University of Southern California Dissertations and Theses

Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

(USC Thesis Other)

Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Optimizing an immortalized human alveolar epithelial cell line model
system to recapitulate lung adenocarcinoma development in vitro
By
Junyi Li
A Thesis Presented to the
FACULTY OF THE USC Keck School of Medicine
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
Biochemistry and Molecular Medicine
August 2021
Copy right: 2021 Junyi Li
ii

Acknowledgments
I would like to express my gratitude to my advisor, Dr. Ite A. Offringa for allowing me to be
part of her amazing lab team and giving me the opportunity to learn, experience and complete my
research as well as my thesis. Her constant encouragement and guidance helped me a lot in
completing my master thesis project. Also, I would like to thank my committee members, Dr.
Beiyun Zhou and Dr. Crystal N. Marconett, who provided me invaluable comments on the thesis
and project. In addition, I would like to extend my special thanks to Dr. Evelyn Tran for her
patience and guidance not only in my research but also in the PhD application process and many
other areas of my life.
In addition, I would like to thank all members of Dr. Offringa’s and Dr. Marconett’s labs for
being a wonderful supportive team, especially Chunli Yan as an amazing lab manager and
technician. I would also like to thank other lab colleagues for their patience, kindness and support
which helped me move along with my project.
Also, I would like to thank the excellent academic advisor, Monica Pan, for her enthusiasm
and help in my master’s student life.
Last but not the least, I would like to thank my family for always being supportive both
spiritually and financially throughout my life.

iii

Table of Contents
Acknowledgments ...................................................................................................................... ii

List of Tables ..............................................................................................................................v

List of Figures ........................................................................................................................... vi

Abbreviations ........................................................................................................................... vii

Abstract .................................................................................................................................... ix

Chapter 1 Introduction ................................................................................................................1
1.1 Brief overview of the distal lung .....................................................................................1
1.2 Statistics and subtypes of lung cancer .............................................................................2
1.3 Methods for studying lung cancer. ..................................................................................3
1.4 Previous work on novel non-cancer human AEC models ................................................7
1.5 Modifying AEC-ON cells to develop a better model for LUAD .................................... 10

Chapter 2 Materials and Methods .............................................................................................. 12
Ethics statement ................................................................................................................. 12
Chemicals, Regents and Oligos. ......................................................................................... 12
Construction of lentiviral plasmids ..................................................................................... 17
Colorless LeGO iT-hTERT and LeGO iG-SV40LgT ..................................................... 17
LeGO iG-SV40LgT with AID tag ................................................................................. 18
LeGO-iG-SV40LgT containing LoxP sites .................................................................... 19
osTIR-containing plasmid ............................................................................................ 19
Bacterial transformation ..................................................................................................... 20
DNA extraction .................................................................................................................. 20

Chapter 3 Results ...................................................................................................................... 22
3.1 Generation of colorless constructs for future lineage tracing experiments ..................... 22
3.2 Design strategy for the auxin-inducible degradation (AID) of SV40LgT system ............ 27
3.3 Design strategy for the Cre-Lox inactivation of SV40LgT ............................................. 34

Chapter 4 Discussion................................................................................................................. 39

References ................................................................................................................................ 44

Appendices ............................................................................................................................... 47

iv

Supplementary Data .................................................................................................................. 48

v

List of Tables

Table 1. List of chemicals…………………………………………………………………...12
Table 2. List of restriction enzymes………………………………………………………....13
Table 3. List of assay kits…………………………………………………………………...14
Table 4. List of oligos……………………………………………………………………….14
Table 5. List of plasmids …………………………………………………………………...16

vi

List of Figures

Figure 1. Different cell types of the lung……………………………………………………….1
Figure 2. Estimated new cases and deaths for lung cancer in 2021………………….................2
Figure 3. Schematic of cellular pathways affecting cell proliferation……………….................5
Figure 4. Alveolar epithelial cell line derivation using ROCK inhibitor media………………..8
Figure 5. Plasmid verification of colorless LeGO-iG-SV40LgT and colorless LeGO-iT-
hTERT………………………………………………………………………………………….24
Figure 6. Plasmid validation of AID fusion on SV40LgT fragment in colorless LeGO iG
SV40LgT and modification of PUCHR-osTIR-eGFP………………………………………….30
Figure 7. Plasmid verification of loxP insertion on colorless LeGO iG SV40LgT…………….38
Figure 8. Lineage tracing in human embryonic kidney (HEK) cells by using BrainBow 3.0…40
Figure 9. Schematic of Cre/Lox-activatable system for KRAS
G12D
mutation in cells………….42

vii

Abbreviations
AT1, alveolar epithelial type 1
AT2, alveolar epithelial type 2
AEC, alveolar epithelial cell
AID, Auxin-inducible degradation
AQP5, Aquaporin-5
CDK4, cyclin-dependent kinase 4
DAPI, 4’6’-diamidino-2-phenylindole
ECAD, E-Cadherin
EGFR, epidermal growth factor receptor
hTERT, human telomerase
LUAD, lung adenocarcinoma
LULC, large cell carcinoma
LUSC, lung squamous cell carcinoma
NKX2-1, thyroid transcription factor 1
NSCLC, non-small cell lung cancer
SV40LgT, simian virus 40 large tumor antigen
SCLC, small cell lung cancer
TERT, telomerase
TIR1, transport inhibitor response 1
viii

VGFR, vascular endothelial growth factor

ix

Abstract
Lung adenocarcinoma is one of the leading causes of lung cancer death worldwide. However,
there is no proper non-cancer cell model to study its initiation yet. Dr, Evelyn Tran has generated
an immortalized human alveolar epithelial cell line model by using SV40-LgT antigen. But since
SV40 LgT was not an endogenous alteration found in human diseases, optimizations are needed
so that SV40 LgT expression could be precisely controlled for lung adenocarcinoma study. We are
generating two different constructs to achieve the modulation of SV40 in cells. Construct using
auxin-initiated degradation (AID) tag system to label SV40 enables the reversible modulate of
SV40-LgT in the lung AT2 cell for validation of the SV40 function in AEC proliferation process
in culture. Another Construct using Cre-lox system which has LoxP sites flanks SV40-LgT allows
irreversible deletion of SV40-LgT that enables the substitution of different tumor drives for the
study the lung adenocarcinoma initiation.

1

Chapter 1 Introduction
1.1 Brief overview of the distal lung
The lung has usually been categorized into three general regions: the upper airways, the small
airways, and the distal parenchyma. Many cell types populate the lung epithelium in these regions
(Figure 1). Previous research has shown that basal, Club and alveolar epithelial type 2 (AT2) cells
contain stem cell characteristics and are able to reform epithelium when encountering lung injury
(1). While proximal airways mainly transmit the air to the lower airway, the distal parenchyma
mediates gas exchange. In the distal parenchyma of the lung, the alveolus consists of type 1 (AT1)
and type 2 (AT2) epithelial cells (1-3).

Figure 1. Different cell types of the lung (4)
2

1.2 Statistics and subtypes of lung cancer
Lung cancer is the leading cause of cancer-related death in the US. As shown in Figure 2, lung
cancer deaths in 2021 are estimated to be ~69,000 for males and ~62,000 for females, which
represents 21.7% of the total cancer death cases (5).

Figure 2. Estimated new cases and deaths for lung cancer in 2021 (5)
There are two main clinical subtypes of lung cancer, small cell lung cancer (SCLC) and non-
small cell lung cancer (NSCLC). NSCLC accounts for nearly 85% of lung cancer cases (6). There
are three major histological subtypes of NSCLC: lung adenocarcinoma (LUAD), squamous cell
carcinoma (LUSC), and large cell carcinoma (LULC). LUAD is the most common subtype
observed in patients (6). Research has shown that LUAD arises from alveolar epithelial cells in
the distal region of the lung, whereas LUSC arises from basal cells in the proximal airway (7).
3

Besides the difference in where these cancers arise, LUAD and LUSC show differences in their
histopathology and disease mechanisms. It is important to know that the distinction between
LUAD and LUSC is needed for patient treatment since the protocols and drugs to treat these two
subtypes of NSCLC is different: LUAD tumor patients can be responsive to drugs that target
epidermal growth factor receptor (EGFR) mutations whereas potential life-threatening
hemorrhaging may occur in LUSC patients treated with a drug that targets vascular endothelial
growth factor (VEGF), a common combination treatment with EGFR-targeting cancer therapies
(8, 9).
1.3 Methods for studying lung cancer.
Researchers use numerous methods to study lung cancer development and progression. One
approach is using mouse models. Many mouse models have already been generated to study
LUAD, such as C57BL/6J and BALB/cj strains of transgenic mice carrying various activatable
oncogenic driver gene mutations such as Kras
G12D
or Egfr
L858R
mutations (10-12). Although mouse
models are great tools to study cancer progression and its interaction with the microenvironment,
there still are physiological differences between mouse and human which may influence tumor
histology and the outcome of drug responses when it comes to clinical applicability. Hence,
human-derived model systems are also needed, including recently developed organoid model
systems derived from lung.
Human organoid models are based on the three-dimension culture of cell lines. By using
progenitor-like cells, along with a bed of fibroblasts, 3D tissue culture can recreate the architecture
4

and physiology of human tissue and therefore, is a promising tool to study the initiation and
progression of cancer. For example, BRCA2-mutant organoids and EGFR mutant lung cancer
organoids have been generated to study tumor response to different drug treatments (13, 14).
However, the lung cancer organoid is not a suitable system to study LUAD initiation because the
LUAD cancer cell lines can not properly recapitulate the transition of normal lung alveolar
epithelial cells to the cancer cells. To better understand the molecular events that lead to cancer
initiation, experiments need to be conducted in a non-transformed cell model, which will allow the
characterization of lung cell phenotypes and molecular alterations as they transition toward
acquisition of carcinogenic properties.
In order to culture non-cancerous human cells in vitro, cells isolated from human tissues must
be immortalized because primary human cells will undergo cellular arrest and fail to proliferate in
culture due to cellular senescence and telomeric attrition.
To proliferate in vitro, cells need to pass the cell cycle checkpoint that occurs at the G1-S phase
transition, which is controlled by cyclins D (1/2/3) and other cyclin-dependent kinases such as
CDK4 or CDK6. Shown in Figure 3, CDK4 binds to cyclin D during cell cycle progression, which
then leads to phosphorylation of RB1, thus releasing its binding partner E2F to translocate to the
nucleus and bind DNA, allowing the cell cycle to proceed (15). In many cancer types, CDK4
mutations are known to be an initiating step in tumor formation (16).
Cellular senescence is a separate process that occurs when cells that are inappropriately
activated to proliferate are growth arrested. It is considered to be a mechanism to prevent cancer
initiation(17). RB1 and TP53 are known to play important roles in the cellular senescence process.
5

When cells experiencing high stress environment, TP53 activates p21 which then deactivates the
CDK2 function(18) resulting in hypophosphorylated RB1 proteins. In the hypophosphorylated
form, RB1 protein will bind to E2F complex which inhibits the cell proliferation and leads to cell
arrest in G1 phase (19). To become immortalized, cells need to overcome senescence.

Figure 3. Schematic of Cellular pathways affecting cell proliferation (15).
Telomere length is another critical factor involved in cellular senescence. Since DNA
polymerase cannot replicate sequences present at the very end of chromosome on the 3’ end of
lagging strand during DNA replication, DNA on the daughter strand is lost in each replication
6

cycle from the end of the chromosome in eukaryotic cell with linear chromosome (20). Telomeres
are highly repetitive DNA sequences capping the ends of chromosomes. They prevent the loss
of important DNA information at the ends (21). Telomere shortening occurs after multiple rounds
of cell division due to the lack of expression of the TERT protein in cells. This process is called
telomere attrition, which eventually leads to cell death (20). For cells to overcome telomere
attrition, human cells need to express telomerase to maintain their telomeres. Human telomerase
contains two molecules each of human telomerase reverse transcriptase (hTERT) and non-coding
telomerase RNA (TERC) (22). In the process of telomere addition, hTERT uses TERC as the
template for telomere addition. hTERT is a catalytic subunit of the enzyme telomerase which is
regulated by many oncogenes such as HIF-1 or AP2 (23). To successfully immortalize normal
human cells in vitro, it is necessary to prevent telomere attrition and thus overcome the cells natural
inclination toward cellular senescence.
Previously, normal human lung cells isolated from the proximal airways have been used to
generate a bronchial epithelial cell line, BEAS-2B (24). This was done by infecting the human
bronchial epithelial cells with an adenovirus 12-simian virus 40 large tumor (SV40LgT) antigen
hybrid virus. The cells showed great proliferation potential while still maintaining bronchial
epithelial characteristics. More recently, Lundberg et al. have generated immortalized
tracheobronchial epithelial cells by retroviral co-transduction of TERT and SV40LgT (25).
SV40LgT dysregulates the cell cycle by both disrupting the RB1-E2F complex, as well as blocking
TP53 activity, while hTERT stabilizes the cell genome and prevents the DNA shorting caused by
rapid replication. Together, these changes allow the cells to proliferate indefinitely (26).
7

Taking together, the transduction of SV40LgT and TERT can immortalize airway cells and
thereby yield cells that can be used to model LUSC. However, as we previously mentioned, LUSC
and LUAD have different cells of origin. Thus, a suitable model derived from alveolar epithelial
cells is needed for the study of LUAD.
1.4 Previous work on novel non-cancer human AEC models
Previously, Dr. Evelyn Tran in the Offringa lab attempted to derive immortalized AEC cell lines
by transducing freshly isolate AT2 cells with either the CDK4
R24C
mutation, which enables the
constant binding of RB1 to CDK4, SV40LgT alone, TERT alone, or the combination of CDK4
R24C

and TERT (19). As shown in Figure 4 A-E, a polyclonal population of cells resulted following each
lentiviral transduction. However, as shown in Figure 4F, only the SV40LgT-transduced cells
showed good proliferative capacity compared to other transduced-cells in a one-month soft agar
growth assay. The cells transduced with SV40LgT were small and compact, and subsequent bulk
RNA-seq analysis of their transcriptomic profiles suggests that these cells express the AEC
progenitor markers SOX6 and SOX2, which are founded in growing distal tips of human embryonic
lung tissue and believed to mark the novel progenitor cells in this region (27).
8

9

Figure 4. Alveolar epithelial cell line derivation using ROCK inhibitor media (28). Purified alveolar epithelial cells were
plated and expanded in media contain ROCK inhibitor Y27632. This was followed by lentiviral transduction. A) brightfield
image of AEC-ROCKinh cells. Expanded cells were then transduced by B) hTERT C) CDK4
R24C
D) CDK4
R24C
+ hTERT
or E) SV40LgT. Scale bar, 100 um. F) Quantification of total colony growth on soft agar assay of six technical replicates.
Colony formation was not significantly different between A549 and AEC-LT cells by Wilcoxon nonparametric t-test G)
Purified Alveolar epithelial cells were plated and expanded in media contain ROCK inhibitor Y27632 and been lentiviral
transduced by SV40LgT. AEC-FT, AEC-ON and AEC-TN polyclonal lines was generated and maintained a monolayer in
2D culture to full confluence. AEC-ON cells were then transferred into 3D co-cultured with fibroblasts and grew into sphere.
The AEC-ON derived sphere was then sectioned and stain for AQP5 and NKX2-1 to validate the alveolar characteristic of
the cells.
As shown in Figure 4 G, when introducing SV40LgT into AT2 cells purified from normal human
10

lung from three individuals, all three polyclonal cell lines were able to proliferate in vitro. Among
the three lines, AEC-ON cells showed the capacity to form complex alveolar-like structures while
expressing known alveolar markers (AQP5 and NKX2-1). Injection of this cell line into nude mice
showed no tumor formation (28). Therefore, AEC-ON cells appear to provide a good starting point
to develop an in vitro model for LUAD.
1.5 Modifying AEC-ON cells to develop a better model for LUAD
Although the AEC-ON line maintains some AEC characteristics and does not form tumors, the
presence of SV40LgT antigen could be a confounding factor in using these cells to develop a model
of LUAD. SV40LgT is a viral antigen, not an endogenous human gene, and is not implicated in
human LUAD. Therefore, the goal of this project is to come up with ways to modulate or eliminate
SV40LgT expression after organoid formation to minimize the influence of SV40LgT while
studying the initiating events that lead to LUAD development. In addition, although SV40LgT
alone is able to maintain AEC proliferation, the end of 3’ ends chromosomes will experience
shorting. Since the addition of TERT in the immortalization process has been shown to help to
stabilize the cell genome by protecting the cell from telomere attrition, the secondary goal in my
project is to facilitate combining SV40LgT and TERT transduction. Also, the original
immortalization constructs that were used to generate AEC-ON cells contained a green fluorescent
(GFP) gene for selection proposes. Therefore, the cells were by default green under the florescent
microscope. This characteristic of the AECs will interfere with using the color-based lineage
tracing system for studies in AEC organoid formation and LUAD. Therefore, the cell line itself
11

should not be fluorescently colored before applying color-based system. Thus, removing GFP
from previously used vectors is also one of the goals for my project.

In summary, my hypothesis is that optimizing the immortalized human alveolar epithelial cell
line model system developed by Dr. Evelyn Tran will allow the better recapitulation of LUAD
development in vitro. Due to delays experienced because of COVID-19, my progress is limited to
the construction of several vectors and attempts to test them in A549 LUAD cells. I anticipate that
once their functionality is confirmed, the vectors will be used to create more versatile AEC cell
lines.

12

Chapter 2 Materials and Methods
Ethics statement
Previously, remnant human transplant lungs were obtained in compliance with the University
of Southern California institutional review board-approved protocols for the use of human source
material in research. All donors were de-identified according to USC HIPAA regulations. Lungs
were processed within 3 days of death. Cells were previously prepared as described in Dr. Evelyn
Tran’s manuscript and stored in frozen aliquots to be used in this study(28). However, due to
COVID time constraints, we did not reach a point in the experiments where the cells could be used.
Chemicals, Regents and Oligos.
Table 1. List of Chemicals
Chemical name Company Catalog number
Ampicillin VWR 0339-25G
Betaine Sigma-Aldrich B2629-100G
Gel Loading Dye, Purple
(6X)
New England Biolabs B7024S
Hygromycin InvivoGen Ant-hg-1
T4 DNA Ligase New England Biolabs 0202S
T4 DNA ligase buffer New England Biolabs 0202A
13

5-Bromo-4-Chloro-3-Indolyl
β-D-Galactopyranoside
Sigma-Aldrich BG-3G
Table 2. List of restriction enzymes
Name Company name Catalog number
AgeI-HF New England Biolabs R3552S
BamHI-HF New England Biolabs R3136S
BsrGI-HF New England Biolabs R3575S
BstXI New England Biolabs R0113S
Bsu36I New England Biolabs R0524S
EcoRI-HF New England Biolabs R3101S
MfeI-HF New England Biolabs R3589S
NheI-HF New England Biolabs R3131S
NotI-HF New England Biolabs R3189S
PmlI New England Biolabs R0532S
PspXI New England Biolabs R0656S
SalI-HF New England Biolabs R3138S
SbfI-HF New England Biolabs R3642S
ScaI-HF New England Biolabs R3122S
SpeI New England Biolabs R0133S
XbaI New England Biolabs R0145S
14

XhoI New England Biolabs R0146S

Table 3. List of assay kits
Name Company Catalog number
GeneArt Site -Directed
Mutagenesis Plus Kit
Invitrogen A14551
NEB 5-alpha competent E.
coli (High Efficiency)
New England Biolabs C2987H
Phusion polymerase Kit ThermoFisher M0530L
QIAGEN Plasmid Mini/Midi
kit
QIAGEN 12143
QIAquick PCR/Gel
purification Kit
QIAGEN 28104
QIAGEN Plasmid Mini/Midi
kit
QIAGEN 12143
One Shot™ Stbl3™
Chemically Competent E.
coli
ThermoFisher 7137303

Table 4. List of oligos
15

Oligo name Sequence
LeGO iT hTERT Seq F
5’-CTCCATCCTGAAAGCCAAGAA-3’
hTERT-intF1
5’-TACGCCGAGACCAAGCACTTCCTCTA-3’
hTERT-intF2
5’-TTGCAAAGCATTGGAATCAGACAGCACTTGAAGA-3’
SFFV-Seq-F
5’-ACCAATCAGCCTGCTTCTCG-3’
SV40-int1440-SeqF
5’- AGAGATTTGCCTTCAGGTCAGGG-3’
SV40-nt1770-Seq-F
5’- ATTCAGAGCAGAATTGTAGAG-3’
NheI-WPRE-R
5’-AAAAAAGCTAGCTAATCAACCTCTGGATTACAA-3’
Bsu36I-WPRE-F
5’-AAAAAACCTCAGGGCGGGGAGGCGGCCCAAAG-3’
LeGO iT-MCS-TOP
5’-AATTCGCGGCCGCCCTAGGCACGTGT-3’
LeGO iT-MCS-BOTTOM
5’-GTACACACGTGCCTAGGGCGGCCGCG-3’
LeGO iG-SV40STOP-Mut-F
5’- CCCTGAACCTGAAACCGGTGAATTCCTGCAGGCC-3’
LeGO iG-SV40STOP-Mut-R
5’- GGCCTGCAGGAATTCACCGGTTTCAGGTTCAGGG-3’
AgeI-AID-STOP-EcoRI-TOP
5’-ccggtCCTAAAGATCCAGCCAAACCTCCGGCCAAGGCACA
AGTTGTGGGATGGCCACCGGTGAGATCATACCGGAAGAACG
TGATGGTTTCCTGCCAAAAATCAAGCGGTGGCCCGGAGG
CGGCGGCGTTCGTGAAGtaaG-3’
AgeI-AID-STOP-EcoRI-BOTTOM
5’- AATTCttaCTTCACGAACGCCGCCGCCTCCGGGCCACCG
CTTGATTTTTGGCAGGAAACCATCACGTTCTTCCGGTAT
GATCTCACCGGTGGCCATCCCACAACTTGTGCCTTGGCCGGA
16

GGTTTGGCTGGATCTTTAGGa-3’
Q5SDM-SbfI5193-Mut-F
5’-caggCCTCGACGAGGGCCGGCG-3’
Q5SDM-SbfI5193-Mut-R
5’-caagAATTCTTATGTTTCAGGTTCAGGGGGAGGTGTG-3’
SbfI-LoxP-BamHI-TOP
5’- GGATAACTTCGTATAGCATACATTATACGAAGTTATG-3’
SbfI-LoxP-BamHI-BOTTOM
5’-GATCCATAACTTCGTATAATGTATGCTATACGAAGTTATC
CTGCA-3’
XhoI-LoxP-NheI-TOP
5’- TCGAGATAACTTCGTATAGCATACATTATACGAAGTTATG-
3’
XhoI-LoxP-NheI-BOTTOM
5’-CTAGCATAACTTCGTATAATGTATGCTATACGAAGTTATC-3’
BstXI-Hygromycin-F
5’- AAAAAACCACAACCATGGAAGCCTGAACTCACCGCGAC-
3’
PspXI-Hygromycin-R
5’- AAAAAAACTCGAGGTTATTCCTTTGCCCTCGGAC-3’
osTIR-Seq-F
5’- AGT GAA TGC TGG GTC CCT-3’
Table 5. List of plasmids
Name Company Catalog number
LeGO iG Addgene 27358
LeGO iT Addgene 27361
pUCHR-osTIR1-IRES-GFP Addgene 110661
PB-TRE-dCas9-VPR Addgene 63800

17

Construction of lentiviral plasmids
Colorless LeGO iT-hTERT and LeGO iG-SV40LgT
The original LeGO iG and LeGO iT plasmids (http://www.lentigo-vectors.de/) were obtained
from Dr. Kate Lawrenson (Cedars Sinai Medical Center, Los Angeles, CA). The original LeGO iG
plasmid contained a GFP gene while the LeGO iT plasmid contains a tdTomato gene. Derivative
plasmids were obtained from Dr. Evelyn Tran who modified the LeGO iG and LeGO iT plasmids
into LeGO iG-SV40LgT-IRES-eGFP and LeGO iT-hTERT-tdTomato by subcloning SV40LgT
antigen coding sequence (CDS) from the pBABE-puro SV40LgT-IRES plasmid (Addgene 13970)
into the LeGO iG vector between BamHI and EcoRI sites and hTERT coding sequence (CDS) from
pBABE0puro-hTERT plasmid (Addgene 1771) into LeGO iT vectors between Bg1II and EcoRI
sites. Plasmids were propagated in Stbl3 chemically competent E. coli (ThermoFisher 7137303)
and were sequence-verified by Sanger sequencing (GENEWIZ Inc).
The plasmids LeGO iG-SV40LgT-IRES-eGFP and LeGO iT-hTERT-tdTomato were then
modified by removing the fluorescent marker gene from the construct. Derived LeGO-iT-hTERT-
colorless construct was obtained though deleting tdTomato gene on LeGO iT-hTERT-tdTomato by
using EcoRI (NEB R3101S) and BsrGI (NEB R3575S). To construct the colorless LeGO iG SV40
construct, previous master student Xiuwen Li redesigned the LeGO iG SV40LgT construct by
deleting the fragment between XbaI (NEB R0145S) and Bsu36I (NEB R0524S) on the LeGO iG
parental vector and introduce the SFFV promoter and SV40LgT antigen CDS from the pBABE-
puro SV40LgT-IRES plasmid as well as an oligo which ordered from IDT contained restriction
18

sites including NotI (NEB R3189S), BamHI (NEB R3136S), EcoRI, XhoI (NEB R0146S), PmlI
(NEB R0532S), NheI (NEB R3131S) and BsrGI for later cloning purpose. This redesigned plasmid
was called LeGO iG-SV40LgT-IRES construct in later experiments. Since the woodchuck hepatitis
virus post-transcriptional regulatory element (WPRE) fragment (a sequence that maximizes gene
expression), which was originally on the LeGO iG plasmid, was cut out during the addition of
SV40LgT in the LeGO-iG-SV40LgT-IRES construct, I used T4 ligation kit (NEB 0202S) to
subcloned the WPRE fragment from the LeGO iG parental vector into the LeGO iG-SV40LgT-
IRES vector between NheI and Bsu36I to get LeGO iG-SV40LgTIRES-WPRE colorless construct.
All the plasmids were then propagated in Stbl3 chemically competent E. coli and were sequence-
verified by Sanger sequencing (GENEWIZ Inc) and diagnostic digest verified.
LeGO iG-SV40LgT with AID tag
To construct the LeGO iG-SV40LgT-AID plasmid, the threonine (ACA) and the STOP codon
(TAA) of SV40LgT from the colorless LeGO-iG-SV40LgTIRES-WPRE plasmid were mutagenized
to an AgeI site (ACCGGT) for insertion of the AID tag using the GeneArt Site-Directed
Mutagenesis Plus Kit (Invitrogen A14551). Plasmids were propagated in Stbl3 chemically
competent E. coli and were sequence-verified by Sanger sequencing. Then I used T4 ligation kit
to subclone the AID-STOP codon using AID-STOP ultramers ordered from IDT which contained
AgeI, the whole AID sequence, the STOP codon after AID sequence and EcoRI sites, into the
colorless LeGO-iG-SV40LgTIRES-WPRE vector between AgeI (NEB R3552S) and EcoRI sites.
The plasmid, LeGO iG SV40LgT-AID colorless construct, was then propagated in Stbl3 chemically
19

competent E. coli and was sequence-verified by Sanger sequencing (GENEWIZ Inc) and
diagnostic digest verified.
LeGO-iG-SV40LgT containing LoxP sites
To construct the LeGO iG-flox-SV40LgT construct, the Sbf I site (CCTGCAA) from colorless
LeGO-iG-SV40 at location 5193 was destroyed by mutagenesis using the Q5 Site-directed
Mutagenesis Kit (NEB E0552S) to make the SbfI site located before SV40LgT sequence unique
for upstream insertion of loxP . After mutagenesis, the plasmid was verified by Sanger sequencing.
I then used T4 ligation kit to subclone the loxP oligo ordered from IDT into LeGO iG SV40LgT-
IRES-WPRE colorless construct between SbfI (NEB R3642S) and BamHI. The plasmid was then
propagated in Stbl3 chemically competent E. coli and was sequence-verified by Sanger sequencing
and diagnostic digest verified. This construct was then be used as the vector for downstream
insertion of loxP site. The downstream loxP insertion is currently underway at the time of this
thesis
osTIR-containing plasmid
To construct the TIR expression plasmid for AID system, the original pUCHR-osTIR1-IRES-
GFP plasmid was obtained from Addgene (Addgene 110661). To keep the construct colorless, I
then replaced the GFP gene on the original pUCHR-osTIR1-IRES-GFP plasmid with the
hygromycin resistance gene for selection purposes. The hygromycin resistance gene from PB-
TRE-dCas9-VPR plasmid (Addgene 63800) was then subcloned into the place of GFP on the
20

pUCHR-osTIR1- IRES vector between BxtX1 (NEB R0113S) and PspX1 (NEB R0656S). The
plasmid was then propagated in Stbl3 chemically competent E. coli and was sequence-verified by
Sanger sequencing and diagnostic digest verified.
Bacterial transformation
To propagate the plasmids, 5 uL of each ligation reaction was incubated with 25uL of the
Stbl3 chemically competent E. coli. After 30 minutes of incubation on ice, competent E. coli.were
heat-shocked for 45 seconds and set back on ice for 2 minutes. The transformed E. coli were then
incubated in a 37
o
C incubator with 225 rpm shaking for 1 hour and then plated on agar plates with
proper antibiotics in working concentration for selection (100 mg/ml Ampicillin for LeGO iG and
LeGO iT-derived plasmids and 150 mg/ml hygromycin for PB-TRE-dCas9-VPR and pUCHR-
osTIR1-IRES-Hygromycin plasmids). The plates were then incubated in the 37
o
C incubator
overnight. For miniprep analysis single colonies were picked and transferred into 5 ml LB broth
with proper antibiotic in working concertation for overnight culture in the 37
o
C

incubator with
shaking at 225 rpm.
DNA extraction
The miniprep cultures were spun down in a microfuge at 13000 rpm for 3 minutes. After
carefully removing the LB broth without disturbing the cell pellet, the cells were resuspended in
P1 buffer provided in the QIAGEN Plasmid Mini/Midi kit (QIAGEN 12143). The suspended
bacteria were lysed using P2 buffer for 4 minutes and neutralized by thoroughly mixing with P3
21

buffer (both included with the kit). The liquid was spun down again at 13500 rpm for 10 minutes.
The supernatant was transferred to a QIAprep spin column (included with the kit) and spun down
at 13000 rpm for 1 minute. After discarding the flowthrough, the column was washed by adding
750 ul PE buffer and spinning for 1 minute at 13000 rpm. After discarding the PE buffer, an
additional 1 minute 13000 rpm spin was performed to remove the residual PE in the column. 30
uL ultrapure H 2O was added to the column to elute the plasmid DNA. The concentration of the
plasmids was measured using Thermo NanoDrop ND-1000 UV/VIS Spectrophotometer by
applying 2uL of the product to lower measurement pedestal of the spectrophotometer after H2O
blanking.

22

Chapter 3 Results
3.1 Generation of colorless constructs for future lineage tracing experiments
In order to optimize the construct previously used to immortalize AECs to enable lineage tracing
using a color-based system, I removed sequence encoding the fluorescent protein from the previous
constructs using restriction digestion.
For the LeGO iG-SV40LgT-IRES colorless construct, a woodchuck hepatitis virus post-
transcriptional regulatory element (WPRE) fragment was reintroduced to the vector to complete
the construct (Figure 5A). Since the size of WPRE fragment is relatively small and hard to
visualize on an agarose gel, we decided to screen for the plasmid that indicates successful ligation
first and then verified the plasmid by Sanger Sequencing. After the ligation, the ligation product
was transformed into bacteria, and plasmid was extracted from one of the single colonies after
transformation. To validate the ligation product, LeGO iG-SV40LgT-WPRE colorless construct
was digested by Bsu36I with SpeI (NEB R0133S), SalI (NEB R3138S) or ScaI (NEB R3122S)
and compared to plasmid the digested with the LeGO iG SV40LgT IRES plasmid that digested with
the same sets of enzymes as mentioned in Figure 5C. As shown in Figure 5e, the diagnostic digest
for each set of enzymes provided band patterns and sizes that confirmed the prediction. The follow-
up Sanger sequencing indicated a correct insertion of the WPRE fragment at the desired order and
position, however, a 35-base-pair deletion in the C-terminal end of the WPRE fragment was noted
(Figure. S2). Whether this deletion will affect WPRE function is unclear; the element consists of
23

3 components, γ component, α component and β component. Both γ component and α
component are intact and thus it may function properly (29). The reasons causing this deletion in
the final plasmid and the efficiency of WPRE function are under further evaluation. In the
meantime, this plasmid was then used in later experiments as the LeGO iG-SV40LgT-WPRE
colorless construct.
For the LeGO iT-hTERT colorless construct, the tdTomato gene was removed from the plasmid
and ligated the vector back using an oligo to bridge the restriction sites and relegate the vector
(Figure 5B). Since the oligo is too small to be observed on agarose gel, we decided to screen for
colonies with successful ligation and then verified the sequence by Sanger sequencing. After the
ligation, ligation product was transformed into bacteria, and I was able to extract the plasmid from
one of single colonies after transformation. I then digested the colorless LeGO iT hTERT construct
by either EcoRI+BsrGI+NheI or NotI+BsrGI and predicted the digestion result as mentioned in
Figure 5D. As shown in Figure 5f, the diagnostic for each set of enzymes provided correct band
patterns and sizes as the prediction. For the enzyme set of EcoRI+BsrGI+NheI, colorless LeGO iT
hTERT no longer contained the band around 2 kb found in the parental vector. For NotI+BsrGI set,
colorless LeGO iT hTERT was linearized compared to two-band pattern on LeGO iT hTERT
tdTomato. The follow-up Sanger sequencing indicates proper ligation of the plasmid (Figure S3).
The plasmid was then used in later experiments as the LeGO iT-hTERT colorless construct.
24

25

26

27

Figure 5. Plasmid verification of colorless LeGO-iG-SV40LgT and colorless LeGO-iT-hTERT. A) cloning Schematic for
colorless LeGO iG-SV40LgT, B) cloning schematic for colorless LeGO iT hTERT. The ligation products were transformed
into Stbl3 competent cells. The DNA was extracted from single colonies. C) schematic for combination digestion of LeGO
iG SV40LgT IRES control and LeGO iG SV40LgT IRES WPRE colorless construct and expected band difference between
the two plasmids after digestion (the remaining vector after digestion is not shown on the schematic). D) schematic for
combination digestion of LeGO iG SV40LgT IRES control and LeGO iG SV40LgT IRES WPRE colorless construct and
expected band difference between the two plasmids after digestion (the remaining vector after digestion is not shown on
the schematic). The comparison was done to E) LeGO iG Sv40LgT colorless construct (WPRE) and LeGO iG SV40LgT-
IRES (CON) and F) LeGO iT-hTERT colorless construct (Colorless) and LeGO iT hTERT tdTomato (CON) after
combination digestion for plasmid validation.

3.2 Design strategy for the auxin-inducible degradation (AID) of SV40LgT
system
Since SV40LgT is critical for the immortalization of AECs but not present in human lung
adenocarcinoma, we aimed to design a system in which the presence of SV40LgT is reversible.
SV40LgT protein binds to pRB1 and interrupts the RB1-E2F complex, which leads to robust
proliferation. One option to reverse the presence of SV40LgT is to use a system that can modulate
SV40LgT at the protein level (15). The auxin-inducible degradation system, also known as the
AID-degro system, is a plant-derived degradation system in which the robust protein degradation
28

of the AID-fused protein has been shown in the presence of the TIR1 protein and the plant hormone,
auxin. In the presence of auxin, the plant F-box protein TIR1 from rice (Oryza sativa) can bind to
proteins that contain an AID motif and trigger their degradation via the proteasome (Figure 6a)
(30). Since osTIR1 is a plant gene responding to a plant hormone, this system can be used in a
human cell model without disturbing the normal mammalian protein degradation process of the
cell.
We fused the AID motif onto the C-terminus of SV40LgT before the stop codon. A computer
algorithm prediction kindly carried out by Dr. Ian Haworth from the USC School of Pharmacy
indicated that C-terminal addition of the AID motif would be unlikely to interfere with the ability
of SV40LgT to bind to TP53 and RB1 (Figure 6B). Since we wanted to fuse the AID sequence to
the SV40LgT sequence in the correct reading frame, we decided to insert the AID sequence before
the SV40LgT stop codon so that this sequence can be properly expressed. However, since there
were no restriction sites near the C-terminal region of SV40LgT before the stop codon, we decided
to mutagenize the last two amino acid sequence, threonine and STOP codon (ACATAA), into an
Age1 site (Threonine and Glycine: ACCGGT) and use the new AgeI site with EcoRI site right after
the reading frame of SV40LgT sequence for AID insertion (Figure 6C). The AID sequence was
then inserted into the colorless LeGO iG SV40LgT-WPRE plasmid after the mutagenesis between
AgeI site and EcoRI site (Figure 6D). Products from AID insertion reaction were transformed into
the bacteria and DNA was extracted after transformation. The plasmid was then digested by AgeI
with either SalI or ScaI for further diagnostic purposes as shown in Figure 6F. As shown in Figure
6H, all digestion results indicate successful AgeI mutagenesis and a possible AID addition. The
29

follow-up Sanger sequencing confirmed a correct insertion of the AID tag at the desired position
(Figure S4). This plasmid was used in later experiments as the colorless LeGO iG-SV40LgT-AID
construct.
The osTIR-containing plasmid pUCHR-osTIR1 -eGFP (Addgene 110661) was also modified to
remove the eGFP gene to generate the colorless characteristic of all constructs. Additionally, since
there was no selection marker other than the eGFP gene on the pUCHR-osTIR-eGFP plasmid, a
hygromycin resistance gene was added to replace the GFP gene for selection purposes (Figure.
6E). After the hygromycin gene replacement, single colonies were inoculated, and the DNA was
extracted. The extracted plasmid was then digested with SbfI and NotI and compared with the
original pUCHR-osTIR-eGFP cut with the same set of enzymes for validation. Expected band
patterns and sizes for both plasmids after digestion are shown in Figure 6G. The diagnostic
digestion result (Figure 6I) followed the prediction, and the follow-up Sanger sequencing indicates
a correct replacement of eGFP with the hygromycin gene in the desired position (Figure S5). This
plasmid will be validated in A540 cells as the colorless pUCHR-osTIR-hygro construct.
30

31

32

33

34

Figure 6. Plasmid validation of AID fusion on SV40LgT fragment in colorless LeGO iG SV40LgT and modification of
PUCHR-osTIR-eGFP A) a schematic of AID degradation system in vitro. B) Molecular modeling by Dr. Ian Haworth
predicted that the AID motif would be unlikely to interfere with the ability of SV40LgT to bind to TP53 (gray) and RB1
(purple) C) mutagenesis plan for LeGO iG Sv40LgT colorless construct to create in-frame mutation for Stop codon removal
and AgeI addition. D) cloning Schematic for LeGO iG SV40LgT AID construct E) cloning Schematic for pUCHR-osTIR-
hygromycin construct. F) schematic for combination digestion of LeGO iG SV40LgT colorless control and LeGO iG
SV40LgT AID colorless construct and expected band difference between the two plasmids after digestion (the remaining
vector after digestion is not shown on the schematic). G) schematic for combination digestion of pUCHR-osTIR-eGFP
control and pUCHR-osTIR-hygromycin colorless construct and expected band difference between the two plasmids after
digestion (the remaining vector after digestion does is not shown on the schematic). The comparison was done to H) LeGO
iG SV40LgT AID (AID) and LeGO iG SV40LgT colorless construct (CON) and I) pUCHR-osTIR-hygromycin (hygro) and
pUCHR-osTIR-eGFP (CON) after combination digestion for plasmid validation.
3.3 Design strategy for the Cre-Lox inactivation of SV40LgT
Although the AID system can be used to modulate SV40LgT expression at the protein level, it
requires constant treatment with auxin to suppress SV40LgT protein, which could be a stressful
condition to the cells. Therefore, we also examine an alternative irreversible system in which
SV40LgT can be permanently deleted after the AECs have grown into an organoid. I, therefore,
modified the LeGO iG-SV40LgT-WPRE colorless construct by adding loxP sites upstream and
downstream of SV40LgT so that when immortalized AECs are infected with Adenovirus carrying
Cre recombinase, SV40LgT will irreversibly be deleted. However, since the unique restriction sites
35

on desired positions were not enough on LeGO iG-SV40LgT-WPRE colorless construct for both
the upstream and downstream insertions of loxP , we decided to mutate one of the double cutters to
a unique site. As shown in Figure 7A SbfI was a double cutter that cut before SV40LgT and in
between SV40LgT and IRES. We mutagenized the SbfI site that was located at the C-terminus to
destroy this site. After the mutagenesis, SbfI and Bsu36I were chosen to be the combination of
restriction sites for upstream loxP insertion while XhoI and NheI were used for downstream loxP
insertion (Figure 7B). As shown in Figure 7C, DNA from colonies obtained after the upstream
loxP insertion was extracted and run on a 1% agarose gel-red DNA gel for screening purposes.
Five out of six colonies showed a band pattern similar to the parental LeGO iG SV40LgT vector,
which indicates a possible ligation. The follow-up Sanger sequencing indicated a correct insertion
of a loxP site at the desired position (Figure S6). Plasmid SW3 was used in later experiments as
the LeGO iG-LoxP-SV40LgT colorless construct which has the upstream loxP inserted. Additional
diagnostic digests for upstream loxP insertion as well as the insertion for downstream loxP
insertion are currently underway at the time of this thesis.
36

37

38

Figure 7. Plasmid verification of loxP insertion on colorless LeGO iG SV40LgT. A) Schematic for SbfI mutagenesis for
upstream insertion of loxP. B) Clone schematic for both upstream and downstream insertion of loxP for LeGO-iG loxP -
SV40LgT- loxP construct. C) 200ug plasmid extracted from each single colony for upstream loxP insertion of LeGO-iG
loxP -SV40LgT- loxP was loaded on a 1% agarose gel-red DNA gel and compared with undigested LeGO-iG Sv40 colorless
construct (negative control) to screen for successful ligation.

39

Chapter 4 Discussion
Lung adenocarcinoma (LUAD) is still the most common histological subtype of lung cancer
and yet there is no proper non-cancer human cell model system to study its initiation and
progression in vitro. Previously, Dr. Evelyn Tran in our lab successfully generated immortalized
AEC lines using purified AT2 cells from the normal lung with the help of SV40LgT transduction.
However, since SV40LgT is a viral protein and not an endogenous human gene, its presence in the
AEC genome does not provide an ideal model for the study of LUAD. Also, since the initially used
construct was labeled with GFP, the utility of the original AEC lines is limited due to the possible
color interference of GFP with other color-based systems in the cell under the fluorescent
microscope. Therefore, in this project, I optimized the constructs which are colorless and allowed
to remove SV40LgT using three different ways so that immortalized AEC model generated using
this optimized construct could be used as a powerful tool in a variety of experiments.
First, by removing GFP from the construct, the cell lines generated by this new construct will
be colorless, and be usable in lineage tracing experiments, such as those using the BrainBow
system (Figure 8). This system allows the tracing of cell proliferation and differentiation by
randomly labeling cells with different colors (31).
40

Figure 8. Lineage tracing in human embryonic kidney (HEK) cells using BrainBow 3.0 (31). HEK cells were randomly
genetically label by red, blue, or green fluorescent proteins. Color genes were inherited after cell division and can thus be
Next, I generated two different systems to achieve the modulation/deletion of SV40LgT in vitro.
The AID degradation system will allow reversible protein degradation of SV40LgT via the
proteasome in an auxin-dependent manner. This system can help us understand the amount of
SV40LgT required for AEC immortalization and to allow and maintain the growth of organoids.
The Cre-Lox system is an irreversible deletion system, which provides us with the opportunity
to substitute the effects of SV40LgT antigen in AEC with more natural oncogenic driver genes such
as KRAS
G12D
, found in ~25% of LUAD patients (32). The KRAS

protein is a part of the RAS/MAPK
pathway, which is known for its function in initiating proliferation (33). The KRAS
G12D
mutation
41

is found in many different cancer types including colorectal cancer and liver cancer and is known
to be a key factor in cancer development (32, 34, 35). By combining a flox-activatable KRAS
G12D

mutation with the AECs that carry a loxP-flanked SV40LgT (Figure 9), we will be able to infect
with Adeno-Cre virus and simultaneously delete SV40LgT and turn on the KRAS
G12D
mutation. To
minimize the unexpected cutting event due to multiple loxP site addition in the genome and
increase the specificity for the correct loxP excisions, we will design the flox-activatable KRAS
G12D

mutation construct with alternative loxP sites that are different than the ones in flox-SV40
construct. This would be particularly interesting in the 3D alveolar-like structures. This will allow
us to study the function of the KRAS
G12D
mutation in the early stages of neoplastic transformation
of the AECs. In the future, this system will also allow us to perform large-scale drug screens to
target the effects of the KRAS
G12D
mutation in a human organoid environment.

42

Figure 9. Schematic of Cre-Lox-activatable system for KRAS
G12D
mutation in cells (36)
All of the constructs have been completed, and the next step is to validate if they are functional.
I will perform validation using A549 cells (easy to grow and transfect) first and then primary AECs
(a limited resource). We need to test if SV40LgT can be reduced/deleted via the two systems I
generated, the AID degradation system using LeGO iG SV40LgT-AID construct and Cre-lox
system using LeGO iG flox-SV40 construct. SV40LgT expression could be measured in A549 cells
via a Western blot with antibodies targeting the SV40LgT protein.
Since we cannot test hTERT expression in cancer cell lines due to constant hTERT expression
in A549 cells, we will validate the construct in AECs directly after the transduction and test the
hTERT activity via TRAP assay (37). By introducing this construct to the AEC line, the new AEC
line will constantly express hTERT and therefore have a much more stabilized genome for later
43

immortalization purposes.
Once the systems have been validated, applying the constructs with the modifiable SV40LgT
would allow us to generate new and more versatile AEC cell lines. We will first combine the
SV40LgT-AID system with the flox-activatable KRAS
G12D
mutation in organoids by co-transducing
flox-activatable KRAS
G12D
construct with the SV40LgT-AID construct to the cell to check if the
KRAS
G12D
mutation activation in organoids is able to maintain AEC proliferation without the
presence of SV40LgT in the organoid state since the SV40LgT-AID system is reversible. If
SV40LgT is not essential and can be replaced by KRAS
G12D
, we will use the AEC organoid derived
from flox-SV40LgT construct and flox-activatable KRAS
G12D
mutation to irreversibly delete
SV40LgT in cell and further examine the transition from normal alveolar epithelial cells to cancer
cells in organoid caused by KRAS
G12D
mutation.

44

References
1. C. E. Barkauskas et al., Type 2 alveolar cells are stem cells in adult lung. The Journal of
clinical investigation 123, 3025-3036 (2013).

2. P. R. Tata, J. Rajagopal, Plasticity in the lung: making and breaking cell identity.
Development (Cambridge, England) 144, 755-766 (2017).

3. J. R. Rock, B. L. Hogan, Epithelial progenitor cells in lung development, maintenance,
repair, and disease. Annu Rev Cell Dev Biol 27, 493-512 (2011).

4. K. T. Leeman, C. M. Fillmore, C. F. Kim, Lung stem and progenitor cells in tissue
homeostasis and disease. Current topics in developmental biology 107, 207-233 (2014).

5. a. c. society. (American cancer society, atlanta, 2021).

6. P. M. de Groot, C. C. Wu, B. W. Carter, R. F. Munden, The epidemiology of lung cancer.
Transl Lung Cancer Res 7, 220-233 (2018).

7. Z. Chen, C. M. Fillmore, P. S. Hammerman, C. F. Kim, K. K. Wong, Non-small-cell lung
cancers: a heterogeneous set of diseases. Nat Rev Cancer 14, 535-546 (2014).

8. W. D. Travis et al., International Association for the Study of Lung Cancer/American
Thoracic Society/European Respiratory Society: international multidisciplinary
classification of lung adenocarcinoma: executive summary. Proc Am Thorac Soc 8, 381-
385 (2011).

9. J. Tabernero, The role of VEGF and EGFR inhibition: implications for combining anti-
VEGF and anti-EGFR agents. Mol Cancer Res 5, 203-220 (2007).

10. B. Chen, L. You, Y. Wang, G. D. Stoner, M. You, Allele-specific activation and
expression of the K-ras gene in hybrid mouse lung tumors induced by chemical
carcinogens. Carcinogenesis 15, 2031-2035 (1994).

11. R. Meuwissen, A. Berns, Mouse models for human lung cancer. Genes Dev 19, 643-664
(2005).

12. R. Safari, R. Meuwissen, Practical use of advanced mouse models for lung cancer.
Methods Mol Biol 1267, 93-124 (2015).

45

13. Z. Li et al., Human Lung Adenocarcinoma-Derived Organoid Models for Drug
Screening. iScience 23, 101411-101411 (2020).

14. M. Kim et al., Patient-derived lung cancer organoids as in vitro cancer models for
therapeutic screening. Nature communications 10, 3991-3991 (2019).

15. D. Ahuja, M. T. Sáenz-Robles, J. M. Pipas, SV40 large T antigen targets multiple cellular
pathways to elicit cellular transformation. Oncogene 24, 7729-7745 (2005).

16. H. E. Puntervoll et al., Melanoma prone families with CDK4 germline mutation:
phenotypic profile and associations with MC1R variants. J Med Genet 50, 264-270
(2013).

17. J. Campisi, L. Robert, Cell senescence: role in aging and age-related diseases. Interdiscip
Top Gerontol 39, 45-61 (2014).

18. B. G. Childs, D. J. Baker, J. L. Kirkland, J. Campisi, J. M. van Deursen, Senescence and
apoptosis: dueling or complementary cell fates? EMBO reports 15, 1139-1153 (2014).

19. I. Ben-Porath, R. A. Weinberg, The signals and pathways activating cellular senescence.
The International Journal of Biochemistry & Cell Biology 37, 961-976 (2005).

20. E. H. Blackburn, J. G. Gall, A tandemly repeated sequence at the termini of the
extrachromosomal ribosomal RNA genes in Tetrahymena. J Mol Biol 120, 33-53 (1978).

21. S. Bekaert, T. De Meyer, P. Van Oostveldt, Telomere attrition as ageing biomarker.
Anticancer Res 25, 3011-3021 (2005).

22. S. B. Cohen et al., Protein Composition of Catalytically Active Human Telomerase from
Immortal Cells. Science 315, 1850 (2007).

23. A. Cukusić, N. Skrobot Vidacek, M. Sopta, I. Rubelj, Telomerase regulation at the
crossroads of cell fate. Cytogenet Genome Res 122, 263-272 (2008).

24. R. R. Reddel et al., Transformation of human bronchial epithelial cells by infection with
SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate
coprecipitation with a plasmid containing SV40 early region genes. Cancer Res 48, 1904-
1909 (1988).

25. A. S. Lundberg et al., Immortalization and transformation of primary human airway
epithelial cells by gene transfer. Oncogene 21, 4577-4586 (2002).
46

26. R. D. Ramirez et al., Immortalization of human bronchial epithelial cells in the absence
of viral oncoproteins. Cancer Res 64, 9027-9034 (2004).

27. Q. Li et al., Histone arginine methylation by Prmt5 is required for lung branching
morphogenesis through repression of BMP signaling. J Cell Sci 131, (2018).

28. E. Tran et al., Development of novel in vitro human alveolar epithelial cell
models to study distal lung biology and disease. bioRxiv, 2020.2012.2025.424415 (2020).

29. J. E. Donello, J. E. Loeb, T. J. Hope, Woodchuck hepatitis virus contains a tripartite
posttranscriptional regulatory element. J Virol 72, 5085-5092 (1998).

30. L. Zhang, J. D. Ward, Z. Cheng, A. F. Dernburg, The auxin-inducible degradation (AID)
system enables versatile conditional protein depletion in C. elegans. Development 142,
4374-4384 (2015).

31. T. A. Weissman, Y. A. Pan, Brainbow: new resources and emerging biological
applications for multicolor genetic labeling and analysis. Genetics 199, 293-306 (2015).

32. H. C. Cho, C. Y . Lai, L. E. Shao, J. Yu, Identification of tumorigenic cells in
Kras(G12D)-induced lung adenocarcinoma. Cancer Res 71, 7250-7258 (2011).

33. J. Yun et al., Glucose deprivation contributes to the development of KRAS pathway
mutations in tumor cells. Science 325, 1555-1559 (2009).

34. C. Tan, X. Du, KRAS mutation testing in metastatic colorectal cancer. World J
Gastroenterol 18, 5171-5180 (2012).

35. J. Luo, KRAS mutation in pancreatic cancer. Seminars in Oncology, (2021).

36. P. Kelmenson, in cre-lox-breeding. (The Jackson Laboratory, 2011).

37. R. Y. Mohammad, G. Somayyeh, H. Gholamreza, M. Majid, R. Yousef, Diosgenin
inhibits hTERT gene expression in the A549 lung cancer cell line. Asian Pac J Cancer
Prev 14, 6945-6948 (2013).

47

Appendices
Figure S1. Schematic for cloning steps of LeGO iG SV40LgT IRES
Figure S2. Sequencing result for WPRE fragment insertion in colorless LeGO iG SV40LgT
construct
Figure S3. Sequencing result for tdTomato gene deletion in colorless LeGO iT hTERT
construct
Figure S4. Sequencing result for AID sequence insertion in colorless LeGO iG-SV40LgT
construct
Figure S5. Sequencing result for hygromycin resistant gene insertion in PUCHR-osTIR-
hygro construct
Figure S6. Sequencing result for Upstream loxP insertion in LeGO iG loxP-SV40LgT-loxP

48

Supplementary Data

Figure S1. Schematic for cloning steps of LeGO iG SV40LgT IRES

Figure S2. Sequencing result for WPRE fragment insertion in colorless LeGO iG SV40LgT construct. Most of the WPRE
fragment sequence alignment perfectly with sequencing result expect a 35 base-pair deletion on the C-terminal of WPRE
fragment.

49

Figure S3. Sequencing result for tdTomato gene deletion in colorless LeGO iT hTERT construct

Figure S4. Sequencing result for AID sequence insertion in colorless LeGO iG-SV40LgT construct
50

Figure S5. Sequencing result for hygromycin resistant gene insertion in PUCHR-osTIR-hygro construct

Figure S6. Sequencing result for Upstream loxP insertion in LeGO iG loxP-SV40LgT-loxP

Abstract (if available)

Abstract Lung adenocarcinoma is one of the leading causes of lung cancer death worldwide. However, there is no proper non-cancer cell model to study its initiation yet. Dr, Evelyn Tran has generated an immortalized human alveolar epithelial cell line model by using SV40-LgT antigen. But since SV40 LgT was not an endogenous alteration found in human diseases, optimizations are needed so that SV40 LgT expression could be precisely controlled for lung adenocarcinoma study. We are generating two different constructs to achieve the modulation of SV40 in cells. Construct using auxin-initiated degradation (AID) tag system to label SV40 enables the reversible modulate of SV40-LgT in the lung AT2 cell for validation of the SV40 function in AEC proliferation process in culture. Another Construct using Cre-lox system which has LoxP sites flanks SV40-LgT allows irreversible deletion of SV40-LgT that enables the substitution of different tumor drives for the study the lung adenocarcinoma initiation.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

In vitro lineage tracing of immortalized human alveolar epithelial cells

PDF

Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

PDF

Generation of an epigenetic toggle switch to test LINC00261 function on lung adenocarcinoma cellular response to the chemotherapeutics oxaliplatin and carboplatin

PDF

Long-term expansion of human alveolar epithelial cells as a novel model system to study lung disease progression in vitro

PDF

Elucidating the cellular origins of lung adenocarcinoma

PDF

Evaluating the impact of long non-coding RNAs on tumor mutational burden in cancer

PDF

CpG methylation profiling in lung cancer cell lines, tumors and non-tumors

PDF

DNA methylation changes in the development of lung adenocarcinoma

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

Development of DNA methylation biomarkers as an early detection tool for human lung adenocarcinoma

PDF

Development of immunotherapy for small cell lung cancer using iso-aspartylated antigen

PDF

LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

PDF

Determining the epigenetic contribution of basal cell identity in cystic fibrosis

PDF

Development of DNA methylation based biomarkers for the early detection of squamous cell lung cancer

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

Development of immunotherapy for small cell lung cancer using novel modified antigens

PDF

Anti-Hu immuno-responsivenss in small-cell lung cancer

PDF

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

Asset Metadata

Creator Li, Junyi (author)

Core Title Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Degree Conferral Date 2021-08

Publication Date 07/26/2021

Defense Date 06/04/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Auxin-inducible system,lineage tracing,lung adenocarcinoma,non-cancer human cell model,OAI-PMH Harvest,SV40LgT antigen

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Offringa, Ite A. (committee chair), Marconett, Crystal N. (committee member), Zhou, Beiyun (committee member)

Creator Email chrisleeqd@gmail.com,jli71103@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15623322

Unique identifier UC15623322

Legacy Identifier etd-LiJunyi-9891

Document Type Thesis

Format application/pdf (imt)

Rights Li, Junyi

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu