University of Southern California Dissertations and Theses

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

(USC Thesis Other)

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

DIFFERENTIAL ROLE OF TWO COACTIVATORS, CCAR1 AND CARM1,
FOR DYSREGULATED β-CATENIN ACTIVITY IN COLORECTAL
CANCER CELL GROWTH AND GENE EXPRESSION

by

Chen-Yin Ou

_______________________________________________

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirement for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR & CELLULAR BIOLOGY)

May 2010

Copyright 2010 Chen-Yin Ou

ii
ACKNOWLEDGEMENTS
Foremost, I would like to thank my mentor Prof. Michael Stallcup for the
opportunity to work in his laboratory. I sincerely and deeply appreciate his
patience, motivation and endless encouragement throughout my thesis work.
His guidance helped me in all the time of research and writing of this thesis.
He is the best mentor one could ask for, and I am very fortunate to have him
as my mentor.
Besides my mentor, I would like to thank the rest of my thesis
committees: Prof. Baruch Frenkel, Prof. Robert Ladner, and Prof. Wange Lu,
for their encouragement, insightful comments and suggestions. I am heartily
thankful to my colleagues for providing a stimulating and fun environment in
which to learn and grow. I am especially grateful to Prof. Jeong Hoon Kim
(Sungkyunkwan University, Korea) for generous sharing of his knowledge,
experience and project. I regard him as my big brother and am so thankful for
his involvement in my life and academic growth.
Lastly, and most importantly, I would like to thank my family: my father
Chang-Fa Ou, my mother Mei-Chin Chen, my husband Chuang-Yuan Lee,
my brother Yen-Liang Ou and my pet KiKi for their support, encouragement
and unconditional love. They give me happiness and bliss. Thus, I dedicate
this thesis to them.

Chen-Yin Ou

iii
TABLE OF CONTENTS

Acknowledgements ii

List of Figures iv

Abstract v

Chapter 1: Introduction 1
Chapter 1 References 7

Chapter 2: Requirement of cell cycle and apoptosis regulator 1 for 11
target gene activation by Wnt and -catenin for
anchorage-independent growth of human
colon carcinoma cells
Chapter 2 References 55

Chapter 3: A coactivator role of CARM1 for the dysregulated 62
-catenin activity in colorectal cancer cell
growth and gene expression
Chapter 3 References 106

Chapter 4: Concluding remarks 109
Chapter 4 References 117

Bibliography 118

iv
LIST of FIGURES

Fig. 2-1: Binding of CCAR1 to -catenin and LEF1 27

Fig. 2-2: Cooperation of CCAR1 and -catenin as coactivators for 32
transcriptional activation by LEF1

Fig. 2-3: Recruitment of CCAR1 to a Wnt target gene 38
depends on -catenin

Fig. 2-4: Requirement of -catenin and CCAR1 for expression 42
of Wnt target genes

Fig. 2-5: Role of CCAR1 in anchorage-independent colony formation 47

Fig. 3-1: Interaction between CARM1 and -catenin 73

Fig. 3-2: Cooperation of CARM1 and -catenin as coactivators 78
for transcriptional activation by LEF1

Fig. 3-3: CARM1 regulates expression of endogenous 85
target genes of -catenin

Fig. 3-4: Role of CARM1 in oncogenic survival and growth 89
of HT29 colorectal carcinomas

Fig. 3-5: Wnt3a ligand induces expression of Wnt target genes 94
and recruitment of coactivators to the promoters

Fig. 3-6: CARM1 is required for expression of Wnt-induced target genes 98

v
ABSTRACT

Aberrant activation of Wnt/ -catenin signaling is recognized as a critical
factor in the etiology of colorectal cancer. Evidence has suggested that
dysregulated -catenin activity is associated with the majority of colon
cancers via activation of the expression of Wnt regulated oncogenes. In the
nucleus, -catenin regulates transcription by recruiting additional
coactivators. These coactivators all have distinct and unique functions on
Wnt/ -catenin target gene activation. Here we report two coactivators for -
catenin-mediated transcription: CCAR1 (Cell Cycle and Apoptosis Regulator
1) and CARM1 (coactivator-associated-protein-arginine-methyltransferase 1).
We show that both CCAR1 and CARM1 interact with -catenin and positively
modulate -catenin-mediated gene expression. In colorectal cancer cells,
which have constitutively high Wnt/ -catenin activity, depletion of CCAR1 or
CARM1 inhibits the expression of Wnt/ -catenin-mediated oncogenes and
suppresses anchorage-independent growth. In colorectal cancer cells that
do not have constitutively high Wnt/ -catenin activity, we found that
activation of Wnt/ -catenin signaling by treatment with Wnt3a increased -
catenin levels and the expression of a subset of Wnt target genes. Utilizing
these cells, we demonstrated that CCAR1 or CARM1 is specifically required
for the expression of these Wnt3a-induced targets. Thus, CCAR1 and

vi
CARM1 are required for expression of the target genes of Wnt and -catenin
in cells with normal or abnormal regulation of -catenin. However, the
coactivator functions of CCAR1 and CARM1 are different. While CCAR1
plays a role in stabilizing -catenin on the promoter of a Wnt target gene,
CARM1 works downstream from promoter-binding -catenin. After being
recruited to a Wnt-responsive element (WRE) by Wnt3a stimulation, CARM1
facilitates transcriptional activation by triggering downstream events, one of
which is di-methylating arginine 17 of histone H3 positioned near or at WRE
in its native chromosomal position. Therefore, the functional studies of -
catenin binding partners, CCAR1 and CARM1, provide novel and exciting
insights into the highly complex mechanism of Wnt/ -catenin target gene
activation.

1
CHAPTER 1: INTRODUCTION

LINKING COLORECTAL CANCER TO WNT/β-CATENIN
SIGNALING

Colorectal cancer, also called colon cancer, is the second leading cause of
cancer death among adults. The disease arises from benign adenomatous
polyps (also called adenomas) in the colon, and with the accumulation of
genetic alternations some develop into invasive cancers and, ultimately,
metastasize. Genetic epidemiology indicates that a significant number of
colorectal cancers occur in a dominantly inherited manner. One of the best
defined syndromes is Familial Adenomatous Polyposis (FAP) (Bienz and
Clevers, 2000; Polakis, 2000). Patients with FAP typically develop hundreds
to thousands of adenomas in their early adulthood. Although these benign
polyps are not lethal, their large numbers practically assure some will
progress into malignant carcinomas. To elucidate the molecular
pathogenesis of FAP, molecular cloning was utilized and demonstrated the
tight linkage of the disease to the adenomatous polyposis coli (APC) gene
(Polakis, 2000). Interestingly, further studies showed that not only the tumors
from FAP patients, but also sporadic colorectal tumors have mutations in

2
APC; and the latter represent approximately between 50 and over 80% of
human colorectal cancers (Bienz and Clevers, 2000; Polakis, 2000).

APC protein is reported to negatively regulate β-catenin protein level in the
absence of Wnt signaling. APC, together with Axin, function as the
scaffolding proteins and facilitate the interaction between β-catenin and
kinases CK1  (casein kinase I ) and GSK3β (glycogen synthase kinase-3β).
Following phosphorylation by CK1  and GSK3β, -catenin is then
ubiquitinated by TrCP ( -transducin repeat-containing protein, an E3
ubiquitin ligase) and destroyed by proteasome-mediated proteolysis (Klaus
and Birchmeier, 2008; MacDonald et al., 2009; Nusse, 2008). Binding of Wnt
ligands to the cognate transmembrane Frizzled receptor inhibits the β-
catenin phosphorylation and thus its degradation. Intracellular level of β-
catenin then accumulates, and surplus β-catenin translocates into the
nucleus, where it binds to the transcription factor lymphoid enhancer factor
(LEF)/T cell factor (TCF) and functions as a potent transcriptional coactivator
to activate expression of a wide range of Wnt target genes.

Aberrant elevation of β-catenin protein level leads to constitutive formation of
LEF/TCF-β-catenin complex and alters expressions of its target genes
implicated in cell proliferation (e.g. c-myc (He et al., 1998), c-jun (Mann et al.,
1999) and GPR49 (Barker et al., 2007; McClanahan et al., 2006)), inhibition

3
of apoptosis (e.g. survivin (Kim et al., 2003b; Zhang et al., 2001) and
metastasis (e.g. MMP7 (Crawford et al., 1999) and s100A4 (Stein et al.,
2006)). Proteins encoded by these Wnt/β-catenin targets likely cooperate
and promote neoplastic transformation. In support of this notion, mutations
in genes that control β-catenin stability, such as APC, Axin, or β-catenin itself,
have been associated with cancer progression. Moreover, a conditional gain
of function mutation of β-catenin in mice causes intestinal polyposis.
Accordingly, dysregulated β-catenin is associated with tumorigenesis, and
the oncogenic effects of β-catenin reside in its transcriptional activity to over-
activate expression of genes involved in tumor progression.

TRANSCRIPTION UNDER THE CONTROL OF NUCLEAR -
CATENIN AND COACTIVATORS

When binding to the Wnt regulated elements (WRE) that control the
expression of Wnt target genes, β-catenin interacts with DNA-binding
LEF/TCF to form a bipartite transcription activator by displacing the
corepressors Groucho and CtBP (Mosimann et al., 2009). β-catenin then
serves as a platform for recruiting additional coactivators to promoters of
LEF/TCF target genes. In general, coactivators are not required for basal
transcription, but for efficient activation of transcription. Recruitment of

4
coactivators via β-catenin assists in transcriptional activation by two
mechanisms: 1) by local modulation of chromatin conformation at or near
WRE; 2) by recruitment and activation of RNA polymerase II and its
associated basal transcription machinery.

To date, several coactivators that are involved in Wnt/β-catenin signaling
have been presented, including Brg1 (the ATPase subunit of SWI/SNF
chromatin remodeling complex) (Barker et al., 2001), p300/CBP (histone
acetyltransferases) (Hecht et al., 2000; Miyagishi et al., 2000; Sun et al.,
2000; Takemaru and Moon, 2000), and MED12 (component of the Mediator
complex which recruits RNA polymerase II) (Carrera et al., 2008). The
identification of these nuclear β-catenin interaction partners has significantly
added our knowledge of β-catenin function as a transcription regulator.
However, to better understand the highly complex mechanism of Wnt/β-
catenin target gene activation, it is important to indentify novel β-catenin
interaction partners and determine their molecular and physiological roles in
Wnt signaling.

CCAR1 (cell cycle and apoptosis regulator 1) serves as a key signaling
transducer of either apoptosis (Rishi et al., 2003) (Rishi et al., 2006) or
contradictory proliferation signaling cascades (Kim et al., 2008) when in
response to different input signals. CCAR1 harbors a central SAF-Acinus-

5
PIAS (SAP) domain which is found in many chromatin-associated proteins.
CCAR1 also has two tandem coiled-coil domains known for protein-protein
interaction and a poly-A-binding protein (PABP) domain located at the C-
terminal end. These variable functional or other unidentified domains
contribute to a dual role of CCAR1 in the control of signaling cascades, either
being a growth-promoting factor or a growth-inhibitory factor. In addition,
CCAR1 is reported to act as a coactivator to multiple classes of transcription
factors (e.g. p53, estrogen receptor  (ER) and glucocorticoid receptor (GR)
(Kim et al., 2008)).

CARM1 (coactivator-associated arginine methyltransferase 1) belongs to the
family of protein arginine methyltransferases (PRMTs), which could transfer
the methyl group from S-adenosylmethionine to the guanidino group of
arginines in protein substrates (Bedford and Clarke, 2009; Lee and Stallcup,
2009). Structurally, CARM1 can be divided into three parts. The central part
is the catalytic methyltransferase domain, which is conserved among all
PRMTs. The N-terminal and C-terminal domains of CARM1 are unique and
have been shown to be important for transcriptional activation. Additionally,
CARM1 has been reported to function as a coactivator for several
transcription factors (e.g. ER (Chen et al., 1999; Frietze et al., 2008), p53 (An
et al., 2004), NF- B (Covic et al., 2005; Miao et al., 2006), IFN-  (Zika et al.,
2005) and MEF2C (Chen et al., 2002)), and it methylates a number of

6
proteins that are involved in transcription and RNA processing, including
histone H3, p300/CBP, AIB1 (amplified in breast cancer-1), PABP1 (poly(A)-
binding protein 1), and CA150 (splicing factor) (Cheng et al., 2007). Thus,
CARM1 plays a critical role in gene expression as a positive regulator.

In this thesis, we investigated the role of CCAR1 and CARM1 in Wnt/β-
catenin signaling. CCAR1 and CARM1 are both required for efficient
expression of β-catenin regulated genes. Nevertheless, they have distinct
and unique functions in assisting β-catenin-controlled gene expression.
While CCAR1 is involved in stabilization of β-catenin at the WRE, CARM1
works downstream from WRE-binding β-catenin. CARM1 remodels the
chromatin at WRE by di-methylating histone H3 at arginine 17. Importantly,
both of them are necessary for neoplastic transformation properties of human
colorectal cancers. Thereby, our works provided a novel insight into β-
catenin-mediated tumorgenesis, and coactivator targeting may be feasible for
future therapeutic interventions in cancers involving aberrantly activated
Wnt/β-catenin signaling.

7
Chapter 1 References
An, W., Kim, J., and Roeder, R.G. (2004). Ordered cooperative functions of
PRMT1, p300, and CARM1 in transcriptional activation by p53. Cell 117,
735-748.
Barker, N., Hurlstone, A., Musisi, H., Miles, A., Bienz, M., and Clevers, H.
(2001). The chromatin remodelling factor Brg-1 interacts with beta-catenin to
promote target gene activation. EMBO J 20, 4935-4943.
Barker, N., van Es, J.H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen,
M., Haegebarth, A., Korving, J., Begthel, H., Peters, P.J., et al. (2007).
Identification of stem cells in small intestine and colon by marker gene Lgr5.
Nature 449, 1003-1007.
Bedford, M.T., and Clarke, S.G. (2009). Protein arginine methylation in
mammals: who, what, and why. Mol Cell 33, 1-13.
Bienz, M., and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling.
Cell 103, 311-320.
Carrera, I., Janody, F., Leeds, N., Duveau, F., and Treisman, J.E. (2008).
Pygopus activates Wingless target gene transcription through the mediator
complex subunits Med12 and Med13. Proc Natl Acad Sci U S A 105, 6644-
6649.
Chen, D., Ma, H., Hong, H., Koh, S.S., Huang, S.M., Schurter, B.T., Aswad,
D.W., and Stallcup, M.R. (1999). Regulation of transcription by a protein
methyltransferase. Science 284, 2174-2177.
Chen, S.L., Loffler, K.A., Chen, D., Stallcup, M.R., and Muscat, G.E. (2002).
The coactivator-associated arginine methyltransferase is necessary for
muscle differentiation: CARM1 coactivates myocyte enhancer factor-2. J Biol
Chem 277, 4324-4333.
Cheng, D., Cote, J., Shaaban, S., and Bedford, M.T. (2007). The arginine
methyltransferase CARM1 regulates the coupling of transcription and mRNA
processing. Mol Cell 25, 71-83.
Covic, M., Hassa, P.O., Saccani, S., Buerki, C., Meier, N.I., Lombardi, C.,
Imhof, R., Bedford, M.T., Natoli, G., and Hottiger, M.O. (2005). Arginine
methyltransferase CARM1 is a promoter-specific regulator of NF-kappaB-
dependent gene expression. EMBO J 24, 85-96.

8
Crawford, H.C., Fingleton, B.M., Rudolph-Owen, L.A., Goss, K.J., Rubinfeld,
B., Polakis, P., and Matrisian, L.M. (1999). The metalloproteinase matrilysin
is a target of beta-catenin transactivation in intestinal tumors. Oncogene 18,
2883-2891.
Frietze, S., Lupien, M., Silver, P.A., and Brown, M. (2008). CARM1 regulates
estrogen-stimulated breast cancer growth through up-regulation of E2F1.
Cancer Res 68, 301-306.
He, T.C., Sparks, A.B., Rago, C., Hermeking, H., Zawel, L., da Costa, L.T.,
Morin, P.J., Vogelstein, B., and Kinzler, K.W. (1998). Identification of c-MYC
as a target of the APC pathway. Science 281, 1509-1512.
Hecht, A., Vleminckx, K., Stemmler, M.P., van Roy, F., and Kemler, R.
(2000). The p300/CBP acetyltransferases function as transcriptional
coactivators of beta-catenin in vertebrates. EMBO J 19, 1839-1850.
Kim, J.H., Yang, C.K., Heo, K., Roeder, R.G., An, W., and Stallcup, M.R.
(2008). CCAR1, a key regulator of mediator complex recruitment to nuclear
receptor transcription complexes. Mol Cell 31, 510-519.
Kim, P.J., Plescia, J., Clevers, H., Fearon, E.R., and Altieri, D.C. (2003).
Survivin and molecular pathogenesis of colorectal cancer. Lancet 362, 205-
209.
Klaus, A., and Birchmeier, W. (2008). Wnt signalling and its impact on
development and cancer. Nat Rev Cancer 8, 387-398.
Lee, Y.H., and Stallcup, M.R. (2009). Minireview: protein arginine methylation
of nonhistone proteins in transcriptional regulation. Mol Endocrinol 23, 425-
433.
MacDonald, B.T., Tamai, K., and He, X. (2009). Wnt/beta-catenin signaling:
components, mechanisms, and diseases. Dev Cell 17, 9-26.
Mann, B., Gelos, M., Siedow, A., Hanski, M.L., Gratchev, A., Ilyas, M.,
Bodmer, W.F., Moyer, M.P., Riecken, E.O., Buhr, H.J., et al. (1999). Target
genes of beta-catenin-T cell-factor/lymphoid-enhancer-factor signaling in
human colorectal carcinomas. Proc Natl Acad Sci U S A 96, 1603-1608.
McClanahan, T., Koseoglu, S., Smith, K., Grein, J., Gustafson, E., Black, S.,
Kirschmeier, P., and Samatar, A.A. (2006). Identification of overexpression of
orphan G protein-coupled receptor GPR49 in human colon and ovarian
primary tumors. Cancer Biol Ther 5, 419-426.

9
Miao, F., Li, S., Chavez, V., Lanting, L., and Natarajan, R. (2006).
Coactivator-associated arginine methyltransferase-1 enhances nuclear
factor-kappaB-mediated gene transcription through methylation of histone H3
at arginine 17. Mol Endocrinol 20, 1562-1573.
Miyagishi, M., Fujii, R., Hatta, M., Yoshida, E., Araya, N., Nagafuchi, A.,
Ishihara, S., Nakajima, T., and Fukamizu, A. (2000). Regulation of Lef-
mediated transcription and p53-dependent pathway by associating beta-
catenin with CBP/p300. J Biol Chem 275, 35170-35175.
Mosimann, C., Hausmann, G., and Basler, K. (2009). Beta-catenin hits
chromatin: regulation of Wnt target gene activation. Nat Rev Mol Cell Biol 10,
276-286.
Nusse, R. (2008). Wnt signaling and stem cell control. Cell Res 18, 523-527.
Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851.
Rishi, A.K., Zhang, L., Boyanapalli, M., Wali, A., Mohammad, R.M., Yu, Y.,
Fontana, J.A., Hatfield, J.S., Dawson, M.I., Majumdar, A.P., et al. (2003).
Identification and characterization of a cell cycle and apoptosis regulatory
protein-1 as a novel mediator of apoptosis signaling by retinoid CD437. J Biol
Chem 278, 33422-33435.
Rishi, A.K., Zhang, L., Yu, Y., Jiang, Y., Nautiyal, J., Wali, A., Fontana, J.A.,
Levi, E., and Majumdar, A.P. (2006). Cell cycle- and apoptosis-regulatory
protein-1 is involved in apoptosis signaling by epidermal growth factor
receptor. J Biol Chem 281, 13188-13198.
Stein, U., Arlt, F., Walther, W., Smith, J., Waldman, T., Harris, E.D., Mertins,
S.D., Heizmann, C.W., Allard, D., Birchmeier, W., et al. (2006). The
metastasis-associated gene S100A4 is a novel target of beta-catenin/T-cell
factor signaling in colon cancer. Gastroenterology 131, 1486-1500.
Sun, Y., Kolligs, F.T., Hottiger, M.O., Mosavin, R., Fearon, E.R., and Nabel,
G.J. (2000). Regulation of beta -catenin transformation by the p300
transcriptional coactivator. Proc Natl Acad Sci U S A 97, 12613-12618.
Takemaru, K.I., and Moon, R.T. (2000). The transcriptional coactivator CBP
interacts with beta-catenin to activate gene expression. J Cell Biol 149, 249-
254.

10
Zhang, T., Otevrel, T., Gao, Z., Ehrlich, S.M., Fields, J.Z., and Boman, B.M.
(2001). Evidence that APC regulates survivin expression: a possible
mechanism contributing to the stem cell origin of colon cancer. Cancer Res
61, 8664-8667.
Zika, E., Fauquier, L., Vandel, L., and Ting, J.P. (2005). Interplay among
coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-
gamma-inducible MHC-II gene expression. Proc Natl Acad Sci U S A 102,
16321-16326.

11
CHAPTER 2: Requirement of cell cycle and apoptosis
regulator 1 for target gene activation by Wnt and β-
catenin and for anchorage-independent growth of
human colon carcinoma cells

INTRODUCTION

The Wnt/β-catenin signaling cascade controls a variety of cell fate decisions
during development, and is important for cell proliferation and self-renewal of
many types of stem cells, including intestinal epithelial and hematopoietic
stem cells (Fuerer et al., 2008; Hayward et al., 2008; McDonald et al., 2006;
Nusse, 2008; Reya and Clevers, 2005). Misregulation of this signaling has
been recognized as a hallmark of many aggressive human cancers (Fuerer
et al., 2008; McDonald et al., 2006; Reya and Clevers, 2005). Indeed,
genetic alterations of genes involved in β-catenin degradation have been
reported in various tumors (Bienz and Clevers, 2000; Dahmen et al., 2001;
Kinzler and Vogelstein, 1996; Liu et al., 2000; Polakis, 2000; Satoh et al.,
2000; Wu et al., 2001). In addition, mutational analyses of clinical specimens
and experiments with transgenic mice have proven the importance of β-
catenin stabilization in adenoma formation, which is the earliest event of

12
colorectal carcinogenesis. Therefore, the Wnt pathway has been causally
linked to various cancers, most notably to colorectal cancers.

Secreted Wnt proteins bind to Frizzled receptors to initiate the signaling
cascade (Willert et al., 2003). In the absence of Wnt signals, there is only a
small pool of cytosolic -catenin under normal physiological conditions, due
to constitutive phosphorylation of -catenin via a multi-protein complex
composed of Axin, casein kinase I  glycogen synthase kinase-3β, and
tumor suppressor adenomatous polyposis coli (Ha et al., 2004; Xing et al.,
2003; Xing et al., 2004). Phosphorylated -catenin is then ubiquitinated by
TrCP and destroyed by proteasome-mediated proteolysis. Wnt signaling
inhibits the function of this complex and thereby stabilizes β-catenin,
resulting in increased cytoplasmic -catenin, some of which then translocates
into the nucleus. -catenin has been recognized as a pivotal factor for cancer
development, as its interaction with various transcriptional activators such as
lymphoid enhancer-binding factor (LEF)/T cell factor (TCF) family members
(Stadeli et al., 2006), NF- B(Deng et al., 2002; Kim et al., 2005), Prop1
(Olson et al., 2006), and nuclear receptors (NR) (Easwaran et al., 1999;
Palmer et al., 2001; Shah et al., 2003; Song et al., 2003) are required for
expression of a subset of target genes involved in regulation of cell
proliferation, apoptosis and tumor metastasis. For example, reported
downstream targets of -catenin-LEF/TCF-regulated transcription include

13
genes involved in cell proliferation (e.g. c-Myc (He et al., 1998) and c-Jun
(Mann et al., 1999)), inhibition of apoptosis (e.g. survivin (Kim et al., 2003b;
Zhang et al., 2001)), and tumor metastasis (e.g. MMP7 (Crawford et al.,
1999)). Hence, to better understand the contribution of Wnt/β-catenin
deregulation in cancer, it is crucial to explore how β-catenin controls and
regulates the transcription of these target genes.

As a potent primary coactivator for LEF/TCF transcription factors, β-catenin
binds directly to DNA-bound LEF/TCF proteins and serves as a platform for
recruiting additional secondary coactivators to promoters of a variety of
LEF/TCF target genes. Generally, these secondary coactivators assist β-
catenin in mediating transcriptional activation either through modulation of
chromatin conformation or recruitment and activation of RNA polymerase II
and its associated basal transcription machinery (Stadeli et al., 2006). To
date, several coactivators have been reported to interact with β-catenin,
including histone methyltransferases CARM1 (Koh et al., 2002) and
MLL/Set1 (Sierra et al., 2006); histone acetyltransferases p300, CBP (Hecht
et al., 2000; Miyagishi et al., 2000; Sun et al., 2000; Takemaru and Moon,
2000), and TRRAP/Tip60 (Bauer et al., 2000; Feng et al., 2003; Kim et al.,
2005); the Brg1 ATPase subunit of the SWI/SNF chromatin remodeling
coplex (Barker et al., 2001); the MED12 component of the Mediator complex
which recruits RNA polymerase II (Carrera et al., 2008); pygopus (Carrera et

14
al., 2008; Parker et al., 2002); Casein Kinase 2 (CK2) (Wang and Jones,
2006); FLAP1 (Lee and Stallcup, 2006); Bcl9/Legless (Kramps et al., 2002);
GAC63(Chen et al., 2007); GRIP1 (Li et al., 2004); and CoCoA (Yang et al.,
2006). Although a number of interacting proteins have been identified, the
molecular details of their cooperation with β-catenin to control transcription
are still poorly understood. To further explore the mechanism of coactivator
function by β-catenin, it is important to define the specific functional
relationships of β-catenin with the interacting proteins and determine their
molecular and physiological roles in Wnt signaling.

Cell Cycle and Apoptosis Regulator 1 (CCAR1) is a regulator of apoptosis
signaling as well as cell proliferation. For example, CCAR1 triggers apoptosis
signaling in a retinoid-dependent manner (Rishi et al., 2003). Additionally,
cell growth-inhibitory and apoptosis-promoting effects elicited by inhibition of
epidermal growth factor receptor involve CCAR1 (Rishi et al., 2006). On the
other hand, CCAR1 has also been shown to be important for estrogen-
induced gene expression, and estrogen-dependent growth of human breast
cancer cells (Kim et al., 2008). Thus, previous studies suggest that CCAR1
can serve as a key intracellular transducer of either proliferation or apoptosis
signaling pathways in response to different signals. Likewise, Wnt ligands are
known as critical stimuli of the cellular communication network controlling
multiple biological processes such as proliferation and cell fate determination.

15
In addition, several coactivators for estrogen receptor and other nuclear
receptors have also been found to cooperate with β-catenin in Wnt signaling.
Hence, we speculated that CCAR1 may play a role in Wnt signaling. Here,
we report that CCAR1 is a functional binding partner of β-catenin and assists
β-catenin in transcriptional activation of Wnt target genes, some of which are
implicated in proliferation and metastasis. In addition, depletion of CCAR1
inhibited the anchorage-independent growth of human colorectal cancer cells.
Thus our results provided a novel insight into β-catenin-mediated
tumorgenesis.

16
MATERIALS AND METHODS

Plasmids: Vectors pGEX-4T1-β-catenin, pGEX-5X1-CCAR1 and pGEX-
5X1-LEF1 for bacterially expressed glutathione S-transferase (GST) fusion
proteins, and luciferase reporter plasmids pGL3OT (for LEF1) and GK1-LUC
(for Gal4) were described previously (Kim et al., 2008; Li et al., 2004). For
expression of N-terminal Gal4 DNA binding domain (DBD) fusion proteins,
pM-β-catenin and pM-LEF1 were constructed as described previously (Li et
al., 2004). The following mammalian expression vectors were described in
previous publications as follows: pSG5.HA-LEF1, pSG5.HA-β-catenin and
the same vector encoding various HA-tagged fragments of β-catenin (Li et al.,
2004), pSG5.HA-CoCoA (Kim et al., 2003a), pSG5.HA-CARM1 (Chen et al.,
1999), pCMV-p300 (Puri et al., 1997) and pSG5.HA-CCAR1 (Kim et al.,
2008). Plasmids encoding CCAR1 fragments (amino acids 290-630, 471-630,
631-1146, 670-900, and 955-1146) were created by PCR amplification and
subcloning into EcoRI and XhoI sites of pSG5.HA (Chen et al., 1999); and
CCAR1 1-249 and CCAR1 1-289 were cloned into BamHI and XhoI sites of
pSG5.HAb (gift from Martin A. Privalsky, University of California at Davis).
For lentivirus production, the vesicular stomatitis virus envelope protein G
(VSV-G) expression construct pMD.G1, the packaging vector pCMV R8.91
(Zufferey et al., 1997), and the transfer vector pHRCMVpuroSin8 (Zhao et al.,
2002) were used. The β-catenin short hairpin RNA (sh-β-catenin) transfer

17
vectors were produced with PCR products containing the U6 promoter and
sh-β-catenin coding sequence. The PCR products were inserted into SpeI
and PstI sites of pHRCMVpuroSin8. Short hairpin RNA encoding sequences
targeting β-catenin were as follows: 5’-
AAAACTGCAGAAAAAGCTTCCAGACACGTATCATGCGTTTCTCTTGAAAA
CGCACGATAGCGCGTCTGGAAGCGGTGTTTCGTCCTTTCCACAAG-3’.
The sh-CCAR1 transfer vector was described previously (Kim et al., 2008).

Cell culture and luciferase reporter gene assay: HT29 cells were
maintained in McCoy’s 5a with 10% fetal bovine serum (FBS) and penicillin
and streptomycin (PenStrep). CV-1, COS-7 and 293T cell lines were cultured
in Dulbeco Modified Eagle Medium (DMEM) with 10% FBS and PenStrep.
For transient reporter gene assay, CV-1 cells were plated at 10
5
cells per
well in 12-well plates and transiently transfected by TargeFect F1 reagent
(Targeting Systems) according to the manufacturer’s protocol. Total DNA in
every well was adjusted to a constant amount by adding empty expression
vectors. Forty-eight hours after transfection, luciferase assays on cell
extracts were performed with Promega Luciferase Assay kit. Data shown are
the mean and range of variation of duplicate transfected cultures from a
single experiment and are representative of at least two independent
experiments. Luciferase activities were not normalized to internal controls,
because expression of so-called constitutive reporter genes is affected by

18
over-expression of many coactivators. Instead, multiple independent
experiments with multiple plasmid preparations were used to demonstrate
reproducibility.

GST pull-down assay: HA- -catenin, HA-LEF1 and HA-CCAR1 were
synthesized in vitro by TNT-Quick coupled transcription/translation system
(Promega) according to the manufacturer’s protocol. These in vitro
synthesized proteins were then used for GST pull-down as described
previously (Kim et al., 2003a). Briefly, in vitro translated proteins and
immobilized GST fusion proteins were mixed with NETN buffer (200 mM
NaCl, 1 mM EDTA, 20 mM Tris-HCl, PH 7.6 and 0.01% NP-40) and
incubated overnight at 4
o
C. Next day, beads were washed with NETN three
times and bound proteins were analyzed by immunoblot with anti-HA
antibodies (Roche Applied Science). The amount of GST used as a negative
control was always higher than that of GST fusion proteins.

Coimmunoprecipitation: COS-7 cells were grown in 100-mm-diameter
dishes seeded with 10
6
cells, and transfected with expression plasmids
pSG5.HA-CCAR1 and pSG5.HA- -catenin using TargeFect F2 reagent
(Targeting Systems) according to the manufacturer’s protocol. Two days
after transfection cells were harvested with RIPA buffer (50 mM Tris-HCl, pH
8.0, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 0.1% sodium dodecyl sulfate)

19
supplemented with protease Inhibitor cocktail (Roche Applied Science), and
cell extracts were used for immunoprecipitation with antibodies against -
catenin (BD Biosciences), normal mouse IgG (Santa Cruz Biotechnology),
normal rabbit IgG (Bethyl Laboratories) or CCAR1 (Bethyl Laboratories).
Protein A/G beads (Santa Cruz Biotechnology) were added and the reaction
was incubated for 3 h at 4
o
C. Beads were then washed with RIPA buffer,
and bound proteins were analyzed by immunoblot with anti-HA antibody.

Chromatin immunoprecipitation (ChIP) and sequential ChIP
assays: ChIP assays were performed as described previously (Kim et al.,
2003a). Briefly, HT29 cells were grown in 150-mm cell culture dishes and
treated with 1% formaldehyde for 20 min at room temperature. Cross-linking
reactions were quenched with glycine, and cells were harvested and
sonicated. After a pre-clearing step with Protein A/G beads (Santa Cruz
Biotechnology), chromatin fractions were subjected to immunoprecipitation
with 4 g of -catenin antibodies (Santa Cruz Biotechnology) or 8 g of
CCAR1 antibodies (Bethyl Laboratories 435A unless specified otherwise).
Protein A/G beads were added to capture immune complexes, which were
then washed extensively, eluted and heated to reverse formaldehyde cross-
linking. Purified immunoprecipitated DNA and total input DNA were utilized
as template in quantitative real-time PCR (qPCR) using a Stratagene
Mx3000P instrument. The qPCR reactions contained SYBR Green QPCR

20
Master Mix (Stratagene) and 150 nM of forward and reverse primers, and
were incubated through 40 cycles using the following conditions: 95
o
C for 30
sec, 60
o
C for 1 min, and 72
o
C for 30 sec. After the end of amplification, a
melting curve analysis was carried out to confirm the homogeneity of
products from each reaction. The primers used were as follows: hAxin2
3’UTR (nucleotides +31681 to +31784 relative to transcription start site) (Li
and Wang, 2008); hAxin2 WRE (nucleotides -284 to -384 relative to
transcription start site), 5’-TTTATAAAGTCCTCCAAGCC-3’ (forward) and 5’-
AAGAACTGCAAGCAAGCAGATT-3’ (reverse); DKK1 Upstream Negative
Control site (nucleotides -4462 to -4559 relative to transcription start site) (Li
and Wang, 2008); DKK1 WRE (nucleotides -827 to -931 relative to
transcription start site) (Li and Wang, 2008); c-Myc WRE (nucleotides -1223
to -1421 relative to transcription start site) (Li and Wang, 2008); c-Myc ORF
(nucleotides +2780 to +2866 relative to transcription start site (Li and Wang,
2008). The relative standard curve method was utilized to determine the
relative amount of immunoprecipitated DNA and input (unfractionated
chromatin) signals. Signals from immunoprecipitated DNA were normalized
to their respective input, and data were represented as the % of Input. In
some experiments relative recruitment was calculated by dividing specific
antibody signal by the signal from IgG_2 (Bethyl Laboratories). Data shown
are mean and range of variation for two PCR reactions from a single
experiment. In sequential ChIP experiments (Kim et al., 2003a), crosslinked

21
DNA-protein complexes were eluted from primary immunoprecipitates by
incubation with 10 mM DTT at 37
o
C for 30 min. Eluates were then diluted
1:50 in IP dilution buffer and subjected to secondary immunoprecipitation
with the indicated antibodies.

Real-time reverse transcriptase PCR (qRT-PCR) assays: Total
RNA from cell lines was extracted using Trizol reagent (Invitrogen), and first-
strand cDNA was synthesized by reverse transcribing 0.1 g of total RNA
using iScript cDNA Synthesis Kit (Bio-Rad). 1 l of the reverse transcription
reaction was amplified by qPCR using the following primers: -actin (Kim et
al., 2008); -tubulin 5’-GATCTGGAGCCTACGGTCATTG-3’ (forward) and 5’-
GAGCTGCTCTGGGTGGAAGA-3’ (reverse); GAPDH (Teyssier et al., 2005);
MMP7 (Li and Wang, 2008); BMP4 5’-CACTGGTCCCTGGGATGTTC
(forward) and 5’-GATCCACAGCACTGGTCTTGACTA-3’ (reverse) ;c-myc 5’-
CTCTCAACGACAGCAGCCCG-3’ (forward) and 5’-
CAACATCGATTTCTTCCTCATCTTC-3’ (reverse); Axin2 5’-
CCACACCCTTCTCCAATCCA-3’ (forward) and 5’-
TGGACACCTGCCAGTTTCTTT-3’ (reverse); DKK1 5’-
AAACGCTGCATGCGTCACGCTAT-3’ (forward) and 5’-
AAAGCTTTCAGTGATGGTTT-3’ (reverse); c-jun 5’-
GAAGTCGGCGAGCGGCTGCA-3’ (forward) and 5’-
TTCTCTTGCGTGGCTCTC-3’ (reverse). Results shown are mean and range

22
of variation for duplicate PCR reactions from a single cDNA preparation, and
a minimum of two independent experiments were performed. Relative
expression levels of target genes were determined by the standard curve
method. All samples were corrected for total input RNA by normalizing to -
tubulin mRNA.

Cell Proliferation assay: HT29 cells (1000 cells per well) were seeded
in 24-well dishes in McCoy’s 5a medium supplemented with 10% FBS. Cell
numbers were determined by MTS assay (Promega) on the indicated days
after plating. Results shown are the mean and SD from triplicate cultures of a
single experiment and are representative of 2 independent experiments.

Colony formation in soft agar: 0.8% of Noble agar (VWR) in McCoy’s
5a medium supplemented with 10% FBS and 1% PenStrep was poured into
60-mm petri dishes and allowed to solidify at room temperature. For each cell
pool, 4000 cells were suspended in 0.3% molten agar and layered on top of
the solidified 0.8 % agar in each dish. These dishes were then placed at
37
o
C and 5 % CO
2
in a cell culture incubator for 2-4 weeks until colonies
were visible. During that period, 1 ml of media was added approximately
every two days to prevent drying of the agar gel. Right before colony
counting, dishes were fixed with 100 % ethanol for 15 min and then stained

23
with 0.1 % crystal violet (VWR) in phosphate-buffered saline (3.2 mM
Na
2
HPO
4
, 0.5 mM KH
2
PO
4
, 1.3 mM KCl, 135 mM NaCl, pH 7.4). The
colonies in each dish were counted by Molecular Imager Gel Doc XR System
(Bio-Rad) and photographed by Leica microscopy (Plan-Apo 1x). Three
dishes were set up for each cell line and results shown are mean and SD of
the triplicate plates for a single experiment, which is representative of 3
independent experiments.

Lentivirus packaging and virus transduction: Lentiviral particles
were generated as described previously (Naldini et al., 1996). Briefly, for
each 100-mm plate of 293T cells, 8 g of the transducing vector
(pHRCMVpuroSin8- -catenin or pHRCMVpuroSin8-CCAR1), 2.5 g of the
envelop plasmid pMD.G1 and 7.5 g of the packaging vector pCMV R8.91
were co-transfected by lipofectamine 2000 (Invitrogen), according to the
manufacturer’s instructions. The medium was changed the next day, and
viruses were harvested by collecting the culture medium at 48 and 72 hours
post-transfection. Conditioned medium from 2 days was pooled, passed
through a 0.45- m filter and stored at -80
o
C. For lentiviral transduction,
target cells were seeded in 12-well plates and reached 80% of confluency at
the day of infection. Conditioned medium containing the virus was added to
cells along with polybrene (Millipore) at the final concentration of 6 g/ml.
Infection was allowed to proceed for 12–16 hours before the addition of

24
selection medium containing puromycin (5 g/ml). Resistant cells were
pooled and used for the indicated experiments.

25
RESULTS

Interaction between CCAR1 and -catenin

To investigate a possible physical interaction between -catenin and CCAR1,
CCAR1 or -catenin synthesized in vitro was incubated with either GST,
GST- -catenin, or GST-CCAR1 bound to glutathione-Sepharose, and the
bound proteins were analyzed by immunoblot. CCAR1 was bound by GST- -
catenin, but not by GST, and -catenin was bound by GST-CCAR1 but not
by GST alone (Fig. 2-1A, upper and middle panels). These data suggest that
-catenin may bind directly to CCAR1. LEF1 synthesized in vitro also bound
specifically to GST-CCAR1, suggesting another possible direct interaction
(lower panel).

To examine whether CCAR1 associates with -catenin in cultured cells, co-
immunoprecipitation was carried out with extracts of COS-7 cells transiently
transfected with plasmids encoding HA- -catenin and HA-CCAR1. CCAR1
was specifically co-precipitated by antibodies against -catenin, but not by
normal IgG (Fig. 2-1B, upper panel). Conversely, -catenin was precipitated
by antibodies against CCAR1, but not by IgG (Fig. 2-1B, lower panel). Thus
interaction between CCAR1 and -catenin can occur in vitro and in vivo.

26

To further map the region(s) of -catenin which is (are) responsible for its
interaction with CCAR1, GST-CCAR1 was incubated in GST pull down
assays with five -catenin fragments which were synthesized in vitro (amino
acids 1-140, 1-664, 520-781, 624-781 and 665-781). Three overlapping C-
terminal fragments of -catenin (amino acids 520-781, 624-781 and 665-781)
bound specifically to GST-CCAR1 (Fig. 2-1C), indicating that the carboxy-
terminus of -catenin is the major CCAR1 binding domain. Reciprocal
mapping of the -catenin-binding region(s) in CCAR1 (Fig. 2-1D) identified
three separate domains of CCAR1 (amino acids 1-249, 471-630 and 670-900)
capable of binding to -catenin. Interestingly, addition of 40 amino acids to
the 1-249 fragment of CCAR1 (amino acids 1-289) strongly inhibited the
interaction between CCAR1 and -catenin, suggesting that amino acids 250-
289 of CCAR1 may regulate this interaction.

CCAR1 cooperates with -catenin as a coactivator for LEF1

To address whether binding of CCAR1 to -catenin can modulate -catenin-
directed transcriptional activity, we monitored the effect of over-expression of

27

Fig. 2-1 Binding of CCAR1 to -catenin and LEF1. (A) GST pull down
assays were performed as described in Experimental Procedures, using
bacterially produced GST fusion proteins bound to glutathione-Sepharose
beads and HA-tagged proteins translated in vitro. Bound proteins were
detected by immunoblot analysis using antibodies against HA-tag. (B) HA-
tagged -catenin and CCAR1 were expressed in COS-7 cells by transient
transfection, and immunoprecipitation (IP) was performed on cell extracts,
using the indicated antibodies against -catenin or CCAR1, or normal IgG.
Precipitated proteins were detected by immunoblot with antibodies against
HA-tag. (C) HA-tagged fragments of -catenin synthesized in vitro were
incubated with GST-CCAR1 in GST pull-down assays, and bound proteins
were detected by immunoblot using antibodies against the HA-tag, as
described in (A). The diagram shows the 12 armadillo repeats of -catenin
flanked by N-terminal and C-terminal domains. (D) GST pull-down assays
were performed as in (C) using GST- -catenin and HA-tagged fragments of
CCAR1. The diagram shows the domains of CCAR1, including regions with a
high content of specific amino acids, a SAF-Acinus-PIAS (SAP) domain, and
a poly-A binding protein (PABP) homology domain. GST pull down assays
were repeated at least twice, with results equivalent to those shown.

28
Fig. 2-1: Continued

29
Fig. 2-1: Continued

30
CCAR1 on transcriptional activation by -catenin tethered to Gal4 DBD.
Compared to Gal4 DBD alone, Gal4 DBD fused to -catenin strongly
activated expression from a luciferase reporter plasmid controlled by Gal4
response elements (Fig. 2-2A), and this activity was further enhanced by
CCAR1 in a dose-dependent manner. However, CCAR1 over-expression
had little or no effect on the activity of Gal4 DBD or Gal4 DBD fused to LEF1.
Thus, even though CCAR1 can bind to LEF1 in vitro (Fig. 2-1A, lower panel),
CCAR1 was unable to enhance transcriptional activation by LEF1. These
results indicate that CCAR1 and -catenin have a functional as well as a
physical interaction.

Members of the LEF/TCF family of DNA-binding proteins recruit -catenin,
which then serves as a platform for recruiting additional transcriptional
coactivators to activate transcription of LEF/ -catenin target genes. Since
CCAR1 interacts with LEF1 and -catenin, we tested whether CCAR1 can
function as a coactivator for LEF1-mediated gene transcription, using the
transiently transfected luciferase reporter plasmid pGL3OT, which is
controlled by LEF/TCF-responsive elements. Over-expression of LEF1 alone
produced a small enhancement of luciferase activity, and over-expression of
-catenin further enhanced luciferase activity (Fig. 2-2B). CCAR1 expression
with LEF1 and -catenin caused a dramatic additional enhancement.
However, without over-expression of -catenin, CCAR1 had very little effect

31
on transcriptional activation by LEF1. The weak enhancement of LEF1
activity by CCAR1 in the absence of over-expressed -catenin may result
from endogenous -catenin. Thus although CCAR1 alone is a weak
coactivator for LEF1, CCAR1 can cooperate synergistically with -catenin to
cause a dramatic enhancement of transcriptional activation by LEF1.

The very large number of transcriptional coactivators discovered to date
suggests that Initiation of transcription is a very complex process. We
therefore tested whether CCAR1 can cooperate with several other
coactivators that have been shown to associate with and enhance the
coactivator activity of -catenin: CoCoA (Yang et al., 2006), p300 (Sun et al.,
2000) and CARM1 (Koh et al., 2002). For these transient transfection
experiments, we used reduced levels of the plasmid encoding LEF1, since
we have previously shown that these conditions are appropriate for
observing synergistic cooperation among multiple coactivators (Lee et al.,
2002). We observed synergistic cooperation of CCAR1 and -catenin with
CARM1 and p300 (Fig. 2-1C) and with CoCoA (Fig. 2-1D). Furthermore, this
synergy was completely dependent on the co-expression of -catenin (data
not shown). These results are consistent with the conclusion that -catenin
associates directly with DNA-bound LEF1 and recruits additional coactivators,
such as CCAR1, CARM1, p300, and CoCoA, each of which makes a specific

32

Fig. 2-2 Cooperation of CCAR1 and -catenin as coactivators for
transcriptional activation by LEF1. (A) CV-1 cells were transfected in 12-
well plates with luciferase reporter plasmid GK1-Luc (300 ng) controlled by
Gal4 response elements, pM plasmids encoding Gal4-DBD alone or fused to
LEF1 or -catenin (100 ng), and pSG5.HA-CCAR1 (300, 600 or 900 ng).
Luciferase assays were conducted on cell extracts as described in
Experimental Procedures. Results shown are from a single experiment and
are representative of 3 independent experiments. (B) CV1 cells were
transfected with luciferase reporter plasmids pGL3OT (200 ng) containing
LEF1 responsive elements, along with pSG5.HA-LEF1 (10 ng), pSG5.HA- -
catenin (200 ng) and pSG5.HA-CCAR1 (300, 600 or 900 ng). Results are
from a single experiment which is representative of 3 independent
experiments. (C-D) Plasmids used for reporter gene assay were pGL3OT
(200 ng) along with pSG5.HA-LEF1 (0.005 ng in C and 5 ng in D), pSG5.HA-
-catenin (200 ng), pSG5.HA-CARM1 (200 ng), pCMV.p300 (200 ng),
pSG5.HA-CoCoA (200 ng), and pSG5.HA-CCAR1 (200 ng), as indicated.
Luciferase activity was determined as in (A).

33
Fig. 2-2: Continued

34
Fig. 2-2: Continued

35
and distinct contribution to the process of transcriptional activity.

-catenin recruits CCAR1 to a target gene of Wnt signaling

To investigate whether -catenin recruits CCAR1 to target genes of LEF1
and the Wnt signaling pathway, we initially used chromatin
immunoprecipitation (ChIP) to test whether CCAR1 associated with the
endogenous Wnt-responsive enhancers (WREs) of the Axin2 gene (Jho et al.,
2002; Leung et al., 2002; Li and Wang, 2008), DKK1 gene (Li and Wang,
2008; Niida et al., 2004) and c-myc gene (Sierra et al., 2006) in HT29 cells.
HT29 is a human colon carcinoma cell line widely used for studying the
Wnt/ -catenin signaling pathway, due to its high endogenous level of -
catenin and constitutively active intrinsic Wnt signaling. Both -catenin and
CCAR1 bound preferentially to the WREs of the Axin2 gene, DKK1 gene and
c-myc gene, compared with other sites within or near these genes which lack
WRE sequences (Fig. 2-3A). ChIP performed with two different normal IgG
preparations showed equally low background recruitment signals at both
WRE and negative control sites. Thus -catenin and CCAR1 specifically
occupy the WREs of the Axin2, DKK1 and c-myc promoters. To investigate
whether -catenin and CCAR1 occupy the Axin2 WRE site together as part
of the same complex, we performed modified ChIP assays with two
sequential immunoprecipitations. Sequential immunoprecipitations performed

36
on HT29 chromatin with antibodies against -catenin and CCAR1 indicated
that these two proteins are found together in the same complex on the Axin2
WRE (Fig. 2-3B). Sequential ChIP performed by antibodies against -catenin
followed by normal IgG served as a negative control.

Next, we explored how CCAR1 is recruited to the Axin2 promoter. Since
CCAR1 can interact with both -catenin and LEF1 (Fig. 2-1A), this raised a
question as to whether CCAR1 binding to the Axin2 WRE is dependent upon
-catenin. Therefore, lentiviral vectors that express short-hairpin RNA
(shRNA) against -catenin or CCAR1 were introduced into HT29 cells to
reduce endogenous levels of these proteins. Western blots confirmed that
the protein levels of -catenin and CCAR1 in HT29 cells were substantially
reduced by their respective shRNAs, when compared with nonspecific
shRNA (shNS) (Fig. 2-3C). ChIP analysis of the Axin2 WRE demonstrated
that shRNA against -catenin (compared with the non-specific shRNA)
almost completely eliminated occupancy of the Axin2 WRE by both -catenin
and CCAR1 (Fig. 2-3D), indicating that CCAR1 is targeted to the Axin2 WRE
by its interaction with -catenin. Surprisingly, the depletion of CCAR1 also
partially inhibited -catenin binding to Axin2 promoter. Since the cellular level
of -catenin was not affected by reduction of the CCAR1 level (Fig. 2-3C),

37
this observation suggests that CCAR1 may contribute to the stable
occupancy of the Axin2 promoter by -catenin.

CCAR1 is required for efficient expression of Wnt target
genes.

The association of CCAR1 with -catenin on the Axin2 WRE (Fig. 2-3) and
the cooperative function of CCAR1 and -catenin in the activation of transient
reporter genes by LEF1 (Fig. 2-2B) suggest that CCAR1 may be important
for helping -catenin to activate endogenous target genes of Wnt signaling,
such as c-myc, c-jun, BMP4, MMP7, Axin2 and DKK1. Lentiviral vectors
expressing shRNAs were used again to reduce endogenous levels of
CCAR1 or -catenin proteins in HT29 cells (Fig. 2-4A). Reduction of -
catenin levels had a moderate to dramatic impact on expression of the six
Wnt/ -catenin target genes listed above. Thus, -catenin appeared to play a
major role in the expression of BMP4, MMP7, Axin2, and DKK1; however,
the expression of c-myc and c-jun appeared to depend only partially on -
catenin and thus presumably is driven by other transcription factor
complexes in addition to LEF1/ -catenin (Fig. 2-4B). Reduction of CCAR1
levels partially compromised the expression of all six of the Wnt target genes,
indicating that CCAR1 is also important for efficient expression of these

38
Fig. 2-3 Recruitment of CCAR1 to a Wnt target gene depends on -
catenin. (A) ChIP assays were performed with HT29 cell chromatin, using
antibodies against -catenin or CCAR1 (CCAR_1 antibody, Bethyl 435A;
CCAR_2 antibody, Bethyl 270A), or with normal IgG (IgG_1, Santa Cruz
normal rabbit; IgG_2, Bethyl normal rabbit). Immunoprecipitated DNA was
analyzed by qPCR with primers for the upstream Wnt response element
(WRE) of the Axin2, c-Myc, and DKK1 genes or with primers for the 3’-
untranslated region (UTR) of the Axin2 gene, an upstream negative control
(UNC) site near the DKK1 gene, and the open reading frame (ORF) of the c-
myc gene. Relative recruitment was calculated by dividing specific antibody
signal by the signal for IgG_2 (Bethyl Laboratories). (B) Sequential ChIP
assays for hAxin2-WRE were performed with the indicated antibodies, and
results were expressed relative to input DNA from the unfractionated
chromatin. (C) HT29 cells were infected with lentivirus encoding a puromycin
resistance gene and shRNA against a non-specific sequence (NS), -catenin,
or CCAR1, and puromycin-resistant cells were selected. At 7 days after the
infection, cell extracts were analyzed by immunoblot using antibodies against
CCAR1, -catenin, or -tubulin. (D) The infected cells from (C) were
analyzed by ChIP assay as in (A). In (A), (B), and (D) the mean and range of
variation from duplicate PCR reactions are shown. ChIP results shown are
from a single experiment which is representative of 2 or more independent
experiments.

39
Fig. 2-3: Continued

40
Fig. 2-3: Continued

41
genes. In contrast, depletion of CCAR1 or -catenin had no effect on the
level of -actin mRNA, demonstrating gene-specific requirement of CCAR1
and -catenin. It is interesting to note that reducing the CCAR1 level had a
larger effect than reducing the -catenin level on expression of c-myc and c-
jun, but had a lesser effect than reducing the -catenin level on expression of
the other four Wnt target genes. These results suggest somewhat different
relative roles for CCAR1 and -catenin in mediating expression of the two
sets of Wnt target genes (see Discussion). Depletion of CCAR1 also reduced
the Wnt3a-dependent expression of the Axin2 gene in RKO cells (Fig. 2-4C).
RKO is a colon cancer cell line with a normal adenomatous polyposis coli
gene and normal Wnt3a-dependent regulation of -catenin levels. Thus,
CCAR1 is required for expression of the target genes of Wnt and -catenin in
cells with normal or abnormal regulation of -catenin.

Role of CCAR1 and -catenin in neoplastic transformation

In colorectal cancers, c-myc, c-jun and MMP7 are robustly expressed and
play critical roles in tumor growth and progression (Marcu et al., 1992; Newell
et al., 1994; Smith et al., 1993). Since reduction of the endogenous CCAR1
level compromised the expression of these genes, we assessed the role of
CCAR1 in colon cancer cell proliferation.

42

Fig. 2-4 Requirement of -catenin and CCAR1 for expression of Wnt
target genes. (A) HT29 cells infected with lentivirus encoding shRNA against
-catenin, CCAR1, or a non-specific sequence (NS) were analyzed by
immunoblot as in Fig. 2-3C. (B) Total RNA from the lentivirus-infected cells in
(A) was examined by quantitative reverse transcriptase-PCR analysis, using
primers specific for the indicated Wnt target genes. Results shown are
normalized to the level of -tubulin mRNA, are the mean and range of
variation for duplicate PCR reactions from a single experiment, and are
representative of at least 3 independent experiments. (C) RKO cells were
treated with lentivirus encoding a puromycin resistance gene and shRNA
against a non-specific sequence (NS) or CCAR1, and puromycin-resistant
cells were selected and analyzed by immunoblots using antibodies against
CCAR1 and -tubulin. Selected RKO cells were also plated and treated with
purified Wnt3a ligands for 6 hours. Total RNA was extracted and examined
by quantitative reverse transcriptase-PCR analysis. Results shown are
normalized to the level of GAPDH mRNA and are from a single experiment
which is representative of two independent experiments.

43
Fig. 2-4: Continued

44
Fig. 2-4: Continued

45
Fig. 2-4: Continued

46
Indistinguishable growth curves were obtained for HT29 cell populations
stably infected with lentiviral vectors encoding shRNAs directed against a
non-specific sequence, -catenin, or CCAR1 (Fig. 2-5A). To assess a
possible role of CCAR1 and -catenin in anchorage-independent growth
which is typically associated with a tumorigenic phenotype, the same HT29
cell populations were tested for their ability to grow and form colonies in soft-
agar. HT29 cells expressing shRNA directed against -catenin or CCAR1
formed fewer and smaller colonies than HT29 cells expressing the non-
specific shRNA (Fig. 2-5B). Depletion of -catenin nearly eliminated colony
formation in soft agar, while colony formation was inhibited by more than
50% by depletion of CCAR1. As a control to test the linearity of the
automated colony counting method, we plated two different amounts of HT29
shNS cells. As expected, reducing the number of cells plated by half also
reduced by half the number of colonies detected (Fig. 2-5B). The result for
depletion of -catenin confirms previous conclusions that an aberrant
elevated endogenous level of -catenin is central to induction of neoplastic
and morphological transformation of human colorectal cancer cells. The
result for depletion of CCAR1 is consistent with the conclusion that CCAR1,
along with other coactivators that are recruited to Wnt target genes by -
catenin, plays an important role in mediating transcriptional activation by -
catenin.

47

Fig. 2-5 Role of CCAR1 in anchorage-independent colony formation. (A)
HT29 cells were plated in standard tissue culture dishes and cell proliferation
was monitored by MTS assay. (B) Diluted HT29 cell suspensions containing
the indicated number of cells were plated in soft agar, and colony formation
was examined by staining after 2-4 weeks (right panels). Microscope images
are shown with a scale bar representing 200 m. Colonies in each dish were
counted by Molecular Imager Gel Doc XR System (Bio-Rad). Results shown
are mean and SD from triplicate cultures from a single experiment and are
representative of 3 independent experiments.

48
Fig. 2-5: Continued

49
Fig. 2-5: Continued

50
DISCUSSION

Defects in crucial components of the Wnt signaling pathway, including -
catenin, APC, and the Axins, play a predominant role in the pathogenesis of
human cancers. A proposed consequence of these Wnt pathway related
mutations is to elevate the levels of -catenin both in the cytoplasm and
nucleus, allowing more -catenin to bind to LEF/TCF and promote
transcription of LEF/TCF target genes. Proteins encoded by LEF/ -catenin
target genes likely collaborate in executing a program leading to and/or
maintaining neoplastic transformation. However, beyond the recruitment of -
catenin, the mechanism of activation of Wnt target gene expression is poorly
understood. Here we extend the current understanding of Wnt signaling by
identifying a novel -catenin binding partner, CCAR1 (Fig. 2-1). Functionally,
CCAR1 cooperated synergistically with -catenin to cause robust
enhancement of LEF1-mediated transcription of a transient reporter gene
(Fig. 2-2). The coactivator function of CCAR1 in the transient reporter gene
assays was almost completely dependent on co-expression of -catenin.
Thus, although CCAR1 can bind to LEF1 as well as -catenin in vitro (Fig. 2-
1), the requirement for -catenin suggests that CCAR1 may be recruited to
LEF1 target genes by -catenin, not directly by LEF1. In agreement with this
conclusion, depletion of endogenous -catenin prevented recruitment of

51
CCAR1 to the WRE associated with the Axin2 promoter (Fig. 2-3D). Thus, in
the chromatin-based cellular environment, the LEF1-CCAR1 interaction, if it
occurs, is not sufficient for stable recruitment of CCAR1 to the Axin2 WRE.

Wnt signaling is important for normal cell proliferation and differentiation.
However, for precise control of Wnt signaling during development, normal
tissue possesses an auto-regulatory mechanism to limit the duration or
intensity of a Wnt-initiated signal. Axin2, which binds to -catenin and
induces its degradation, is a direct transcriptional target of LEF/ -catenin
(Jho et al., 2002). In addition, the DKK1 gene encoding an extracellular
inhibitor of Wnt signaling is also induced by Wnt signaling (Chamorro et al.,
2005; Gonzalez-Sancho et al., 2005; Niida et al., 2004). By contrast, during
tumorigenesis this negative feedback loop is disrupted by acquisition of
oncogenic mutations of -catenin or cellular components that normally cause
regulated degradation of -catenin, or by epigenetic silencing of components
involved in the auto-regulatory loop. For example, hyper-methylation of the
DKK1 gene promoter has been reported in human colorectal cancer cells
(Aguilera et al., 2006). Here, our loss-of-function studies provide evidence for
the involvement of CCAR1 in the auto-regulatory mechanism; depletion of
CCAR1 moderately reduced expression of Axin2 and DKK1 (Fig. 2-4B).
Additionally, depletion of -catenin essentially abolished expression of these
two genes, indicating that these two components of the Wnt/ -catenin auto-

52
inhibitory loop are regulated primarily by Wnt/ -catenin signaling. Loss of -
catenin at the Axin2 and DKK1 promoters would presumably prevent
recruitment of multiple coactivators, including CCAR1, which are needed for
transcriptional activation. In fact, the dismissal of -catenin from the WRE of
the Axin2 gene blocked recruitment of CCAR1 (Fig. 2-3D).

The importance of CCAR1 for Wnt targets is not limited to genes involved in
the auto-regulatory mechanism, but also extends to genes involved in
neoplastic transformation. Depletion of CCAR1 caused a 30%-40%
suppression of the expression of the growth promoting genes c-myc and c-
jun (Fig. 2-4). It is interesting to note that depletion of -catenin caused a
stronger inhibition of Axin2 and DKK1 expression than depletion of CCAR1,
while depletion of CCAR1 caused a slightly stronger inhibition of expression
of the growth promoting genes c-myc and c-jun than depletion of -catenin.
These results suggest two different regulatory programs for the Wnt auto-
regulatory target genes versus the growth-promoting Wnt target genes. The
dramatic loss of expression of Axin2 and DKK1 upon depletion of -catenin
indicates that the Wnt/ -catenin pathway plays a dominant role in regulating
these genes in HT29 cells. Since -catenin is expected to recruit multiple
secondary coactivators (including CCAR1) to the promoter, it is not surprising
that depletion of CCAR1 caused less inhibition of these genes than depletion
of -catenin. In contrast, the more moderate loss of c-myc and c-jun

53
expression observed upon depletion of -catenin suggests that Wnt/ -
catenin signaling is only one of multiple signaling pathways regulating
expression of these genes. In fact, c-myc and c-jun are known to be
regulated by signaling through a variety of transcription factors, including NR
(Dubik and Shiu, 1988). Since CCAR1 can function as a coactivator for
LEF1/ -catenin (this report) as well as NR and p53 (Kim et al., 2008), it
would not be surprising if CCAR1 also functions as a coactivator for other
classes of transcription factors. Thus, if CCAR1 is recruited to c-myc and c-
jun promoters by multiple transcription factors, this could explain why
depletion of CCAR1 had a stronger effect than depletion of -catenin.

The involvement of CCAR1 as a mediator of signaling leading to apoptosis
(Rishi et al., 2003; Rishi et al., 2006) as well as proliferation (Kim et al., 2008)
and aspects of oncogenic transformation (Fig. 2-5) appears contradictory at
first glance. However, the finding that CCAR1 can serve as a coactivator for
multiple classes of transcription factors indicates that the activity of CCAR1
can be directed by a variety of signaling pathways which result in recruitment
of CCAR1 to specific sets of target genes that depend upon the nature of the
signal. Thus, interactions between two coactivators may control specific
programs of gene expression with specific physiological outcomes. The fact
that depletion of CCAR1 or -catenin suppressed one aspect of the
neoplastic transformation of human colorectal cancer cells (i.e. colony

54
formation in soft agar, Fig. 2-5) suggests the possibility that targeting the
interaction between CCAR1 and -catenin may be a potential strategy for
therapeutic control of aberrant Wnt/ -catenin signaling in colorectal cancer.

55
Chapter 2 References
Aguilera, O., Fraga, M.F., Ballestar, E., Paz, M.F., Herranz, M., Espada, J.,
Garcia, J.M., Munoz, A., Esteller, M., and Gonzalez-Sancho, J.M. (2006).
Epigenetic inactivation of the Wnt antagonist DICKKOPF-1 (DKK-1) gene in
human colorectal cancer. Oncogene 25, 4116-4121.
Barker, N., Hurlstone, A., Musisi, H., Miles, A., Bienz, M., and Clevers, H.
(2001). The chromatin remodelling factor Brg-1 interacts with beta-catenin to
promote target gene activation. EMBO J 20, 4935-4943.
Bauer, A., Chauvet, S., Huber, O., Usseglio, F., Rothbacher, U., Aragnol, D.,
Kemler, R., and Pradel, J. (2000). Pontin52 and reptin52 function as
antagonistic regulators of beta-catenin signalling activity. EMBO J 19, 6121-
6130.
Bienz, M., and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling.
Cell 103, 311-320.
Carrera, I., Janody, F., Leeds, N., Duveau, F., and Treisman, J.E. (2008).
Pygopus activates Wingless target gene transcription through the mediator
complex subunits Med12 and Med13. Proc Natl Acad Sci U S A 105, 6644-
6649.
Chamorro, M.N., Schwartz, D.R., Vonica, A., Brivanlou, A.H., Cho, K.R., and
Varmus, H.E. (2005). FGF-20 and DKK1 are transcriptional targets of beta-
catenin and FGF-20 is implicated in cancer and development. EMBO J 24,
73-84.
Chen, D., Ma, H., Hong, H., Koh, S.S., Huang, S.M., Schurter, B.T., Aswad,
D.W., and Stallcup, M.R. (1999). Regulation of transcription by a protein
methyltransferase. Science 284, 2174-2177.
Chen, Y.H., Yang, C.K., Xia, M., Ou, C.Y., and Stallcup, M.R. (2007). Role of
GAC63 in transcriptional activation mediated by beta-catenin. Nucleic Acids
Res 35, 2084-2092.
Crawford, H.C., Fingleton, B.M., Rudolph-Owen, L.A., Goss, K.J., Rubinfeld,
B., Polakis, P., and Matrisian, L.M. (1999). The metalloproteinase matrilysin
is a target of beta-catenin transactivation in intestinal tumors. Oncogene 18,
2883-2891.

56
Dahmen, R.P., Koch, A., Denkhaus, D., Tonn, J.C., Sorensen, N., Berthold,
F., Behrens, J., Birchmeier, W., Wiestler, O.D., and Pietsch, T. (2001).
Deletions of AXIN1, a component of the WNT/wingless pathway, in sporadic
medulloblastomas. Cancer Res 61, 7039-7043.
Deng, J., Miller, S.A., Wang, H.Y., Xia, W., Wen, Y., Zhou, B.P., Li, Y., Lin,
S.Y., and Hung, M.C. (2002). beta-catenin interacts with and inhibits NF-
kappa B in human colon and breast cancer. Cancer Cell 2, 323-334.
Dubik, D., and Shiu, R.P. (1988). Transcriptional regulation of c-myc
oncogene expression by estrogen in hormone-responsive human breast
cancer cells. J Biol Chem 263, 12705-12708.
Easwaran, V., Pishvaian, M., Salimuddin, and Byers, S. (1999). Cross-
regulation of beta-catenin-LEF/TCF and retinoid signaling pathways. Curr
Biol 9, 1415-1418.
Feng, Y., Lee, N., and Fearon, E.R. (2003). TIP49 regulates beta-catenin-
mediated neoplastic transformation and T-cell factor target gene induction via
effects on chromatin remodeling. Cancer Res 63, 8726-8734.
Fuerer, C., Nusse, R., and Ten Berge, D. (2008). Wnt signalling in
development and disease. Max Delbruck Center for Molecular Medicine
meeting on Wnt signaling in Development and Disease. EMBO Rep 9, 134-
138.
Gonzalez-Sancho, J.M., Aguilera, O., Garcia, J.M., Pendas-Franco, N., Pena,
C., Cal, S., Garcia de Herreros, A., Bonilla, F., and Munoz, A. (2005). The
Wnt antagonist DICKKOPF-1 gene is a downstream target of beta-
catenin/TCF and is downregulated in human colon cancer. Oncogene 24,
1098-1103.
Ha, N.C., Tonozuka, T., Stamos, J.L., Choi, H.J., and Weis, W.I. (2004).
Mechanism of phosphorylation-dependent binding of APC to beta-catenin
and its role in beta-catenin degradation. Mol Cell 15, 511-521.
Hayward, P., Kalmar, T., and Arias, A.M. (2008). Wnt/Notch signalling and
information processing during development. Development 135, 411-424.
He, T.C., Sparks, A.B., Rago, C., Hermeking, H., Zawel, L., da Costa, L.T.,
Morin, P.J., Vogelstein, B., and Kinzler, K.W. (1998). Identification of c-MYC
as a target of the APC pathway. Science 281, 1509-1512.

57
Hecht, A., Vleminckx, K., Stemmler, M.P., van Roy, F., and Kemler, R.
(2000). The p300/CBP acetyltransferases function as transcriptional
coactivators of beta-catenin in vertebrates. EMBO J 19, 1839-1850.
Jho, E.H., Zhang, T., Domon, C., Joo, C.K., Freund, J.N., and Costantini, F.
(2002). Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a
negative regulator of the signaling pathway. Mol Cell Biol 22, 1172-1183.
Kim, J.H., Kim, B., Cai, L., Choi, H.J., Ohgi, K.A., Tran, C., Chen, C., Chung,
C.H., Huber, O., Rose, D.W., et al. (2005). Transcriptional regulation of a
metastasis suppressor gene by Tip60 and beta-catenin complexes. Nature
434, 921-926.
Kim, J.H., Li, H., and Stallcup, M.R. (2003a). CoCoA, a nuclear receptor
coactivator which acts through an N-terminal activation domain of p160
coactivators. Mol Cell 12, 1537-1549.
Kim, J.H., Yang, C.K., Heo, K., Roeder, R.G., An, W., and Stallcup, M.R.
(2008). CCAR1, a key regulator of mediator complex recruitment to nuclear
receptor transcription complexes. Mol Cell 31, 510-519.
Kim, P.J., Plescia, J., Clevers, H., Fearon, E.R., and Altieri, D.C. (2003b).
Survivin and molecular pathogenesis of colorectal cancer. Lancet 362, 205-
209.
Kinzler, K.W., and Vogelstein, B. (1996). Lessons from hereditary colorectal
cancer. Cell 87, 159-170.
Koh, S.S., Li, H., Lee, Y.H., Widelitz, R.B., Chuong, C.M., and Stallcup, M.R.
(2002). Synergistic coactivator function by coactivator-associated arginine
methyltransferase (CARM) 1 and beta-catenin with two different classes of
DNA-binding transcriptional activators. J Biol Chem 277, 26031-26035.
Kramps, T., Peter, O., Brunner, E., Nellen, D., Froesch, B., Chatterjee, S.,
Murone, M., Zullig, S., and Basler, K. (2002). Wnt/wingless signaling requires
BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-
TCF complex. Cell 109, 47-60.
Lee, Y.H., Koh, S.S., Zhang, X., Cheng, X., and Stallcup, M.R. (2002).
Synergy among nuclear receptor coactivators: selective requirement for
protein methyltransferase and acetyltransferase activities. Mol Cell Biol 22,
3621-3632.

58
Lee, Y.H., and Stallcup, M.R. (2006). Interplay of Fli-I and FLAP1 for
regulation of beta-catenin dependent transcription. Nucleic Acids Res 34,
5052-5059.
Leung, J.Y., Kolligs, F.T., Wu, R., Zhai, Y., Kuick, R., Hanash, S., Cho, K.R.,
and Fearon, E.R. (2002). Activation of AXIN2 expression by beta-catenin-T
cell factor. A feedback repressor pathway regulating Wnt signaling. J Biol
Chem 277, 21657-21665.
Li, H., Kim, J.H., Koh, S.S., and Stallcup, M.R. (2004). Synergistic effects of
coactivators GRIP1 and beta-catenin on gene activation: cross-talk between
androgen receptor and Wnt signaling pathways. J Biol Chem 279, 4212-4220.
Li, J., and Wang, C.Y. (2008). TBL1-TBLR1 and beta-catenin recruit each
other to Wnt target-gene promoter for transcription activation and
oncogenesis. Nat Cell Biol 10, 160-169.
Liu, W., Dong, X., Mai, M., Seelan, R.S., Taniguchi, K., Krishnadath, K.K.,
Halling, K.C., Cunningham, J.M., Boardman, L.A., Qian, C., et al. (2000).
Mutations in AXIN2 cause colorectal cancer with defective mismatch repair
by activating beta-catenin/TCF signalling. Nat Genet 26, 146-147.
Mann, B., Gelos, M., Siedow, A., Hanski, M.L., Gratchev, A., Ilyas, M.,
Bodmer, W.F., Moyer, M.P., Riecken, E.O., Buhr, H.J., et al. (1999). Target
genes of beta-catenin-T cell-factor/lymphoid-enhancer-factor signaling in
human colorectal carcinomas. Proc Natl Acad Sci U S A 96, 1603-1608.
Marcu, K.B., Bossone, S.A., and Patel, A.J. (1992). myc function and
regulation. Annu Rev Biochem 61, 809-860.
McDonald, S.A., Preston, S.L., Lovell, M.J., Wright, N.A., and Jankowski, J.A.
(2006). Mechanisms of disease: from stem cells to colorectal cancer. Nat
Clin Pract Gastroenterol Hepatol 3, 267-274.
Miyagishi, M., Fujii, R., Hatta, M., Yoshida, E., Araya, N., Nagafuchi, A.,
Ishihara, S., Nakajima, T., and Fukamizu, A. (2000). Regulation of Lef-
mediated transcription and p53-dependent pathway by associating beta-
catenin with CBP/p300. J Biol Chem 275, 35170-35175.
Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma,
I.M., and Trono, D. (1996). In vivo gene delivery and stable transduction of
nondividing cells by a lentiviral vector. Science 272, 263-267.

59
Newell, K.J., Witty, J.P., Rodgers, W.H., and Matrisian, L.M. (1994).
Expression and localization of matrix-degrading metalloproteinases during
colorectal tumorigenesis. Mol Carcinog 10, 199-206.
Niida, A., Hiroko, T., Kasai, M., Furukawa, Y., Nakamura, Y., Suzuki, Y.,
Sugano, S., and Akiyama, T. (2004). DKK1, a negative regulator of Wnt
signaling, is a target of the beta-catenin/TCF pathway. Oncogene 23, 8520-
8526.
Nusse, R. (2008). Wnt signaling and stem cell control. Cell Res 18, 523-527.
Olson, L.E., Tollkuhn, J., Scafoglio, C., Krones, A., Zhang, J., Ohgi, K.A., Wu,
W., Taketo, M.M., Kemler, R., Grosschedl, R., et al. (2006). Homeodomain-
mediated beta-catenin-dependent switching events dictate cell-lineage
determination. Cell 125, 593-605.
Palmer, H.G., Gonzalez-Sancho, J.M., Espada, J., Berciano, M.T., Puig, I.,
Baulida, J., Quintanilla, M., Cano, A., de Herreros, A.G., Lafarga, M., et al.
(2001). Vitamin D(3) promotes the differentiation of colon carcinoma cells by
the induction of E-cadherin and the inhibition of beta-catenin signaling. J Cell
Biol 154, 369-387.
Parker, D.S., Jemison, J., and Cadigan, K.M. (2002). Pygopus, a nuclear
PHD-finger protein required for Wingless signaling in Drosophila.
Development 129, 2565-2576.
Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851.
Puri, P.L., Sartorelli, V., Yang, X.J., Hamamori, Y., Ogryzko, V.V., Howard,
B.H., Kedes, L., Wang, J.Y., Graessmann, A., Nakatani, Y., et al. (1997).
Differential roles of p300 and PCAF acetyltransferases in muscle
differentiation. Mol Cell 1, 35-45.
Reya, T., and Clevers, H. (2005). Wnt signalling in stem cells and cancer.
Nature 434, 843-850.
Rishi, A.K., Zhang, L., Boyanapalli, M., Wali, A., Mohammad, R.M., Yu, Y.,
Fontana, J.A., Hatfield, J.S., Dawson, M.I., Majumdar, A.P., et al. (2003).
Identification and characterization of a cell cycle and apoptosis regulatory
protein-1 as a novel mediator of apoptosis signaling by retinoid CD437. J Biol
Chem 278, 33422-33435.

60
Rishi, A.K., Zhang, L., Yu, Y., Jiang, Y., Nautiyal, J., Wali, A., Fontana, J.A.,
Levi, E., and Majumdar, A.P. (2006). Cell cycle- and apoptosis-regulatory
protein-1 is involved in apoptosis signaling by epidermal growth factor
receptor. J Biol Chem 281, 13188-13198.
Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T.,
Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., et al. (2000). AXIN1
mutations in hepatocellular carcinomas, and growth suppression in cancer
cells by virus-mediated transfer of AXIN1. Nat Genet 24, 245-250.
Shah, S., Hecht, A., Pestell, R., and Byers, S.W. (2003). Trans-repression of
beta-catenin activity by nuclear receptors. J Biol Chem 278, 48137-48145.
Sierra, J., Yoshida, T., Joazeiro, C.A., and Jones, K.A. (2006). The APC
tumor suppressor counteracts beta-catenin activation and H3K4 methylation
at Wnt target genes. Genes Dev 20, 586-600.
Smith, D.R., Myint, T., and Goh, H.S. (1993). Over-expression of the c-myc
proto-oncogene in colorectal carcinoma. Br J Cancer 68, 407-413.
Song, L.N., Herrell, R., Byers, S., Shah, S., Wilson, E.M., and Gelmann, E.P.
(2003). Beta-catenin binds to the activation function 2 region of the androgen
receptor and modulates the effects of the N-terminal domain and TIF2 on
ligand-dependent transcription. Mol Cell Biol 23, 1674-1687.
Stadeli, R., Hoffmans, R., and Basler, K. (2006). Transcription under the
control of nuclear Arm/beta-catenin. Curr Biol 16, R378-385.
Sun, Y., Kolligs, F.T., Hottiger, M.O., Mosavin, R., Fearon, E.R., and Nabel,
G.J. (2000). Regulation of beta -catenin transformation by the p300
transcriptional coactivator. Proc Natl Acad Sci U S A 97, 12613-12618.
Takemaru, K.I., and Moon, R.T. (2000). The transcriptional coactivator CBP
interacts with beta-catenin to activate gene expression. J Cell Biol 149, 249-
254.
Teyssier, C., Ma, H., Emter, R., Kralli, A., and Stallcup, M.R. (2005).
Activation of nuclear receptor coactivator PGC-1alpha by arginine
methylation. Genes Dev 19, 1466-1473.
Wang, S., and Jones, K.A. (2006). CK2 controls the recruitment of Wnt
regulators to target genes in vivo. Curr Biol 16, 2239-2244.

61
Willert, K., Brown, J.D., Danenberg, E., Duncan, A.W., Weissman, I.L., Reya,
T., Yates, J.R., 3rd, and Nusse, R. (2003). Wnt proteins are lipid-modified
and can act as stem cell growth factors. Nature 423, 448-452.
Wu, R., Zhai, Y., Fearon, E.R., and Cho, K.R. (2001). Diverse mechanisms
of beta-catenin deregulation in ovarian endometrioid adenocarcinomas.
Cancer Res 61, 8247-8255.
Xing, Y., Clements, W.K., Kimelman, D., and Xu, W. (2003). Crystal structure
of a beta-catenin/axin complex suggests a mechanism for the beta-catenin
destruction complex. Genes Dev 17, 2753-2764.
Xing, Y., Clements, W.K., Le Trong, I., Hinds, T.R., Stenkamp, R., Kimelman,
D., and Xu, W. (2004). Crystal structure of a beta-catenin/APC complex
reveals a critical role for APC phosphorylation in APC function. Mol Cell 15,
523-533.
Yang, C.K., Kim, J.H., Li, H., and Stallcup, M.R. (2006). Differential use of
functional domains by coiled-coil coactivator in its synergistic coactivator
function with beta-catenin or GRIP1. J Biol Chem 281, 3389-3397.
Zhang, T., Otevrel, T., Gao, Z., Ehrlich, S.M., Fields, J.Z., and Boman, B.M.
(2001). Evidence that APC regulates survivin expression: a possible
mechanism contributing to the stem cell origin of colon cancer. Cancer Res
61, 8664-8667.
Zhao, J., Pettigrew, G.J., Thomas, J., Vandenberg, J.I., Delriviere, L., Bolton,
E.M., Carmichael, A., Martin, J.L., Marber, M.S., and Lever, A.M. (2002).
Lentiviral vectors for delivery of genes into neonatal and adult ventricular
cardiac myocytes in vitro and in vivo. Basic Res Cardiol 97, 348-358.
Zufferey, R., Nagy, D., Mandel, R.J., Naldini, L., and Trono, D. (1997).
Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo.
Nat Biotechnol 15, 871-875.

62
CHAPTER 3: A coactivator role of CARM1 for the
dysregulated -catenin activity in colorectal cancer
cell growth and gene expression

INTRODUCTION

Wnt/ -catenin signaling is indispensible for the development of the
gastrointestinal system, and aberrant activation of this pathway is implicated
in disease, notably in colorectal cancer (MacDonald et al., 2009; Polakis,
2000; Reya and Clevers, 2005). A hallmark of Wnt pathway activation is the
elevation of -catenin protein levels. In the absence of Wnt signaling, -
catenin protein is targeted to a multisubunit destruction complex, which is
composed of scaffolding proteins adenomatous polysis coli (APC) and Axin,
and the protein kinases casein kinase 1  (CK1 ) and glycogen synthase
kinase 3  (GSK3 ). Phosphorylation of -catenin within this complex targets
it for poly-ubiquitination by TrCP and subsequently for proteasome-
mediated proteolysis (MacDonald et al., 2009). Binding of Wnt ligands to
transmembrane frizzled receptors disrupts the destruction complex, and
thereby stabilizes and causes accumulation of -catenin protein. Surplus -
catenin then translocates into the nucleus, where it binds to transcriptional

63
factor of the lymphoid enhancer factor (LEF)/T cell factor (TCF) family and
functions as a transcription coactivator to activate expression of Wnt target
genes (MacDonald et al., 2009).

Abnormally elevated -catenin level or activity results in constitutive
formation of LEF/TCF- -catenin complexes and alters expression of -
catenin-regulated proto-oncogenes. Proteins encoded by -catenin-
controlled genes likely cooperate in neoplastic transformation. In support of
this notion, mouse studies and identification of mutations in clinical
specimens has shown that abnormal stabilization of -catenin leads to colon
tumorigenesis (Klaus and Birchmeier, 2008). Reported downstream Wnt/ -
catenin targets include known pro-proliferative genes (e.g. c-myc (He et al.,
1998)), anti-apoptosis genes (e.g. survivin (Kim et al., 2003b; Zhang et al.,
2001)) and genes involved in metastasis (e.g. s100A4 (Stein et al., 2006)).
GPR49, a newly identified Wnt target gene, encodes an orphan G protein-
coupled receptor and was proposed as a potential marker of tumor-initiating
colorectal cancer stem cells (Barker et al., 2007). In addition, GPR49 was
found overexpressed in colon tumors compared with normal colon tissues;
and knockdown of GPR49 in colon cancer cells induced apoptosis
(McClanahan et al., 2006). Thereby, GPR49, in concert with other Wnt/ -
catenin targets, promotes growth and/or survival of cancers with defects in -
catenin regulation.

64

Since the oncogenic effects of -catenin reside in its transcriptional activity to
activate expression of Wnt regulated oncogenes, it is crucial to study
coregulators that could modulate transcriptional activity of -catenin. CARM1
(coactivator-associated-protein-arginine-methyltransferase 1) belongs to the
protein arginine methyltransferase family which methylate arginine residues
in proteins. CARM1 methylates a subset of proteins that play a crucial role in
transcription. For instance, CARM1 methylates arginine 17 of histone H3
(H3R17) at promoters, and this event is associated with transcriptional
activation (Bedford and Clarke, 2009; Lee and Stallcup, 2009). Previously
published work suggests CARM1 functions as a rather general transcriptional
coactivator, and has been shown to be important for estrogen receptor-,
androgen receptor-, c-Fos-, peroxisome proliferator-activated receptor -, and
NF B-controlled transcription (Bedford and Clarke, 2009). A previous report
from our lab has shown that CARM1 binds to -catenin in vivo and functions
in synergy with -catenin as a coactivator for LEF1-mediated expression of
transiently transfected reporter genes (Koh et al., 2002). The reporter gene
assay provides a convenient way to study transcriptional regulation. However,
the findings are not necessarily indicative of physiological function because
they generally involve 1) expression of very high levels of exogenous
coactivators and transcription factors and 2) usage of reporter plasmids that
lack native chromatin structure as readout of transcriptional activation.

65

Here, we report the expression of CARM1 in colon cancer cell lines, and its
nuclear occupancy with -catenin in a Wnt3a-dependent manner on the
promoter of an endogenous Wnt target gene in its native chromosomal
location. The nucleosomes near the transcription start site of the Wnt target
gene undergo histone arginine dimethylation of histone H3 (H3R17me2)
upon Wnt3a induction, and this modification event disappears when
endogenous CARM1 level is diminished. In addition, endogenous CARM1 is
required for efficient expression of Wnt target genes and for clonal survival
and anchorage-independent growth of colorectal cancers. Collectively, our
studies suggest CARM1 plays an essential role in oncogenic growth of colon
cancers though the positive regulation of Wnt/ -catenin oncogenes, and is
thereby a potential target for therapeutic remedy in cancers involving
abnormally activated Wnt/ -catenin signaling.

66
MATERIALS AND METHODS

Plasmids and antibodies: The luciferase reporter plasmids pGL3OT
(containing LEF1 response elements) and GK1-Luc (containing Gal4
response elements), and bacterial expression vectors pGEX-4T1- -catenin,
pGEX-4T1-CARM1 and pGEX-5X-1-LEF1 for expressing glutathione S-
transferase (GST) fusion proteins were described previously (Li et al., 2004;
Teyssier et al., 2002). The following mammalian expression vectors were
described in previous publications as follows: pCMV.p300 (Puri et al., 1997);
pSG5.HA-LEF1, pSG5.HA- -catenin (Li et al., 2004), and pSG5.HA-CARM1
and the same vector encoding various HA-tagged CARM1 deletion mutants
(Teyssier et al., 2002). For lentivirus production, the packaging vector pCMV-
ΔR8.91, the envelop plasmid pMD.G1 and the transfer vector
pHRCMVpuroSin8 were described previously (Ou et al., 2009). The short
hairpin RNA (shRNA) transfer vectors were produced by inserting PCR
products containing the U6 promoter and shRNA coding sequence, into
vector pHRCMVpuroSin8. shRNA encoding sequences were listed as follows:
sh -catenin (Ou et al., 2009) and shCARM1 (5’-
AAAACTGCAGAAAAAGGGTTCACCTCACACTTGAATGTACTCTCTTGAA
GTACATGCAAGTGTTAGGTGAACCCGGTGTTTCGTCCTTTCCACAAG-3’.
The following antibodies were purchased and used for this study: -catenin,

67
-actin, -tubulin and histone H3 from Santa Cruz Biotechnology; CARM1
from Bethyl Laboratory; H3R17me2 from Upstate Biotechnology.

Cell culture and luciferase reporter gene assay: All Cell lines
used in this study were maintained in a humidified incubator at 37
0
C with 5%
CO
2
and were cultured in media supplemented with 10% fetal bovine serum.
Base media used for cell lines was listed below: McCoy’s 5a medium for
HT29 and HCT116 cell lines; DMEM medium for L cells, L-Wnt3a cells, CV-1,
H630 and DLD1 cells; MEM medium for CaCo2 and RKO; Leibovitz medium
for SW620; Ham’s F12K medium for LoVo; and DMEM:F12 (1:1) medium for
FHC. Additional components suggested by ATCC (American Type Culture
Collection) were added to FHC culture medium, and are listed as follows:
cholera toxin, insulin, transferrin and hydrocortisone (Sigma Aldrich). Wnt3a
and control conditioned medium were prepared as described previously
(Willert et al., 2003). Transient reporter gene assays were conducted in CV-1
cells with TargeFect F1 reagent (Targeting Systems) as described previously.
In a given experiment, empty vectors were used to balance the total amount
of DNA among all samples. Each experiment was repeated independently at
least two times. The results shown are the mean and range of variation of
duplicate transfected cultures.

68
GST pull-down assay: HA tagged full-length LEF1, -catenin, and
CARM1 and its fragments were synthesized in vitro by using TNT-quick
coupled transcription/translation system (Promega) according to the
manufacturer’s protocol. These in vitro synthesized proteins were then used
for GST pulldown assays as described previously (Ou et al., 2009). Bound
proteins were analyzed by immunoblot with anti-HA antibodies (Roche
Applied Science). The amount of GST used as a control was greater than or
equal to that of GST fusion proteins.

Chromatin Immunoprecipitation (ChIP) Assay: ChIP assays were
carried out as described previously (Ou et al., 2009). For
immunoprecipitation, 2 g of -catenin antibodies (Santa Cruz Biotechnology)
or 4 g of CARM1 antibodies (Bethyl Laboratories) were used. Purified
immunoprecipitated DNA and total input DNA (from unfractionated chromatin)
were utilized as template in quantitative real-time PCR (qPCR) with primers
spanning the hAxin2 3’-untranslated region (nucleotides +31681 to +31784
relative to transcription start site) (Ou et al., 2009) and hAxin2 WRE
(nucleotides -284 to -384 relative to transcription start site) (Ou et al., 2009).
After the end of amplification, a melting curve analysis was performed to
confirm the homogeneity of PCR products from each reaction. The relative
standard curve method was used to determine the relative quantity of
immunoprecipitated DNA and input signals. Signals from immunoprecipitated

69
DNA were divided by the input signal, and the data were represented as the %
of Input.

Quantitative Reverse Transcriptase-PCR (qRT-PCR): RNA was
extracted from cells using the Trizol method (Invitrogen), resuspended in
DEPC (diethylpyrocarbonate)-treated H
2
O and normalized to 100 ng/ l.
cDNA was synthesized by reverse transcribing 1 g of total RNA using
iScript cDNA synthesis kit (Bio-Rad) and then diluted 10-fold. 2 l of diluted
cDNA was amplified by qPCR using the following primers: GPADH (Teyssier
et al., 2005); Axin2 (Ou et al., 2009); s100A4, 5’-CATGGCGTGCCCTCTG-3’
(forward) and 5’-TGCCCGAGTACTTGTGGAAG-3’ (reverse); c-myc (Ou et
al., 2009); cyclin D1 (Ou et al., 2009); and GPR49, 5’-
ACCTTGGCCCTGAACAAAATAC-3’(forward) and 5’-
CTCCAGCTTGGTAGTTCTACAT-3’(reverse). Results shown are mean and
range of variation for duplicate PCR reactions from a single cDNA
preparation, and a minimum of two independent experiments were performed.
Relative mRNA expression levels were determined by normalizing against
GAPDH mRNA levels.

Cell Proliferation Assay: HT29 cells were seeded in 24-well plates at
1000 cells/well in 0.5 ml of McCoy’s 5a medium supplemented with 10% fetal
bovine serum. On the indicated days after plating, 100 l of CellTiter 96

70
AQueous one solution (Promega) was added to each well and incubated for
4 hrs at 37
0
C in a humidified, 5% CO
2
atmosphere. Absorbance was
measured using SpectraMax 190 microplate reader (Molecular Devices,
Sunnyvale, CA) at 490 nm. The background absorbance of no-cell control
was subtracted from the absorbance of samples. Results shown are the
mean + S.D. from triplicate cultures of a single experiment and are
representative of two independent experiments.

Colony Formation Assay: 200 HT29 cells were subcultured into 6-well
plate and cultured until colonies form. Cells were washed twice with
phosphate-buffered saline (PBS) (3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3
mM KCl, 135 mM NaCl, pH 7.4), fixed with methanol and then stained with
0.1% crystal violet (VWR international) in PBS for pictures. Afterwards,
colonies were destained with 10 % SDS and destaining solution was
subjected to OD reading at 570 nm.

Colony Formation Assay in Soft Agar: 0.8% of Noble agar (VWR
International) in McCoy’s 5a medium supplemented with 10% fetal bovine
serum was prepared and poured into 35-mm Petri dishes as base agar layer.
As for top agar layer, 4000 cells from each cell pool were suspended in 0.3%
molten agar and layered on top of the solidified base agar in each dish.
These dishes were placed at 37 °C and 5% CO
2
in a cell culture incubator

71
until colonies were visible; and were fed with culture medium every couple
days to avoid the drying of the agar gel. Right before colony counting, dishes
were fixed with 100% methanol for 15 min and then stained with 0.01%
crystal violet (VWR International) in PBS. The colonies in each dish were
counted by using the Molecular Imager Gel Doc XR System (Bio-Rad) and
photographed by Leica microscopy (Plan-Apo 1X). Three dishes were set up
for each cell line, and results shown are mean + S.D. of the triplicate plates
for a single experiment, which is representative of two independent
experiments.

72
RESULTS

CARM1 interacts with -catenin, but not LEF1

Previous studies in our lab have demonstrated the in vivo interaction
between CARM1 and -catenin (Koh et al., 2002). To investigate this protein-
protein interaction further, HA-tagged CARM1 was synthesized in vitro and
incubated with GST- -catenin fusion protein bound to glutathione-Sepharose
beads. The associated bound proteins were purified and analyzed by
immunoblot. As shown in Fig. 3-1A, HA-CARM1 was bound to GST- -
catenin, but not GST; and conversely -catenin synthesized in vitro also
bound specifically to GST-CARM1. To more finely map the regions of
CARM1 that are responsible for its interaction with -catenin, various
domains of CARM1 were used and tested for their ability to bind to GST- -
catenin (Fig. 3-1B). The N-terminal and C-terminal domains of CARM1
(amino acids 1 to 200 and 461-608, respectively) did not interact with -
catenin, whereas five overlapping fragments of CARM1 (amino acids 3-460,
3-500, 100-460, 121-608, and 241-608) bound specifically to GST- -catenin,
indicating that part of the methyltransferase domain (amino acids 241-460) is
the major -catenin binding domain. Since the methyltransferase domain is
conserved among members of the protein arginine methyltransferase

73

Fig. 3-1 Interaction between CARM1 and -catenin. (A-B) GST pulldown
assays were performed as described in “Materials and Methods”, using in
vitro translated HA-tagged proteins and bacterially generated GST fusion
protein bound to glutathione-sepharose beads. Bound proteins were
detected by immunoblot analysis using antibodies against an HA tag. (C)
GST pulldown assays were performed as in (A) using GST- -catenin and
HA-tagged fragments of CARM1.

74
Fig. 3-1: Continued

75
(PRMT) family (Bedford and Clarke, 2009), -catenin may also interact with
other PRMTs besides CARM1. The interaction between CARM1 and LEF1
was also investigated by GST pulldown assay; as shown in Fig. 3-1C, there
was no interaction between them.

CARM1 is a specific coactivator of -catenin transcription
activation.

To address whether the binding of CARM1 to -catenin would modulate -
catenin-mediated transcription, we monitored the influence of CARM1
overexpression on the transcriptional activity of -catenin tethered to the
Gal4 DNA-binding domain (DBD). Compared with Gal4 DBD alone, Gal4
DBD fused to -catenin strongly activated expression of a luciferase gene
controlled by Gal4 response elements, and ectopic expression of CARM1
further enhanced the transcription in a dose-dependent manner (Fig. 3-2A).
As a control, the overexpression of CARM1 had minimal or no effect on the
activity of Gal4 DBD. This result indicates that CARM1 interacts with -
catenin and positively modulates the transcriptional activity of -catenin. We
also tested the effect of CARM1 overexpression on the activity of Gal4 DBD
fused to LEF1. No detectable effect was observed (Fig. 3-2A), which is
expected in that CARM1 did not interact with LEF1 (Fig. 3-1C).

76

-catenin is known to be a potent coactivator and could strongly enhance the
expression of its target gene when it is recruited to the promoter by its
interaction with a DNA-binding transcription factor or other coactivators. The
LEF/TCF families are DNA-binding transcription activators and are known to
recruit -catenin to their target genes. To confirm previous findings that
CARM1 potentiates the transcriptional activation of LEF1/ -catenin reporter
genes, we examined the effect of CARM1 overexpression on the expression
of a luciferase reporter plasmid pGL3OT, which is driven by multiple
LEF/TCF-binding elements. As seen in Fig. 3-2B, CARM1 overexpression
together with LEF1 and -catenin drove dramatic expression of the luciferase
reporter gene, and this synergy disappeared when -catenin was omitted.
Thus, this result is consistent with the previous report that CARM1 can
positively modulate transcription in a LEF1/ -catenin-dependent manner
(Koh et al., 2002). Given that CARM1 does not interact with LEF1 directly
(Fig. 3-1C) and the coactivator function of CARM1 depends on the presence
of -catenin, we conclude that CARM1 functions as a secondary coactivator
in the transcriptional activation of genes controlled by LEF1. Moreover,
histone acetyltransferase p300 (Hecht et al., 2000; Sun et al., 2000) was
shown previously to be a coactivator for -catenin-mediated transcription,
and hence we wondered whether p300 and CARM1 could work together to
regulate LEF1/ -catenin mediated reporters. We observed synergistic

77
cooperation of CARM1 and p300 on expression of LEF1/ -catenin mediated
reporters, and this synergy was completely dependent on the presence of -
catenin (Fig. 3-2C). These results agree with the current model that -catenin
associates with DNA-bound LEF1 and functions as a scaffolding protein to
recruit additional coactivators, such as CARM1 and p300, each of which
makes a unique and specific contribution to the highly complex
transcriptional initiation process.

Analysis of basal CARM1 protein expression in colon cancer
cell lines.

Aberrant activation of Wnt/ -catenin signaling has been implicated in the
development of cancers, most notably colorectal cancers. Our reporter gene
data suggest that CARM1 acts as a positive regulator for -catenin activity.
Therefore, to further conduct the studies of CARM1 in a physiologically
relevant model system, we decided to choose human colon cancer cell lines
for subsequent experiments. First, we determined whether CARM1 is
expressed in various human colon cancer lines. When examined by western
blot, eight different lines each were found to express CARM1 protein (Fig. 3-
3A). In contrast, human normal colon cell line FHC showed much lower

78

Fig. 3-2 Cooperation of CARM1 and -catenin as coactivators for
transcriptional activation by LEF1. (A) CV-1 cells were transfected in 12-
well plates with luciferase reporter plasmid GK1-Luc (300 ng) containing
multiple Gal4-binding elements, pM plasmids expressing Gal4-DBD alone or
Gal4-DBD fused to LEF1 or -catenin (100 ng), and pSG5.HA-CARM1 (100,
200 or 600 ng). Luciferase assays were performed on cell extracts as
described under “Materials and Methods”. Results shown are from a single
experiment and are representative of five independent experiments. (B) CV1
cells were transfected with luciferase reporter plasmid pGL3OT (200 ng)
controlled by LEF1-binding elements, pSG5.HA-LEF1 (0.5 ng), pSG5.HA- -
catenin (200 ng), and pSG5.HA-CARM1 (100, 200 or 300 ng). Results are
from a single experiment, which is representative of three independent
experiments. (C) Plasmids used for reporter gene assay were pGL3OT (200
ng) along with pSG5.HA-LEF1 (0.5 ng), pSG5.HA- -catenin (200 ng),
pSG5.HA-CARM1 (200 ng), and pCMV.p300 (200 ng).

79
Fig. 3-2: Continued

80
Fig. 3-2: Continued

81
Fig. 3-2: Continued

82
expression of CARM1, suggesting that CARM1 may be overexpressed
during the development or progression of colorectal carcinoma.

CARM1 mediates transcription of -catenin-activated
downstream target genes.

The HT29 human colorectal carcinoma cell line contains truncated APC
protein, which is unable to mediate degradation of -catenin (Klaus and
Birchmeier, 2008). Abundant -catenin then occupies Wnt-responsive
elements (WREs) in the nucleus and abnormally over-expresses Wnt/ -
catenin target genes. Re-introduction of wide-type APC to HT29 cells
reduces -catenin levels, dissociates -catenin from the promoter and
subsequently abrogates transcriptional activation (He et al., 1998; Roose et
al., 1999; Zhang et al., 2001). Several Wnt/ -catenin target genes (e.g. c-
myc (He et al., 1998), survivin (Zhang et al., 2001) and TCF-1 (Roose et al.,
1999)) were identified by the introduction of wild-type APC into HT29 cells.
To investigate a possible physiological role of CARM1 in Wnt/ -catenin
signaling, we initially used chromatin immunoprecipitation (ChIP) to test
whether CARM1 associates with the endogenous WRE of the Axin2 gene in
its native chromosomal location. As a positive control, -catenin was shown
to bind preferentially to the WRE of the Axin2 gene but not to the 3’
untranslated region (3’ UTR), which lacks WRE sequences (Fig. 3-3B). ChIP

83
performed with antibodies specific against CARM1 showed a higher
recruitment signal at WRE than at 3’UTR, whereas two control IgG
antibodies gave equal low background signals. Therefore, -catenin and
CARM1 specifically occupy the WRE of the Axin2 promoter.

To test whether CARM1 is important for helping -catenin to transactivate
endogenous Wnt target genes, lentiviral vectors that express short-hairpin
RNA (shRNA) against CARM1or -catenin were introduced into HT29 cells to
specifically knockdown protein levels of their corresponding targets.
Immunoblot analysis showed that the protein levels of CARM1 or -catenin
were decreased by their respective shRNAs, when compared with control
nonspecific shRNA (Fig. 3-3C). Consistent with previous reports, reduction of
-catenin levels had a moderate to dramatic effect on various Wnt target
genes tested, such as c-myc, Axin2, s100A4 and GPR49. While -catenin
appeared to play a major role in the expression of Axin2 and GPR49, the
expression of c-myc and s100A4 only partially depended on -catenin and
thereby presumably was controlled by other transcription factor(s) besides
LEF1/ -catenin (Fig. 3-3D). Importantly, knockdown of CARM1 levels had an
impact on the expression of these target genes, thus suggesting that CARM1
is required for constitutive expression of endogenous Wnt target genes
controlled by -catenin.

84
CARM1 plays a critical role in -catenin-mediated
oncogenesis.

CARM1 is essential for expression of Wnt/ -catenin target genes that are
involved in oncogenic growth and cellular transformation (e.g. c-myc, GPR49
and s100A4) (Fig. 3-3D). Therefore, we next examined phenotypic
consequences of CARM1 knockdown in highly proliferative human colorectal
carcinoma HT29 cells. We first compared the cellular proliferation rates of
HT29 cell populations stably infected with lentiviral vectors encoding shRNAs
against a nonspecific sequence (NS) or CARM1. As compared with HT29
shNS cells, the decreased protein level of CARM1 had little or no effect on
cellular proliferation (Fig. 3-4A). However, when the same HT29 cell
populations were tested for their ability to form colonies in culture dishes, we
found that loss of CARM1 resulted in lower numbers of surviving colonies
(Fig. 3-4B). Interestingly, the approximate sizes of colonies (by visual
inspection) were unaffected with CARM1 reduction. These results indicate
that CARM1 is important for clonogenic cell survival, but not for proliferation
rate of the cell. Soft agar assays were performed next to measure
anchorage-independent survival and growth which typically correlates with a
tumorigenic phenotype in vivo. As seen in Fig. 3-4C, HT29 shNS control

85

Fig. 3-3 CARM1 regulates expression of endogenous target genes of -
catenin. (A) CARM1 expression in colon cancer cell lines. Total cell lysates
from the indicated cell lines were analyzed by immunoblot with the indicated
antibodies. (B) ChIP assays were done with HT29 cell chromatin, using
antibodies against -catenin or CARM1, or with normal rabbit IgG (IgG_1,
Santa Cruz Biotechnology; IgG_2, Bethyl Laboratory) (C) HT29 cells infected
with lentivirus encoding shRNA against CARM1, -catenin, or a nonspecific
sequence (NS) were analyzed by immunoblot with the indicated antibodies.
(D) total RNA from the lentivirus-infected cells in (C) was examined by qRT-
PCR analysis, with primers specific for the indicated mRNAs. Results shown
are normalized to the level of GAPDH mRNA, are the mean and range of
variation for duplicate PCR reactions from a single experiment, and are
representative of at least two independent experiments.

86
Fig. 3-3: Continued

87
Fig. 3-3: Continued

88
groups formed significantly more and bigger colonies in soft agar than HT29
shCARM1 groups. Thus reductions in CARM1 protein level significantly
compromised important indicators of the transformed phenotype of colorectal
carcinoma cells.

Wnt3a ligands induce the recruitment of -catenin and
CARM1 to native Wnt-regulatory elements which correlate
with increased transcript level of Wnt target

CARM1 knockdown had an impact on expression of various Wnt/ -catenin
targets, indicating that CARM1 is involved in the transcriptional activation
process directed by -catenin. Nevertheless, crosstalk between the Wnt/ -
catenin cascade and other signaling cascade(s) which converge on the
regulation of the same genes has been reported, and thus it is possible that
the involvement of CARM1 on Wnt/ -catenin target gene expression is not
the result of direct interaction of CARM1 with TCF/LEF- -catenin, but through
other transcriptional factors. Therefore, it is crucial to investigate the role of
CARM1 in a Wnt-inducible system.

RKO human colon carcinoma cells have low cellular protein levels of -
catenin; and after an hour of Wnt3a ligand stimulation, we observed both

89

Fig. 3-4 Role of CARM1 in oncogenic survival and growth of HT29
colorectal carcinomas. (A) HT29 cells were plated in culture dishes, and
cell proliferation was detected by MTS assay. (B) Colony formation efficiency
of HT29 in 6-well cell culture plates. Viable colonies were fixed and stained
with crystal violet. The stain was dissolved in 10% SDS solution and
quantified by absorbance at 595 nm. (C) Soft agar assay of HT29 cells. Cells
were mixed with agar and plated in 35-mm Petri dishes. Microscope images
are shown with a scale bar representing 100 m. Colonies in each dish were
counted by Molecular Imager Gel Doc XR system (Bio-Rad). Results shown
are mean + S.D. from triplicate culture dishes from a single experiment and
are representative of two independent experiments.

90
Fig. 3-4: Continued

91
Fig. 3-4: Continued

92
nuclear and cytosolic accumulation of -catenin (Fig. 3-5A). ChIP
experiments on cells grown for 1 hour Wnt3a conditioned medium (Wnt3a-
CM) or control conditioned medium showed that -catenin was recruited to
the endogenous WRE of the Axin2 gene in the native chromosomal site in
response to Wnt3a (Fig. 3-5B). Additionally, we detected the association of
endogenous CARM1 with the WRE in a Wnt3a-dependent manner, and the
nucleosomes located near the native Axin2-WRE are subject to CARM1-
dependent dimethylation on histone H3 Arginine 17 (H3R17me2). In that
Wnt3a ligands induce the recruitment of -catenin and CARM1 (and perhaps
other unidentified coactivators) to a Wnt-regulated promoter, as well as
H3R17me2 histone methylation event that generally parallels the gene
activation process, we then wondered whether the transcript levels of Wnt
targets are affected with Wnt3a exposure. We showed here that transcript
levels of Axin2 and GPR49 were induced more than three fold after seven
hours exposure to Wnt3a ligands (Fig. 3-5C).

CARM1 is required for Wnt3a-dependent transcriptional
activation

To assess the involvement of CARM1 in Wnt3a-dependent activation of
Axin2 and GPR49 genes, CARM1 expression was efficiently and specifically
silenced in RKO cells at the protein levels by infection with shCARM1-

93
encoding lentivirus (Fig. 3-6A). Upon CARM1 silencing, the Wnt3a-induced
expression of Axin2 and GPR49 was substantially decreased (Fig. 3-6B).
Because stabilization of -catenin is crucial for expression of Wnt/ -catenin
targets, we also investigated whether CARM1 knockdown would interfere
with Wnt3a-induced accumulation of -catenin. As seen in Fig. 3-6A, CARM1
silencing has no effect on it.

Our data have indicated that CARM1 is required for optimal transcriptional
activation of -catenin target genes (Fig. 3-2, Fig. 3-3D and Fig. 3-6B). In
order to examine the mechanistic contributions of CARM1, ChIP assays were
performed for the Wnt response elements in the Axin2 promoter in RKO
shCARM1 and shNS cells. A small fraction of cells were collected for
immunoblots to confirm the efficient CARM1 knockdown by shCARM1 as
well as the proper induced -catenin protein levels by Wnt3a-CM (Fig. 3-6C).
The remaining cells were subject to nuclei isolation, sonication and
subsequently immunoprecipitated with antibodies against -catenin or
H3R17me2. Depletion of CARM1 had no effect on the Wnt3a-regulated
recruitment of -catenin to Axin2-WRE (Fig. 3-6D). However, reduction in
CARM1 levels significantly compromised the arginine 17 dimethylation of
histone H3 in a Wnt3a-dependent manner.

94

Fig. 3-5 Wnt3a ligand induces expression of Wnt target genes and
recruitment of coactivators to the promoters. (A) RKO cells were treated
with purified Wnt3a ligand for 1 hr. Cells were then harvested and subjected
to fractionation. Nuclear fraction and cytosolic fraction were collected and
analyzed by immunoblot with the indicated antibodies. (B) Sheared
chromatin from RKO cells grown with Wnt3a conditioned medium (Wnt3a-
CM) or Control conditioned medium (1 hr treatment) was immunoprecipitated
with the indicated antibodies. Immunoprecipitated DNA was analyzed by
qPCR with primers for the upstream WRE of the Axin2 gene or with primers
for the 3’-untranslated region (3’UTR) of the Axin2 gene. ChIP results shown
are from a single experiment, which is representative of two independent
experiments. (C) RKO cells were treated with purified Wnt3a or untreated
and harvested at the indicated times for qRT-PCR analysis of the indicated
mRNAs. Results shown are normalized to the level of GAPDH mRNA, are
the mean and range of variation for duplicate PCR reactions from a single
experiment, and are representative of at least two independent experiments.

95
Fig. 3-5: Continued

96
Fig. 3-5: Continued

97
Fig. 3-5: Continued

98

Fig. 3-6 CARM1 is required for expression of Wnt-induced target genes.
(A-B) RKO cells were infected with lentivirus encoding shRNA against
CARM1 or a nonspecific sequence (NS). Infected cells were treated with
purified Wnt3a for 7 hr and then harvested for immunoblots (A) or for qRT-
PCR (B). (C-D), Wnt3a conditioned medium (Wnt3a CM) was used to treat
lentivirus infected cells for 1 hr and then harvested for either immunoblots (C)
or ChIP assay (D). Results shown are the mean and range of variation for
duplicate PCR reactions from a single experiment, and are representative of
two independent experiments.

99
Fig. 3-6: Continued

100
Fig. 3-6: Continued

101
DISCUSSION

The Wnt/ -catenin signaling cascade is a highly conserved pathway during
evolution and plays a crucial role in the embryonic development of all animal
species. Wnt signals regulate cellular processes such as cellular proliferation,
survival or differentiation; and misregulation of this signaling system is
heavily implicated in the development of cancers, most notably to colorectal
cancers (Klaus and Birchmeier, 2008; MacDonald et al., 2009). Uncontrolled
Wnt signaling leads to constitutive activation of many oncogenes, which were
tightly regulated and only activated transiently during normal development.
The pivotal mediator which responds to upstream Wnt signals and executes
the downstream gene activation event is -catenin. Upon Wnt stimulus, -
catenin docks on the promoters of its target genes, where it recruits other
transcriptional coactivators to activate the transcription of target genes
(MacDonald et al., 2009; Mosimann et al., 2009). Identification and functional
investigation of -catenin binding partners are thus becoming important
because they will provide novel and exciting insights into the highly
complicated mechanism of Wnt target activation.

CARM1 is a member of the protein arginine methyltransferase family and
transfers the methyl group from S-adenosylmethioine to arginine residues of
specific protein substrates. CARM1 is found in both the nucleus and

102
cytoplasm, and it methylates a large number of cellular substrates including
histone or non-histone proteins. Deregulation of CARM1 is implicated in the
pathogenesis of cancers, in that expression of CARM1 has been correlated
with tumor staging (Bedford and Clarke, 2009). Several findings further
reported that CARM1 functions as a general transcriptional coactivator for
several transcription factors, and as such, altered CARM1 expression likely
affects many transcriptional programmes with consequences of changing
proliferation rate or other oncogenic properties. In fact, studies from the
MCF7 breast cancer cell line showed that CARM1 is a positive regulator of
estrogen receptor-responsive genes and is essential for estrogen-stimulated
growth and proliferation of breast carcinomas (Frietze et al., 2008). Therefore,
by extending the mechanistic knowledge of how deregulated CARM1 might
transform cells, we tested whether CARM1 is transcriptionally involved in
oncogenic activation of the Wnt/ -catenin signaling cascade in human
colorectal carcinomas.

First of all, we showed that CARM1 interacts with -catenin, and experiments
with two different reporters showed that CARM1 and -catenin cooperate
functionally at the transcriptional level. Since reporter gene assays are
considered as an artificial system to study transcription, we then continued to
study the role of CARM1 in Wnt/ -catenin regulation of endogenous genes in
physiologically pertinent colon cancer cells. In a colorectal cancer with

103
aberrant activation of Wnt/ -catenin signaling and thus constitutive -catenin
regulated transcription, CARM1 is essential for expression of several Wnt
target genes, including known oncogenes (c-myc, GPR49 and s100A4) and
a gene involved in the auto-inhibition loop of Wnt signaling (Axin2). Worthy of
mention is that depletion of -catenin caused dramatic loss of expression of
Axin2 and GPR49, but only moderate suppression for c-myc and s100A4
expression. These results suggest that the Wnt/ -catenin pathway plays a
more dominant role in controlling Axin2 and GPR49 genes than in c-myc and
s100A4 genes. In other words, Wnt/ -catenin signaling is only one of several
signaling cascades regulating expression of c-myc and s100A4 genes. As a
matter of fact, the c-myc gene is known to be regulated by transcription
factors such as nuclear receptors and AP1 (Dubik and Shiu, 1988; Iavarone
et al., 2003), and the s100A4 gene is reported to be under the control of
transcription factor NFAT5 (nuclear factor of activated T-cells 5) (Chen et al.,
2009).

The importance of CARM1 for transcript levels of Wnt target genes has been
addressed. Nevertheless, CARM1 works as a general coactivator for multiple
transcription factors, and in addition crosstalk between Wnt/ -catenin
signaling and other signaling cascades which converges on transcriptional
regulation of same target genes has been documented (Chesnutt et al., 2004;
Koh et al., 2002). Accordingly, to know whether CARM1 works directly under

104
the Wnt/ -catenin signaling to modulate transcription, we investigated the
role of CARM1 in a Wnt-responsive colon cancer cell line which has normal
Wnt/ -catenin signaling. Importantly, induction of Axin2 and GPR49
transcription by Wnt3a ligands was blocked by CARM1 depletion, which
indicates that CARM1 is a bona fide coactivator for Wnt/ -catenin signaling.
Furthermore, the recruitment of -catenin to Wnt targets is the very initial
step towards transcriptional activation and thence is very crucial for
expression of Wnt target genes. Depletion of CARM1 levels did not alter
Wnt-induced accumulation of -catenin nor the recruitment of -catenin to
the Wnt target gene. Hence, these findings indicate that CARM1 works
downstream from the promoter-binding -catenin.

When -catenin is inducibly recruited to a Wnt-responsive element (WRE) by
Wnt3a stimulation, CARM1 spontaneously associates with the same WRE in
a Wnt3a-dependent manner and facilitates transcriptional activation by
triggering downstream events, one of which is di-methylating arginine 17 of
histone H3 that is positioned near or at WRE. Depletion of CARM1 eliminates
this modification which coincides with suppression of Wnt3a-induced gene
expression. Thus, arginine-specific histone methylation by CARM1 is
correlated with gene activation and is a significant part of transcriptional
activation process. One would expect that the histone methylation mark

105
would then recruit a downstream methyl-binding protein that assists
transcription, though no such proteins have been identified.

Abnormal activation of CARM1 has been linked to human prostate (Hong et
al., 2004; Majumder et al., 2006) and breast cancers (El Messaoudi et al.,
2006). In this report, we showed that CARM1 protein levels are higher in a
panel of colorectal cancer cell lines than in the normal control cell line.
Moreover, CARM1 silencing adversely affected clonal survival and
anchorage-independent growth of transformed colorectal cancers. We also
revealed that CARM1 functions in oncogenic colon cancer growth through
the transcriptional regulation of Wnt/ -catenin signaling. Thereby,
interference of interaction between CARM1 and -catenin may be a potential
strategy for therapeutic treatment of abnormally activated Wnt/ -catenin
signaling in colorectal cancers.

106
Chapter 3 References
Barker, N., van Es, J.H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen,
M., Haegebarth, A., Korving, J., Begthel, H., Peters, P.J., et al. (2007).
Identification of stem cells in small intestine and colon by marker gene Lgr5.
Nature 449, 1003-1007.
Bedford, M.T., and Clarke, S.G. (2009). Protein arginine methylation in
mammals: who, what, and why. Mol Cell 33, 1-13.
Chen, M., Sinha, M., Luxon, B.A., Bresnick, A.R., and O'Connor, K.L. (2009).
Integrin alpha6beta4 controls the expression of genes associated with cell
motility, invasion, and metastasis, including S100A4/metastasin. J Biol Chem
284, 1484-1494.
Chesnutt, C., Burrus, L.W., Brown, A.M., and Niswander, L. (2004).
Coordinate regulation of neural tube patterning and proliferation by TGFbeta
and WNT activity. Dev Biol 274, 334-347.
Dubik, D., and Shiu, R.P. (1988). Transcriptional regulation of c-myc
oncogene expression by estrogen in hormone-responsive human breast
cancer cells. J Biol Chem 263, 12705-12708.
El Messaoudi, S., Fabbrizio, E., Rodriguez, C., Chuchana, P., Fauquier, L.,
Cheng, D., Theillet, C., Vandel, L., Bedford, M.T., and Sardet, C. (2006).
Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive
regulator of the Cyclin E1 gene. Proc Natl Acad Sci U S A 103, 13351-13356.
Frietze, S., Lupien, M., Silver, P.A., and Brown, M. (2008). CARM1 regulates
estrogen-stimulated breast cancer growth through up-regulation of E2F1.
Cancer Res 68, 301-306.
He, T.C., Sparks, A.B., Rago, C., Hermeking, H., Zawel, L., da Costa, L.T.,
Morin, P.J., Vogelstein, B., and Kinzler, K.W. (1998). Identification of c-MYC
as a target of the APC pathway. Science 281, 1509-1512.
Hecht, A., Vleminckx, K., Stemmler, M.P., van Roy, F., and Kemler, R.
(2000). The p300/CBP acetyltransferases function as transcriptional
coactivators of beta-catenin in vertebrates. EMBO J 19, 1839-1850.
Hong, H., Kao, C., Jeng, M.H., Eble, J.N., Koch, M.O., Gardner, T.A., Zhang,
S., Li, L., Pan, C.X., Hu, Z., et al. (2004). Aberrant expression of CARM1, a
transcriptional coactivator of androgen receptor, in the development of
prostate carcinoma and androgen-independent status. Cancer 101, 83-89.

107
Iavarone, C., Catania, A., Marinissen, M.J., Visconti, R., Acunzo, M.,
Tarantino, C., Carlomagno, M.S., Bruni, C.B., Gutkind, J.S., and Chiariello, M.
(2003). The platelet-derived growth factor controls c-myc expression through
a JNK- and AP-1-dependent signaling pathway. J Biol Chem 278, 50024-
50030.
Kim, P.J., Plescia, J., Clevers, H., Fearon, E.R., and Altieri, D.C. (2003).
Survivin and molecular pathogenesis of colorectal cancer. Lancet 362, 205-
209.
Klaus, A., and Birchmeier, W. (2008). Wnt signalling and its impact on
development and cancer. Nat Rev Cancer 8, 387-398.
Koh, S.S., Li, H., Lee, Y.H., Widelitz, R.B., Chuong, C.M., and Stallcup, M.R.
(2002). Synergistic coactivator function by coactivator-associated arginine
methyltransferase (CARM) 1 and beta-catenin with two different classes of
DNA-binding transcriptional activators. J Biol Chem 277, 26031-26035.
Lee, Y.H., and Stallcup, M.R. (2009). Minireview: protein arginine methylation
of nonhistone proteins in transcriptional regulation. Mol Endocrinol 23, 425-
433.
Li, H., Kim, J.H., Koh, S.S., and Stallcup, M.R. (2004). Synergistic effects of
coactivators GRIP1 and beta-catenin on gene activation: cross-talk between
androgen receptor and Wnt signaling pathways. J Biol Chem 279, 4212-4220.
MacDonald, B.T., Tamai, K., and He, X. (2009). Wnt/beta-catenin signaling:
components, mechanisms, and diseases. Dev Cell 17, 9-26.
Majumder, S., Liu, Y., Ford, O.H., 3rd, Mohler, J.L., and Whang, Y.E. (2006).
Involvement of arginine methyltransferase CARM1 in androgen receptor
function and prostate cancer cell viability. Prostate 66, 1292-1301.
McClanahan, T., Koseoglu, S., Smith, K., Grein, J., Gustafson, E., Black, S.,
Kirschmeier, P., and Samatar, A.A. (2006). Identification of overexpression of
orphan G protein-coupled receptor GPR49 in human colon and ovarian
primary tumors. Cancer Biol Ther 5, 419-426.
Mosimann, C., Hausmann, G., and Basler, K. (2009). Beta-catenin hits
chromatin: regulation of Wnt target gene activation. Nat Rev Mol Cell Biol 10,
276-286.

108
Ou, C.Y., Kim, J.H., Yang, C.K., and Stallcup, M.R. (2009). Requirement of
cell cycle and apoptosis regulator 1 for target gene activation by Wnt and
beta-catenin and for anchorage-independent growth of human colon
carcinoma cells. J Biol Chem 284, 20629-20637.
Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851.
Puri, P.L., Sartorelli, V., Yang, X.J., Hamamori, Y., Ogryzko, V.V., Howard,
B.H., Kedes, L., Wang, J.Y., Graessmann, A., Nakatani, Y., et al. (1997).
Differential roles of p300 and PCAF acetyltransferases in muscle
differentiation. Mol Cell 1, 35-45.
Reya, T., and Clevers, H. (2005). Wnt signalling in stem cells and cancer.
Nature 434, 843-850.
Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K.,
Goldschmeding, R., Logtenberg, T., and Clevers, H. (1999). Synergy
between tumor suppressor APC and the beta-catenin-Tcf4 target Tcf1.
Science 285, 1923-1926.
Stein, U., Arlt, F., Walther, W., Smith, J., Waldman, T., Harris, E.D., Mertins,
S.D., Heizmann, C.W., Allard, D., Birchmeier, W., et al. (2006). The
metastasis-associated gene S100A4 is a novel target of beta-catenin/T-cell
factor signaling in colon cancer. Gastroenterology 131, 1486-1500.
Sun, Y., Kolligs, F.T., Hottiger, M.O., Mosavin, R., Fearon, E.R., and Nabel,
G.J. (2000). Regulation of beta -catenin transformation by the p300
transcriptional coactivator. Proc Natl Acad Sci U S A 97, 12613-12618.
Teyssier, C., Chen, D., and Stallcup, M.R. (2002). Requirement for multiple
domains of the protein arginine methyltransferase CARM1 in its
transcriptional coactivator function. J Biol Chem 277, 46066-46072.
Teyssier, C., Ma, H., Emter, R., Kralli, A., and Stallcup, M.R. (2005).
Activation of nuclear receptor coactivator PGC-1alpha by arginine
methylation. Genes Dev 19, 1466-1473.
Willert, K., Brown, J.D., Danenberg, E., Duncan, A.W., Weissman, I.L., Reya,
T., Yates, J.R., 3rd, and Nusse, R. (2003). Wnt proteins are lipid-modified
and can act as stem cell growth factors. Nature 423, 448-452.
Zhang, T., Otevrel, T., Gao, Z., Ehrlich, S.M., Fields, J.Z., and Boman, B.M.
(2001). Evidence that APC regulates survivin expression: a possible
mechanism contributing to the stem cell origin of colon cancer. Cancer Res
61, 8664-8667.

109
CHAPTER 4: CONCLUDING REMARKS

Aberrant activation of the Wnt/β-catenin signaling cascade is an important
part of the etiology of colorectal carcinomas, and more than 90% of colon
cancers bear mutations that result in abnormal stabilization of β-catenin
(Bienz and Clevers, 2000; Polakis, 2000). Uncontrolled elevation of β-catenin
continuously drives expression of proto-oncogenes and thus leads to
excessive cell proliferation that predisposes cells to tumorigenesis (Klaus
and Birchmeier, 2008). Therefore, understanding dysregulated Wnt/β-
catenin-mediated gene activation and designing therapeutic agents that
target this pathway has generated significant interest.

The lymphoid enhancer factor/T cell factor (LEF/TCF) family of DNA-bound
transcription factors is the main partner for β-catenin in gene activation. Wnt-
induced β-catenin stabilization and nuclear accumulation leads LEF/TCF to
complex with β-catenin, which then displaces corepressors from LEF/TCF
and recruits coactivators to loosen chromatin structure, initiate the assembly
of pre-initiation complex and RNA polymerase II, and subsequently
transcribe Wnt/β-catenin target genes (MacDonald et al., 2009; Stadeli et al.,
2006). Given that transcriptional initiation is a very complex process,
presumably a number of β-catenin-associated coactivators are required for
this process, and each of them all has a distinct and unique contribution in

110
helping β-catenin to activate the transcription. The work presented in this
thesis describes the studies of two novel β-catenin coactivators (CCAR1 and
CARM1) and their molecular and physiological roles in Wnt signaling.

Several different types of experimental evidence support the notion that
CCAR1 (or CARM1) functions as a transcriptional coactivator for β-catenin-
controlled gene activation. First, GST pull-down and co-immunoprecipitation
assays demonstrated the physical interaction between β-catenin and CCAR1
(or CARM1) (Fig. 2-1A, Fig. 2-1B and Fig. 3-1A). Second, fusion of β-catenin
to Gal4-DBD showed autonomous transcriptional activation of a luciferase
reporter containing the Gal4 response elements, and overexpression of
CCAR1 (or CARM1) further enhanced the β-catenin-driven activity in a dose-
dependent manner (Fig. 2-2A and Fig. 3-2A). Third, synergy experiments
showed that CCAR1 (or CARM1) is necessary for synergistic activation with
β-catenin of LEF1-mediated reporter gene activation (Fig. 2-2B and Fig. 3-
2B). Fourth, in colon cancer cell lines (HT29 cells) which have abnormally
activated Wnt/β-catenin signaling, depletion of endogenous CCAR1 (or
CARM1) causes reduction in transcript of Wnt/β-catenin target genes (Fig. 2-
4B and Fig. 3-3D). Moreover, chromatin immunoprecipitation (ChIP) showed
that endogenous CCAR1 (or CARM1) and β-catenin constitutively occupy the
promoter of a Wnt/β-catenin target gene in its native chromosomal locus (Fig.
2-3A and Fig. 3-3B). Finally, with the usage of another colorectal cancer cell-

111
line (RKO cells) which have normal Wnt3a-dependent regulation of β-catenin
protein levels and β-catenin-controlled transcription, we demonstrated that
CCAR1 (or CARM1) is specifically required for expression of Wnt3a-induced
gene (Fig. 2-4C and Fig. 3-6B), suggesting that CCAR1 (or CARM1) is the
bona fide coactivator for transcriptional regulation of Wnt/β-catenin signaling.

Transcriptional initiation is a highly complicated process and generally
requires multiple coactivators to assist to activate it. Synergy experiments
demonstrated that coactivators CCAR1, CARM1 and p300 function together
to synergistically promote transcriptional activation directed by LEF1/β-
catenin (Fig. 2-2C), indicating that CCAR1, CARM1 and p300 each makes a
specific and non-overlapping contribution to the process of transcriptional
activity. p300 is a transcriptional coactivator that links proteins to basal
transcription machinery or alters chromatin structure through its intrinsic or
associated histone acetyltransferase activities (Hecht et al., 2000; Stadeli et
al., 2006). Therefore my thesis addressed the coactivator functions of
CCAR1 and CARM1 in Wnt/β-catenin controlled transcirption.

ChIP assays with depletion of either CCAR1 or β-catenin demonstrated that
CCAR1 absolutely required the presence of β-catenin to be positioned on a
promoter of an endogenous Wnt target gene, and that the recruitment of β-
catenin also partially depended on the existence of CCAR1 (Fig. 2-3D). ChIP

112
experiments and sequential immunoprecipitations (ChIP and Re-ChIP)
showed that CCAR1 and β-catenin occupied the endogenous Wnt-
responsive element (WRE) together as part of the same complex (Fig. 2-3B).
Moreover, GST pull-down assay showed the physical interaction between
LEF1 and CCAR1 (Fig. 2-1A). These data indicate that CCAR1 plays a role
in stabilizing β-catenin at the WRE, which is essential for transcriptional
initiation. Perhaps the LEF1-CCAR1 interaction, if it occurs in the chromatin-
based cellular environment, contributes to stable occupancy of β-catenin
and/or CCAR1 on the WRE. However, further studies are required to test it.

On the contrary, CARM1 is not required for β-catenin occupancy at WRE.
ChIP assays on Wnt-responsive RKO cells showed that CARM1 knockdown
had no effect on Wnt-induced β-catenin accumulation and on Wnt-induced
β-catenin recruitment to the WRE (Fig. 3-6C and Fig. 3-6D). This suggests
that CARM1 works downstream from promoter-binding -catenin.
Furthermore, ChIP assays on Wnt3a-stimulated RKO cells showed that
when -catenin was inducibly recruited to a WRE by Wnt3a stimulation,

CARM1 spontaneously associated with the same WRE and facilitated
transcriptional activation by triggering downstream events, one of which was
di-methylating arginine 17 of histone H3 positioned near or at a WRE in its

113
native chromosomal position (Fig. 3-5B). Reduction of CARM1 eliminated
this histone modification which was concurrent with suppression of Wnt3a-
induced gene activation (Fig. 3-6B and Fig. 3-6D). Therefore, CARM1-
directed histone modification is correlated with gene activation and thus may
be a crucial part of transcriptional activation. To test the importance of
CARM1-dependent arginine methylation on histones (or non-histone
proteins), it will be tempting to overexpress the enzymatically-dead form of
CARM1 in cells and check whether there is a dominant-negative effect on
expression of endogenous Wnt target genes or not. Additionally,
downstream signal events triggered by arginine-specific histone methylation
on promoters remain poorly understood. It is proposed that histone
methylation marks recruit a downstream methyl-binding protein that is
involved in transcriptional activation, although no such proteins have been
identified. Further work on identification and functional analysis of the
methyl-binding protein is crucial and will shed light on the complex
mechanism of Wnt target gene activation.

During transcriptional activation, ATP-dependent chromatin remodeling
complexes are known to disrupt the compact chromatin architecture of target
promoters and facilitate recruitment of essential proteins for transcription to
nucleosome-free promoters (Stadeli et al., 2006). In the case of the -
catenin-directed gene activation, -catenin was reported to associate with

114
Brg1, the ATPase subunit of the SWI/SNF chromatin remodeling complex
(Barker et al., 2001). Moreover, Brg1 was shown to function as a positive
transcriptional coregulator of Wnt/ -catenin regulated transcription, and
ATPase activity of Brg1 was essential for expression of Wnt/ -catenin target
genes (Barker et al., 2001). Interestingly, previous findings showed that
CARM1 is found in a large ATP-dependent chromatin-remodeling complex,
which includes the ATPase Brg1 (Xu et al., 2004). Within the complex,
CARM1 acquires the ability to methylate nucleosomal histone H3, whereas
free CARM1 prefers to methylate free histone. Reciprocally, CARM1
stimulates the ATPase activity of Brg1 as demonstrated by in vitro ATPase
assay (Xu et al., 2004). Thereby, we hypothesize that CARM1 cooperates
with Brg1 to remodel the chromatin which involves loosening up the
chromatin structure and modifying histones by arginine methylation, and thus
collectively overcomes the repressive structure of chromatin in -catenin-
targeted gene activation. Evidently, our preliminary data showed that in
response to Wnt3a ligand, Brg1 (data not shown), along with -catenin and
CARM1 are inducibly recruited to an endogenous WRE in its native
chromosomal locus, which is subjected to CARM1-dependent dimethylation
on histone H3 arginine 17 (Fig. 3-5B). Furthermore, transient transfection
reporter gene assay showed that CARM1 cooperated with Brg1 to
synergistically enhance the reporter gene expression controlled by LEF1/ -

115
catenin, and the ATPase activity of Brg1 is required for the synergy (data not
shown).

To further strengthen the proposed hypothesis above, several tempting
experiments are suggested. First, ChIP and ReChIP assays are needed in
order to prove that CARM1 and Brg1 co-exist in the same complex at the
WRE. Second, if CARM1 and Brg1 do co-exist in the same complex at the
promoter, it will be interesting to know whether their occupancies at WRE
are mutually dependent on each other. Thereby, depletion of CARM1 (or
Brg1) and performing ChIP experiments to check the recruitment signal of
Brg1 (CARM1) will provide insightful information. Third, since CARM1 is
important for ATPase activity of Brg1 in vitro and chromatin remodeling at
the promoter requires energy derived from Brg1-dependent ATP hydrolysis,
it will be of interest to test whether depletion of CARM1 would affect in vivo
Brg1 activity, as judged by DNase digestion of chromatin. Fourth, if
knockdown of CARM1 would have any effect on the promoter recruitment or
chromatin remodeling activity of Brg1, it will be tempting to further investigate
which domain(s) of CARM1 is required for the effect or to ask whether the
methyltransferase activity is involved in it.

116
In conclusion, our studies on CCAR1 and CARM1 have expanded our
understanding of transcriptional coactivators in Wnt/ -catenin signaling. Of
most importance is to demonstrate their non-overlapping coactivator
functions for -catenin-dependent transcription and their cooperative synergy
in promoting transcriptional activation. Of equal importance is to know that
CCAR1 and CARM1 are required for potent transcription of Wnt mediated
oncogenes and hence are crucial for oncogenic growth of transformed
colorectal cancers (Fig. 2-5 and Fig. 3-4). In addition, many cancers
overexpress coactivators and hijack them to drive pathologic outcome. In
support of this notion, aberrant activation of CARM1 has been linked to
human prostate (Hong et al., 2004; Majumder et al., 2006), breast (El
Messaoudi et al., 2006; Frietze et al., 2008) and colon cancers (Fig. 3-3A).
Thereby, fine-tuning of abnormally activated Wnt/ -catenin signaling in
cancers by targeting specific coactivator- -catenin interaction may be a
potential therapeutic treatment in the future.

117
Chapter 4 References
Barker, N., Hurlstone, A., Musisi, H., Miles, A., Bienz, M., and Clevers, H.
(2001). The chromatin remodelling factor Brg-1 interacts with beta-catenin to
promote target gene activation. EMBO J 20, 4935-4943.
Bienz, M., and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling.
Cell 103, 311-320.
El Messaoudi, S., Fabbrizio, E., Rodriguez, C., Chuchana, P., Fauquier, L.,
Cheng, D., Theillet, C., Vandel, L., Bedford, M.T., and Sardet, C. (2006).
Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive
regulator of the Cyclin E1 gene. Proc Natl Acad Sci U S A 103, 13351-13356.
Frietze, S., Lupien, M., Silver, P.A., and Brown, M. (2008). CARM1 regulates
estrogen-stimulated breast cancer growth through up-regulation of E2F1.
Cancer Res 68, 301-306.
Hecht, A., Vleminckx, K., Stemmler, M.P., van Roy, F., and Kemler, R.
(2000). The p300/CBP acetyltransferases function as transcriptional
coactivators of beta-catenin in vertebrates. EMBO J 19, 1839-1850.
Hong, H., Kao, C., Jeng, M.H., Eble, J.N., Koch, M.O., Gardner, T.A., Zhang,
S., Li, L., Pan, C.X., Hu, Z., et al. (2004). Aberrant expression of CARM1, a
transcriptional coactivator of androgen receptor, in the development of
prostate carcinoma and androgen-independent status. Cancer 101, 83-89.
Klaus, A., and Birchmeier, W. (2008). Wnt signalling and its impact on
development and cancer. Nat Rev Cancer 8, 387-398.
MacDonald, B.T., Tamai, K., and He, X. (2009). Wnt/beta-catenin signaling:
components, mechanisms, and diseases. Dev Cell 17, 9-26.
Majumder, S., Liu, Y., Ford, O.H., 3rd, Mohler, J.L., and Whang, Y.E. (2006).
Involvement of arginine methyltransferase CARM1 in androgen receptor
function and prostate cancer cell viability. Prostate 66, 1292-1301.
Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851.
Stadeli, R., Hoffmans, R., and Basler, K. (2006). Transcription under the
control of nuclear Arm/beta-catenin. Curr Biol 16, R378-385.
Xu, W., Cho, H., Kadam, S., Banayo, E.M., Anderson, S., Yates, J.R., 3rd,
Emerson, B.M., and Evans, R.M. (2004). A methylation-mediator complex in
hormone signaling. Genes Dev 18, 144-156.

118
BIBLIOGRAPHY

Aguilera, O., Fraga, M. F., Ballestar, E., Paz, M. F., Herranz, M., Espada, J.,
Garcia, J. M., Munoz, A., Esteller, M., and Gonzalez-Sancho, J. M. (2006).
Epigenetic inactivation of the Wnt antagonist DICKKOPF-1 (DKK-1) gene in
human colorectal cancer. Oncogene 25, 4116-4121.
An, W., Kim, J., and Roeder, R. G. (2004). Ordered cooperative functions of
PRMT1, p300, and CARM1 in transcriptional activation by p53. Cell 117,
735-748.
Barker, N., Hurlstone, A., Musisi, H., Miles, A., Bienz, M., and Clevers, H.
(2001). The chromatin remodelling factor Brg-1 interacts with beta-catenin to
promote target gene activation. EMBO J 20, 4935-4943.
Barker, N., van Es, J. H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen,
M., Haegebarth, A., Korving, J., Begthel, H., Peters, P. J., and Clevers, H.
(2007). Identification of stem cells in small intestine and colon by marker
gene Lgr5. Nature 449, 1003-1007.
Bauer, A., Chauvet, S., Huber, O., Usseglio, F., Rothbacher, U., Aragnol, D.,
Kemler, R., and Pradel, J. (2000). Pontin52 and reptin52 function as
antagonistic regulators of beta-catenin signalling activity. EMBO J 19, 6121-
6130.
Bedford, M. T., and Clarke, S. G. (2009). Protein arginine methylation in
mammals: who, what, and why. Mol Cell 33, 1-13.
Bienz, M., and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling.
Cell 103, 311-320.
Carrera, I., Janody, F., Leeds, N., Duveau, F., and Treisman, J. E. (2008).
Pygopus activates Wingless target gene transcription through the mediator
complex subunits Med12 and Med13. Proc Natl Acad Sci U S A 105, 6644-
6649.
Chamorro, M. N., Schwartz, D. R., Vonica, A., Brivanlou, A. H., Cho, K. R.,
and Varmus, H. E. (2005). FGF-20 and DKK1 are transcriptional targets of
beta-catenin and FGF-20 is implicated in cancer and development. EMBO J
24, 73-84.

119
Chen, D., Ma, H., Hong, H., Koh, S. S., Huang, S. M., Schurter, B. T., Aswad,
D. W., and Stallcup, M. R. (1999). Regulation of transcription by a protein
methyltransferase. Science 284, 2174-2177.
Chen, M., Sinha, M., Luxon, B. A., Bresnick, A. R., and O'Connor, K. L.
(2009). Integrin alpha6beta4 controls the expression of genes associated
with cell motility, invasion, and metastasis, including S100A4/metastasin. J
Biol Chem 284, 1484-1494.
Chen, S. L., Loffler, K. A., Chen, D., Stallcup, M. R., and Muscat, G. E.
(2002). The coactivator-associated arginine methyltransferase is necessary
for muscle differentiation: CARM1 coactivates myocyte enhancer factor-2. J
Biol Chem 277, 4324-4333.
Chen, Y. H., Yang, C. K., Xia, M., Ou, C. Y., and Stallcup, M. R. (2007). Role
of GAC63 in transcriptional activation mediated by beta-catenin. Nucleic
Acids Res 35, 2084-2092.
Cheng, D., Cote, J., Shaaban, S., and Bedford, M. T. (2007). The arginine
methyltransferase CARM1 regulates the coupling of transcription and mRNA
processing. Mol Cell 25, 71-83.
Chesnutt, C., Burrus, L. W., Brown, A. M., and Niswander, L. (2004).
Coordinate regulation of neural tube patterning and proliferation by TGFbeta
and WNT activity. Dev Biol 274, 334-347.
Covic, M., Hassa, P. O., Saccani, S., Buerki, C., Meier, N. I., Lombardi, C.,
Imhof, R., Bedford, M. T., Natoli, G., and Hottiger, M. O. (2005). Arginine
methyltransferase CARM1 is a promoter-specific regulator of NF-kappaB-
dependent gene expression. EMBO J 24, 85-96.
Crawford, H. C., Fingleton, B. M., Rudolph-Owen, L. A., Goss, K. J.,
Rubinfeld, B., Polakis, P., and Matrisian, L. M. (1999). The metalloproteinase
matrilysin is a target of beta-catenin transactivation in intestinal tumors.
Oncogene 18, 2883-2891.
Dahmen, R. P., Koch, A., Denkhaus, D., Tonn, J. C., Sorensen, N., Berthold,
F., Behrens, J., Birchmeier, W., Wiestler, O. D., and Pietsch, T. (2001).
Deletions of AXIN1, a component of the WNT/wingless pathway, in sporadic
medulloblastomas. Cancer Res 61, 7039-7043.
Deng, J., Miller, S. A., Wang, H. Y., Xia, W., Wen, Y., Zhou, B. P., Li, Y., Lin,
S. Y., and Hung, M. C. (2002). beta-catenin interacts with and inhibits NF-
kappa B in human colon and breast cancer. Cancer Cell 2, 323-334.

120
Dubik, D., and Shiu, R. P. (1988). Transcriptional regulation of c-myc
oncogene expression by estrogen in hormone-responsive human breast
cancer cells. J Biol Chem 263, 12705-12708.
Easwaran, V., Pishvaian, M., Salimuddin, and Byers, S. (1999). Cross-
regulation of beta-catenin-LEF/TCF and retinoid signaling pathways. Curr
Biol 9, 1415-1418.
El Messaoudi, S., Fabbrizio, E., Rodriguez, C., Chuchana, P., Fauquier, L.,
Cheng, D., Theillet, C., Vandel, L., Bedford, M. T., and Sardet, C. (2006).
Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive
regulator of the Cyclin E1 gene. Proc Natl Acad Sci U S A 103, 13351-13356.
Feng, Y., Lee, N., and Fearon, E. R. (2003). TIP49 regulates beta-catenin-
mediated neoplastic transformation and T-cell factor target gene induction via
effects on chromatin remodeling. Cancer Res 63, 8726-8734.
Frietze, S., Lupien, M., Silver, P. A., and Brown, M. (2008). CARM1 regulates
estrogen-stimulated breast cancer growth through up-regulation of E2F1.
Cancer Res 68, 301-306.
Fuerer, C., Nusse, R., and Ten Berge, D. (2008). Wnt signalling in
development and disease. Max Delbruck Center for Molecular Medicine
meeting on Wnt signaling in Development and Disease. EMBO Rep 9, 134-
138.
Gonzalez-Sancho, J. M., Aguilera, O., Garcia, J. M., Pendas-Franco, N.,
Pena, C., Cal, S., Garcia de Herreros, A., Bonilla, F., and Munoz, A. (2005).
The Wnt antagonist DICKKOPF-1 gene is a downstream target of beta-
catenin/TCF and is downregulated in human colon cancer. Oncogene 24,
1098-1103.
Ha, N. C., Tonozuka, T., Stamos, J. L., Choi, H. J., and Weis, W. I. (2004).
Mechanism of phosphorylation-dependent binding of APC to beta-catenin
and its role in beta-catenin degradation. Mol Cell 15, 511-521.
Hayward, P., Kalmar, T., and Arias, A. M. (2008). Wnt/Notch signalling and
information processing during development. Development 135, 411-424.
He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T.,
Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998). Identification of c-MYC
as a target of the APC pathway. Science 281, 1509-1512.

121
Hecht, A., Vleminckx, K., Stemmler, M. P., van Roy, F., and Kemler, R.
(2000). The p300/CBP acetyltransferases function as transcriptional
coactivators of beta-catenin in vertebrates. EMBO J 19, 1839-1850.
Hong, H., Kao, C., Jeng, M. H., Eble, J. N., Koch, M. O., Gardner, T. A.,
Zhang, S., Li, L., Pan, C. X., Hu, Z., et al. (2004). Aberrant expression of
CARM1, a transcriptional coactivator of androgen receptor, in the
development of prostate carcinoma and androgen-independent status.
Cancer 101, 83-89.
Iavarone, C., Catania, A., Marinissen, M. J., Visconti, R., Acunzo, M.,
Tarantino, C., Carlomagno, M. S., Bruni, C. B., Gutkind, J. S., and Chiariello,
M. (2003). The platelet-derived growth factor controls c-myc expression
through a JNK- and AP-1-dependent signaling pathway. J Biol Chem 278,
50024-50030.
Jho, E. H., Zhang, T., Domon, C., Joo, C. K., Freund, J. N., and Costantini, F.
(2002). Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a
negative regulator of the signaling pathway. Mol Cell Biol 22, 1172-1183.
Kim, J. H., Kim, B., Cai, L., Choi, H. J., Ohgi, K. A., Tran, C., Chen, C.,
Chung, C. H., Huber, O., Rose, D. W., et al. (2005). Transcriptional
regulation of a metastasis suppressor gene by Tip60 and beta-catenin
complexes. Nature 434, 921-926.
Kim, J. H., Li, H., and Stallcup, M. R. (2003a). CoCoA, a nuclear receptor
coactivator which acts through an N-terminal activation domain of p160
coactivators. Mol Cell 12, 1537-1549.
Kim, J. H., Yang, C. K., Heo, K., Roeder, R. G., An, W., and Stallcup, M. R.
(2008). CCAR1, a key regulator of mediator complex recruitment to nuclear
receptor transcription complexes. Mol Cell 31, 510-519.
Kim, P. J., Plescia, J., Clevers, H., Fearon, E. R., and Altieri, D. C. (2003b).
Survivin and molecular pathogenesis of colorectal cancer. Lancet 362, 205-
209.
Kinzler, K. W., and Vogelstein, B. (1996). Lessons from hereditary colorectal
cancer. Cell 87, 159-170.
Klaus, A., and Birchmeier, W. (2008). Wnt signalling and its impact on
development and cancer. Nat Rev Cancer 8, 387-398.

122
Koh, S. S., Li, H., Lee, Y. H., Widelitz, R. B., Chuong, C. M., and Stallcup, M.
R. (2002). Synergistic coactivator function by coactivator-associated arginine
methyltransferase (CARM) 1 and beta-catenin with two different classes of
DNA-binding transcriptional activators. J Biol Chem 277, 26031-26035.
Kramps, T., Peter, O., Brunner, E., Nellen, D., Froesch, B., Chatterjee, S.,
Murone, M., Zullig, S., and Basler, K. (2002). Wnt/wingless signaling requires
BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-
TCF complex. Cell 109, 47-60.
Lee, Y. H., Koh, S. S., Zhang, X., Cheng, X., and Stallcup, M. R. (2002).
Synergy among nuclear receptor coactivators: selective requirement for
protein methyltransferase and acetyltransferase activities. Mol Cell Biol 22,
3621-3632.
Lee, Y. H., and Stallcup, M. R. (2006). Interplay of Fli-I and FLAP1 for
regulation of beta-catenin dependent transcription. Nucleic Acids Res 34,
5052-5059.
Lee, Y. H., and Stallcup, M. R. (2009). Minireview: protein arginine
methylation of nonhistone proteins in transcriptional regulation. Mol
Endocrinol 23, 425-433.
Leung, J. Y., Kolligs, F. T., Wu, R., Zhai, Y., Kuick, R., Hanash, S., Cho, K.
R., and Fearon, E. R. (2002). Activation of AXIN2 expression by beta-
catenin-T cell factor. A feedback repressor pathway regulating Wnt signaling.
J Biol Chem 277, 21657-21665.
Li, H., Kim, J. H., Koh, S. S., and Stallcup, M. R. (2004). Synergistic effects
of coactivators GRIP1 and beta-catenin on gene activation: cross-talk
between androgen receptor and Wnt signaling pathways. J Biol Chem 279,
4212-4220.
Li, J., and Wang, C. Y. (2008). TBL1-TBLR1 and beta-catenin recruit each
other to Wnt target-gene promoter for transcription activation and
oncogenesis. Nat Cell Biol 10, 160-169.
Liu, W., Dong, X., Mai, M., Seelan, R. S., Taniguchi, K., Krishnadath, K. K.,
Halling, K. C., Cunningham, J. M., Boardman, L. A., Qian, C., et al. (2000).
Mutations in AXIN2 cause colorectal cancer with defective mismatch repair
by activating beta-catenin/TCF signalling. Nat Genet 26, 146-147.
MacDonald, B. T., Tamai, K., and He, X. (2009). Wnt/beta-catenin signaling:
components, mechanisms, and diseases. Dev Cell 17, 9-26.

123
Majumder, S., Liu, Y., Ford, O. H., 3rd, Mohler, J. L., and Whang, Y. E.
(2006). Involvement of arginine methyltransferase CARM1 in androgen
receptor function and prostate cancer cell viability. Prostate 66, 1292-1301.
Mann, B., Gelos, M., Siedow, A., Hanski, M. L., Gratchev, A., Ilyas, M.,
Bodmer, W. F., Moyer, M. P., Riecken, E. O., Buhr, H. J., and Hanski, C.
(1999). Target genes of beta-catenin-T cell-factor/lymphoid-enhancer-factor
signaling in human colorectal carcinomas. Proc Natl Acad Sci U S A 96,
1603-1608.
Marcu, K. B., Bossone, S. A., and Patel, A. J. (1992). myc function and
regulation. Annu Rev Biochem 61, 809-860.
McClanahan, T., Koseoglu, S., Smith, K., Grein, J., Gustafson, E., Black, S.,
Kirschmeier, P., and Samatar, A. A. (2006). Identification of overexpression
of orphan G protein-coupled receptor GPR49 in human colon and ovarian
primary tumors. Cancer Biol Ther 5, 419-426.
McDonald, S. A., Preston, S. L., Lovell, M. J., Wright, N. A., and Jankowski, J.
A. (2006). Mechanisms of disease: from stem cells to colorectal cancer. Nat
Clin Pract Gastroenterol Hepatol 3, 267-274.
Miao, F., Li, S., Chavez, V., Lanting, L., and Natarajan, R. (2006).
Coactivator-associated arginine methyltransferase-1 enhances nuclear
factor-kappaB-mediated gene transcription through methylation of histone H3
at arginine 17. Mol Endocrinol 20, 1562-1573.
Miyagishi, M., Fujii, R., Hatta, M., Yoshida, E., Araya, N., Nagafuchi, A.,
Ishihara, S., Nakajima, T., and Fukamizu, A. (2000). Regulation of Lef-
mediated transcription and p53-dependent pathway by associating beta-
catenin with CBP/p300. J Biol Chem 275, 35170-35175.
Mosimann, C., Hausmann, G., and Basler, K. (2009). Beta-catenin hits
chromatin: regulation of Wnt target gene activation. Nat Rev Mol Cell Biol 10,
276-286.
Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma,
I. M., and Trono, D. (1996). In vivo gene delivery and stable transduction of
nondividing cells by a lentiviral vector. Science 272, 263-267.
Newell, K. J., Witty, J. P., Rodgers, W. H., and Matrisian, L. M. (1994).
Expression and localization of matrix-degrading metalloproteinases during
colorectal tumorigenesis. Mol Carcinog 10, 199-206.

124
Niida, A., Hiroko, T., Kasai, M., Furukawa, Y., Nakamura, Y., Suzuki, Y.,
Sugano, S., and Akiyama, T. (2004). DKK1, a negative regulator of Wnt
signaling, is a target of the beta-catenin/TCF pathway. Oncogene 23, 8520-
8526.
Nusse, R. (2008). Wnt signaling and stem cell control. Cell Res 18, 523-527.
Olson, L. E., Tollkuhn, J., Scafoglio, C., Krones, A., Zhang, J., Ohgi, K. A.,
Wu, W., Taketo, M. M., Kemler, R., Grosschedl, R., et al. (2006).
Homeodomain-mediated beta-catenin-dependent switching events dictate
cell-lineage determination. Cell 125, 593-605.
Ou, C. Y., Kim, J. H., Yang, C. K., and Stallcup, M. R. (2009). Requirement
of cell cycle and apoptosis regulator 1 for target gene activation by Wnt and
beta-catenin and for anchorage-independent growth of human colon
carcinoma cells. J Biol Chem 284, 20629-20637.
Palmer, H. G., Gonzalez-Sancho, J. M., Espada, J., Berciano, M. T., Puig, I.,
Baulida, J., Quintanilla, M., Cano, A., de Herreros, A. G., Lafarga, M., and
Munoz, A. (2001). Vitamin D(3) promotes the differentiation of colon
carcinoma cells by the induction of E-cadherin and the inhibition of beta-
catenin signaling. J Cell Biol 154, 369-387.
Parker, D. S., Jemison, J., and Cadigan, K. M. (2002). Pygopus, a nuclear
PHD-finger protein required for Wingless signaling in Drosophila.
Development 129, 2565-2576.
Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851.
Puri, P. L., Sartorelli, V., Yang, X. J., Hamamori, Y., Ogryzko, V. V., Howard,
B. H., Kedes, L., Wang, J. Y., Graessmann, A., Nakatani, Y., and Levrero, M.
(1997). Differential roles of p300 and PCAF acetyltransferases in muscle
differentiation. Mol Cell 1, 35-45.
Reya, T., and Clevers, H. (2005). Wnt signalling in stem cells and cancer.
Nature 434, 843-850.
Rishi, A. K., Zhang, L., Boyanapalli, M., Wali, A., Mohammad, R. M., Yu, Y.,
Fontana, J. A., Hatfield, J. S., Dawson, M. I., Majumdar, A. P., and Reichert,
U. (2003). Identification and characterization of a cell cycle and apoptosis
regulatory protein-1 as a novel mediator of apoptosis signaling by retinoid
CD437. J Biol Chem 278, 33422-33435.

125
Rishi, A. K., Zhang, L., Yu, Y., Jiang, Y., Nautiyal, J., Wali, A., Fontana, J. A.,
Levi, E., and Majumdar, A. P. (2006). Cell cycle- and apoptosis-regulatory
protein-1 is involved in apoptosis signaling by epidermal growth factor
receptor. J Biol Chem 281, 13188-13198.
Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K.,
Goldschmeding, R., Logtenberg, T., and Clevers, H. (1999). Synergy
between tumor suppressor APC and the beta-catenin-Tcf4 target Tcf1.
Science 285, 1923-1926.
Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T.,
Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., et al. (2000). AXIN1
mutations in hepatocellular carcinomas, and growth suppression in cancer
cells by virus-mediated transfer of AXIN1. Nat Genet 24, 245-250.
Shah, S., Hecht, A., Pestell, R., and Byers, S. W. (2003). Trans-repression of
beta-catenin activity by nuclear receptors. J Biol Chem 278, 48137-48145.
Sierra, J., Yoshida, T., Joazeiro, C. A., and Jones, K. A. (2006). The APC
tumor suppressor counteracts beta-catenin activation and H3K4 methylation
at Wnt target genes. Genes Dev 20, 586-600.
Smith, D. R., Myint, T., and Goh, H. S. (1993). Over-expression of the c-myc
proto-oncogene in colorectal carcinoma. Br J Cancer 68, 407-413.
Song, L. N., Herrell, R., Byers, S., Shah, S., Wilson, E. M., and Gelmann, E.
P. (2003). Beta-catenin binds to the activation function 2 region of the
androgen receptor and modulates the effects of the N-terminal domain and
TIF2 on ligand-dependent transcription. Mol Cell Biol 23, 1674-1687.
Stadeli, R., Hoffmans, R., and Basler, K. (2006). Transcription under the
control of nuclear Arm/beta-catenin. Curr Biol 16, R378-385.
Stein, U., Arlt, F., Walther, W., Smith, J., Waldman, T., Harris, E. D., Mertins,
S. D., Heizmann, C. W., Allard, D., Birchmeier, W., et al. (2006). The
metastasis-associated gene S100A4 is a novel target of beta-catenin/T-cell
factor signaling in colon cancer. Gastroenterology 131, 1486-1500.
Sun, Y., Kolligs, F. T., Hottiger, M. O., Mosavin, R., Fearon, E. R., and Nabel,
G. J. (2000). Regulation of beta -catenin transformation by the p300
transcriptional coactivator. Proc Natl Acad Sci U S A 97, 12613-12618.
Takemaru, K. I., and Moon, R. T. (2000). The transcriptional coactivator CBP
interacts with beta-catenin to activate gene expression. J Cell Biol 149, 249-
254.

126
Teyssier, C., Chen, D., and Stallcup, M. R. (2002). Requirement for multiple
domains of the protein arginine methyltransferase CARM1 in its
transcriptional coactivator function. J Biol Chem 277, 46066-46072.
Teyssier, C., Ma, H., Emter, R., Kralli, A., and Stallcup, M. R. (2005).
Activation of nuclear receptor coactivator PGC-1alpha by arginine
methylation. Genes Dev 19, 1466-1473.
Wang, S., and Jones, K. A. (2006). CK2 controls the recruitment of Wnt
regulators to target genes in vivo. Curr Biol 16, 2239-2244.
Willert, K., Brown, J. D., Danenberg, E., Duncan, A. W., Weissman, I. L.,
Reya, T., Yates, J. R., 3rd, and Nusse, R. (2003). Wnt proteins are lipid-
modified and can act as stem cell growth factors. Nature 423, 448-452.
Wu, R., Zhai, Y., Fearon, E. R., and Cho, K. R. (2001). Diverse mechanisms
of beta-catenin deregulation in ovarian endometrioid adenocarcinomas.
Cancer Res 61, 8247-8255.
Xing, Y., Clements, W. K., Kimelman, D., and Xu, W. (2003). Crystal
structure of a beta-catenin/axin complex suggests a mechanism for the beta-
catenin destruction complex. Genes Dev 17, 2753-2764.
Xing, Y., Clements, W. K., Le Trong, I., Hinds, T. R., Stenkamp, R.,
Kimelman, D., and Xu, W. (2004). Crystal structure of a beta-catenin/APC
complex reveals a critical role for APC phosphorylation in APC function. Mol
Cell 15, 523-533.
Xu, W., Cho, H., Kadam, S., Banayo, E. M., Anderson, S., Yates, J. R., 3rd,
Emerson, B. M., and Evans, R. M. (2004). A methylation-mediator complex in
hormone signaling. Genes Dev 18, 144-156.
Yang, C. K., Kim, J. H., Li, H., and Stallcup, M. R. (2006). Differential use of
functional domains by coiled-coil coactivator in its synergistic coactivator
function with beta-catenin or GRIP1. J Biol Chem 281, 3389-3397.
Zhang, T., Otevrel, T., Gao, Z., Ehrlich, S. M., Fields, J. Z., and Boman, B. M.
(2001). Evidence that APC regulates survivin expression: a possible
mechanism contributing to the stem cell origin of colon cancer. Cancer Res
61, 8664-8667.

127
Zhao, J., Pettigrew, G. J., Thomas, J., Vandenberg, J. I., Delriviere, L.,
Bolton, E. M., Carmichael, A., Martin, J. L., Marber, M. S., and Lever, A. M.
(2002). Lentiviral vectors for delivery of genes into neonatal and adult
ventricular cardiac myocytes in vitro and in vivo. Basic Res Cardiol 97, 348-
358.
Zika, E., Fauquier, L., Vandel, L., and Ting, J. P. (2005). Interplay among
coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-
gamma-inducible MHC-II gene expression. Proc Natl Acad Sci U S A 102,
16321-16326.
Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., and Trono, D. (1997).
Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo.
Nat Biotechnol 15, 871-875.

Abstract (if available)

Abstract Aberrant activation of Wnt/beta-catenin signaling is recognized as a critical factor in the etiology of colorectal cancer. Evidence has suggested that dysregulated beta-catenin activity is associated with the majority of colon cancers via activation of the expression of Wnt regulated oncogenes. In the nucleus, beta-catenin regulates transcription by recruiting additional coactivators. These coactivators all have distinct and unique functions on Wnt/beta-catenin target gene activation. Here we report two coactivators for beta-catenin-mediated transcription: CCAR1 (Cell Cycle and Apoptosis Regulator 1) and CARM1 (coactivator-associated-protein-arginine-methyltransferase 1). We show that both CCAR1 and CARM1 interact with beta-catenin and positively modulate beta-catenin-mediated gene expression. In colorectal cancer cells, which have constitutively high Wnt/beta-catenin activity, depletion of CCAR1 or CARM1 inhibits the expression of Wnt/beta-catenin-mediated oncogenes and suppresses anchorage-independent growth. In colorectal cancer cells that do not have constitutively high Wnt/beta-catenin activity, we found that activation of Wnt/beta-catenin signaling by treatment with Wnt3a increased beta-catenin levels and the expression of a subset of Wnt target genes. Utilizing these cells, we demonstrated that CCAR1 or CARM1 is specifically required for the expression of these Wnt3a-induced targets. Thus, CCAR1 and CARM1 are required for expression of the target genes of Wnt and beta-catenin in cells with normal or abnormal regulation of beta-catenin. However, the coactivator functions of CCAR1 and CARM1 are different. While CCAR1 plays a role in stabilizing beta-catenin on the promoter of a Wnt target gene, CARM1 works downstream from promoter-binding beta-catenin.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Molecular role of EZH2 overexpression in Colorectal Cancer progression

PDF

Role of beta-catenin in mouse epiblast stem cell, embryonic stem cell self-renewal and differentiation

PDF

Harnessing the power of stem cell self-renewal pathways in cancer: dissecting the role of BMI-1 in Ewing’s sarcoma initiation and maintenance

PDF

Steatosis induces Wnt/β-catenin pathway to stimulate proliferation of hepatic tumor initiating cells and promote liver cancer development

PDF

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

The role of histone H4 lysine 20 monomethylation in gene expression and differentiation

PDF

The role of fibroblast growth factor signaling on postnatal hepatic progenitor cell expansion

PDF

Wnt/β-catenin/p300 induced transcription is critical for the differentiation and maintenance of Paneth cells

PDF

The role of LGR5 in the pathogenesis of Ewing sarcoma: a marker of aggressive disease and a contributor to the malignant phenotype

PDF

Importance of alpha-catenin and cell-cell interactions in hair follicle stem cells homeostasis

PDF

Novel roles for Maf1 in embryonic stem cell differentiation and adipogenesis

PDF

Molecular mechanism of transforming growth factor-beta signaling in skin wound healing

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

Evaluating novel chemotherapeutic strategies in colorectal and gastric cancer: the role of histone deacetylase inhibitors and human epidermal receptor family inhibitors

PDF

The expression of human carboxylesterases in normal tissues and cancer cell-lines

PDF

Identification of CBP/FOXM1 as a molecular target in triple negative breast cancer

PDF

The noncanonical role of telomerase in prostate cancer cells: exploring a non-telomeric signaling role for telomerase protein (TERT) in a cancer cell line

PDF

Mechanisms for regulating the expression of the TATA-binding protein

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Leucine-rich amelogenin peptide induces osteogenesis in mouse embryonic stem cells

Asset Metadata

Creator Ou, Chen-Yin (author)

Core Title Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 04/24/2012

Defense Date 03/16/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag beta-catenin,CARM1,CCAR1,coactivator,colon cancer,colorectal cancer,OAI-PMH Harvest,transcriptional regulation,Wnt signaling

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Stallcup, Michael R. (committee chair), Frenkel, Baruch (committee member), Ladner, Robert D. (committee member), Lu, Wange (committee member)

Creator Email chenyino@usc.edu,s42154@hotmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2950

Unique identifier UC1151609

Identifier etd-Ou-3607 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-310293 (legacy record id),usctheses-m2950 (legacy record id)

Legacy Identifier etd-Ou-3607.pdf

Dmrecord 310293

Document Type Dissertation

Rights Ou, Chen-Yin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu