University of Southern California Dissertations and Theses

The effect of microbial load and autophagy on drosophila immunity and life span

(USC Thesis Other)

The effect of microbial load and autophagy on drosophila immunity and life span

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

THE EFFECT OF MICROBIAL LOAD AND AUTOPHAGY ON DROSOPHILA
IMMUNITY AND LIFE SPAN

by

Chunli Ren

_____________________________________

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
in Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR BIOLOGY)

December 2008

Copyright 2008 Chunli Ren

ii
Acknowledgements
I would like to express my greatest appreciation to my graduate advisor and mentor,
Dr. John Tower, who supervised, directed and helped me for all of my work. His
instruction, patience and encouragement helped me to finish this study. I also give
special thanks to Dr. Steve Finkel for his constant instruction and advice on my study. I
am very grateful to Dr. Paul Webster in the House Ear Institute for teaching me to use
their electronic microscopy and advise me for my project. I also acknowledge Dr.
Oscar Aparicio, Dr. Michelle Arbeitman and Dr. Minnie McMillan for serving as my
committee members and give me guidance.
I want to thank the people in my lab and our Molecular Biology program for giving
me different kinds of help and support during my study, especially to Dr. Morris
Waskar, Yishi Li, Dr. Daofeng Liu, Linda Bazilian, Christina Tasulis and Eleni Yokas.
I appreciate my parents and my husband for their continuous support during these
years, for their understanding, tolerance and love.

iii
Table of Contents
Acknowledgements .................................................................................................... ii
List of Tables ...............................................................................................................v
List of Figures.............................................................................................................vi
Abbreviations .......................................................................................................... viii
Abstract..................................................................................................................... iix

CHAPTER 1 INTRODUCTION..............................................................................1
1.0 Introduction to Study of Aging in Drosophila................................................1
1.1 Bacteria’s Effect on the Host..........................................................................3
1.2 Drosophila’s Innate Immunity........................................................................4
1.3 GeneSwitch System to Express Genes Conditionally....................................7
1.4 Autophagy as a Fundamental Cellular Mechanism........................................9
1.5 Autophagy and Immunity.............................................................................11

CHAPTER 2 INCREASED BACTERIAL LOAD DURING DROSOPHILA
AGING WITHOUT LIFE SPAN TRADE-OFF .......................................................14
2.0 Introduction ..................................................................................................14
2.1 Results ..........................................................................................................17
2.1.1 Bacterial Load Increases during Age .................................................17
2.1.2 Microbial Species Associated with Flies............................................21
2.1.3 Analysis of Bacteria on the Fly Surface.............................................27
2.1.4 Bacterial Load Is Eliminated in Axenic Flies.....................................34
2.1.5 Life Span Is Not Altered by Microbial Load......................................38
2.1.6 AMP Gene Expression Is Reduced in Axenic Flies...........................44
2.2 Discussion.....................................................................................................57
2.3 Experimental Procedures..............................................................................59
2.3.1 Fly Stocks and Culture .......................................................................59
2.3.2 Antibiotic treatment............................................................................60
2.3.3 Axenic fly culture...............................................................................60
2.3.4 Bacterial Counts from Flies................................................................61
2.3.5 Identification of cultured bacterial species.........................................62
2.3.6 Identification of Bacterial Species by PCR........................................62
2.3.7 Northern Blot Analysis.......................................................................63
2.3.8 Semiquantitative Real-Time PCR Assay of Bacterial Load...............63
2.3.9 Scanning Electron Microscopy Assays ..............................................64
2.3.10 Antifungal Treatment .......................................................................64
2.3.11 Correlation between Bacterial Load of Individual Flies and the
Surface of Their Food with Age..................................................................65

iv
2.3.12 Bacterial Load in 100% Oxygen-Treated Flies................................66
2.3.13 PCR Assay of Wolbachia Sequences ...............................................66
2.3.14 AMP-GFP Reporter Expression Measurements...............................67
2.3.15 Quantification of Northern Blot Data...............................................68
2.3.16 Statistics............................................................................................68

Chapter 3 CONDITIONAL INHIBITION OF AUTOPHAGY GENES IN
ADULT DROSOPHILA IMPAIRS IMMUNITY WITHOUT
COMPROMISING LONGEVITY............................................................................69
3.0 Introduction ..................................................................................................69
3.1 Results ..........................................................................................................72
3.1.1 Conditional Inactivation of Atg Genes Using Geneswitch System....72
3.1.2 Life Span Is Not Altered by Adult-Specific Inhibition of Atg5,
Atg7 and Atg12 genes .................................................................................75
3.1.3 Atg Gene Inhibition Reduces Survival After E. coli Injection...........82
3.1.4 Atg Gene Inhibition Enables E. coli Proliferation in Injected Flies...89
3.2 Discussion.....................................................................................................96
3.3 Experimental Procedures............................................................................103
3.3.1 Drosophila strains.............................................................................103
3.3.2 Drosophila culture ...........................................................................103
3.3.3 Life span assays for Atg7 inhibition at either developmental
or adult stage..............................................................................................105
3.3.4 Real-time RT-PCR ...........................................................................105
3.3.5 E. coli injection into flies..................................................................106
3.3.6 Bacterial counts from E.coli injected flies .......................................107
3.3.7 Statistics............................................................................................108

Chapter 4 CONCLUSIONS AND FUTURE STUDIES......................................109

BIBLIOGRAPHY ...................................................................................................115

v

List of Tables
Table 1. Microorganisms Associated with Oregon-R Flies. ............................... 26

Table 2. Fold Induction of AMP Genes..................................................................49

vi
List of Figures

Figure 1. 1 Diagram of Toll (left) and Imd (right) Signaling Pathway
in Drosophila.. ....................................................................................................6

Figure 1. 2 The Molecules and Steps in the Autophagy Pathway. . .................... 10

Figure 2. 1 Drosophila Bacterial Load Increases with Age. ...........................19

Figure 2. 2 Correlation between bacterial load of individual flies and the
surface of their food with age. ........................................................................20

Figure 2. 3 Fungal Load in Control- and Antifungal-Treated Flies. ...............23

Figure 2. 4 PCR Assay for Fungal Existence in Flies. . ...................................24

Figure 2. 5 Assay of Wolbachia Sequences by PCR. . .....................................25

Figure 2. 6 Analysis of Fly Surface. ...............................................................29

Figure 2. 7 SEM Assay of Bacterial Species Grown on Plates. . .....................33

Figure 2. 8 Semiquantitative PCR Assay of Bacterial 16S rDNA Gene
Sequences in Control and Axenic Flies............................................................35

Figure 2. 9 Life-span analyses. ....................................................................40

Figure 2. 10 Bacterial Load Was Reduced in Antibiotic-Treated Flies. .......43

Figure 2. 11 Expression of Antimicrobial Peptide Genes during Aging of
Control and Axenic Flies. ...............................................................................46

Figure 2. 12 Quantitative RT-PCR Assay of AMP Gene Expression in
Young and Old, Control and Axenic, Oregon-R and Canton-S Flies. .............50

Figure 2. 13 Bacterial Load under 100% Oxygen Conditions. . ......................53

Figure 2. 14 Correlation between Bacterial Count and AMP-GFP
Reporter Expression in Young and Old Individual Flies. ................................54

vii

Figure 2. 15 Summary of Bacterial Effects to Aging. ......................................59
Figure 3.1 Outline of autophagy pathway and role of Atg5, Atg7 and Atg12. 72
Figure 3.2 Real-time RT-PCR Assay of Atg5, Atg7 and Atg12 Gene
Message Levels in Control and Autophagy-inhibited Flies. ...........................74

Figure 3.3 Effect of Autophagy Gene inhibition on Survival of Adult Flies...76

Figure 3.4 Effect of Autophagy Gene Inhibition on Survival of Adult Flies
at 25˚C. ............................................................................................................79

Figure 3.5 Effect of Autophagy Gene Inhibition on Survival of Flies after
E. coli Injection ...............................................................................................83

Figure 3.6 Effect of Autophagy Gene Inhibition on Survival of Flies after
E. coli Injection at 29˚C...................................................................................86

Figure 3.7 Effect of Autophagy Gene Inhibition on Bacterial Titers in
E. coli Injected Flies........................................................................................90

Figure 3.8 Effect of Autophagy Gene Inhibition on Bacterial Titers in
E. coli Injected Flies at 29˚C. ..........................................................................93

Figure 3.9 Life Span Analyses of the Effect of Atg7 Inhibition During
both Developmental and Adult Stages at 25˚C..............................................100

viii

Abbreviations

Atg – Autophagy
Atg5 – Autophagy pathway gene 5
Atg7 – Autophagy pathway gene 7
Atg12 – Autophagy pathway gene 12
Or-R – Oregon R flies
CS – Canton S flies

ix

Abstract

Aging is a complicated process which is affected by many factors. Here we want to
check what bacteria are associated with the fruit fly Drosophila melanogaster and how
the bacteria affect the fly life span. Microbial load was quantified inside the body and
on the surface of adult flies. Both aerobic and anaerobic bacterial load increased
dramatically during aging in both compartments. Structures resembling abundant small
bacteria and bacterial biofilms were visualized on the surface of old flies by scanning
electron microscopy and cell staining. Bacteria cultured from laboratory flies included
aerobic species Acetobacter aceti, Acetobacter tropicalis, Acetobacter pasteurianus
and anaerobic Lactobacillus plantarum and Lactobacillus MR-2. Additional species
Lactobacillus homohiochii, Lactobacillus fructivorans and Lactobacillus brevis were
identified by DNA sequencing. Bacterial load and anti-microbial-peptide gene
expression were reduced or eliminated using axenic culture conditions and antibiotics,
however life span was unaffected. The data demonstrate that Drosophila can tolerate a
significant internal and external bacterial load and mount a large innate immune
response without a detectable trade-off with life span, and suggest that microbes do not
limit life span in the optimized laboratory assay.
Autophagy is a basic cellular function to autodigest contents of the cytoplasm for
recycling or removal. Recently it was also found that it is involved in resistance to

x
bacteria in cultured cells. In addition, autophagy genes are required for life span
extension caused by reduced insulin/IGF1-like signaling and dietary restriction in C.
elegans. Here I wanted to test if the autophagy pathway might be limiting for
immunity and/or life span in adult Drosophila. The Geneswitch system was used to
cause conditional inactivation of the Atg5, Atg7 and Atg12 genes by RNAi. Conditional
inhibition of Atg genes in adult flies reduced resistance to injected E. coli, as evidenced
by increased bacterial titers and reduced survival. However, survival of uninjected flies
was unaffected by Atg gene inactivation. The data indicate that Atg gene activity is
required for normal immune function in adult flies, and suggest that neither immune
function nor autophagy are limiting for adult life span under typical laboratory
conditions.

1
CHAPTER 1 INTRODUCTION
1.0 Introduction to Study of Aging in Drosophila
Aging results in a decrease of performance and fitness and leads to death (Hughes
and Reynolds, 2005). The life span assay is the most simple and commonly used
way to measure aging, although it cannot give direct information on the mechanisms
that lead to death. The median and mean life spans are measures used to compare life
spans in different fly groups to check whether the aging process is affected (Helfand
and Rogina, 2003).
The fruit fly Drosophila melanogaster is one of the most commonly used model
organisms for the study of aging mechanisms. There are many advantages to using
Drosophila in aging studies. First, it has a short life span, which is about 3 months
and it can be cultured easily. Second, many genetically different stocks are available
in public stock centers. Third, the whole genome sequence of Drosophila and many
molecular and genetic techniques are available. Fourth, development is easy to study
since the life cycle contains obvious morphologically different stages.
Several manipulations are known to affect Drosophila’s life span nongenetically.
First, environmental temperature can affect life span. Usually life span can be
doubled at 18˚C compared to 25˚C and reduced one-third at 29˚C and this change is
probably through an effect on metabolic rates (Helfand et al., 1995). Second,

2
reproduction status can affect life span in both male and female flies. Virgin females’
life span can be doubled compared to mated ones and courtship reduces life span in
male flies (Cordts and Patridge, 1996; Helfand and Rogina, 2003). Third, dietary
restriction can extend life span and it is well studied in many other organisms, e.g.
nematodes and mammals (Longo and Finch, 2003).
Many genes in different systems and pathways have been found to affect
Drosophila’s life span. ROS (reactive oxidative species) generated from cellular
metabolism causes oxidative damage to cellular macromolecules. The accumulated
damage may be one of the main factors to cause aging (Finkel and Holbrook, 2000;
Sohal et al., 2000). Over-expression of antioxidant enzymes, such as catalase and
superoxide dismutase (SOD) extend Drosophila’s life span (Parkes et al., 1998; Sun
et al., 2004). The Insulin/insulin-like growth factor (IIS) signaling pathway is a
conserved pathway from yeast to mouse. Reduced IIS signaling may be a way to
extend lifespan by the reduction of dietary nutrients (Tu et al., 2002). Mutations in
the insulin/IGF-like signaling pathway of Drosophila, like InR and chico, extend life
span (Clancy et al., 2001; Tatar et al., 2001). Histone acetylation has also been
shown to be involved in lifespan determination,

for example, the reduced level of
histone deacetylase Rpd3 was found to extend life span in Drosophila (Rogina et al.,
2002).

3

1.1 Bacteria’s Effect on the Host
The pathogenic bacteria, for example, Group A Streptococcus and
Staphylococcus aureus, can cause many infections in many organs and may lead to
death. But most of bacteria associated with humans are non-pathogenic. These
bacteria are called “commensal” to the host since the bacteria and host can coexist
without obvious benefit or detriment to each other (Hooper and Gordon, 2001).
Some bacteria are called mutualistic since the hosts can gain carbon and energy from
them (Backhed et al., 2005). Sometimes the non-pathogenic bacteria can also be
used as a therapeutic agent, such as Escherichia coli to treat ulcerative colitis
(Rembacken et al., 1999). However, the commensal flora in the human gut can shift
to a pathogenic state in some conditions like inflammatory bowel disease (IBD)
(Macpherson et al., 1996). Some bacteria, like Helicobacter pylori, have both
beneficial and detrimental effects: it promotes appetite regulation yet is linked to
ulcers and gastric cancer (Kuipers et al., 2003). So the effect of endogenous bacteria
on the human host can vary and depends on different physiological status of bacteria
and host.
Besides pathogenicity, bacteria can alter life span and host fitness under
appropriate conditions. For example, when C. elegans was cultured in absence of

4
bacteria, it had a longer life span and greater stress resistance (Garigan et al., 2002;
Houthoofd et al., 2003; Houthoofd et al., 2002). A diverse microbial flora is required
for normal gut development and function in mammals (Ge et al., 2006). It was also
found that in Drosophila that have the normal flora have shortened developmental
time compared to the axenic and monoxenic conditions (Bakula, 1969).

1.2 Drosophila’s Innate Immunity
Insects don’t have adaptive immune response, which can produce specific
antibodies by the immune T and B cells. They only have innate immunity to defend
against invading microbes. The innate immune response in Drosophila is manifested
in 3 ways: first, the humoral response generates circulating antimicrobial peptides
(AMPs) to kill invading pathogens; second, there is a cellular response to
encapsulate the microbes by the hemocytes and result in phagocytosis; third, the cell
deposits black pigment produced by melanization around the foreign particles for
degradation (Hultmark, 2003).
Humoral immunity generates circulating antimicrobial peptides (AMPs) in various
tissues rapidly after the microbes enter the body cavity. The AMPs are produced by
the Drosophila fat body, which functions similarly to the liver in mammals. At least
seven AMPs are found in Drosophila: drosomycin, metchnikowin, defensin,

5
diptericin, attacin, cecropin and drosocin (Hultmark, 2003). They kill bacteria in the
hemolymph and are regulated by two distinct signaling pathways: the Toll and Imd
pathways. Rel proteins (Dorsal, DIF and Relish) are involved in these pathways and
are conserved with human transcription factor NF-kB. The Toll pathway is
particularly important in the defense against infections caused by natural fungi and
Gram-positive bacteria. The peptidoglycan of Gram-positive bacteria and an
unknown molecule from fungi are recognized by molecules in Drosophila and
activates Toll, a transmembrane receptor. Several proteins, including Myd88, Tube,
Pelle, and some unknown enzymes work together to activate DIF (dorsal-related
immunity factor). Then the active DIF translocates into the nucleus and activates
downstream gene expression. Drosomycin is the main AMP activated by this
pathway. The Imd pathway is primarily activated by infection with Gram-negative
bacteria. The exact mechanism how the bacteria are recognized by this pathway is
still not known. Several proteins including Imd, dFADD, and DREDD possibly work
together to activate the transcription factor Relish. Many downstream AMPs are
activated by this pathway: diptericin, cecropin, and other immune-response factors
(Leclerc and Reichhart, 2004).

6

Figure 1. 1 Diagram of Toll (left) and Imd (right) Signaling Pathway in
Drosophila. Adapted from (Hoffmann and Reichhart, 2002).
The cellular immune response relies on the phagocytosis of pathogens by
macrophage-like blood cells, also called hemocytes. There are three main classes of
hemocytes with phagocytosis function: plasmatocytes, lamellocytes and crystal cells.
Plasmatocytes are the most important class and are professional phagocytes. They
take up infectious bacteria and other particles rapidly. Lamellocytes are flattened in
shape and encapsulate larger invaders such as parasites. Crystal cells, which have a
crystalline inclusion inside the cytoplasm, contain phenoloxidase and are required in
the humoral melanization defense to kill bacteria (Leclerc and Reichhart, 2004).

Toll
TLR
Myd88
Tube
Pelle
DIF
Drosomycin
Other immune-responsive
proteins
G- bacteria
?
Imd
dFADD
DREDD

Relish
Diptericin
Cecropin
Defensin
Other immune proteins
Fungi
G+ bacteria

7
A phenoloxidase reaction catalyzes the production of melanin and deposits it
around wounds and foreign objects (Hultmark, 2003). When Drosophila is wounded
by invaders and its cuticular barrier is broken, deposition of melanin and rapid
clotting of the hemolymph is induced (Soderhall and Cerenius, 1998). The
bacteria-specific receptors, like LPS and peptidoglycan, are recognized and trigger
the proteolytic pathway.
1.3 GeneSwitch System to Express Genes Conditionally
Many transgenic methods are available to control gene expression in
Drosophila, including ‘GAL4/UAS’, ‘FLP-out’ and ‘tet-on’ systems (Tower, 2000).
The GAL4/UAS system is the most useful and versatile method among them. It can
be combined with ‘FLP-out’, ‘tet-on’ and other systems when designed properly.
Gal4 is a yeast transcription factor and UAS (upstream activating sequence) is
Gal4’s binding site. They are not present in Drosophila normally and are usually
introduced into the fly genome by P element-mediated transformation. The Gal4
transgenic construct contains a weak promoter and it cannot drive the expression of a
significant amount of Gal4 by itself. After the P element is transposed into the fly
genome, Gal4 protein will be expressed to a greater level if the construct is located
around enhancers of other genes. These lines with the Gal4 elements are called Gal4
drivers. The UAS construct consists of the UAS promoter sequence and the

8
downstream coding sequence of the gene of interest. The downstream gene will not
be expressed if Gal4 does not bind and activate the UAS promoter. However, when
the two constructs are introduced into the same fly by crosses, the gene of interest
will be expressed after the activated Gal4 binds the UAS sequence. Since different
enhancers are located in different positions and may function temporally, gene
expression can be tissue- and/or temporally-specific. Gal4 drivers with many
different tissue-specific expression patterns are available from the EP (enhancer and
promoter)-Gal4 driver collection (Rorth et al., 1998).
The modified Gal4 protein, Gal4-ER, was shown to be activated by the
mammalian steroid hormone estrogen (Braselmann et al., 1993). The Gal4-ER is a
combined transcription factor, which consists of the yeast Gal4 DNA-binding
domain and human estrogen-binding domain. When the artificial human steroid
hormone RU486 is present, the GAL4-ER protein is activated in Drosophila and
promotes the UAS-regulated downstream gene expression (Osterwalder et al., 2001).
Induction is at a very low basal level without RU486. The GAL4-ER protein is now
called “GeneSwitch” and is controlled by the drug RU486. Many target genes can be
expressed by the “GeneSwitch” protein system, which can be controlled in a spatial-
and temporal-specific pattern.

9
1.4 Autophagy as a Fundamental Cellular Mechanism
Autophagy is a primary homeostatic process to autodigest cytosolic
macromolecules for recycling or removal. It is a conserved process from yeast to
humans (Deretic, 2005). It recycles macromolecules to provide nutrients to the cells
in the starved condition. It also removes damaged and old organelles, like
mitochondria, to protect cells from oxidative stress and other damages
(Rodriguez-Enriquez et al., 2004). More than 20 autophagy proteins are involved in
this pathway. They were first identified in yeast, and then similar proteins were
found in Drosophila (Baehrecke, 2003).
The autophagy pathway has 3 stages. First, the isolation membrane or the
phagophore, a nascent cellular structure is formed in the initiation stage. Atg1
initiates the process and is regulated by Tor (target of rapamycin). Tor is a Ser/Thr
kinase and is the critical factor to regulate the initiation of autophagy. VPS34
(vascular protein sorting 34) is required for the initiation process and controlled by
Atg6 (Beclin). Atg9 is also involved in the initiation process and is an integral
membrane protein (Deretic, 2005). Second, many factors work together to enlarge
the phagophore in the elongation stage by adding new membranes. Then the new
membranes form a sealed autophagosome. The captured organelle and cytosol are
wrapped inside the autophagosome. In this process, Atg12 is linked with Atg7 first,

10
then transferred to Atg10 and connected with Atg5. The Atg5-12 complex is
stabilized by Atg16 and the Atg5-12/Atg16 complex localizes to the outside
membrane of the autophagosome. The Atg5-Atg12 complex is a ubiquitin-like
system and is critical in the enlongation process. The other protein-protein
conjugation system is LC3-II, the lipidated form of Atg8. The non-lipidated form of
Atg8, LC3-I, is activated by Atg7 and Atg3 and finally converted to the lipidated
LC3-II. This conversion process can be monitored by western blots and is a good
marker for autophagy (Tanida et al., 2008). The LC3-II exists in both sides of the
membrane and still remains inside after the autophagosome is complete, while the
Atg5-Atg12-Atg16 complex leaves from the outside membrane. Finally, in the
maturation stage, the autophagosome and lysosomes fuse to form an autolysosome to
degrade the inside contents.

Figure 1. 2 The Molecules and Steps in the Autophagy Pathway. Adapted from
(Deretic, 2005).

Atg7-Atg12
Atg5-Atg12
Captured
organelle
and cytosol
Initiation
Elongation
Maturation
Isolation membrane/Phagophore Autophagosom Autolysosom
Atg16
Tor
Atg1
Beclin
PI3K
VPS34
Atg9
LC3-I
LC3-II

11

Autophagy can be regulated by many factors and signaling pathways. Autophagy
can be induced by starvation and lack of growth hormones to provide nutrients to
cells by recycling the macromolecules (Scott et al., 2004). Tor, the Ser/Thr kinase,
controls and inhibits Atg1 to initiate autophagy. So Tor works like a switch to control
autophagy: when it is activated, autophagy is inhibited; when it is inhibited,
autophagy is activated. Rapamycin, which inhibits Tor, can induce autophagy
pharmaceutically. 3MA (3-methyl-adenine) and wortmannin can inhibit autophagy
by inactivating PI3K (phosphoinositide 3-kinase), which is required in the initiation
of autophagy (Blommaart et al., 1997).

1.5 Autophagy and Immunity
Recent publications report that autophagy not only plays a role in the recycling of
cytosolic constituents, but also removes intracellular bacteria and viruses during both
innate and adaptive immunity (Nakagawa et al., 2004; Ogawa et al., 2005; Schmid
and Munz, 2007).
The double-membrane autophagosome was not formed in Atg5
-/-
mouse
embryonic cells and GAS (Group A Streptococcus) survived and multiplied inside

12
the cells. However, GAS was killed within several hours in wild-type cells
(Nakagawa et al., 2004). Listeria monocytogenes was eliminated from the cells by
autophagy directly after metabolic inhibition by the treatment with chloramphenicol
(Rich et al., 2003). Shigella flexneri and Mycobacterium tuberculosis were also
found to be targets of intracellular autophagsome and cleared by lysosomal
hydrolysis (Gutierrez et al., 2004; Ogawa et al., 2005).
Although bacteria can be killed by the autophagy pathway, some bacteria can
evade autophagic immunity and some can even replicate and benefit from the
autophagosome vacuoles (Ogawa and Sasakawa, 2006). Wild-type invasive bacteria
Shigella flexneri can escape autophagy and survive inside cells by secretion of IcsB,
a bacterial effector against recognition by autophagy. However, in the icsB mutant
Shigella, the bacterial VirG protein, which is usually inhibited by IcsB, binds to Atg5
and induces the recognition and capture by autophagy (Ogawa et al., 2005). Brucella
abortus and Coxiella brunetii can form vacuoles in the cytoplasm of host cells and
replicate inside them. These vacuoles are very similar to autophagosomes and their
replication can be stopped when autophagy is inhibited (Gutierrez et al., 2005;
Pizarro-Cerda et al., 1998).
Autophagy also plays a role in adaptive immunity and promotes MHC-II antigen
presentation (Paludan et al., 2005). Macroautophagy transfers viral and bacterial
antigens to the corresponding cytosolic compartment. Another type of autophagy,

13
called chaperone-mediated autophagy, also has an important role here. It delivers the
antigens to the MHC-II loading compartments by the protein LAMP-2a
(lysosomal-associated membrance protein 2a). Recent reports also found that
autophagy can be induced by IFN- γ, which is an anti-tuberculosis cytofactor, in
macrophages (Gutierrez et al., 2004). IFN- γ is also found to promote MHC II
expression (Reith and Mach, 2001). So IFN- γ may be a mediator to connect and
regulate both autophagy and MHC antigen presentation. Autophagy is also found to
regulate T and B cells survival and function (Pua et al., 2007).
Most studies on autophagy in innate and adaptive immunity were investigated in
vitro. The in vivo immunity role of autophagy is not well studied. Recently a paper
illustrated an in vivo study in mice. It was found that neurovirulence of HSV-1 is
inhibited by autophagy in mice (Orvedahl et al., 2007). Another important unsolved
question is how autophagy recognizes and transports specific viruses and bateria.
What receptors are identified and what factors are involved are still unknown.

14

CHAPTER 2 INCREASED BACTERIAL LOAD DURING
DROSOPHILA AGING WITHOUT LIFE SPAN TRADE-OFF

2.0 Introduction
Humans and bacteria have mutualistic relationships: The hosts gain nutrients and
energy and their microbes are provided with a buffered environment, glycans and
nutrients (Backhed et al., 2005). Since immune function is impaired with age, it
might be expected that bacterial load would increase or otherwise be altered with age
(Frasca et al., 2005). Bacteria levels in human intestine are reported to be similar
with age, however changes in relative species abundance occur, and inflammatory
bowel disease may become more common (Dethlefsen et al., 2006; Holt, 2003;
Hopkins et al., 2001). Several studies suggest detrimental increases in bacterial load
in specific tissues such as prostate (Wagenlehner et al., 2005).
To study the interactions between a host and its microbial flora, axenic
culturing techniques have been developed for several organisms, including the
mouse (Reyniers and Sacksteder, 1958), Drosophila melanogaster (Geer, 1963), and
Caenorhabditis elegans (Houthoofd et al., 2002). In mammals a diverse microbial
fauna is required for normal gut development and function. Axenic (gnotobiotic)

15
mice have been used to characterize a minimum set of eight bacterial species
sufficient to rescue gut function, called the Altered Schaedler Flora (ASF) (Ge et al.,
2006). Two of the required ASF species are aerotolerant Lactobacillus strains
ASF360 & ASF361.
Bacteria can alter invertebrate host fitness and longevity under appropriate
conditions. For example, C. elegans cultured on axenic medium had longer life span
and increased stress resistance (Garigan et al., 2002; Houthoofd et al., 2003;
Houthoofd et al., 2002; Kaeberlein et al., 2006) and pathways that affect nematode
life span, such as sex-determination, insulin-like signaling, and heat shock factor
(HSF) can also affect pathogen resistance (Garsin et al., 2003; Singh and Aballay,
2006; van den Berg et al., 2006). Recently, Brummel and coworkers found that the
life span of Canton-S strain Drosophila flies was reduced under axenic conditions,
and that re-introducing bacteria during the first week of adult life had benefits for
survival (Brummel et al., 2004).
Drosophila is emerging as an ideal model system in which to study most aspects
of immunity, including innate immune pathways, cellular immunity and the
metabolic effects of infection (Dionne et al., 2006; Matova and Anderson, 2006).
The immune response to invading pathogens in Drosophila is manifested in at least
three ways: first, a humoral response generates circulating anti-microbial peptides
(AMPs) through high-level induction of AMP genes in various tissues. This is

16
mediated through NF-kB and other signaling pathways that play a conserved role in
the human immune response. Second, a cellular response results in phagocytosis or
encapsulation of the intruders; and third, a phenoloxidase reaction deposits black
melanin around wounds and foreign objects (Hultmark, 2003). In the Drosophila gut,
the dual oxidase (Duox) and immune-regulated catalase (FlyBase ID: FBgn0038465)
are implicated in protecting the fly from ingested pathogens, presumably by
production of anti-microbial ROS (Ryu et al., 2006).
How Drosophila might maintain and regulate the growth of potentially
beneficial bacteria is unknown. Both the ROS-type and AMP-type immune
responses described above are attractive as possible mechanisms by which the fly
might regulate gut flora, however the possible cost to the fly of these responses, if
any, is unclear. Several studies suggest an intimate link between immune function,
aging and life span. Older flies were less able to suppress the growth of introduced E.
coli (Kim et al., 2001), and less able to induce AMP gene expression in response to
heat killed bacteria (Zerofsky et al., 2005), consistent with an aging-related decline
in immune function. The expression of AMP genes increases dramatically during
normal Drosophila aging, and the expression of certain AMP gene-GFP reporter
constructs is partially predictive of life span in young flies, suggesting a link
between innate immune response and longevity (Landis et al., 2004; Pletcher et al.,
2002). Constitutive activation of NF-kB signaling and AMP gene expression in fat

17
body tissue conferred enhanced pathogen resistance to transgenic flies, but also
reduced life span, suggesting the possibility of an obligatory trade-off (Libert et al.,
2006). In this study it was asked whether Drosophila microbial load changes with
age, and how bacteria might affect survival under conditions otherwise optimized for
fly longevity.

2.1 Results
2.1.1 Bacterial Load Increases during Age
Age-synchronized cohorts of Oregon-R (Or-R) wild-type male flies were
cultured on standard fly food, at ~25 flies per vial, with passage to fresh food every
other day. One fly from each of 6 different vials was removed and assayed for
bacterial count every week. The bacterial load on the body surface and inside the fly
was determined by counting the total colony number obtained by plating fly extracts
on Nutrient Agar. The bacterial load increased dramatically with age both on the
surface and inside the fly - both aerobic bacteria and anaerobic bacteria (Figure 2.1).
Significant numbers of aerobic bacteria were also found on the surface of the fly
food after two days culture with adult flies, and these levels increased with age
roughly in proportion to the aerobic bacterial load of the flies themselves (Figure

18
2.2). One possible artifact of the aerobic bacterial counts from the fly surface and
interior might therefore be that the bacteria are growing on the food and are simply
being transferred to the flies by contact and ingestion, and are not actually growing
in and on the flies. In this scenario one might expect the bacteria to be preferentially
associated with the proboscis and the tips of the legs – the parts of the fly in direct
contact with the food. However, the distribution and appearance of bacteria-like
material over most of the surface of the flies presented below indicates that bacterial
growth does indeed occur on the fly. Moreover, anaerobic bacteria levels increased
with age both on the surface and inside the fly, and will not grow on the fly food
under the aerobic fly culture conditions. We conclude that at each passage the flies
can transfer some bacteria to the fresh food, where additional proliferation of the
aerobic species may occur.

19
A

B

Figure 2. 1 Drosophila Bacterial Load Increases with Age. Bacterial counts (up to
10
6
colony forming units per fly) increased with age in both aerobic (A) and
anaerobic (B) conditions by plating method.

0
1
2
3
4
5
6
8 15 23 37 44 53 62 69 75 8 15 23 37 44 53 62 69 75
surface interior
days of age
cfu/fly (LOG10)
0
1
2
3
4
5
6
8 15 23 37 44 53 62 69 75 8 15 23 37 44 53 62 69 75
surface interior
days of age
cfu/fly (LO G 10)

20
A

B

Figure 2. 2 Correlation between bacterial load of individual flies and the surface
of their food with age. At the indicated time-points, a single Or-R fly from each of 6
different vials, each containing ~25 flies, was assayed for total aerobic bacterial load.
Concurrently the remaining flies were passaged to fresh vials and the old vial was
immediately assayed for total aerobic bacterial load. A. Flies. B. Food vials.

0
1
2
3
4
5
8 152229364350
days of age
LOG10(cfu/fly)
1
2
3
4
5
6
0
1
2
3
4
5
6
7
8 152229 3643 50
days of age
LOG10(cfu/vial)
1
2
3
4
5
6

21
2.1.2 Microbial Species Associated with Flies
The bacterial species cultured from flies were identified by PCR amplification
and sequencing of 16S rDNA clones isolated from individual bacterial colonies.
Several Acetobacter and Lactobacillus species were cultured from the surface and
the interior of the flies using aerobic and anaerobic culture conditions (Table 1). To
identify any species that might be resistant to culture, DNA was isolated from the fly
surface and interior, and multiple 16S rDNA clones were sequenced, revealing
additional Lactobacillus species. The two anaerobic species found on the fly surface,
Lactobacillus plantarum and Lactobacillus homohiochii, are both aerotolerant
anaerobes (Archibald and Fridovich, 1981; Chohnan et al., 1997), perhaps
explaining their ability to survive externally. Moreover, these bacterial cells may be
growing in an anaerobic microenvironment such as the interior of a biofilm or
colony (Fux et al., 2005), which might also be located in a crevice of the cuticle, as
indicated by the SEM analysis presented below. The results are in general agreement
with reports from other laboratories that Acetobacter and Lactobacillus species are
associated with Drosophila laboratory stocks (Theodore Brummel, personal
communication; David Schneider, personal communication), wild-caught Drosophila
strains (Corby-Harris et al., 2007); Kvasnikov et al., 1971), as well as the common
name for Drosophila of “vinegar flies”. Acetobacter and Lactobacillus species have

22
also been found associated with other insects, such as mealybug (Saccharococcus
sacchari) (Ashbolt and Inkerman, 1990), and bees (Apoidea) (Mohr and Tebbe,
2006). Taken together the data suggest that both the fly surface and the fly interior
create unique environments that favor the survival of specific Acetobacter and
Lactobacillus species. This suggests that the ability of the vertebrate gut to favor the
survival of specific microbiota (McFall-Ngai, 2006) extends to both the invertebrate
gut and surface compartments.
The common food-borne fungus Cladosporium cladosporioides was also cultured
from the interior of flies using Sabouraud dextrose agar. This fungus was present
only occasionally inside flies, did not increase in abundance with age (Figure 2.3),
and was not detectable by PCR of whole fly DNA using fungal-specific primers
(Figure 2.4). For these reasons, Cladosporium cladosporioides appears to be
associated only with the flies’ food and does not appear to be growing in or on the
fly. No other fungi were detected in young or old flies by culture or PCR. The
cytoplasmic parasite Wolbachia can affect life span (Fry et al., 2004) but was not
present in the strains used here as determined by PCR assay (Figure 2.5).

23

0
40
80
120
160
200
14d 24d 33d 43d 53d 70d
days of age
fungal load per fly
control
0.5% DMSO
Nystatin
Ketoconazole

Figure 2. 3 Fungal Load in Control- and Antifungal-Treated Flies. Oregon-R male
flies were cultured at ~25 flies per vial on control food and in the presence of the
indicated antifungals (nystatin or ketoconazole) or the solvent DMSO. Total fly fungal
load was assayed at the indicated time points by plating fly extracts on Sabouraud
dextrose agar medium.

24
A

B

Figure 2. 4 PCR Assay for Fungal Existence in Flies. (A) Diagram of eukaryotic
small-subunit rDNA with V1 to V9 variable regions indicated. nu-SSU-0817-5' and
nu-SSU-1196-3' are one pair of primers with a PCR product of 422bp in S.cerevisiae.
nu-SSU-0817-5' and nu-SSU-1536-3' are another pair of primers with a PCR products
of 762bp in S. cerevisiae. (B) Both pairs of primers, nu-SSU-0817-5' and
nu-SSU-1196-3' (top half of gel, lanes 1-6) and nu-SSU-0817-5' and nu-SSU-1536-3'
(bottom half of gel, lanes 7-12), were used to amplify any fungal sequences that might
be present in the genomic DNA extracted from 60 day old Oregon-R flies. Lanes 1 and
7, negative (no template) control. Lanes 2 and 8, genomic DNA extracted from
Cladosporium cladosporioides (positive control). Lanes 3 and 9, ketoconazole-treated
flies. Lanes 4 and 10, nystatin-treated flies. Lanes 5 and 11, 0.5% DMSO-treated flies
(control for solvent of antifungals). Lanes 6 and 12, Oregon-R flies.

25

Figure 2. 5 Assay of Wolbachia Sequences by PCR. Total DNA was extracted from
20 flies of each strain and assayed by PCR for the presence of Wolbachia-specific
sequences. No template control (Lane 1), Canton-SH flies (Wolbachia positive control)
(lane 2), Canton-S flies (lane 3), Oregon-R flies (lane 4). The amplified Wolbachia
sequence is 860bp and is present only in lane 2. A faint, non-specific background band
is also visible.

26

Cultured Species Identified by PCR
Fly surface Acetobacter aceti Lactobacillus homohiochii (50)
Acetobacter tropicalis Acetobacter aceti (45)
Acetobacter pasteurianus Lactobacillus fructivorans (1)
Lactobacillus plantarum Unidentified species (1)
Fly interior Acetobacter pasteurianus Acetobacter tropicalis (80)
Lactobacillus sp. MR-2 Lactobacillus brevis (15)
Acetobacter aceti Lactobacillus plantarum (3)
Lactobacillus plantarum Acetobacter pasteurianus (1)
Cladosporium sphaerospermum Acetobacter aceti (1)

Table 1. Microorganisms Associated with Oregon-R Flies. Microorganisms
from the fly surface and interior were identified by culturing of bacterial species
followed by PCR amplification and sequencing of 16S rDNA sequences isolated
from colonies on plates (“cultured species”). Additional species were identified by
direct PCR amplification, cloning, and sequencing of 16S rDNA sequences present
in DNA extracts, and the number of clones corresponding to each bacterial species is
shown in parentheses.

27
2.1.3 Analysis of Bacteria on the Fly Surface
The surface of flies was examined by SEM using preparation conditions
designed to preserve bacterial cells, should they be present. The micrographs
revealed abundant small spherical objects and debris consistent with individual
bacterial cells, as well as elaborate fibrous structures indicative of bacterial biofilms
(Figure 2.6 A-E). The material was present over the entire surface of the fly, but with
a decidedly nonrandom distribution: Larger accumulations were present in recessed
areas of the cuticle and among dense bristles, areas that might be less accessible to
the flies’ grooming behaviors, which include scraping the body and wings with the
legs (Szebenyi, 1969). The size of the cells (about 0.5 μM) was smaller than
typically expected for bacteria (1–2 μM). One possible explanation for this small
size might be shrinkage of the cells caused by the sample preparation, as can happen
with other cell types and SEM procedures (Virtanen et al., 1984). However, the size
of several species of bacterial cells was normal when grown on culture plates and
visualized using the same SEM procedures as were used for the whole flies (Figure
2.7). Another possibility is that the small cells represent an as yet unidentified
organism living on the fly. However, based on bacterial counts and DNA
quantification data presented below, it seems most likely that these structures are
abundant Lactobacillus and Acetobacter cells growing to a small size due to their

28
unique and perhaps harsh environment. Starvation is reported to cause small
bacterial cell size in other situations (Kim and Fogler, 1999). Consistent with the
identification of these cells as bacteria, bromophenol blue (BPB) yielded bright
staining of Acetobacter aceti, Acetobacter tropicalis, and Staphylococcus hominis
cells cultured on plates (data not shown), as well as the bacteria-like structures on the
fly surface (Figure 2.6 G and H). Finally, when cultured on plates and examined by
SEM, Acetobacter tropicalis colonies also contained smaller cells similar to the ones
present on the surface of flies (Figure 2.7).

29

Figure 2. 6 Analysis of Fly Surface. Cells on the surface of old flies were detected
using scanning electron microscopy (A–F) and bromophenol blue (BPB) staining of
cells (G and H). Flies were cultured under either control conditions (A, B, C, E, and
G) or axenic conditions (D, F, and H). The image in (B) is a higher magnification of
the region of thorax bounded by the white box in (A). Note that BPB gives
background staining of nervous (eye) tissue in both control (G) and axenic (H) flies.
Scale bars: (A) = 200 mm, (B) = 20 mm, (C) and (D) = 10 mm, (E) = 5 mm, (F) = 10
mm.

30
A

B

31
Figure 2.6, Continued
C

D

E

32
Figure 2.6, Continued
F

G

H

33
A

B

C

Figure 2. 7 SEM Assay of Bacterial Species Grown on Plates. Bacterial species
isolated from flies were grown on Nutrient Agar plates under aerobic conditions and
the plates were prepped and assayed by SEM analogous to the procedure for whole
flies. Scale bars are 2 μm. (A) Staphylococcus hominis. (B) Acetobacter tropicalis. (C)
Acetobacter aceti.

34
2.1.4 Bacterial Load Is Eliminated in Axenic Flies
The bacterial load was assayed in several ways to confirm that it was eliminated
or reduced in axenic flies. First, SEM and BPB staining revealed that the
bacteria-like structures were mostly, although not completely, absent from the
surface of old axenic flies (Figure 2.3 D and F). Second, semiquantitative real-time
PCR was used to quantify the 16S rDNA bacterial molecules present in total DNA
isolated from both the fly surface and the fly interior (Figure 2.8). The bacterial 16S
rDNA gene sequences were present at ~500 per young fly in the control Oregon-R
strain and at ~5000 per young fly in the control Canton-S strain (Figure 2.8), and, as
expected, this number increased dramatically during aging, to ~1 x 10
7
molecules
per old fly in both Oregon-R and Canton-S strains. Strikingly, no bacterial 16S
rDNA sequences could be detected in young or old axenic fly samples using this
assay. Assuming about five rDNA repeats per bacterial cell (Acinas et al., 2004), this
would suggest that over 10
6
bacteria are typically associated with an old fly.

35

Figure 2. 8 Semiquantitative PCR Assay of Bacterial 16S rDNA Gene Sequences
in Control and Axenic Flies. The16S rDNA gene sequences were amplified from
Acetobacter aceti DNA using the universal primers, quantitated by
spectrophotometry, and used as the standard. Total fly DNA was extracted from 20
control and 20 axenic flies. The indicated amount of standard DNA was amplified in
parallel reactions alongside the experimental samples. The Ct number was plotted vs.
input DNA, and experimental sample concentrations were derived from the curve.
(A) Young flies, 14 days of age. (B) Old flies, 50 days of age. ND, not detected.

36
A

37
Figure 2.8, Continued

B

38
2.1.5 Life Span Is Not Altered by Microbial Load
Life-span measurements of control and axenic flies were repeated in three
separate experiments (Figure 2.9 A-C). While the bacterial load of axenic flies was
eliminated or much reduced, there was no consistent difference in life span between
axenic and control flies for either the Oregon-R strain or the shorter-lived Canton-S
strain. Microbial load was also reduced or eliminated using antibiotics. Oregon-R
flies were treated with combinations of the antibiotics doxycycline (Dox), ampicillin
(Amp), and kanamycin (Kan), and bacterial load was assayed on the fly surface and
fly interior by plating total colonies from both young and old flies. The flies treated
with Dox, Dox+Amp, and Dox+Amp+Kan had a greatly reduced bacterial load
relative to controls, while flies treated only with Amp and/or Kan retained a high
bacterial load (Figure 2.10). Therefore, Dox is effective in reducing bacterial growth
in and on the fly, while Amp and Kan have little effect, at least for the bacterial
species assayed here. Interestingly, all three antibiotics were effective against growth
of these species on culture plates, and one possibility is that the bacteria associated
with the fly are more resistant to antibiotics because they are growing in biofilms
(Fux et al., 2005). The life span of flies treated with or without antibiotics was
similar, meaning that the altered bacterial load did not affect the longevity of the
flies (Figure 2.9D). This is consistent with previous data showing no or only small

39
positive (~4%) effects of Dox on fly life span (Bieschke et al., 1998; Landis et al.,
2003). There was also no difference in life span between antifungal treated flies and
controls (Figure 2.9E).
Since elimination of bacterial load by axenic culture conditions and antibiotic
treatment did not significantly affect the life span of either Canton-S or Oregon-R
flies, these data indicate that the relatively shorter life span of the Canton-S strain
relative to the Oregon-R strain cannot be attributed to differences in bacteria species
diversity, load, or toxicity between the strains.

40

Figure 2. 9 Life-span analyses. Each panel presents an independent experiment.
Oregon-R (Or-R) and Canton-S (CS) wild-type flies were cultured under control and
axenic conditions as indicated (A-C) or in the presence and absence of the indicated
antimicrobials (D and E). Survival is plotted as a function of adult age in days. Each
curve represents R125 flies. Antibiotics in (D): Dox = doxycycline, Amp =
ampicillin and Kan = kanamycin.

41

A
0
20
40
60
80
100
0 1020 30 40 5060 70 80 90 100
days of age
Or-R Control
Or-R Axenic
Percent survival
0
20
40
60
80
100
0 1020 30 40 5060 70 80 90 100
days of age
Or-R Control
Or-R Axenic
0
20
40
60
80
100
0 1020 30 40 5060 70 80 90 100
days of age
Or-R Control
Or-R Axenic
Percent survival

B
Or-R control
CS control
Or-R axenic
CS axenic
0
20
40
60
80
100
0 10 20 30 40 506070 80 90 100
days of age
Percent survival
Or-R control Or-R control
CS control
Or-R axenic
CS axenic
0
20
40
60
80
100
0 10 20 30 40 506070 80 90 100
days of age
Percent survival
0
20
40
60
80
100
0 10 20 30 40 506070 80 90 100
days of age
Percent survival

C
CS axenic
Or-R control
CS control
Or-R axenic
010 20 30 40 50 60 70 80 90 100
days of age
0
20
40
60
80
100
Percent survival
CS axenic
Or-R control
CS control
Or-R axenic
Or-R control
CS control
Or-R axenic
010 20 30 40 50 60 70 80 90 100
days of age
0
20
40
60
80
100
Percent survival
010 20 30 40 50 60 70 80 90 100
days of age
0
20
40
60
80
100
Percent survival

42

Figure 2.9, Continued

D
Or-R control
Kanamycin
Dox+Amp+Kan
Amp
Dox
0
20
40
60
80
100
0 1020 3040 50 60 70 80 90 100
days of age
Percent survival
Dox+Amp
Or-R control
Kanamycin
Dox+Amp+Kan
Amp
Dox
0
20
40
60
80
100
0 1020 3040 50 60 70 80 90 100
days of age
Percent survival
0
20
40
60
80
100
0 1020 3040 50 60 70 80 90 100
days of age
Percent survival
0
20
40
60
80
100
0 1020 3040 50 60 70 80 90 100
days of age
Percent survival
Dox+Amp

E
0
20
40
60
80
100
0 10 20304050 6070 8090 100
days of age
Percent survival
Or-R control
DMSO
Nystatin
Ketoconazole
0
20
40
60
80
100
0 10 20304050 6070 8090 100
days of age
Percent survival
Or-R control
DMSO
Nystatin
Ketoconazole

43
A

B

C

D

Figure 2. 10 Bacterial Load Was Reduced in Antibiotic-Treated Flies. Oregon-R
male flies were cultured under control conditions and on food supplemented with the
indicated antibiotics, and bacterial load was assayed by plating colonies. (A, B) Fly
interior, (C, D) Fly surface. (A, C) Aerobic bacteria. (B, D) Anaerobic bacteria.
0
1
2
3
4
5
6
7
8
15d 66d 15d 66d 15d 66d 15d 66d 15d 66d 15d 66d
Or-R
control
Dox Amp Dox+Amp Kana DKA
LOG10(cfu/fly)
0
1
2
3
4
5
6
15d 66d 15d 66d 15d 66d 15d 66d 15d 66d 15d 66d
Or-R
control
Dox Amp Dox+Amp Kana DKA
LOG10(cfu/fly)
0
1
2
3
4
5
15d 66d 15d 66d 15d 66d 15d 66d 15d 66d 15d 66d
Or-R
control
Dox Amp Dox+Amp Kana DKA
LOG10(cfu/fly)
0
1
2
3
4
5
15d 66d 15d 66d 15d 66d 15d 66d 15d 66d 15d 66d
Or-R
control
Dox Amp Dox+Amp Kana DKA
LOG10(cfu/fly)

44

2.1.6 AMP Gene Expression Is Reduced in Axenic Flies
Northern blots were used to assay AMP gene expression in young and old
Oregon-R and Canton-S flies cultured under control and axenic conditions (Figure
2.11A; quantification in Figure 2.11B; fold induction in Table 2). AMP gene
expression levels were also assayed using semiquantitative real-time RT-PCR
(Figure 2.11C) and quantitative RT-PCR (Figure 2.12), and in each case, the results
obtained were similar to the Northern blot data. The diptericin, defensin, drosomycin,
cecropin, and attacin-A genes were found to be induced during aging in control flies,
consistent with previous Northern blot and microarray studies (Landis et al., 2004;
Pletcher et al., 2002). The expression of most of these AMP genes was greatly
reduced in the axenic flies, as might be expected considering the reduced bacterial
load. A partial exception was the drosomycin gene, in which constitutive expression
was higher and the difference in expression was smaller between young and old
control and axenic flies. Interestingly, it was the drosomycin-GFP reporter that
showed the most predictive power for life span in previous studies (Landis et al.,
2004). The low level of drosomycin and other AMP gene expression observed in
axenic flies may be due to the fact that these genes can be induced by other factors
besides microbes (Peng et al., 2005). For example, a 100% oxygen atmosphere was

45
previously shown to cause increased AMP gene expression in flies (Landis et al.,
2004). Drosomycin is related to human Hepcidin, the iron-homeostasis gene
involved in human hereditary hemochromatosis disease (Wang et al., 2005) Perhaps
the drosomycin-GFP reporter is more predictive of life span because it is relatively
more responsive to some other input such as oxidative stress; this will be an
interesting topic of investigation for future experiments. While high oxygen tension
generally inhibits the growth of bacteria in culture, here oxidative stress did not
cause a significant change in microbial load, either aerobic or anaerobic, in the flies
(Figure 2.13). This suggests that any antimicrobial effect that high oxygen tension
might have is not significant relative to its likely negative consequences for the flies’
immune system and membrane integrity. The total aerobic bacterial count of
individual flies and the expression of AMP promoter-GFP reporter fusions in those
flies was quantified, and a significant positive correlation was identified for only one
out of four strains assayed (Metch-GFP C2 II; Figure 2.14). This may be because
different AMP genes respond preferentially to different pathogens, and the gene
being assayed may not respond well to the particular species being detected in the
plating assay. For example, the plating assay does not count the total bacterial
diversity revealed by DNA sequencing (Table 1).

46

Figure 2. 11 Expression of Antimicrobial Peptide Genes during Aging of Control
and Axenic Flies. (A) Northern blot analysis of total RNA isolated from young (Y)
and old (O) flies of Oregon-R and Canton-S strains, cultured under either control
(Co) or axenic (Ax) conditions, as indicated. The northern blot was sequentially
hybridized with probes specific for the indicated antimicrobial peptide (AMP) genes
and the ribosomal protein 49 (Rp49) gene as a loading control. (B) Quantification of
northern blot data. Bars indicate mean ± SD. (C) Semiquantitative real-time PCR
analysis of AMP gene induction during aging in Oregon-R (Or-R) and Canton-S (CS)
wild-type strains cultured under control and axenic conditions, as indicated. Values
are normalized to Rp49 and plotted on log scale as mean ± SD.

47

A

B
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Dip Def Dro Cec Att Dip Def Dro Cec Att
Ratio (AMP/Rp49)
Or-R control
Or-R axenic
CS control
CS axenic

48

Figure 2.11, Continued

C

0
1
2
3
4
5
6
7
8
Dip Def Dro Cec Att Dip Def Dro Cec Att
AMP expression normalized to Rp49
Or-R control
Or-R axenic
CS control
CS axenic

49

Northern Blots
DiptericinDefensin DrosomycinCecropin Attacin
Or-R control 29.6 10.1 3.12 14.13 27.81
Or-R axenic 14.27 6.41 3.42 4.72 8.56
CS control 30.98 42.05 2.35 3.78 7.29
CS axenic 5.81 14.25 1.31 0.98 1.15
Quantitative RT-PCR
Diptericin Defensin Drosomycin Cecropin Attacin
Or-R control induced 55 induced 1015.7 induced
Or-R axenic 0 induced induced 0 0
CS control 1.19 21.66 12.9 5.65 0
CS axenic 0 0.022 induced 0.091 0

Table 2. Fold Induction of AMP Genes. Induced means the young AMP gene
expression adjusted band intensity is 0. We cannot divide by 0, so we used induced
to indicate that the gene was induced but fold induction could not be calculated. 0
means both young and old AMP gene expression adjusted band intensities are 0.

50

Figure 2. 12 Quantitative RT-PCR Assay of AMP Gene Expression in Young and
Old, Control and Axenic, Oregon-R and Canton-S Flies. Total RNA was
extracted from 30 male flies of the indicated type, Oregon-R (Or-R), Canton-S (CS),
control culture conditions (C), axenic culture conditions (A), and then reverse
transcribed to cDNA as described in Methods. The indicated AMP gene sequences
(Diptericin, Defensin, Drosomycin, Cecropin and Attacin) as well as Rp49 were
amplified by PCR using gene-specific primers. E. coli fadR gene was used as the
spiked-in control. (A) Young flies. (B) Old flies. (C) Quantification. The detailed
labeling information in B is the same as A.

51

A

52
Figure 2.12, Continued
B
C
0
1
2
3
4
5
6
7
8
9
Dip Def Dro Cec Att Rp49 Dip Def Dro Cec Att Rp49
LOG10 (Molecule numbers)
Or-R control
Or-R axenic
CS control
CS axenic

53

A
1
10
100
1000
10000
100000
aerobic anaerobic aerobic anaerobic
bacterial count (cfu/fly)
control
pure oxygen

B
1
10
100
1000
10000
aerobic anaerobic aerobic anaerobic
bacterial count (cfu/fly)
control
pure oxygen

Figure 2. 13 Bacterial Load under 100% Oxygen Conditions. Oregon-R flies were
cultured in both 100% oxygen atmosphere and normal conditions. The bacterial count
on both the fly surface and fly interior was assayed at the 50% survival time point for
the oxygen-treated flies, which was 8 days. The means were not significantly different
based on unpaired, two-sided t tests (P > 0.05). (A) and (B) are replicate experiments.

54

Figure 2. 14 Correlation between Bacterial Count and AMP-GFP Reporter
Expression in Young and Old Individual Flies. (A) Male flies from the indicated
transgenic strains were cultured on standard fly food at ~25 flies per vial. At two
time points during the life span, 2 weeks (indicated in blue) and 6 weeks (indicated
in pink), one fly from each of 6 different vials was assayed for GFP expression level,
and then sacrificed and total aerobic bacterial count determined. (B) Three linear
regression models were fitted to the data and F-tests were performed using ANOVA
in R 2.4.1 statistical environment (R Development Core Team: R: A Language and
Environment for Statistical Computing. R Foundation for Statistical Computing,
Vienna, Austria 2006 [http:/www.R-project.org]), and the resulting p values are
presented. A significant correlation between AMP-GFP reporter expression and
bacterial count (BC) was obtained only for line Metch C2 II.

55

A

0
10
20
30
40
01 2 345 6 7
LOG10 (cfu/fly)
GFP density
0
40
80
120
160
01 23 4 5 6 7
LOG10 (cfu/fly)
GFP density
0
6
12
18
24
0123 4 567
LOG10 (cfu/fly)
GFP density
0
5
10
15
20
01 23 4 5 67
LOG10 (cfu/fly)
GFP density

56

Figure 2.14, Continued

B
AMP-GFP reporter strain Metch A1 III Metch C2 II Defesin Drosomycin

p value (GFP~age) 0.4512 0.09326 0.8072 0.1042
p value (GFP~BC) 0.08545 0.001632 0.669 0.2098
p value (GFP~age+BC)BC 0.05923 0.01045 0.7323 0.5283

57

2.2 Discussion
In this study, experimental manipulation of microbial load was found to have
little or no effect on Drosophila life span. In contrast, Brummel and coworkers (2004)
previously reported that the life span of Canton-S flies was reduced under axenic
conditions and that reintroducing bacteria during the first week of life had a positive
effect on longevity. The most likely explanation for the difference in results is the
different culture conditions used. In the Brummel study, Canton-S mean life span
was about 50 days, while here, Canton-S mean life span was also about 50 days and
Oregon-R mean life span was 70 days, so overall life spans were similar. However,
the food used in the Brummel study contained sucrose, while the food used here did
not, and one possibility is that bacteria alter the sucrose or the flies’ response.
Another intriguing possibility is that there was a beneficial or detrimental microbial
species present in the Brummel experiments that was not present here. In that study,
fly food was sterilized by irradiation, while here, it was autoclaved. Perhaps specific
bacteria have a beneficial or detrimental effect on fly survival only when other
organisms are present. For example, in humans, Lactobacillus species have been
found to protect the urogenital and intestinal tracts from infection by pathogenic

58
bacteria (Reid and Burton, 2002). Conversely, in moth larvae, infection by Bacillus
thuringiensis is toxic only when native gut flora are present (Broderick et al., 2006).
We conclude that Brummel and coworkers have identified culture conditions that
reveal the benefit of specific microbial flora, while we have identified optimized
culture conditions that make life span largely independent of the presence or absence
of microbes and the induction of a robust innate immune response (summarized in
Figure 2.12). The data argue that any metabolic expenditure by the fly required to
support the bacterial load and the innate immune response occurs without a cost to
life span, as might be predicted by models in which longevity is limited by metabolic
resources available for somatic maintenance. It will be of interest in the future to
characterize the physiological factors that do limit the life span of flies under these
optimized conditions where longevity is maximized and microbial load and
induction of the innate immune response appear largely inconsequential.

59

Figure 2. 15 Summary of Bacterial Effects to Aging.

2.3 Experimental Procedures
2.3.1 Fly Stocks and Culture
Drosophila culture and life-span assays were performed as previously described
(Ford et al., 2007). Stocks were maintained on standard cornmeal agar medium
containing the antifungal agent Tegosept (Sigma) at a final concentration of 11 mM.
The food recipe was as follows: 105 g dextrose, 7.5 g agar, 26 g yeast, 50 g
cornmeal, and 1 l purified H2O were mixed and boiled for 30 min with constant
agitation, and 1.7 g Tegosept dissolved in 8.5 ml 95% ethanol and 1.9 ml propionic
acid (99%, Mallinckrodt Baker) was added. For axenic conditions, plastic vials
containing fly food were autoclaved for 25 min. Life-span measurements were made
Aging
Immune function
AMP gene expression
Microbial load Survival

60
at 25˚C, with ~25 flies per vial, and flies were transferred to fresh vials ever other
day. Females were excluded from the experiments to reduce the life-span assay
workload and expense by half. In addition, males were chosen over females because
in general, female life span appears to be more affected by subtleties in the food
source (Magwere et al., 2004), which in turn might be affected by the presence or
absence of bacteria growth on the food.

2.3.2 Antibiotic treatment
Food vials were adjusted by adding 100μl of concentrated stock solutions of
antibiotic in purified water and allowed to dry overnight, to yield final
concentrations in the food of doxycycline (DOX; 640 μg/ml), ampicillin (AMPA;
640 μg/ml) and kanamycin (KAN; 1mg/ml). DOX was purchased from Sigma,
AMPA and KAN from Shelton Scientific.

2.3.3 Axenic fly culture
Collections of 12-hr embryos were sterilized by successive rinses in Drosophila
saline, 0.25% clorox and 0.04% n-alkyl dimethyl benzyl ammonium chloride (Geer,
1963). These embryos were transferred into axenic food vials. Axenia of the

61
embryos was confirmed by performing 16S rDNA PCR on homogenates of the adult
flies, and by plating the homogenates on Nutrient Agar plates (Weisburg et al., 1991).
The flies were transferred every other day into new control and axenic food vials.

2.3.4 Bacterial Counts from Flies
At the indicated time point during adult life span, a single Oregon-R male was
removed from each of six different vials (each vial contained ~25 flies). For bacterial
counts on the fly surface, each fly was washed in 0.8 ml sterile H2O for 2 min. The
bottom 100 ml of water was kept after centrifugation in an Eppendorf Centrifuge
5415D at 13,200 rpm for 10 min. This 100 ml of concentrated bacteria was diluted
as necessary and spread on plates. The number of colonies was counted after 3–5
days incubation under either aerobic or anaerobic conditions. The values obtained
for the six flies were averaged, and standard deviations are indicated in the figures.
Nutrient agar was used for aerobic culture media, and TPGY (tryptone peptone
glucose yeast extract) was used for anaerobic culture media (Ferreira et al., 2003).
For bacterial counts inside flies, each fly used above was surface sterilized by
immersion in 70% ethanol for 2 min and then washed twice in sterile H2O for 2 min
each wash. Each fly was then homogenized in 100 ml sterile PBS using a small
pestle for about 1 min, until pieces of tissue were no longer visible. The

62
homogenates were diluted as necessary and plated as above. Anaerobic culture
conditions were generated using the BBL GasPak 150 Large Anaer System (VWR
International).
2.3.5 Identification of cultured bacterial species
At the end of the incubation period, discrete colonies were aseptically removed
and re-streaked on Nutrient agar. A single and discrete bacterial colony was picked
and mixed with 50μl PBS, and 2μl was used as the PCR template. 16S rDNA
sequences were amplified using the universal primers 5-agagtttgatcctggctcag-3 (27F)
and 5-ggttaccttgttacgactt-3 (1492R) (Weisburg et al., 1991), using the following PCR
protocol: 94˚C for 10min; then 30 cycles of 94˚C 1min, 54˚C 1min, 72˚C 2min;
finally, 72˚C 5min. The PCR products were sequenced at the USC/Norris DNA core
facility. To determine the bacterial species the results were compared to known
sequences in databases using BLASTn (http://www.ncbi.nlm.nih.gov/BLAST/ ).
2.3.6 Identification of Bacterial Species by PCR
Ten Oregon-R flies at 60 days of age were washed in 0.8 ml distilled water for 2
min. The distilled water was centrifuged for 10 min, and the bottom 0.1 ml of water
was kept as the surface bacteria sample. To obtain fly interior samples, flies were
washed in 70% ethanol for 30 s and then homogenized. Total DNA was extracted
from the surface and interior samples using the ZR Genomic DNA II kit (Zymo

63
Research). Bacterial 16S rDNA gene sequences were amplified by PCR using the
universal primers 27F and 1492R. The PCR products were subcloned by the TOPO
TA cloning method (Invitrogen) and sequenced.

2.3.7 Northern Blot Analysis
Total RNA from 30 control and 30 axenic flies was extracted using TRIzol
reagent (Invitrogen). For the Oregon-R strain, young flies were 14 days old and old
flies were 68 days old (~50% survival for the cohort). For the Canton-S strain, young
flies were 14 days old and old flies were 55 days old (50% survival for the cohort).
Northern blot experiments were performed essentially as described (Landis et al.,
2004).
2.3.8 Semiquantitative Real-Time PCR Assay of Bacterial Load
The 16S rDNA gene sequences were amplified from Acetobacter aceti DNA
using the universal primers 27F and 1492R, quantitated by spectrophotometry, and
used as the standard. Total fly DNA was extracted from 20 control and 20 axenic
flies at 50 days of age using the ZR Genomic DNA II kit (Zymo Research). PCR
primers and reaction cycles were the same as used above to amplify 16S rDNA
genes. Standard DNA was amplified in parallel reactions alongside the experimental

64
samples. Real-time PCR was performed using the Bio-Rad DNA Engine Opticon 2
real-time PCR detector and SYBR green dye (Shen et al., 2006; Skovhus et al.,
2004). Experimental sample concentrations were derived from standard curves
(Figure S6).
2.3.9 Scanning Electron Microscopy Assays
Control and axenic flies (five each) at 50 days of age were assayed by SEM.
SEM examination was performed at the House Ear Institute using an XL30 SFEG
machine (FEI Company) and previously described procedures designed to preserve
bacterial cells and biofilms (Webster et al., 2004). Briefly, the Oregon-R flies were
immersed in liquid propane followed by freeze substitution and critical point drying.
They were then sputter coated with platinum and examined under the scanning
electron microscope. To perform SEM of bacterial species grown on plates, several
bacterial species were grown on nutrient agar under aerobic conditions to produce
discrete colonies. The plates were prepped and assayed by SEM analogous to the
procedure for whole flies (Figure S5).
2.3.10 Antifungal Treatment
Food vials were adjusted by adding 100 μl of concentrated stock solutions of
antifungal dissolved in 0.5% DMSO and allowed to dry overnight, to yield final

65
concentrations in the food of nystatin (50 μg/ml) and ketoconazole (5 μg/ml). The
fungal load of flies was assayed both by plating fly extracts and by PCR
amplification of fungal sequences from total fly DNA. Fungal colonies were plated
on SDA (Sabouraud dextrose agar) medium, with doxycycline added to prevent
bacterial growth. Single flies were homogenized in PBS, the extract was spread on
the plate, and the plates were incubated at 25°C for 5-7 days and fungal colonies
were counted. For PCR assay, total fly DNA was extracted using the ZR Genomic
DNA II kit (Zymo Research). The PCR primers and PCR protocol were as
previously described and are designed to amplify rDNA sequences from all four
major phyla of fungi (Borneman and Hartin, 2000). Cladosporium sphaerospermum
colonies from plates were used as a positive control.

2.3.11 Correlation between Bacterial Load of Individual Flies and the Surface
of Their Food with Age
At the indicated time-points, a single Oregon-R fly from each of 6 different vials,
each containing ~25 flies, was assayed for total aerobic bacterial load. Concurrently
the remaining flies were transferred to fresh vials, and the old vial was immediately
assayed for the presence of bacteria. The surface of the food was scored four times
with a metal spatula, and then 0.8ml of PBS was added to the vial and incubated for

66
about 30 seconds. The PBS was then withdrawn from the vial with a pipette and
centrifuged for 5 min in an Eppendorf tube. The bottom 0.1ml of PBS and bacteria
was spread on plates and incubated for 2-3 days in aerobic conditions.

2.3.12 Bacterial Load in 100% Oxygen-Treated Flies
An age-synchronized cohort of male Oregon-R flies was cultured under both
normal conditions and under 100% oxygen atmosphere, as previously described
(Landis et al., 2004). The cohort consisted of 10 vials with 12 flies per vial, passaged
to fresh food every other day. The bacterial count was assayed at the 50% survival
time point for the oxygen-treated flies, which was 8 days. Two flies were removed
from each vial, one for aerobic bacterial counts, the other for anaerobic bacterial
counts.
2.3.13 PCR Assay of Wolbachia Sequences
Total DNA was isolated from twenty flies of the indicated genotypes using ZR
Genomic DNA II kit (Zymo Research). About 200ng of genomic DNA was used in
PCR reactions with Wolbachia-specific primers, as previously described (O'Neill et
al., 1992). Forward primer: TTGTAGCCTGCTATGGTATAACT Reverse primer:
GAATAGGTATGATTTTCATGT. PCR protocol was as follows: first 94°C for

67
1min; then 30 cycles of 95°C 1min, 52°C 1min, 72°C 1min; at last 72°C 5min.
Products were resolved on a 1% agarose gel and stained with ethidium bromide. The
amplified Wolbachia sequence is about 860bp and was compared to MW markers
run in adjacent lane (1kb DNA ladder; Invitrogen). The Wolbachia-positive
Canton-SH strain was a gift from Michelle Arbeitman, University of Southern
California.

2.3.14 AMP-GFP Reporter Expression Measurements
The transgenic AMP-GFP reporter lines for Metchnikowin (lines A1III and C2II),
Defensin (line B9B9), and Drosomycin (line DD1, on X) were generously provided
by Bruno Lemaitre & Jean-Luc Imler (Tzou et al., 2000), and GFP expression was
quantified in adult male flies as previously described (Landis et al., 2004). Briefly, at
two time points (“Young” 14 days and “old” 42 days) individual flies were
anesthetized with hydrated CO
2
gas and GFP expression level was determined by
fluorescence microscopy using the Leica MZFLIII and ImagePro-Plus Software
(Media Cybernetics). Three pictures were taken of each fly under the fluorescent
light (GFP2) with the gain selected as 2 and exposure time 8 sec. GFP expression
level was determined from the pictures using ImagePro-Plus Software: First, the
whole fly was circled as the area for analysis and counted as a subject, then the green

68
density was measured. Finally, the measurements were viewed in Excel format and
the means and SD calculated.

2.3.15 Quantification of Northern Blot Data
The blots were hybridized successively with probes specific for various AMP
genes including Defensin, Diptericin, Drosomycin, Attacin-A and Cecropin. Rp49
was used as a loading control. Hybridization signals were visualized and quantified
using the Bio-RAD Molecular Imager FX machine and Quantity One software
(Bio-Rad), and corrected for background. The foldinduction of AMP genes with age
was calculated using the following equation: Fold AMP gene induction =
(AMP-old/Rp49-old)/(AMP-young/Rp49-young).
2.3.16 Statistics
Survival analysis was performed using two-sided log-rank tests. The Cox
proportional hazards regression model was used with the Breslow method as a
default. All analyses were performed using the R 2.4.1 statistical environment (R
Development Core Team, 2006).

69

Chapter 3 CONDITIONAL INHIBITION OF AUTOPHAGY
GENES IN ADULT DROSOPHILA IMPAIRS IMMUNITY
WITHOUT COMPROMISING LONGEVITY
3.0 Introduction
Macroautophagy (hereafter referred to as autophagy) is a fundamental
mechanism in which cells digest parts of the cytosol for recycle or removal. During
autophagy a double-membranous structure called the isolation membrane (or
phagophore) is extended to surround discrete portions of the cytosol (diagrammed in
Figure 3.1). The phagophore seals to form a double-membrane bound vacuole
called the autophagosome. The autophagosome fuses with lysosomes to create the
autolysosome, where the trapped material is then degraded. The autophagy pathway
is conserved from yeasts to Drosophila to humans, and involves more than 20
proteins (e.g., Atg1 through Atg27 in yeast) (Baehrecke, 2003; Deretic, 2005;
Mizushima et al., 2008). Several of the conserved factors show similarities to the
ubiquitin system. For example, Atg12 is a small, ubiquitin-like protein, and Atg7
and Atg10 are E1/E2-like enzymes that catalyze cross-linking of the C-terminal
glycine of Atg12 to a lysine residue of Atg5. The Atg5-Atg12 conjugate localizes to
the concave, cytofacial side of the phagophore, where it is required for elongation.

70

Recent studies have revealed that autophagy not only functions in the recycling
of cytosolic constituents, but also targets intracellular pathogens for destruction
during innate immunity (Nakagawa et al., 2004; Ogawa and Sasakawa, 2006;
Schmid and Munz, 2007). For example, Group A Streptococci will proliferate in
atg5
-/-
mouse embryonic fibroblasts, whereas in wild-type cells the bacteria are
enveloped by autophagosomes and destroyed (Nakagawa et al., 2004). Similarly,
after Listeria monocytogenes bacteria have been inhibited by chloramphenicol they
can be efficiently cleared from cells by autophagy (Rich et al., 2003). So far, most
studies implicating autophagy in immunity have been performed in cultured cells.
However, evidence for an in vivo role for autophagy in immunity was recently
reported for mice, where it was found that neurovirulence of HSV-1 is inhibited by
autophagy (Orvedahl et al., 2007).
Aging is a multifactorial process with several mechanisms contributing to
functional decline. At least three pathways have been found to extend life span in
model organisms: reduced insulin/IGF1-like signaling (IIS), dietary restriction (DR),
and decreased mitochondrial gene function (Wolff and Dillin, 2006). Autophagy’s
relation to aging and longevity is complex and not yet clear (Cuervo et al., 2005;
Mizushima et al., 2008). In C. elegans, autophagy has been reported to be required
for life-span extension in response to each of the three life span pathways: reduced

71
IIS (Melendez et al., 2003) DR (Jia and Levine, 2007), and reduced mitochondrial
gene function (Toth et al., 2008). Drosophila is a powerful model for the study of
immune function and aging (Libert et al., 2006; Libert et al., 2008; Ramsden et al.,
2008; Ren et al., 2007; Zerofsky et al., 2005), and most recently the role of
autophagy. Previous work has shown that when autophagy gene activity is reduced
during both Drosophila development and adulthood, the flies are short-lived,
sometimes associated with reduced protein aggregate clearance and degeneration in
the adult nervous system (Juhasz et al., 2007; Simonsen et al., 2008; Toth et al.,
2008); however it is not clear if the reduced life span resulted from defects in
development or from effects in the adult flies.
Here we test if the autophagy pathway might be limiting for immunity and/or
life span specifically in adult-stage Drosophila. The Geneswitch system was used to
cause conditional expression of transgenes designed to inactivate the Atg5, Atg7 and
Atg12 genes by RNA interference (RNAi). RNAi of Atg genes in adult flies was
found to reduce resistance to injected E. coli, as evidence by increased bacterial titers
and reduced survival. However, survival of uninjected flies was unaffected by Atg
gene inactivation. The data confirm the expected requirement for Atg gene activity
for normal immune function in adult flies, but suggest that neither autophagy nor
immune response are limiting for adult fly life span under typical laboratory
conditions.

72

Figure 3.1 Outline of autophagy pathway and role of Atg5, Atg7 and Atg12.
Please check the text for details.

3.1 Results
3.1.1 Conditional Inactivation of Atg Genes Using Geneswitch System
The Atg5, Atg7 and Atg12 RNAi strains contain constructs where
UAS-promoters drive expression of inverted-repeat sequences derived from the
corresponding Atg genes (Roman et al., 2001; Scott et al., 2004). These RNAi strains
have previously been demonstrated to mediate inactivation of Atg genes and the
autophagy pathway in transgenic Drosophila using the constitutively active
Atg7-Atg12
Atg5-Atg12/Atg16
Captured
organelle
and cytosol
Initiation Elongation
Maturation (flux)
Isolation membrane/Phagophore Autophagosome Autolysosome

73
transcription factor GAL4, which binds to UAS sites and activates transcription.
Here the conditional gene expression system Geneswitch was utilized, where the
engineered transcriptional activator protein Geneswitch becomes active only upon
interaction with the drug Mifepristone (RU486), and then binds to the UAS sites and
drives high-level transcription (Osterwalder et al., 2001; Roman et al., 2001). The
Geneswitch driver line “GS-Actin-255B” was used, in which the powerful and
tissue-general Actin5C cytoplasmic actin gene promoter drives expression of
Geneswitch protein in all somatic tissues of the fly. GS-Actin-255B yields robust,
RU486-dependent expression of target transgenes in all the tissues of larvae and
adult flies, including abundant expression in nervous system (Ford et al., 2007)(J.
Shen and J.T., unpublished data). The GS-Actin-255B line was crossed to each
RNAi strain, and the male progeny containing both constructs were cultured as
adults in the presence and absence of the RU486 drug in the food. Control flies were
progeny of the GS-Actin-255B driver crossed to Oregon-R wild-type and w[1118]
strain flies. Real-time RT-PCR assays confirmed that Atg gene expression was
partially reduced (Figure 3.2), consistent with the previous characterization of these
RNAi strains, where partial inhibition of autophagy was scored in larvae using
lysotracker dye as an assay (Scott et al., 2004).

74
A

B

C

Figure 3.2. Real-time RT-PCR Assay of Atg5, Atg7 and Atg12 Gene Message
Levels in Control and Autophagy-inhibited Flies. Each experiment was repeated 3
times and data is presented as mean value +/- SD. Solid bars indicate minus-drug,
open bars indicate plus-drug. (A) Atg5. (B) Atg7. (C) Atg12. Statistical
significance was determined using unpaired, two-sided t-tests, and results were p =
0.015 for Atg5 inhibited flies, p = 0.12 for Atg7 inhibited flies, and p = 0.0023 for
Atg12 inhibited flies. All other comparisons were p > 0.05.
0
1
2
3
4
5
6
7
8
9
Atg5 RNAi GFP dsRNA
control
Or-R control W1118 control
Atg5 gene molecules (x10E+5)
0
1
2
3
4
5
6
7
8
9
Atg7 RNAi GFP dsRNA
control
Or-R control W1118 control
Atg7 gene molecules (x10E+4)
0
1
2
3
4
5
6
7
8
9
Atg12 RNAi GFP dsRNA
control
Or-R control W1118
control
Atg12 gene molecules (x10E+6)

75

3.1.2 Life Span Is Not Altered by Adult-Specific Inhibition of Atg5, Atg7 and
Atg12 genes
Adult male flies were cultured in the presence and absence of the RU486 drug
and life span was quantified. Experimental flies contained both the GS-Actin-255B
driver and the Atg gene RNAi construct, while control flies contained only the driver.
Assays were performed at 29
o
C (Figure 3.3) and at 25
o
C (Figure 3.4), and similar
results were obtained at both culture temperatures. Assay of control flies
demonstrates that life span is not reduced by the drug itself (Figure 3.3A, B).
Strikingly, life span was not affected by adult-specific expression of RNAi constructs
specific for Atg5 (Figure 3.3C), Atg7 (Figure 3.3D) or Atg12 (Figure 3.3E).

76

Figure 3.3. Effect of Autophagy Gene inhibition on Survival of Adult Flies. (A-E)
Survival of control and autophagy-inhibited flies. Survival is plotted as a function
of adult age in days. Each curve represents >125 flies, cultured as adults at 29
o
C.
Solid symbols indicate minus-drug, open symbols indicate plus-drug. Mean life
span was calculated for plus-drug (+) and minus-drug (-) cohorts, with SD in
parentheses, followed by the percent change. Median is presented for each cohort,
followed by percent change and p value generated using log-rank tests. (A)
Oregon-R controls. (B) w[1118] controls. (C) Atg5 RNAi. (D) Atg7 RNAi. (E) Atg12
RNAi.

77
A
0
20
40
60
80
100
0 102030 40 50 607080
days of age
survival percentage
Median: + 54; - 55; -1.85%; p = 0.337
Mean: + 53 (7.38); - 54 (6.81); -1.89%
0
20
40
60
80
100
0 102030 40 50 607080
days of age
survival percentage
Median: + 54; - 55; -1.85%; p = 0.337
Mean: + 53 (7.38); - 54 (6.81); -1.89%

B
0
20
40
60
80
100
0 1020 3040 5060 70 80
days of age
survival percentage
Mean: + 61 (10.16); - 59 (8.25); +3.1%
Median: + 64; - 60; +6.25%; p = 0.045
0
20
40
60
80
100
0 1020 3040 5060 70 80
days of age
survival percentage
Mean: + 61 (10.16); - 59 (8.25); +3.1%
Median: + 64; - 60; +6.25%; p = 0.045

C
0
20
40
60
80
100
0 1020 3040 5060 70 80
days of age
survival percentage
Mean: + 61 (10.16); - 59 (8.25); +3.1%
Median: + 64; - 60; +6.25%; p = 0.045
0
20
40
60
80
100
0 1020 3040 5060 70 80
days of age
survival percentage
Mean: + 61 (10.16); - 59 (8.25); +3.1%
Median: + 64; - 60; +6.25%; p = 0.045

78

Figure 3.3, Continued
D

E

0
20
40
60
80
100
0 10 2030 405060 7080
day s of age
survival percentage
Mean: + 57 (9.56); - 58 (9.96);
Median: + 61; - 61; +0%; p = 0.156
0
20
40
60
80
100
0 1020 304050607080
days of age
survival percentage
Mean:+50 (8.82); - 49 (10.67);+1.54%
Median: + 52; - 51; +1.94%; p = 0.37

79

Figure 3.4. Effect of Autophagy Gene Inhibition on Survival of Adult Flies at
25˚C. Survival is plotted as a function of adult age in days. Each curve represents
>125 flies, cultured as adults at 25
o
C. Solid symbols indicate minus-drug, open
symbols indicate plus-drug. Mean life span was calculated for plus-drug (+) and
minus-drug (-) cohorts, with SD in parentheses, followed by the percent change.
Median is presented for each cohort, followed by percent change and p value
generated using log-rank tests. (A) Or-R controls. (B) w[1118] controls. (C) Atg5
RNAi. (D) Atg7 RNAi. (E) Atg12 RNAi.

80
A
0
20
40
60
80
100
0 10 20 30 4050 60708090 100110
days of age
survival percentage
Mean: + 88 (8.3); - 89 (8.1); -0.81%
Median: + 90; - 89; +1.11%; p = 0.56
0
20
40
60
80
100
0 10 20 30 4050 60708090 100110
days of age
survival percentage
Mean: + 88 (8.3); - 89 (8.1); -0.81%
Median: + 90; - 89; +1.11%; p = 0.56

B
0
20
40
60
80
100
0 10 20 3040 506070 80 90 100110
days of age
survival percentage
Mean: + 89 (15.3); - 88 (17.6); +1.9%
Median: + 95; - 93; +2.1%; p = 0.62
0
20
40
60
80
100
0 10 20 3040 506070 80 90 100110
days of age
survival percentage
Mean: + 89 (15.3); - 88 (17.6); +1.9%
Median: + 95; - 93; +2.1%; p = 0.62

C
0
20
40
60
80
100
0 10 20304050 607080 90 100110
days of age
survival percentage
Mean:+64(13.8);-67(15.4);-5.6%
Median:+65;-69; -6.2%; p=0.017
0
20
40
60
80
100
0 10 20304050 607080 90 100110
days of age
survival percentage
Mean:+64(13.8);-67(15.4);-5.6%
Median:+65;-69; -6.2%; p=0.017

81

Figure 3.4, Continued

D

E

0
20
40
60
80
100
0 10 20304050 60708090 100110
days of age
survival percentage
Mean:+65(15);-63(20.7);+2.8%
Median:+67;-65; +3.0%; p=0.37
0
20
40
60
80
100
0 1020 304050607080 90 100110
days of age
survival percentage
Mean:+69(16);-65(15.3);+6.3%
Median:+71;-67; +5.6%; p=0.027

82

3.1.3 Atg Gene Inhibition Reduces Survival After E. coli Injection
To assay for effects of Atg gene inhibition on immune function, flies were assayed
for survival after injection of the abdomen with approximately 40,000 E. coli
bacteria. E. coli was chosen not only because it is convenient to manipulate, but
also because it has been found to be a target for cellular immunity in Drosophila
(Kocks et al., 2005; Ramsden et al., 2008) and for the autophagy pathway in
macrophages (Amer et al., 2005). Experiments were performed twice at 29
o
C
(Figure 3.5 and Figure 3.6) with similar results. Injection of PBS buffer alone did
not have a detectable effect on fly life span (Figure 3.6A). Moreover, injection of E.
coli did not have a significant effect on life span in control flies (Figure 3.5A, B;
Figure 3.6). However, the life span of flies injected with E. coli was significantly
reduced upon inhibition of Atg gene expression (Figure 3.5C-E; Figure 3.6C-E),
indicating that autophagy is required for resistance to E. coli toxicity.

83

Figure 3.5. Effect of Autophagy Gene Inhibition on Survival of Flies after E. coli
Injection. Approximately 40,000 bacterial cells were injected into each fly at three
days after eclosion. Survival is plotted as a function of adult age in days. Each curve
represents >125 flies, cultured as adults at 29
o
C. Solid symbols indicate minus-drug,
open symbols indicate plus-drug. Mean life span was calculated for plus-drug (+)
and minus-drug (-) cohorts, with SD in parentheses, followed by the percent change.
Median is presented for each cohort, followed by percent change and p value
generated using log-rank tests. (A) Oregon-R controls. (B) w[1118] controls. (C)
Atg5 RNAi. (D) Atg7 RNAi. (E) Atg12 RNAi.

84
A
0
20
40
60
80
100
0 10 2030 4050 6070
days of age
survival percentage
Mean: + 52 (9.1); - 53 (9.43); -0.55%
Median: + 55; - 55; +0%; p = 0.37
0
20
40
60
80
100
0 10 2030 4050 6070
days of age
survival percentage
Mean: + 52 (9.1); - 53 (9.43); -0.55%
Median: + 55; - 55; +0%; p = 0.37

B
0
20
40
60
80
100
0 1020 3040 5060 70
days of age
survival percentage
Mean: + 50 (8.71); - 51 (9.16); -1.2%
Median: + 53; - 54; -1.89%; p = 0.183
0
20
40
60
80
100
0 1020 3040 5060 70
days of age
survival percentage
Mean: + 50 (8.71); - 51 (9.16); -1.2%
Median: + 53; - 54; -1.89%; p = 0.183

C

0
20
40
60
80
100
0 1020304050 60 70
days of age
survival percentage
Mean: + 45 (9.56); - 50 (10.67); -9%
Median: + 48; -51; -6.25%; p = 4.39e-8

85

Figure 3.5, Continued
D

E

0
20
40
60
80
100
0 102030 4050 6070
days of age
survival percentage
Mean: + 47 (13.9); - 54 (13.1); -13.5%
Median: + 54; - 59; -9.26%; p = 7.35e-9
0
20
40
60
80
100
0 1020 3040 5060 70
days of age
survival percentage
Mean: + 41(11.48); - 48 (11.35); -14.2%
Median: + 44; - 50; -13.6%; p = 7.05e-8

86

Figure 3.6. Effect of Autophagy Gene Inhibition on Survival of Flies after E. coli
Injection at 29˚C. Approximately 40,000 bacterial cells were injected into each fly
at three days after eclosion. Survival is plotted as a function of adult age in days.
Each curve represents >125 flies, cultured as adults at 29
o
C. Solid symbols indicate
minus-drug, open symbols indicate plus-drug. Mean life span was calculated for
plus-drug (+) and minus-drug (-) cohorts, with SD in parentheses, followed by the
percent change. Median is presented for each cohort, followed by percent change
and p value generated using log-rank tests. (A) Oregon-R controls, injected with
PBS buffer only. (B-E) Flies injected with bacteria. (B) Oregon-R controls. (C) Atg5
RNAi. (D) Atg7 RNAi. (E) Atg12 RNAi.

87
A
0
20
40
60
80
100
0 102030405060
days of age
survival percentage
Mean: + 44 (8.4); - 43 (9.8); +2.4%
Median: + 47; - 46; +2.13%; p = 0.739
0
20
40
60
80
100
0 102030405060
days of age
survival percentage
Mean: + 44 (8.4); - 43 (9.8); +2.4%
Median: + 47; - 46; +2.13%; p = 0.739

B
0
20
40
60
80
100
0 1020 3040 50 60
days of age
survival percentage
Mean: + 42 (9.2); - 43 (9.7); -0.7%
Median: + 44; - 46; -4.54%; p = 0.59
0
20
40
60
80
100
0 1020 3040 50 60
days of age
survival percentage
Mean: + 42 (9.2); - 43 (9.7); -0.7%
Median: + 44; - 46; -4.54%; p = 0.59

C
0
20
40
60
80
100
0 1020 30 405060
days of age
survival percentage
Mean:+33(11.3);-36(13.5);-7.4%
Median:+37;-39; -4.1%; p=5.3e-5
0
20
40
60
80
100
0 1020 30 405060
days of age
survival percentage
Mean:+33(11.3);-36(13.5);-7.4%
Median:+37;-39; -4.1%; p=5.3e-5

88

Figure 3.6, Continued
D

E

0
20
40
60
80
100
0 1020 30405060
days of age
survival
percentage
Mean:+35(10.7);-39(14);-9.9%
Median:+39;-45; -15.4%; p=1.38e-9
0
20
40
60
80
100
0 1020 30405060
days of age
survival percentage
Mean:+33(11.3);-37(13);-11.1%
Median:+34;-39; -14.7%; p=0.00036

89

3.1.4 Atg Gene Inhibition Enables E. coli Proliferation in Injected Flies
To further characterize the role of autophagy in Drosophila immune function,
flies were injected with E. coli and bacterial load was assayed with and without
inhibition of autophagy genes by RNAi. Bacterial load was quantified on the same
day as injection, and at various time points throughout the adult life span, by plating
whole-fly extracts and counting E. coli colonies. Since the injected E. coli strain was
resistant to the antibiotic nalidixic acid, E. coli could be unambiguously identified by
growth on plates containing the antibiotic. In control flies the bacterial load was
unaffected by the RU486 drug itself, and rapidly fell to low levels that were
maintained throughout the fly life span (Figure 3.7A, B; Figure 3.8A, B). Moreover,
expression of a control inverted-repeat construct (GFP-RNAi) did not affect bacterial
load (Figure 3.7C; Figure 3.8C). In contrast, inhibition of Atg genes resulted in a
significant increase in bacterial load (Figure 3.7D-F; Figure 3.8D-F). The data
suggest that normal autophagy pathway function is required to suppress the growth
of injected E. coli, particularly in older flies.

90

Figure 3.7. Effect of Autophagy Gene Inhibition on Bacterial Titers in E.coli
Injected Flies. Approximately 40,000 bacterial cells were injected to each fly at 3
days after eclosion. Bacterial load was assayed the same day, and at 25 days and 35
days after injection, as indicated; flies were cultured as adults at 29
o
C. Solid bars
indicate minus-drug, open bars indicate plus-drug. (A) Oregon-R controls. (B)
w[1118] controls. (C) GFP RNAi controls. (D) Atg5 RNAi. (E) Atg7 RNAi. (F)
Atg12 RNAi. Statistical significance was determined using unpaired, two-sided
t-tests and significant increases (p < 0.05) are indicated by asterisk.

91

A

B

C

0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)

92
Figure 3.7, Continued
D

E
0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*
0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*

F
0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*
0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*

0
1
2
3
4
5
6
328 38
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*

93

Figure 3.8. Effect of Autophagy Gene Inhibition on Bacterial Titers in E. coli
Injected Flies at 29˚C. Approximately 40,000 bacterial cells were injected to each
fly at 3 days after eclosion. Bacterial load was assayed the same day, and at various
time points after injection, as indicated. Solid bars indicate minus-drug, open bars
indicate plus-drug. (A) Oregon-R controls. (B) w[1118] controls. (C) GFP RNAi
controls. (D) Atg5 RNAi. (E) Atg7 RNAi. (F) Atg12 RNAi. Statistical
significance was determined using unpaired, two-sided t-tests and significant
increases (p < 0.05) are indicated by asterisk.

94
A

B

C

0
2
4
6
8
10
12
3 10 1826 3340 47 54
days of age
Bacterial count
(x10E+4 cfu/fly)
0
2
4
6
8
10
12
3 10 1826 3340 47 54
days of age
Bacterial count
(x10E+4 cfu/fly)
0
2
4
6
8
10
12
3 10 1826 3340 47 54
days of age
Bacterial count
(x10E+4 cfu/fly)

95
Figure 3.8, Continued
D

0
2
4
6
8
10
12
3 101826 334047 54
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*
0
2
4
6
8
10
12
3 101826 334047 54
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*

E

0
2
4
6
8
10
12
3 1018 2633 404754
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*
*
*
0
2
4
6
8
10
12
3 1018 2633 404754
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*
*
*

F
0
2
4
6
8
10
12
3 1018 2633 4047 54
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*
0
2
4
6
8
10
12
3 1018 2633 4047 54
days of age
Bacterial count
(x10E+4 cfu/fly)
*
*

96

3.2 Discussion
The goal of this study was to determine if autophagy gene function might be
limiting in adult Drosophila flies for immune function and/or life span. Conditional
expression of transgenes designed to inactivate the Atg5, Atg7 and Atg12 genes
produced flies that were more susceptible to toxicity from injected E. coli, as
evidence by decreased fly survival. These Atg-inhibited flies were also less able to
control the proliferation of injected E. coli. This indicates that the function of these
genes and the autophagy pathway is required in adult flies for optimal immune
function. This system should be useful in the future for more extensive studies of
the in vivo role of autophagy for resistance to bacteria, and genetic manipulation of
the E. coli is promising for analysis of virulence factors.
Strikingly, in flies without the challenge of injected E. coli, life span was not
affected by expression of Atg RNAi constructs. This suggests that under our typical
laboratory conditions immune function is not limiting for adult fly life span. This
data is consistent with our previous observations that flies cultured under
bacteria-free conditions have no alteration in life span (Ren et al., 2007), and
therefore provides further support for the conclusion that in the laboratory assay, fly

97
life span is not limited by bacteria, but must be limited by some other factor(s) not
directly related to immune function or pathogens.
It is somewhat surprising that our experiments suggest that the autophagy
pathway is not limiting for adult fly life span. Recent studies have reported that
mutations in the Drosophila autophagy genes Atg7 (Juhasz et al., 2007) and Atg8a
(Simonsen et al., 2008) resulted in flies with reduced life span and
neurodegeneration in the adult. One possible explanation for these differing results is
that in the previous studies the function of the Atg genes was reduced throughout the
life span of the flies, and therefore reduced autophagy during development might
have caused defects that resulted in reduced subsequent adult life span. Consistent
with this idea, when we used the Geneswitch system to express the Atg7 RNAi
construct during Drosophila development, we did observe reductions in subsequent
adult life span (Figure 3.9), however this experiment was complicated by a smaller,
but significant, negative effect of the RU486 drug itself during development.
Another possibility, and the one that we favor, is that in experiments where
autophagy gene function was reduced by mutation, autophagy was reduced below
some threshold required for normal adult life span, while in the present experiments
the partial inhibition of autophagy genes produced by RNAi did not reduce function
below such a critical threshold. Based on the observation that morphological
development in Atg mutant flies appeared largely normal, and the fact that adult flies

98
had significant indicators of neurodegeneration as well as reduced life span, it was
previously concluded that autophagy may be required in the adult for normal life
span (Juhasz et al., 2007; Simonsen et al., 2008). The fact that we did not observe
reduced life span upon partial reduction of autophagy specifically in adults may be
because adult flies can withstand significant neurodegeneration with out reduced life
span, such as observed for other Drosophila mutants with severe neurodegeneration
(Palladino et al., 2000). Another possibility is that autophagy is not limiting for
adult life span, but severe reductions can cause a novel pathology resulting in both
neurodegeneration and reduced life span. Previously, over-expression of Atg8a in
Drosophila using a non-conditional system and a nervous system-specific driver
(APPL-Gal4) was found to yield increased life span, while another
nervous-system-specific driver (Elav-Gal4) did not (Simonsen et al., 2008), and
those results were also interpreted to suggest that autophagy gene function might be
limiting for adult life span. However, that approach yields over-expression during
development as well as in adults, and therefore the longevity effect may have been
due to developmental changes; it is also possible that Atg8a over-expression might
affect life span through effects other than on autophagy. Finally, it is relevant that
in the present study the Geneswitch conditional system was utilized, and therefore
control and experimental flies have identical genetic backgrounds, and differ only in
the presence or absence of the triggering drug RU486. In contrast, in previous

99
studies using mutants and non-conditional expression systems, the control and
experimental flies necessarily have slight differences in genetic background that
could potentially affect life span.
In C. elegans, autophagy gene function was found to be required for life span
extension in response to reduced IIS, DR, and reduced mitochondrial gene activity
(Jia and Levine, 2007; Melendez et al., 2003; Toth et al., 2008). However, differing
results were obtained as to whether the autophagy pathway limits life span in adult
worms under normal conditions. One possibility suggested by the present results
with Drosophila is that under the particular experimental conditions where inhibition
of autophagy was found to limit life span of wild-type C. elegans, life span was
being limited by bacteria and immune function (Garigan et al., 2002).
In summary, the present results indicate that autophagy is required for
optimal immune function in adult Drosophila flies, but that neither immune function
nor autophagy gene function are limiting for adult life span under laboratory
conditions that have been optimized for long life spans. It will be of interest in the
future to determine what are the factors that limit adult fly life span under these
optimized laboratory conditions.

100

Figure 3.9. Life Span Analyses of the Effect of Atg7 Inhibition During both
Developmental and Adult Stages at 25˚C. Survival is plotted as a function of adult
age in days. Each curve represents >125 flies, cultured as adults at 25oC. Mean life
span was calculated for each cohorts, with SD in parentheses, followed by the
percent change. Median is presented for each cohort, followed by percent change
and p value generated using log-rank tests. Cohorts treated with no drug (D-A-),
solid squares. Flies treated with drug during development only (D+A-), open
diamonds. Flies treated with drug as adult only (D-A+), open triangles. (A) Or-R
controls. (B) w[1118] controls. (C) Atg7 RNAi.

101

A

B

0
20
40
60
80
100
0 10203040 5060708090 100
days of age
survival percentage
D-A- Mean: 73(15); Median: 75
D+A- 65(21) -11.6%; 73 -2.7%; p=0.0034
D-A+ 75(12) +3%; 77 +2.6%; p=0.96
0
20
40
60
80
100
0 1020 3040 5060 7080 90
days of age
survival percentage
D-A- Mean: 59(9.9); Median: 61
D+A- 51(16) -16%; 55 -11%; p=9.6e-5
D-A+ 63(11) +6.4%; 67 +9%; p=2.6e-6

102

Figure 3.9, Continued
C

0
20
40
60
80
100
0 10 20304050 607080 90 100
days of age
survival percentage
D-A- Mean: 59(8); Median: 63
D+A- 50(13) -18%; 55 -14%; p=3.7e-9
D-A+ 58(9) -2%; 61 -3.3%; p=0.63

103
3.3 Experimental Procedures
3.3.1 Drosophila strains
The Atg5-RNAi strain (UAS-Atg5-IR
8-1
, insert on third chromosome),
Atg7-RNAi strain (UAS-Atg7-IR
17-6
/CyO, insert on second chromosome) and
Atg12-RNAi strain (UAS-Atg12-IR
26-2
, insert on third chromosome) were provided
by Thomas P. Neufeld, and were described previously (Scott et al., 2004). The
GFP-RNAi transgenic strain (Roignant et al., 2003) was genotype w
1118
;
P{UAS-Avic\GFP .dsRNA.R}142, and was obtained from Bloomington Drosophila
Stock Center. The Geneswitch driver line GS-Act-255B contains a P element
construct in which the Geneswitch cDNA is cloned downstream of the
tissue-general actin5C promoter, and was described previously (Ford et al., 2007).
The flies used in this paper were the male progeny from the Geneswitch driver
crossed to the Atg RNAi strains, and the progeny of Geneswitch driver crossed to the
Oregon-R wild-type and w[1118] control strains (referred to in the Figures as
“Oregon-R controls” and “w[1118] controls”).
3.3.2 Drosophila culture
Drosophila culture and life span assays were performed as described
previously (Ford et al., 2007; Ren et al., 2007). Stocks were maintained on a

104
standard cornmeal agar medium that contains the antifungal agent tegosept (Sigma)
at a final concentration of 11mM. Food recipe: 105g dextrose, 7.5g agar, 26g yeast,
50g cornmeal, 1 liter purified H
2
0, boil for 30 minutes with constant agitation, then
add 1.7g tegosept dissolved in 8.5ml 95% ethanol and 1.9ml propionic acid (99%,
Mallinckrodt Baker). Life span measurements were conducted with ~25 male flies
per vial, and a total 5 vials for each cohort. For survival assays performed at 25
o
C,
flies were transferred to fresh vials ever other day. For adult survival assays
preformed at 29
o
C, flies were transferred to fresh vials every other day during the
first 30-40 days, and then every day for the remainder of the life span. Culture of
adults at 20
o
C results in shorter life span and therefore allows for more rapid
experiments; no difference in results was observed for experiments conducted at
25
o
C versus 29
o
C. For the Geneswitch system experiments, food vials were
adjusted to a final concentration of ~160ug/ml of RU486 (Mifepristone, Sigma) by
applying 50ul of an ethanol stock solution to the surface of fresh food vials, while
the control food vials were treated with ethanol solvent alone; vials were air-dried
for 48 hours to allow the ethanol to evaporate (detailed protocols for food
preparation are provided online at http://towerlab.usc.edu/). Flies were injected
with E. coli at 3 days of age (as described below), and immediately transferred to
food vials with and without drug. Recording of deaths for life span assays of E.
coli-injected flies was initiated 2 days after injection to eliminate any deaths due to

105
the trauma of injection (always < 5% of total flies). Females were excluded from
these experiments to reduce the life span assay workload and expense by half. In
addition males were chosen over females because in general female life span appears
more affected by subtleties in the food source (Magwere et al., 2004).

3.3.3 Life span assays for Atg7 inhibition at either developmental or adult stage
Life span measurements were made at 25
o
C, with ~25 flies per vial, and total 5
vials for each strain. Flies were transferred to fresh vials ever other day at 25
o
C. For
the Geneswitch system, food vials were adjusted to ~160 ug/ml of RU486
(Mifepristone, Sigma) using a stock solution dissolved in ethanol at either
developmental or adult stage only. The control food was treated with ethanol solvent
only.

3.3.4 Real-time RT-PCR
Total RNA was isolated from 30 male flies at 1 week of age using TRIzol
reagent (Invitrogen). RNA concentration was measured using a spectrophotomer
(NanoDrop) and the RNA was converted to cDNA using the QuantiTect Reverse
Transcription kit (Qiagen) according to the manufacturer’s instructions. The primers

106
used to amplify the Atg7 and Atg12 genes were as previously described (Juhasz et al.,
2007; Scott et al., 2004). The primers used to amplify Atg5 gene were as follows:
Atg5F (gcactacatgtcctgcctga) and Atg5R (agattcgcaggggaatgttt). The Atg5, Atg7 and
Atg12 gene sequences were amplified from fly cDNA, quantitated by
spectrophotometry, and used as the standard. Varying amounts of standard cDNA
(10
2
, 10
3
, 10
4
, 10
5
, 10
6
, 10
7
, 10
8
molecules) was amplified in parallel reactions
alongside the experimental cDNA samples. Real-time PCR was performed using the
Bio-RAD DNA Engine Opticon 2 Real-time PCR detector, and SYBR green dye.
The threshold cycle (Ct) is the point where each kinetic curve reaches a common
arbitrary fluorescence level (AFL), placed to intersect each curve in the region of
exponential increase (Kang et al., 2000). The Ct number was plotted vs. input DNA,
and experimental sample concentrations were derived from the standard curves.
Values are plotted as mean ± SD of triplicate assays.
3.3.5 E. coli injection into flies
The E. coli bacteria strain ZK1142 (Palchevskiy and Finkel, 2006) is resistant
to the antibiotic nalidixic acid. Bacteria were grown in Luria-Betani (LB) broth for
12-18h and the density of bacterial culture was estimated by spectrophotometry.
The bacterial culture was diluted to approximately 8x10
8
cells/ml in PBS. Green
food coloring (Kroger brand) was added to the bacterial solution to simplify liquid

107
handling and scoring of injections. Microneedles were made using the PN-30
puller (Narishige) and Brosil glass capillary tubing (1.0mm OD x 0.75mm ID; FHC
Inc.). The needles were graduated before use with a scale of 1/32 inch, and ~3ul of
bacterial solution was added to the needle. The needles with bacterial solution were
then assembled into the FemtoJet express microinjector (Eppendorf). The flies were
anaesthetized using CO
2
and positioned on the pad with the abdomen oriented
towards the needle using brushes. The colored bacterial solution was then injected
into the abdomen of the adult fly using the microinjector; the volume injected was ~
0.05ul per fly.

3.3.6 Bacterial counts from E.coli injected flies
At the indicated time points after E. coli injection, three males were removed
from each of five different vials (each vial contained ~20 flies). Each fly was
individually homogenized in 100 μl sterile PBS using a small pestle for about 1
minute, until pieces of tissue were no longer visible. The homogenates were diluted
as necessary and plated on LB agar with 20 ug/ml nalidixic acid. The values
obtained for the 15 flies were averaged, and standard deviations are indicated in the
figures by error bars.

108
3.3.7 Statistics
Median life spans were compared using two-sided log-rank tests. The Cox
Proportional Hazards Regression Model was used with Breslow method as a default.
All analyses were performed in R 2.4.1 statistical environment
(RDevelopmentCoreTeam, 2006). Survival statistics results are presented in the
Figures. Unpaired, two-sided t-tests were used to determine the significance of the
difference of bacterial load between the RU486-treated and control flies. Statistically
significant differences (p < 0.05) are indicated in bar graphs by asterisks.

109

Chapter 4 CONCLUSIONS AND FUTURE STUDIES

Drosophila melanogaster is a good model organism in modern biology. It can be
easily manipulated with comparatively short life span. Many genetic techniques and
tools are available to study the gene regulation mechanisms. Many genetically
manipulated fly strains which express or inhibit specific genes are also available in
the public stock centers. Drosophila has been used as a model to study the aging
mechanism in our lab. Aging is a complicated process and has been a hot topic for
years. Many methods have been tried to study the mechanism to extend life span
without compromising the survival quality. Aging process is related and affected by
many other important pathways and cellular functions, like immunity (Zerofsky et
al., 2005), antioxidation process (Missirlis et al., 2001), and DNA repair pathway
(Ruan et al., 2002). It is still not very clear whether it is the aging process causing
the reduced activities of other pathways, or the decreased functions of other
processes leading to accumulated damages and causing senescence.
Although aging is affected by many factors, I am interested in whether the
bacteria associated with flies have an effect on aging. First, my results showed that
there are more than 10
6
bacteria associated with a single fly in their old age (Ren et
al., 2007). However, only about 100 bacteria were detected for each young fly.

110
Although more than 10
6
bacteria were found at the old age, they belonged to 2 main
genera: Acetobacter and Lactobacillus. This result was similar in Oregon-R and
Canton-S wild type flies, and the similar species were also found in other insects-like
bees (Mohr and Tebbe, 2006) and mealybug (Ashbolt and Inkerman, 1990). The
SEM pictures showed the bacteria were around the whole body surface of the fly.
The fungus Cladosporium sphaerospermum was also detected in the flies
occasionally, but appears to be associated with the flies’ food only and does not
apprear to be growing in or on the fly.
I wanted to check whether the life span is affected by bacteria associated with the
fly, I removed the bacteria from flies by a serial washing method described
previously (Geer, 1963). Then the flies without bacteria were called “axenic” flies. I
found the fly life span was not altered between axenic and control Oregon-R
wild-type flies. The same results were found in Canton-S wild-type flies, which have
a shorter life span. I also removed the bacteria from the fly by treating the flies with
antibiotics. The antibiotics-treated flies also had an unchanged life span. A similar
result was found with anti-fungal treated flies. Different methods, which include
real-time PCR, quantitative PCR, culture plating, and SEM, were used to
demonstrate that the axenic flies lacked at least 90% of bacteria. So the results
showed that fly life span was not altered by the microbes, including both bacteria
and fungi.

111
Next, I checked whether the fly immune function changed with age in our flies.
Drosophila is a widely used model to study innate immunity (Garcia-Lara et al.,
2005). Most previous studies were focused on the immune response to externally
introduced infectious bacteria (Ayres et al., 2008; Garver et al., 2006). Here we
checked how the Drosophila innate immunity responded to endogenous bacteria.
Drosophila’s innate immunity includes both humoral and cellular defenses. I
checked the expression of several AMP genes, which are produced as part of the
humoral response. Several methods, including real-time RT-PCR, Northern Blots,
and quantitative RT-PCR, were used to compare AMP gene expressions between
axenic and control flies. They all showed the same results: AMP gene expression
was greatly reduced in axenic flies compared to control flies, meaning a reduced
response to the lowered bacterial load.
The conclusion from my first project is that drosophila can tolerate a large amount
of bacterial load and mount a significant level of immune response. However, the fly
life span is not altered in the typical laboratory conditions. This is an interesting
result since the bacteria was not found a limiting factor to affect fly longevity. This
result is a surprise to most people since it is natural to think that the energy taken to
fight for bacteria will cause a decreased life span. So it will be an interesting study in
the future to determine what physiological factors are limiting fly life span under the
optimal laboratory conditions.

112
Autophagy is a basic cellular function in which cells autodigest their cytoplasm
for recycling or removal. Autophagy can remove damaged organelles like
mitochondria and recycle macromolecules like amino acids in the starved condition.
Since it is a fundamental cellular process, I would like to check whether it will affect
the aging process.
The Geneswitch system was used to conditionally inhibit three autophagy
pathway genes: Atg5, Atg7, and Atg12. These genes are each essential for the
process of autophagosome elongation. The three genes were inhibited by RNA
interference when the drug RU486 was present, as described in the last chapter. Or-R
and W1118 flies crossed to the gene-switch driver line served as the controls. The
life span was not affected in Atg5, Atg7, and Atg12 inhibited flies by RNAi. The
similar results were shown in both 25˚C and 29˚C. This result is somewhat
surprising and different from previous findings in other labs. Previous results
showed that Atg7 and Atg8a mutant flies had a decreased life span (Juhasz et al.,
2007; Simonsen et al., 2008). There are several possible reasons for the difference in
results: First, our autophagy inhibition by RNAi is a partial knockout of the genes,
while the Atg7 mutant described previously had a complete inhibition effect. The
complete knockout of Atg genes may have caused damages other than the autophagy
process itself and the reduced life span could be caused by the other damages. Our
autophagy-inhibited strains may only have a mild effect that would not affect other

113
pathways. Second, the Atg7 mutation inhibited autophagy in the developmental stage
as well as in adult flies. The inhibition of autophagy in our study was specific to the
adult stage. Autophagy process may be critical for normal development and therefore
cause reduced life span. Third, our geneswitch system provides the same genetic
background between control and experimental groups, while the genetic background
was not the same between control and mutant flies in the previous papers. Flies with
different genetic backgrounds may show differences in life spans that are not related
to inhibition of autophagy.
Besides the cellular autodigestion function, autophagy was recently found to play
an important role in immunity (Nakagawa et al., 2004; Ogawa et al., 2005) in
mammalian cells. I was interested to see whether autophagy has an immune function
and might also affect the ability to resist bacteria in flies. To test this I injected
nalidixic acid-resistant E. coli into autophagy-inhibited flies. There was decreased
life span in autophagy-inhibited flies, but not in the control flies. To check whether
the reduced longevity was caused by the autophagy’s effect on resistance to the
injected bacteria, I quantified the bacterial load in the flies. The results showed that
there was much higher bacterial proliferation in autophagy-inhibited flies, while not
in the control flies. Together these results informed us that autophagy does play an
immunity role in our flies and this reduced immune function caused decreased
longevity only when the flies were challenged by injection of bacteria.

114
The autophagy project indicates that autophagy is required for the optimal
immune function of the fly, but is not required for the normal life span. In C. elegans,
autophagy has been reported to be required for life-span extension in response to
each of the three life span pathways: reduced IIS pathway (Melendez et al., 2003),
DR (Jia and Levine, 2007), and reduced mitochondrial gene function (Toth et al.,
2008). So it will be interesting to study whether autophagy can affect Drosophila’s
life span downstream of these three pathways in the future. Mutations of genes in the
autophagy pathway have been found to cause neurogeneration in Drosophila (Juhasz
et al., 2007; Simonsen et al., 2008). So it will be of interest to study whether
autophagy induction can be used as a therapeutic intervention in neurodegenerative
diseases with intracytosolic aggregate accumulations, like Huntington's disease (HD)
(Sarkar et al., 2008).
Combining the two projects together, our results demonstrate that normal fly
longevity is not limited by endogenous bacteria, nor by autophagy gene function or
immune function under our laboratory conditions which have been optimized for
long life spans. It will be important to determine what are the limiting factors and
pathways for adult life span with these optimized laboratory conditions.

115
BIBLIOGRAPHY

Acinas, S. G., Marcelino, L. A., Klepac-Ceraj, V ., and Polz, M. F. (2004). Divergence
and redundancy of 16S rRNA sequences in genomes with multiple rrn operons. J
Bacteriol 186, 2629-2635.

Amer, A. O., Byrne, B. G., and Swanson, M. S. (2005). Macrophages rapidly transfer
pathogens from lipid raft vacuoles to autophagosomes. Autophagy 1, 53-58.

Archibald, F. S., and Fridovich, I. (1981). Manganese, superoxide dismutase, and
oxygen tolerance in some lactic acid bacteria. J Bacteriol 146, 928-936.

Ashbolt, N. J., and Inkerman, P. A. (1990). Acetic Acid Bacterial Biota of the Pink
Sugar Cane Mealybug, Saccharococcus sacchari, and Its Environs. Appl Environ
Microbiol 56, 707-712.

Ayres, J. S., Freitag, N., and Schneider, D. S. (2008). Identification of Drosophila
mutants altering defense of and endurance to Listeria monocytogenes infection.
Genetics 178, 1807-1815.

Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., and Gordon, J. I. (2005).
Host-bacterial mutualism in the human intestine. Science 307, 1915-1920.

Baehrecke, E. H. (2003). Autophagic programmed cell death in Drosophila. Cell
Death Differ 10, 940-945.

Bakula, M. (1969). The persistence of a microbial flora during postembryogenesis of
Drosophila melanogaster. J Invertebr Pathol 14, 365-374.

Bieschke, E. T., Wheeler, J. C., and Tower, J. (1998). Doxycycline-induced transgene
expression during Drosophila development and aging. Mol Gen Genet 258, 571-579.

Blommaart, E. F., Krause, U., Schellens, J. P., Vreeling-Sindelarova, H., and Meijer,
A. J. (1997). The phosphatidylinositol 3-kinase inhibitors wortmannin and
LY294002 inhibit autophagy in isolated rat hepatocytes. Eur J Biochem 243,
240-246.

Borneman, J., and Hartin, R. J. (2000). PCR primers that amplify fungal rRNA genes
from environmental samples. Appl Environ Microbiol 66, 4356-4360.

116

Braselmann, S., Graninger, P., and Busslinger, M. (1993). A selective transcriptional
induction system for mammalian cells based on Gal4-estrogen receptor fusion
proteins. Proc Natl Acad Sci U S A 90, 1657-1661.

Broderick, N. A., Raffa, K. F., and Handelsman, J. (2006). Midgut bacteria required
for Bacillus thuringiensis insecticidal activity. Proc Natl Acad Sci U S A 103,
15196-15199.

Brummel, T., Ching, A., Seroude, L., Simon, A. F., and Benzer, S. (2004).
Drosophila lifespan enhancement by exogenous bacteria. Proc Natl Acad Sci U S A
101, 12974-12979.

Chohnan, S., Furukawa, H., Fujio, T., Nishihara, H., and Takamura, Y. (1997).
Changes in the size and composition of intracellular pools of nonesterified coenzyme
A and coenzyme A thioesters in aerobic and facultatively anaerobic bacteria. Appl
Environ Microbiol 63, 553-560.

Clancy, D. J., Gems, D., Harshman, L. G., Oldham, S., Stocker, H., Hafen, E.,
Leevers, S. J., and Partridge, L. (2001). Extension of life-span by loss of CHICO, a
Drosophila insulin receptor substrate protein. Science 292, 104-106.

Corby-Harris, V., Pontaroli, A. C., Shimkets, L. J., Bennetzen, J. L., Habel, K. E.,
and Promislow, D. E. (2007). Geographical distribution and diversity of bacteria
associated with natural populations of Drosophila melanogaster. Appl Environ
Microbiol 73, 3470-3479.

Cordts, R., and Patridge, L. (1996). Courtship reduces longevity of male Drosophila
melanogaster Animal Behaviour 52, 269-278.

Cuervo, A. M., Bergamini, E., Brunk, U. T., Droge, W., Ffrench, M., and Terman, A.
(2005). Autophagy and aging: the importance of maintaining "clean" cells.
Autophagy 1, 131-140.

Deretic, V. (2005). Autophagy in innate and adaptive immunity. Trends Immunol 26,
523-528.

Dethlefsen, L., Eckburg, P. B., Bik, E. M., and Relman, D. A. (2006). Assembly of
the human intestinal microbiota. Trends Ecol Evol 21, 517-523.

117
Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., and Schneider, D. S. (2006). Akt and
FOXO dysregulation contribute to infection-induced wasting in Drosophila. Curr
Biol 16, 1977-1985.

Ferreira, J. L., Maslanka, S., Johnson, E., and Goodnough, M. (2003). Detection of
botulinal neurotoxins A, B, E, and F by amplified enzyme-linked immunosorbent
assay: collaborative study. J AOAC Int 86, 314-331.

Finkel, T., and Holbrook, N. J. (2000). Oxidants, oxidative stress and the biology of
ageing. Nature 408, 239-247.

Ford, D., Hoe, N., Landis, G. N., Tozer, K., Luu, A., Bhole, D., Badrinath, A., and
Tower, J. (2007). Alteration of Drosophila life span using conditional, tissue-specific
expression of transgenes triggered by doxycyline or RU486/Mifepristone. Exp
Gerontol 42, 483-497.

Frasca, D., Riley, R. L., and Blomberg, B. B. (2005). Humoral immune response and
B-cell functions including immunoglobulin class switch are downregulated in aged
mice and humans. Semin Immunol 17, 378-384.

Fux, C. A., Costerton, J. W., Stewart, P. S., and Stoodley, P. (2005). Survival
strategies of infectious biofilms. Trends Microbiol 13, 34-40.

Garcia-Lara, J., Needham, A. J., and Foster, S. J. (2005). Invertebrates as animal
models for Staphylococcus aureus pathogenesis: a window into host-pathogen
interaction. FEMS Immunol Med Microbiol 43, 311-323.

Garigan, D., Hsu, A. L., Fraser, A. G., Kamath, R. S., Ahringer, J., and Kenyon, C.
(2002). Genetic analysis of tissue aging in Caenorhabditis elegans: a role for
heat-shock factor and bacterial proliferation. Genetics 161, 1101-1112.

Garsin, D. A., Villanueva, J. M., Begun, J., Kim, D. H., Sifri, C. D., Calderwood, S.
B., Ruvkun, G., and Ausubel, F. M. (2003). Long-lived C. elegans daf-2 mutants are
resistant to bacterial pathogens. Science 300, 1921.

Garver, L. S., Wu, J., and Wu, L. P. (2006). The peptidoglycan recognition protein
PGRP-SC1a is essential for Toll signaling and phagocytosis of Staphylococcus
aureus in Drosophila. Proc Natl Acad Sci U S A 103, 660-665.

118
Ge, Z., Feng, Y ., Taylor, N. S., Ohtani, M., Polz, M. F., Schauer, D. B., and Fox, J. G.
(2006). Colonization dynamics of altered Schaedler flora is influenced by gender,
aging, and Helicobacter hepaticus infection in the intestines of Swiss Webster mice.
Appl Environ Microbiol 72, 5100-5103.

Geer, B. W. (1963). A Ribonucleic Acid-Protein Relationship in Drosophila Nutrition.
J Exp Zool 154, 353-364.

Gutierrez, M. G., Master, S. S., Singh, S. B., Taylor, G. A., Colombo, M. I., and
Deretic, V. (2004). Autophagy is a defense mechanism inhibiting BCG and
Mycobacterium tuberculosis survival in infected macrophages. Cell 119, 753-766.

Gutierrez, M. G., Vazquez, C. L., Munafo, D. B., Zoppino, F. C., Beron, W.,
Rabinovitch, M., and Colombo, M. I. (2005). Autophagy induction favours the
generation and maturation of the Coxiella-replicative vacuoles. Cell Microbiol 7,
981-993.

Helfand, S. L., Blake, K. J., Rogina, B., Stracks, M. D., Centurion, A., and Naprta, B.
(1995). Temporal patterns of gene expression in the antenna of the adult Drosophila
melanogaster. Genetics 140, 549-555.

Helfand, S. L., and Rogina, B. (2003). Genetics of aging in the fruit fly, Drosophila
melanogaster. Annu Rev Genet 37, 329-348.

Hoffmann, J. A., and Reichhart, J. M. (2002). Drosophila innate immunity: an
evolutionary perspective. Nat Immunol 3, 121-126.

Holt, P. R. (2003). Gastrointestinal diseases in the elderly. Curr Opin Clin Nutr
Metab Care 6, 41-48.

Hooper, L. V., and Gordon, J. I. (2001). Commensal host-bacterial relationships in
the gut. Science 292, 1115-1118.

Hopkins, M. J., Sharp, R., and Macfarlane, G. T. (2001). Age and disease related
changes in intestinal bacterial populations assessed by cell culture, 16S rRNA
abundance, and community cellular fatty acid profiles. Gut 48, 198-205.

Houthoofd, K., Braeckman, B. P., Johnson, T. E., and Vanfleteren, J. R. (2003). Life
extension via dietary restriction is independent of the Ins/IGF-1 signalling pathway
in Caenorhabditis elegans. Exp Gerontol 38, 947-954.

119

Houthoofd, K., Braeckman, B. P., Lenaerts, I., Brys, K., De Vreese, A., Van Eygen,
S., and Vanfleteren, J. R. (2002). Axenic growth up-regulates mass-specific
metabolic rate, stress resistance, and extends life span in Caenorhabditis elegans.
Exp Gerontol 37, 1371-1378.

Hughes, K. A., and Reynolds, R. M. (2005). Evolutionary and mechanistic theories
of aging. Annu Rev Entomol 50, 421-445.

Hultmark, D. (2003). Drosophila immunity: paths and patterns. Curr Opin Immunol
15, 12-19.

Jia, K., and Levine, B. (2007). Autophagy is required for dietary restriction-mediated
life span extension in C. elegans. Autophagy 3, 597-599.

Juhasz, G., Erdi, B., Sass, M., and Neufeld, T. P. (2007). Atg7-dependent autophagy
promotes neuronal health, stress tolerance, and longevity but is dispensable for
metamorphosis in Drosophila. Genes Dev 21, 3061-3066.

Kaeberlein, T. L., Smith, E. D., Tsuchiya, M., Welton, K. L., Thomas, J. H., Fields,
S., Kennedy, B. K., and Kaeberlein, M. (2006). Lifespan extension in Caenorhabditis
elegans by complete removal of food. Aging Cell 5, 487-494.

Kang, J. J., Watson, R. M., Fisher, M. E., Higuchi, R., Gelfand, D. H., and Holland,
M. J. (2000). Transcript quantitation in total yeast cellular RNA using kinetic PCR.
Nucleic Acids Res 28, e2.

Kim, D. S., and Fogler, H. S. (1999). The effects of exopolymers on cell morphology
and culturability of Leuconostoc mesenteroides during starvation. Appl Microbiol
Biotechnol 52, 839-844.

Kocks, C., Cho, J. H., Nehme, N., Ulvila, J., Pearson, A. M., Meister, M., Strom, C.,
Conto, S. L., Hetru, C., Stuart, L. M., et al. (2005). Eater, a transmembrane protein
mediating phagocytosis of bacterial pathogens in Drosophila. Cell 123, 335-346.

Kuipers, E. J., Janssen, M. J., and de Boer, W. A. (2003). Good bugs and bad bugs:
indications and therapies for Helicobacter pylori eradication. Curr Opin Pharmacol 3,
480-485.

120
Landis, G. N., Abdueva, D., Skvortsov, D., Yang, J., Rabin, B. E., Carrick, J., Tavare,
S., and Tower, J. (2004). Similar gene expression patterns characterize aging and
oxidative stress in Drosophila melanogaster. Proc Natl Acad Sci U S A 101,
7663-7668.

Landis, G. N., Bhole, D., and Tower, J. (2003). A search for doxycycline-dependent
mutations that increase Drosophila melanogaster life span identifies the VhaSFD,
Sugar baby, filamin, fwd and Cctl genes. Genome Biol 4, R8.

Leclerc, V., and Reichhart, J. M. (2004). The immune response of Drosophila
melanogaster. Immunol Rev 198, 59-71.

Libert, S., Chao, Y., Chu, X., and Pletcher, S. D. (2006). Trade-offs between
longevity and pathogen resistance in Drosophila melanogaster are mediated by
NFkappaB signaling. Aging Cell 5, 533-543.

Longo, V. D., and Finch, C. E. (2003). Evolutionary medicine: from dwarf model
systems to healthy centenarians? Science 299, 1342-1346.

Macpherson, A., Khoo, U. Y., Forgacs, I., Philpott-Howard, J., and Bjarnason, I.
(1996). Mucosal antibodies in inflammatory bowel disease are directed against
intestinal bacteria. Gut 38, 365-375.

Magwere, T., Chapman, T., and Partridge, L. (2004). Sex differences in the effect of
dietary restriction on life span and mortality rates in female and male Drosophila
melanogaster. J Gerontol A Biol Sci Med Sci 59, 3-9.

Matova, N., and Anderson, K. V. (2006). Rel/NF-kappaB double mutants reveal that
cellular immunity is central to Drosophila host defense. Proc Natl Acad Sci U S A
103, 16424-16429.

McFall-Ngai, M. (2006). Love the one you're with: vertebrate guts shape their
microbiota. Cell 127, 247-249.

Missirlis, F., Phillips, J. P., and Jackle, H. (2001). Cooperative action of antioxidant
defense systems in Drosophila. Curr Biol 11, 1272-1277.

Mizushima, N., Levine, B., Cuervo, A. M., and Klionsky, D. J. (2008). Autophagy
fights disease through cellular self-digestion. Nature 451, 1069-1075.

121
Mohr, K. I., and Tebbe, C. C. (2006). Diversity and phylotype consistency of
bacteria in the guts of three bee species (Apoidea) at an oilseed rape field. Environ
Microbiol 8, 258-272.

Nakagawa, I., Amano, A., Mizushima, N., Yamamoto, A., Yamaguchi, H., Kamimoto,
T., Nara, A., Funao, J., Nakata, M., Tsuda, K., et al. (2004). Autophagy defends cells
against invading group A Streptococcus. Science 306, 1037-1040.

O'Neill, S. L., Giordano, R., Colbert, A. M., Karr, T. L., and Robertson, H. M. (1992).
16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with
cytoplasmic incompatibility in insects. Proc Natl Acad Sci U S A 89, 2699-2702.

Ogawa, M., and Sasakawa, C. (2006). Bacterial evasion of the autophagic defense
system. Curr Opin Microbiol 9, 62-68.

Ogawa, M., Yoshimori, T., Suzuki, T., Sagara, H., Mizushima, N., and Sasakawa, C.
(2005). Escape of intracellular Shigella from autophagy. Science 307, 727-731.

Orvedahl, A., Alexander, D., Talloczy, Z., Sun, Q., Wei, Y., Zhang, W., Burns, D.,
Leib, D. A., and Levine, B. (2007). HSV-1 ICP34.5 confers neurovirulence by
targeting the Beclin 1 autophagy protein. Cell Host Microbe 1, 23-35.

Osterwalder, T., Yoon, K. S., White, B. H., and Keshishian, H. (2001). A conditional
tissue-specific transgene expression system using inducible GAL4. Proc Natl Acad
Sci U S A 98, 12596-12601.

Palchevskiy, V., and Finkel, S. E. (2006). Escherichia coli competence gene
homologs are essential for competitive fitness and the use of DNA as a nutrient. J
Bacteriol 188, 3902-3910.

Palladino, M. J., Keegan, L. P., O'Connell, M. A., and Reenan, R. A. (2000). A-to-I
pre-mRNA editing in Drosophila is primarily involved in adult nervous system
function and integrity. Cell 102, 437-449.

Paludan, C., Schmid, D., Landthaler, M., Vockerodt, M., Kube, D., Tuschl, T., and
Munz, C. (2005). Endogenous MHC class II processing of a viral nuclear antigen
after autophagy. Science 307, 593-596.

122
Parkes, T. L., Elia, A. J., Dickinson, D., Hilliker, A. J., Phillips, J. P., and Boulianne,
G. L. (1998). Extension of Drosophila lifespan by overexpression of human SOD1 in
motorneurons. Nat Genet 19, 171-174.

Peng, J., Zipperlen, P., and Kubli, E. (2005). Drosophila sex-peptide stimulates
female innate immune system after mating via the Toll and Imd pathways. Curr Biol
15, 1690-1694.

Pizarro-Cerda, J., Meresse, S., Parton, R. G., van der Goot, G., Sola-Landa, A.,
Lopez-Goni, I., Moreno, E., and Gorvel, J. P. (1998). Brucella abortus transits
through the autophagic pathway and replicates in the endoplasmic reticulum of
nonprofessional phagocytes. Infect Immun 66, 5711-5724.

Pletcher, S. D., Macdonald, S. J., Marguerie, R., Certa, U., Stearns, S. C., Goldstein,
D. B., and Partridge, L. (2002). Genome-wide transcript profiles in aging and
calorically restricted Drosophila melanogaster. Curr Biol 12, 712-723.

Pua, H. H., Dzhagalov, I., Chuck, M., Mizushima, N., and He, Y. W. (2007). A
critical role for the autophagy gene Atg5 in T cell survival and proliferation. J Exp
Med 204, 25-31.

Ramsden, S., Cheung, Y. Y., and Seroude, L. (2008). Functional analysis of the
Drosophila immune response during aging. Aging Cell 7, 225-236.

RDevelopmentCoreTeam (2006). R: A language and environment for statistical
computing. (R Foundation for Statistical Computing, Vienna, Austria).

Reid, G., and Burton, J. (2002). Use of Lactobacillus to prevent infection by
pathogenic bacteria. Microbes Infect 4, 319-324.

Reith, W., and Mach, B. (2001). The bare lymphocyte syndrome and the regulation
of MHC expression. Annu Rev Immunol 19, 331-373.

Rembacken, B. J., Snelling, A. M., Hawkey, P. M., Chalmers, D. M., and Axon, A. T.
(1999). Non-pathogenic Escherichia coli versus mesalazine for the treatment of
ulcerative colitis: a randomised trial. Lancet 354, 635-639.

Ren, C., Webster, P., Finkel, S. E., and Tower, J. (2007). Increased internal and
external bacterial load during Drosophila aging without life-span trade-off. Cell
Metab 6, 144-152.

123

Reyniers, J. A., and Sacksteder, M. R. (1958). Apparatus and method for shipping
germ-free and disease-free animals via public transportation. Appl Microbiol 6,
146-152.

Rich, K. A., Burkett, C., and Webster, P. (2003). Cytoplasmic bacteria can be targets
for autophagy. Cell Microbiol 5, 455-468.

Rodriguez-Enriquez, S., He, L., and Lemasters, J. J. (2004). Role of mitochondrial
permeability transition pores in mitochondrial autophagy. Int J Biochem Cell Biol 36,
2463-2472.

Rogina, B., Helfand, S. L., and Frankel, S. (2002). Longevity regulation by
Drosophila Rpd3 deacetylase and caloric restriction. Science 298, 1745.

Roignant, J. Y., Carre, C., Mugat, B., Szymczak, D., Lepesant, J. A., and
Antoniewski, C. (2003). Absence of transitive and systemic pathways allows
cell-specific and isoform-specific RNAi in Drosophila. Rna 9, 299-308.

Roman, G., Endo, K., Zong, L., and Davis, R. L. (2001). P[Switch], a system for
spatial and temporal control of gene expression in Drosophila melanogaster. Proc
Natl Acad Sci U S A 98, 12602-12607.

Rorth, P., Szabo, K., Bailey, A., Laverty, T., Rehm, J., Rubin, G. M., Weigmann, K.,
Milan, M., Benes, V., Ansorge, W., and Cohen, S. M. (1998). Systematic
gain-of-function genetics in Drosophila. Development 125, 1049-1057.

Ruan, H., Tang, X. D., Chen, M. L., Joiner, M. L., Sun, G., Brot, N., Weissbach, H.,
Heinemann, S. H., Iverson, L., Wu, C. F., and Hoshi, T. (2002). High-quality life
extension by the enzyme peptide methionine sulfoxide reductase. Proc Natl Acad Sci
U S A 99, 2748-2753.

Ryu, J. H., Ha, E. M., Oh, C. T., Seol, J. H., Brey, P. T., Jin, I., Lee, D. G., Kim, J.,
Lee, D., and Lee, W. J. (2006). An essential complementary role of NF-kappaB
pathway to microbicidal oxidants in Drosophila gut immunity. Embo J 25,
3693-3701.

Sarkar, S., Krishna, G., Imarisio, S., Saiki, S., O'Kane, C. J., and Rubinsztein, D. C.
(2008). A rational mechanism for combination treatment of Huntington's disease
using lithium and rapamycin. Hum Mol Genet 17, 170-178.

124

Schmid, D., and Munz, C. (2007). Innate and adaptive immunity through autophagy.
Immunity 27, 11-21.

Scott, R. C., Schuldiner, O., and Neufeld, T. P. (2004). Role and regulation of
starvation-induced autophagy in the Drosophila fat body. Dev Cell 7, 167-178.

Shen, H., Rogelj, S., and Kieft, T. L. (2006). Sensitive, real-time PCR detects
low-levels of contamination by Legionella pneumophila in commercial reagents.
Mol Cell Probes 20, 147-153.

Simonsen, A., Cumming, R. C., Brech, A., Isakson, P., Schubert, D. R., and Finley, K.
D. (2008). Promoting basal levels of autophagy in the nervous system enhances
longevity and oxidant resistance in adult Drosophila. Autophagy 4, 176-184.

Singh, V., and Aballay, A. (2006). Heat shock and genetic activation of HSF-1
enhance immunity to bacteria. Cell Cycle 5, 2443-2446.

Skovhus, T. L., Ramsing, N. B., Holmstrom, C., Kjelleberg, S., and Dahllof, I.
(2004). Real-time quantitative PCR for assessment of abundance of
Pseudoalteromonas species in marine samples. Appl Environ Microbiol 70,
2373-2382.

Soderhall, K., and Cerenius, L. (1998). Role of the prophenoloxidase-activating
system in invertebrate immunity. Curr Opin Immunol 10, 23-28.

Sohal, R. S., Mockett, R. J., and Orr, W. C. (2000). Current issues concerning the
role of oxidative stress in aging: a perspective. Results Probl Cell Differ 29, 45-66.

Sun, J., Molitor, J., and Tower, J. (2004). Effects of simultaneous over-expression of
Cu/ZnSOD and MnSOD on Drosophila melanogaster life span. Mech Ageing Dev
125, 341-349.

Tanida, I., Ueno, T., and Kominami, E. (2008). LC3 and Autophagy. Methods Mol
Biol 445, 77-88.

Tatar, M., Kopelman, A., Epstein, D., Tu, M. P., Yin, C. M., and Garofalo, R. S.
(2001). A mutant Drosophila insulin receptor homolog that extends life-span and
impairs neuroendocrine function. Science 292, 107-110.

125
Toth, M. L., Sigmond, T., Borsos, E., Barna, J., Erdelyi, P., Takacs-Vellai, K., Orosz,
L., Kovacs, A. L., Csikos, G., Sass, M., and Vellai, T. (2008). Longevity pathways
converge on autophagy genes to regulate life span in caenorhabditis elegans.
Autophagy 4, 330-338.

Tower, J. (2000). Transgenic methods for increasing Drosophila life span. Mech
Ageing Dev 118, 1-14.

Tu, M. P., Epstein, D., and Tatar, M. (2002). The demography of slow aging in male
and female Drosophila mutant for the insulin-receptor substrate homologue chico.
Aging Cell 1, 75-80.

Tzou, P., Ohresser, S., Ferrandon, D., Capovilla, M., Reichhart, J. M., Lemaitre, B.,
Hoffmann, J. A., and Imler, J. L. (2000). Tissue-specific inducible expression of
antimicrobial peptide genes in Drosophila surface epithelia. Immunity 13, 737-748.

van den Berg, M. C., Woerlee, J. Z., Ma, H., and May, R. C. (2006). Sex-dependent
resistance to the pathogenic fungus Cryptococcus neoformans. Genetics 173,
677-683.

Virtanen, J., Uusitalo, H., Palkama, A., and Kaufman, H. (1984). The effect of
fixation on corneal endothelial cell dimensions and morphology in scanning electron
microscopy. Acta Ophthalmol (Copenh) 62, 577-585.

Wagenlehner, F. M., Naber, K. G., and Weidner, W. (2005). Asymptomatic
bacteriuria in elderly patients: significance and implications for treatment. Drugs
Aging 22, 801-807.

Wang, R. H., Li, C., Xu, X., Zheng, Y ., Xiao, C., Zerfas, P., Cooperman, S., Eckhaus,
M., Rouault, T., Mishra, L., and Deng, C. X. (2005). A role of SMAD4 in iron
metabolism through the positive regulation of hepcidin expression. Cell Metab 2,
399-409.

Weisburg, W. G., Barns, S. M., Pelletier, D. A., and Lane, D. J. (1991). 16S
ribosomal DNA amplification for phylogenetic study. J Bacteriol 173, 697-703.

Wolff, S., and Dillin, A. (2006). The trifecta of aging in Caenorhabditis elegans. Exp
Gerontol 41, 894-903.

126
Zerofsky, M., Harel, E., Silverman, N., and Tatar, M. (2005). Aging of the innate
immune response in Drosophila melanogaster. Aging Cell 4, 103-108

Abstract (if available)

Abstract Aging is a complicated process which is affected by many factors. Here we want to check what bacteria are associated with the fruit fly Drosophila melanogaster and how the bacteria affect the fly life span. Microbial load was quantified inside the body and on the surface of adult flies. Both aerobic and anaerobic bacterial load increased dramatically during aging in both compartments. Structures resembling abundant small bacteria and bacterial biofilms were visualized on the surface of old flies by scanning electron microscopy and cell staining. Bacteria cultured from laboratory flies included aerobic species Acetobacter aceti, Acetobacter tropicalis, Acetobacter pasteurianus and anaerobic Lactobacillus plantarum and Lactobacillus MR-2. Additional species Lactobacillus homohiochii, Lactobacillus fructivorans and Lactobacillus brevis were identified by DNA sequencing. Bacterial load and anti-microbial-peptide gene expression were reduced or eliminated using axenic culture conditions and antibiotics, however life span was unaffected. The data demonstrate that Drosophila can tolerate a significant internal and external bacterial load and mount a large innate immune response without a detectable trade-off with life span, and suggest that microbes do not limit life span in the optimized laboratory assay.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Sex-specific effects of drosophila p53 on adult life span

PDF

Transgenic biomarkers of aging in drosophila melanogaster

PDF

Molecular and genomic studies of sex determination in Drosophila

PDF

Microbial ecology in the deep terrestrial biosphere: a geochemical, metagenomic and culture-based approach

PDF

Biological interactions on the behavioral, genomic, and ecological scale: investigating patterns in Drosophila melanogaster of the southeast United States and Caribbean islands

PDF

Computational approaches to identify genetic regulators of aging and late-life mortality

Asset Metadata

Creator Ren, Chunli (author)

Core Title The effect of microbial load and autophagy on drosophila immunity and life span

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Molecular Biology

Publication Date 11/25/2008

Defense Date 09/04/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag aging,autophagy,bacteria,fruit fly,immunity,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Tower, John (committee chair), Aparicio, Oscar Martin (committee member), Arbeitman, Michelle (committee member), Finkel, Steven E. (committee member), McMillan, Minnie (committee member)

Creator Email cren@usc.edu,erchunli@yahoo.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1825

Unique identifier UC1150631

Identifier etd-Ren-2344 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-131905 (legacy record id),usctheses-m1825 (legacy record id)

Legacy Identifier etd-Ren-2344.pdf

Dmrecord 131905

Document Type Dissertation

Rights Ren, Chunli

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu