University of Southern California Dissertations and Theses

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

(USC Thesis Other)

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

The Role of Envelope Protein in SARS-CoV-2 Evasion of CD1d Antigen
Presentation Pathway

By
Zhewei Liu
A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
Molecular Microbiology and Immunology

August 2021

Copyright 2021 Zhewei Liu
ii
Acknowledgments

I would like to take this opportunity to express my sincere gratitude to all those
who give me support and guidance through my two-year graduate study at the
University of Southern California.
I would especially like to express my gratitude to Dr. Weiming Yuan for his
mentoring and support of my Master’s study and research. His kindness, patience, and
enthusiasm inspired me not only to become a better researcher but also to become a
better man.
I would also like to thank the rest of my master thesis committee members: Dr.
Pinghui Feng and Dr. Stanley Tahara for insightful suggestions, encouragement, and
guidance.
In a nutshell, I would love to thank my colleagues in Dr. Weiming Yuan’s Lab,
Siyang Chen, Hongjia Lu, Ruiting Zhou, Rongqi Zhao, and Amarjot Thind for their
assistance and support, and also the Department of Molecular Microbiology and
Immunology for this great opportunity and program. Finally, I would like to thank Dr.
Axel Schönthal and Monica Pan for their kindness and support.

iii
Table of Contents
Acknowledgments ..................................................................................................................................... ii
Abbreviations .............................................................................................................................................. v
List of Figures and Tables ..................................................................................................................... vi
Abstract ...................................................................................................................................................... vii
I. Introduction ........................................................................................................................................ 1
1. NKT cells and CD1d presentation .......................................................................................................... 1
2. COVID-19 and SARS-CoV-2 Virus ............................................................................................................ 3
3. Viroporin ........................................................................................................................................................ 7
4. Importance of SARS-CoV E protein ........................................................................................................ 8
II. Materials and Methods ................................................................................................................. 10
1. Cell lines and plasmids ........................................................................................................................... 10
2.Antibodies and inhibitors ...................................................................................................................... 10
3.Transient Transfection ........................................................................................................................... 11
4. Cell lysis and immunoprecipitation assay ....................................................................................... 12
5. Western blotting ....................................................................................................................................... 13
6. Flow cytometry ......................................................................................................................................... 14
7. Immunofluorescence .............................................................................................................................. 15
8. Cloning ......................................................................................................................................................... 16
Primer Table .................................................................................................................................................. 17
Template Sequences Table ........................................................................................................................ 19
III. Results .................................................................................................................................................. 20
1. SARS-CoV-2 envelope protein and Membrane protein interactions do not abolish the
APC surface CD1d expression downregulation phenotype. ........................................................... 20
2. Interactions between CD1d molecule and SARS-CoV-2 envelope protein ............................ 22
3. SARS-CoV-2 envelope protein Transmembrane domain is necessary and sufficient to
downregulate APC surface CD1d expression ...................................................................................... 23
4.SARS-CoV-2 envelope protein ion-channel function plays an important role in
downregulating APC surface CD1d expression .................................................................................. 25
5.SARS-CoV-2 envelope protein cellular localization ....................................................................... 27
IV. Discussion .......................................................................................................................................... 29
iv
References .................................................................................................................................................. 32
Figures ........................................................................................................................................................ 39

v
Abbreviations

AA Amino Acid
APC Antigen-presenting Cell
CD Cluster of Differentiation
CD1d Cluster of Differentiation 1 (Class D)
DMEM Dulbecco's Modified Eagle Medium
dPBS Dulbecco's Modified Phosphate Buffer Saline
IgG Immunoglobulin G
iNKT Invariant Natural Killer T
nsp non-structure protein
ORF Open reading frame
PBS Phosphate Buffer Saline
PAGE Polyacrylamide gel electrophoresis
PEI polyethyleneimine
PS permeabilization solution
SARS-CoV-2 E SARS-CoV-2 Envelope protein
SARS-CoV-2 N SARS-CoV-2 Nucleocapsid protein
SARS-CoV-2 S SARS-CoV-2 Spike protein
SARS-CoV-2 M SARS-CoV-2 Membrane protein
SDS Sodium dodecyl sulfate
β2m beta 2-Microglobulin

vi
List of Figures and Tables

Figure 1. SARS-CoV-2 envelope protein and Membrane protein interaction does not
affect the APC surface CD1d expression, downregulation phenotype. 39
Figure 2. Detergent Test. 40
Figure 3. Interactions between CD1d molecule and SARS-CoV-2 envelope protein. 40
Figure 4. SARS-CoV-2 envelope protein Transmembrane domain is necessary and
sufficient to downregulate APC surface CD1d expression. 41
Figure 5. SARS-CoV-2 C-terminal expression. 42
Figure 6. The Co-immunoprecipitation for the E Transmembrane domain shows the
Transmembrane domain has interaction with the CD1d molecule. 42
Figure 7. Time-course transfection study. 43
Figure 8. Time-course transfection study. 44
Figure 9. SARS-CoV-2 envelope protein ion-channel function plays an important role in
downregulating APC surface CD1d expression. 45
Figure 10. SARS-CoV-2 envelope protein ion-channel function plays an important role
in downregulating APC surface CD1d expression. 46
Figure 11. Ion-channel inhibitor treatment result. 47
Figure 12. SARS-CoV-2 envelope protein localization in the cells. 48
Primer Table 17
Template Sequences Table 19

vii

Abstract
The COVID-19 pandemic has caused a tremendous loss in human life all around
the world. COVID-19 disease is caused by the severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2). Understanding the exact mechanisms of viral
pathogenesis is imperative to design effective antiviral treatments. During viral
pathogenesis, evading and suppressing the human innate immune system is one of the
most prominent features of this potentially deadly virus. CD1d-restricted NKT cells are
one subset of the innate-like T cells that play critical roles in early viral pathogenesis.
Very little is known how SARS-CoV-2 interacts with this important group of T cells. Our
lab has recently discovered that the SARS-CoV-2 envelope (E) protein downregulates
surface CD1d expression level in antigen-presenting cells. This study endeavored to
elucidate the molecular mechanism of E protein-mediated CD1d downregulation. By
using immunoprecipitation with specific antibodies, we demonstrated E protein
specifically decreased the level of the mature form of CD1d. The CD1d-downregulation
function was mapped to the transmembrane (TM) domain of E protein. The TM domain
alone is sufficient for downregulating CD1d. E proteins of SARS coronaviruses possess
ion channel function via their TM domains. We generated point mutations that abolished
the ion channel function. Interestingly, the E protein mutants lacking ion channel
function do not downregulate CD1d expression, suggesting that SARS-CoV-2 E protein
leads to CD1d degradation through its ion channel function. More studies are needed to
elucidate the exact mechanism how the E protein ion channel exerts this function. Our
viii
investigations demonstrated a novel immune evasion function of SARS-CoV-2 E protein
targeting NKT cell function.
1
I. Introduction

1. NKT cells and CD1d presentation

Natural Killer T cells (NKT) are T lymphocytes that express both innate and
adaptive immune cell surface markers (Bendelac et al., 2007). Among the NKT cell
population, the invariant NKT cell type is the best-characterized subset. A CD1d-
restricted T cell receptor is expressed on the surface of iNKT cells. The Vα24Jα18 type
associates with Vβ11 in the human, and the mouse Vα14Jα18 pairs with Vβ8.2, 7, and
2 (Godfrey et al., 2010).

There are many ways to activate the iNKT cells by microbial infection. First, the
CD1d can present endogenous or exogenous lipid antigens to iNKT cells. CD1d
proteins act as antigen-presenting molecules that present lipid antigens to the iNKT
cells. CD1d presents lipid antigens to other CD1d-restricted iNKT cells during the
infection, which further activates the downstream innate and adaptive immune
response. Second, many different cytokines can directly or indirectly activate iNKT cells
like IL-12, IL-18, type I, and II interferons (Cohen et al., 2009). Throughout the
evolutionary history, microorganisms have evolved numerous mechanisms to avoid
detection and evade both innate and adaptive immune systems (Tessmer et al., 2008).
The activation of innate and adaptive immune responses points out that iNKT cells can
modulate the host immune response to infectious agents. Furthermore, CD1d-restricted
2
iNKT cells express various effector molecules that enable the iNKT cells to directly
regulate the antimicrobial activity (Skold et al., 2003). In the mouse, the NKT cells are
found in most lymphatic tissues like the spleen, thymus, and pancreatic lymph nodes,
which usually comprise about 2.5% of the total T cell population. However, in the liver,
NKT cells are more numerous and represent 30% of this T cell population; NKT cells
reside primarily within the liver sinusoids (Bendelac et al., 2007). Other viruses, such as
HSV-1 have developed mechanisms to interfere with CD1d trafficking in the cell,
reducing the CD1d surface expression on APC (Yuan et al., 2006). Notably in COVID-
19 hospitalized patients, most of their immune cells are dysregulated by SARS-CoV-2
virus. The NKT cells are also downregulated in both mild and severely ill patients (Odak
et al., 2020).

CD1d molecules are commonly found on the surface of the antigen-presenting
cells such as dendritic cells, B cells, and macrophages. When encountering foreign
pathogens like bacteria, the APC will engulf the pathogen, and CD1d will load the
glycolipid antigen from the pathogen in the late endosome and lysosome (Barral &
Brenner, 2007). CD1d is a Type I transmembrane protein composed of an ectodomain,
a transmembrane domain and a short cytoplasmic tail. The ectodomain consists of α1,
α2, and α3 domains. The anti-parallell arranged α-helical structures on the β-sheets
from α1 and α2 domains form the antigen-binding site. The α3 domain connects the
antigen-binding site to the transmembrane site that is linked to the cytoplasmic tail.
Also, α3 domains interact noncovalently with β2m which is the signature of the mature
CD1d molecule (Zeng et al., 1997).
3

CD1d is a crucial part of the iNKT cell activation process. The reduction in CD1d
surface expression on APC can seriously affect iNKT cell activation (Yuan et al., 2006).
The synthesis and expression pathway of the CD1d molecule is similar to that of the
MHC class I molecule. After the synthesis of CD1d, its signal peptide directs the CD1d
molecule to the endoplasmic reticulum. In the ER, CD1d molecules are folded,
glycosylated, and assembled with β2m by the lectin-like ER chaperone calnexin (Kang
et al., 2002). After assembling with β2m, CD1d is loaded with self-lipid antigens by ER-
resident lipid transfer protein (Microsomal triglyceride transfer protein, MTP) and then
transferred to the cell membrane through the trans-Golgi network (Dougan et al., 2005).
CD1d loaded with endogenous lipids interacts with adaptor protein 2 to enter into the
early endosome to become exposed on the cell surface. Adaptor protein 3 helps CD1d
move into the late endosome or lysosome. In the late endosome/lysosome, the CD1d
molecules unload endogenous lipids and load exogenous lipid antigens. Finally, the
CD1d molecules with foreign antigens are recycled to the cell surface and presented to
the iNKT cells (Shin & Park, 2014).

2. COVID-19 and SARS-CoV-2 Virus

COVID-19 disease is caused by the severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2). This virus was first identified in Wuhan, China, in late
December 2019 (Lu et al., 2020). On January 30th, 2020, the World Health
4
Organization announced COVID-19 as the sixth public health emergency of
international concern (Jee, 2020). The common symptoms of COVID-19 are fever,
cough, dyspnea, myalgia, headache, and diarrhea. Patients with COVID-19 usually start
with mild symptoms, although some patients show asymptomatic infection (Lai et al.,
2020). The overall fatality rate of COVID-19 is around 3%. To treat COVID-19 more
efficiently and save lives, it is critical to understand the immune evasion mechanism of
the SARS-CoV-2 virus.

Like most coronaviruses, SARS-CoV-2 is an enveloped, positive single-stranded
RNA virus containing a ~30 kb RNA genome. The genome contains a 5’-cap and a 3’
poly-A tail structure. SARS-CoV-2 belongs to the betacoronaviridae, which also includes
SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV). The life
cycle of SARS-CoV-2 starts with entry of the virus. Following entry, the SARS-CoV-2’s
genomic RNA starts translation of ORF1a and ORF1ab to produce a total of 15 non-
structural proteins (V’kovski et al., 2021). After the translation of ORF1a, a -1 frameshift
occurs at upstream of the stop codon to ensure the continued translation of ORF1ab.
The viral protease nsp3 and nsp5 participate in the cleavage of the viral polyprotein
(Kim et al., 2020). The non-structure proteins form viral replication organelles, including
double-membrane vesicles, convoluted membranes, and small open double-membrane
spherules. All these structures create a microenvironment for the viral subgenomic
mRNA translation which include four main structural proteins (V’kovski et al., 2021).
Among all SARS-CoV-2 viral genomes, two-thirds of the viral genome encodes non-
structural proteins, one-third of the viral genome encodes structural proteins. SARS-
5
CoV-2 has four main structural proteins, Spike protein (S), membrane protein (M),
nucleocapsid protein (N), and envelope protein (E).

Spike proteins are responsible for the “crown” appearance of the coronavirus.
Each virus has an average of 74 spikes. Each spike consists of a spike protein trimer.
Therefore, there are about 222 spike proteins per virion (Tay et al., 2020). Spike
proteins have two subunits, S1 and S2. The S1 subunit of S protein contains a receptor-
binding domain (RBD) that can bind to the ACE2 receptor on the host cell. The binding
of RBD to ACE2 initiates endocytosis of SARS-CoV-2 virion; simultaneously, the virion
becomes exposed to the endosomal proteases (Tay et al., 2020).

Membrane proteins play an essential role in the virion assembly between the ER
and Golgi-complex. The structure of CoV M proteins has a long cytoplasmic tail followed
by three transmembrane segments and a short N-terminal site. The M protein holds the
spike protein on the outside; on the inside, M protein binds to the nucleocapsid protein
core (Neuman et al., 2010).

As one of the crucial antigens, SARS-CoV-2 nucleocapsid proteins participate in
viral RNA packing. N proteins have two RNA binding sites, the N-terminal domain (NTD)
and the C-terminal domain (CTD). These two RNA binding domains are linked by the
linkage region (LKR), a serine/arginine-rich domain (Zeng et al., 2020). As NTD and
CTD bind to the RNA, LKR shows an important oligomerization function. However, more
6
study is needed to unravel the molecular properties of the SARS-CoV-2 N protein (Zeng
et al., 2020).

SARS-CoV-2 envelope protein is a minor protein of the four SARS-CoV-2 viral
structural proteins. The E protein is also the least studied protein and is highly
conserved in the different viral subtypes (Mukherjee, Bhattacharyya & Bhunia, 2020).
The SARS-CoV-2 envelope protein has a short N-terminal tail followed by a
transmembrane domain and a long cytoplasmic tail. The SARS-CoV-2 E protein has 75
amino acids, and about 50% of amino acids make up the C-terminal tail. Although most
coronavirus viral proteins show significant differences between coronavirus subtypes, E
protein remains the most conserved coronavirus structural protein among these viral
subtypes. The similarity of E protein between SARS-CoV and SARS-CoV 2 reaches
95% (Mukherjee, Bhattacharyya & Bhunia, 2020). More incredibly, the SARS-CoV and
SARS-CoV-2 viral E proteins share the same transmembrane domain sequence. This
points out that the E protein function of SARS-CoV and SARS-CoV-2 may be highly
conserved.

After their synthesis, the E and M proteins will co-localize to the ER. The
interaction between viral E protein and M protein is the most well-studied and
characterized protein-protein interaction in the virion assembly process. The expression
and interaction between E protein and M protein are sufficient for viral-like particle (VLP)
formation (Schoeman, Fielding, 2019). This meaningful protein-protein interaction
occurs in the endoplasmic-reticulum-Golgi intermediate compartment (ERGIC) through
7
the long C-terminal tails of E and M protein. The necessity of this interaction for viral life
cycle was tested by the significant reduction of VLP formation by deletion of C-terminal
domains of E and M protein (Schoeman, Fielding, 2019). Other studies show, E protein
sequence mutations can increase host cell apoptosis (Parthasarathy, 2008).

3. Viroporin

In general, virus infection, especially for RNA viruses, usually modulates the
host’s cellular ion balance. Therefore, more and more viroporins have been identified
(Nieva et al., 2012). Viroporin is the term for viral proteins that can alter the host
membrane and facilitate viral particle release by forming ion channels or pores in the
host’s plasma membrane. Viroporins are more commonly found in RNA viruses. Some
well-studied viroporins include poliovirus 2B, alphavirus 6K, HIV-1 Vpu, and influenza
virus M2 (Gonzalez & Carrasco, 2003). These studies show that viroporins can affect
cell homeostasis and cell metabolism through changes in the protein-protein
interactions with host cell proteins. Viroporins are unnecessary for viral replication, but
the lack of viroporin activities can significantly reduce viral replication rate (Gonzalez &
Carrasco, 2003).

SARS-CoV-2 has three viroporins, E, ORF3a, and ORF8a, all of which can self-
assemble into oligomers and develop ion-channel activity. A recent study shows that the
SARS-CoV E protein shows more significant ion-channel activity than ORF3a and
8
ORF8a (Kern et al., 2020). Viral pathogenicity can be severely impacted by blocking the
E protein ion-channel activity (Nieto-Torres et al., 2014). It has been pointed out that
chemically synthesized SARS-CoV E protein, which has been reassembled in the
membrane, and is known to simulate ERGIC charge and composition and shows a
preference for cations rather than anions (Verdiá-Báguena et al., 2013).

4. Importance of SARS-CoV E protein

According to previous studies, the ion-channel activity of SARS-CoV E protein is
created by an a-helical bundle formed by oligomerization its transmembrane domain in
the host membrane (Torres et al., 2006). Both SARS-CoV and SARS-CoV-2 E protein
show viroporin activity, and the two proteins have 95% identity in amino acid sequences
(Mukherjee, Bhattacharyya & Bhunia, 2020). More interestingly, the amino sequence of
the SARS-CoV and SARS-CoV-2 E protein transmembrane domains are identical. Also,
the SARS-CoV-2 ETM oligomerizes in the host membrane (Barrantes, 2021). The
sequence data shows that SARS-CoV-2 protein shares many similarities with SARS-
CoV E protein, and according to recent research, the SARS-CoV-2 E protein shows a
similar ion-channel function like SARS-CoV E protein (Alam et al., 2020).

Previous research has reported that the V25F and N15A mutations in the SARS-
CoV E protein transmembrane region could lead to the loss of ion-channel activity
(Verdiá-Báguena et al., 2012). In the experiment, the researcher used Vero E6 cells,
9
and mouse DBT-mACE2 cells infected with rSARS-CoV-N15A, rSARS-CoV-V25F, and
wild-type SARS-CoV. All three viruses could replicate and grow in cell culture, which
points out the ion-channel function is nonessential for the SARS-CoV replication and
growth (Nieto-Torres et al., 2014). However, both the N15A and V25F mutant viruses
show smaller plaques than the wild-type virus. In another experiment, the researcher
infected Vero E6 cells with N15A point mutant SARS-CoV virus and wild-type SARS-
CoV virus simultaneously. After 20 viral passages, the sequence result shows the wild-
type virus population steadily increases over each passage, which indicates the E
protein ion-channel function can improve viral fitness. Nevertheless, the virus with
malfunctioning E protein tends to regain ion-channel activity through compensatory
mutations (Nieto-Torres et al., 2014). After serial infection in mice and testing for ion
conductance, N15D, V25L, V25F-L19A, V25F-F26C, V25F-L27S, V25F-T30I, and
V25F-L37R amino acid replacements showed restored ion-channel function (Nieto-
Torres et al., 2014).

This study targeted the molecular basis of SARS-CoV-2 virus immune evasion,
especially the targeting of NKT cells through the downregulation of CD1d presentation
in the antigen-presenting cells. After the screening of SARS-CoV-2 viral proteome
through flow cytometry analysis, the SARS-CoV-2 E protein was found responsible for
the CD1d downregulation. The molecular mechanism of SARS-CoV-2 E protein-induced
CD1d dysregulation is investigated in the current study.

10
II. Materials and Methods

1. Cell lines and plasmids

293T.CD1d cell line and HeLa.CD1d cell line were used in this study (provided
by Dr. Weiming Yuan). These two cell lines were designed to stably express CD1d
molecules by lentiviral transduction. 293T.CD1d cell line was cultured with Dulbecco’s
Modified Eagle Medium (Corning) with 5% Fetal Bovine Serum (FBS) (HyClone) and
0.05% puromycin. Puromycin was used to select and maintain CD1d positive cells.
HeLa.CD1d cell line was grown in Dulbecco’s Modified Eagle Medium (Corning) with
5% Fetal Bovine Serum (FBS) (HyClone) and 100 µg/ml of Penicillin-Streptomycin
(Genesee Scientific) antibiotics.
pTracer plasmid (provided by Dr. Weiming Yuan) produces GFP in the cell and
was used as a transfection indicator. The Krogan Lab at UCSF kindly provided the
human codon-optimized SARS-CoV-2 envelope protein and membrane protein with
2XStrep-tagged plasmid (Gordon et al., 2020).
2.Antibodies and inhibitors

Primary antibodies: Monoclonal 51.1.3 (provided by Dr. Steven Porcelli at Albert
Einstein College of Medicine, Bronx, NY) was used to detect the expression of mature
11
human CD1d and β2m complexes. D5 was used to detect the CD1d heavy chain
(immature form). Grp94 antibody (rat monoclonal, Enzo) binds to GRP94 protein, which
was used as a loading control. SARS-CoV-2 viral proteins with 2XStrep tag were
detected with anti-Strep tag mouse monoclonal antibody (Biolegend).
Secondary antibodies: donkey anti-mouse IgG (H+L)(Jackson) and donkey anti-
rat IgG (Jackson) antibodies were used as secondary antibodies for western blot
analysis with 1:5000 dilution in the TBST buffer. PE goat anti-mouse polyclonal antibody
(Biolegend) was used to stain cell surface CD1d in FACS analysis with 1 μg/ml
concentration in PBS buffer. Alexa Fluor 488 goat anti-mouse IgG2b, Alexa Fluor 568
goat anti-mouse IgG1, and Alexa Fluor 647 goat anti-rabbit (Thermo Fisher) were used
in immunofluorescence assays.
Inhibitors: Chloroquine (Sigma) can inhibit the fusion of endosomes and
lysosomes and increase the PH of lysosomes. MG132 (Sigma) is a protease inhibitor.
Amantadine (Sigma) can inhibitor viroporin ion-channel activity (Influenza M2).

3.Transient Transfection

293 T CD1d or HeLa.CD1d cells were cultured in 10 cm tissue culture plates.
When the cell confluency reached 80-85%, the cells were transfected using the
polyethyleneimine (PEI) method (Kichler et al., 2001). When doing an inhibitor treatment
experiment, inhibitors were added after 24 hours of transfection. After 48 hours of
transfection, the cells were harvested. Cells were washed off the plate and centrifuged
12
at 290XRCF for 3 minutes. After centrifugation, the supernatant was discarded, and
cells were washed with PBS buffer and the final PBS supernatant was discarded. The
cells can be used for flow cytometry analysis or stored in a -20 ° C freezer.

4. Cell lysis and immunoprecipitation assay

Cell lysis buffer was freshly prepared for each use. The detergent composition of
the lysis buffer was varied. 1% CHAPS in Tris-buffered Saline buffer (TBS) was used in
this study unless otherwise indicated. In addition, 1% CHAPS, various protease
inhibitors were added into the lysis buffer, including 2 mM Indole-3-Acetic Acid (IAA),
0.1 mM PMSF, 1 mM NaVO3, Leupeptin, Pepstatin A, 1 mM NaF, 0.1 µM Okadaic acid,
1 mM β-glycerophosphate and 5 mM NaPP. For each 10 cm plate cell sample, 1 ml of
cell lysis buffer was added, and cells were dispersed by mixing with a pipet. The mixture
was left on ice for 45 minutes, mixed well after every 15 minutes of incubation. The cell
suspension was centrifuged at 1000 RCF, at 4° C for 10 minutes to spin down the
nuclei. After the centrifugation, 200 µl of supernatant was saved as whole-cell-lysate
sample and 800 µl was used for immunoprecipitation assay. To 200 µl supernatant of
whole-cell-lysate sample, 40 µl of 6X SDS loading buffer was added and heated in a 95°
C heating block for 2 minutes before storing at 4° C.
The immunoprecipitation assay has two steps: pre-clearing and
immunoprecipitation. For pre-clearing, 1 µl of normal rabbit serum with 40 µl:40 µl of
Sepharose 4B and protein G beads were added into samples. Then the sample was
13
rotated in a four-degree-Celsius fridge for an hour. After an hour, the supernatant was
collected by centrifugation at 4000 rpm for 1 minute and added to 1 µl of CD1d 51.1.3 or
D5 antibody with 40:40 mixture of Sepharose 4B and protein G beads. The sample was
rotated at 4° C overnight. The next day, the supernatant was saved for later use. The
beads were collected and washed three times with 0.1% CHAPS/TBS solution to
remove residual cell lysate. 80 µl of 2X SDS loading buffer was added to each IP
sample and boiled in a 95° C heating block for 2 minutes before storing at 4° C.

5. Western blotting

Western blotting was performed for different protein sizes using different gel
concentrations for SDS polyacrylamide gel electrophoresis. For SARS-CoV-2 E protein,
a 15% SDS gel was used for the assay. For CD1d protein, a 10% SDS gel was used for
the assay. Samples (20 µl) were loaded into individual gel wells; protein molecular
weight standards (Bio-Rad) were included for size comparisons. Gels were routinely run
at 80 V until the methylene blue dye front reached the bottom of the gel. For 15% gels,
electrophoresis was stopped before the methylene blue dye front ran off the gel.
Polyvinylidene Fluoride (PVDF) membrane (Bio-rad) was first activated by placing in
methanol. Proteins were transferred to the membrane using 0.12 A constant current for
90 min. Successfully transferred PVDF membranes showed visible protein markers.
Blocking of the PVDF membrane was done in 5% non-fat milk in TBST for at least 30
minutes. Afterwards the excess blocking solution was removed, and the membrane was
14
incubated with primary antibody (1:1000 in TBST) overnight at 4° C. The primary
antibody was collected for reuse. Washing of the PVDF membrane was performed
using three TBST 5-minute washes, followed by incubation with a secondary antibody
for one hour at room temperature. The secondary antibodies were discarded and the
PVDF membrane was washed three times with TBST. The antibody was visualized with
HRP based detection fluid (Genesee Scientific) briefly and imaged using the ChemiDoc
Imaging System (Bio-rad) for detection of chemiluminescence.

6. Flow cytometry

Cells were transduced with plasmids as described above. pTracer was included
to allow detection of transduced cells by their green color. For flow cytometry assay one
fifth of the cells from each 10 cm plate were used; the remaining cells were saved for
western blot analysis as described earlier. All intact cell staining was performed at 0-4°
C. Cells were washed with FACS buffer (1XdPBS with 0.5% BSA). Then 150 µl of
primary antibody 51.1.3 (5 μg/ml) was added and incubated for 30 minutes. Excess
primary antibody was removed by washing with FACS buffer three times. Secondary
antibody PE goat anti-mouse (1 μg/ml, 150 µl) was added and incubated for 30 minutes.
The incubation of secondary antibodies was performed in the dark, so all samples were
wrapped with aluminum foil. Excess secondary antibodies were removed by washing
with FACS buffer three times. Finally, 100 µl of 4% formaldehyde solution was added for
ten minutes to fix stained cells, and then add 300 µl dPBS to reach a final concentration
15
of 1% formaldehyde. The cells were resuspended in 1% formaldehyde/dPBS solution
for FACS analysis. The BD FACSCanto II Flow cytometer was used to analyze cell
samples. Finally, the FACS data were processed and interpreted with Flowjo software.

7. Immunofluorescence

The HeLa.CD1d cell line was used in this assay. These cells were seeded in 24
well-plates which had microscope coverslips at 20,000 cells per well. Transfected cells
expressed plasmid-encoded SARS-CoV-2 viral proteins. After 48 hours of transfection,
the cells were incubated in fixation solution (4% formaldehyde in DMEM with 10mM
HEPES: 500 µl/well) for 15 minutes at room temperature. Fixed cells were washed three
times with fresh DMEM media. Cells were permeabilized with 500 µl of permeabilization
solution (PS) added to each well and incubated at room temperature for 20 minutes.
Use of PS solution with purple color was avoided, which indicated the pH was not within
the proper range and would interfere with antibody binding. Primary antibody was
diluted in PS to 10 μg/ml for use. Ccell staining was performed in a humidified container:
20 µl drops of primary antibody was placed on parafilm and the coverslip was placed
(cell side down) on the antibody solution. The box was sealed with aluminum foil and
incubated for 30 minutes at room temperature. It was vital to maintain a moist
environment during the antibody incubation. After incubation the coverslips were
removed and washed three times with 500 µl of PS. This incubation process was
repeated for the secondary antibody.
16
Cover slips were mounted on glass microscope slides. Prior to mounting, 20%
Mowiol was preheated in a 95°C heating block. Before mounting, coverslips were
washed by dipping them into water and excess water was aspirated from the coverslips.
Mowiol (5 µl drops) was added to the microscope slide and coverslips were placed (cell
side down) on the Mowiol. The samples were covered with aluminum foil to avoid light
exposure. The samples were dried overnight at 4°C before viewing. Confocal
microscopy (Nikon) was used to visualize the samples. Confocal microscopy has four
laser channels, 405 nm, 488nm, 561nm, and 640 nm. The appropriate filter combination
was used to excite stained dyes.
Primary antibodies used: anti-CD1d 51.1.3 mouse IgG2b, anti-Strep tag mouse
IgG1, anti-ERGIC rabbit.
Secondary antibodies used: Alexa Fluor 488 goat anti-mouse IgG2b, Alexa Fluor
568 goat anti-mouse IgG1, Alexa Fluor 647 goat anti-rabbit.

8. Cloning

In this study, a total of 11 different mutants of SARS-CoV-2 envelope protein
were generated (figure 9A). The cloning process using PCR reaction with custom-
designed primers and SARS-CoV-2 E protein sequence encoded plasmids as the
template sequence. Amplified target sequences were then digested with restriction enzymes
(EcoRI & BamHI from New England BioLabs). Empty vector was also generated by restriction
enzyme digestion. After digestion, the digest underwent a gel purification process to isolate the
17
PCR product. The DNA was extracted by QIAquick Gel Extraction Kit (QIAGEN). T4 ligase
(New England BioLabs) was used to link the target DNA segment with the empty vector to
create target SARS-CoV-2 E protein mutant plasmids. One-shot Top-ten competent cells were
used to create a stable bacterial stock for newly made plasmids.

Primer Table
Primer
name
Sequence Sourc
e
purpos
e
E-TM-C-
lower
TCCATCCCCCGCCGCCTTCGAGCCTCAATGCAGTCAGAATT
GC
IDT Generate
TM only
or TM+N
E protein
mutants
E-TM-C-
Upper
GCAATTCTGACTGCATTGAGGCTCGAAGGCGGCGGGGGAT
GGA
IDT Generate
TM only
or TM+N
E protein
mutants
E-Del-N-
EcoRI
GGTGAATTCGCCGCCACCATGACCGGGACACTGATCGTAA
AT
IDT Generate
TM only
E protein
mutant
S2-E-N15A-
F
GAAACCGGGACACTGATCGTAGCCTCTGTGCTCTTGTTTCT
GG
IDT Generate
S-CoV-2
ETM-
N15A
mutant
S2-E-N15A-
R
CCAGAAACAAGAGCACAGAGGCTACGATCAGTGTCCCGGT
TTC
IDT Generate
S-CoV-2
ETM-
N15A
mutant
S2-E-V25F-
F
TCTTGTTTCTGGCATTCGTCTTCTTTCTCCTCGTCACACTGG
C
IDT Generate
S-CoV-2
ETM-
V25F
mutant
S2-E-V25F-
R
GCCAGTGTGACGAGGAGAAAGAAGACGAATGCCAGAAACA
AGA
IDT Generate
S-CoV-2
E-N15A-
V25F-TM
mutant
E-Del-N-
EcoRI-
N15A-V25F-
TM
GGTGAATTCGCCGCCACCATGACCGGGACACTGATCGTA IDT Generate
S-CoV-2
E-N15A-
18
V25F-TM
mutant
S2-E-N15D-
F
GAAACCGGGACACTGATCGTAGACTCTGTGCTCTTGTTTCT
GG
IDT Generate
S-CoV-2
ETM-
N15D
mutant

S2-E-N15D-
R
CCAGAAACAAGAGCACAGAGTCTACGATCAGTGTCCCGGTT
TC
IDT Generate
S-CoV-2
ETM-
N15D
mutant
S2-E-L19A-
F
CTGATCGTAAATTCTGTGCTCGCTTTTCTGGCATTCGTCGTA
TTT
IDT Generate
S-CoV-2
ETM-
V25FL19
A mutant
S2-E-L19A-
R
AAATACGACGAATGCCAGAAAAGCGAGCACAGAATTTACGA
TCAG
IDT Generate
S-CoV-2
ETM-
V25FL19
A mutant
S2-E-F26C-
F-Rev
TGTTTCTGGCATTCGTCTTCTGCCTCCTCGTCACACTGGCA
ATTCT
IDT Generate
S-CoV-2
ETM-
V25FF26
C mutant
S2-E-F26C-
R-Rev
AGAATTGCCAGTGTGACGAGGAGGCAGAAGACGAATGCCA
GAAACA
IDT Generate
S-CoV-2
ETM-
V25FF26
C mutant
S2-E-T30I-
F-Rev
CGTCTTCTTTCTCCTCGTCATTCTGGCAATTCTGACTGCAT IDT Generate
S-CoV-2
ETM-
V25FT30
I mutant
S2-E-T30I-
R-Rev
ATGCAGTCAGAATTGCCAGTGTGACGAGGAGAAAGAAGAC
G
IDT Generate
S-CoV-2
ETM-
V25FT30
I mutant
S2-E-L37R-
F-Rev-TM
CTGGCAATTCTGACTGCACGGAGGCTCGAAGGC IDT Generate
S-CoV-2
ETM-
V25FL37
R mutant
S2-E-L37R-
R-Rev-TM
GCCTTCGAGCCTCAATGCAGTCAGAATTGCCAG IDT Generate
S-CoV-2
ETM-
V25FL37
R mutant
S2-E-L27S-
F-Rev-2
TTCTGGCATTCGTCTTCTTTAGCCTCGTCACACTGGCAATTC
TG
IDT Generate
S-CoV-2
ETM-
19
V25FL27
S mutant
S2-E-L27S-
R-Rev-2
CAGAATTGCCAGTGTGACGAGGCTAAAGAAGACGAATGCCA
GAA
IDT Generate
S-CoV-2
ETM-
V25FL27
S mutant

Template Sequences Table

SARS-CoV-2
envelope with
2Xstrep tag
TGTACAGCTTCGTATCAGAAGAAACCGGGACACTGATCGTAAATTCTGTGCTCTT
GTTTCTGGCATTCGTCGTATTTCTCCTCGTCACACTGGCAATTCTGACTGCATTG
AGGCTTTGCGCCTACTGTTGTAACATTGTCAATGTATCTCTCGTGAAACCCTCAT
TCTACGTTTACAGCAGGGTGAAGAATCTCAATTCTAGCAGGGTGCCGGATCTCC
TCGTTCTCGAAGGCGGCGGGGGATGGAGCCATCCACAATTCGAGAAAGGCGGT
GGTTCAGGAGGAGGTAGCGGGGGTGGATCATGGTCACATCCGCAGTTTGAAAA
GTAAG
SARS-CoV-2
ETM with
2Xstrep tag
ACCGGGACACTGATCGTAAATTCTGTGCTCTTGTTTCTGGCATTCGTCGTATTTC
TCCTCGTCACACTGGCAATTCTGACTGCATTGAGGCTCGAAGGCGGCGGGGGA
TGGAGCCATCCACAATTCGAGAAAGGCGGTGGTTCAGGAGGAGGTAGCGGGGG
TGGATCATGGTCACATCCGCAGTTTGAAAAGTAAG

20
III. Results

1. SARS-CoV-2 envelope protein and Membrane protein
interactions do not abolish the APC surface CD1d expression
downregulation phenotype.

From the beginning of the COVID-19 pandemic, our lab started working on the
COVID-19 immune evasion strategy by focusing on the SARS-CoV-2 virus immune
evasion of NKT cells. Previous screening results from our lab showed the SARS-CoV-2
envelope protein was able to downregulate the CD1d surface expression on 293T.CD1d
cells, which can help the virus infection process by inhibiting iNKT activation.

SARS-CoV-2 is an enveloped positive single-stranded RNA virus containing
about 30 kb RNA genome, and its genome contains a 5’-cap and a 3’ poly-A tail
structures. The envelope protein is a short structural protein containing 75 amino acids
(Kim et al., 2020).

Dr. Weiming Yuan did the screening process of the effects of SARS-CoV-2
proteins on CD1d surface expression. He used 293T.CD1d cells and plasmids that
encoded SARS-CoV-2 viral proteins during the screening process. First, 293 T CD1d
cells were co-transfected with plasmids that encoded different SARS-CoV-2 proteins
21
and p-Tracer as a transfection indicator. After 48 hours of transfection, the cells were
collected and stained for cell surface CD1d with α-CD1d 51.1.3 (mouse IgG2b) antibody
as primary antibody then stained with PE-labeled goat anti-mouse antibody as the
secondary antibody. The cells were analyzed by flow cytometry which showed the
downregulation of CD1d expression on the positively transfected cells (GFP positive)
compared to untransfected cells (GFP negative). The expression of M protein itself does
not downregulate CD1d expression, confirming Dr. Yuan’s screening result. Further, the
immunoprecipitation and western blot analysis indicated the cellular expression level of
mature CD1d was downregulated as well.

This thesis project study successfully repeated the CD1d downregulation
phenotype in response to SARS-CoV-2 E protein (Figure 1A). M protein, one of the
major structural proteins of SARS-CoV-2, interacts with E protein during the virion
formation, and showed no effects on E protein’s downregulation of CD1d phenotype.
Flow cytometry and western blot analysis showed that the E protein transfected
samples and combined E and M proteins co-transfected samples still exhibited the
surface CD1d expression downregulation phenotype (Figure 1B), suggesting even in
infected cells where expression of both E and M proteins is high, the E protein still
downregulates CD1d.

22
2. Interactions between CD1d molecule and SARS-CoV-2
envelope protein

A co-immunoprecipitation experiment was performed to determine whether there
is an interaction between CD1d and SARS-CoV-2 E protein. There were two different
types of CD1d antibodies used that bind to different forms of CD1d molecule. A mouse
IgG2b isotype control was used in the co-immunoprecipitation experiment. α-CD1d
51.1.3 (mouse IgG2b) was used to recognize the CD1d and β2m molecule complex,
which is considered the mature form of CD1d. Only the mature form of CD1d is
expressed on the cell surface of APC (Kang et al., 2002). α-CD1d D5 (mouse IgG2b)
can bind directly to the free heavy chain of CD1d, which allows the D5 antibody to bind
to the precursor form of CD1d in the cell as shown after SDS treatment of cells followed
by 51.1.3 pull-down of CD1d (Zhu, 2010).

Protein-protein interaction is fragile and easily disrupted by the harsh detergent in
the cell lysis buffer. Therefore, a detergent test was performed to ensure the maximum
detection of protein-protein interaction. 293T.CD1d cells were transfected with SARS-
CoV-2 E protein-encoding plasmid. After 48 hours of transfection, the cells were
collected and lysed with 1% Triton-X-100, NP-40, CHAPS, or digitonin in Tris-buffered
saline with protease inhibitors. As a result, Triton-X-100 showed no SARS-CoV-2
envelope protein in CD1d 51.1.3 immunoprecipitation samples (Figure 2). After
consideration CHAPS was chosen as the detergent in further co-immunoprecipitation
experiments.
23

Co-immunoprecipitation was performed using α-CD1d 51.1.3 (mouse IgG2b), α-
CD1d D5 (mouse IgG2b), and mouse IgG2b isotype control. In the α-CD1d 51.1.3
antibody and the α-CD1d D5 antibody pull-down groups, both showed that the SARS-
CoV-2 E protein was also co-precipitated with the CD1d molecule during the
immunoprecipitation process. A background signal showed up in the isotype control
group, but the signal strength was significantly lower than both α-CD1d 51.1.3 antibody
and α-CD1d D5 antibody pull-down groups (p<0.05, Figure 3A&3B). SARS-CoV-2
envelope protein was co-precipitated with CD1d indicated there was an interaction
between envelope proteins and CD1d molecules.

3. SARS-CoV-2 envelope protein Transmembrane domain is
necessary and sufficient to downregulate APC surface CD1d
expression

Three deletion mutants were generated to examine which domain of SARS-CoV-
2 envelope protein is responsible for the downregulation of surface CD1d expression
(Figure 4A). As indicated in the figure, C-terminal only, transmembrane domain only,
and N-transmembrane domain only, were generated by using PCR reaction with
custom-designed primers and SARS-CoV-2 E protein sequence encoded plasmid as
the template sequence. The targeted DNA fragments from the PCR reaction were
ligated to pLVX-IRES-Puro vector to generate a plasmid that encoded the target SARS-
24
CoV-2 envelope protein deletion mutants. Later, 293 T CD1d cells were used for
transfection by these plasmids. Flow cytometry and Western blot analysis were used to
examine the CD1d expression level change in the 293T.CD1d cells. As a result, the flow
cytometry data indicated the SARS-CoV-2 E Transmembrane domain (ETM) and N-
Transmembrane domain (N-ETM) showed a similar effect as wild-type SARS-CoV-2 E
protein. The SARS-CoV-2 E C-terminal domain (ECT) of E protein showed no
downregulation of CD1d expression on the cell surface. Western blot results were
consistent with the flow cytometry data. The SARS-CoV-2 E protein down regulated
CD1d surface expression by ~40%, the ETM and N-ETM downregulated CD1d surface
expression by ~50% (Figure 4B). All E, ETM, and N-ETM transfected groups showed
significant downregulation of surface CD1d compared to the control group CD1d level
(p<0.0001) (Figure 4C). However, the C-terminal expression was not detected by the
western blot analysis. To investigate the reason for the absence of C-terminal domain
expression, two drugs were used to treat the C-terminal transfected cells. 293T.CD1d
cells were treated with MG132 in 5 nM and 10 nM concentrations, and chloroquine in 20
μg/ml and 50 μg/ml concentrations for 24 hours. MG132 is a type of protease inhibitor
that can inhibit proteasome function to preserve proteins targeted for degradation.
Chloroquine is a commonly used antiviral drug that can increase the pH of the lysosome
to prevent protein digestion and viral release. As a result, the C-terminal domain was
detected in the groups treated with MG132, and 50 µg/ml chloroquine treated group
(Figure 5). However, the detection in the 50 µg/ml chloroquine treated group is very
weak compared to MG132 treated groups, suggesting that the C-terminal domain of E
protein is rapidly degraded upon expression, largely via the proteasomal degradation
25
pathway. The co-immunoprecipitation for the E transmembrane domain showed that the
transmembrane domain had an interaction with the mature and pre-mature form of
CD1d molecule (Figure 6). The SARS-CoV-2 ETM protein concentration in anti-CD1d
51.1.3 immunoprecipitation samples was much higher than the isotype control samples.

A time-course transfection study was performed to examine the time-related
CD1d downregulation. SARS-CoV-2 E protein and ETM transfected 293T.CD1d cells
were collected 12 hours, 24 hours, 36 hours, and 48 hours after transfection. To
minimize cell population variant in 48 hours of growth, the 293T.CD1d cells were grown
to ~90% confluency before transfection. Flow cytometry analysis and Western blot were
used to examine the CD1d expression level change in the 293T.CD1d cells. The flow
cytometry results showed that around 24 hours after transfection, both the SARS-CoV-2
E protein and ETM transfected group exhibited the peak activity in downregulating
surface CD1d expression (Figure 7). From western blot results, the expression of full-
length E and ETM gradually increased with increasing transfection time, which
coincides with the gradual decrease in mature CD1d protein level (Figure 8).

4.SARS-CoV-2 envelope protein ion-channel function plays an
important role in downregulating APC surface CD1d expression

To explore the role of SARS-CoV-2 envelope protein ion-channel function in
downregulating APC surface CD1d expression, two point mutations of the ETM (N15A,
26
V25F) were generated. Previous research reported that the mutation V25F and N15A in
the SARS-CoV E protein transmembrane region could lead to the loss of ion-channel
activity (Verdiá-Báguena et al., 2012). Also, six revertant mutants of ETM (N15D, V25F-
L19A, V25F-F26C, V25F-L27S, V25F-T30I, and V25F-L37R) were generated. These
were reported in a previous study to restore the ion-channel activity (Nieto-Torres et al.,
2014). All mutant sequences were generated through PCR with a custom-designed
primer, and SARS-CoV-2 ETM sequence encoded plasmid as template sequence
(Figure 9). The targeted DNA fragments from the PCR reactions were ligated to a
pLVX-IRES-Puro vector to generate a plasmid that encoded the target SARS-CoV-2
ETM mutants. 293 T CD1d cells were used for transfection with these ETM mutant
plasmids. Flow cytometry analysis and western blot were used to examine the CD1d
expression level change in the 293T.CD1d cells. Flow cytometry data demonstrated that
the N15A and V25F mutated samples showed no CD1d surface downregulation
compared to the control group. For the revertant mutants, FACS results showed the
V25F-T30I and N15D mutants partially restored CD1d surface downregulation, both
mutants reduced CD1d surface expression by ~15% less than the wild-type ETM
protein (~50%). Other revertant mutants showed little to no change in CD1d surface
downregulation phenotype in the flow cytometry analysis. The western blot results were
consistent with the flow cytometry data in that N15A and V25F mutant groups showed
no CD1d downregulation effects. However, for the revertant mutants, western blot
analysis showed that except for the V25F-L27S mutant, all revertant mutants showed
downregulation of mature CD1d expression.
27
Amantadine, a type of ion-channel inhibitor, was used to treat ETM transfected
293T.CD1d cells. SARS-CoV-2 ETM transfected 293T.CD1d cells were treated with 25
mM, 50 mM, 100 mM, and 200 mM amantadine for 48 hours. Flow cytometry analysis
was used to examine the CD1d expression level change in the 293T.CD1d cells. The
flow cytometry results showed that the 200 mM amantadine treated group had a
significantly lower surface CD1d downregulated percentage than the untreated group
(Figure 11A&11B, p<0.05). From western blot results, the expression of ETM protein
and CD1d was comparable in control, or all treated samples (Figure 11C). These results
suggested that the ion channel function was required for the E protein-mediated CD1d
downregulation.

5.SARS-CoV-2 envelope protein cellular localization

Immunofluorescence assay was used to determine the localization of the SARS-
CoV-2 envelope protein and its mutants. HeLa.CD1d cells were used in the
immunological assay. In this study, three proteins were immunostained, FITC for CD1d
51.1.3, TRITC for SARS-CoV-2 E protein including mutants, and Cy5 for ERGIC
complex. From the IF pictures, the full-length SARS-CoV-2 E protein staining showed
co-localization with ERGIC staining. However, the ETM only transfected group showed
ETM expression in the ERGIC region and other areas of the cell. Also, the ETM only
transfected group expression level was higher than the full-length E protein transfected
group. The ETM point mutants, N15A, V25F, and V25F-L19A showed staining co-
28
localizing with ERGIC staining. All other mutants showed a similar pattern as for wild-
type ETM localization. As for the CD1d expression change, the IF analysis showed cells
that were transfected with full-length E protein, ETM, N15D, and V25F-T30I. The
surface CD1d expression of these transfected cells was downregulated compared to
untransfected cells (Figure 12).

29
IV. Discussion

During the COVID-19 pandemic, among the COVID-19 hospitalized patients,
most of their immune cells were dysregulated by SARS-CoV-2 virus infection. The NKT
cells were also downregulated in both mild and severely ill patients (Odak et al., 2020).
Thus, disrupting CD1d presentation may be a commonly observed outcome of SARS-
CoV-2 infection and is likely used by the virus to evade iNKT cell detection.

In this study, through a screening of the SARS-CoV-2 viral transcriptome,
envelope (E) protein showed a surface CD1d downregulation phenotype. SARS-CoV-2
membrane protein (M) and envelope protein (E) co-transfection indicated that M protein
alone cannot downregulate CD1d surface expression. Furthermore, the interaction
between E and M proteins does not abolish the CD1d downregulation process. The co-
immunoprecipitation experiments revealed the interaction between E protein and
mature and immature forms of the CD1d molecule. With further investigation of the
possible mechanism of SARS-CoV-2 E protein and CD1d surface expression
downregulation, the transmembrane domain of E protein was found responsible for
CD1d downregulation and interaction with the CD1d molecule. N15A and V25F point
mutants point out that the ion-channel function of E protein may be an important part of
the APC surface CD1d downregulation process. The N15D and V25F-T30I revertant
mutants showed partial recovery of surface CD1d downregulation function. This
indicated the ion-channel function of ETM protein may play a role in CD1d
downregulation but may not be entirely responsible for the full CD1d downregulation
30
phenotype. Further, the time course study after transfection points out the time
dependence of CD1d downregulation. I observed that the overall quantity of mature
form of CD1d decreased with the increasing time post-transfection. However, the
surface CD1d expression level of 293T.CD1d cells was downregulated significantly
within the first 24 hours after transfection and reached a stable level after 24-hour post-
transfection. The immunofluorescence assay confirmed the expected localization of the
SARS-CoV-2 E and ETM proteins. An interesting result was the observation that ETM
mutant loss of ion-channel function restricted localization to the ERGIC and whereas
functional mutants exhibited wild-type ETM like localization.

More experiments need to be done in order to further investigate the mechanism
of CD1d downregulation by SARS-CoV-2 E protein. Further co-immunoprecipitation
experiments are needed to ensure the relationship between CD1d surface expression
downregulation and its interaction with E protein. Also, the viral protein ion-channel has
multiple impacts on the cell environment like pH change and electrochemical gradient
disruption. There was a study that reported that neutralizing endocytic pH can enhance
CD1d localization the to cell surface, and low endocytic pH change can significantly
destabilize the CD1d complex (Arora et al., 2016). Therefore, more experiments can be
done to monitor the pH change during the expression of SARS-CoV-2 E protein to see
whether that change correlates with changes in surface CD1d expression level.

The COVID-19 pandemic has caused a tremendous loss in human life
worldwide. Experts predict that the coronavirus pandemic may become a seasonal
31
infection like the flu (Phillips, 2021). Due to the highly conserved function and sequence
of envelope protein across the coronavirus family, a full understanding of the
mechanism of iNKT cell immune evasion by the SARS-CoV-2 virus can help to develop
more specific novel treatments against this deadly virus.

32
References
Alam, Intikhab, Allan A. Kamau, Maxat Kulmanov, Łukasz Jaremko, Stefan T. Arold,
Arnab Pain, Takashi Gojobori, and Carlos M. Duarte. "Functional Pangenome
Analysis Shows Key Features of E Protein Are Preserved in SARS and SARS-
CoV-2." Frontiers in Cellular and Infection Microbiology 10 (2020). Print.
Arora, Pooja, et al. "Endocytic pH regulates cell surface localization of glycolipid antigen
loaded CD1d complexes." Chemistry and physics of lipids 194 (2016): 49-57.
Barral, Duarte C., and Michael B. Brenner. "CD1 Antigen Presentation: How It Works."
Nature Reviews Immunology 7.12 (2007): 929-41. Print.
Barrantes, Francisco J. “Structural biology of coronavirus ion channels.” Acta
crystallographica. Section D, Structural biologyvol. 77,Pt 4 (2021): 391-402.
doi:10.1107/S2059798321001431
Bendelac, Albert, Paul B. Savage, and Luc Teyton. "The biology of NKT cells." Annu.
Rev. Immunol. 25 (2007): 297-336.
Bendelac, Albert, Paul B. Savage, and Luc Teyton. "The Biology of NKT Cells." Annual
Review of Immunology 25 (2006): 297-336. Print.
Chih-Cheng Lai, Tzu-Ping Shih, Wen-Chien Ko, Hung-Jen Tang, Po-Ren Hsueh,
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and
coronavirus disease-2019 (COVID-19): The epidemic and the challenges,
33
International Journal of Antimicrobial Agents, Volume 55, Issue 3, 2020, 105924,
ISSN 0924-8579, https://doi.org/10.1016/j.ijantimicag.2020.105924.
Cohen, Nadia R., Salil Garg, and Michael B. Brenner. "Antigen presentation by CD1:
lipids, T cells, and NKT cells in microbial immunity." Advances in immunology
102 (2009): 1-94.
Dougan, Stephanie K., Azucena Salas, Paul Rava, Amma Agyemang, Arthur Kaser,
Jamin Morrison, Archana Khurana, Mitchell Kronenberg, Caroline Johnson, Mark
Exley, M. Mahmood Hussain, and Richard S. Blumberg. "Microsomal Triglyceride
Transfer Protein Lipidation and Control of CD1d on Antigen-presenting Cells."
Journal of Experimental Medicine 202.4 (2005): 529-39. Print.
Godfrey, Dale I., Sanda Stankovic, and Alan G. Baxter. "Raising the NKT Cell Family."
Nature Immunology 11.3 (2010): 197-206. Print.
Gonzalez, Maria Eugenia, and Luis Carrasco. "Viroporins." FEBS Letters 552.1 (2003):
28-34. Print.
Gordon, David E., et al. "A SARS-CoV-2 protein interaction map reveals targets for drug
repurposing." Nature 583.7816 (2020): 459-468.
Jee, Youngmee. "WHO international health regulations emergency committee for the
COVID-19 outbreak." Epidemiology and health 42 (2020).
34
Kang, Suk-Jo, and Peter Cresswell. "Calnexin, calreticulin, and ERp57 cooperate in
disulfide bond formation in human CD1d heavy chain." Journal of Biological
Chemistry 277.47 (2002): 44838-44844.
Kern, David M., Ben Sorum, Sonali S. Mali, Christopher M. Hoel, Savitha Sridharan,
Jonathan P. Remis, Daniel B. Toso, Abhay Kotecha, Diana M. Bautista, and
Stephen G. Brohawn. "Cryo-EM Structure of the SARS-CoV-2 3a Ion Channel in
Lipid Nanodiscs." BioRxiv (2020). Print.
Kichler, Antoine, et al. "Polyethylenimine-mediated gene delivery: a mechanistic
study." The journal of gene medicine 3.2 (2001): 135-144.
Kim, Dongwan, Joo-Yeon Lee, Jeong-Sun Yang, Jun Won Kim, V. Narry Kim, and
Hyeshik Chang. "The Architecture of SARS-CoV-2 Transcriptome." Cell 181.4
(2020): 914-21. Print.
Lu, Hongzhou, Charles W. Stratton, and Yi-Wei Tang. "Outbreak of Pneumonia of
Unknown Etiology in Wuhan, China: The Mystery and the Miracle." Journal of
Medical Virology 92.4 (2020): 401-02. Print.
Mukherjee, Shruti, Dipita Bhattacharyya, and Anirban Bhunia. "Host-membrane
Interacting Interface of the SARS Coronavirus Envelope Protein: Immense
Functional Potential of C-terminal Domain." Biophysical Chemistry 266 (2020):
106452. Print.
35
Neuman B.W., Kiss G., Kunding A.H., Bhella D., Baksh M.F. A structural analysis of M
protein in coronavirus assembly and morphology. Journal of Structural Biology.
2011;174(1):11–22. doi: 10.1016/j.jsb.2010.11.021.
Nieto-Torres, Jose L., Marta L. DeDiego, Carmina Verdiá-Báguena, Jose M. Jimenez-
Guardeño, Jose A. Regla-Nava, Raul Fernandez-Delgado, Carlos Castaño-
Rodriguez, Antonio Alcaraz, Jaume Torres, Vicente M. Aguilella, and Luis
Enjuanes. "Severe Acute Respiratory Syndrome Coronavirus Envelope Protein
Ion Channel Activity Promotes Virus Fitness and Pathogenesis." PLoS
Pathogens 10.5 (2014). Print.
Nieto-Torres, Jose L., Marta L. DeDiego, Carmina Verdiá-Báguena, Jose M. Jimenez-
Guardeño, Jose A. Regla-Nava, Raul Fernandez-Delgado, Carlos Castaño-
Rodriguez, Antonio Alcaraz, Jaume Torres, Vicente M. Aguilella, and Luis
Enjuanes. "Severe Acute Respiratory Syndrome Coronavirus Envelope Protein
Ion Channel Activity Promotes Virus Fitness and Pathogenesis." PLoS
Pathogens 10.5 (2014). Print.
Nieva, J., Madan, V. & Carrasco, L. Viroporins: structure and biological functions. Nat
Rev Microbiol 10, 563–574 (2012). https://doi.org/10.1038/nrmicro2820
Odak, Ivan, Joana Barros-Martins, Berislav Bosnjak, Klaus Stahl, Sascha David, Olaf
Wiesner, Markus Busch, Marius M. Hoeper, Isabell Pink, Tobias Welte, Markus
Cornberg, Matthias Stoll, Lilia Goudeva, Rainer Blasczyk, Arnold Ganser, Immo
Prinz, Reinhold Foerster, Christian Koenecke, and Christian R. Schultze-Florey.
36
"Reappearance of Effector T Cells Predicts Successful Recovery from COVID-
19." (2020). Print.
Parthasarathy, Krupakar, Lifang Ng, Xin Lin, Ding Xiang Liu, Konstantin Pervushin,
Xiandi Gong, and Jaume Torres. "Structural Flexibility of the Pentameric SARS
Coronavirus Envelope Protein Ion Channel." Biophysical Journal 95.6 (2008).
Print.
Phillips, Nicky. "The coronavirus is here to stay-here’s what that means." Nature
590.7846 (2021): 382-384.
Schoeman, Dewald, and Burtram C. Fielding. "Coronavirus Envelope Protein: Current
Knowledge." Virology Journal 16.1 (2019). Print.
Shin, Jung Hoon, and Se-Ho Park. "The Effect of Intracellular Trafficking of CD1d on the
Formation of TCR Repertoire of NKT Cells." BMB Reports 47.5 (2014): 241-48.
Print.
Sköld, Markus, and Samuel M. Behar. "Role of CD1d-Restricted NKT Cells in Microbial
Immunity." Infection and Immunity 71.10 (2003): 5447-455. Print.
Tay, Matthew Zirui, Chek Meng Poh, Laurent Rénia, Paul A. MacAry, and Lisa F. Ng.
"The Trinity of COVID-19: Immunity, Inflammation and Intervention." Nature
Reviews Immunology 20.6 (2020): 363-74. Print.
Torres, Jaume, Krupakar Parthasarathy, Xin Lin, Rathi Saravanan, Andreas Kukol, and
Ding Xiang Liu. "Model of a Putative Pore: The Pentameric α-Helical Bundle of
37
SARS Coronavirus E Protein in Lipid Bilayers." Biophysical Journal 91.3 (2006):
938-47. Print.
V’kovski, Philip, et al. "Coronavirus biology and replication: implications for SARS-CoV-
2." Nature Reviews Microbiology 19.3 (2021): 155-170.
Verdiá-Báguena, Carmina, Jose L. Nieto-Torres, Antonio Alcaraz, Marta L. DeDiego,
Luis Enjuanes, and Vicente M. Aguilella. "Analysis of SARS-CoV E Protein Ion
Channel Activity by Tuning the Protein and Lipid Charge." Biochimica Et
Biophysica Acta (BBA) - Biomembranes 1828.9 (2013): 2026-031. Print.
Verdiá-Báguena, Carmina, Jose L. Nieto-Torres, Antonio Alcaraz, Marta L. DeDiego,
Jaume Torres, Vicente M. Aguilella, and Luis Enjuanes. "Coronavirus E Protein
Forms Ion Channels with Functionally and Structurally-involved Membrane
Lipids." Virology 432.2 (2012): 485-94. Print.
Zeng, Weihong, et al. "Biochemical characterization of SARS-CoV-2 nucleocapsid
protein." Biochemical and biophysical research communications 527.3 (2020):
618-623.
Yuan, Weiming, Anindya Dasgupta, and Peter Cresswell. "Herpes Simplex Virus
Evades Natural Killer T Cell Recognition by Suppressing CD1d Recycling."
Nature Immunology 7.8 (2006): 835-42. Print.
Zeng, Z. "Crystal Structure of Mouse CD1: An MHC-Like Fold with a Large Hydrophobic
Binding Groove." Science 277.5324 (1997): 339-45. Print.
38
Zhu, Yajuan, et al. "Calreticulin controls the rate of assembly of CD1d molecules in the
endoplasmic reticulum." Journal of Biological Chemistry 285.49 (2010): 38283-
38292.

39

Figures

Figure 1. SARS-CoV-2 envelope protein and Membrane protein interaction does not affect the
APC surface CD1d expression, downregulation phenotype. A. Analyzed Flow cytometry data. The yellow
line represents isotype control, the red line represents GFP positive cells, and the blue line represents GFP negative
cells. Peak shift to the left indicates the CD1d signal strength is decreased, which means the cell surface CD1d level
was lower. In this graph, SARS-CoV-2 E and E&M transfected groups show lower CD1d levels compared to the
control group. B. Western blot result of transfected samples. SARS-CoV-2 E protein and E&M transfected group
showed lower mature CD1d than control and M only transfected groups. Anti-Strep blotting confirmed the expression
of viral protein in the cell. Anti-GRP94 blotting was used as a loading control.
40

Figure 2. Detergent Test. Western blot result of detergent test samples. SARS-CoV-2 E protein transfected
group shows lower mature CD1d than the control group. As shown in the graph, the Triton detergent group shows no
signal in anti-Strep blotting for Co-IP samples. This showed the Triton detergent is not suitable in this interaction
study. Anti-Strep blotting confirmed the expression of viral protein in the cell. Anti-GRP94 blotting was used as a
loading control.

A. B.

Figure 3. Interactions between CD1d molecule and SARS-CoV-2 envelope protein. A. Western blot
result of co-IP for SARS-CoV-2 E protein transfected samples. The SARS-CoV-2 E protein transfected group showed
lower mature CD1d than the control group. Co-IP results showed the interaction between CD1d and E protein. Anti-
Strep blotting confirmed the expression of viral protein in the cell. Anti-GRP94 blotting was used as a loading control.
B. Quantitative analysis of western blot result. Both anti-CD1d 51.1.3 and D5 antibody co-IP showed significant
differences with the isotype control group (p<0.001, p<0.05).
41

Figure 4. SARS-CoV-2 envelope protein Transmembrane domain is necessary and sufficient to
downregulate APC surface CD1d expression. A. Indication picture of different deletion mutants generated in
the study. B. Analyzed Flow cytometry data. The yellow line represents isotype control, the red line represents GFP
positive cells, and the blue line represents GFP negative cells. Peak shit to left indicates the CD1d signal strength is
decreased, which means the cell surface CD1d level is lower. In this graph, SARS-CoV-2 E, ETM, and N-TM
transfected groups show lower CD1d levels compare to the control group. C. Quantitative analysis of FACS result. E,
ETM, N-TM transfected group show significantly lower CD1d level than the control group (p<0.001). D. Western blot
result for SARS-CoV-2 E protein and mutants transfected samples. SARS-CoV-2 E, ETM, and N-TM transfected
groups show lower mature CD1d than the control group. Anti-Strep blotting confirms the expression of viral protein in
the cell. Anti-GRP94 blotting was used as a loading control.
42

Figure 5. SARS-CoV-2 C-terminal expression. Western blot result for SARS-CoV-2 E CT protein
transfected samples. The C-terminal domain was detected in the groups treated with MG132, and 50 ul/ml
chloroquine treated group. Anti-Strep blotting confirms the expression of viral protein in the cell. Anti-GRP94 blotting
was used as a loading control.

Figure 6. The Co-immunoprecipitation for the E Transmembrane domain shows the
Transmembrane domain has interaction with the CD1d molecule. Western blot result of co-IP
result for SARS-CoV-2 ETM protein transfected samples. SARS-CoV-2 ETM protein transfected group shows lower
mature CD1d than the control group. Co-IP results show the interaction between CD1d and ETM protein. Anti-Strep
blotting confirms the expression of viral protein in the cell. Anti-GRP94 blotting was used as a loading control.

43

Figure 7. Time-course transfection study. Analysis of flow cytometry data. The yellow line represents
isotype control cells, the red line represents GFP positive cells, and the blue line represents GFP negative cells. Peak
shift to the left indicates the CD1d signal strength is decreased, which means the cell surface CD1d level was lower.
The flow cytometry results showed that around 24 hours after transfection, both the SARS-CoV-2 E protein and ETM
transfected group exhibited the peak activity in downregulating surface CD1d expression.
44

Figure 8. Time-course transfection study. A. Western blot result for SARS-CoV-2 E protein transfected
samples. The expression of full-length E gradually increased with increasing transfection time, and mature CD1d
protein level gradually decreased with increasing transfection time. Anti-Strep blotting confirms the expression of viral
protein in the cell. Anti-GRP94 blotting was used as a loading control. B. Western blot result for SARS-CoV-2 ETM
protein transfected samples. The expression of ETM gradually increased with increasing transfection time, and the
mature CD1d protein level gradually decreased with increasing transfection time. Anti-Strep blotting confirmed the
expression of viral protein in the cell. Anti-GRP94 blotting was used as a loading control.

45
A.

B.

Figure 9. SARS-CoV-2 envelope protein ion-channel function plays an important role in
downregulating APC surface CD1d expression. A. Schematic of different deletion mutants generated in the
study. B. Western blot results for transfected SARS-CoV-2 E protein and mutant samples. SARS-CoV-2 E, ETM,
ETM N15D, V25F-L19A, V25F-F26C, V25F-T30I, and V25F-L37R transfected groups showed lower mature CD1d
than the control group. Anti-Strep blotting confirmed the expression of viral protein in the cell. Anti-GRP94 blotting
was used as a loading control.
46

Figure 10. SARS-CoV-2 envelope protein ion-channel function plays an important role in
downregulating APC surface CD1d expression. A. Analysis of flow cytometry data. The yellow line
represents the isotype control, the red line represents GFP positive cells, and the blue line represents GFP negative
cells. A peak shift to the left indicates the CD1d signal strength is decreased, which means the cell surface CD1d
level is lower. In this graph, SARS-CoV-2 E, ETM, ETM N15D, and ETM V25F-T30I transfected groups showed lower
CD1d levels compared to the control group.
47

Figure 11. Ion-channel inhibitor treatment result. A. Analysis of flow cytometry data. The yellow line
represents the isotype control, the red line represents GFP positive cells, and the blue line represents GFP negative
cells. A peak shift to the left indicates the CD1d signal strength is decreased, which means the cell surface CD1d
level is lower. In this graph, the peak shift decreases with increasing inhibitor concentration. B. Bar graph shows the
relative decrease of CD1d surface presenting. Dot plot shows the decrease in CD1d downregulation with increase
inhibitor concentration. C. Western blot results for transfected SARS-CoV-2 ETM. Anti-Strep blotting confirmed the
expression of viral protein in the cell. Anti-GRP94 blotting was used as a loading control.
48

Figure 12. SARS-CoV-2 envelope protein localization in the cells. Green corresponds to mature CD1d
staining. Red corresponds to E protein and mutant staining. Purple corresponds to ERGIC staining. For the CD1d
expression change, the IF analysis showed cells that were transfected with full-length E protein, ETM, N15D, and
V25F-T30I showed this result. The surface expression of these transfected cells was downregulated compared to
untransfected cells.

Abstract (if available)

Abstract The COVID-19 pandemic has caused a tremendous loss in human life all around the world. COVID-19 disease is caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Understanding the exact mechanisms of viral pathogenesis is imperative to design effective antiviral treatments. During viral pathogenesis, evading and suppressing the human innate immune system is one of the most prominent features of this potentially deadly virus. CD1d-restricted NKT cells are one subset of the innate-like T cells that play critical roles in early viral pathogenesis. Very little is known how SARS-CoV-2 interacts with this important group of T cells. Our lab has recently discovered that the SARS-CoV-2 envelope (E) protein downregulates surface CD1d expression level in antigen-presenting cells. This study endeavored to elucidate the molecular mechanism of E protein-mediated CD1d downregulation. By using immunoprecipitation with specific antibodies, we demonstrated E protein specifically decreased the level of the mature form of CD1d. The CD1d-downregulation function was mapped to the transmembrane (TM) domain of E protein. The TM domain alone is sufficient for downregulating CD1d. E proteins of SARS coronaviruses possess ion channel function via their TM domains. We generated point mutations that abolished the ion channel function. Interestingly, the E protein mutants lacking ion channel function do not downregulate CD1d expression, suggesting that SARS-CoV-2 E protein leads to CD1d degradation through its ion channel function. More studies are needed to elucidate the exact mechanism how the E protein ion channel exerts this function. Our investigations demonstrated a novel immune evasion function of SARS-CoV-2 E protein targeting NKT cell function.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

The interaction of SARS-CoV-2 with CD1d/NKT antigen presentation pathway

PDF

SARS-CoV-2 interaction with the CD1d/NKT cell antigen presentation system

PDF

Comparative studies of coronavirus interaction with CD1d-restricted iNKT cells

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Investigating the role of ion channel activity of coronaviruses envelope protein in CD1d regulation

PDF

Molecular mechanism for the immune evasion of CD1d antigen presentation by herpes simplex virus-1 UL56 protein

PDF

HSV-1 UL56 serves as a potential Nedd4L E3 ligase adaptor for CD1d downregulation

PDF

Mechanistic insights into HSV-1 UL56-mediated immune evasion through CD1d downregulation and NKT cell suppression

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

Herpes Simplex virus-1 UL56 collaborates with Nedd4 E3 ubiquitin ligase to downregulate surface CD1d and facilitate immune evasion of NKT cell function

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

The role of CD1d transmembrane and cytoplasmic tail domain in CD1d trafficking pathway

PDF

Herpes simplex virus-1 and immune evasion: the mechanistic role of UL56 and Nedd4 family ubiquitin ligases in CD1d downregulation

PDF

Novel approaches of mobilizing human iNKT cells for cancer immunotherapies

PDF

Comparative studies of immune evasion function for herpes simplex virus-1 UL56 and US3 genes

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Neurological impact of SARS-CoV-2 and variants in K18 hACE2 transgenic mouse model

PDF

Self-secretion of checkpoint blockade enhances antitumor immunity by murine chimeric antigen receptor-engineered T cells

PDF

Characterization of invariant natural killer T cells in a novel humanized HBV-transgenic model

Asset Metadata

Creator Liu, Zhewei (author)

Core Title The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Degree Conferral Date 2021-08

Publication Date 07/26/2021

Defense Date 06/02/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag antigen presentation pathway,CD1d,envelope protein,immune evasion,NKT,OAI-PMH Harvest,SARS-CoV-2

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Yuan, Weiming (committee chair), Feng, Pinghui (committee member), Tahara, Stanley (committee member)

Creator Email zheweil96@gmail.com,zheweili@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15623321

Unique identifier UC15623321

Legacy Identifier etd-LiuZhewei-9894

Document Type Thesis

Format application/pdf (imt)

Rights Liu, Zhewei

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu