Dose- and time-dependent effects of RTD-1 on airway neutrophilia, cytokine proteins
and gene expression. A time course study was conducted to assess the direct effects of RTD-1 on airway
neutrophils and immune mediators. RTD-1 at 0, 5 or 25 mg/kg was administered 0.5 h prior to 1 g
intranasal LPS. BALF was obtained at the pre-determined times (A) MIP-2, (B) KC, (C) TNF-α, and (D)
IL-1 and (F) total cell counts (n=3/group; mean ± SD). (F) In a separate set of mice, changes in cytokine
42

mRNA levels in lung homogenate at 3 h were evaluated (n=6/group; mean ± SD). Treatment compared to
control by two-way ANOVA with the Bonferroni’s post-test (*) p<0.05, (**) p<0.01, (***) p<0.001,
(****) p<0.0001.
Table 1. Total Exposure of inflammatory markers in mice with LPS induced lung injury treated
with RTD-1
RTD-1 [mg/kg]
MARKER 0 5 25
WBC 2,571,220.0 (62,570.9) 1,267,870.0 (121,595.0) **** 814,981.0 (59,138.8) ****
MIP-2 48,972.2 (5,274.1) 30,368.0 (6,506.6) ** 28,412.9 (818.6) **
KC 57,789.1 (3,398.9) 51,719.6 (8,313.2) 46,748.4 (1,502.1)
TNF-Α 27,549.5 (1,453.8) 22,543.7 (1,062.9) *** 18,627.2 (769.9) ***
IL-1 761.5 (51.5) 516.4 (48.8) *** 395.6 (18.8) ****
sIL-6R 20,980.3 (634.6) 25,119.5 (2,924.4) 22,338.0 (2,420.6)
sTNFRI 20,872.4 (671.6) 25,511.8 (3,549.9) 23,974.6 (2,849.9)
sTNFRII 192,113.0 (8,930.2) 198,590.0 (14942.0) 152,459.0 (9117.3)
sIL-1RII 15,942.8 (1645.9) 16,327.7 (1298.2) 14,067.9 (668.9)
Insufflation of 1 µg LPS in 50 L PBS and s.c. injection of either 0, 5, or 25 mg/kg RTD-1 in normal saline (n=3
BALB/c mice per treatment group); AUC analysis using Bailer-Satterthwaite method to estimate samples mean 
SD from sparse sampling (177). Unpaired two-sample t-test. (**) p<0.01, (***) p<0.001, (****) p<0.0001.

RTD-1 exhibits anti-inflammatory effects up to 12 hours post LPS insufflation
Next, we tested the interventional effects of 25 mg/kg RTD-1 administered s.c. at 0 and 12 h post LPS
insufflation (Fig. 11). For comparison, 2 mg/kg DEX was selected as a positive control. One death
occurred in the RTD-1 T 0 group 12 hours post LPS insufflation which was likely due to a surgical
complication. RTD-1 treatment led to a trend towards decreased neutrophil lung infiltration at T 0 and
significantly reduced lung neutrophilia at T 12 (p<0.01) (Fig. 11A). As expected, DEX also significantly
reduced lung neutrophilia (p<0.05). There was no statistically significant difference between the T 0 and
T 12 cohorts (unpaired two samples t-test p=0.1360). In addition, RTD-1 significantly reduced TNF-α (-
0.32 FC; p<0.05), IL-6 (-0.66 FC; p<0.001) and IP-10 (-0.34 FC; p<0.001) at T 0, and TNF-α (-0.40 FC;
p<0.01), IL-1β (-0.43 FC; 0.01), IL-6 (-0.66 FC; 0.001) and IP-10 (-0.67 FC; p<0.001) at T 12 (Fig. 11B-
F). However, MIP-2 and KC levels were not significantly altered by RTD-1 treatment (data not shown).
DEX reduced IL-1β (-0.40 FC; p<0.05), KC (-0.27 FC; p<0.05 data not shown) and IP-10 (-0.50 FC;
43

p<0.001). These data demonstrate that RTD-1 treatment retains a protective effect when administered 12
h post LPS insufflation.

Figure 11. Time-dependent effect of RTD-1 on airway neutrophilia and cytokines. To assess timing
of drug administration, 25 mg/kg RTD-1 was administered at 0- or 12 h after 1 g LPS instillation. As a
comparator agent, 2 mg/kg DEX was given at 0 h. LPS mice administered saline served as control. (A)
BALF WBCs were quantified by manual counting. BALF concentrations of TNF-α (B), IL-1 (C), IL-6
(D), IP-10 (E), IFN-γ (F) were quantified by multiplex ELISA. n=9 mice per group (except n=8 for RTD-
1 at 0 h); mean ± SD; Treatment compared to control by unpaired two-sided t-test (*) p<0.05, (**)
p<0.01, (***) p<0.001.

RTD-1 protects against LPS induced acute lung injury
Considering the maximal immunomodulatory effects observed at the highest dose, we selected the 25
mg/kg of RTD-1 to evaluate the disease severity at 24 h as measured by histology and lung pathology
scoring. We compared the presence of congestion, interstitial and alveolar leukocytes, and alveolar
hyaline membranes between RTD-1 treated, LPS untreated and sham mice (Fig. 12). RTD-1 exhibited a
protective effect against LPS-induced lung injury as evidenced by the lack of alveolar leukocyte
infiltrates, absence of hyaline membranes and normal alveolar wall thickness (Fig. 12A-I). A comparison
44

of standardized lung injury scores demonstrated a significant reduction in lung injury in RTD-1 treated
animals when compared with controls. (p<0.01) (Fig 12J).

Figure 12. Effects of RTD-1 on severity of acute lung injury. To assess treatment effects on lung
injury, mice received pre-treatment with 0- or 25 mg/kg RTD-1 0.5 h prior to 1 g LPS insufflation.
Lungs were formalin inflated and H&E stained. Representative images of each mouse and their respective
treatment groups (A-C) LPS alone, (D-F) LPS + 25 mg/kg RTD-1, or (G-I) PBS sham are shown. (J)
Pathological scoring of slides for lung injury and inflammation. Parameters included the presence of
congestion, interstitial and alveolar leukocytes, and alveolar hyaline membranes (n=3 mice/group); Mean
± SD; Treatment compared to control by unpaired two-sample t-test (**) p<0.01.

Discussions
ALI is a disorder of acute inflammation characterized by loss of alveolar-capillary barrier integrity,
excessive neutrophil infiltration, release of pro-inflammatory mediators, and pulmonary edema (165).
Lung infections and/or sepsis are often the underlying cause of ALI. In the context of COVID-19, acute
lung injury is induced as SARS-CoV-2 infects and damages the type II alveolar cells, capillary
45

endothelial cells and alveolar macrophages. Currently, there are limited therapies available for directly
targeting the inflammatory response in ALI without predisposing the patients to secondary bacterial
infection. Fortunately, cationic HDP participate in direct microbial killing, as well as the initiation and
resolution of the inflammatory responses (178, 179). Several cationic HDP have demonstrated efficacy in
murine models of sepsis induced ALI, suggesting the potential use of HDP as therapeutics for COVID-19
(180-183). Therefore, the dual antimicrobial and immunomodulatory actions of cationic HDP allow them
to be attractive drug candidates for treatment of ALI induced by COVID-19 (179).

While most studies with RTD-1focused on its antimicrobial activities, murine models of severe acute
respiratory syndrome (SARS) and E. Coli sepsis proved that RTD-1-mediated attenuation of the
inflammatory response plays a significant role in the therapeutic benefit (125, 140). However, the effects
of RTD-1 in a model of infection-free inflammation and direct lung injury have not previously been
investigated. In the current investigation, we present the first evidence that the RTD-1 yields protective
effects in mitigating ALI by reducing pro-inflammatory cytokines, neutrophil infiltration, alveolar-
capillary membrane leakage, and lung damage.

Following a direct insult (i.e. infection or trauma), cell-mediated amplification of pro-inflammatory
cytokines occur in response to pathogens as well as continued cellular injury. In the context of COVID-
19, infected and damaged type II alveolar cells, which are the predominate target of SARS-CoV-2 in the
alveolar space due to its abundant expression of ACE2, release inflammatory signals that recruit
leukocytes, particularly M  and neutrophils, to the site of infection and injury. Here we used the well-
established bacterial endotoxin model to mimic the host lung immune response and ALI pathology in
human. RTD-1 treatment following LPS challenge reduced the total airway production of several
46

monocyte/MΦ related cytokines (i.e. MIP-2, TNF-α, IL-1 ) in a dose-dependent manner. Particularly,
rapid reductions (3 h) of soluble TNF-α and MIP-2 were observed in the lung.

A fundamental feature of ALI is the excessive neutrophil infiltration into the airway space. In LPS-
challenged mice, RTD-1 dose-dependently reduced airway neutrophil recruitment at 24 h. The early
treatment differences of airway neutrophils (3-7 h) compared to LPS treated mice suggest that RTD-1
may directly inhibit neutrophil migration from the vasculature. One potential mechanism by which RTD-
1 reduces neutrophil chemotaxis is through the inhibition of neutrophil-endothelial cell adhesion. In vitro
data demonstrated RTD-1 reduced CXCL8-induced neutrophil-endothelial cell adhesion by >50% (data
not shown). This novel mechanism of inhibition of neutrophil chemotaxis contradicts the general
observation of HDPs, which are known to induce neutrophil recruitment (104). Consistent with these
findings is the improved lung injury scores with RTD-1 treatment in vivo that was accompanied by the
reduction in airway neutrophilia. Therefore, data suggest that the peripheral blood neutrophils may be
another target of RTD-1 as systemic action on this cell population would reduce airway neutrophil
burden, thereby alleviating the lung injury.

Exuberant neutrophilia and accumulation of the associated toxic products, such as proteases, neutrophil
extracellular traps and ROS, drive the destruction of epithelial basement membrane and increased
permeability of the alveolar-capillary barrier. RTD-1 treatment led to the reduced pulmonary edema in
vivo, which was measured by the total protein concentration in BALF. While active migration of
neutrophils contributes to a “leaky” barrier, the release of proteolytic enzymes (NE, MMP-9) and ROS
further exacerbates the injury (184). Treatment with RTD-1 reduced POD and MMP-9 activity in a dose-
dependent manner in vivo. Given the observed strong positive association between neutrophil counts and
their released products (POD or MMP activity), these dose-dependent effects are likely the result of
47

reduced neutrophil recruitment. The anti-inflammatory and protective effects persisted even when RTD-1
was administered 12 h post LPS insufflation, further supporting its potential as a treatment for ALI
induced by COVID-19.

Based on our investigations, we hypothesize that pleotropic effects of RTD-1 on early alveolar MΦ
driven inflammatory reactions and blood neutrophil migration and adhesion underlie the in vivo
observation of reduced neutrophil lung recruitment from LPS challenge. The immunoregulatory property
of RTD-1 is relatively unique in comparison with other cationic HDPs in which the anti-inflammatory
action is an indirect effect mediated by their endotoxin neutralizing effects (125, 137). Previous work has
elucidated several modes by which RTD-1 may exert these effects, which were independent of endotoxin
neutralization (137). RTD-1 inhibited the NF- B activation and subsequent productions of downstream
pro-inflammatory mediators through PI3K/Akt pathway activation in monocytes/MΦ, which through
induction of phosphorylated Akt, which is a known regulator of NF- B and MAPK signaling cascades
(14). This is consistent with our in vivo gene expression data suggesting that RTD-1 modulates TLR
signaling activity and subsequently mRNA levels and soluble cytokines. Published data demonstrating
rapid inhibition (4 h) of soluble TNF-α in MΦ suggest that RTD-1 is likely multi-regulatory (125, 137).

Pharmacokinetic studies designed to characterize the time course of drug concentrations in blood are key
to identifying the optimal dose to maximize efficacy and safety of the compound. Examination of the
plasma concentration time curves revealed several observations. First, the peak in vivo concentrations
following single dose s.c. administration were below the in vitro IC 50 (e.g. neutrophil chemotaxis and
inflammatory cytokines from murine alveolar macrophages [MH-S cells], data not shown) indicating the
potential for greater anti-inflammatory activity with intravenous administration. Second, the AUC
increased less than dose proportionally when comparing the parameter at 5- and 25 mg/kg, which
48

indicates potential saturable absorption from the injection site. This observation explains the less than
proportional increase in the anti-inflammatory activity at the higher dose. Lastly, the relatively long
plasma half-life observed with the PK study suggest an extended treatment effect is possible (125).

In conclusion, data described here provides evidence that RTD-1 exhibited anti-inflammatory effects
comparable to 2 mg/kg DEX in a murine model of LPS-induced ALI and retains its protective effects 12
hours post LPS challenge. Given that the secondary bacterial infection is associated with poor prognosis
in COVID-19 patients and the use of anti-inflammatory therapies currently used to treat cytokine storms
(i.e. corticosteroids and monoclonal antibody therapies) can predispose the patients to secondary
infections, data presented in this chapter demonstrates that the dual antimicrobial and immunomodulatory
activities of RTD-1 will provides additional benefits to the treatment of ALI in the context of COVID-19
(125).

49

Chapter 3. Preclinical pharmacokinetics and safety of intravenous RTD-1
Introduction
The coronavirus disease 2019 (COVID-19) is caused by the novel coronavirus, severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2), which is a single, positive-stranded RNA virus that belongs to β
genus of coronaviridae family. The disease is characterized by acute lung injury (ALI) which can progress
to respiratory failure and death. Elevated levels of pro-inflammatory cytokines including interleukin (IL)-
6, IL-2, granulocyte-colony stimulating factor (G-CSF), IP-10, monocyte chemoattractant protein 1
(MCP1) macrophage inflammatory protein (MIP) 1α, interferon (IFN)-ɣ, and tumor necrosis factor
(TNF)-α, are detectable in the blood samples of patients with severe COVID-19 infections, an observation
referred to as cytokine storm (CS) syndrome (51). As such, CS is a leading cause of mortality in COVID-
19 patients. Furthermore, several studies suggest a direct correlation between cytokine storm and lung
injury and multiple organ failure (35, 50, 185). In the RECOVERY trial, in which COVID-19 patients
were randomized to receive dexamethasone or placebo, the use of dexamethasone reduced the incidence
of death in patients receiving either invasive mechanical ventilation and oxygen without invasive
mechanical ventilation, highlighting the role of anti-inflammatory therapies in the treatment of COVID-
19 (88).

Rhesus theta (θ) defensin-1 (RTD-1) is a host defense peptide that possesses both antimicrobial and
immunomodulatory properties. In vitro studies have demonstrated its activities against several microbes,
including P. aeruginosa, S. aureus and E. Coli, as well as against Candida albicans and HIV-1 (130,
133, 135, 186). One of the mechanisms in which RTD-1 exerts its immunomodulatory activity is via the
inhibitions of MAPK and NF-κB signaling pathways through the upregulation of AKT phosphorylation,
leading to reduction in the production of pro-inflammatory cytokines and chemokines (137). Additionally,
in vitro experiments have revealed that RTD-1 acts as non-competitive inhibitor of TNF-α-converting
50

enzyme (TACE) (138). Inhibition of NF-kB activation and the downstream genes lead to reduction in
airway neutrophil recruitment and adhesion, as well as neutrophil activation (126). The potent anti-
inflammatory activity of RTD-1 was discovered during an investigation of the efficacy of intranasal RTD-
1 in a murine model of SARS-CoV lung disease, which was responsible for the outbreak of SARS in
2002 (140). Prophylactic treatment of RTD-1 led to a significant improvement in the survival of SARS-
CoV-infected mice without any changes in the viral load, suggesting that the beneficial effect of RTD-1 is
likely derived from its immunomodulatory activities. In murine model of LPS-induced ALI, subcutaneous
administration of RTD-1 at 5- and 25 mg/kg led to attenuation of airway inflammatory response through
inhibitions of pro-inflammatory cytokine production, peroxidase activity and neutrophil recruitment, and
provided protection against lung injury (126).

This report summarizes the analyses from two Good Laboratory Practice (GLP) studies undertaken in
rodent and non-rodent species as well as a non-GLP dose range finding study in cynomolgus monkeys to
assess the safety and pharmacokinetics of single and repeat dose intravenous RTD-1 administration. The
preclinical experiments were conducted to determine the safety and first in human (FIH) dosing in
preparation for clinical trials of intravenous RTD-1 for treatment of COVID-19.

Materials and Methods
The pharmacokinetics and safety of intravenous (i.v) RTD-1 were studied in mice, rats, cynomolgus
monkeys, and a vervet. RTD-1 (purity > 98%) dissolved in filter-sterilized saline solution was used for
injections. The summary of study design and schedule of safety assessments are listed in Tables 2 and 3
respectively. The studies included single- and multiple-dose ranging experiments. All protocols received
local IACUC approval prior to initiation of the studies.
51

Table 2. Study design of pre-clinical pharmacokinetics and safety of intravenous RTD-1
Species Study type Regimen Dose Administration route
Number of
animals
Mouse PK study Single dose 5 mg/kg IV bolus 24
Rat
14
C-RTD-1
biodistribution
study
Single dose 5 mg/kg IV bolus 5
GLP toxicity study Single dose 20 mg/kg 20 min-IV infusion 12
Multiple dose

5

mg/kg daily x 7 days
10 mg/kg daily x 7 days

20 min-IV infusion 12
12
Monkey Non-GLP dose
escalation study

Single dose 0.3 mg/kg
1 mg/kg
3 mg/kg
10 mg/kg
1 h-IV infusion 2
2
2
2
Multiple dose 15 mg/kg daily x 7 days 1 h-IV infusion 2
GLP toxicity study Multiple dose 5

mg/kg daily x 10 days

10 mg/kg daily x 10 days

15 mg/kg daily x 10 days
1 h-IV infusion 6
6
10
Vervet A pilot safety study Single dose 3 mg/kg IV bolus 1

52

Table 3. Summary of general in-life assessments and sample collections
Safety
parameters
A GLP 7-Day toxicity study in
rats
A non-GLP PK study in
cynomolgus monkeys
A GLP 10-day toxicity study in
cynomolgus monkeys
Main Recovery TK Main Recovery
c

Individual
body weight
Pre-dose and weekly Pre-dose, Day 1 and 3 Pre-dose and weekly
Mortality Twice daily Twice daily Twice daily
Clinical
observations
Weekly Pre-dose, Day 1 and 3 Pre-dose and weekly
Food
consumption
Once weekly ND Daily
Clinical
pathology
a

Day 8 Day 24 Day 25 Day 6
d,e
, 8
d,e
, 11
d,e
, and 15
d,f
Predose, Day 10
Pre-dose, Day 10 and
23/24
Urinalysis Day 8 Day 24 Day 25 ND Predose, Day 10
Pre-dose, Day 10 and
23/24
Ophthalmology Pre-dose, Day 6 ND Pre-dose, Day 8
Electrocardiogr
am
ND ND Pre-dose, Day 8
Pre-dose, Day 8 and
21/22
Gross
pathology
b

Day 8 Day 24 ND ND Day 11 Day 23/24
Organ weights
b
Day 8 Day 24 ND ND Day 11 Day 23/24
Microscopic
pathology
b

Day 8 Day 24 ND ND Day 11 Day 23/24
ND – Not determined
a
Includes hematology, serum chemistry, and coagulation
b
Any animals found dead or pre-terminally euthanized are assessed at the time of necropsy
c
Includes a subset of cynomolgus monkeys in the main group that received 0 mg/kg (placebo) or 15 mg/kg of intravenous RTD-1
d
Includes cynomolgus monkeys that received seven (7) daily doses of 15 mg/kg of intravenous RTD-1
e
Blood collected for hematology and serum chemistry
f
Blood collected for coagulation

Pharmacokinetics
Mice
The murine pharmacokinetic study has been described previously (186). All procedures and protocols
involving the use of animals were reviewed and approved by the University of Southern California (USC)
IACUC (protocol #20538). Briefly, male (31.7-37.7 g) and female (25.2-35.6 g) CD-1 mice (Charles
River Laboratories) were administered a single 5 mg/kg i.v. bolus injection of RTD-1 into the lateral tail
vein. A total of 24 mice were separated into 6 groups (n=2/sex/group), with each group assigned to a
single, pre-determined time point. Blood samples were collected at 0.25, 1, 2, 4, 8, and 24 h post-dose via
53

terminal cardiac puncture. The collected samples were centrifuged to separate the plasma and stored at -
80°C until analysis.

Rats
Pharmacokinetics of RTD-1 in Sprague-Dawley rats was evaluated as part of a Good Lab Practice (GLP)
7-day toxicity study performed at Charles River Laboratories (Stilwell, Kansas). The study protocol was
reviewed and approved by the Citoxlab USA IACUC and was conducted in accordance with guidelines
from the USA National Research Council. On the day of the dosing (Day 1), male (229-272 g) and female
(186-214 g) rats (n= 6/sex/group) were assigned to receive repeated doses of 0 (placebo), 5 ,10 or 20
mg/kg of RTD-1 once daily for 7 days via i.v. infusion (20 min ± 3 min). The intravenous route was
selected as this is the intended route of administration for treatment of COVID-19 pneumonia. The doses
were chosen based on a pilot single dose escalation study in rats, which established the MTD of 20 mg/kg
(data not shown). Two subgroups of rats with alternating blood sampling schemes (n=3/sex/group) were
assigned as follows: subgroup A with blood collections at 0 (pre-dose), 0.5, 6 and 24 h post infusion and
subgroup B with blood collections at 0.083, 2, and 12 h post infusion. The 24 h post-infusion samples on
Day 1 were taken prior to the administration of the dose on Day 2. Serial blood samples were collected
into K 2EDTA tubes at the abovementioned time points on Days 1 and 7, and additionally once on Day 25
(recovery). The samples were centrifuged at 2,700 g for 10 min at 5°C to separate plasma from the blood
and stored at -80°C until analysis.

Cynomolgus monkeys
A non-GLP dose range finding PK study and a GLP 10-day toxicity study were conducted in cynomolgus
monkeys (Macaca fascicularis) at Charles River Laboratories (Stilwell, Kansas). The study protocol was
reviewed and approved by the Citoxlab USA IACUC and was conducted in accordance with guidelines
54

from the USA National Research Council. The non-GLP dose range finding study included a single
ascending dose and a multiple dose evaluation. In the single ascending dose PK study, male (3.49-3.57
kg) and female (2.66-2.79 kg) cynomolgus monkeys (n=1/sex/group) were randomly assigned to one of
two dose groups. Group 1 received a single dose of 0.3 mg/kg RTD-1 as an i.v. infusion (60 min ± 5 min)
on Day 1 and a single dose of 3 mg/kg RTD-1 on Day 3, while Group 2 received a single dose of 1 mg/kg
RTD-1 on Day 1 and a single dose 10 mg/kg RTD-1 on Day 3. The doses used in this study are based on
a pilot study in cynomolgus monkeys, which demonstrated the safety of single i.v. doses up to and
including 10 mg/kg (data not shown). Blood samples were collected into K 2EDTA tubes at the following
time points: pre-dose and approximately 0.083, 0.25, 0.5, 1, 2, 4, 8, 12 and 24 h post end of infusion, on
Days 1 and 3. In the multiple dose study, repeated doses of 15 mg/kg RTD-1 were administered once
daily for seven days via i.v. infusion (60 min ± 5 min) (n=1 per sex). Serial blood samples were collected
into K 2EDTA at pre-dose, and at approximately 0.083, 0.25, 0.5, 1, 2, 4, 8, 12 and 24 h post end of
infusion, on Days 1, 4 and 7. The 24 h post-infusion samples on Days 1 and 4 were taken prior to the
administration of the dose on Day 2 and 5, respectively. In the GLP 10-day toxicity study, PK was
evaluated following multiple ascending doses of RTD-1. Male (2.52-3.65 kg) and female (2.39-3.18 kg)
cynomolgus monkeys (n=3-5/sex/group) received placebo (sterile saline) or 5, 10 or 15 mg/kg of RTD-1
once daily for 10 days via i.v. infusion (60 min ± 5min). Serial blood samples were collected into
K 2EDTA tubes at the following time points: pre-dose, 0.083, 0.5, 2, 6, and 12 h post infusion on Day 1
and pre-dose, 0.083, 0.5, 2, 6, 12, and 24 h post infusion on Day 10. Additional blood samples were
collected on Days 12 and 24 from monkeys that received 0 or 15 mg/kg (n=2/sex/group). All samples
were centrifuged at ~2700 x g for 10 min at ~5°C to isolate plasma and stored at -80°C until analysis.

55

Vervet
As a pilot safety study, a single dose of RTD-1 at 3 mg/kg was administered to an adult male
vervet/African green monkey (Chlorocebus aethiops sabaeus) via i.v. bolus. Serial blood samples were
collected at 0.5, 1, 4, 8, 24, 48, 72, 96, 120, and 192 h post administration.

Bioanalytical analysis.
Clarified plasma samples from mice were directly diluted into 5% formic acid/5% acetonitrile. Quantitative
analysis of RTD-1 was performed by LC-MS/MS with reverse-phase liquid chromatography (XBridge
BEH phenyl 3.5 µm 3 x 100 mm column, Waters #186003328) on an Acquity H-Class UPLC (Waters)
coupled to a Xevo TQ-S tandem electrospray mass spectrometry running MassLynx V4.1 (Waters).
Quantitative mass spectroscopy was performed by multiple-reaction monitoring transition 417.32 > 517.21,
with area under the curve determined by TargetLynx (Waters). A synthetic theta defensin-like peptide with
an identical chromatography retention time as RTD-1 was used as an internal standard (IS). The lower limit
of quantification (LLOQ) of the assay was 1 ng/mL. Intra- and inter-assay precision (percent coefficient of
variation [CV]) was ≤ 3% and intra and interassay accuracy (% relative error) was ≤ 5%. Plasma RTD-1
concentration analyses for rats and cynomolgus monkey studies were performed at MicroConstants (San
Diego, CA) by HPLC using a Mac-Mod Analytical ACE C4 column. The mobile phase was nebulized using
heated nitrogen in Z-Spray source/interface set to electrospray positive ionization mode and the compound
was detected using MS/MS (LLOQ= 10.0 ng/mL). Details of the method are summarized in the
MicroConstants method No. MN20038. Clarified plasma samples from a serially sampled vervet were
quantified by ultra-performance liquid chromatography Waters Acquity H-Class UPLC. The plasma
samples were diluted directly (1:10) into 5% formic acid/5% acetonitrile and quantified by photo diode
array (PDA AUC of 210 nm) using (C18 XBridge BEH 2.5µm 2.1 x 150mm Waters #186006709) running
Empower software. RTD-1 peak and mass confirmation was performed on post PDA eluent using a
56

Micromass Quattro Ultima mass spectrometer with MassLynx 4.1 (Waters). The lower limit of quantitation
(LLOQ) ranged from 10-30 ng/mL (determined by sample background) to a upper limit of 50 ug/mL. RTD-
2 (10 ug/mL) was used as an internal standard. Intra- and interassay precision (% coefficient of variation
[CV]) was ≤ 3% and intra and interassay accuracy (% relative error) was ≤ 5%.

Pharmacokinetic analysis.
Non-compartmental analysis (NCA) was performed using Phoenix® WinNonlin (version 8.3.1, Certara
USA, Inc.; Princeton NJ) to determine the PK parameters in mice, rats, cynomolgus monkeys and the
vervet. Nominal sampling times were used in the analysis, and data below the lower limit of
quantification of the assay were excluded from analysis. The maximum plasma concentration (C max) was
determined from visual inspection of the data. The following parameters were calculated: terminal
elimination rate constant (λz), area under the curve extrapolated to infinity (AUC 0-∞), area under the curve
to dosing interval (AUCτ), mean residence time (MRT), clearance (CL), and volume of distribution at
steady state (Vss). AUC was calculated using linear up, log down method, and the λ z was calculated using
up to the last four data points of the log-linear terminal phase of the concentration time profile. Due to
sparsely sampled data in mice and rats, the sparse sampling calculation methodology in Phoenix
WinNonlin was used, which generated a single estimate without standard error for all parameters, with
the exception of C max. For rats and cynomolgus monkeys, all parameters were calculated using sampling
times relative to the beginning of the i.v. infusion.

Plasma pharmacokinetic modeling.
Pharmacokinetic modeling of plasma RTD-1 in cynomolgus monkeys was performed using the maximum
likelihood expectation maximization algorithm in ADAPT software (version 5) (187). Model performance
and discrimination were based on the likelihood ratio test, Akaike’s Information Criterion (AIC), and
57

Bayesian Information Criterion (BIC). First, one- and two-compartmental models for plasma disposition
were evaluated. Then, models considered for RTD-1 distribution and elimination included two
compartmental models with first-order elimination, Michaelis-Menten elimination, parallel first-order and
Michalis-Menten elimination, and a model with saturable distribution and first-order elimination.

Dose proportionality.
Dose proportionality of C max and AUC 0-∞ was evaluated in cynomolgus monkeys administered a single
i.v. dose of RTD-1 ranging from 0.3 to 15 mg/kg using a natural log-transformed power model (188).
Dose proportionality was concluded if the slope and the corresponding 95% confidence interval of the
linear regression included 1.

Interspecies allometric scaling.
Single dose PK data from mice, rats, cynomolgus monkeys and a vervet was used to predict human PK
parameters using simple allometry. The relationship between CL or Vss obtained from the NCA and the
body weight was described using the following equation: 𝑌 = 𝑎 ∙ 𝐵𝑊
𝑏 , where Y is the PK parameter
(e.g. CL or Vss), BW is the body weight of the species, 𝑎 is an allometric coefficient, and b is an
allometric exponent (189, 190). Linear regression was performed on log-transformed data. The predicted
human equivalent dose was calculated based on the allometrically scaled clearance using the following
equation: Dos e = CL ∗ AU C
0 − ∞
. The corresponding average AUCτ and AUC 0-∞ at NOAEL and LOAEL,
respectively, were used to convert the doses at NOAEL and LOAEL in preclinical animals to HED.

58

Biodistribution [
14
C]-radiolabeled RTD-1 in female rats
Five SD rats (195 and 200 g b.w.) with jugular vein catheters (JVC) were each injected with 200 µL of 5
mg/mL RTD-1 in saline containing ~4 million CPM of [
14
C]-RTD-1. The JVC line was cleaned with
70% isopropyl alcohol and the line plug was removed. A new 25G blunt needle with a 1 mL syringe
containing injectable solutions was used for each injection. The JVC line was first cleared with 100 µL
saline, followed by the RTD-1 solution, then cleared with an additional 100 µL of saline. Tissues and
organs were harvested into separated vials and weighed. Small organs such as lymph nodes, kidneys, and
heart/lungs were processed whole. Large organs (e.g. liver, muscles, subcutaneous fat pads) were sampled
from representative areas or those of interest (e.g. subcutis at site of injection). Organs were then
dissolved in 2 mL SOLVABLE (Perkin Elmer 6NE9100) for up to 1 g of tissue. For large section of skin
and other organs, 4 or 6 mL were added. Vials were incubated in a 60°C water bath for 18-22 hours then
removed and allowed to cool to room temperature. Two mL of dissolved tissue were added to a fresh
scintillation tube for color correction with 100 μL of 0.1 M EDTA and 2 x 100 μL 30% hydrogen
peroxide. Samples were allowed to stand at room temperature for 1 hour, incubated in a 37°C incubator
for 1 hour, then incubated in 60°C water bath for 1 hour. If necessary to prevent boiling over, samples
were removed from heat source temporarily before continuing. Samples were cooled before 10 mL of
Ultima Gold (Perkin Elmer 6013321) were added to each vial, then contents were mixed and allowed to
stand in the dark at 22°C for 1 h. Scintillation counting were average of 2 x 1 minute counts using a
Packard TRI-CARD 2100TR scintillation counter. Urine was collected over 1 h or 24 h after i.v. infusion
and 500 μL was added to a scintillation vial processed as described above for scintillation counting.
Stomach and its content were dissolved with 6 mL of SOLVABLE and processed as other tissues. The
duodenum, jejunum, and ileum were flushed with saline to remove luminal contents then the tissues were
processed with SOLVABLE as described above. Large intestine was opened lengthwise to remove fecal
content and rinsed with saline to remove remaining luminal contents then processed as described above.
Feces were collected, transferred into a 500 mL plastic cup, and treated with 50 mL of 7% sodium
59

hypochlorite and allowed to react for 1 hour at 22°C followed by 1 h in a 60°C water bath. Two mL of
the resulting suspension were transferred to a scintillation vial and mixed with 10 mL of scintillation
fluid. Contents were mixed and allowed to stand for 1 hour before scintillation counting.

Safety
Evaluation of safety in rats and cynomolgus monkeys was based on clinical observations, survival, body
weight, food consumption, clinical pathology (hematology, clinical chemistry, and coagulation),
urinalysis, ophthalmology, macroscopic findings at necropsy, and microscopic histopathology. The
schedule of assessments for these studies are summarized in Table 2.

In details, male and female Sprague Dawley rats (n=16-21/sex) were evaluated for potential toxicity for
seven day repeat administration of RTD-1 and reversibility of any findings. Rats were divided into 3
subgroups within each dosing group: main (n=10/sex), recovery (n=0-5/sex), and toxicokinetics (TK)
(n=3-6/sex).

Mortality and clinical observations.
Detailed clinical observations were recorded weekly, from a week prior to the study initiation and
throughout the study including the day of necropsy in all rats. In cynomolgus monkeys, detailed clinical
observations were recorded once at pre-dose and weekly following the study initiation, including the day
of necropsy. All animals were observed/monitored for mortality twice daily beginning upon the arrival
through release.

60

Body weight and food consumption.
Individual body weight was recorded once at pre-dose and weekly following the initiation of dosing in all
rats and three times at pre-dose and at least once weekly following the initiation of dosing in cynomolgus
monkeys. Food consumption was quantitatively measured, per cage, once weekly starting on Day 1 and
throughout the study in rats and assessed once daily, throughout the study in cynomolgus monkeys.

Hematology, blood chemistry, and coagulation.
Blood samples for hematology, coagulation and clinical chemistry were collected from retro-orbital sinus
on days of scheduled (day 8, 24, and 25 in rats belonging to the main, recovery and TK group,
respectively) or unscheduled necropsy in rats. Blood samples were collected by venipuncture at pre-dose
and at the end of treatment (Day 11) in cynomolgus monkeys, and additionally at the end of recovery in a
few subset of male and female monkeys in the placebo (n=2/sex) and 15 mg/kg group (n=2-3/sex).

Urinalysis
Overnight urine samples were collected prior to euthanasia in rats, and at pre-dose, Day 10 and end of
recovery in cynomolgus monkeys.

Ophthalmology
Ophthalmological examinations, which consisted of funduscopic (indirect ophthalmoscopy) and
biomicroscopic (slit lamp) examinations, were performed at pre-dose and Day 6 in rats and at pre-dose
and on Day 8 in cynomolgus monkeys.

61

Electrocardiogram (ECG)
ECG was collected at pre-dose, Day 8 within 10 min following the end of infusion and 2 days prior to
necropsy in cynomolgus monkeys.

Statistical analysis
Statistical analysis of the PK data was performed with GraphPad Prism version 9.1.2 (GraphPad
Software, Inc., San Diego, CA). Shapiro-Wilk test was used to check for normality. One-way ANOVA
with Bonferroni’s multiple comparisons test were performed to compare C max across doses (5-, 10- and 20
mg/kg) in rats, and λz, AUC, C max, CL, and Vss across doses (5-, 10- and 15 mg/kg) in cynomolgus
monkeys. Unpaired t-test was used to compare PK parameters (λz, AUC, C max, CL, and Vss) between
different days (Days 1 vs 10) within each dosing group and between sexes. Statistical analyses of safety
data were performed using SAS 9.4, considering a 95% statistical significance. Differences in body
weight, change in body weight, and clinical pathology (hematology, serum chemistry, coagulation) were
compared between each dose group using Kruskal Wallis with Dunn's multiple comparison test. The data
analysis was performed independently for each sex.

62

Results
Pharmacokinetics

Figure 13. Mean (SD) plasma concentration-time profiles of RTD-1 in (A) mice (n=4/time point), (B)
rats (n=6/time point), (C) cynomolgus monkeys (n=2-12/dosing group) and (D) vervet (n=1) following
single dose IV administration.
Mice
The mean plasma concentration-time profile after single dose administration in mice is shown on Fig
13A, and the corresponding pharmacokinetic (PK) parameters calculated by non-compartmental analysis
(NCA) are listed in Table 4. Due to terminal blood collection from each mouse, a pooled PK result was
generated. After single i.v. bolus administration, RTD-1 displayed a biphasic profile, with a relatively
short distribution phase followed by a longer elimination phase with a half-life of 5.2 hours.
63

Table 4. Single dose pharmacokinetics in mice receiving RTD-1 5 mg/kg
Parameters Estimate (SE)
C max (ng/mL) 8,919 (1,088)
λz (h
-1
) 0.114
AUCτ (ng*h/mL) 12,282
AUC 0-∞ (ng*h/mL) 12,497
CL (mL/h/kg) 400
MRT (h) 2.62
Vss (mL/kg) 1,048
C max, maximum observed plasma concentration; λz, terminal elimination rate constant; AUCτ, area under the curve
to dosing interval (24 h), AUC 0-∞, area under the curve extrapolated to infinity; CL, clearance; MRT, mean residence
time; Vss, volume of distribution at steady state
Rats
The mean plasma concentration-time profiles in rats following single (5, 10, or 20 mg/kg) or multiple
dose (5 or 10 mg/kg) administrations are depicted in Fig. 13B and Fig 14, respectively, and the
corresponding PK parameters are summarized in Table 5. Of the total 180 infusions from 36 rats, there
were 5 infusions that deviated by more than 10% from the intended 20-min infusion. However, these
deviations did not occur on blood PK sampling days and therefore did not influence the PK analysis. Due
to sparsely sampled data per rat, a pooled PK result was generated in WinNonlin. Plasma levels of RTD-1
were undetectable during the recovery period (Day 25) in all rats, except for one female rat that received
10 mg/kg, which had a concentration of 12.5 ng/mL. Early removal of the rats in 20 mg/kg group
precluded the PK analysis with repeat dosing at this dose level. The C max was slightly higher in female
compared to male rats, but the differences did not reach statistical significance. While both C max and
AUC 0-∞ appeared to increase proportionally to the dose based on 95% confidence interval (CI) of the
slope including 1, (C max, Y=1.110*X+8.936 [Slope 95% CI: 0.7066 to 1.513], R
2
=0.6803; AUC 0-∞,
Y=1.543*X+9.448 [Slope 95% CI: 0.4460 to 2.639], R
2
=0.9969), a comprehensive analysis of dose
proportionality in rats was limited due to pooled calculations of AUC 0-∞ at each dose level, and the
relatively narrow range of doses tested. The AUCτ on day 7 was slightly lower (22% and 19% for the 5-
and 10 mg/kg groups respectively) when compared with their AUC 0-∞ on Day 1 indicating no significant
drug accumulation.
64

Figure 14. Mean (SD) plasma concentration versus time profiles following a 7-day repeat once daily
i.v. administrations in rats A) 5 mg/kg/day and B) 10 mg/kg/day

Table 5. Single and multiple dose pharmacokinetics of intravenous RTD-1 in rats
Parameters
5 mg/kg 10 mg/kg 20 mg/kg
Day 1 Day 7 Day 1 Day 7 Day 1
C max
(ng/mL)
7,468
(1,202)
*,#

10,137 (688) 27,533 (1,419)
*
21,850 (759) 35,400 (5,350)
#

λz (h
-1
) 0.056 0.104 0.148 0.133 0.221
AUCτ
(ng*h/mL)
14,956 12,468 41,669 34,121 126,860
AUC 0-∞
(ng*h/mL)
15,948 12,704 42,085 34,688 127,386
CL (mL/h/kg) 334 401 240 293 157
MRT (h) 4.37 2.92 2.88 3.45 4.81
Vss (mL/kg) 1,461 1,173 691 1,011 758
(Estimate, SE)
C max, maximum observed plasma concentration; λz, terminal elimination rate constant; AUCτ, area under the curve
to dosing interval (24 h), AUC 0-∞, area under the curve extrapolated to infinity; CL, clearance; MRT, mean residence
time; Vss, volume of distribution at steady state
*, #
denote statistically significant differences between matching groups (p<0.05)

Cynomolgus monkeys
The mean plasma concentration-time profiles in cynomolgus monkeys following single or multiple dose
administrations are illustrated in Fig. 13C and Fig 15, respectively. The corresponding PK parameters
calculated by NCA are outlined in Table 6. Of the total 233 infusions from 24 cynomolgus monkeys,
65

there were 4 infusions that deviated by more than 10% from the intended 1-h infusion. However, these
deviations did not occur on blood PK sampling days and therefore did not influence the PK analysis. Data
from two separate studies involving single and multiple dosing in cynomolgus monkeys were combined
in this analysis. Overall, concentration time profiles displayed a biphasic pattern, with a prolonged
elimination phase at higher doses. Plasma concentrations of RTD-1 after a single dose of 0.3 or 1 mg/kg
were detectable up to 12 h post end of infusion. In the GLP-compliant 10-day TK study, all animals
received 10 i.v. doses except for one female monkey in 15 mg/kg, which received a total of 9 doses due to
issues with venous access. Extended sampling with cynomolgus monkeys assigned to the recovery group
(15 mg/kg) revealed that plasma levels of RTD-1 were quantifiable on Day 12 (537 ng/mL) and on Day
24 (12.5 ng/mL), indicating that RTD-1 exhibits a long terminal half-life (Fig 15D). The terminal half-life
in the recovery animals was 47.2 h when compared with 9.88 h in the main group with the shorter
sampling period. The C max and AUC 0-∞ were slightly higher in males compared to females, but the
differences did not reach statistical significance.
66

Figure 15. Mean (SD) plasma concentration versus time profiles following repeated i.v.
administrations of RTD-1 in cynomolgus monkeys (A) 5 mg/kg/day, (B) 10 mg/kg/day, (C) 15
mg/kg/day, and (D) in the recovery group (15 mg/kg, n=4).

Detailed assessment of dose proportionality in cynomolgus monkeys administered a single i.v. dose
ranging from 0.3 to 15 mg/kg revealed that both C max and AUC 0-∞ increased greater than dose
proportional (Fig 16). Specifically, AUC 0-∞ was dose proportional at lower doses (0.3-3 mg/kg) but began
to deviate from dose proportionality at higher doses (≥5 mg/kg) (data not shown). Dose proportionality
assessment at steady state demonstrated that while the C max increased dose proportionally (C max,
Y=0.9553*X+6.805 [Slope 95% CI: 0.5573 to 1.353, R
2
=0.5705]), the AUCτ increased greater than dose
proportionally (AUCτ, Y=1.422*X+6.745 [Slope 95% CI: 1.072 to 1.772, R
2
=0.7916]). However, these
results were limited due to the narrow range of doses examined. Comparisons of AUCs after single dose
(Day 1) and repeat dose administrations (Day 10) revealed statistically significant accumulations at 5- and
67

10 mg/kg, yielding approximately 1.4- and 1.5-fold higher mean AUCτ compared to the mean AUC 0-∞ on
Day 1 for 5- and 10 mg/kg, respectively [5 mg/kg (p=0.0229) and 10 mg/kg (p=0.0103)]. Although there
was a trend towards RTD-1 accumulation at 15 mg/kg at steady state (Day 10), the difference did not
reach statistical significance (p=0.1879). Statistical analysis was not performed with the PK parameters
calculated on Days 4 and 7 in 15 mg/kg group due to the small number of animals (n=2).

Figure 16. Assessment of dose proportionality of A) C max and B) AUC 0-∞ in cynomolgus monkeys
following a single dose administration of RTD-1 (0.3, 1, 3, 10, or 15 mg/kg)

68

Table 6. Single and multiple dose pharmacokinetics of intravenous RTD-1 in cynomolgus monkeys
Parameters
0.3 mg/kg 1 mg/kg 3 mg/kg 5 mg/kg 10 mg/kg 15 mg/kg
Day 1 Day 1 Day 1 Day 1 Day 10 Day 1 Day 10 Day 1 Day 4 Day 7 Day 10
n=2 n=2 n=2 n=6 n=6 n=8 n=6 n=12 n=2 n=2 n=9
Cmax
(ng/mL)
582 (109) 2,560 (820)
4,750
(905)
10,700
(2,455)
11,675
(2,036)
26,675
(8,240)
27,333
(7,361)
46,458

(15,247)
†

31,100
(283)
32,850
(919)
32,233
(13,933)
†

λz (h
-1
)
0.523
(0.119)
0.251
(0.035)
0.078
(0.017)
0.323
(0.016)
#

0.157
(0.009)
#

0.192
(0.034)
*

0.120
(0.018)
*

0.149
(0.019)
†

0.072
(0.020)
0.071
(0.017)
0.078
(0.020)
†

AUCτ
(ng*h/mL)
591 (145) 3,818 (961)
10,334
(2,239)
27,160
(4,286)
38,936
(9,829)
76,083
(23,562)
117,529
(26,077)
138,135
(34,942)
139,595
(2,366)
154,149
(12,406)
173,315
(67,934)
AUC0-∞
(ng*h/mL)
617 (137) 3,875 (973)
10,740
(2,485)
27,176
(4,292)
39,997
(10,219)

76,820
(23,871)
124,790
(30,604)
142,095
(35,842)
167,061
(16,034)
187,609
(31,623)
212,728
(104,487)
CL
(mL/h/kg)
498 (111) 266 (66.9) 287 (66.4)
188
(29.2)
#

136 (36.5)
#
143 (48.2)
*
88.5 (18.5)
*
114 (25.7) 107 (1.82) 97.6 (7.86)
103
(53.0)
MRTinf (h) 1.24 (0.16) 1.82 (0.07)
4.30
(0.60)
2.94
(0.15)
4.84 (0.57) 4.40 (0.50)
7.20
(1.04)
5.48 (0.76)
11.8
(2.46)
12.3 (3.08)
12.0
(3.33)
Vss (mL/kg)
626
(218)
486 (139)
1,215
(112)
550 (74.6) 645 (123) 629 (231)
624
(88.2)
629 (176)
†

1,263
(242)
1,193 (204)
1,139
(411)
†

Mean (SD)
Cmax, maximum observed plasma concentration; λz, terminal elimination rate constant; AUCτ, area under the curve to dosing interval (24 h), AUC0-∞, area under the curve
extrapolated to infinity; CL, clearance; MRT, mean residence time; Vss, volume of distribution at steady state
#, *,†
denote statistically significant differences within dosing group between Day 1 and Day 10 (p<0.05)

69

Vervet.
The mean plasma concentration-time profile of RTD-1 in the vervet after a single i.v. bolus
administration is shown in Fig. 13D, and the PK parameters are presented in Table 7. Following the bolus
administration, plasma concentrations of RTD-1 declined monoexponentially. The plasma concentrations
collected after 24 h were below the lower limit of quantification and therefore excluded from the analysis.

Table 7. Pharmacokinetics of single dose RTD-1 (3 mg/kg) in vervet
Parameters Estimate
Cmax
(ng/mL)
5,193
λz (h
-1
) 0.204
AUCτ (ng*h/mL) 21,949
AUC0-∞
(ng*h/mL)
22,110
CL (mL/h/kg) 136
MRT (h) 4.71
Vss (mL/kg) 639
C max, maximum observed plasma concentration; λz, terminal elimination rate constant; AUCτ, area under the curve
to dosing interval (24 h), AUC 0-∞, area under the curve extrapolated to infinity; CL, clearance; MRT, mean residence
time; Vss, volume of distribution at steady state

Compartmental modeling.
The traditional two-compartmental model (first-order distribution and elimination) performed better than
a one-compartmental model and therefore, two-compartmental model was chosen to describe the biphasic
decline of plasma RTD-1 concentrations in cynomolgus monkeys. Subsequently, two-compartmental
models with different distribution kinetics (first order vs. Michaelis-Menten) and different elimination
kinetics (first-order vs Michaelis-Menten vs parallel) were compared to assess the potential mechanism
responsible for the nonlinearity. Table 8 summarizes the various two compartmental models used to
describe the potential distribution and elimination of RTD-1. The model accounting for both the first
order and Michaelis-Menten elimination performed marginally better than the linear (first-order
70

elimination) model but did not lead to significant improvement in the model fit. Additionally, models
with Michaelis-Menten elimination or with Michaelis-Menten distribution to the peripheral compartment
did not improve the overall model fit to the data. Therefore, the compartmental modeling of the PK data
from cynomolgus monkeys were not fruitful in elucidating the mechanism involved in the nonlinear
behavior.
Table 8. A comparison of four two-compartmental models with different eliminations or
distribution
AIC, Akaike information criterion; BIC, Bayesian information criterion; -2LL, negative 2 loglikelihood; MM, model
with Michaelis-Menten elimination, C, central compartment; P, peripheral compartment, Km, Michaelis constant;
Vmax, maximal velocity.

Interspecies allometric scaling.
Overall, linear regression of logarithmically transformed CL or Vss against log-transformed BW from the
four preclinical species resulted in a reasonable fit, as evidenced by the relatively high r
2
. (Fig. 17). The
allometric scaling equations for CL and Vss were 𝑌 = 190 . 1 ∙ 𝐵𝑊
0 . 8 2 91
(r
2
=0.7719) and 𝑌 = 706 . 3 ∙
𝐵𝑊
0 . 8 6 6 3
(r
2
=0.8853), respectively, which yielded the predicted human CL of 6.44 L/h and volume of
distribution at steady state (Vss) of 28.0 L. Based on the target plasma AUC 0-∞ of approximately 3,869
and 9,001 ng*h/mL, which were previously established in a murine model of endotoxin-induced acute
lung injury (ALI), the estimated human equivalent doses (HED) to reach therapeutic efficacy are between
24.9 and 58.0 mg for a 70 kg individual, or 0.36 and 0.83 mg/kg.
Model
selection
Linear elimination
model
MM elimination
model
Parallel elimination
model
Saturable
distribution model

AIC 6692.88 6877.07 6572.40 6689.73
BIC 6756.17 6964.10 6687.12 6776.76
-2LL 6660.88 6833.07 6514.40 6645.73
71

Figure 17. Interspecies allometric correlation. Plot was created based on results of RTD-1 single dose
PK studies. Dashed line represents the predicted A) CL (6.44 L/h) or B) Vss (28.0 L) for an adult (70 kg).

Biodistribution of
14
C-RTD in female Sprague-Dawley rats
The biodistribution study was undertaken to determine the patterns of distribution and potential routes of
elimination of RTD-1 in rats after single dose i.v. administration of
14
C-RTD-1 equivalent to 5 mg/kg.
Widespread distribution of
14
C-RTD-1 was observed at 1 h, with the highest density measured in the liver
(34%), followed by the kidney (7%) (Fig. 18). At 1 h, there was a trace amount of
14
C counts measured in
the urine, skin, leg muscle, eyes, and brain. After 24 h, the density of
14
C counts in the tissues and organs
decreased compared to counts detected at 1 h, including the liver (13%), except for in the urine. The
14
C
counts in urine increased from trace amounts at 1 h to 8.5% after 24 h. Moreover, approximately 4% of
14
C-RTD-1 dose administered was recovered in the feces at 24 h, suggesting that the major route of
elimination is urinary, followed by the biliary excretion.
72

Figure 18. Mean (SD) density of 14C-RTD-1 in tissues and organs 1 h and 24 h after i.v.
administration in female rats
Note: *indicates that tissue was not collected at 1 h

Safety
Rats
The results of the safety assessments are provided in detail in Table 8-10. In general, single doses up to 10
mg/kg were well tolerated in both male and female rats. During the study, mortality was observed in a
total of 7 rats. Specifically, 1 out of 18 female rats in the placebo group was found dead on Day 6, and
another 1 out of 16 female rats in the 5 mg/kg dose group was found dead on Day 15 of the study.
However, the mortality of the female rat in the 5 mg/kg group was determined to be unrelated to RTD-1
treatment due to minimal clinical manifestations until the day of death as well as the timing of the event.
73

Additionally, a single i.v. administration of 20 mg/kg RTD-1 led to acute, treatment-related mortality in 5
out of 12 rats on Day 1. Of the five rats, three male rats were found dead, and one male and one female rat
were euthanized due to moribund conditions.

Following once daily i.v. infusion of RTD-1 (5- and 10 mg/kg/day), non-adverse, treatment-related
clinical signs such as muscle fasciculation, lethargy, swollen nose, chin, and/or cheeks, swollen front
limbs, reluctance to walk and/or stand, hypoactivity, ataxia, and increased respiration, were noted
throughout the course of the study at both dose levels, but were temporary and resolved during the
recovery period. There were no significant changes in the body weight in rats except for those in 20
mg/kg dosing group, where significant decreases in body weights were recorded in both male and female
rats (data not shown). Food consumption was not significantly affected by treatment administration in rats
at any dose level. Due to the unexpected mortality and adverse treatment-related clinical observations at
20 mg/kg, the study in this dosing group was prematurely terminated, and the remaining rats were
euthanized prior to their scheduled administration on Days 1 or 2. Adverse clinical observations
associated with mortalities included cold to touch, laying on side, abnormal body color, inability to walk,
extreme dehydration, tremors, and labored respiration.

No treatment-related changes in hematological parameters were observed in male and female rats at 5
mg/kg at the end of treatment (Day 8) (Table 8). At the end of recovery, RBC volume distribution width
(RDW) was significantly elevated in female rats at 5 mg/kg and was outside of historical control range
(HCR) for female Sprague Dawley rats (data not shown). At 10 mg/kg, a significant decrease in absolute
reticulocytes in male rats treated with 10 mg/kg at the end of treatment. However, this value was within
the HCR for male Sprague Dawley rats of this age and therefore was considered non-adverse (191). In
female rats, there were significant increases in WBC, and absolute lymphocytes and monocytes at the end
74

of treatment when compared to controls. However, these increases were considered non-adverse due to
lack of dose-dependency and the reversibility of the changes by the end of recovery period (data not
shown). At the end of recovery, mean cell hemoglobin (MCH) and mean cell hemoglobin concentration
(MCHC) increased modestly in male rats when compared to the controls, but the values remained within
the reference range for male rats of similar age. At 20 mg/kg, white blood cell counts (WBC), relative and
absolute neutrophils, relative and absolute monocytes, and relative and absolute large unclassified cells
(LUC) counts were significantly elevated in male rats, while relative lymphocytes, relative and absolute
eosinophils, and platelet counts significantly decreased on Day 2 compared to the controls at the end of
treatment. Of these, the relative and absolute neutrophil, relative lymphocyte, and relative and absolute
monocyte values were outside of the HCR for male rats. In female rats, there were significant increases in
absolute reticulocytes and monocytes, while significant decreases in relative and absolute eosinophils
were observed on Day 2 (interim euthanasia) when compared with controls at the end of treatment. Due to
the premature termination of study in 20 mg/kg group, the reversibility of the alterations in these
parameters could not be determined. However, regardless of statistical significance, these changes in
female rats were considered non-adverse as the values were within the HCR for female rats.

There were no significant treatment-induced abnormalities in serum biochemical parameters in male and
female rats that received 5 or 10 mg/kg/day at the end of treatment (Table 9). At the end of recovery,
glucose levels were slightly elevated in female rats at 10 mg/kg (data not shown). At the highest dose
examined (20 mg/kg), chloride and albumin levels significantly decreased while serum urea nitrogen
(Urea N) levels increased in male rats on Day 2 when compared to controls. In female rats, alanine
aminotransferase (ALT), calcium, and gamma-glutamyl transferase (GGT) levels were significantly
elevated compared to controls. In both male and female rats, albumin/globulin ratio (A/G), creatinine,
glucose, triglyceride levels were significantly elevated while total protein (TP), sodium (Na), and globulin
levels significantly reduced when compared with controls. Of these, albumin, A/G, globulin, Urea N, TP,
75

and triglyceride levels were outside the HCR in male rats and A/G, GGT, globulin, glucose, TP, and
triglycerides were outside the HCR in female rats. The rest of the parameters were within the HCR and
therefore considered non-adverse.

There were no treatment-related changes in coagulation parameters in male and female rats at 5 or 10
mg/kg group at the end of treatment (Table 10) or at the end of recovery (data not shown). At 20 mg/kg,
the prothrombin time (PT) and activated partial thromboplastin time (APTT) were significantly elevated
in both male and female rats, while fibrinogen levels decreased in male rats when compared to controls at
the end of treatment. Of these, fibrinogen levels were outside of HCR in male rats, and both PT and
APTT were outside of HCR in female rats.

There were no treatment-related changes in urinalysis parameters from male and female rats receiving 5
or 10 mg/kg (data not shown). Due to early removal, overnight urine samples were not collected in rats in
the 20 mg/kg group and therefore could not be assessed. No treatment-related abnormalities were detected
during the post-exposure ophthalmology assessments with any dosing group. In this study, treatment-
related effect on the injection site could not be assessed due to the surgical catheterization.
Histopathological evaluations of rats in the 20 mg/kg group showed discolorations in the kidney, brain,
and lungs, with bronchi and trachea filled with fluids at interim euthanasia. There were no macroscopic
findings related to RTD-1 treatment in any dose groups at interim euthanasia (for 20 mg/kg group, Day
2), terminal euthanasia (Day 8) or recovery euthanasia (Day 24). Key treatment-related microscopic
findings included non-adverse, dose-dependent increased incidence of minimal to mild liver necrosis in
female rats administered 5- and 10 mg/kg/day at the end of treatment. However, liver necrosis was not
present in female animals (5- and 10 mg/kg/day) euthanized at the end of recovery period and did not lead
to increases in parameters included in the liver function panels (TP, albumin, total bilirubin, and liver
76

enzymes). Therefore, these observations were considered recoverable and non-adverse. Adverse
treatment-related, severity ranging from minimal to moderate liver necrosis, defined by focal to
multifocal areas of lytic to coagulative necrosis, was observed in male rats administered 20 mg/kg. Mild
to severe adrenal necrosis, which is characterized by unilateral to bilaterally coagulative cortical to
corticomedullar necrosis, was observed in both male and female rats administered 20 mg/kg.

Based on the lack of adverse clinical signs or abnormalities in parameters at the 10 mg/kg dose, the no-
observed-adverse-effect-level (NOAEL) in rats, was established at 10 mg/kg/day. The lowest observed
adverse effect level (LOAEL), which is defined by the FDA as the lowest dose tested in preclinical
species with adverse effects, in rats was established at 20 mg/kg (192).

77

Table 9. Hematological results of male and female rats at the end of treatment
Parameter Male Female
0 mg/kg 5 mg/kg 10 mg/kg 20 mg/kg
d
0 mg/kg 5 mg/kg 10 mg/kg 20 mg/kg
d

WBC (10
3
/mm
3
) 7.95 (1.93) 8.40 (2.53) 10.05 (3.28) 13.70 (4.90)
a,b
6.95 (2.43) 6.50 (3.50) 10.75 (3.68)
a
8.15 (5.70)
Hemoglobin (g/dL) 13.8 (0.9) 14.1 (1.0) 14.2 (0.7) 12.1 (1.0)
b,c
13.2 (0.9) 13.5 (1.0) 13.7 (0.4) 15.2 (4.6)
Hct (%) 42.6 (2.9) 43.8 (1.7) 43.7 (1.2) 37.3 (3.7)
b,c
40.8 (2.2) 40.5 (1.9) 41.2 (1.8) 46.9 (14.3)
RBC (10
6
/mm
3
) 6.69 (0.64) 7.06 (0.23) 7.06 (0.38) 6.04 (0.47)
b,c
6.92 (0.36) 6.88 (0.33) 7.21 (0.40) 7.63 (2.19)
MCH (pg) 20.4 (0.7) 20.0 (1.4) 20.2 (0.6) 20.0 (0.6) 19.3 (0.8) 19.1 (1.0) 19.0 (0.5) 19.6 (0.9)
MCV (fL) 62.4 (3.1) 61.8 (2.9) 62.6 (3.1) 62.5 (2.1) 58.0 (2.7) 57.9 (2.8) 57.3 (2.4) 61.0 (2.2)
c

MCHC (g/dL) 32.0 (0.8) 32.1 (0.3) 32.4 (0.7) 31.8 (0.5) 33.1 (0.9) 33.4 (0.4) 33.3 (0.4) 32.3 (0.3)
b,c

RDW (%) 14.1 (1.5) 14.0 (1.2) 13.1 (1.1) 14.3 (1.2) 12.5 (0.3) 12.7 (0.8) 13.0 (0.4) 12.2 (0.6)
c

HDW (g/dL) 2.27 (0.29) 2.30 (0.09) 2.20 (0.20) 2.44 (0.25)
c
2.37 (0.19) 2.37 (0.16) 2.45 (0.16) 2.37 (0.32)
Neutrophils (%) 17.4 (6.0) 20.2 (4.7) 22.6 (7.9) 61.1 (6.1)
a,b,c
22.9 (16.0) 26.7 (11.1) 19.9 (5.5) 33.6 (14.5)
Lymphocytes (%) 75.6 (7.8) 71.8 (5.4) 70.9 (11.2) 30.9 (4.7)
a,b,c
69.8 (18.6) 68.1 (8.7) 72.0 (4.4) 60.5 (12.9)
Monocytes (%) 2.5 (1.3) 2.9 (1.6) 2.7 (1.1) 8.1 (2.6)
a,b,c
3.1 (1.3) 2.6 (1.0) 3.5 (1.4) 3.8 (1.5)
Eosin (%) 3.3 (0.5) 3.9 (1.3) 3.0 (1.9) 1.1 (0.3)
a,b,c
4.1 (2.5) 3.6 (2.4) 3.3 (1.0) 1.5 (0.5)
a,b,c

Basophils (%) 0.3 (0.1) 0.3 (0.1) 0.3 (0.2) 0.2 (0.1) 0.3 (0.2) 0.3 (0.2) 0.4 (0.2) 0.5 (0.5)
LUC (%) 0.3 (0.2) 0.3 (0.1) 0.3 (0.2) 0.5 (0.5)
a
0.3 (0.1) 0.3 (0.1) 0.35 (0.28) 0.5 (0.3)
Retic (%) 5.8 (1.4) 5.2 (0.4) 4.6 (0.8) 6.4 (1.6)
b,c
4.0 (1.2) 3.9 (1.0) 4.1 (0.6) 5.3 (1.4)
Neutrophil abs. (10
3
/mm
3
) 1.48 (0.83) 2.04 (0.96) 1.85 (0.61) 8.40 (3.42)
a,b,c
1.75 (0.77) 1.33 (0.99) 2.18 (1.30) 2.55 (2.72)
Lympho abs. (10
3
/mm
3
) 5.49 (2.00) 6.03 (1.81) 6.69 (2.92) 4.24 (1.79)
b,c
4.40 (1.75) 4.78 (3.21) 7.13 (1.76)
a
5.56 (2.93)
Monocyte abs. (10
3
/mm
3
) 0.19 (0.16) 0.22 (0.20) 0.28 (0.10) 0.93 (0.29)
a,b,c
0.17 (0.09) 0.17 (0.08) 0.39 (0.13)
a,b
0.33 (0.26)
a

Eosin abs. (10
3
/mm
3
) 0.27 (0.05) 0.37 (0.10) 0.31 (0.24) 0.15 (0.06)
a,b,c
0.28 (0.22) 0.30 (0.23) 0.33 (0.14) 0.13 (0.06)
a,c

Basophils abs. (10
3
/mm
3
) 0.02 (0.01) 0.03 (0.02) 0.03 (0.02) 0.03 (0.03)

0.02 (0.03) 0.02 (0.02) 0.04 (0.02) 0.06 (0.06)
LUC abs. (10
3
/mm
3
) 0.02 (0.01) 0.03 (0.02) 0.03 (0.02) 0.07 (0.05)
a,b,c
0.02 (0.03) 0.02 (0.03) 0.04 (0.03) 0.05 (0.03)
Retic abs. (10
3
/mm
3
) 378.3 (90.6) 359.7 (38.0) 314.2 (33.4)
a
373.3 (106.5)
c
277.8 (60.6) 256.7 (53.5) 277.3 (42.0) 326.0 (60.4)
a,b

Platelets (10
3
/mm
3
) 895 (93) 1,052 (145) 1,086 (192) 728 (86)
a,b,c
822 (169) 801 (306) 939 (315) 604 (524)
c

Data represents median (IQR)
WBC, White blood cell count; RBC, Red blood cell count; RDW, RBC volume distribution width; HDW, Hemoglobin concentration distribution width; MCH, Mean cell
hemoglobin; MCHC, Mean cell hemoglobin concentration; MCV, Mean cell volume; LUC, Large unclassified cells. Lympho, lymphocytes; Retic, reticulocytes; Eosin,
eosinophils; Abs, absolute amount
a
p<0.05 compared with control (0 mg/kg)
b
p<0.05 compared with control (5 mg/kg)
c
p<0.05 compared with control (10 mg/kg)
d
Measurement on day of unscheduled euthanasia (Day 2), excludes animals found dead

78

Table 10. Serum biochemical data of male and female rats at the end of treatment
Parameter

Male Female
0 mg/kg 5 mg/kg 10 mg/kg 20 mg/kg
d
0 mg/kg 5 mg/kg 10 mg/kg 20 mg/kg
d

ALT (U/L)
42.5 (5.5) 40.0 (9.8) 32.5 (4.5) 74.0 (38.0)
b,c
33.0 (8.0) 35.0 (7.0) 32.5 (6.0) 62.0 (28.5)
a,b,c

Albumin (g/dL)
3.7 (0.2) 3.8 (0.0) 3.7 (0.2) 2.7 (0.0)
a,b,c
3.6 (0.2) 3.9 (0.3) 3.9 (0.1) 3.0 (0.6)
b,c

A/G
2.4 (0.4) 2.2 (0.3) 2.35 (0.18) 2.70 (0.10)
a,b,c
2.20 (0.10) 2.10 (0.20) 2.15 (0.18) 3.00 (0.40)
a,b,c

ALP (U/L)
248.5 (72.8) 212.0 (40.3) 212.5 (51.5) 232.0 (45.0) 124.0 (28.0) 92.0 (21.0) 109.5 (30.5) 142.0 (34.5)
b,c

AST (U/L)
158.5 (45.8) 133.0 (34.0) 113.5 (16.8) 245.0 (100.0)
b,c
149.0 (22.0) 139.0 (35.0) 122.0 (14.3) 397.0 (345.5)
b,c

Calcium (mg/dL)
9.60 (0.18) 9.75 (0.45) 9.70 (0.20) 9.40 (0.50)
b
9.60 (0.20) 9.80 (0.20) 9.95 (0.28) 10.30 (0.60)
a,b

Chloride (mmol/L)
105.0 (1.8) 104.5 (1.8) 105.0 (1.0) 101.0 (1.0)
a,b,c
105.0 (3.0) 105.0 (2.0) 105.0 (2.0) 104.0 (3.0)
Cholesterol (mg/dL)
59.5 (13.0) 70.5 (10.3) 66.0 (14.3) 67.0 (7.0) 52.0 (7.0) 55.0 (15.0) 55.0 (26.5) 52.0 (6.5)
CK (U/L)
828 (342) 766 (396) 613 (255) 707 (615) 914 (450) 792 (198) 474 (211) 1,506 (2,605)
Creatinine (mg/dL)
0.2 (0.0) 0.2 (0.1) 0.3 (0.1) 0.4 (0.1)
a,b,c
0.3 (0.0) 0.3 (0.0) 0.3 (0.0) 0.5 (0.2)
a,b,c

GGT (U/L) 0.0 (0.0) 0.0 (0.0) 0.0 (0.0) 0.0 (0.0) 0.0 (0.0) 0.0 (0.0) 0.0 (0.0)
4.0 (5.5)
a,b,c

Globulin (g/dL)
1.6 (0.2) 1.7 (0.2) 1.6 (0.2) 1.0 (0.0)
a,b,c
1.7 (0.1) 1.8 (0.1) 1.8 (0.2) 1.0 (0.3)
a,b,c

Glucose (mg/dL)
87 (7) 73 (16) 83 (7) 175 (35)
a,b,c
105 (7) 97 (16) 99 (6) 218 (70)
a,b,c

Phos (mg/dL)
8.25 (0.75) 8.45 (0.55) 8.6 (1.0) 9.3 (3.8) 7.6 (0.7) 7.3 (0.8) 7.05 (0.75) 9.3 (5.0)
K (mmol/L)
4.8 (0.1) 5.15 (0.18) 5.1 (0.3) 5.1 (0.6) 4.4 (0.4) 4.9 (0.4) 5.05 (0.45) 4.9 (0.65)
Urea N (mg/dL)
17.5 (4.25) 16.5 (4.0) 19.0 (3.5) 28 (6)
a,b,c
20 (1) 20 (2) 21 (1.8) 20 (3)
Na (mmol/L)
145 (1.75) 144 (1.8) 144 (0) 140 (2)
a,b,c
145 (3) 143 (1) 142.5 (1.0) 141 (2.5)
a

T-Bil (mg/dL) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
0.10 (0.20)
0.00 (0.00) 0.00 (0.00) 0.00 (0.00) 0.00 (0.00)
TP (g/dL)
5.2 (0.25) 5.5 (0.18) 5.35 (0.28) 3.7 (0.1)
a,b,c
5.4 (0.4) 5.8 (0.5) 5.7 (0.4) 3.90 (0.85)
a,b,c

Triglycerides
(mg/dL) 29 (12) 37 (22) 29 (5) 193 (111)
a,b,c
22 (4) 25 (7) 26 (12) 106 (37)
a,b,c

Data represents median (IQR)
ALT, alanine aminotransferase; A/G, Albumin/Globulin ratio; ALP, Alkaline phosphatase; AST, Aspartate aminotransferase; CK, Creatine kinase; GGT, Gamma
glutamyltransferase; Phos, inorganic phosphorus; K, potassium; Na, Sodium; Urea N, serum Urea nitrogen; T-Bil, total bilirubin; TP, total protein.
a
p<0.05 compared with control (0 mg/kg)
b
p<0.05 compared with 5 mg/kg
c
p<0.05 compared with 10 mg/kg
d
Measurement on day of unscheduled euthanasia (Day 2), excludes animals found dead
79

Table 11. Coagulation data of male and female rats at the end of treatment
Parameter

Male Female
0 mg/kg 5 mg/kg 10 mg/kg 20 mg/kg
d
0 mg/kg 5 mg/kg 10 mg/kg 20 mg/kg
d

PT
(seconds) 16.3 (1.6)
16.0
(0.5) 17.5 (1.4)
21.3 (1.4)

a,b

16.3
(0.7)
16.3
(1.4) 17.1 (0.6)
23.5 (9.8)

a,b

APTT
(seconds) 14.1 (2.9)
14.8
(1.0) 14.6 (1.1)
18.5 (3.1)

a,b,c

10.5
(1.9)
10.6
(0.7) 10.9 (2.4)
29.2 (20.7)

a,b,c

Fibrinogen
(mg/dL) 264 (50) 263 (9) 261 (55) 98 (19)
a,b,c
269 (68) 223 (80) 283 (37) 83 (152)
c

Data represents median (IQR)
PT, Prothrombin time; APTT, Activated partial thromboplastin time.
a
p<0.05 compared with control (0 mg/kg)
b
p<0.05 compared with 5 mg/kg
c
p<0.05 compared with 10 mg
d
Measurement on day of unscheduled euthanasia (Day 2), excludes animals found dead.

Cynomolgus monkeys
Overall, doses up to 15 mg/kg of RTD-1 was well tolerated in both male and female monkeys. In the non-
GLP dose range finding study, all animals survived the study without any treatment-related adverse
clinical signs. Based on these data the maximum tolerated dose (MTD) was established at 15 mg/kg.
Similarly, in the GLP-compliant 10-day repeat dose TK study, no mortality or unscheduled euthanasia
occurred at any dose level. No significant changes in body weight were observed in the monkeys.
Treatment-related decrease in food consumption was observed in females at 10 mg/kg/day and in both
sexes at 15 mg/kg/day during the dosing phase but this was considered non-adverse as the animals
recovered to baseline by the end of recovery and the changes in food consumption did not translate to
changes in body weight or adverse clinical observations.

Non-adverse treatment-related hematological changes at the end of treatment included statistically
significant, but modest increases in absolute LUC counts in male monkeys and absolute monocytes in
female monkeys at 15 mg/kg when compared to the respective controls (data not shown). However, the
increase in absolute LUC was resolved by the end of recovery and therefore considered non-adverse (data
not shown), and the elevated absolute monocyte counts observed in female monkeys were within the
80

HCR for female cynomolgus monkeys (193). Most notable non-adverse, but significant treatment-related
changes in serum biochemical parameters included a slight reduction in inorganic phosphorus (Phos)
level and an elevated glucose level in female monkeys at 15 mg/kg/day at the end of treatment. However,
these changes were considered non-adverse regardless of statistical significance due to the small
magnitude in change and the elevated values were still within the HCR for female cynomolgus monkeys.
A trend towards an increase in fibrinogen levels was noted in all treated monkeys when compared to the
control group and baseline levels, but the changes did not reach statistical significance and returned to
baseline by the end of the recovery period (data not shown). There were no treatment-related changes in
urinalysis parameters or abnormalities in post-exposure ophthalmologic assessments or the
electrocardiogram from cynomolgus monkeys at any dose level (data not shown). The lack of significant
alterations in clinical pathology parameters in any of the animals with doses up to 15 mg/kg corroborates
the results from the non-GLP dose range study in cynomolgus monkeys, which also established an MTD
of 15 mg/kg based on no adverse effects on mortality, clinical observations, or body weight with up to 15
mg/kg intravenous RTD-1 treatment. Due to the small number of measurements taken at the end of
recovery period, statistical analyses of the clinical pathology parameters at this timepoint could not be
performed.

Procedure-related gross observations were recorded at the injection sites of three animals at 15 mg/kg,
which included abrasions and abnormal texture likely due to repeat catheterization. However, there were
no macroscopic findings related to treatment at the end of treatment or recovery. In the main group,
microscopic evaluations revealed treatment-related thrombosis at the injection sites at the end of
treatment, although there was a lack of a dose trend in incidence and/or severity. In the recovery group,
treatment-related thrombosis at the injection site, acute inflammation, edema, hemorrhage, and fibrosis
was present in animals receiving 15 mg/kg at the end of recovery. However, comparable observations
were also present at the injection sites of control animals in the recovery group, which include minimal to
81

mild injection site fibrosis and mild chronic thrombosis, suggesting that these findings are procedure
related. Lastly, minimal to mild intravascular thrombosis (thromboembolism) was observed in the lung of
only the treated animals (males administered ≥ 10 mg/kg/day and females administered ≥ 5 mg/kg/day) at
the end of treatment (Day 11). The thrombi within the lungs contained varying numbers of inflammatory
cells both within the thrombi and in the surrounding connective tissues, and thrombi in the lungs were
present predominately in mid to small arteries and capillaries in the alveolar walls with two animals.
Thromboembolism was concluded to be secondarily related to the peptide administration due to the
composition of the thrombi found in the lung, which were likely embolic from the thrombi formed at the
injection site. These findings also resolved by the end of recovery period, as thrombosis was not identified
in any lung sections in the control group or monkeys administered 15 mg/kg.

The summary of the NOAEL and LOAEL determined in each species is listed in Table 8. Given that the
repeat administration of RTD-1 of up to 15 mg/kg/day was well tolerated in both sexes, NOAEL was
established at 15 mg/kg/day in cynomolgus monkeys. LOAEL could not be determined in cynomolgus
monkeys as the highest dose examined in the GLP study was well tolerated. Based on this analysis, the
HEDs that are equivalent to the NOAEL and LOAEL in rats are 3.1 mg/kg and 11.7 mg/kg for a 70 kg
individual, and the HED that is equivalent to NOAEL in cynomolgus monkeys is 15.9 mg/kg for a 70 kg
individual.

82

Table 12. Summary of NOAEL, LOAEL and gross pathology and clinical observations for RTD-1-
related adverse events
Species Study duration NOAEL
(mg/kg/day)
LOAEL
(mg/kg/day)
Adverse effects observed at the LOAEL
Sprague-Dawley rats 7 days 10 20 Cold to touch
Laying on side
Abnormal body color (pale)
Unable to walk
Extreme dehydration
Tremors
Labored respiration
Brain, kidney, and lung discolorations
Enlarged salivary glands
Cynomolgus monkeys 7 days 15 ND Not attained
Cynomolgus monkeys 10 days 15 ND Not attained
ND – Not determined

Discussion
Despite the recent development of COVID-19 vaccines, the emergence of new COVID-19
variants remains a major threat to global health. Dysregulated inflammatory response is one of the key
characteristics observed in severe COVID-19 patients and is the main contributing factor to multiple
organ failure and mortality (74, 194). Early intervention of systemic inflammation has shown to be
effective in reducing the mortality in COVID-19 patients, which highlights the importance of targeting
the systemic inflammation caused by COVID-19 to improve patient outcomes (92). However, at present,
there are a limited number of safe and effective treatments available for COVID-19 pneumonia. In the
current analysis, the PK and safety of intravenous RTD-1 were examined in various preclinical studies in
preparation for planned clinical trials of RTD-1 for the treatment of COVID-19 pneumonia.

Single and multiple dose studies performed in rats and cynomolgus monkeys demonstrated the
excellent safety profile of intravenous RTD-1 administration. Repeat administration of RTD-1 was well
tolerated in rats at doses up to 10 mg/kg, and therefore, the NOAEL in rats was established at 10
mg/kg/day. Treatment-related mortality and adverse clinical signs were observed in rats treated at 20
83

mg/kg, including cold to touch, abnormal body color, inability to walk, extreme dehydration, and tremors.
In cynomolgus monkeys, single and repeated daily dose administration of RTD-1 were tolerated up to 15
mg/kg/day, with no major treatment-related adverse findings or toxicities. Given the lack of adverse
findings, the NOAEL was established at 15 mg/kg/day in cynomolgus monkeys. The NOAEL in the
cynomolgus monkeys was established at a higher dose when compared with the rats, demonstrating that
RTD-1 was better tolerated in cynomolgus monkeys. Most changes noted in hematological, serum
chemistry, and coagulation parameters in both rats and cynomolgus monkeys were determined as non-
adverse due to their low magnitude, lack of consistency between the two species, lack of dose
dependence, and/or reversibility by the end of the recovery period. Therefore, these data demonstrate the
safety of intravenous RTD-1 at dose up to 10 mg/kg/day in rats and 15 mg/kg/day in cynomolgus
monkeys.

The PK of intravenous RTD-1 following single and multiple ascending doses in multiple species
is characterized by extensive tissue distribution and prolonged elimination. The volume of distribution
(Vss) normalized to body weight of the animals receiving 5 mg/kg of RTD-1 varied across species, with
1,048, 1,461, 550 mL/kg, in mice, rats and cynomolgus monkeys, respectively. The relatively large Vss
indicates that RTD-1 extensively distributes to tissues. The biodistribution study confirmed extensive
tissue distribution, particularly in the liver. The prolonged elimination half-life observed in cynomolgus
monkeys in the recovery group (47.2 h) is suggestive of tissue redistribution. Future studies involving
whole body tissue PK analysis to evaluate the time course of drug disposition more extensively within
tissues are planned.

Analysis of the single- and multiple ascending dose studies in rats and monkeys showed a greater
than dose proportional increase in AUC 0-∞ and C max suggestive of nonlinear PK. Several therapeutic
84

proteins exhibit nonlinear PK mediated by different mechanisms. For instance, exenatide and recombinant
human interferon (IFN) (e.g. IFN-β1a) display nonlinear kinetics due to the saturation of the elimination
pathway, such as target-mediated drug disposition (TMDD) (161, 162). Alternatively, nonlinear PK of
cyclosporin A and erythropoietin were attributable to the saturation of tissue binding and receptors in
target tissues, respectively (157, 163). The widespread distribution of
14
C-RTD-1 in rats in the
biodistribution study, which could explain the large Vss estimated in the preclinical PK studies, suggest
that saturation of the peptide within these tissues may be one potential source of nonlinearity. Since the
greatest accumulation of RTD-1 occurred in the liver and kidney, a dose-dependent decrease in CL
observed in rats and cynomolgus monkeys could also explain the nonlinearity. Consistent with data from
other small peptides (< 10 kDa) which are predominately cleared through the glomerular filtration,
appreciable amounts of
14
C-RTD-1 were recovered from the urine (accounting for 7% at 24 h). In
addition, a relatively significant portion was recovered in feces (accounting for 4% at 24 h) indicating that
elimination of RTD-1 occurs through renal and biliary excretion (145, 151). As cyclic peptides are
generally not a substrate for metabolic enzymes (i.e. CYP450), RTD-1 presumably is excreted as the
intact peptide. Therefore, one plausible explanation for the nonlinear PK of RTD-1 may be the saturations
of uptake and/or efflux transporters present on the liver or kidney. However, the definitive role of
hepatic/renal transporters in the distribution and elimination of RTD-1 requires further investigation.

Interspecies allometric scaling is a valuable tool that enables extrapolation of PK data from preclinical
species to humans and is commonly used to predict an appropriate dosage for FIH clinical trials. Since
RTD-1 is believed to follow linear PK at the HED for efficacy, as evidenced by dose proportional
increases in the AUC 0-∞ at lower doses in cynomolgus monkeys (0.3-3 mg/kg), we performed interspecies
allometric scaling using simple allometry to predict human PK. For macromolecules that are renally
excreted, human CL can be adequately predicted using the simple allometric equation (195). As three or
more preclinical species are typically needed to reliably scale the parameters to humans, available single
85

dose data from mice and vervet were included in the analysis (196). The estimated allometric scaling
exponents of 0.829 and 0.866 for CL and Vss respectively, are in agreement with the values reported for
other therapeutic proteins, which are 0.65-0.84 for CL and 0.84-1.02 for Vss (197). The target AUC was
previously established in mouse model of LPS-induced ALI, where a single subcutaneous injection of 5-
or 25 mg/kg RTD-1, which resulted in mean AUC 0-∞ of 3,869 and 9,001 ng*h/mL respectively, led to a
significant decrease in airway neutrophil burden and inflammatory cytokines/chemokines without
mortality (126). The HED of 0.3 mg/kg daily was determined using the predicted human CL (6.44 L/h)
from interspecies allometric scaling and the target AUC for efficacy (from the murine model of
endotoxin-induced ALI). Based on the FDA’s recommendation for a 10-fold safety factor, the predicted
first-in-human (FIH) dose in clinical trial is approximately 0.03 mg/kg for an adult (190, 198). This
approximation of the dose for FIH study is predicted to be well below the NOAEL established by
preclinical animals and therefore projected to be safe in humans. The HED equivalent to NOAEL in
cynomolgus monkeys of 15.9 mg/kg was higher than both the HED equivalent to NOAEL and LOAEL in
rats (3.1 and 11.7 mg/kg, respectively). Since cynomolgus monkeys are more physiologically similar to
humans than the rats, it is possible that doses up to 15.9 mg/kg may be tolerated in humans. Furthermore,
this indicates that the HED required for efficacy (0.36-0.83 mg/kg) is approximately 19- to 45-fold lower
than the HED calculated based on NOAEL in cynomolgus monkeys, further ensuring safety in humans.

There were a few limitations to our analysis. First, simple allometry does not account for dose dependent
(nonlinear) processes and therefore may not be suitable for scaling the parameters to human. However,
since nonlinearity was more evident at higher dose ranges, we believe that at the doses selected for FIH
clinical trial, RTD-1 is predicted to exhibit linear PK. Secondly, the target AUC 0-∞ used to determine the
FIH dose was established in a murine model of LPS-induced ALI and therefore may not reflect the actual
target AUC required for efficacy in COVID-19 in humans. We, however, believe this is an appropriate
animal model to derive the target AUC for efficacy as COVID-19-related pneumonia is characterized by
86

excessive infiltration of neutrophils and overproduction of pro-inflammatory cytokines in the airway
(199, 200).

In summary, we assessed the PK and safety of intravenous RTD-1 in mice, rats, cynomolgus monkeys,
and a vervet and predicted the human PK using a simple allometric equation. Single and multiple
ascending dose studies in cynomolgus monkeys revealed a dose-dependent decrease in CL. The
biodistribution of
14
C-RTD-1 revealed that RTD-1 extensively distributes to tissues, and in particular, the
liver. Recoverable
14
C counts in the urine and feces indicate renal and biliary excretion are the major
routes of elimination. Further studies are warranted to investigate the kinetics of tissue
distribution/elimination to identify the sources of nonlinearity. Lastly, repeat administrations of
intravenous RTD-1 were well tolerated in rats and cynomolgus monkeys up to 10 mg/kg/day and 15
mg/kg/day, respectively, without any evidence of toxicity. The HED required to provide efficacy is well
below the HED established based on NOAEL in cynomolgus monkey. Therefore, these results support
the clinical investigation of RTD-1 for treatment of COVID-19. The PK and safety of intravenous RTD-1
are being evaluated in a phase I/II clinical trial with patients hospitalized with COVID-19 related
pneumonia (ClinicalTrials.gov Identifier: NCT04708236).

87

Chapter 4. Tissue distribution kinetics, spatial distribution profiles, and the effect of
RTD-1 in the liver
Introduction
Previous investigations on plasma PK of RTD-1 in preclinical species revealed a large volume of
distribution and a prolonged terminal elimination, which may be indicative of extensive tissue distribution
followed by slow re-distribution through tissues acting as the peptide reservoirs. In line with this idea,
preliminary biodistribution studies in female rats revealed widespread distribution to multiple tissues,
particularly the liver. Furthermore, evidence of nonlinear PK in rats and cynomolgus monkeys was
observed in single ascending dose studies. However, dose-dependent, and time-dependent changes in
RTD-1 exposures in tissues have not yet been investigated. Based on these knowledge, we performed
tissue PK studies in in male Sprague Dawley rats to investigate the extent to which RTD-1 distributes to
the tissues and to assess the potential cause of nonlinearity. Additional experiment was undertaken to
provide data on specific distribution of RTD-1 within the rat liver.

Factors that influence the rate and extent of tissue distribution of therapeutic peptides and proteins consist
of size (i.e. hydrodynamic radius), molecular weight, charge, lipophilicity, degree of protein and tissue
binding, and mechanism(s) of tissue transport (201). In general, the extravascular distribution of
therapeutic peptides and proteins is limited by their size and physicochemical properties. Therefore,
macromolecules distribute into interstitial space mainly via convection rather than diffusion. As a result,
most peptides and proteins are confined to the vascular space and have a small volume of distribution,
although exceptions do exist (151). In general, drugs can distribute to tissues through one or more of the
following mechanisms: passive diffusion, paracellular transport, fluid-phase pinocytosis, receptor-
mediated endocytosis, or transporter-mediated uptake (151). Small, lipophilic peptides can be transported
via simple passive diffusion, while larger peptides generally depend on carrier-mediated transport.
88

The liver is also the major organ responsible for the metabolism of lipids, carbohydrates, and protein, as
well as xenobiotics. Most clinically relevant drug-metabolizing enzymes (DME) in the liver include
cytochrome P450 (CYP)1A2, CYP2B6, CYP2C9, CYP2C19, CYP2D6, and CYP3A4. Among them,
CYP3A4 is the most abundant enzyme and metabolizes more than 50% of the commercially marketed
drugs (202). Because the CYP3A4 activity is inducible and/or inhibitable, determining the effect of RTD-
1 on CYP3A4 activity is important to assess the risk of potential drug-drug interactions (DDI). A number
of FDA-approved drugs are known to induce CYP3A4 activity, including rifampin, phenytoin, and
ritonavir. Administration of drug in the presence of CYP3A4 inducer may result in suboptimal plasma
concentration of the drug and/or higher levels of toxic metabolites. Potent inhibitors of CYP3A4 include
ketoconazole, itraconazole, erythromycin, ritonavir, and verapamil.

In this chapter, I investigated the tissue distribution kinetics with single ascending dose administration of
RTD-1, as well as the temporal and spatial distribution within the liver in vivo. The blood-to-plasma ratio
and plasma protein binding of RTD-1 were determined to better understand the distribution characteristics
of RTD-1. Once the liver was identified as the primary organ of RTD-1 accumulation, hepato-
cytotoxicity, the role of the passive permeability in the tissue uptake, and CYP3A4-mediated DDI
potentials of RTD-1 were evaluated in vitro.

Method and Materials
Chemicals and reagents
Atorvastatin, metoprolol, and ketoconazole were purchased from Cayman Chemical (Ann Arbor, MI).
Methazolamide, dexamethasone, rifampin, rifamycin SV, dimethyl sulfoxide (DMSO), hydrocortisone
hemisuccinate, and insulin were purchased from Sigma-Aldrich (St. Louis, MO). Williams’ Medium E
89

and GlutaMAX
TM
were purchased from Gibco. For hepatic uptake experiments, Krebs-Henseleit buffer
(KHB; Sigma-Aldrich) was prepared according to the manufacturer’s instructions. Heat inactivated fetal
bovine serum (FBS) was purchased from GenClone (San Diego, CA).

Cell culture
HepaRG cells, an immortalized human hepatic cell line, were purchased from Biopredic International
(Rennes, France) and maintained in growth medium consisting of Williams’ medium E supplemented
with 2 mM GlutaMAX
TM
, 50 μM hydrocortisone hemisuccinate, 5 μg/mL insulin and 10% (vol/vol) FBS.
The cells were grown at 37°C, 5%, CO 2, in a humified incubator and the growth media was renewed
every 2-3 days. After two weeks of culture, the HepaRG cells were cultured in growth media with 2%
DMSO for two additional weeks to promote differentiation. All experiments were performed in growth
media that contained Williams’ medium E without phenol red and 1% FBS.

A pilot single dose escalation study to evaluate the tissue distribution kinetics of RTD-1 in rats
All animal care and experimental procedures were approved by the University of Southern California
Institutional Animal Care and Use Committee (IACUC) (protocol# 21271). The stock solution of RTD-1
was prepared in 0.9% Sodium Chloride for injection, USP (Hospira, Lake Forest, IL). Adult male dual
jugular catheterized Sprague-Dawley rats (n=5/group), weighing 316 to 350 g, were purchased from
Charles River Laboratory (Hollister, CA). Rats were given a single dose of 5 mg/kg of RTD-1 via 20-min
i.v. infusion in the left jugular vein catheter (JVC) using an automated pump (New Era Pump Systems
Inc.) (Table 13). Each rat was assigned to a specific blood and tissue sampling schedule, with up to 5
blood samplings per rat. Serial blood samples were collected from the right JVC in EDTA K2-tubes (Sai
infusion technologies) at 0 (pre-dose), 0.083, 0.5, 1, 2, 4, 6, 8, 24, and 48 h relative to the end of infusion.
The blood samples were immediately centrifuged at 2,700 x g for 10 min at 4°C to separate the plasma.
90

Plasma samples were then stored at -80°C until analysis. Rats were sacrificed at various timepoints up to
48 h post infusion (t=0.5, 1, 4, 24 or 48 h post-infusion), and major organs and tissues, including the liver,
kidneys, lung, spleen, and heart, were harvested. Tissues were immediately rinsed in ice-cold saline
solution, blot dry, and weighed. Approximately 250 mg of each tissue (right kidney and left anterior lobe
of the liver) was transferred to a siliconized microcentrifuge tube containing 0.15, 0.5 and 2.0 mm of
zirconium oxide beads (Next Advance) and homogenized in a solution containing 80% acetonitrile and
5% acetic acid in saline (250 μL) using Qiagen TissueLyser II. The tissue lysates were then centrifuged at
15,000 x g for 10 min at 4°C, and the supernatant was stored at -80°C until analysis. The rest of the tissue
samples were immediately flash-frozen in a liquid nitrogen bath and stored at -80°C. Both plasma and
tissue samples were quantified by liquid chromatography-tandem mass spectrometry (LC-MS-MS).

An additional tissue PK study was undertaken with rats to examine the dose-dependent changes in tissue
distribution of RTD-1. In this study, stock solution of RTD-1 was prepared in 25% water for injection
(wfi) and 20 mM NaOAc, and the working solutions were further prepared in 0.9% Sodium Chloride for
injection, USP (Hospira, Lake Forest, IL). Adult male dual jugular catheterized Sprague-Dawley rats
(n=4-5/group), weighing 341 to 395 g, were purchased from Charles River Laboratory (Hollister, CA).
Rats were given a single dose of 1 or 10 mg/kg of RTD-1 via 20-min i.v. infusion in the left jugular vein
catheter (JVC) using an automated pump (New Era Pump Systems Inc.) (Table 13). Each rat was assigned
to a specific blood and tissue sampling schedule, with up to 5 blood samplings per rat. Serial blood
samples were collected from the right JVC in EDTA K2-tubes (Sai infusion technologies) at 0 (pre-dose),
0.083, 0.5, 1, 2, 4, 6, 8, 24, 48, and 72 h relative to the end of infusion. The blood samples were
immediately centrifuged at 2,700 x g for 10 min at 4°C to separate the plasma. Plasma samples were then
stored at -80°C until analysis. Rats were sacrificed at various timepoints up to 72 h post infusion (t=0.5, 4,
24, 48, or 72 h post-infusion), and major organs and tissues, including the liver, kidneys, lung, spleen, and
heart, were harvested, and processed in a similar manner as the previous pilot tissue PK study
91

Table 13. Study design of the tissue PK studies in male Sprague Dawley rats
Dose
level
(mg/kg)
Regimen
Infusion
duration
(min)
Dose
volume
(mL/kg)
Dose
concentration
(mg/mL)
Blood sampling
schedule
Tissue sampling
schedule
1 SD 20±2 10 0.1
0, 0.083, 0.5, 1, 2,
4, 6, 8, 24, 48 h
0.5, 4, 24, 48 h
5 SD 20±2 10 0.5
0, 0.083, 0.5, 1, 2,
4, 6, 8, 24, 48 h
0.5, 1, 4, 24, 48 h
10 SD 20±2 10 1.0
0, 0.083, 0.5, 1, 2,
4, 6, 8, 24, 48, 72 h
0.5, 4, 24, 48, 72
h

Plasma and tissue pharmacokinetic analysis
The drug amount (ng/g) in each tissue was determined by multiplying the dilution factors to the drug
concentration (ng/mL), then dividing by the gram of tissue per milliliter (mL) of homogenizing solvent.
The peak concentration (C max) and the time to peak concentration (T max) in plasma and tissues were
obtained directly from the concentration-time data. Data below the lower limit of the quantification
(plasma: 10 ng/mL, tissues: 20 ng/mL) were excluded from the analysis. Non-compartmental analysis
(NCA) of plasma and tissue PK data were performed using Phoenix® WinNonlin (version 8.3.1, Certara
USA, Inc.; Princeton NJ) with sparse sampling option and AUC last and AUC 0-∞ were calculated using
linear up log down method. The terminal rate constant was determined using up to last 3 data points. The
ratios of exposures in the tissue and plasma were determined using the dividing the AUC 0-∞ in the tissue
over the AUC 0-∞ in the plasma.

Spatial distribution of intravenous RTD-1 within rat livers
Adult male dual jugular catheterized Sprague-Dawley rats (n=6), weighing 313 to 359 g, were purchased
from Charles River Laboratory (Hollister, CA). In this study, RTD-1 was administered intravenously at 5
mg/kg as a 20-min i.v. infusion to the left JVC. At pre-determined time points (t=0 [pre-dose], 0.083, 0.5,
1, 2, 4, 6, 24 h post end of infusion), blood was collected from the right JVC to examine the plasma
concentration-time profile. Liver and lung tissues were collected at 0.5, 6, and 24 h (n=2/timepoint) after
92

the end of infusion for MALDI imaging. At each timepoint, the liver was rinsed in ice-cold saline, blot
dry, weighed, and dissected into five segments: caudate, right posterior, right anterior, median, and left
anterior lobes. Each segment was snap-frozen using liquid nitrogen.

MALDI imaging of the rat liver
Left anterior portion of each rat liver was sectioned at 12 µm thickness (-21°C) using a Leica Biosystems
Cryostat and thawed on a pre-cooled ITO-coated slide. Slides were immediately stored at -80°C for
further processing. On the day of experiment, slides were taken out of -80 °C and thawed at room
temperature under a chemical fume hood. Sections were washed twice in 70% EtOH each time for 120
sec, followed by washing with 100% EtOH for 120 sec to remove lipids and salts that would interfere
with detection of RTD-1. After complete dryness, sections were scanned using a Reflecta MF5000
scanner. Sections were coated with 2,5 dihydroxybenzoic acid (2,5-DHB) as MALDI matrix at 15mg/ml
in 70% ACN containing 10% acetic acid. DHB was sprayed on tissue sections using a HTX M5 sprayer
operating under following conditions: flow rate = 125 µl/min; velocity = 1000 mm/min; track spacing = 2
mm; pattern = HH; drying time = 3 sec; nozzle height = 40 mm; N 2 flow rate = 3 l/min. After spraying,
sections were imaged using rapifleX Tissuetyper MALDI-TOF-TOF mass spectrometer at 50 µm spatial
resolution and RTD-1 was detected at m/z = 2081.78 using a Linear detector. Resulting images were
processed and analyzed using SCiLS Lab software.

EScalate equilibrium shift assay
The plasma protein binding of RTD-1 was determined in pooled mixed gender plasma from rats using the
EScalate equilibrium shift assay. The details of the EScalate assay are described elsewhere (203). Briefly,
the shift in the binding equilibrium of RTD-1 to human serum albumin (HSA)-coated beads was
93

determined in the presence of increasing rat plasma concentrations. The samples were then quantified by
LC-MS.

Blood-to-plasma ratio assay
Fresh blood from a male donor was collected into EDTA K2 blood collection tubes (BD). Methazolamide
(MTZ) was used as a positive control. 500 μL of fresh, whole blood was transferred to 24 well plate and
known concentrations of RTD-1 (final concentration, 1 and 5 μg/mL) or a positive control (final
concentration, 500 nM) were spiked into the whole blood. In parallel, equivalent volumes of plasma and
red blood cells (RBCs) derived from the same donor were treated the same way as the whole blood and
used as references (204). Samples were then mixed and incubated at 37°C for 1 h. Longer incubation time
has previously been shown to cause hemolysis. At the end of incubation, whole blood samples from each
treatment group were transferred to a 1.5 mL microcentrifuge tube and centrifuged at 2,500 rpm for 10
min to separate the plasma and RBCs. Approximately 150 μL of plasma fraction was carefully transferred
to a new microcentrifuge tube and stored at -80°C until analysis. Approximately 150 μL of RBC fraction
was transferred to a new microcentrifuge tube and lysed through five freeze-thaw cycles. The reference
RBCs were also lysed in the same manner. The samples were then analyzed by LC/MS. The blood-to-
plasma ratio ( 𝑘 𝑏 / 𝑝 ) was determined using the equation (205):
𝑘 𝑏 / 𝑝 = ( 𝑘 𝑒 𝑝 ⁄
∙ Hct ) + ( 1 − Hct ),
where 𝑘 𝑒 𝑝 ⁄
is RBC-to-plasma partition coefficient and Hct is hematocrit, which was derived from the
literature value (0.43-0.48).
𝑘 𝑒 𝑝 ⁄
=
(
𝐼 𝑅 𝐵 𝐶 𝐼 𝑅 𝐵 𝐶 , 𝑟 𝑒𝑓 )
(
𝐼 𝑝𝑙 𝑎 𝑠 𝑚 𝑎 𝐼 𝑝𝑙 𝑎 𝑠 𝑚 𝑎 , 𝑟 𝑒𝑓 )
,
94

where 𝐼 𝑅𝐵 𝐶 is the LC-MS/MS response for the RBC fraction, 𝐼 𝑅𝐵 𝐶 , 𝑟 𝑒 𝑓 is the LC-MS/MS response for the
reference RBC, 𝐼 𝑝𝑙 𝑎 𝑠 𝑚 𝑎 is LC-MS/MS response for the plasma fraction, and 𝐼 𝑝𝑙 𝑎𝑠 𝑚 𝑎 , 𝑟 𝑒 𝑓 is the LC-
MS/MS response for the reference plasma.

Cell viability assay
The HepaRG cells (0.072x10
6
cells/well) were seeded in 96-well plate 3 days prior to the experiment. On
the day of the experiment, cells were treated with vehicle only (water) or various concentrations of RTD-
1 (0.01-100 μg/mL) in growth media supplemented with 1% FBS and alamarBlue
TM
Cell Viability
Reagent (Invitrogen) for 2 h at 37°C. After 2 h of incubation, plate was removed from the incubator and
the absorbance was measured at 570 and 600 nm. Data was normalized to vehicle-treated control. All of
the subsequent in vitro experiments involving transporters and enzymes were performed with low serum
to minimize the protein bindin while maintaining cell viability (206).

CYP3A4 gene induction assay
Three days before the start of the experiment, HepaRG cells were seeded in a 24-well plate at a density of
0.48x10
6
cells/well. On the day of the experiment, HepaRG cells were treated with either rifampin (25
μM), dexamethasone (50 μM), or RTD-1 (0.01-1 µg/mL) and incubated for 48 h in growth media
supplemented with 1% FBS. Growth media containing the test compounds were replaced once at 24 h. At
the end of treatment, cells were lysed using the Lysis Buffer (Invitrogen, Carlsbad, CA) with 2-
mercaptoethanol (Sigma-Aldrich). Total RNA was extracted with PureLink RNA mink Kit (Invitrogen)
according to the manufacturer’s protocol. Subsequently, 1 μg of complementary DNA (cDNA) was
transcribed using iScript
TM
cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) and quantitative
real-time PCR was performed using SsoAdvanced Universal SYBR Green Supermix (BioRad) and the
CFX96
TM
Real-Time PCR Detection System (Bio-Rad). All primers were purchased from Sigma-Aldrich
95

(St. Louis, MO), and the primer pair sequences for CYP3A4 and GAPDH are as follows: CYP3A4, 5’-
AGTCTTTCCATTCCTCATCC-3’ (forward) and 5’-TGCTTTTGTGTATCTTCGAG-3’ (reverse) and
GAPDH, 5’-TCGGAGTCAACGGATTTG-3’ (forward) and 5’-CAACAATATCCACTTTACCAGAG-
3’ (reverse). Data were normalized to the reference gene (GAPDH) and no treatment (NT) group.

In vitro CYP450 induction and inhibition assays
To examine the CYP3A4 inducibility of RTD-1, CYP3A4 activity was measured using the Promega
TM

P450-Glo CYP3A4 assay (product# V9001) (207). The assay was performed according to the
manufacturer’s instructions. In brief, the HepaRG cells were seeded in a 96 well plate at a density of
0.072x10
6
cells/well 96 h prior to the experiment. On the day of the experiment, HepaRG cells were pre-
treated with either rifampin (25 μM), dexamethasone (50 µM), or varying concentrations of RTD-1 (0.01-
10 µg/mL), for 48 h. Additional wells were treated with vehicle only (DMSO or cell culture-grade water).
Growth media containing the test compounds were replaced once at 24 h. After 48 h of incubation,
culture media was replaced with a fresh medium containing 3 μM of Luciferin-IPA and incubated for an
additional 1 h at 37°C. At the end of incubation, 25 μL of culture medium was transferred to a 96-well
plate opaque white luminometer plate, and 25 μL of Luciferin Detection Reagent was added to initiate a
luminescent reaction. After 20 min of incubation at room temperature (RT), luminescence was measured
using a luminometer (Synergy
TM
HTX Multi-Mode Microplate Reader), with an integration time of 1 sec
per well. The reaction was performed in duplicates and results are presented as a percentage relative to the
vehicle-treated control.

To examine the CYP3A4 inhibition potential of RTD-1, the same assay was performed with minor
modifications. Briefly, HepaRG cells were seeded in a 96 well plate at a density of 0.072x10
6
cells/well
96 h prior to the experiment. On the day of the experiment, cells were incubated at 37°C in culture media
96

containing 1 μM Luciferin-IPA and varying concentrations of RTD-1 or ketoconazole (4 μg/mL), which
was used as a positive control, for 2 h. After incubation, 25 μL of culture medium was transferred to a 96-
well plate opaque white luminometer plate, and 25 μL of Luciferin Detection Reagent was added to
initiate a luminescent reaction. After 20 min at RT, luminescence was measured using a luminometer
(Synergy
TM
HTX Multi-Mode Microplate Reader), with an integration time of 1 sec per well. The results
are presented as a percentage relative to vehicle-treated control.

Bioanalytical method
100 µL of each plasma sample was transferred to separate siliconized 1.5 mL microcentrifuge tubes,
along with 5 µL of IS (1 µg/mL MTDA) and 500 µL of 5% acetic acid. The solutions were vortexed and
loaded onto separate Phenomenex® 30 mg/1 mL Strata-X Pro SPE columns which had been pre-
conditioned with 1 mL of acetonitrile and 1 mL of 5% acetic acid. The samples were washed with two
600 µL-portions of 5% methanol, 1% acetic acid solution and then eluted with 500 µL of 80%
acetonitrile, 5% acetic acid. The solvent was evaporated using a speed-vac, the residue was reconstituted
with 100 µL of 40% acetonitrile/10% acetic acid, vortexed and centrifuged. 80 µL of the supernatants
were transferred to separate HPLC vials with inserts and analyzed using the SCIEX® 6500+. The plasma
calibration curve was prepared similarly. Stock solutions of RTD-1 were prepared at concentrations of
200,000, 100,000, 20,000, 10,000, 2000, 1000, 200 and 80 ng/mL. 5 µL of stock solution was added to a
1.5 mL siliconized microcentrifuge tube along with 5 µL of IS, 90 µL of blank plasma and 500 µL of 5%
acetic acid. A blank was also prepared with 90 µL of blank plasma, 5 µL of IS, 5 µL 0.01% acetic acid (to
match the std matrix) and 500 µL of 5% acetic acid. Extraction, evaporation, reconstitution and analysis
were performed as above. Final working standard concentrations were 20x dilutions of stock solutions
(10,000, 5000, 1000, 500, 100, 50, 10 and 4 ng/mL, respectively).

97

Blank homogenates of each tissue type (liver, lung, spleen, heart, and kidney) in 80% acetonitrile were
received. 1.2 mL of 80% acetonitrile were added to each homogenate to create enough volume for the
calibration curves. Homogenates were vortexed and sonicated to dissolve and then centrifuged.
Supernatants of each tissue type were transferred to separate siliconized microcentrifuge tubes. Using
stock solutions of the same RTD-1 concentration as for the blood plasma calibration, working standard
solutions were prepared by diluting 5 µL of the respective stock, 5 µL of IS and 85 µL of tissue
supernatant. A blank was also prepared by diluting 5 µL of IS and 5 µL 0.01% acetic acid with 90 µL of
tissue supernatant. Full sets of working standards (4 to 10,000 ng/mL) and blanks were prepared for each
tissue type. Solvent was evaporated with a speed-vac and residue reconstituted in 40% acetonitrile/10%
acetic acid, vortexed and centrifuged. 80 µL of supernatants of each standard and blank were taken for
analysis using the SCIEX® 6500+. The samples (four of each tissue type) were spiked with 5 µL IS,
placed in the speed-vac to evaporate any remaining solvent, reconstituted in 40% acetonitrile/10% acetic
acid, vortexed and centrifuged. Supernatant was carefully removed from samples and analyzed as above.

Statistical analysis
Statistical analysis was performed using GraphPad Prism version 9.1.2 (GraphPad Software, Inc., San
Diego, CA). One-way ANOVA or student t-test was performed where applicable. P-values less than 0.05
were considered significant.
Results
RTD-1 rapidly and extensively distributes to tissues
In the present study, tissue distribution kinetics of RTD-1 following a single dose administration of RTD-
1 was investigated in male Sprague Dawley rats. The mean concentration-time profile in plasma and
tissues are presented in Figure 19 and the plasma and tissue PK parameters are summarized in Table 14.
98

The plasma C max occurred at 5 min after the end of infusion, and the levels declined rapidly thereafter.
Consistent with the previous investigations, the plasma levels of RTD-1 displayed a biexponential
decline, with the exception of the plasma concentration time profiles of RTD-1 in rats given 1 mg/kg
where plasma levels were quantifiable up 4 h. In line with the
14
C-RTD-1 biodistribution study in female
rats, RTD-1 was widely distributed in all the harvested tissues, with the highest level in the liver, spleen
and kidney at all doses examined. In contrast, limited distributions to the heart and lung were detected.
The C max in all the tissues were reached after 0.5 h post-infusion, which was the first tissue sampling time
point, except for the spleen (1 and 10 mg/kg) and heart (10 mg/kg). The total exposures of RTD-1 in the
liver were consistently higher than that in the plasma at all doses (1-10 mg/kg), indicating high liver
penetration. Relatively high RTD-1 concentrations in the liver were sustained throughout the study, with
all of the tissue samples quantifiable up to the end of the study period (48-72 h). RTD-1 concentrations in
the spleen and kidney were also above the lower limit of quantification throughout the entire study period,
while the levels in the lung and heart were below the LLOQ as early as 4 h post infusion in the lower
dosing group. At 10 mg/kg, all the tissues examined as well as the plasma were quantifiable up to 72 h
post infusion, with the most accumulation in the kidney and spleen.

99

Table 14. Non-compartmental analysis of intravenous RTD-1 in various tissues.
Samples
Group
(mg/kg)
C max
(ng/mL or
ng/g)
T max
*

(h)
T last
*

(h)
AUC last
(h⸱ng/mL or
h⸱ng/g)
AUC 0-∞
(h⸱ng/mL or
h⸱ng/g)
Exposure
ratio
Plasma
1 1,097 (643) 0.083 4 848.5 933
5
10,800
(1,500)
0.083 8 12,980 13,087
10
11,767
(3,967)
0.083 72 34,313 34,945
Liver
1 724 0.5 48 7,323 7,832 8.39
5 2,424 0.5 48 22,663 23,570 1.80
10 5,240 0.5 72 65,147 67,936 1.94
Spleen
1 344.8 4 48 6,976 7580 8.12
5 1,400 0.5 48 8,619 9,829 0.75
10 4,944 4 72 89,290 92,588 2.65
Kidney
1 427.2 0.5 48 6,452 10,487 11.24
5 1,400 0.5 48 4,180 5,601 0.43
10 12,960 0.5 72 72,856 79,119 2.26
Lung
1 208.8 0.5 4 622 2,285 2.45
5 476 0.5 4 1,129 1,366 0.10
10 2,392 0.5 72 29,247 33,813 0.97
Heart
1 79.9 0.5 0.5 173 991 1.06
5 247 0.5 24 1,167 1,742 0.13
10 1,040 4 72 16,951 17,581 0.50
*
Indicates time after end of infusion
Cmax, maximum observed concentration; Tmax, time of maximum observed concentration; Tlast, time of last quantifiable observed
concentration; AUClast, Area under the curve from the start of the infusion to the time of the last quantifiable concentration;
AUC0-∞, AUC from the start of the infusion extrapolated to infinity.
100

Figure 19. Observed concentration-time profiles in plasma and tissues in male rats after i.v.
infusion of RTD-1 at 1, 5 or 10 mg/kg.
Interestingly, concentration-time profiles in all of the tissues (kidney, spleen, lung, heart) except for the
liver were nearly superimposable at 1 and 5 mg/kg, indicating an absence of dose-dependent changes in
the total exposures, while the total exposures in each tissue at 10 mg/kg were significantly higher
compared to that in 1- and 5 mg/kg. Comparisons of the exposures in each tissue between 1 and 10 mg/kg
showed dose-proportional increases in the tissue exposures.

Spatial distribution of RTD-1 in male rat liver
The spatial analysis of RTD-1 within the liver over time was carried out using fresh frozen liver sections
from male rats given 5 mg/kg of intravenous RTD-1 (Fig. 20). In agreement with the tissue PK data, liver
distribution of RTD-1 was most prominent at 0.5 h post infusion in rats, as reflected by the highest ion
signal peak (Fig. 20D). At 0.5 h, RTD-1 appears to be mostly localized to the bile duct, which is shown
with the white arrows (Fig. 20A). The signal intensity for RTD-1 began to diminish at 6 h and were
101

nearly close to the baseline by 24 h. By 24 h, with most of the detectable signals were found what we
believe to be the blood vessels.

Figure 20. Spatial distribution of intravenous RTD-1 over time in male Sprague Dawley rats given
5 mg/kg. Distribution of RTD-1 in the left anterior lobe after A) 0.5 h, B) 6 h, and C) 24 h post infusion.
D) Changes in MALDI peak intensity over time.
RTD-1 does not partition into RBC
To find potential explanations for the large volume of distribution determined in various preclinical
species and to predict the likelihood of extensive tissue distribution, the extent to which RTD-1 partitions
or binds to RBC was investigated in fresh human blood. Methazolamide (MTZ) is a drug known to
extensively distribute to RBC and were used as positive controls. The observed blood-to-plasma ratio
(Kb/p) for MTZ was 29.7, which is in line with the reported value in the literature of 23.5 ± 3.02 (205).
The average Kb/p of 0.615 indicates that RTD-1 does not partition into RBCs and therefore remains in the
plasma. At two concentrations tested (1 and 5 μg/mL), blood-to-plasma ratios of RTD-1 were very similar
(0.59 and 0.64, respectively) (Table 15).

102

RTD-1 is highly bound to plasma protein
The plasma protein binding of RTD-1 in rat plasma was very high resulting in unbound fraction of 0.38%
(TQI 9.1), with intra-assay 95% CI of 0.003% (Table 15). The dissociation constant of the RTD-1-
albumin complex (K D
HSA
) was 5.70 x 10
-6
, indicating a moderate affinity to the rat serum albumin. The
apparent dissociation constant of compound-plasma protein complexes (K D
plasma
) was 2.27 x 10
-6
.

Table 15. Summary of physicochemical properties and blood binding of RTD-1
Physicochemical
properties
Estimates
Molecular weight (g/mol) 2,082.7
Kb/p 0.615
Fraction unbound in plasma 0.038
Hydrodynamic radius (nm)
*
0.9377
Isoelectric point
#
9.0
Net charge at pH 7.0
5
*
Hydrodynamic radius was estimated in Simcyp simulator v.19 based on the molecular weight
#
Isoelectric point was predicted based on the peptide sequence
Kb/p, blood-to-plasma ratio.
RTD-1 does not induce hepatocytotoxicity
Since in vivo studies revealed that the liver is the major site of accumulation and is involved in subsequent
excretion of RTD-1, we sought to investigate the direct effect of RTD-1 exposures in the liver. As fully
differentiated human hepatoma HepaRG cell lines are known to retain liver-specific metabolizing enzyme
functions and to reflect comparable cytotoxicity profiles to a similar extent as primary human
hepatocytes, this cell line was chosen for subsequent in vitro studies. First, cytotoxicity of RTD-1 in
HepaRG cells were determined in growth media containing low serum (1%). Previous in vitro studies in
fibroblasts demonstrated that RTD-1 did not cause cytotoxicity up to 100 µg/mL in media containing
0.4% FBS, as shown in Figure 21 (133). In line with this finding, our assays demonstrated that the
viability of HepaRG remained high up to the highest concentration tested of 100 µg/mL of RTD-1, with
103

average cell viability of ≥90% at 2 h of treatment, indicating that RTD-1 likely will not cause
hepatotoxicity or liver injury.
Figure 21. Cytotoxicity of RTD-1 in HepaRG cells after 2 h treatment in growth media containing
low serum (1% FBS). The values are normalized to untreated cells and expressed as means ± SD.

CYP3A4 induction and inhibition screening
To evaluate the potential ability of RTD-1 to induce CYP3A4 enzyme activity, the gene expression
changes in response to RTD-1 treatment in the HepaRG cells was examined first. As expected, 48 h
treatment with 25 µM rifampin, a potent inducer of CYP3A4, led to approximately 63.6-fold induction
(p<0.0001) in CYP3A4 mRNA expression, while 50 µM dexamethasone, a weak CYP3A4 inducer,
resulted in 13.1-fold induction (p<0.0051) (Fig. 22A). In contrast, RTD-1 treatment did not induce the
mRNA expression of CYP3A4 at any concentration tested (0.01-0 µg/mL). To confirm this finding at the
enzymatic level, the CYP3A4 activity in HepaRG cells was examined using the P450-Glo system. While
48 h treatment with rifampin and dexamethasone induced CYP3A4 enzymatic activity by approximately
10-fold (p<0.096) and 1.8-fold, respectively, RTD-1 treatment did not affect the CYP3A4 enzymatic
activity (Fig. 22B). Since the mechanism involved in CYP inhibition is independent of the induction
mechanism, the effect of RTD-1 on CYP3A4 inhibition potential was also examined. Treatment of RTD-
1 did not inhibit CYP3A4 activity, whereas 4 µg/mL ketoconazole led to approximately 99% inhibition
(p<0.0001) of CYP3A4 activity in HepaRG cells (Fig. 22C).
104

Figure 22. Screening of CYP3A4 Induction and inhibition potential of RTD-1 in HepaRG cells. (A)
CYP3A4 gene fold induction, (B) induction potential of YP3A4 enzyme activity normalized to vehicle
control (DMSO or water) (C) inhibition potential of CYP3A4 enzyme activity. Data represents mean ±
SD. Treatment effect relative to NT for gene induction assay or positive control (RIF for induction assay,
KCZ for inhibition assay) by one-way ANOVA with the Bonferroni’s multiple comparisons test. (**)
p<0.01, (****) p<0. 0001.
NT, no treatment; Veh, vehicle-treated control; RIF, rifampin; DEX, dexamethasone; KCZ, ketoconazole.
Discussion
In this chapter, I sought to characterize the tissue distribution kinetics and spatial distribution of RTD-1 in
male Sprague Dawley rats, to determine important physicochemical properties necessary for
understanding the distribution patterns of RTD-1, and to assess the potential effect of RTD-1 on human
hepatocytic cell line and CYP3A4 enzyme activities. The large volume of distribution estimated from
preclinical species in previous PK studies and widespread distribution of
14
C-RTD-1 in rats, especially in
the liver, helped to guide the current investigation of tissue distribution kinetic study in male Sprague-
Dawley rats. Although the initial plasma C max was higher in the plasma when compared with other tissue
concentrations, the plasma concentrations declined quickly at 1 and 5 mg/kg, while the tissue levels were
sustained as long as 48 h. At the highest dose tested (10 mg/kg), both plasma and tissue levels were
measurable up to 72 h post infusion, suggesting a prolonged terminal elimination in both the tissues and
plasma. The plasma AUC 0-∞ at 5 mg/kg were significantly lower in our tissue PK study when compared to
that in the GLP study. Perhaps the reason for this discrepancy could be due to the differences in the
formulation of the intravenous RTD-1 in this dosing group, which used saline, and a small number of
105

animals used. RTD-1 was present at the highest level in most of the tissues examined as early as 30 min
post-infusion, indicating a rapid tissue penetration, particularly in the liver and kidney. Across all doses
examined, the liver, kidney, and spleen exhibited the highest RTD-1 exposures while the heart and lung
consistently exhibited the least distribution. Considerable differences in tissue PK profile were observed
between the initial tissue PK study (5 mg/kg) and subsequent tissue PK study involving 1- and 10 mg/kg
dosing groups. In general, the ratios of tissue exposures to that in the plasma were greater in rats
administered 1 and 10 mg/kg, when compared to that in 5 mg/kg. One difference between the two studies
is that in the initial pilot tissue PK study, RTD-1 was reconstituted in saline while in the subsequent tissue
PK study (1- and 10 mg/kg), the formulation of the RTD-1 was updated to saline containing 20 mM
NaOAc. This signifies that the formulation differences could account for the pharmacokinetic differences.
Previously, subcutaneous administration of RTD-1 prepared in a solution containing NaOAc in a rat
model of rheumatoid arthritis resulted in greater therapeutic efficacy (data not shown). Therefore, one
possible explanation for the differences in the extent of tissue penetration is that the addition of sodium
acetate may alter the proportions of ionized and unionized fractions in vivo, which can affect the
permeability of RTD-1. Additional studies are warranted to examine the specific effect of sodium acetate
on the tissue distribution patterns of RTD-1.

Between 1- and 10 mg/kg, the tissue exposures increased dose proportionally, as evidenced by an average
of a 12-fold increase in tissue exposures at 10 mg/kg when compared to that at 1 mg/kg. These relatively
dose proportional increases in tissue exposure indicate that the tissue distribution most likely does not
explain the nonlinearity observed in prior studies. This could partially explain the lack of improvement in
fitting the PK data from cynomolgus monkeys to the 2-compartmental model with saturable distribution
when compared with the model with first-order distribution. Previous rat GLP study demonstrated that the
nonlinearity is most evident at 20 mg/kg. However, mortality and significant treatment-related adverse
events that occurred at this dosing level precluded the investigation of tissue distribution at this dosing
106

level. This also indicates that the nonlinearity may be only observed at the toxicokinetic study setting
which uses doses that are much higher than the doses considered therapeutically relevant. Hence,
nonlinearity most likely will not be observed in the clinical setting. However, tissue distribution kinetics
at steady state may need to be examined to definitively determine the dose proportionality of tissue
distribution.

From the overall patterns of tissue distribution (i.e. extensive distribution and retentions of RTD-1 in
highly vascularized organs [i.e. liver, kidney, and spleen]), we postulate that RTD-1 likely passes through
the bloodstream and nonspecifically binds to tissues that it comes into contact with. The first pass effect
would explain the high exposures of RTD-1 in the liver. At higher doses (10 mg/kg), nonspecific binding
to liver tissue may be saturated, leading to the increases in available RTD-1 in the plasma to be cleared by
the renal system. Based on the extensive distribution to the liver, we then sought to visualize the spatial
distribution of RTD-1 within the liver as a function of time via MALDI-TOF-MS imaging. At 0.5 h post
infusion, most of the peptide were detected near the bile duct, which in line with the recovery of
14
C-
RTD-1 in feces in the rat biodistribution study. The signal intensity diminished over time and most of
RTD-1 was localized to what appears to be the blood vessels.

The extent to which a drug distributes to extravascular space or tissues is partially dependent upon the
degree of binding to plasma proteins and tissues, as well as the RBCs. Exploring the interactions of the
RTD-1 with these blood constituents as well as the tissues allow a better understanding of the whole-body
PK of RTD-1. Specifically, the blood-to-plasma ratio (Kb/p) measures the extent to which RTD-1
partitions or binds to red blood cells (RBC), as RBCs serve as a potential compartment in the blood where
drug can distribute to and often used as a surrogate to predict the degree of tissue distribution.
Additionally, plasma may not be an appropriate matrix to measure drug concentrations for drugs that
107

significantly partitions into or sequestered in RBC (i.e. cyclosporin A, methazolamide, chlorthalidone) as
it can misleadingly overestimate the drug clearance. Furthermore, nonlinear RBC partitioning is a
potential source of nonlinearity due to saturable binding sites on RBCs. For these reasons, we investigated
the extent to which RTD-1 partitions or binds to RBC, to determine whether the large volume of
distribution could in part be due to partitioning to the blood compartment. Our result demonstrated that
RTD-1 did not bind or partition into RBCs up to 5 µg/mL (Kb/p=0.61), which was the highest
concentration tested in our assay and most likely higher than the clinically relevant concentrations.
Considering the large volume of distribution and extensive tissue distribution in vivo, lack of RBC
distribution of RTD-1 implies that a tissue-specific mechanism may be involved in the uptake of RTD-1.

According to the “Free Drug Principle”, only the unbound fraction of the drug is available to act on its
pharmacological target(s), which include uptake transporters and metabolizing enzymes. In general,
plasma protein binding involves drugs reversibly (and often nonspecifically) binding to proteins such as
albumin, α-1-glycoproteins (AAG), or lipoprotein, present in plasma (208). Drugs with high degree of
protein binding may exhibit longer half-life but have limited tissue distribution due to the drug-plasma
protein complex acting as a “reservoir”. In this study, RTD-1 was found to be extensively bound to
plasma proteins (99.62%), with affinity for human albumin in the lower micromolar range (5.70 x 10
-6
),
suggesting that the high degree of plasma protein binding of RTD-1 is likely attributable to albumin
binding. Extensive binding to plasma constituents may be partially responsible for the prolonged plasma
levels of RTD-1 but does not explain the extensive tissue distribution observed in vivo. Pharmacokinetics
and safety of RTD-1 in patients with hypoalbuminemia or other liver disease may need to be investigated
to assess the impact of altered plasma protein binding.

108

The net charge of the therapeutic peptides is another important determinant of the drug biodistribution.
Unlike other larger biologics, peptides, specifically HDP, have relatively high permeability owing to the
small size and amphipathic structure, which contains a hydrophobic core. Particularly, cationic peptides
have higher propensity for cellular membrane due to the abundance of negatively charged phospholipids
on the cellular membrane at physiological pH (209, 210). The isoelectric point of 9.0 calculated based on
the peptide sequence indicates that RTD-1 has a net positive charge at physiological pH. Once the HDP
interacts with the cellular membrane via the electrostatic interaction, these peptides use their hydrophobic
core to permeate through the cellular membrane. In addition, cyclization of peptides have shown to
improve the membrane permeability (211, 212). Whereas distribution of most macromolecules is largely
restricted to the extracellular space due to poor membrane permeability (large size and hydrophilicity),
small, net positive charge, and amphipathic nature of most HDP likely increases the membrane
permeability. This is in line with previous in vitro studies where HDP have shown to engage with
intracellular targets in monocytes/macrophages (i.e. inhibition of NF-κB/MAPK signaling cascades),
implying these small peptides can readily permeate through mammalian membranes in addition to the
bacterial membranes (213). Therefore, these physicochemical properties of RTD-1 may partially explain
the high tissue penetrations of RTD-1 despite the extensive plasma protein binding and absence of RBC
distribution. Although we did not investigate the exact mechanism responsible for the uptake of RTD-1
into the hepatocytes, we postulate that the partitioning of RTD-1 is likely governed by a passive process.
For example, the cyclic peptide cyclosporin A has shown to permeate the membrane primarily through
passive diffusion (214). Therefore, the contribution of passive diffusion to the uptake of RTD-1 may need
to be further investigated.

As the liver is the principal organ of drug metabolism and elimination, drugs that induce hepatotoxicity or
liver injury could pose a significant problem in drug development. Based on the prolonged retention of
RTD-1 in the liver, we assessed the potential for RTD-1 to induce hepatocytotoxicity. High cellular
109

viability (≥ 90%) following treatment of RTD-1 up to 100 µg/mL in low serum condition, which is
significantly higher than the plasma concentrations that are considered clinically relevant, indicates that
RTD-1 is unlikely to cause liver injury in humans. This finding also in agreement with the lack of adverse
findings in the liver pathology or liver function panels in the GLP toxicity studies in rat and cynomolgus
monkey.

Another potential downstream consequence of prolonged and high exposure of RTD-1 in the liver is its
ability to influence the CYP enzyme activities. Previous microarray analysis on the lung homogenates and
bronchoalveolar lavage fluid (BALF) from chromic P. aeruginosa murine model demonstrated that RTD-
1 upregulated genes encoding CYP450 enzymes, including Cyp2F2 and Cyp2A5 in BALF cells, by 2.555-
fold and 2.148-fold, respectively; Cyp2E1 was upregulated 2.019-fold in lung tissue homogenates. RTD-1
also induced a 2.307-fold upregulation of the organic anion uptake transporter, SLCO2B1 (OATP2B1) in
BALF cell pellets (data not shown). This led to the investigation of the effect of RTD-1 on human CYP
enzymes, particularly CYP3A4, as it is the most prevalent CYP enzyme isoform in the liver. CYP3A4 is
subject to inhibition and/or induction by various xenobiotics as well as pathophysiological conditions.
Induction of CYP3A4 enzyme occurs through the activation of one of several nuclear receptors, including
the pregnane X receptor (PXR), constitutive androstane receptor (CAR), peroxisome-proliferator-
activated receptor (PPAR-α) and glucocorticoid receptor (GR) (215). CYP induction can cause increase in
clearance of the co-administered (“victim”) drugs leading to a reduction in therapeutic efficacy or
increased metabolism of prodrug that can inadvertently cause increased exposure to toxic metabolites.
Inhibitions of CYP450 enzymes can also increase total drug exposure as a result of reduced elimination.
RTD-1’s potential to influence CYP3A4 enzyme activity is particularly of interest as many patients
hospitalized for severe COVID-19 receive various medications for COVID-19 treatment as well as their
underlying medical conditions. Fortunately, RTD-1 had no effect on the CYP3A4 activity at both
110

transcriptional and enzymatic levels, indicating that the risk of CYP3A4-mediated DDI with RTD-1 is
low.

As both the urinary and biliary excretions were discovered to substantially contribute to the clearance of
the peptide, one avenue of future research is to quantify the urinary and biliary excretion over time.
Assessing the extent to which RTD-1 is eliminated by the two routes of elimination and the relative
contributions of these elimination pathways to the nonlinear PK would allow more comprehensive
understanding of the whole-body PK of RTD-1.

From a mechanistic perspective, another potential avenue of research is to examine the role of the active
transporters, both uptake and efflux transporters, in the elimination of RTD-1 through overexpressing cell
lines. Most transporters can be categorized into two major superfamilies: ATP-binding cassettes (ABC),
which are generally efflux transporters, and solute carrier (SLC) transporters, which consist of uptake
transporters. In the liver, organic anion transporting polypeptides (OATP), organic anion transporters, and
organic cation transporter (OCT) are most abundant in the basolateral membrane of human hepatocytes
and play a major role in the hepatic uptake (216). On the canalicular membrane, P-glycoprotein (P-gp),
breast cancer resistance protein (BCRP), and multidrug resistance protein 2 (MRP2) are the major efflux
transporters in charge of hepatobiliary excretion of most xenobiotics and metabolites. Transporter-
mediated hepatic uptake and efflux are both rate-limiting steps in the clearance of biliary-excreted drugs
and can lead to disproportionate increases in plasma drug concentration at higher doses due to the
saturable elimination. Therefore, identifying the possible contributions of OATP and OCT on the uptake
of RTD-1 into the liver as well as P-gp, BCRP and MRP2 in the biliary excretion of RTD-1 would
improve our understanding the mechanism(s) responsible for the nonlinearity.

111

Chapter 5. Summary & Future Directions
In conclusion, the major aims of the thesis were to investigate the therapeutic potentials of RTD-1 in
COVID-19 pneumonia and to better understand the plasma and multi-tissue pharmacokinetic profiles as
well as the safety profiles of RTD-1 in preclinical animals. In our studies, RTD-1 dose dependently
ameliorated the endotoxin-induced lung injury through the inhibition of neutrophil infiltrations to the
lungs, reductions in airway pro-inflammatory cytokines, and attenuating lung edema. The plasma
concentration time profiles of intravenous RTD-1 in several preclinical animals displayed a biphasic
decline, with prolonged terminal elimination and the PK analysis revealed a large volume of distribution
that is suggestive of wide tissue distribution. RTD-1 was well tolerated up to 10 mg/kg/day in Sprague
Dawley rats and 15 mg/kg/day in cynomolgus monkeys. Interspecies allometric scaling was utilized to
extrapolate the PK parameters from preclinical animals to humans. We determined that the HEDs of
approximately 0.36-0.83 mg/kg of RTD-1 are needed for an individual weighing 70 kg to achieve the
target AUC 0-∞ for therapeutic efficacy. These doses are considered safe based on the HEDs necessary to
achieve the AUCτ corresponding to the NOAEL in cynomolgus monkeys following repeat dosing, which
is 15.9 mg/kg, as it is approximately 19-45-fold higher than the HEDs required for efficacy. Furthermore,
single dose escalation studies in rats and cynomolgus monkeys revealed that RTD-1 follows nonlinear
PK, as evidenced by disproportionate increases in the AUC 0-∞ with increases in the dose and consequent
dose-dependent decreases in the systemic CL. Specifically, nonlinearity in PK was most evident at doses
greater than 5 mg/kg. Furthermore, the terminal half-life of RTD-1 based on the extended plasma
sampling of RTD-1 in cynomolgus monkeys given 15 mg/kg was revealed to be 47 h, which may be
indicative of slow redistribution of RTD-1 from the tissues to plasma. Subsequent investigation of tissue
distribution kinetics of RTD-1 in rats demonstrated that RTD-1 rapidly and extensively distributed to
peripheral tissues, with the highest exposure in the liver, kidney, and spleen. Taken together, these may
explain the biphasic plasma kinetic profiles observed in previous preclinical studies, where RTD-1
displayed an initial rapid distribution phase followed by a prolonged elimination phase. In male rats,
112

tissue exposures increased dose proportionally, indicating that tissue distribution likely is not responsible
for the nonlinearity. Spatial analysis of RTD-1 in the rat liver further revealed that the most accumulation
occurred near the bile ducts as early as 0.5 h post infusion. Despite the prolonged retention of RTD-1 in
the liver, RTD-1 did not induce hepatocytotoxicity or alter the CYP3A4 activity. Therefore, the key
findings highlighted in this thesis indicate intravenous RTD-1 may be a safe and potent
immunomodulating agent for COVID-19 treatment.

The complex pharmacokinetic behavior of RTD-1 necessitates a mechanistic, physiologically-based PK
(PBPK) modeling approach that is capable of accurately characterizing both the tissue and plasma
dispositions of RTD-1. Therefore, the physicochemical properties and pharmacokinetic parameters of
RTD-1 presented in this thesis will be used as a framework to develop a mechanistic PBPK model. The
PBPK modeling will enable more comprehensive understanding of the nonlinear pharmacokinetic
behavior of RTD-1 and will improve the prediction of human PK.

While simple allometry approach was utilized to provide insights into PK parameters in human, the
accuracy of this approach will need to be validated through a human clinical trial. The phase I/II clinical
trial is currently underway to characterize the PK and PD of intravenous RTD-1 in adults hospitalized
with COVID-19 pneumonia (Clinicaltrials.gov identifier NCT04708236). Thus, the data resulting from
this first in human study will confirm the predictions made using the preclinical animals and will further
guide the development of a PBPK model.

113

References
1. Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, Tong S, Urbani C, Comer
JA, Lim W. 2003. A novel coronavirus associated with severe acute respiratory syndrome. New
England journal of medicine 348:1953-1966.
2. Zhou P, Yang X-L, Wang X-G, Hu B, Zhang L, Zhang W, Si H-R, Zhu Y, Li B, Huang C-L.
2020. A pneumonia outbreak associated with a new coronavirus of probable bat origin. nature
579:270-273.
3. Kim D, Lee J-Y, Yang J-S, Kim JW, Kim VN, Chang H. 2020. The Architecture of SARS-CoV-2
Transcriptome. Cell 181:914-921.e10.
4. Klompas M, Baker MA, Rhee C. 2020. Airborne transmission of SARS-CoV-2: theoretical
considerations and available evidence. Jama.
5. Noorimotlagh Z, Jaafarzadeh N, Martínez SS, Mirzaee SA. 2021. A systematic review of possible
airborne transmission of the COVID-19 virus (SARS-CoV-2) in the indoor air environment.
Environ Res 193:110612.
6. Kumar M, Al Khodor S. 2020. Pathophysiology and treatment strategies for COVID-19. Journal
of Translational Medicine 18:353.
7. Yuki K, Fujiogi M, Koutsogiannaki S. 2020. COVID-19 pathophysiology: A review. Clinical
immunology:108427.
8. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, Herrler T, Erichsen S, Schiergens TS,
Herrler G, Wu N-H, Nitsche A. 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2
and is blocked by a clinically proven protease inhibitor. Cell.
9. Hoffmann M, Kleine-Weber H, Pöhlmann S. 2020. A multibasic cleavage site in the spike protein
of SARS-CoV-2 is essential for infection of human lung cells. Molecular Cell.
10. Walls AC, Park Y-J, Tortorici MA, Wall A, McGuire AT, Veesler D. 2020. Structure, Function,
and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell 181:281-292.e6.
11. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, Herrler T, Erichsen S, Schiergens TS,
Herrler G, Wu N-H, Nitsche A. 2020. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2
and is blocked by a clinically proven protease inhibitor. cell 181:271-280. e8.
12. Bestle D, Heindl MR, Limburg H, Pilgram O, Moulton H, Stein DA, Hardes K, Eickmann M,
Dolnik O, Rohde C. 2020. TMPRSS2 and furin are both essential for proteolytic activation of
SARS-CoV-2 in human airway cells. Life science alliance 3.
13. Peacock TP, Goldhill DH, Zhou J, Baillon L, Frise R, Swann OC, Kugathasan R, Penn R, Brown
JC, Sanchez-David RY. 2021. The furin cleavage site in the SARS-CoV-2 spike protein is
required for transmission in ferrets. Nature Microbiology:1-11.
14. Shulla A, Heald-Sargent T, Subramanya G, Zhao J, Perlman S, Gallagher T. 2011. A
transmembrane serine protease is linked to the severe acute respiratory syndrome coronavirus
receptor and activates virus entry. Journal of virology 85:873-882.
15. Wrapp D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, Abiona O, Graham BS, McLellan JS.
2020. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science
367:1260-1263.
16. Ortiz ME, Thurman A, Pezzulo AA, Leidinger MR, Klesney-Tait JA, Karp PH, Tan P, Wohlford-
Lenane C, McCray Jr PB, Meyerholz DK. 2020. Heterogeneous expression of the SARS-
Coronavirus-2 receptor ACE2 in the human respiratory tract. EBioMedicine 60:102976.
17. Jia HP, Look DC, Shi L, Hickey M, Pewe L, Netland J, Farzan M, Wohlford-Lenane C, Perlman
S, McCray PB, Jr. 2005. ACE2 receptor expression and severe acute respiratory syndrome
coronavirus infection depend on differentiation of human airway epithelia. J Virol 79:14614-21.
18. Zhang H, Penninger JM, Li Y, Zhong N, Slutsky AS. 2020. Angiotensin-converting enzyme 2
(ACE2) as a SARS-CoV-2 receptor: molecular mechanisms and potential therapeutic target.
Intensive Care Medicine 46:586-590.
114

19. Verdecchia P, Cavallini C, Spanevello A, Angeli F. 2020. The pivotal link between ACE2
deficiency and SARS-CoV-2 infection. Eur J Intern Med 76:14-20.
20. Grant RA, Morales-Nebreda L, Markov NS, Swaminathan S, Querrey M, Guzman ER, Abbott
DA, Donnelly HK, Donayre A, Goldberg IA. 2021. Circuits between infected macrophages and T
cells in SARS-CoV-2 pneumonia. Nature 590:635-641.
21. Carcaterra M, Caruso C. 2021. Alveolar epithelial cell type II as main target of SARS-CoV-2
virus and COVID-19 development via NF-Kb pathway deregulation: A physio-pathological
theory. Medical Hypotheses 146:110412.
22. Wiersinga WJ, Rhodes A, Cheng AC, Peacock SJ, Prescott HC. 2020. Pathophysiology,
Transmission, Diagnosis, and Treatment of Coronavirus Disease 2019 (COVID-19): A Review.
JAMA 324:782-793.
23. Mason RJ. 2020. Pathogenesis of COVID-19 from a cell biology perspective. Eur Respiratory
Soc.
24. Rendeiro AF, Ravichandran H, Bram Y, Chandar V, Kim J, Meydan C, Park J, Foox J, Hether T,
Warren S. 2021. The spatial landscape of lung pathology during COVID-19 progression. Nature
593:564-569.
25. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, Wang B, Xiang H, Cheng Z, Xiong Y, Zhao Y, Li
Y, Wang X, Peng Z. 2020. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel
Coronavirus–Infected Pneumonia in Wuhan, China. JAMA 323:1061-1069.
26. Johansson MA, Quandelacy TM, Kada S, Prasad PV, Steele M, Brooks JT, Slayton RB,
Biggerstaff M, Butler JC. 2021. SARS-CoV-2 transmission from people without COVID-19
symptoms. JAMA network open 4:e2035057-e2035057.
27. Sun X, Wang T, Cai D, Hu Z, Chen Ja, Liao H, Zhi L, Wei H, Zhang Z, Qiu Y, Wang J, Wang A.
2020. Cytokine storm intervention in the early stages of COVID-19 pneumonia. Cytokine &
Growth Factor Reviews 53:38-42.
28. Batah SS, Fabro AT. 2020. Pulmonary pathology of ARDS in COVID-19: A pathological review
for clinicians. Respiratory medicine:106239.
29. Leng L, Cao R, Ma J, Mou D, Zhu Y, Li W, Lv L, Gao D, Zhang S, Gong F. 2020. Pathological
features of COVID-19-associated lung injury: a preliminary proteomics report based on clinical
samples. Signal transduction and targeted therapy 5:1-9.
30. Shi Y, Wang Y, Shao C, Huang J, Gan J, Huang X, Bucci E, Piacentini M, Ippolito G, Melino G.
2020. COVID-19 infection: the perspectives on immune responses. Nature Publishing Group.
31. Wu Z, McGoogan JM. 2020. Characteristics of and important lessons from the coronavirus
disease 2019 (COVID-19) outbreak in China: summary of a report of 72 314 cases from the
Chinese Center for Disease Control and Prevention. Jama 323:1239-1242.
32. Azar MM, Shin JJ, Kang I, Landry M. 2020. Diagnosis of SARS-CoV-2 infection in the setting
of the cytokine release syndrome. Expert Review of Molecular Diagnostics 20:1087-1097.
33. Cao X. 2020. COVID-19: immunopathology and its implications for therapy. Nature reviews
immunology 20:269-270.
34. Wang J, Li Q, Yin Y, Zhang Y, Cao Y, Lin X, Huang L, Hoffmann D, Lu M, Qiu Y. 2020.
Excessive neutrophils and neutrophil extracellular traps in COVID-19. Frontiers in immunology
11:2063.
35. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, Zhang L, Fan G, Xu J, Gu X. 2020. Clinical
features of patients infected with 2019 novel coronavirus in Wuhan, China. The lancet 395:497-
506.
36. Feng Z, Yu Q, Yao S, Luo L, Zhou W, Mao X, Li J, Duan J, Yan Z, Yang M. 2020. Early
prediction of disease progression in COVID-19 pneumonia patients with chest CT and clinical
characteristics. Nature communications 11:1-9.
37. Kwee TC, Kwee RM. 2020. Chest CT in COVID-19: what the radiologist needs to know.
RadioGraphics 40:1848-1865.
115

38. O'Sullivan JM, Mc Gonagle D, Ward SE, Preston RJ, O'Donnell JS. 2020. Endothelial cells
orchestrate COVID-19 coagulopathy. The Lancet Haematology 7:e553-e555.
39. Baker SA, Kwok S, Berry GJ, Montine TJ. 2021. Angiotensin-converting enzyme 2 (ACE2)
expression increases with age in patients requiring mechanical ventilation. PloS one
16:e0247060.
40. Langford BJ, So M, Raybardhan S, Leung V, Westwood D, MacFadden DR, Soucy J-PR,
Daneman N. 2020. Bacterial co-infection and secondary infection in patients with COVID-19: a
living rapid review and meta-analysis. Clinical Microbiology and Infection.
41. Shafran N, Shafran I, Ben-Zvi H, Sofer S, Sheena L, Krause I, Shlomai A, Goldberg E, Sklan EH.
2021. Secondary bacterial infection in COVID-19 patients is a stronger predictor for death
compared to influenza patients. Scientific reports 11:1-8.
42. Vaira LA, Salzano G, Deiana G, De Riu G. 2020. Anosmia and ageusia: common findings in
COVID‐19 patients. The Laryngoscope 130:1787-1787.
43. Ramos-Casals M, Brito-Zerón P, Mariette X. 2021. Systemic and organ-specific immune-related
manifestations of COVID-19. Nature Reviews Rheumatology 17:315-332.
44. Kiss S, Gede N, Hegyi P, Németh D, Földi M, Dembrovszky F, Nagy B, Juhász MF, Ocskay K,
Zádori N. 2021. Early changes in laboratory parameters are predictors of mortality and ICU
admission in patients with COVID-19: a systematic review and meta-analysis. Medical
microbiology and immunology 210:33-47.
45. Lee C, Choi WJ. 2021. Overview of COVID-19 inflammatory pathogenesis from the therapeutic
perspective. Archives of pharmacal research:1-18.
46. Ni W, Yang X, Yang D, Bao J, Li R, Xiao Y, Hou C, Wang H, Liu J, Yang D. 2020. Role of
angiotensin-converting enzyme 2 (ACE2) in COVID-19. Critical Care 24:1-10.
47. Schultze JL, Aschenbrenner AC. 2021. COVID-19 and the human innate immune system. Cell.
48. Hiraiwa K, van Eeden SF. 2014. Nature and consequences of the systemic inflammatory response
induced by lung inflammation. Lung Inflammation 79.
49. Gong J, Dong H, Xia SQ, Huang YZ, Wang D, Zhao Y, Liu W, Tu S, Zhang M, Wang Q. 2020.
Correlation analysis between disease severity and inflammation-related parameters in patients
with COVID-19 pneumonia. MedRxiv.
50. Ruan Q, Yang K, Wang W, Jiang L, Song J. 2020. Clinical predictors of mortality due to
COVID-19 based on an analysis of data of 150 patients from Wuhan, China. Intensive care
medicine 46:846-848.
51. Zhang W, Zhao Y, Zhang F, Wang Q, Li T, Liu Z, Wang J, Qin Y, Zhang X, Yan X. 2020. The
use of anti-inflammatory drugs in the treatment of people with severe coronavirus disease 2019
(COVID-19): The experience of clinical immunologists from China. Clinical
Immunology:108393.
52. Del Valle DM, Kim-Schulze S, Huang H-H, Beckmann ND, Nirenberg S, Wang B, Lavin Y,
Swartz TH, Madduri D, Stock A. 2020. An inflammatory cytokine signature predicts COVID-19
severity and survival. Nature medicine 26:1636-1643.
53. Nagant C, Ponthieux F, Smet J, Dauby N, Doyen V, Besse-Hammer T, De Bels D, Maillart E,
Corazza F. 2020. A score combining early detection of cytokines accurately predicts COVID-19
severity and intensive care unit transfer. International Journal of Infectious Diseases 101:342-345.
54. Zhang Z-L, Hou Y-L, Li D-T, Li F-Z. 2020. Laboratory findings of COVID-19: a systematic
review and meta-analysis. Scandinavian journal of clinical and laboratory investigation 80:441-
447.
55. Moore JB, June CH. 2020. Cytokine release syndrome in severe COVID-19. Science 368:473-
474.
56. Velazquez-Salinas L, Verdugo-Rodriguez A, Rodriguez LL, Borca MV. 2019. The role of
interleukin 6 during viral infections. Frontiers in microbiology 10:1057.
57. Tanaka T, Narazaki M, Kishimoto T. 2014. IL-6 in inflammation, immunity, and disease. Cold
Spring Harbor perspectives in biology 6:a016295.
116

58. Herold T, Jurinovic V, Arnreich C, Lipworth BJ, Hellmuth JC, von Bergwelt-Baildon M, Klein
M, Weinberger T. 2020. Elevated levels of IL-6 and CRP predict the need for mechanical
ventilation in COVID-19. Journal of Allergy and Clinical Immunology 146:128-136. e4.
59. Karki R, Sharma BR, Tuladhar S, Williams EP, Zalduondo L, Samir P, Zheng M, Sundaram B,
Banoth B, Malireddi RKS, Schreiner P, Neale G, Vogel P, Webby R, Jonsson CB, Kanneganti
TD. 2021. Synergism of TNF-α and IFN-γ Triggers Inflammatory Cell Death, Tissue Damage,
and Mortality in SARS-CoV-2 Infection and Cytokine Shock Syndromes. Cell 184:149-168.e17.
60. Ferreira AC, Soares VC, de Azevedo-Quintanilha IG, Dias SdSG, Fintelman-Rodrigues N,
Sacramento CQ, Mattos M, de Freitas CS, Temerozo JR, Teixeira L. 2021. SARS-CoV-2 engages
inflammasome and pyroptosis in human primary monocytes. Cell death discovery 7:1-12.
61. Diao B, Wang C, Tan Y, Chen X, Liu Y, Ning L, Chen L, Li M, Liu Y, Wang G. 2020.
Reduction and functional exhaustion of T cells in patients with coronavirus disease 2019
(COVID-19). Frontiers in immunology 11:827.
62. Qin C, Zhou L, Hu Z, Zhang S, Yang S, Tao Y, Xie C, Ma K, Shang K, Wang W. 2020.
Dysregulation of immune response in patients with COVID-19 in Wuhan, China. Clinical
Infectious Diseases.
63. Zuo Y, Yalavarthi S, Shi H, Gockman K, Zuo M, Madison JA, Blair C, Weber A, Barnes BJ,
Egeblad M. 2020. Neutrophil extracellular traps in COVID-19. JCI insight 5.
64. Metzemaekers M, Cambier S, Blanter M, Vandooren J, de Carvalho AC, Malengier‐Devlies B,
Vanderbeke L, Jacobs C, Coenen S, Martens E. 2021. Kinetics of peripheral blood neutrophils in
severe coronavirus disease 2019. Clinical & Translational Immunology 10:e1271.
65. Veras FP, Pontelli MC, Silva CM, Toller-Kawahisa JE, de Lima M, Nascimento DC, Schneider
AH, Caetité D, Tavares LA, Paiva IM. 2020. SARS-CoV-2–triggered neutrophil extracellular
traps mediate COVID-19 pathology. Journal of Experimental Medicine 217:e20201129.
66. Tan L, Wang Q, Zhang D, Ding J, Huang Q, Tang Y-Q, Wang Q, Miao H. 2020. Lymphopenia
predicts disease severity of COVID-19: a descriptive and predictive study. Signal transduction
and targeted therapy 5:1-3.
67. Drewry AM, Samra N, Skrupky LP, Fuller BM, Compton SM, Hotchkiss RS. 2014. Persistent
lymphopenia after diagnosis of sepsis predicts mortality. Shock (Augusta, Ga) 42:383.
68. Huang I, Pranata R, Lim MA, Oehadian A, Alisjahbana B. 2020. C-reactive protein,
procalcitonin, D-dimer, and ferritin in severe coronavirus disease-2019: a meta-analysis.
Therapeutic advances in respiratory disease 14:1753466620937175.
69. Buicu A-L, Cernea S, Benedek I, Buicu C-F, Benedek T. 2021. Systemic Inflammation and
COVID-19 Mortality in Patients with Major Noncommunicable Diseases: Chronic Coronary
Syndromes, Diabetes and Obesity. Journal of Clinical Medicine 10:1545.
70. Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y, Qiu Y, Wang J, Liu Y, Wei Y. 2020.
Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in
Wuhan, China: a descriptive study. The lancet 395:507-513.
71. Clay C, Donart N, Fomukong N, Knight JB, Lei W, Price L, Hahn F, Van Westrienen J, Harrod
KS. 2012. Primary severe acute respiratory syndrome coronavirus infection limits replication but
not lung inflammation upon homologous rechallenge. Journal of virology 86:4234-4244.
72. Felsenstein S, Herbert JA, McNamara PS, Hedrich CM. 2020. COVID-19: Immunology and
treatment options. Clinical immunology 215:108448.
73. Scutigliani EM, Kikkert M. 2017. Interaction of the innate immune system with positive-strand
RNA virus replication organelles. Cytokine & growth factor reviews 37:17-27.
74. Merad M, Martin JC. 2020. Pathological inflammation in patients with COVID-19: a key role for
monocytes and macrophages. Nature reviews immunology 20:355-362.
75. Jamilloux Y, Henry T, Belot A, Viel S, Fauter M, El Jammal T, Walzer T, François B, Sève P.
2020. Should we stimulate or suppress immune responses in COVID-19? Cytokine and anti-
cytokine interventions. Autoimmunity reviews 19:102567.
117

76. Li S, Zhang Y, Guan Z, Li H, Ye M, Chen X, Shen J, Zhou Y, Shi Z-L, Zhou P. 2020. SARS-
CoV-2 triggers inflammatory responses and cell death through caspase-8 activation. Signal
transduction and targeted therapy 5:1-10.
77. Iwasaki M, Saito J, Zhao H, Sakamoto A, Hirota K, Ma D. 2021. Inflammation triggered by
SARS-CoV-2 and ACE2 augment drives multiple organ failure of severe COVID-19: molecular
mechanisms and implications. Inflammation 44:13-34.
78. Nieto-Torres JL, Verdiá-Báguena C, Jimenez-Guardeño JM, Regla-Nava JA, Castaño-Rodriguez
C, Fernandez-Delgado R, Torres J, Aguilella VM, Enjuanes L. 2015. Severe acute respiratory
syndrome coronavirus E protein transports calcium ions and activates the NLRP3 inflammasome.
Virology 485:330-339.
79. DeDiego ML, Nieto-Torres JL, Regla-Nava JA, Jimenez-Guardeño JM, Fernandez-Delgado R,
Fett C, Castaño-Rodriguez C, Perlman S, Enjuanes L. 2014. Inhibition of NF-κB-mediated
inflammation in severe acute respiratory syndrome coronavirus-infected mice increases survival.
J Virol 88:913-24.
80. Xia B, Shen X, He Y, Pan X, Liu F-L, Wang Y, Yang F, Fang S, Wu Y, Duan Z. 2021. SARS-
CoV-2 envelope protein causes acute respiratory distress syndrome (ARDS)-like pathological
damages and constitutes an antiviral target. Cell research:1-14.
81. Simões e Silva A, Silveira K, Ferreira A, Teixeira M. 2013. ACE2, angiotensin‐(1‐7) and M as
receptor axis in inflammation and fibrosis. British journal of pharmacology 169:477-492.
82. Meng Y, Yu C-H, Li W, Li T, Luo W, Huang S, Wu P-S, Cai S-X, Li X. 2014. Angiotensin-
converting enzyme 2/angiotensin-(1-7)/Mas axis protects against lung fibrosis by inhibiting the
MAPK/NF-κB pathway. American journal of respiratory cell and molecular biology 50:723-736.
83. Imai Y, Kuba K, Rao S, Huan Y, Guo F, Guan B, Yang P, Sarao R, Wada T, Leong-Poi H. 2005.
Angiotensin-converting enzyme 2 protects from severe acute lung failure. Nature 436:112-116.
84. Offringa A, Montijn R, Singh S, Paul M, Pinto YM, Pinto-Sietsma* S-J. 2020. The mechanistic
overview of SARS-CoV-2 using angiotensin-converting enzyme 2 to enter the cell for replication:
possible treatment options related to the renin–angiotensin system. European Heart Journal-
Cardiovascular Pharmacotherapy 6:317-325.
85. Kuba K, Imai Y, Rao S, Gao H, Guo F, Guan B, Huan Y, Yang P, Zhang Y, Deng W. 2005. A
crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus–induced lung
injury. Nature medicine 11:875-879.
86. López-Medina E, López P, Hurtado IC, Dávalos DM, Ramirez O, Martínez E, Díazgranados JA,
Oñate JM, Chavarriaga H, Herrera S. 2021. Effect of ivermectin on time to resolution of
symptoms among adults with mild COVID-19: a randomized clinical trial. Jama 325:1426-1435.
87. Cao B, Wang Y, Wen D, Liu W, Wang J, Fan G, Ruan L, Song B, Cai Y, Wei M. 2020. A trial of
lopinavir–ritonavir in adults hospitalized with severe Covid-19. New England Journal of
Medicine.
88. Group RC. 2021. Dexamethasone in hospitalized patients with Covid-19. New England Journal
of Medicine 384:693-704.
89. Salton F, Confalonieri P, Meduri GU, Santus P, Harari S, Scala R, Lanini S, Vertui V, Oggionni
T, Caminati A. Prolonged low-dose methylprednisolone in patients with severe COVID-19
pneumonia, p ofaa421. In (ed), Oxford University Press US,
90. Edalatifard M, Akhtari M, Salehi M, Naderi Z, Jamshidi A, Mostafaei S, Najafizadeh SR, Farhadi
E, Jalili N, Esfahani M. 2020. Intravenous methylprednisolone pulse as a treatment for
hospitalised severe COVID-19 patients: results from a randomised controlled clinical trial.
European Respiratory Journal 56.
91. Ricciotti E, Laudanski K, FitzGerald GA. 2021. Nonsteroidal anti-inflammatory drugs and
glucocorticoids in COVID-19. Advances in Biological Regulation:100818.
92. Goyal DK, Mansab F, Iqbal A, Bhatti S. 2020. Early intervention likely improves mortality in
COVID-19 infection. Clin Med (Lond) 20:248-50.
118

93. Yip TC-F, Lui GC-Y, Wong VW-S, Chow VC-Y, Ho TH-Y, Li TC-M, Tse Y-K, Hui DS-C,
Chan HL-Y, Wong GL-H. 2021. Liver injury is independently associated with adverse clinical
outcomes in patients with COVID-19. Gut 70:733-742.
94. Sanders JM, Monogue ML, Jodlowski TZ, Cutrell JB. 2020. Pharmacologic treatments for
coronavirus disease 2019 (COVID-19): a review. Jama 323:1824-1836.
95. Pagano G, Bruno A, Cavallo-Perin P, Cesco L, Imbimbo B. 1989. Glucose intolerance after short-
term administration of corticosteroids in healthy subjects: Prednisone, deflazacort, and
betamethasone. Archives of internal medicine 149:1098-1101.
96. Li H, Chen C, Hu F, Wang J, Zhao Q, Gale RP, Liang Y. 2020. Impact of corticosteroid therapy
on outcomes of persons with SARS-CoV-2, SARS-CoV, or MERS-CoV infection: a systematic
review and meta-analysis. Leukemia 34:1503-1511.
97. Rosas IO, Bräu N, Waters M, Go RC, Hunter BD, Bhagani S, Skiest D, Aziz MS, Cooper N,
Douglas IS. 2021. Tocilizumab in hospitalized patients with severe Covid-19 pneumonia. New
England Journal of Medicine 384:1503-1516.
98. Tharaux P-L, Pialoux G, Pavot A, Mariette X, Hermine O, Resche-Rigon M, Porcher R, Ravaud
P, Bureau S, Dougados M. 2021. Effect of anakinra versus usual care in adults in hospital with
COVID-19 and mild-to-moderate pneumonia (CORIMUNO-ANA-1): a randomised controlled
trial. The Lancet Respiratory Medicine 9:295-304.
99. Huet T, Beaussier H, Voisin O, Jouveshomme S, Dauriat G, Lazareth I, Sacco E, Naccache J-M,
Bézie Y, Laplanche S. 2020. Anakinra for severe forms of COVID-19: a cohort study. The
Lancet Rheumatology 2:e393-e400.
100. Salvi R, Patankar P. 2020. Emerging pharmacotherapies for COVID-19. Biomedicine &
Pharmacotherapy 128:110267.
101. Kalil AC, Patterson TF, Mehta AK, Tomashek KM, Wolfe CR, Ghazaryan V, Marconi VC, Ruiz-
Palacios GM, Hsieh L, Kline S. 2021. Baricitinib plus remdesivir for hospitalized adults with
Covid-19. New England Journal of Medicine 384:795-807.
102. Jorgensen SC, Tse CL, Burry L, Dresser LD. 2020. Baricitinib: a review of pharmacology, safety,
and emerging clinical experience in COVID‐19. Pharmacotherapy: The Journal of Human
Pharmacology and Drug Therapy 40:843-856.
103. Mookherjee N, Anderson MA, Haagsman HP, Davidson DJ. 2020. Antimicrobial host defence
peptides: functions and clinical potential. Nature reviews Drug discovery 19:311-332.
104. Mansour SC, Pena OM, Hancock RE. 2014. Host defense peptides: front-line
immunomodulators. Trends in immunology 35:443-450.
105. Ong ZY, Wiradharma N, Yang YY. 2014. Strategies employed in the design and optimization of
synthetic antimicrobial peptide amphiphiles with enhanced therapeutic potentials. Advanced drug
delivery reviews 78:28-45.
106. Scocchi M, Mardirossian M, Runti G, Benincasa M. 2016. Non-membrane permeabilizing modes
of action of antimicrobial peptides on bacteria. Current topics in medicinal chemistry 16:76-88.
107. Bechinger B, Gorr S-U. 2017. Antimicrobial peptides: mechanisms of action and resistance.
Journal of dental research 96:254-260.
108. Gupta S, Bhatia G, Sharma A, Saxena S. 2018. Host defense peptides: An insight into the
antimicrobial world. Journal of oral and maxillofacial pathology: JOMFP 22:239.
109. Kościuczuk EM, Lisowski P, Jarczak J, Strzałkowska N, Jóźwik A, Horbańczuk J, Krzyżewski J,
Zwierzchowski L, Bagnicka E. 2012. Cathelicidins: family of antimicrobial peptides. A review.
Mol Biol Rep 39:10957-70.
110. Brook M, Tomlinson GH, Miles K, Smith RW, Rossi AG, Hiemstra PS, van’t Wout EF, Dean JL,
Gray NK, Lu W. 2016. Neutrophil-derived alpha defensins control inflammation by inhibiting
macrophage mRNA translation. Proceedings of the National Academy of Sciences 113:4350-
4355.
111. Ganz T. 2003. Defensins: antimicrobial peptides of innate immunity. Nature reviews immunology
3:710-720.
119

112. Selsted ME, Ouellette AJ. 2005. Mammalian defensins in the antimicrobial immune response.
Nature immunology 6:551-557.
113. van der Does AM, Hiemstra PS, Mookherjee N. 2019. Antimicrobial host defence peptides:
immunomodulatory functions and translational prospects. Antimicrobial Peptides:149-171.
114. Diamond G, Beckloff N, Weinberg A, Kisich KO. 2009. The roles of antimicrobial peptides in
innate host defense. Current pharmaceutical design 15:2377-2392.
115. Oppenheim J, Biragyn A, Kwak L, Yang D. 2003. Roles of antimicrobial peptides such as
defensins in innate and adaptive immunity. Annals of the rheumatic diseases 62:ii17-ii21.
116. Steinstraesser L, Koehler T, Jacobsen F, Daigeler A, Goertz O, Langer S, Kesting M, Steinau H,
Eriksson E, Hirsch T. 2008. Host defense peptides in wound healing. Molecular medicine 14:528-
537.
117. Alford MA, Baquir B, Santana FL, Haney EF, Hancock RE. 2020. Cathelicidin host defense
peptides and inflammatory signaling: Striking a balance. Frontiers in microbiology 11:1902.
118. Steinstraesser L, Kraneburg U, Jacobsen F, Al-Benna S. 2011. Host defense peptides and their
antimicrobial-immunomodulatory duality. Immunobiology 216:322-333.
119. Gallo RL, Murakami M, Ohtake T, Zaiou M. 2002. Biology and clinical relevance of naturally
occurring antimicrobial peptides. Journal of Allergy and Clinical Immunology 110:823-831.
120. Lehrer RI, Bevins CL, Ganz T. 2005. Defensins and other antimicrobial peptides and proteins.
Mucosal immunology:95.
121. Steinstraesser L, Kraneburg UM, Hirsch T, Kesting M, Steinau H-U, Jacobsen F, Al-Benna S.
2009. Host defense peptides as effector molecules of the innate immune response: a
sledgehammer for drug resistance? International journal of molecular sciences 10:3951-3970.
122. Lehrer RI, Cole AM, Selsted ME. 2012. θ-Defensins: cyclic peptides with endless potential.
Journal of Biological Chemistry 287:27014-27019.
123. Schaal JB, Tran DQ, Subramanian A, Patel R, Laragione T, Roberts KD, Trinh K, Tongaonkar P,
Tran PA, Minond D. 2017. Suppression and resolution of autoimmune arthritis by rhesus θ-
defensin-1, an immunomodulatory macrocyclic peptide. PLoS One 12:e0187868.
124. Tongaonkar P, Tran P, Roberts K, Schaal J, Ösapay G, Tran D, Ouellette AJ, Selsted ME. 2011.
Rhesus macaque θ‐defensin isoforms: expression, antimicrobial activities, and demonstration of a
prominent role in neutrophil granule microbicidal activities. Journal of leukocyte biology 89:283-
290.
125. Schaal JB, Tran D, Tran P, Ösapay G, Trinh K, Roberts KD, Brasky KM, Tongaonkar P,
Ouellette AJ, Selsted ME. 2012. Rhesus macaque theta defensins suppress inflammatory
cytokines and enhance survival in mouse models of bacteremic sepsis. PLoS One 7:e51337.
126. Jayne JG, Bensman TJ, Schaal JB, Park AYJ, Kimura E, Tran D, Selsted ME, Beringer PM.
2018. Rhesus θ-defensin-1 attenuates endotoxin-induced acute lung injury by inhibiting
proinflammatory cytokines and neutrophil recruitment. American journal of respiratory cell and
molecular biology 58:310-319.
127. Tai KP, Kamdar K, Yamaki J, Le VV, Tran D, Tran P, Selsted ME, Ouellette AJ, Wong-Beringer
A. 2015. Microbicidal effects of α-and θ-defensins against antibiotic-resistant Staphylococcus
aureus and Pseudomonas aeruginosa. Innate immunity 21:17-29.
128. Beringer PM, Bensman TJ, Ho H, Agnello M, Denovel N, Nguyen A, Wong-Beringer A, She R,
Tran DQ, Moskowitz SM. 2016. Rhesus θ-defensin-1 (RTD-1) exhibits in vitro and in vivo
activity against cystic fibrosis strains of Pseudomonas aeruginosa. Journal of Antimicrobial
Chemotherapy 71:181-188.
129. Basso V, Garcia A, Tran DQ, Schaal JB, Tran P, Ngole D, Aqeel Y, Tongaonkar P, Ouellette AJ,
Selsted ME. 2018. Fungicidal potency and mechanisms of θ-defensins against multidrug-resistant
Candida species. Antimicrobial agents and chemotherapy 62:e00111-18.
130. Seidel A, Ye Y, De Armas LR, Soto M, Yarosh W, Marcsisin RA, Tran D, Selsted ME, Camerini
D. 2010. Cyclic and acyclic defensins inhibit human immunodeficiency virus type-1 replication
by different mechanisms. PloS one 5:e9737.
120

131. Tran D, Tran PA, Tang Y-Q, Yuan J, Cole T, Selsted ME. 2002. Homodimeric θ-Defensins from
Rhesus macaqueLeukocytes: ISOLATION, SYNTHESIS, ANTIMICROBIAL ACTIVITIES,
AND BACTERIAL BINDING PROPERTIES OF THE CYCLIC PEPTIDES. Journal of
Biological Chemistry 277:3079-3084.
132. Benfield AH, Henriques ST. 2020. Mode-of-action of antimicrobial peptides: membrane
disruption versus intracellular mechanisms. Frontiers in Medical Technology 2:20.
133. Tran D, Tran P, Roberts K, Osapay G, Schaal J, Ouellette A, Selsted ME. 2008. Microbicidal
properties and cytocidal selectivity of rhesus macaque theta defensins. Antimicrobial agents and
chemotherapy 52:944-953.
134. Tang Y-Q, Yuan J, Ösapay G, Ösapay K, Tran D, Miller CJ, Ouellette AJ, Selsted ME. 1999. A
cyclic antimicrobial peptide produced in primate leukocytes by the ligation of two truncated α-
defensins. Science 286:498-502.
135. Bensman TJ, Jayne JG, Sun M, Kimura E, Meinert J, Wang JC, Schaal JB, Tran D, Rao AP,
Akbari O. 2017. Efficacy of rhesus theta-defensin-1 in experimental models of Pseudomonas
aeruginosa lung infection and inflammation. Antimicrobial agents and chemotherapy 61:e00154-
17.
136. Jayne JG, Bensman TJ, Schaal JB, Park AYJ, Kimura E, Tran D, Selsted ME, Beringer PM.
2018. Rhesus θ-Defensin-1 Attenuates Endotoxin-induced Acute Lung Injury by Inhibiting
Proinflammatory Cytokines and Neutrophil Recruitment. Am J Respir Cell Mol Biol 58:310-319.
137. Tongaonkar P, Trinh KK, Schaal JB, Tran D, Gulko PS, Ouellette AJ, Selsted ME. 2015. Rhesus
macaque θ‐defensin RTD‐1 inhibits proinflammatory cytokine secretion and gene expression by
inhibiting the activation of NF‐κB and MAPK pathways. Journal of leukocyte biology 98:1061-
1070.
138. Schaal JB, Maretzky T, Tran DQ, Tran PA, Tongaonkar P, Blobel CP, Ouellette AJ, Selsted ME.
2018. Macrocyclic θ-defensins suppress tumor necrosis factor-α (TNF-α) shedding by inhibition
of TNF-α-converting enzyme. J Biol Chem 293:2725-2734.
139. Rossi GA, Sacco O, Mancino E, Cristiani L, Midulla F. 2020. Differences and similarities
between SARS-CoV and SARS-CoV-2: spike receptor-binding domain recognition and host cell
infection with support of cellular serine proteases. Infection:1-5.
140. Wohlford-Lenane CL, Meyerholz DK, Perlman S, Zhou H, Tran D, Selsted ME, McCray PB.
2009. Rhesus Theta-Defensin Prevents Death in a Mouse Model of Severe Acute Respiratory
Syndrome Coronavirus Pulmonary Disease. Journal of Virology 83:11385-11390.
141. Muttenthaler M, King GF, Adams DJ, Alewood PF. 2021. Trends in peptide drug discovery.
Nature Reviews Drug Discovery 20:309-325.
142. de la Torre BG, Albericio F. 2020. Peptide Therapeutics 2.0. Multidisciplinary Digital Publishing
Institute.
143. Lau JL, Dunn MK. 2018. Therapeutic peptides: Historical perspectives, current development
trends, and future directions. Bioorganic & medicinal chemistry 26:2700-2707.
144. Sachdeva S. 2017. Peptides as ‘drugs’: the journey so far. International Journal of Peptide
Research and Therapeutics 23:49-60.
145. Diao L, Meibohm B. 2013. Pharmacokinetics and pharmacokinetic–pharmacodynamic
correlations of therapeutic peptides. Clinical pharmacokinetics 52:855-868.
146. Khodadoust A, Aghamollaei H, Latifi AM, Hasanpour K, Kamali M, Tebyanian H, Farnoosh G.
2020. Elimination Pathways of Fusion Protein and Peptide Drugs. Liver 500:1000.
147. Otvos Jr L, Wade JD. 2014. Current challenges in peptide-based drug discovery. Frontiers in
chemistry 2:62.
148. Fosgerau K, Hoffmann T. 2015. Peptide therapeutics: current status and future directions. Drug
discovery today 20:122-128.
149. Renukuntla J, Vadlapudi AD, Patel A, Boddu SH, Mitra AK. 2013. Approaches for enhancing
oral bioavailability of peptides and proteins. International journal of pharmaceutics 447:75-93.
121

150. Uhlig T, Kyprianou T, Martinelli FG, Oppici CA, Heiligers D, Hills D, Calvo XR, Verhaert P.
2014. The emergence of peptides in the pharmaceutical business: From exploration to
exploitation. EuPA Open Proteomics 4:58-69.
151. Di L. 2015. Strategic approaches to optimizing peptide ADME properties. Aaps j 17:134-43.
152. Patel A, Cholkar K, Mitra AK. 2014. Recent developments in protein and peptide parenteral
delivery approaches. Therapeutic delivery 5:337-365.
153. Moretta A, Scieuzo C, Petrone AM, Salvia R, Manniello MD, Franco A, Lucchetti D, Vassallo A,
Vogel H, Sgambato A. 2021. Antimicrobial Peptides: A New Hope in Biomedical and
Pharmaceutical Fields. Frontiers in Cellular and Infection Microbiology 11:453.
154. Barre J, Houin G, Brunner F, Bree F, Tillement J. 1983. Disease-induced modifications of drug
pharmacokinetics. International journal of clinical pharmacology research 3:215-226.
155. Krippendorff B-F, Kuester K, Kloft C, Huisinga W. 2009. Nonlinear pharmacokinetics of
therapeutic proteins resulting from receptor mediated endocytosis. Journal of pharmacokinetics
and pharmacodynamics 36:239-260.
156. Kawai R, Mathew D, Tanaka C, Rowland M. 1998. Physiologically based pharmacokinetics of
cyclosporine A: extension to tissue distribution kinetics in rats and scale-up to human. Journal of
Pharmacology and Experimental Therapeutics 287:457-468.
157. Tanaka C, Kawai R, Rowland M. 2000. Dose-dependent pharmacokinetics of cyclosporin A in
rats: events in tissues. Drug metabolism and disposition 28:582-589.
158. Huang Z, Ung T. 2013. Effect of alpha-1-acid glycoprotein binding on pharmacokinetics and
pharmacodynamics. Current drug metabolism 14:226-238.
159. Smith SA, Waters NJ. 2019. Pharmacokinetic and pharmacodynamic considerations for drugs
binding to alpha-1-acid glycoprotein. Pharmaceutical research 36:1-19.
160. Dong JQ, Salinger DH, Endres CJ, Gibbs JP, Hsu C-P, Stouch BJ, Hurh E, Gibbs M. 2011.
Quantitative prediction of human pharmacokinetics for monoclonal antibodies. Clinical
pharmacokinetics 50:131-142.
161. Chen T, Mager DE, Kagan L. 2013. Interspecies modeling and prediction of human exenatide
pharmacokinetics. Pharmaceutical research 30:751-760.
162. Kagan L, Abraham AK, Harrold JM, Mager DE. 2010. Interspecies scaling of receptor-mediated
pharmacokinetics and pharmacodynamics of type I interferons. Pharmaceutical research 27:920-
932.
163. Kato M, Kamiyama H, Okazaki A, Kumaki K, Kato Y, Sugiyama Y. 1997. Mechanism for the
nonlinear pharmacokinetics of erythropoietin in rats. Journal of Pharmacology and Experimental
Therapeutics 283:520-527.
164. Matthay MA, Zimmerman GA. 2005. Acute lung injury and the acute respiratory distress
syndrome: four decades of inquiry into pathogenesis and rational management. American journal
of respiratory cell and molecular biology 33:319-327.
165. Johnson ER, Matthay MA. 2010. Acute lung injury: epidemiology, pathogenesis, and treatment.
Journal of aerosol medicine and pulmonary drug delivery 23:243-252.
166. Park WY, Goodman RB, Steinberg KP, Ruzinski JT, RADELLA F, Park DR, Pugin J, Skerrett
SJ, Hudson LD, Martin TR. 2001. Cytokine balance in the lungs of patients with acute respiratory
distress syndrome. American journal of respiratory and critical care medicine 164:1896-1903.
167. Bdeir K, Higazi AA-R, Kulikovskaya I, Christofidou-Solomidou M, Vinogradov SA, Allen TC,
Idell S, Linzmeier R, Ganz T, Cines DB. 2010. Neutrophil α-defensins cause lung injury by
disrupting the capillary–epithelial barrier. American journal of respiratory and critical care
medicine 181:935-946.
168. Selsted ME. 2004. θ-Defensins: cyclic antimicrobial peptides produced by binary ligation of
truncated α-defensins. Current Protein and Peptide Science 5:365-371.
169. Proudfoot AG, McAuley DF, Griffiths MJ, Hind M. 2011. Human models of acute lung injury.
Disease models & mechanisms 4:145-153.
122

170. Matute-Bello G, Downey G, Moore BB, Groshong SD, Matthay MA, Slutsky AS, Kuebler WM.
2011. An official American Thoracic Society workshop report: features and measurements of
experimental acute lung injury in animals. American journal of respiratory cell and molecular
biology 44:725-738.
171. Garcia AE, Osapay G, Tran PA, Yuan J, Selsted ME. 2008. Isolation, synthesis, and antimicrobial
activities of naturally occurring θ-defensin isoforms from baboon leukocytes. Infection and
immunity 76:5883-5891.
172. Balloy V, Deveaux A, Lebeaux D, Tabary O, Le Rouzic P, Ghigo J, Busson P, Boëlle P, Guez
JG, Hahn U. 2014. Azithromycin analogue CSY 0073 attenuates lung inflammation induced by
LPS challenge. British journal of pharmacology 171:1783-1794.
173. Szarka RJ, Wang N, Gordon L, Nation P, Smith RH. 1997. A murine model of pulmonary
damage induced by lipopolysaccharide via intranasal instillation. Journal of immunological
methods 202:49-57.
174. Wieland CW, Siegmund B, Senaldi G, Vasil ML, Dinarello CA, Fantuzzi G. 2002. Pulmonary
inflammation induced by Pseudomonas aeruginosa lipopolysaccharide, phospholipase C, and
exotoxin A: role of interferon regulatory factor 1. Infection and immunity 70:1352-1358.
175. Abdel-Latif D, Steward M, Macdonald DL, Francis GA, Dinauer MC, Lacy P. 2004. Rac2 is
critical for neutrophil primary granule exocytosis. Blood 104:832-839.
176. De Filippo K, Henderson RB, Laschinger M, Hogg N. 2008. Neutrophil chemokines KC and
macrophage-inflammatory protein-2 are newly synthesized by tissue macrophages using distinct
TLR signaling pathways. The Journal of Immunology 180:4308-4315.
177. Nedelman JR, Gibiansky E, Lau DT. 1995. Applying Bailer's method for AUC confidence
intervals to sparse sampling. Pharmaceutical research 12:124-128.
178. Tecle T, Tripathi S, Hartshorn KL. 2010. Defensins and cathelicidins in lung immunity. Innate
immunity 16:151-159.
179. Hancock RE, Sahl H-G. 2006. Antimicrobial and host-defense peptides as new anti-infective
therapeutic strategies. Nature biotechnology 24:1551-1557.
180. Tasaka S, Ishizaka A, Urano T, Sayama K, Sakamaki F, Nakamura H, Terashima T, Waki Y,
Soejima K, Nakamura M. 1996. A derivative of cationic antimicrobial protein attenuates lung
injury by suppressing cell adhesion. American journal of respiratory cell and molecular biology
15:738-744.
181. Simpson AJ, Wallace WA, Marsden ME, Govan JR, Porteous DJ, Haslett C, Sallenave J-M.
2001. Adenoviral augmentation of elafin protects the lung against acute injury mediated by
activated neutrophils and bacterial infection. The Journal of Immunology 167:1778-1786.
182. Vandermeer TJ, Menconi MJ, O′ Sullivan BP, Larkin VA, Wang H, Kradin RL, Fink MP. 1994.
Bactericidal/permeability-increasing protein ameliorates acute lung injury in porcine
endotoxemia. Journal of Applied Physiology 76:2006-2014.
183. Bals R, Weiner DJ, Moscioni AD, Meegalla RL, Wilson JM. 1999. Augmentation of innate host
defense by expression of a cathelicidin antimicrobial peptide. Infection and immunity 67:6084-
6089.
184. Grommes J, Soehnlein O. 2011. Contribution of neutrophils to acute lung injury. Molecular
medicine 17:293-307.
185. Chen L, Liu H, Liu W, Liu J, Liu K, Shang J, Deng Y, Wei S. 2020. Analysis of clinical features
of 29 patients with 2019 novel coronavirus pneumonia. Zhonghua jie he he hu xi za zhi=
Zhonghua jiehe he huxi zazhi= Chinese journal of tuberculosis and respiratory diseases 43:E005-
E005.
186. Basso V, Tran DQ, Schaal JB, Tran P, Eriguchi Y, Ngole D, Cabebe AE, young Park A, Beringer
PM, Ouellette AJ. 2019. Rhesus Theta Defensin 1 Promotes Long Term Survival in Systemic
Candidiasis by Host Directed Mechanisms. Scientific reports 9:1-14.
123

187. D'Argenio DZ, Schumitzky A, Wang X. 2009. ADAPT 5 User’s Guide:
Pharmacokinetic/Pharmacodynamic Systems Analysis Software. Biomedical Simulations
Resource.
188. Gough K, Hutchison M, Keene O, Byrom B, Ellis S, Lacey L, McKellar J. 1995. Assessment of
Dose Proportionality: Report from the Statisticians in the Pharmaceutical
Industry/Pharmacokinetics UK Joint Working Party. Drug Information Journal 29:1039-1048.
189. Amantana A, Chen Y, Tyavanagimatt SR, Jones KF, Jordan R, Chinsangaram J, Leeds JM,
Hruby DE. 2013. Pharmacokinetics and interspecies allometric scaling of ST-246, an oral
antiviral therapeutic for treatment of orthopoxvirus infection. PloS one 8:e61514.
190. Caldwell GW, Masucci JA, Yan Z, Hageman W. 2004. Allometric scaling of pharmacokinetic
parameters in drug discovery: can human CL, Vss and t1/2 be predicted from in-vivo rat data?
Eur J Drug Metab Pharmacokinet 29:133-43.
191. Petterino C, Argentino-Storino A. 2006. Clinical chemistry and haematology historical data in
control Sprague-Dawley rats from pre-clinical toxicity studies. Experimental and Toxicologic
Pathology 57:213-219.
192. FDA. 2005. Guidance for Industry Estimating the Maximum Safe Starting Dose in Initial Clinical
Trials for Therapeutics in Adult Healthy Volunteers.
193. Schuurman HJ, Smith HT. 2005. Reference values for clinical chemistry and clinical hematology
parameters in cynomolgus monkeys. Xenotransplantation 12:72-75.
194. Catanzaro M, Fagiani F, Racchi M, Corsini E, Govoni S, Lanni C. 2020. Immune response in
COVID-19: addressing a pharmacological challenge by targeting pathways triggered by SARS-
CoV-2. Signal transduction and targeted therapy 5:1-10.
195. Huh Y, Smith DE, Feng MR. 2011. Interspecies scaling and prediction of human clearance:
comparison of small- and macro-molecule drugs. Xenobiotica 41:972-87.
196. Mahmood I, Balian JD. 1996. Interspecies scaling: predicting clearance of drugs in humans.
Three different approaches. Xenobiotica 26:887-895.
197. Mordenti J, Chen SA, Moore JA, Ferraiolo BL, Green JD. 1991. Interspecies scaling of clearance
and volume of distribution data for five therapeutic proteins. Pharm Res 8:1351-9.
198. FDA. 2005. Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for
Therapeutics in Adult Healthy Volunteers.
199. Feng Z, Yu Q, Yao S, Luo L, Zhou W, Mao X, Li J, Duan J, Yan Z, Yang M, Tan H, Ma M, Li T,
Yi D, Mi Z, Zhao H, Jiang Y, He Z, Li H, Nie W, Liu Y, Zhao J, Luo M, Liu X, Rong P, Wang
W. 2020. Early prediction of disease progression in COVID-19 pneumonia patients with chest CT
and clinical characteristics. Nature Communications 11:4968.
200. McElvaney OJ, McEvoy NL, McElvaney OF, Carroll TP, Murphy MP, Dunlea DM, Ní Choileáin
O, Clarke J, O’Connor E, Hogan G. 2020. Characterization of the inflammatory response to
severe COVID-19 illness. American journal of respiratory and critical care medicine 202:812-
821.
201. Tibbitts J, Canter D, Graff R, Smith A, Khawli LA. Key factors influencing ADME properties of
therapeutic proteins: a need for ADME characterization in drug discovery and development, p
229-245. In (ed), Taylor & Francis,
202. Zhou S-F, Xue CC, Yu X-Q, Li C, Wang G. 2007. Clinically important drug interactions
potentially involving mechanism-based inhibition of cytochrome P450 3A4 and the role of
therapeutic drug monitoring. Therapeutic drug monitoring 29:687-710.
203. Ungewiss J, Gericke S, Boriss H. 2019. Determination of the plasma protein binding of
liraglutide using the EScalate* equilibrium shift assay. Journal of pharmaceutical sciences
108:1309-1314.
204. Yu S, Li S, Yang H, Lee F, Wu JT, Qian MG. 2005. A novel liquid chromatography/tandem mass
spectrometry based depletion method for measuring red blood cell partitioning of pharmaceutical
compounds in drug discovery. Rapid Communications in Mass Spectrometry: An International
124

Journal Devoted to the Rapid Dissemination of Up‐to‐the‐Minute Research in Mass Spectrometry
19:250-254.
205. Dilo A, Daali Y, Desmeules J, Chalandon Y, Uppugunduri CR, Ansari M. 2020. Comparing dried
blood spots and plasma concentrations for Busulfan therapeutic drug monitoring in children.
Therapeutic drug monitoring 42:111-117.
206. Li L, Nouraldeen A, Wilson AGE. 2013. Evaluation of transporter-mediated hepatic uptake in a
non-radioactive high-throughput assay: a study of kinetics, species difference and plasma protein
effect. Xenobiotica 43:253-262.
207. Cali JJ, Ma D, Sobol M, Simpson DJ, Frackman S, Good TD, Daily WJ, Liu D. 2006.
Luminogenic cytochrome P450 assays. Expert opinion on drug metabolism & toxicology 2:629-
645.
208. Schmidt S, Gonzalez D, Derendorf H. 2010. Significance of protein binding in pharmacokinetics
and pharmacodynamics. Journal of pharmaceutical sciences 99:1107-1122.
209. Loufakis DN, Cao Z, Ma S, Mittelman D, Lu C. 2014. Focusing of mammalian cells under an
ultrahigh pH gradient created by unidirectional electropulsation in a confined microchamber.
Chemical science 5:3331-3337.
210. Yue B. 2014. Biology of the extracellular matrix: an overview. Journal of glaucoma:S20.
211. Riniker S. 2019. Toward the elucidation of the mechanism for passive membrane permeability of
cyclic peptides. Future medicinal chemistry 11:637-639.
212. Vlieghe P, Lisowski V, Martinez J, Khrestchatisky M. 2010. Synthetic therapeutic peptides:
science and market. Drug discovery today 15:40-56.
213. Pfeil M-P, Pyne AL, Losasso V, Ravi J, Lamarre B, Faruqui N, Alkassem H, Hammond K, Judge
PJ, Winn M. 2018. Tuneable poration: host defense peptides as sequence probes for antimicrobial
mechanisms. Scientific reports 8:1-15.
214. Rezai T, Bock JE, Zhou MV, Kalyanaraman C, Lokey RS, Jacobson MP. 2006. Conformational
flexibility, internal hydrogen bonding, and passive membrane permeability: successful in silico
prediction of the relative permeabilities of cyclic peptides. Journal of the American Chemical
Society 128:14073-14080.
215. Luo G, Cunningham M, Kim S, Burn T, Lin J, Sinz M, Hamilton G, Rizzo C, Jolley S, Gilbert D.
2002. CYP3A4 induction by drugs: correlation between a pregnane X receptor reporter gene
assay and CYP3A4 expression in human hepatocytes. Drug Metabolism and Disposition 30:795-
804.
216. Shitara Y, Maeda K, Ikejiri K, Yoshida K, Horie T, Sugiyama Y. 2013. Clinical significance of
organic anion transporting polypeptides (OATPs) in drug disposition: their roles in hepatic
clearance and intestinal absorption. Biopharmaceutics & drug disposition 34:45-78.

Abstract (if available)

Abstract Severe illness caused by Coronavirus disease 2019 (COVID-19) is characterized by an overexuberant inflammatory response resulting in acute respiratory distress syndrome (ARDS) and progressive respiratory failure. Elevated systemic inflammatory markers, such as IL-6 and CRP, in hospitalized COVID-19 patients have been linked to poor clinical outcomes. Current immunomodulating agents used to combat COVID-19-mediated inflammation, such as dexamethasone and tocilizumab, may induce glucose intolerance, delay viral clearance, and increase the risk of secondary bacterial infection, underscoring the need for safer immunomodulating treatment. Rhesus theta (θ) defensin-1 (RTD-1) is a macrocyclic host defense peptide exhibiting dual antimicrobial and immunomodulatory activities. Previously, RTD-1 treatment was associated with a significant improvement in survival in a murine model of severe acute respiratory syndrome (SARS-CoV-1) lung disease, which was attributable to its potent in vivo anti-inflammatory activity. ❧ The overarching objective of this thesis was to investigate the therapeutic potentials of RTD-1 for the treatment of COVID-19 using endotoxin-induced acute lung injury (ALI) model and to characterize the plasma and tissue pharmacokinetics and safety of RTD-1 in preclinical species. A single subcutaneous administration of RTD-1 to a well-established murine model of lipopolysaccharide (LPS)-induced ALI resulted in significant reductions of neutrophil extravasation and pro-inflammatory cytokines, leading to attenuation in lung injury. In repeated dose toxicity studies, RTD-1 was well tolerated up to 10 mg/kg and 15 mg/kg in rats and cynomolgus monkeys, respectively. Based on the lack of adverse findings, the no-observed-adverse-effect-level (NOAEL) was established at 10 mg/kg/day in rats and 15 mg/kg/day in cynomolgus monkeys. Analysis of single ascending dose studies in rats and cynomolgus monkeys revealed greater than dose proportional increases in area under the curve extrapolated to infinity (AUC₀-∞), suggestive of nonlinear PK, particularly at the higher doses. Following a single 5 mg/kg intravenous (i.v.) dose of RTD-1, volume of distribution (Vss) was large across all species, indicating extensive tissue distribution, with 1,048, 1,461, 550 mL/kg, in mice, rats and cynomolgus monkeys, respectively. A biodistribution study of ¹⁴C-RTD-1 in rats confirmed widespread tissue distribution, the liver. The presence of ¹⁴C-RTD-1 in the urine and feces at 24 h indicates elimination occurs in part via urinary and biliary excretion. Based on interspecies allometric scaling, the predicted human clearance and Vss are 6.44 L/h and 28.0 L for an adult (70 kg). To achieve plasma exposures associated with therapeutic efficacy established in a murine model of LPS-induced ALI, the estimated human equivalent dose (HED) is between 0.36 and 0.83 mg/kg. The excellent safety profile demonstrated in these studies, and the efficacy observed in the murine models of SARS-CoV-1 and LPS-induced ALI support the clinical investigation of RTD-1 for treatment of COVID-19. In vivo, RTD-1 was most accumulated in the liver, kidney, and spleen. The area under the concentration-time curve (AUC) in the tissues increased proportionally to the dose, suggesting that the tissue distribution of RTD-1 is not responsible for the nonlinearity observed in the preclinical PK studies. Additional studies are needed to examine whether the prolonged retention of RTD-1 in the liver could be caused by saturation of the biliary excretion. Lastly, RTD-1 did not induce hepatocytotoxicity or affect the CYP3A4 enzyme activity, indicating that RTD-1 is less likely to cause adverse effects in the liver.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Therapeutic potential of rhesus theta defensin-1 in the treatment of inflammatory lung diseases

PDF

Therapeutic potential of host defense peptides for the treatment of cystic fibrosis lung disease

PDF

Pharmacokinetic and pharmacodynamic optimization of CFTR modulator therapy to mitigate potential drug interactions and adverse events in people with cystic fibrosis

PDF

Pharmacokinetics-pharmacodynamics of tedizolid in plasma and sputum of adults with cystic fibrosis

PDF

Modulation of the renin-angiotensin system (RAS) for the treatment of COVID-19

PDF

Therapeutic potential of rhesus theta (θ) defensin-1 in cystic fibrosis airway infection and inflammation

PDF

Immunomodulatory properties, mechanisms, and therapeutic potential of macrocyclic theta defensins

PDF

Neuropsychiatric complications of COVID-19 and major depression disorder with pharmacological strategies for management

PDF

Investigating sodium butyrate as a potential treatment for alcohol liver disease through the gut-liver axis

PDF

Clinical, functional and therapeutic analysis of CD99 in acute myeloid leukemia

PDF

Renin-angiotensin system modulation for the prevention and treatment of metabolic dysfunction

PDF

Dihydromyricetin as a potential therapeutic for Alzheimer's disease-like changes induced by social isolation

PDF

RPE secretome for the treatment of retinal degeneration in the RCS rat

PDF

Small molecule lipoxin analogue for prevention of retinal degeneration

PDF

Modulation of immune response in Systemic Lupus Erythematosus by synthetic lipoxin analogue, NAP1051

PDF

DHM reduces cognitive impairment induced by social isolation and ethanol consumption

PDF

Laser induced modulation of ocular renin-angiotensin system for treatment of dry age-related macular degeneration

PDF

Perimenopausal transition increases blood brain permeability: implications for neurodegenerative diseases

PDF

Assessment of theranostic agent for brain cancer

PDF

The therapeutic effects of dihydromyricetin (DHM) on anxiety disorders

Asset Metadata

Creator Park, A young Jenny (author)

Core Title Therapeutic potential of Rhesus theta defensin-1 for the treatment of COVID-19 pneumonia

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Clinical and Experimental Therapeutics

Degree Conferral Date 2021-12

Publication Date 10/28/2022

Defense Date 09/23/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag COVID-19,nonlinear pharmacokinetics,nonlinear PK,OAI-PMH Harvest,pharmacokinetics,Rhesus theta defensin,RTD-1

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Beringer, Paul (committee chair), D'Argenio, David (committee member), Louie, Stan (committee member)

Creator Email ayoung.jenny.park@gmail.com,ayoungpa@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC16251446

Unique identifier UC16251446

Legacy Identifier etd-ParkAYoung-10180

Document Type Dissertation

Format application/pdf (imt)

Rights Park, A Young Jenny

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu