University of Southern California Dissertations and Theses

Development of TCR-like antibody and novel chimeric antigen receptor for cancer immunotherapy

(USC Thesis Other)

Development of TCR-like antibody and novel chimeric antigen receptor for cancer immunotherapy

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content
DEVELOPMENT OF TCR-LIKE ANTIBODY AND NOVEL CHIMERIC ANTIGEN
RECEPTOR FOR CANCER IMMUNOTHERAPY

by

XIN LIU

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(Infectious Diseases, Immunology and Pathogenesis)

August 2021

Copyright 2021 Xin Liu
ii
DEDICATION

To my beloved grandma: I am sorry that I missed your 100
th
birthday party and funeral.
Thank you for everything. May the God be with you.

To the ones who love me and I love: I am grateful to have you in my life.

iii
ACKNOWLEDGEMENTS

First and foremost, I would like to express my gratitude to my Ph.D. mentor, Dr. Rongfu
Wang for his support, mentorship and patience around all these years. None of those work would
be done without his high demanding, standard and scientific qualification. He made me become
an independent scientist and acquire critical thinking regarding scientific questions. His innovative
attitude to science and his motto “everything is possible” taught me that we could always perform
better. Thanks Ms. Helen Wang for the generous support in my research career and life. I also
want to thank my current committee members: Dr. Weiming Yuan and Dr. Leonardo Morsut, and
previous committee member: Yubin Zhou, Margie Moczygemba, Yi Xu and Qi Cao, who not only
gave me valuable advices and suggestions about my project and guided me through the difficulties,
but also provided help in life and career.
My sincere thanks also go to all my labmates and friends: Dr. Changsheng Xing, Dr. Motao
Zhu, Dr. Chen Qian, Ms. Bingnan Yin, Dr. Junjun Chu, Dr. Yang Du, Dr. Tianhao Duan. We have
gone through all the difficulties: hurricane, flood, wide fire, earthquake and pandemic, and all the
joy. I would also like to thank all the people who brought happiness and contributed to my success
including Hongye Li, Pinghua Liu, Chumeng Chen, Siyao Liu, Pengfei Zhang and lots of students
from Sun Yatsen University and Xiangya medical school. I would like to express my deep gratitude
to my collaborators, Dr. Zhiqiang An, Dr. Ningyan Zhang, Dr. Yixiang Xu and Dr. Wei Xiong,
who helped me and made the project interesting and promising. Thanks Cindy Lewis, Bami
Andrada, Domonique Walker, Timothy Chung and other administrative staffs for all the
paperwork.
iv
Last but not least, I would express my deepest gratitude to my family, my father Renyuan
Liu, mother Aizhen Wang, my sister Xiao Liu. Thank you for your support and love. Your kindness,
diligence, braveness and honesty set a good example for me. I want to specially express my love
to my wife: Wenfeng Li for your persistence, hardworking and selfless love. It is tough for us to
live in different countries and take care of our baby daughter Yuanxi (Emma) Liu. We made it!
Love you forever!

v
TABLE OF CONTENTS
PAGE

DEDICATION ................................................................................................................................ ii
ACKNOWLEDGEMENTS ........................................................................................................... iii
LIST OF TABLES ....................................................................................................................... viii
LIST OF FIGURES ....................................................................................................................... ix
ABBREVIATIONS ....................................................................................................................... xi
ABSTRACT ................................................................................................................................. xvi
Chapter 1: Introduction ................................................................................................................... 1
1.1 BCRs and antibodies ............................................................................................................. 1
1.1.1 Mechanism of Action ..................................................................................................... 2
1.1.2 Antibody modifications ................................................................................................. 4
1.2 T Cell Receptor (TCR) ......................................................................................................... 6
1.2.1 Soluble TCRs ................................................................................................................. 6
1.3 Antibody discovery ............................................................................................................... 7
1.3.1 Hybridoma technology ................................................................................................... 8
1.3.2 Phage display ............................................................................................................... 10
1.4 TCR-like antibody .............................................................................................................. 12
1.4.1 Generation of TCR-like antibodies .............................................................................. 15
1.5 Adoptive cell transfer (ACT) .............................................................................................. 23
1.5.1 Tumor infiltrating lymphocytes (TILs) ........................................................................ 24
1.5.2 T cell receptor engineered T cells (TCR)..................................................................... 25
1.5.3 Chimeric antigen receptor engineered T cells (CAR) .................................................. 30
1.5.3.1 Key Elements of Chimeric Antigen Receptor Composition ................................. 32
1.5.3.2 Methods of T cell transduction ............................................................................. 37
1.5.3.3 Methods for improving safety. .............................................................................. 38
1.5.3.4 Improvement of CAR-T signaling and persistence .............................................. 46
Chapter 2: Development of TCR-Like Antibody and Chimeric Antigen Receptor for Cancer
Immunotherapy ............................................................................................................................. 53
2.1 Abstract ............................................................................................................................... 53
2.2 Introduction ......................................................................................................................... 53
2.3 Materials and methods ........................................................................................................ 55
2.3.1 Animal .......................................................................................................................... 55
2.3.2 Cell lines ...................................................................................................................... 55
2.3.3 Panning of phage-displayed scFv antibody library ...................................................... 56
vi
2.3.4 Phage ELISA ............................................................................................................... 57
2.3.5 Antibody production and purification .......................................................................... 57
2.3.6 ELISA of purified NY-ESO-1 antibodies .................................................................... 58
2.3.7 Generation of retroviral constructs and transduction ................................................... 58
2.3.8 Cytokine detection ....................................................................................................... 58
2.3.9 Flow Cytometry ........................................................................................................... 59
2.3.10 Confocal imaging ....................................................................................................... 59
2.3.11 Immunohistochemistry .............................................................................................. 60
2.3.12 LDH cytotoxicity release assay.................................................................................. 60
2.3.13 Toxicity studies .......................................................................................................... 60
2.3.14 Statistical analysis ...................................................................................................... 61
2.4 Results ................................................................................................................................. 62
2.4.1 Screening and selection of specific scFv for HLA-A2/NY-ESO-1 complex and
engineering of full-length human mAb ................................................................................. 62
2.4.2 Characterization of 2D2 mAb ...................................................................................... 66
2.4.3 Retrovirally transduced T cells express the 2D2-BBZ CAR ....................................... 68
2.4.4 2D2-BBZ CAR T cells specifically recognize and lyse HLA-A2
+
, NY-ESO-1
+
cells in
vitro. ...................................................................................................................................... 68
2.4.5 2D2-BBZ CAR T cells prolong the survival of mice bearing triple negative breast cancer
in vivo. ................................................................................................................................... 72
2.4.6 2D2-CAR T cells demonstrates anti-tumor activity against an endogenously expressing
A2/NY-ESO-1 tumor model in vivo. .................................................................................... 75
2.4.7 Safety assessment of 2D2-CAR T cells demonstrates no damage to key organs in vivo.
............................................................................................................................................... 78
2.5 Discussion ........................................................................................................................... 80
Chapter 3: A novel Chimeric Antigen Receptor with Zap70 enhances anti-tumor activity by
generating long-lived memory cells and lowering exhaustion markers ....................................... 84
3.1 Abstract ............................................................................................................................... 84
3.2 Introduction ......................................................................................................................... 84
3.3 Materials and methods ........................................................................................................ 86
3.3.1 Plasmids ....................................................................................................................... 86
3.3.2 Human PBMC and transduction .................................................................................. 86
3.3.3 Flow cytometry ............................................................................................................ 87
3.3.4 Cell lines ...................................................................................................................... 87
3.3.5 ELISA .......................................................................................................................... 87
3.3.6 LDH cytotoxicity release assay ................................................................................... 88
3.3.7 Serum ........................................................................................................................... 88
3.3.8 Statistical analysis ........................................................................................................ 88
3.3.9 Animal .......................................................................................................................... 89
3.4 Results ................................................................................................................................. 89
3.4.1 Fusion of Zap70 kinase domain to CD3ζ chain enhances anti-tumor activity. ........... 89
3.4.2 Replacement of CD3ζ chain with Zap70 kinase domain remains anti-tumor response in
vitro ....................................................................................................................................... 95
3.4.3 Replacement of CD3ζ chain with Zap70 kinase domain enhances anti-tumor response
in vivo .................................................................................................................................. 102
vii
3.4.4 1928z327 prolongs mice survival by increasing long-lived memory phenotype T cells
and lowering exhaustion markers ....................................................................................... 104
3.5 Discussion ......................................................................................................................... 107
Chapter 4: Conclusion and prospect ........................................................................................... 112
REFERENCES ........................................................................................................................... 116
APPENDICES ............................................................................................................................ 152

viii

LIST OF TABLES
PAGE

TABLE 1- 1 PUBLISHED TCR-LIKE ANTIBODY IN HUMAN DISEASES. ........................................................ 21
TABLE 1- 2 CLINICAL TRIALS ACTIVATED ON ENGINEERED TCR-T CELLS. ........................................... 27
TABLE 1- 3 TIMELINE OF KEY EVENTS FOR CHIMERIC ANTIGEN RECEPTOR DEVELOPMENT .......... 33
TABLE 1- 4 ANTIGENS USED IN CLINICAL TRIALS IN SOLID TUMOR WITH CAR-T CELLS ................... 34
TABLE 1- 5 GENES INVOLVED IN THE REGULATION OF EXHAUSTION AND SENESCENCE PATHWAYS
IN T CELLS. ...................................................................................................................................................... 51

ix
LIST OF FIGURES
PAGE

FIGURE 1- 1 SIMILARITY AND DIFFERENCE BETWEEN BCR AND TCR IN STRUCTURE, DIVERSITY
AND ANTIGEN RECOGNITION. ..................................................................................................................... 1
FIGURE 1- 2 MECHANISMS OF ACTION OF THERAPEUTIC ANTIBODIES ..................................................... 3
FIGURE 1- 3 MODIFICATION OF ANTIBODY-BASED IMMUNOTHERAPY ..................................................... 5
FIGURE 1- 4 TIMELINE FOR DEVELOPMENT OF THERAPEUTIC ANTIBODIES WITH APPLICATIONS
AND MARKET REVENUE. ............................................................................................................................... 8
FIGURE 1- 5 A GENERAL REPRESENTATION OF THE HYBRIDOMA METHOD USED TO PRODUCE
MONOCLONAL ANTIBODIES. ..................................................................................................................... 10
FIGURE 1- 6 SCHEMA OF ANTIBODY (SCFV) PHAGE DISPLAY SELECTION AND SCREENING. ............ 12
FIGURE 1- 7 ANTIGEN PROCESS AND PRESENTATION. ................................................................................. 15
FIGURE 1- 8 GENERAL SCHEMA FOR USING THE ADOPTIVE CELL TRANSFER OF NATURALLY
OCCURRING AUTOLOGOUS TILS. .............................................................................................................. 25
FIGURE 1- 9 THE TARGETED ANTIGEN DISTRIBUTION OF TCR-T CLINICAL THERAPIES FROM 2004 TO
2019. .................................................................................................................................................................. 26
FIGURE 1- 10 GENERATIONS OF CHIMERIC ANTIGEN RECEPTOR. ............................................................. 31
FIGURE 1- 11 OVERCOMING SYSTEMIC CYTOKINE TOXICITIES OF CAR T CELLS. ................................ 40
FIGURE 1- 12 OVERCOMING ON-TARGET, OFF-TUMOR TOXICITIES OF CAR T CELLS. ......................... 43
FIGURE 1- 13 IMPROVING THE EFFICACY OF CAR T CELL THERAPY. ....................................................... 45

FIGURE 2- 1 VERIFICATION OF SPECIFICITY AND QUALITY OF HLA-A2/NY-ESO-1 COMPLEX BY IFN-
γ ELISA. ............................................................................................................................................................. 62
FIGURE 2- 2 SELECTION OF SCFVS SPECIFIC FOR HLA-A2/NY-ESO-1 COMPLEX. .................................... 64
FIGURE 2- 3 SCREENING STRATEGY OF HLA-A2/NY-ESO-1 SPECIFIC ANTIBODIES FROM HUMAN
SCFV PHAGE LIBRARY. ................................................................................................................................ 65
FIGURE 2- 4 CHARACTERIZATION OF 2D2 MAB AND ITS SPECIFICITY. .................................................... 67
FIGURE 2- 5 2D2-BBZ CAR T CELLS SPECIFICALLY RECOGNIZE AND LYZE HLA-A2+, NY-ESO-1+
CELLS IN VITRO. ............................................................................................................................................. 71
FIGURE 2- 6 2D2-BBZ CAR T CELLS SPECIFICALLY RECOGNIZE AND LYZE HLA-A2+, NY-ESO-1+
CELLS IN VITRO. ............................................................................................................................................. 71
FIGURE 2- 7 DAC COULD ENHANCE NY-ESO-1 EXPRESSION IN MRNA LEVEL AND LEAD TO
RECOGNIZE AND KILL BY 2D2-BBZ CAR-T CELLS. ............................................................................... 72
FIGURE 2- 8 2D2-BBZ CAR T CELLS IMPAIR TUMOR GROWTH AND PROLONG THE SURVIVAL OF MICE
BEARING TRIPLE NEGATIVE BREAST CANCER IN VIVO. ..................................................................... 75
FIGURE 2- 9 2D2-CAR T CELLS HAVE INCREASED PERSISTENCE IN SPLEEN AND ENHANCED ABILITY
IN TUMOR INFILTRATION. .......................................................................................................................... 75
FIGURE 2- 10 2D2-CAR T CELLS DEMONSTRATE ANTI-TUMOR ACTIVITY AGAINST AN
ENDOGENOUSLY EXPRESSING A2/ESO TUMOR MODEL IN VIVO ...................................................... 78
FIGURE 2- 11 SAFETY ASSESSMENT OF 2D2-CAR T CELL IN VIVO. ............................................................. 80

FIGURE 3- 1 FUSION OF ZAP70 KINASE DOMAIN TO CD3ζ CHAIN (1928ZZ300) ENHANCES ANTI-
TUMOR ACTIVITY. ........................................................................................................................................ 91
FIGURE 3- 2 FUSION OF ZAP70 KINASE DOMAIN TO CD3ζ CHAIN (1928ZZ327) ENHANCES ANTI-
TUMOR ACTIVITY. ........................................................................................................................................ 93
FIGURE 3- 4 CD19-CAR GENETICALLY ENGINEERED T CELLS SPECIFICALLY ELIMINATE TUMOR
CELLS IN VIVO. ............................................................................................................................................... 94
x
FIGURE 3- 5 REPLACEMENT OF CD3 ZETA CHAIN WITH ZAP70 KINASE DOMAIN (1928Z327) PRESENTS
ANTI-TUMOR ACTIVITY. .............................................................................................................................. 98
FIGURE 3- 6 REPLACEMENT OF CD3 ZETA CHAIN WITH ZAP70 KINASE DOMAIN (1928Z300) PRESENTS
ANTI-TUMOR ACTIVITY. .............................................................................................................................. 99
FIGURE 3- 7 REPLACEMENT OF CD3ζ CHAIN WITH ZAP70 KINASE DOMAIN (19BBZ327) PRESENTS
ANTI-TUMOR ACTIVITY. ............................................................................................................................ 100
FIGURE 3- 8 REPLACEMENT OF CD3ζ CHAIN WITH LAT INTRACELLULAR DOMAIN (1928LAT) LOSSES
ANTI-TUMOR ACTIVITY. ............................................................................................................................ 101
FIGURE 3- 9 REPLACEMENT OF CD3ζ CHAIN WITH ZAP70 KINASE DOMAIN ENHANCES ANTI-TUMOR
RESPONSE IN VIVO. .................................................................................................................................... 104
FIGURE 3- 10 1928Z327 PROLONGS MICE SURVIVAL BY INCREASING THE PERSISTENCE OF T CELLS
AND GENERATING LONG-LIVED MEMORY PHENOTYPE T CELLS. ................................................. 106
FIGURE 3- 11 1928Z327 INCREASES THE PERCENTAGE OF MEMORY PHENOTYPE T CELLS AND
LOWERS EXHAUSTION MARKERS IN VITRO. ........................................................................................ 106

xi

ABBREVIATIONS
A2AR Adenosine A2A Receptor
ACT Adoptive Cell Transfer
ADC Antibody Drug Conjugate
ADCC Antibody-Dependent Cell-Mediated Cytotoxic
ADCP Antibody-Dependent Cell-Mediated Phagocytosis
AKT Serine/Threonine-Protein Kinase
ALL Acute Lymphocyte Leukemia
AML Acute Myeloid Leukemia
APC Antigen Presenting Cell
BATF3 Basic Leucine Zipper Atf-Like Transcription Factor 3
BBIR Biotin-Binding Immune Receptor
BCR B Cell Receptor
BiTE Bi-Specific T-Cell Engager
BLIMP1 B Lymphocyte-Induced Maturation Protein-1
BTLA B And T Lymphocyte Associated
CAR Chimeric Antigen Receptor
CARD Caspase Recruitment Domain
CAT Catalase
CCR C-C Chemokine Receptor
CDC Complement-Dependent Cytotoxic
CDR Complementarity Determining Regions
xii
CEA Carcinoembryonic Antigen
CID Chemical Inducer of Dimerization
CLL Chronic Lymphocyte Leukemia
CR Complete Response
CRC Colorectal Cancer
CRS Cytokine Release Syndrome
CTA Cancer Testis Antigen
CTLA-4 Cytotoxic T Lymphocyte-Associated Antigen-4
Da Dalton
DAC 5-Aza-2'-Deoxycytidine (Decitabine)
DNMT3A DNA Methyltransferase 3A
DRiPs Defective Ribosomal Products
EGFR Epidermal Growth Factor Receptor
Eomes Eomesodermin
FAP Fibroblast Activation Protein
FcγR Fc Gamma Receptors
FITC Fluorescein Isothiocyanate
FOXO Members of The Class O of Forkhead Box Transcription Factors
GITR Glucocorticoid-Induced TNF-Related Protein
GM-CSF Granulocyte Macrophage Colony Stimulating Factor
GvHD Graft-Versus-Host Disease
HA Hemagglutinin
HAMA Human Anti-Mouse Antibody
xiii
HLA Human Leukocyte Antigen
HPLC High Performance Liquid Chromatography
HRP Horseradish Peroxidase
HSK Herpes Simplex Virus
IFN-γ Interferon Gamma
IgG Immunoglobulin G
IL-10 Interleukin 10
IL-12 Interleukin 12
IL-2 Interleukin 2
IL-4 Interleukin 4
IL-6 Interleukin 6
IL-8 Interleukin 8
ImmTAC Immune Mobilizing Monoclonal T-Cell Receptors Against Cancer
IRF4 Interferon Regulatory Factor 4
ITAM Immunoreceptor Tyrosine-Based Activation Motif
ITIM Immunoreceptor Tyrosine-Based Inhibitory Motif
KLRG-1 Killer-Cell Lectin Like Receptor G1
LAG-3 Lymphocyte-Activation Gene 3
LAK Lymphokine-Activated Killer
LAT The Linker for Activation of T Cells
LCK Mphocyte-Specific Protein Tyrosine Kinase
MHC Major Histocompatibility Complex
MMAE Monomethyl Auristatin E
xiv
MSLN Mesothelin
mTOR Mechanistic Target of Rapamycin
NFAT Nuclear Factor of Activated T-Cells
NK Natural Killer
NR4A Nuclear Receptor Subfamily 4 Group A
NSCLC Non-Small Cell Lung Carcinoma
NY-ESO-1 New York Esophageal Squamous Cell Carcinoma-1
PBMC Peripheral Blood Mononuclear Cell
PD-1 Programmed Cell Death Protein 1
PD-L1 Programmed Death-Ligand 1
PDK1 Pyruvate Dehydrogenase Kinase 1
PI3K Phosphoinositide 3-Kinase
PKA Protein Kinase A
PKC Protein Kinase C
PNE Peptide Neo-Epitopes
PP2A Protein Phosphatase 2A
PSMA Prostate Specific Membrane Antigen
PTPN2 Protein Tyrosine Phosphatase Non-Receptor Type 2
REP Rapid Expansion Protocol
ROR1 Receptor Tyrosine Kinase Like Orphan Receptor 1
scFv Single-Chain Variable Fragment
SH2 Src- Homology-2
SHP1 Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase 1
xv
SLP-76 SH2-Domain-Containing Leukocyte Protein of 76 kDa
TAA Tumor-Associated Antigen
TAP Transporter Associated with Antigen Processing
TCF1 T Cell Factor 1
TIGIT T Cell Immunoreceptor With Ig And Itim Domains
TIL Tumor Infiltrating Lymphocyte
TIM-3 T Cell Immunoglobulin and Mucin Domain-Containing Protein 3
TK Thymidine Kinase
TNF-α Tumor Necrosis Factor Alpha
TSA Tumor Associated Antigen
VEGF Vascular Endothelia Growth Factor
VISTA V-Type Immunoglobulin Domain-Containing Suppressor of T Cell Activation
WT1 Wilms Tumor 1
Zap70 Zeta- Activated Protein 70 kDa

xvi
ABSTRACT

Chimeric antigen receptor (CAR) engineered T cells have shown promising clinical
response in patients with blood cancer. However, the efficacy towards solid tumors is dramatically
reduced partially due to the limited ideal surface antigens for targeting, while most antigens are
intracellular and undruggable yet. Other possible reasons may owe to CAR-T cells exhaustion
caused by redundant signaling in the current CAR construct that is associated with overexpressed
immune inhibitory markers, and poor T-cell trafficking and persistence in the complicated tumor
microenvironment. This thesis focuses on these issues by expanding the availability of targets for
CAR-T cells and increasing the persistence of CAR-T cells with enhanced anti-tumor response.
Here in our first study, we developed a novel TCR-like antibody-based immunotherapy that can
access to intracellular antigens processed and presented on the cell surface, broadening the
application of current therapeutic approaches. The antibody screened from phage displayed library
has high specificity towards target peptide/MHC complex, but not other antigens. Besides,
antibody derived chimeric antigen receptor engineered T-cells also demonstrated antigen
specificity both in vitro and in vivo. In a triple negative breast cancer model, CAR-T cells
specifically impaired tumor growth and prolonged mice overall survival. In our second part, we
modified the conventional CAR construct with a novel kinase domain from Zap70, resulting in
improved anti-tumor activity by increasing memory T-cell population and reducing the expression
of negative regulators.

1
Chapter 1: Introduction

The human body has such an effectively strong immune
system that can fight off most infections and diseases. This
defense system can be categorized into innate and adaptive
immune responses. The primary defensive action from
innate response is rapid and broad, while adaptive response
produces much stronger and more pathogen-specific
reactions. B lymphocytes and T lymphocytes are the main
types of cells involved in adaptive immune system. Both B
cell receptors (BCR) from B cells and T cell receptors
(TCR) from T cells are membrane proteins that are
responsible for recognizing foreign antigens. Thus, there
are similarities in many ways, along with differences in
structure, diversity and antigen recognition (Figure 1- 1).

1.1 BCRs and antibodies
BCR locates extracellularly with a type I transmembrane
that anchors at the B cell membrane. Upon encounter with
an antigen, B cells are activated, proliferated and
differentiated to generate plasma B cells that are able to secrete antibodies specific to antigens (1).
Antibody, known for its Y-shape, is also called
immunoglobulin, which is used by the host to fight
against pathogens such as bacteria and viruses. It is a
Figure 1- 1 Similarity and difference between BCR
and TCR in structure, diversity and antigen
recognition.
(Adapted from digitalworldbiology)

2
heavy protein with about 150 kDa molecular weight, 10 nm in size and consisted of three globular
domains, which conformationally form the Y shape. It is a roughly symmetric with two light chains
and two heavy chains connected by disulfide bonds. At the tips of the Y shape, two identical
paratopes from heavy chains and light chains determine the specificity of antibodies. Those
paratopes are also known as antigen-binding sites, which bind to antigens precisely. More
specifically, both the heavy chain and the light chain have four frameworks separated by three
hypervariable regions named complementarity-determining regions (CDRs). Six CDRs together
with frameworks form a groove that could bind to antigens with different sizes and formations.

1.1.1 Mechanism of Action
Variable regions and constant regions endow the function of antibody. Main mechanism of action
from antibody includes neutralization, antibody-dependent cell-mediated cytotoxic (ADCC)
activity, antibody-dependent cell-mediated phagocytosis (ADCP) and complement-dependent
cytotoxic (CDC) activity (Figure 1- 2). The process of neutralization for an antibody functions to
block the pathophysiological binding between the ligands and receptors, impeding activation of
the signaling pathway. Many antibodies were designed to use this feature for disease treatment.
For example, Bevacizumab (Avastin®), an anti-VEGF (vascular endothelia growth factor) human
monoclonal antibody, binds to VEGF, which binds to its receptor VEGFR1/2, thus blocking the
signaling transduction from VEGF (2). It has been approved by FDA to treat colorectal cancer,
breast cancer and non-small cell lung cancer, etc (2). Another instance, a monoclonal antibody
anti-EGFR (epidermal growth factor receptor) Cetuximab (Erbitux®), binds to human EGFR and
blocks the interaction between EGF and EGFR. It prevents the receptor dimerization and tyrosine
3
phosphorylation and impairs cell differentiation and proliferation (3, 4). Thus, it was approved for
treating head and neck cancer and colorectal cancer.

Figure 1- 2 Mechanisms of action of therapeutic antibodies
(Adapted from J Toxicol Pathol. 2015 Jul; 28(3): 133–139.)

Cancer cells not only have diverse strategies to facilitate proliferation but can also hijack the
immune system by exhausting T cells via negative regulators. Several well-known immune
checkpoint inhibitors are systemically investigated. CTLA-4, PD-1 and PD-L1 have emerged
successfully as a curable approach for patients. Expression of CTLA-4 is up-regulated during early
stage of T-cell activation. CTLA-4 outcompetes CD28 binding to its ligands (CD80/CD86)
because of its higher affinity, resulting to inhibition of T cells activation and proliferation. While
PD-1 is involved in later activation of T cells. Its ligands PD-L1 and PD-L2, expressed
predominantly in peripheral tissues, as well as tumor micro-environment, which limits T cells
4
activation, effector function and leads to apoptosis. Ipilimumab, is an anti-CTLA-4 monoclonal
antibody, approved by FDA in 2011 for treating advanced melanoma. Three anti-PD1 antibodies,
Pembrolizumab, Nivolumab and Cemiplimab are approved by FDA as well as three anti-PD-L1
antibodies: Atezolizumab, Avelumab and Durvalumab.

1.1.2 Antibody modifications
The flexibility of modification makes antibodies important for many applications in research
activities, diagnosis and clinical use. Antibodies could be produced in different forms such as full-
length antibody, single chain variable fragment (scFv), heavy chain antibody, antibody-drug
conjugates, bi-specific antibody and so on (Figure 1- 3). scFv is a joint heavy chain variable region
with light chain variable region that is combined by a flexible linker such as (G4S)3, which is rich
in glycine and serine or threonine. The format of scFv maintains its specificity against antigens
and can be applied to flow cytometry, immunofluorescence and chimeric antigen receptor
engineered T cells. The second form is bi-specific antibodies. It is an artificial antibody that
recognizes two different antigens by linking two types of antibody together. Two main types of
bispecific antibodies are IgG-like and non-IgG like. IgG-like format maintain antibodies’ Y shape
by replacing one light chain and heavy chain with a sequence from another antibody. The non-IgG
like antibody format is widely used so far. A typical example is the bi-specific T-cell engagers
(BiTEs). It contains two scFvs linked by a flexible linker, in which one scFv is derived from anti-
CD3 monoclonal antibody that binds to CD3 on the T cell side, while another scFv is designed to
recognize tumor surface antigens. Blinatumomab is a bispecific antibody that binds CD3 and
CD19 for treating acute lymphoblastic leukemia. This drug functions by linking target B cells that
express CD19 and cytotoxic T cells that are activated by anti-CD3 antibody (5, 6). The third format
5
is called antibody-drug conjugates, which combines target specific monoclonal antibody with
potent anti-cancer drugs through chemical linkers. These linkers are biodegradable, stable and
accessible to control the drug pharmacokinetics, as well as specificity in delivering cytotoxic
agents to cancer cells rather than to normal tissues.

Figure 1- 3 Modification of antibody-based immunotherapy
(Adapted from Trends Cancer. 2018 Aug;4(8):567-582.)

6

1.2 T Cell Receptor (TCR)
The T cell receptor is composed of two chains linked by disulfide to form a heterodimer, which is
anchored on the membrane. Instead of recognizing surface antigens amongst the antibody, it is
responsible for recognizing antigens processed and presented by major histocompatibility complex
(MHC) molecules (pMHC). The affinity of TCR is relatively low compared to antibodies. Thus,
TCR may be degenerative, which means one TCR could recognize several antigens and one
antigen could be recognized by many TCRs as well (7). In human, α/β TCRs are dominant while
the left 5% TCRs are γ/δ TCRs. TCR consists of two domains: variable chain and constant region.
Similar to antibodies, both TCR α and β chain also have three CDRs, determining the specificity
of TCR. The constant region has a short cytoplasmic tail, transmembrane domain and a proximal
region, which is considered important for incorporation of CD3 components and signaling
transduction. Two constant regions from α and β chain form a disulfide bond, together with CD3γ,
CD3δ, CD3ε and CD3ζ, generating the TCR-CD3 complex. The octameric complex is in the
stoichiometry with TCR α/β-CD3ε/γ-CD3ε/δ-CD3ζ/ζ (8).

1.2.1 Soluble TCRs
Generally, TCRs are transmembrane receptors that don’t naturally present in soluble form, while
antibodies can be secreted and membrane bond as well. However, TCRs have the advantages in
recognizing antigens from intracellular and extracellular in the presence of MHC molecules. Thus,
number of antigens are significantly larger compared to antibodies. Attempts to express soluble
TCR have been undertaken (9). Different expression systems from bacterial to Drosophila and
mammalian cells were used to express soluble TCRs, though the expression level was relatively
7
low (10-13). To explore the potential benefit of soluble TCR based therapy, modifications such as
ImmTAC and TCR-fusion proteins were reported. Immune mobilizing monoclonal T-cell
receptors Against Cancer (ImmTAC) are similar to bi-specific T cell engagers (BiTEs) with one
end targeting tumor antigens by single chain TCR and another end hooks anti-CD3 scFv to recruit
and activate T cells. Several ImmTAC molecules were demonstrated efficacy both in vitro and in
vivo (14-17). Based on the pre-clinical results, clinical trials have been initiated to further
investigate the effectiveness in humans (18). The second approach linked a TCR with IL-2, which
can activate a broad range of immune cells located in the tumor’s area, such as B cells, T cells,
macrophages, monocytes, natural killer (NK) cells and lymphokine-activated killer (LAK) cells.
ALT-801 is a novel molecule that comprises IL-2 and TCR that binds to p53 (264-272) in the
context of HLA-A2. A series of p53+/HLA-A2+ tumor cells were recognized and killed by ALT-
801 with a forty-fold longer half-life than the recombinant human IL-2 (rhIL-2) (19-21). A phase
I clinical trial of ALT-801 in evaluation of advanced metastatic melanoma was conducted. Ten of
26 patients had a partial response, while one patient had a complete response (22). Another
approach fused TCR molecule with IgG1 constant region to exert ADCC function. The anti-tumor
efficacy was approved in a non-small cell lung carcinoma (NSCLC) model in nude mice (23).
Overall, soluble TCRs demonstrate potential anti-tumor activities but are not widely used due to
the difficulty in engineering in vitro and low affinity for targets (24-26).

1.3 Antibody discovery
It has been more than three decades since the United States Food and Drug Administration (FDA)
approved the first monoclonal antibody used for transplant rejection in 1986. Since then,
technologies for antibody engineering have dramatically improved to generate antibodies with
8
higher affinity and specificity and lower side effects. There are more than 600 therapeutic
monoclonal antibodies that have been studied in clinical trials around the world and 79 antibodies
were in late-stage clinical studies led by pharmaceutical companies before final market use (27).
More than half (40/79) of those antibodies are used for cancer treatment, making therapeutic
antibodies the bestselling drugs over the past six years. The importance of therapeutic monoclonal
antibody is unquestionable with its predominance in various diseases and market benefits (Figure
1- 4).

Figure 1- 4 Timeline for development of therapeutic antibodies with applications and market revenue.
(Adapted from Journal of Biomedical Science volume 27, Article number: 1 (2020))

1.3.1 Hybridoma technology
Hybridoma technology was developed by Köhler and Milstein in 1975 (28). This technology
enables large quantity of pure antibodies for research and clinical use. In the process of hybridoma
9
development, mouse B cells are infused with myeloma cells. Those immunized B cells can produce
antibody of interest and myeloma cells guarantee the immortality of the cells. Screening against
immortal B cells will generate desirable monoclonal antibodies with ideal specificity and affinity
(Figure 1- 5). However, the disadvantages of hybridoma technology are also obvious. First of all,
animals are involved in the process of immunization and the generation time usually is long. It
may take more than two months from immunization and final boosts, let alone include the time
needed for the hybridoma generation. Second, antibodies derived from immunized mice or rabbit
may be immunogenetic to human for the therapeutic purpose, which need further humanization.
Although humanized mice were developed to produce human antibody, more relevant research
need to be done before translating to human subject (29). Moreover, the inability to screen toxic
antigens also leads to incomplete epitope identification.
10

Figure 1- 5 A general representation of the hybridoma method used to produce monoclonal antibodies.
(licensed under the Creative Commons Attribution-Share Alike 3.0 Unported license)

1.3.2 Phage display
Phage display technology was attributed to George P. Smith in 1985. He first described that peptide
could be displayed on filamentous phage by fusing peptide sequence to virus’s capsid protein (30).
Later on, biopanning for affinity selection was introduced to screen positive clones at 1 in a billion
or less (31). In 1990, together with Greg Winter, large proteins such as antibodies were able to
present on the surface of phage, which forms the basis of current antibody screening and generation
(32). Phage display technology determines the potential binding partners interacted with the
11
protein, where a DNA library of all coding sequences are fused with phage coat proteins such as
pIII and pVIII. pIII determines the virion infectivity of the phage. It allows monovalent display
with larger proteins that are longer than 100 amino acids (33). pVIII, on the contrary, is the main
coat protein of Ff phage, which can fuse peptides with 6-8 amino acids. Since it has around 2700
copies for a typical phage, it is capable of multivalent display. However, increased avidity of high
valency pVIII display results in selection of low affinity ligands, while low valency pIII display
permits higher affinity ligands (34). The general screening process for phage display includes
binding, washing, elution, enriching, amplification and characterization (Figure 1- 6). The
advantages of phage display outweigh hybridoma technology. First, the time scale is less.
Compared to months from hybridoma, antibody discovery from phage display usually takes
several weeks. Besides, phage display could screen multiple antigens parallelly whereas it requires
lots of effort by using hybridoma technology that needs animal immunizations. What’s more,
antigens that are toxic to animals can also be applied to phage display, which is an in vitro system.
On the other side, antigens that are non-immunogenicity can’t be used to stimulate antigen specific
B cells to generate antigen specific antibodies via hybridoma technology, but it is not the case for
phage display technology. Furthermore, difficulties still exist in growing hybridoma clones even
after the successful fusion of B cells and myeloma fusion partner, while phages don’t have viability
issues. Lastly, phage library could be directly applied to screen human origin antibody by using
human scFv or Fab library. One thing we need to point out that antibodies achieved from phage
library may have lower affinity, which demands antibody affinity maturation, and post-
translational modifications are missing compared to those antibodies screened from eukaryote.
12

Figure 1- 6 Schema of antibody (scFv) phage display selection and screening.
(Adapted from Wenzel E.V. et al. (2020) Antibody Phage Display: Antibody Selection in Solution Using
Biotinylated Antigens.)

1.4 TCR-like antibody
TCR-like antibodies, by means, are antibodies that mimic the feature of TCR by recognizing
endogenous antigens processed and presented on the surface in the context of MHC molecules. In
1981, Wylie and his colleagues injected influenza and virus infected cell line into mice, where they
found about one third antibodies were able to recognize virus specific antigen hemagglutinin (HA)
or neuraminidase, whereas the rest of the antibodies only able to recognize antigens on the surface
of infected cell line, but not solely the virion or uninfected cell line (35). One year later, those
antibodies were found to recognize pMHC complex (36). Although the cytotoxicity of those TCR-
like antibodies was not demonstrated at that time, it clearly provides the evidence that TCR-like
13
antibodies could specifically recognize peptide/MHC complex similar to TCR. Since then, concept
is further proved by different studies with different target antigens (37-39). It is not until 2000 that
the first TCR-like antibody targeting human antigen MAGE-A1 was identified by Chames, et al.
via phage display technology (40).
An ideal target for TCR-like antibodies should have a considerable number of epitope abundance,
well-presented on the cell surface in the context of MHC molecules and tumor-specific or tumor
associated but not or limited expressed in normal tissues. Cancer-testis antigens are a sort of tumor
antigens that are highly expressed in the malignant tumors but not detected in normal tissues with
the exception of testis. For example, NY-ESO-1 expression is highly upregulated in melanoma,
sarcoma and multiple myeloma (41, 42). Another category is tumor specific antigens derived from
mutated proteins, e.g., β-catenin in colon cancer (43). Mutated β-catenin circumvents
adenomatous polyposis coli (APC)’s tumor suppressive effect. The third group is tumor associated
antigens, which are over-expressed in tumor cells, such as Her2/neu and CD19 (44-46). CD19 is
a B lymphocyte differentiation antigen. Cancer cells such as leukemia and lymphoma originated
from B cell lineage express CD19 as well. Thus, eliminating CD19 positive cancer cells will target
and eradicate normal B cells at the same time, causing B cell aplasia. Fortunately, this can be
ameliorated by immunoglobulin replacement (47).
The presence of epitope density on the cell surface is critical in modulating antibody binding.
Unlike surface antigens recognized by traditional antibodies have high copies (20,000 - 500,000
copies per cell), antigens that are recognized by TCR-like antibody are extremely low (100 - 1,000
copies per cell) due to the process and presentation in the context of MHC molecules. To process
the protein, protein must have enough quantities. For example, defective ribosomal products
(DRiPs) may contain a high percentage of pMHC due to the failure in transcription, translation or
14
folding that lead to accumulation in the cells (48, 49). It is reported that the efficiency of
presentation depends on the number of precursor peptides generated by proteasomes, which means
short-lived proteins may be more abundant than those with a longer half-life (50). The processes
of epitope generation start in the cytosol, where proteins are cleaved by proteasomes into random-
sized peptides. Then those peptides are transported into endoplasmic reticulum via the transporter
associated with antigen processing (TAP) and further trimmed by aminopeptidases (Figure 1- 7).
Peptides, ranging from eight to fifteen amino acids, bind to MHC molecules, which then are
transported to cell surface. Unstable binding between peptides and HLA on the cell surface
dissociate peptides from HLA, leading to recycle of HLA and downregulation of surface HLA
expression, which is widely used for HLA shift assay, particular for T2 cells (51). T2 cells are
TAP deficient so that endogenous proteins can’t be processed and presented onto cell surface.
Upon incubation with pulsed peptides, peptides bind to HLA and stabilize HLA molecules on the
cell surface. Thus, the fluorescence intensity is stronger than T2 cells along. However, some types
of tumor evolve the mechanism to significantly downregulate surface HLA molecules, potentially
causing TCR and TCR-like based therapeutic methods less effective (52, 53).
To solve the issue of low frequency of targets on the cell surface, several methods are adopted to
enhance the antigen expression. For example, cytokines such as tumor necrosis factor alpha (TNF-
α) and interferon gamma (IFN-γ) could upregulate HLA expression (54). Some chemo-drugs and
radiation can also increase HLA expression (55). What’s more, an FDA-approved agent 5-aza-2'-
deoxycytidine can also enhance the antigens expression (56). DAC is a DNA demethylation
compound. It has been demonstrated in many types of cancer that could upregulate cancer testis
gene expression, thus improving the application of immunotherapy (57, 58).
15

Figure 1- 7 Antigen process and presentation.
(Adapted from Nature Reviews Immunology volume 8, pages607–618 (2008))

1.4.1 Generation of TCR-like antibodies
Over the past few years, massive studies have been conducted to advance the generation of TCR-
like antibodies. Naïve and immunized phage libraries as well as hybridoma technology have been
performed to isolate TCR-like antibodies (Table 1- 1).
Recombinant proteins enable in vitro screening and in vivo immunization, drastically facilitating
the development of TCR-like antibody. In vitro expressed MHC molecules and synthesized
peptides are re-folded and purified through HPLC. This purified recombinant pMHC complex with
native conformation could be recognized by T cells, which provide the evidence for generation of
TCR-like antibodies and is confirmed by structural and functional studies (59-62). The feasibility
of adding biotin to specific site of the complex facilitates the in vitro selection and subsequent
steps of characterization. The high purity of pMHC complex also significantly reduce the
unwanted products, improving the probability of obtaining target antibodies.
16
Phage display technology contains positive selection of target binders. If necessary, a negative
selection could be applied before positive selection to remove the non-specific binders at the very
beginning, increasing the success rate to get real hits. A quantity of antibodies against murine class
I complexes and human disease-related peptides-HLA complexes have been developed so far (63).
Human scFv phage libraries and Fab libraries are largely used by investigators for TCR-like
antibodies development. Naïve libraries are derived from a bunch of healthy donors, where B cell
repertoires are combined from PCR products by using cDNA reverse-transcribed from peripheral
blood mononuclear cells (PBMCs) as templates and then inserting into phagemid. Semi-synthesis
phage libraries have also been widely used by mutating in all 6 CDR regions from heavy and light
chains, especially in CDR3 region. Dozens of clones directed to pMHC complex were isolated in
a reproducible manner. Denkberg and his colleagues used naïve human Fab phage library
screening against melanoma differentiation antigen gp100 in the context of HLA-A2. Three clones
G2D12, 1A7 and 2F1 were identified for epitope 154-162 (KTWGQYWQV), 209-217
(ITDQVPFSV) and 280-288 (YLEPGPVTA), respectively (64, 65). Klechevsky’s group also
developed antibody against gp100209-217, named G1 (66). Other melanoma antigens including
Tyroinase, MART-1, MAGE-A1 and MAGE-A3, etc, in associated with different HLA molecules
were used for antibodies development (40, 67, 68). Held’s group generated several TCR-like
antibody specific for NY-ESO-1 157-165 in the context of HLA-A2 (69). 3M4E5 and 3M4F4 showed
specific recognition to NY-ESO-1 peptide pulsed T2 cells but not other peptides. Those antibodies
screened from naïve library may not be sufficient for the purpose of therapeutic. Both random and
rational design strategies were developed for improving antibody affinity (70, 71). Chames and
colleagues improved 18-fold of affinity for the TCR-like antibody Fab G8 that targets HLA-
A1/MAGE-A1 by random mutation in the CDR3 regions of both heavy chain and light chain. The
17
final antibody (Hyb3) had an affinity of 14 nM compared to 250 nM from original antibody, while
maintaining the specificity (71). In 2009, Renner and colleagues analyzed the high-resolution
structure of Fab 3M4E5 bond with HLA-A2/NY-ESO-1 complex. Key residues that directly bond
to MHC were left unchanged. Other resides that may potentially optimize peptide interaction were
randomly mutated by NNK library. The second library were screened against HLA-A2/NY-ESO-
1. And a new antibody T1 was identified with 20-fold improvement in affinity (70). However,
CAR-based on the TCR-like scFv of high affinity T1 lost its epitope specificity (72). A successful
example would be TCR-mimic antibody targeting the Wilms tumor 1 (WT1) RMFPNAPYL
peptide in the complex with human leukocyte antigen - A2 (73). WT1 is an intracellularly
expressed oncogenic zinc finger transcription factor, which is highly expressed in a range of
leukemias of multiple lineages and solid tumors such as mesothelioma and ovarian cancer (74-77).
Tao Dao et al. identified five TCR-like antibodies ESK1, ESK3, ESK5, ESK15 and ESK23 that
recognize WT1/HLA-A2, while ESK1 was able to recognize a panel of tumor cell lines that WT1
is naturally processed and presented on the cell surface in the context of HLA-A2. This is the first
fully human IgG1 mAb targeting cell expressing WT1. In the presence of human PBMCs as
effector cells, ESK1 mediated ADCC against T2 cells pulsed with RMF peptide and HLA-A2+;
WT1+ cell lines JMN (mesothelioma), BV173 (leukemia), SKOV (ovarian carcinoma), CC228
(colon carcinoma) in a dose-dependent manner, as well as for fresh AML cells from patients.
Interestingly, in mice experiment, in the absence of effector cells, ESK1 antibody along could
dramatically inhibit tumor growth. To further enhance ADCC effect, ESK1 antibody was modified
in the Fc region that has increased binding affinity for FcgRIIIα (158V variant) and reduced
binding affinity for FcgRIIβ (78). ESKM was more than 5-fold potent against a series of tumor
cell lines both in vitro and in vivo, providing proof of concept that Fc-enhanced antibodies could
18
improve therapeutic efficacy against low-density targets. In 2015, ESK1 mAb was modified to
bispecific antibody targeting CD3 and WT1 (BiTEs) (79). Anti-CD3 antibody that directly
interacts with T cells leads to short-term T cell activation and exert cytotoxicity function. The
upregulation of degranulation marker CD107α and increased secretion of IFN-γ and TNF-α
cytokines showed no difference between CD4 and CD8 T cells from fresh healthy donors after
BiTE activation for 24h and 48h, suggesting that broad activation of T cells went through CD3
signaling upon binding to the anti-CD3 antibody. The high-resolution crystal structure of
monoclonal antibody ESK1 targeting WT1/HLA-A2 determined the binding sites, illuminated the
antibody specificity, expressed potential cross-reactivity and identified possible off-targets (80).
The crystal structure of WT1(RMFPNAPYL)/HLA-A2/ESK (Fab) complex was solved at 3.05 Å.
It clearly indicated the difference in binding between variable chains and the pMHC complex
compared to TCR (81). ESK1 contacts the RMF peptide position 1 (Arg) and 4 (Pro), while
interacting with position 2 (Met), 3 (Phe), 6 (Ala) and 9 (Leu) residues at the bottom. Side chains
position 5 (Asn) and 8 (Tyr) don’t contact with the ESK1 as they face the solvent. Arginine1 is the
center for the interaction with electrostatic lock. Substitution of Arg1 with other similar residues
dramatically decreased or totally eliminated the binding. Based on that information, several
potential peptides were predicted and ranked via NETMHC by binding affinity to HLA-A2.
MED13L (RMFPTPPSL), and PIGQ (RMFPGEVAL) were predicted and positively verified
within peptides pulsed T2 cells. Those results may extend the potential targets of ESK1 to more
patients with less stringent on HLA subtypes. However, the determination of alternative peptides’
expression on cell surface in normal cells is challenging. In 2017, the scFv of ESK1 was linked to
the second generation of CAR construct with CD28 as costimulatory domain and CD3ζ as a
signaling domain (82). They also fused IL-12 to ESK1-28z, which can express IL-12 to enhance
19
anti-tumor response. Both ESK1-28z and ESK1-28z/IL12 CAR-T cells showed anti-tumor activity
in vitro and in vivo. Further modification with linking anti-tumor toxin agent to ESK1 was
conducted by Shen and his colleagues (83). Monomethyl auristatin E (MMAE) was linked with
the help of sortase A to the C-terminus of the antibody. The function of ADC was confirmed to
internalize and kill target cells in vitro as well as a tumor model in vivo, though the overall
therapeutic efficacy needs to be further improved because after stopping administration of
antibody, the tumor grew rapidly.
Neoantigens have the feature of high tumor specificity, which are excellent targets for cancer
immunotherapy. However, due to the rarity of common shared antigens in the patients, the
development of therapeutic drugs to target mutated proteins have also proven to be the most
difficult. Many research groups have the ability to perform whole-exon genome sequencing of
tumors and healthy tissues, identify the candidate neoantigens by comparison between normal and
tumor samples, verify the potential HLA binding in vitro, and even screen the neoantigen-specific
single-clone-level tumor infiltrating lymphocytes to these mutant/MHC complexes (84).
Unfortunately, most neoantigens found in cancers are not common shared among different patients.
p53, RAS and BCR/ABL mutations are massively reported in diverse of cancer types, serving
potential targets for identifying highly shared mutations. A TCR-like antibody against wide-type
p53 was reported in previous study (85). However, the clinical application for targeting wide-type
genes is dramatically limited due to the expression in normal cells. Most recently, researchers from
Dr. Shibin Zhou’s group identified several TCR-like antibodies against mutated p53 and RAS (86,
87). Those TCR-like antibodies were modified into bispecific T cell engagers (BiTEs), which
displayed highly specificity towards mutant epitopes but not wide-type epitopes, providing
evidence for future development of TCR-like antibodies to target broadened tumor types.
20
Besides the reported anti-tumor function, TCR-like antibody can also be used for immune
regulation. Unlike PD-1, PD-L1 and CTLA-4, which are surface molecules that negatively regulate
T cell functions, Foxp3 is an intracellular protein and master regulator of Treg cells. Treg cells are
well-known to maintain the balance between cancers and autoimmune diseases. Thus, depletion
of Treg cells in the tumor microenvironment would be promising for cancer immunotherapy. One
way to deplete Treg cells is using antibody to surface proteins expressed on Tregs such as CD25
and glucocorticoid-induced TNF-related protein (GITR) (88, 89). However, the expression of
CD25 and GITR in activated CD4 and CD8 effector T cells may interfere the potential results of
clinical use (90-92). So a TCR-like antibody targeting Foxp3 was development to overcome the
issue (93). Foxp3-#32 could successfully deplete Tregs cells in xenografts of PMBCs both from a
healthy donor and patient.
In summary, TCR-like antibody provides a new concept of treating cancer cells by targeting
intracellular proteins processed and presented onto the cell surface, which broaden the application
of cancer immunotherapy. For the purpose of clinical use in the future, more detailed study still
needs to be performed.
21
Table 1- 1 Published TCR-like antibody in human diseases.
Antige
n
Disease Epitope Clone Function
For
mat
Strateg
y
Refere
nce
Note
CMV
Mucoepider
moid
carcinoma
495-503
NLVPMVATV/
HLA-A2
H9 Detection Fab Phage (94) pp65
Foxp3 -
344–353
TLIRWAILEA/
HLA-A2
#32
Depletion
BiTE
ADCC
scFv phage (93)
HA-1H Leukemia
153-161
VLHDDLLEA/
HLA-A2
#131 CAR-T scFv phage (95)
HBV Hepatitis B
183-191
FLLTRILTI/HL
A-A2
Env183/A2
Detection/intrac
ellular
delivery of
cargo
mIgG
1
Hybrid
oma
(96) Env
hCGb
Ovarian,
colon,
breast
cancer
40-48
TMTRVLQGV/
HLA-A2
3F9 Detection IgG1
Hybrid
oma
(97)

47-55
GVLPALPQV/H
LA-A2
1B10 Detection IgG1
Hybrid
oma
RL4B (3.2G1)
Detection,
CDC, ADCC
mIgG
2a
Hybrid
oma
(98)
Her2
Breast,
colon
cancer
369-377
KIFGSLAFL/H
LA-A2
1B8
Detection/inhibi
tion
IgG1
Hybrid
oma
(99) Neu
HIV-1 AIDS
720-728
VLMTEDIKL/H
LA-A2
4F7 Detection
mIgG
1
Hybrid
oma
(100) Elf4G
105-113
RRQDILWIY/H
LA-C7
C3
Surface co-
expression
with fas-ligand
on
virion particle
Fab phage (101)
Nef

138-147
RYPLTFGWCF/
HLA-A24
#3, #27 Detection scFv phage (102)
hTERT
Melanoma,
prostate
cancer
540-548
ILAKFLHWL/H
LA-A2
4A9, 4G9
Detection/inhibi
tion
Fab Phage (103)
HTLV-
1
T-Cell
leukemia
lymphoma
11-19
LLFGYPVYV/H
LA-A2
T3A4, T3D4;
T3F2; T3E3;
T3D3; T2H9
Detection Fab Phage
(104,
105)
TAX
Influen
za
Flu
58-66
GILGFVFTL/H
LA-A2
M1-D1, M1-G8;
M1-D12; M1-A2
Detection Fab Phage (106) M1
MAGE
-A1
Melanoma
161-169
EADPTGHSY/H
LA-A1
Fab-G8 Detection
Fab Phage
(40)

Fab-G8
CAR-T
(67)
Fab-G8/Fab-
Hyb3
(71)
MAGE
-A3
Melanoma
271-279
FLWGPRALV/
HLA-A2
7D4, 8A11,
2G12, 9E6
Detection
mIgG
1
Hybrid
oma
(107)
MART
-1
Melanoma 26-35
2M3F11;3N4E9;
2N4B4; E6; H4
Detection Fab Phage (108)
Melan-
A
22
Antige
n
Disease Epitope Clone Function
For
mat
Strateg
y
Refere
nce
Note
EAAGIGILTV/
HLA-A2
CAG10, CLA12 ADC
Fab-
PE38
(66)
MIF
Breast
cancer
10-18
FLSELTQQL/H
LA-A2
RL21A CDC, ADCC
IgG2
a
Hybrid
oma
(109)
MUC1
Breast
cancer
13-21
LLLTVLTVV/H
LA-A2
M2B1, M2F5,
M3A1, M3B8,
M3C8
Detection Fab Phage (110)
NY-
ESO-1
Melanoma
157-165
SLIMWITQC/-
HLA-A2
3M4E5;3M4F4;
T1
Detection/inhibi
tion
Fab Phage
(69,
70)

T1 CAR-T
(72,
111)
p53
Various
tumors,
breast
cancer
65-73
RMPEAAPPV/
HLA-A2
T1-116C
ADCC, ADCP,
CDC
IgG1
Hybrid
oma
(85)
Wide
Type
T1-29D, T1-84C Detection
IgG1,
IgG2
b
Hybrid
oma
(112)
187-197
GLAPPQHLIRV
/HLA-A2
T2-108A, T2-2A,
T2-116A
Detection
IgG1,
IgG2
a,
IgG1
Hybrid
oma
(112)
Myeloma
168-176
HMTEVVRHC/
HLA-A2
H2
Bispecific
diabody
scFv Phage (86)
Neoanti
gen
R175H
p68
Breast
cancer
128-136
YLLPAIVHI/HL
A-A2
RL6A ADCP
mIgG
2a
Hybrid
oma
(113)
PRAM
E
Leukemia,
lymphoma
300-309
ALYVDSLFFL/
HLA-A2
Pr20
ADCC, CDC,
ADCP
hIgG
1
Phage (114)
PR1 AML

169-177
VLQELNVTV/
HLA-A2
8F4
Detection,
ADCC IgG2
a
Hybrid
oma
(115,
116) Proteina
se 3
CAR-T (117)
RAS
Lung cancer
8-16
VVGAVGVGK/
HLA-A3
V2
Bispecific
diabody
scFv Phage (87)
KRAS
G12V
Leukemia
55-64
ILDTAGLEEY
/HLA-A1
L2
NRAS
Q61L
55-64
ILDTAGHEEY
/HLA-A1
H1
NRAS
Q61H
55-64
ILDTAGREEY
/HLA-A1
R6
NRAS
Q61R
TARP
Breast,
prostate
cancer
29-37
FLRNFSLML/H
LA-A2
Fab-D2 ADC
Fab-
PE38
Phage (118)
Tyrosin
ase
Melanoma
368-376
YMDGTMSQV/
HLA-A2
TA2 Detection Fab Phage (119)
23
Antige
n
Disease Epitope Clone Function
For
mat
Strateg
y
Refere
nce
Note
WT1
Leukemia,
ovarian,
colon
cancer
126-134
RMFPNAPYL/
HLA-A2
ESK1 ADCC, ADCP
hIgG
1
Phage
(73)

Leukemia,
solid tumors
ESKM ADCC
(78,
120)
ovarian
cancer,
mesothelio
ma, ALL
ESK1-BiTE BiTE (79)
Leukemia
ESK1 CAR-T (82)
F2, F3 CAR-T Fab (121)
Clone45 ADCC, CAR-T scFv (122)

1.5 Adoptive cell transfer (ACT)
Cancer is the worldwide threat to human health and second leading cause of death in United States.
According to the American Cancer Society, in 2016, totally 1,685,210 new cancer cases and
595,690 cancer deaths are predicted throughout the nation (123). Although chemotherapy and
radiotherapy as the mainstay non-surgical option, have been developed for a long time for cancer
treatment, inability to treat refractory cases and severe side effects hamper the further usage. In the
mid of 1970s, Morgen et, al. found the selective growth cytokine of T lymphocytes in vitro (now
known as IL-2), which opens the door to adoptive cell transfer (ACT) (124). Since then, the first
study used tumor infiltrating lymphocytes (TILs) to cure metastatic melanoma by Rosenberg and
his colleagues at National Cancer Institute in 1988 (125). Around two decades later in 2006,
Rosenberg’s team also was the first to report a clinical benefit by using TCR redirected T cells in
melanoma and metastatic cancers later (126-128). However, due to the restriction of HLA type
matching, down-regulating of tumor surface of HLA expression as a means of immune escape and
mispairing between endogenous TCR α and β chain and introduced exogenous TCR, the
application of TCR engineered T cells is limited so far. Meanwhile, chimeric antigen receptor
(CAR) engineered T cells can overcome these problems (129). The most impressive cases are the
two studies conducted by Carl June’s team in 2011 and 2013 using CAR-T cells to treat chronical
24
lymphocyte leukemia (CLL) and acute lymphocyte leukemia (ALL) (130, 131). And in same year
2013, immunotherapy was selected as the “Breakthrough of the Year” by Science because of its
dramatically success in hematological malignancies as of chimeric antigen receptor (CAR)
engineered T cells.
1.5.1 Tumor infiltrating lymphocytes (TILs)
TILs are defined as a type of T lymphocytes that reside in the tumor sites and have the ability of
recognizing and killing tumor cells, while the function may be restricted due to tumor
microenvironment. The discovery of T cell growth factor (TCGF) [Interleukin-2 (IL-2)] in 1976
by Morgan make it possible for T cells to culture and expand in vitro/ ex vivo with the maintenance
of effector function, which paves the road to adoptive cell transfer (124). The procedure of
preparing TILs starts from resecting the tumor from patient and cutting into pieces, which are
cultured in the plate in the presence of IL-2. Expanded T cells will be co-cultured with autologous
tumor cells to identify the positive TILs that will be went through rapid expansion protocol (REP)
to the quantity needed to infuse back to the patient (Figure 1- 8). The first in vitro study in 1986
showed that TILs obtained from melanoma patients are capable to recognize autologous tumor
specifically (132), which led to the first clinical trial of ACT using autologous TILs for patients
with metastatic melanoma two years later (125). At the time summarized in April 2021, there are
more than 550 clinical trials conducted around the world (https://ClinicalTrials.gov), with 270
registered in the United States and above 200 clinical trials carried in the Europe. With the advance
of gene-editing and modification technologies, TILs are further modified to improve trafficking,
cytotoxicity, homing to tumor sites and prevent exhaustion (133).
25

Figure 1- 8 General schema for using the adoptive cell transfer of naturally occurring autologous TILs.
(Adapted from Science. 2015 Apr 3;348(6230):62-8. doi: 10.1126/science.aaa4967.)
1.5.2 T cell receptor engineered T cells (TCR)
Unlike TILs using natural expressed TCRs, TCR-T cells adopt exogenous TCRs identified and
affinity-improved from TILs or screened from library. TCRs are transduced into T cells via
lentivirus or retrovirus to stably express onto the cell surface. There are about 600 clinical trials
registered in clinicaltrials.gov and most trials are targeting NY-ESO-1 and melanoma, respectively
(Figure 1- 9). Although there are dozens of active clinical trials of engineered TCR-T cells (Table
1- 2), the limitations of TCR-T cells therapy are needed to overcome. First of all, unlike CAR-T
cells which are HLA-independent, TCR-T cells recognize peptide/HLA complex, resulting limited
number of populations of patients. Second, natural TCRs on the T cell surface have been
26
underwent positive and negative selection, which eliminate high affinity TCR that may cause
autoimmunity. This mechanism can be hijacked by tumor cells after evolving enough to evade
being killed by T cells, generating immune escape, especially for tumor cells with tumor associated
antigens that are also expressed in normal cells. More importantly, in case of severe adverse events
it is important to pay close attention to the off-target toxicity and cytokine release syndrome after
T cells injection.

Figure 1- 9 The targeted antigen distribution of TCR-T clinical therapies from 2004 to 2019.
(Adapted from Annuals of Blood, Volume 5, March 2020, doi: 10.21037/aob.2020.02.02)

27
Table 1- 2 Clinical trials activated on engineered TCR-T cells.
ID Study Title Cancers Interventions Participants
NCT03578406
HPV-E6-Specific Anti-PD1
TCR-T Cells in the
Treatment of HPV-Positive
NHSCC or Cervical
Cancer
Cervical Cancer
Head and Neck
Squamous
Cell Carcinoma
Drug: HPV E6-specific
TCR-T cells
20
NCT03941626
Autologous CAR-T/TCR-T Cell
Immunotherapy
for Solid Malignancies
Esophagus Cancer
Hepatoma
Glioma
Gastric Cancer
Biological: CAR-T/TCR-T
cells immunotherapy
50
NCT03891706
Individualized Tumor Specific
TCR- T Cells in the
Treatment of Advanced Solid
Tumors
Lung Cancer
Melanoma
Drug: tumor-specific
TCR-T cells
30
NCT03638206
Autologous CAR-T/TCR-T Cell
Immunotherapy
for Malignancies
B-cell Acute
Lymphoblastic
Leukemia
Lymphoma
Myeloid Leukemia
(and 13 more…)
Biological: CAR-T cell
immunotherapy
Multi-target tumor specific
CAR-Ts for CD19 and
CD22 in B cell leukemia
and lymphoma, CD33 in
myeloid leukemia, B-cell
maturation antigen
(BCMA)
and CD38 in multiple
myeloma, NY-ESO-1 in
multiple
myeloma, esophagus
cancer, lung cancer, and
synovial sarcoma, DR5 in
hepatoma, C-met in
hepatoma, colorectal
cancer, ovarian cancer and
renal carcinoma, EGFR V
III in hepatoma, lung
cancer and glioma, and
mesothelin in gastric
cancer,
pancreatic cancer and
mesothelioma
73
NCT03139370
Safety and Efficacy of MAGE-
A3/A6 T Cell
Receptor Engineered T Cells
(KITE-718) in HLADPB1*
04:01 Positive Adults with
Advanced
Cancers
Solid Tumor
Drug: KITE-718
Drug: Cyclophosphamide
Drug: Fludarabine
Device: MAGE - A3/A6
Screening Test
75
NCT03691376
NY-ESO-1 TCR Engineered T
Cell and HSC
After Melphalan Conditioning
Regimen in
Treating Participants with
Recurrent or
Refractory Ovarian, Fallopian
Tube, or Primary
Peritoneal Cancer
HLA-A*0201 Positive
Cells
HLA-DP4 Positive Cells
Platinum-Resistant
Ovarian
Carcinoma (and 6
more…)
Biological: Aldesleukin
Biological: Autologous
NY-ESO-1-specific CD8-
positive T Lymphocytes
Other: Cellular Therapy
Drug: Melphalan
15
28
ID Study Title Cancers Interventions Participants
NCT02858310
E7 TCR T Cells for Human
Papillomavirus-
Associated Cancers
Papillomavirus
Infections
Cervical Intraepithelial
Neoplasia
Carcinoma in Situ
(and 2 more…)
Biological: E7 TCR cells
Drug: Aldesleukin
Drug: Fludarabine
Drug: Cyclophosphamide
180
NCT03686124
TCR-engineered T Cells in Solid
Tumors
Refractory Cancer
Recurrent Cancer
Solid Tumor, Adult
Cancer
Biological: IMA203
Product
Device: IMADetect
16
NCT03029273
NY-ESO-1 TCR (TAEST16001)
for Patients With
Advanced NSCLC
Lung Cancer, Non-small
Cell,
Recurrent
Drug: Cyclophosphamide
and Fludarabine
Biological: Anti-NY-ESO-
1 TCR transduced T cells
20
NCT03503968
TCR Modified T Cells
MDG1011in High Risk
Myeloid and Lymphoid
Neoplasms
Safety
Tolerability
Feasibility
Treatment Efficacy
Drug: MDG1011
Other: Investigator Choice
therapy
92
NCT03912831
Safety and Efficacy of KITE-439
in HLA-A*02:01
+ Adults with
Relapsed/Refractory HPV16+
Cancers
Human Papillomavirus
16+
Relapsed/Refractory
Cancer
Drug: KITE-439
Drug: Cyclophosphamide
Drug: Fludarabine
75
NCT03247309
TCR-engineered T Cells in Solid
Tumors With
Emphasis on NSCLC and
HNSCC (ACTengine)
Solid Tumor
Cancer
Head and Neck
Squamous
Cell Carcinoma
Non-small Cell Lung
Cancer
Biological: IMA201
Product
Diagnostic Test:
IMA_Detect
Diagnostic Test: ACT-
HLA
16
NCT03441100
TCR-engineered T Cells in Solid
Tumors
Including NSCLC and HCC
Patients
Solid Tumor, Adult
Cancer
Hepatocellular
Carcinoma
(and 4 more…)
Drug: IMA202 Product
Device: IMA_Detect
16
NCT02650986
Gene-Modified T Cells in
Treating Patients With
Locally Advanced or Stage IV
Solid Tumors
Expressing NY-ES0-1
Adult Solid Neoplasm
Drug: Cyclophosphamide
Other: Laboratory
Biomarker Analysis
Biological: NY-ESO-1
Reactive TCR Retroviral
Vector Transduced
Autologous PBL
Biological: TGFbDNRII-
transduced Autologous
Tumor Infiltrating
Lymphocytes
24
NCT03431311
T Cell Receptor Based Therapy
of Metastatic
Colorectal Cancer
Colorectal Cancer
Biological: Adoptive Cell
Therapy (ACT)
5
NCT03326921
HA-1 T TCR T Cell
Immunotherapy for the
Treating of Patients with
Relapsed or Refractory
Acute Leukemia After Donor
Stem Cell
Transplant
HLA-A*0201 HA-1
Positive
Cells Present
Juvenile
Myelomonocytic
Leukemia
Recurrent Acute
Biphenotypic
Leukemia
(and 24 more…)
Biological: CD8+ and
CD4+ Donor Memory T-
cellsexpressing
HA1-Specific TCR
Drug: Fludarabine
Phosphate
Other: Laboratory
Biomarker Analysis
24
29
ID Study Title Cancers Interventions Participants
NCT03462316
NY-ESO-1-specific T Cell
Receptor (TCR) T Cell
in Sarcoma
Bone Sarcoma
Soft Tissue Sarcoma
Biological: NY-ESO-
1(TCR Affinity Enhancing
Specific T cell Therapy)
20
NCT02686372
TCR-Redirected T Cell Infusions
to Prevent
Hepatocellular Carcinoma
Recurrence Post Liver
Transplantation
Hepatocellular
Carcinoma
Biological: HBV antigen
specific TCR redirected T
cell
10
NCT02719782
A Study of TCR-Redirected T
Cell Infusion in
Subject with Recurrent HBV-
related HCC Post
Liver Transplantation
Recurrent Hepatocellular
Carcinoma
Biological: TCR-T 10
(Adapted from Front. Immunol., 30 March 2021 | https://doi.org/10.3389/fimmu.2021.658753)

30
1.5.3 Chimeric antigen receptor engineered T cells (CAR)
Chimeric antigen receptor (CAR) is an artificial T-cell receptor that is engineered into T cells. It
typically contains an extracellular single chain variable fragment (scFv) that derived from antibody
for antigen recognition and binding, a hinge domain to provide flexibility, a transmembrane
domain for membrane anchor, a costimulatory to provide second signaling and an intracellular
signaling transduction domain. Till now, there are four generations of CARs (Figure 1- 10), among
which the second generation dominates with one costimulatory domain. First generation of CAR
only comprises CD3ζ domain, while second generation of CAR has one costimulatory domain
from CD27, CD28, 4-1BB, ICOS or OX40 to enhance the T-cell signal. Third generation of CAR
contains two tandem costimulatory domains and CD3ζ to further augment the signal and
effectiveness of CAR-T cells (134-141). Two mainstream types of second generation CD19 CARs
are incorporated with either CD28 (142) or 4-1BB (143). T cells equipped with 4-1BB show long-
term persistence, while CD28 integrated T cells perform strong anti-tumor function at the
beginning. And both CARs are better than the first-generation CAR in every single aspect (144).
Evidence to comprehensively compare which costimulatory motif is optimal in different
circumstances are still needed to provide besides the current knowledge (145-147). In the clinical
trial conducted by Maude et al., 27 of 30 treated children with ALL achieved overall response
treated by CAR-T cells equipped with CD28 (148). Davila et al. reported an overall response rate
of 88% within 16 patients treated with autologous T cells expressing 1928z CAR (149).
Kochenderfer et al. reported that 8 out of 15 patients with lymphoma treated with CD19-CAR T
cells (1928z) got complete responses (150). And Lee et al. reported a complete response rate of
66.7% (14/21) within 21 patients with refractory B-cell malignancies (151). In children and young
adults with refractory or relapsed B-cell ALL, 81% (61/75) of patients treated with 19bbz achieved
31
complete response (47). Another 19bbz CAR-T product with defined CD4/CD8 composition had
more than 90% (40/45) complete response rate against adult and pediatric B-cell ALL (152).

Figure 1- 10 Generations of chimeric antigen receptor.
(Adapted from Journal of Cellular Immunotherapy, Volume 2, Issue 2, November 2016, Pages 59-68.)

However, despite the exciting achievement of CAR-T cells in clinical trials, severe side effects
and the finite availability of targets deeply limit the application of CAR-T cells. First of all, CAR-
T cells have on-target/off tumor recognition. CD19-CAR T cells specifically target tumor cells but
also eliminate normal B cells, resulting in B-cell aplasia, which needs intermittent infusion of
immunoglobulin to prevent infection. Similarly, other CAR-T cells may have the same issue of
attacking normal tissues that express the target antigens (153-155). Second, neurologic toxicities
such as seizure, obtundation, confusion, myoclonus and delirium are often seen in patients treated
with CD19-CAR T cells (149, 151, 156). The direct mechanism of causing neurologic toxicities is
still unknown, but it may be partially due to the high level of secreted cytokines, which is also
related to the most prevalent side effect of CAR-T cells - cytokine release syndrome (CRS) (157).
The typical features of CRS are high fever, fatigue, nausea, capillary leak, renal impairment,
cardiac dysfunction and heart failure, etc. (130, 157). Currently, in case of high lethal level of IL-
6, one of dramatic augment of cytokines, which also include IL-10, IFN-γ and granulocyte
macrophage colony stimulating factor (GM-CSF), C-reactive protein (anti-IL-6) is adopted to
32
lower the severity (148, 149, 151, 158). However, IL-6 plays like a double sides sword acting as a
pro-inflammatory and an anti-inflammatory cytokine (159). On one hand, IL-6 level incensement
followed with high body temperature to stimulate immune response; On the other hand, persistent
high fever damages body tissues and organs, which even lead to lethality. But there is no exact
explanation about IL-6: how and when to terminate the high level of cytokines is yet undecided
and it totally depends on the feature of each person.
1.5.3.1 Key Elements of Chimeric Antigen Receptor Composition
Chimeric antigen receptor is a synthetic single chain construct that has an extracellular antigen
binding domain usually from scFv of antibody, a transmembrane domain that help anchor at T cell
membrane, a costimulatory domain to endow secondary signal that facilitates T cells proliferation
and persistence, and an signaling domain that transduce signal to downstream pathways (160, 161).
The development and progress of CAR can be found in Table 1- 3. The University of Pennsylvania,
the National Cancer Institute and Memorial Sloan Kettering Cancer Center are now leading in this
area and a lot of other centers are chasing as well.
33
Table 1- 3 Timeline of key events for Chimeric antigen receptor development
Time/Year Research/product Event Institute/company FDA approval
1987 Yoshikazu Kuwana
Expression of
immunoglobulin
variable region and
TCR constant region
(T body)
Fujita-Gakuen
Health University

1989 Zelig Eshhar Function of T body
Weizmann Institute
of Science

1991 Arthur Weiss
Chimeric T cell
signaling
transduction with
CD3ζ
University of
California, San
Francisco

1993 Zelig Eshhar
First generation of
CAR
NCI, Rosenberg lab
2002 Michael Sadelain
Second-generation
CARs (CD28-based)
Memorial Sloan
Kettering Cancer
Center (MSKCC)

2004 Dario Campana
Second-generation
CARs (4-1BB-
based)
National University
of Singapore (NUS)

2010 Mcichel Sadelain

Third-generation
CARs

Memorial Sloan
Kettering Cancer
Center (MSKCC)

2010 Steven Rosenberg
First to demonstrate
the success of CD19-
CAR in vivo
National Cancer
Institute (NCI)

2011 Carl June
First report of CD19
CAR therapy in CLL
University of
Pennsylvania

2013 Carl June

First report of CD19
CAR therapy in ALL

University of
Pennsylvania

2013 Hinrich Abken
Fourth-generation
CARs (TRUCK)
University of
Cologne

2017 Kymriah
FDA approval of
CD19 CAR therapy
41BB-CD3Z
Novartis
diffuse large B-cell
lymphoma (DLBCL)
acute lymphoblastic
leukemia (ALL)
2017 Yescarta
FDA approval of
CD19 CAR therapy
CD28-CD3Z
Gilead (Kite)
Diffuse large B-cell
lymphoma (DLBCL)
Primary mediastinal B-cell
lymphoma
High grade B-cell lymphoma
DLBCL that results from
follicular lymphoma
Follicular lymphoma
2020 Tecartus
FDA approval of
CD19 CAR therapy
CD28-CD3Z
Gilead (Kite) mantle cell lymphoma
2021 Breyanzi
FDA approval of
CD19 CAR therapy
41BB-CD3Z
Bristol Myers
Squibb (Juno)
Diffuse large B cell
lymphoma (DLBCL)
High-grade B-cell lymphoma
Primary mediastinal large B-
cell lymphoma
Follicular lymphoma grade
3B
34
2021 Abecma
FDA approval of
BCMA CAR therapy
41BB-CD3Z
Bristol Myers
Squibb/ bluebird bio,
Inc
Multiple myeloma

Table 1- 4 Antigens used in clinical trials in solid tumor with CAR-T cells
Antigen Cancer Phase NCT ID
EGFR Lung, liver, stomach Phase 1/2 NCT03179007, NCT03525782
HER2
Central nervous system tumor, pediatric
glioma
Phase 1 NCT03500991
EGFR806
Central nervous system tumor, pediatric
glioma
Phase 1 NCT03179012
Mesothelin Ovarian, cervical, pancreatic, lung Phase 1/2 NCT01583686
PSCA Lung Phase 1 NCT03198052
MUC1 Advanced solid tumors, lung Phase 1/2 NCT03179007, NCT03525782
Claudin 18.2 Advanced solid tumor Phase 1 NCT03874897
EpCAM Colon, pancreatic, prostate, gastric, liver Phase 1/2 NCT03013712
GD2 Brain Phase 1 NCT04099797
VEGFR2 Melanoma, brain Phase 1 NCT01218867
AFP Hepatocellular carcinoma liver cancer Phase 1 NCT03349255
Nectin4/FAP
Nectin4-positive advanced malignant solid
tumor
Phase 1 NCT03932565
CEA
Lung, colorectal, gastric, breast, pancreatic
cancer
Phase 1 NCT02349724
Lewis Y Advanced cancer Phase 1 NCT03851146
Glypican-3 Liver Phase 1 NCT02932956
EGFRIII Glioblastoma and brain tumor Phase 1 NCT01454596
IL-13Rα2 Glioblastoma Phase 1 NCT02208362
CD171 Neuroblastoma Phase 1 NCT02311621
MUC16 Ovarian Phase 1 NCT02311621
PSMA Prostate Phase 1 NCT01140373
AFP Hepatocellular carcinoma, liver Phase 1 NCT03349255
AXL Renal Phase 1 NCT03393936
CD20 Melanoma Phase 1 NCT03893019
CD80/86 Lung Phase 1 NCT03198052
35
Antigen Cancer Phase NCT ID
c-MET Breast, hepatocellular Phase 1 NCT03060356, NCT03638206
DLL-3 Lung Phase 1 NCT03392064
DR5 Hepatoma Phase 1 NCT03638206
EpHA2 Glioma Phase 1 NCT02575261
FR-α Ovarian Phase 1 NCT00019136
gp100 Melanoma Phase 1 NCT03649529
MAGE-A1/3/4 Lung Phase 1 NCT03356808, NCT03535246
LMP1 Nasopharyngeal Phase 1 NCT02980315
(Adapted from Stem Cell Res Ther. 2021 Jan 25;12(1):81. doi: 10.1186/s13287-020-02128-1.)

1.5.3.1.1 Extracellular antigen binding domain
Generally, the extracellular domain of CAR comes from a single chain variable fragment that
derived from monoclonal antibody, of which only variable heavy chain (VH) and variable light
chain are joined by a flexible GS linker (162). This high affinity scFv can bind and recognize wide
types of antigens express on the surface of tumor cells such as glycoprotein, differentiation cluster
and receptors (Table 1-4). Others use protein receptors to create dominant-negative receptor CARs,
such as PD-1 and TGF-βRII (163, 164). Unlike TCR, which is restricted to major
histocompatibility complex (MHC), CAR-T cells specificity target antigens independent of human
leukocyte antigen (165). Thereby, attempts to avoid immuno-surveillance by down-regulating
HLA molecules by tumor cells doesn’t affect CAR-T cells’ ability to recognize target cells.
1.5.3.1.2 Hinge domain/spacer region
Although it is not related to the specificity of CAR, it is very important for the function as
inappropriate length of hinge will damage the function. Riddell et al. conducted an experiment
comparing the function among Receptor Tyrosine Kinase Like Orphan Receptor 1 (ROR1) CAR-
T cells with different lengths of hinge (166). Surprisingly, CAR-T cells with the shortest length of
36
hinge had the strongest immune response in cell killing and cytokines release, while CAR-T cells
with the longest hinge performed worst. Electron microscope indicates that the distance between
T cells and conjugated APCs is about 15 nm, which may account for the situation in some case
(167). However, another study inserted a certain hinge into different hingeless CARs against
various antigens (168). Some CARs after hinge insertion increased the functions while others
decreased the functions or even lost function. It is still unclear what is the appropriate length of
hinge for certain CAR. More research should be done to investigate the mechanism of CAR design
and adjust the hinge length for specific CAR against antigen of interest accordingly.
1.5.3.1.3 Transmembrane domain
Transmembrane domain is important for signaling transduce from ectodomain into intracellular
motif. Harris et al. found that transmembrane domain played a key role in surface expression of
single chain TCR (scTCR), although the T cells functioned well as detected by cytokine release
and cytotoxicity (169). Several commonly used transmembrane domains have been reported and
are derived from CD3ζ, CD4, CD8α and CD28 (141, 170-172). The first generation of CAR used
CD3ζ as the transmembrane domain. Replacement of transmembrane domain with CD8α or CD28
can increase CAR surface expression as well as T cell activation (172). Intriguingly, in a third-
generation of CAR with ICOS and 4-1BB demolished anti-tumor efficacy when replaced the
transmembrane domain from ICOS to CD8α (173, 174). Zhitao Ying also reported that different
length of hinge and transmembrane domain contributed the safety of CAR in human (175). Thus,
the use of transmembrane domain is in conjunct together with respective hinges or intracellular
costimulatory domains.
37
1.5.3.1.4 Intracellular signaling domain
The first-generation CAR doesn’t have a costimulatory domain, but it still has the ability to target
and lyse tumor cells. While the second and third generation CARs have one and two costimulatory
molecules, respectively, which further enhance the T cells function. The well-known co-
stimulatory domains include CD28 receptor family (CD28 and ICOS) and the tumor necrosis
factor receptor family (CD27, OX40 and 4-1BB), while CD28 and 4-1BB are the most widely
used ones. CD28 costimulation was demonstrated to promote rapid proliferation of T-cells and
effector functions, while 4-1BB costimulation conferred long-term persistence (137, 138, 176).
This change also reflected distinctly in the T-cell metabolism upon antigen stimulation (146).
CD28 containing CAR-T cells predominantly relied on glycolytic metabolism, whereas CAR-T
cells incorporating 4-1BB preferentially tended to oxidative phosphorylation with increased
mitochondrial biogenesis and fatty acid oxidation. Moreover, CD28-CAR-T cells induced faster,
and stronger phosphorylation compared to 4-1BB-CAR, resulting in profound changes in
transcriptional factors, cytokine release and effector molecules (177).
1.5.3.2 Methods of T cell transduction
High transduction efficiency of CAR-T cells with less variation between each batch is one of the
most important goals in clinical use. Several methods have been reported as follows.
1.5.3.2.1 Retroviral and lentiviral vectors
Viral based vectors have been found for a long time (178). Currently, these two vectors are
commonly used for T cell engineering (179). Upon transduction, T cells can maintain long-lasting
CAR expression after proliferation. Retrovirus is easily to prepare large scale of clinical-grade for
one time, but it can only infect dividing cells, which need to pre-activate T cells before transduction
(180). On the contrary, lentivirus can infect non-dividing cells, while the process is laborious. As
38
of safety issue, though viral gene may integrate into genomic DNA and cause insertional
mutagenesis like the development of leukemia (181), seldom such effect is observed in fully
differentiated T cells.
1.5.3.2.2 Nonviral gene transfer
In case of viral gene insertion into genome, several nonviral based methods have been generated.
mRNA was transiently electrophoresed into T-cells to avoid unknown toxicities and adverse
effects. Peshwa et al. used this method to scale up large volume of clinical grade T-cells (182).
And Deng et al. utilized modified TERT mRNA to deliver CAR into T-cells and enhanced the
persistence and antitumor efficacy in vivo (183). Since it is transient transfection, multiple rounds
of infusion into CAR-T cells are needed to maintain T-cell function. Another available method for
nonviral gene transfer is transposons such as PiggyBac and Sleeping Beauty. In 2006, Huang et al.
first introduced transposon to stably transfer gene into T-cells (184). Two years later, scientists
began to use this system to engineer CAR-T cells (185, 186). One clinical trial used Sleeping
Beauty system to transduce T-cells for treating patients with advanced leukemia (187).
1.5.3.3 Methods for improving safety.
Given the fact that CAR-T cells elicit significant toxic potential, lots of effects have been done
(Figure 1-10, 1-11, 1-12) (188). As mentioned above, transient transfection with mRNA could
avoid the immediate toxicity. Besides, strategies with low affinity CARs to target overexpression
antigens on tumor cells can reduce the influence of on-target-off-tumor. Low affinity CARs are
more probably to bind to highly expressed tumor antigens in tumor sites instead of the level
expression of the same antigen in normal cells, thus reducing the toxicity caused by CAR-T cells
targeting normal cells (189, 190). Others tried to improve the safety by introducing inducible gene
cassettes into CAR vector, which can be terminated after injection of inducer. First study using
39
this concept expressed herpes simplex virus thymidine kinase (HSK-TK) into donor lymphocytes
to control graft-versus-host disease (GvHD) (191). After adding Ganciclovir, a nucleoside analog,
HSV-TK phosphorylates the analog, whose metabolites are further phosphorylated by cellular
kinase that inhibits DNA polymerase to impair cells proliferation and DNA synthesis, causing
apoptosis. Another system included an inducible caspase 9 gene that consisted of FK506 binding
proteins (FKBP) (192). Upon chemical inducer of dimerization (CID) AP20187 administration,
caspase recruitment domain (CARD) dimerizes and leads to the aggregation of caspase 9, which
further activates downstream caspase 3 to induce apoptosis. More than 99% of T cells were
eliminated both in vitro and in vivo with a single dose in very short time. Clinical trials about
inducible caspase 9 as a suicide gene have been proved successfully (193). One group described
that truncated human EGFR containing N-terminal domain III and IV and transmembrane domain
but no extracellular binding domain nor intracellular receptor tyrosine kinase domain functioned
as a surface marker for selectively tracking adoptive transferred cells and eliminated T cells
because of antibody-dependent-cell-cytotoxicity (ADCC) upon binding to cetuximab whose Fc
domain engaged to Fc gamma receptors (FcγR) expressed on immune effector cells (194).

40

Figure 1- 11 Overcoming systemic cytokine toxicities of CAR T cells.
(Adapted from Nat Rev Clin Oncol,. 2020 Mar;17(3):147-167. doi: 10.1038/s41571-019-0297-y.)

Similarity, ideas that co-express two genes in synthetic biological CAR are wildly used. One way
to enhance the specificity of CAR-T cells is to separate the CAR construct into two parts, one
construct with attenuated signal and another construct containing costimulatory signal (190). Fully
activation of T cells requires both signals from part one and two. And only tumor cells express
antigens A and B simultaneously can deliver signal one and two to T cells for sufficiently
activation. This tumor-sensitive method could help enlarge CAR’s application and reduce or even
avoid some adverse effects when targeting certain types of antigens. Besides, Fedorov et al.
developed a PD-1 or CTLA-4 based inhibitory CAR (iCAR) that can strictly limit TCR function
41
(195). In vitro study demonstrated that CD19-CAR T cells could effectively and efficiently kill
the target cells 3T3-CD19, while co-expression of CD19 CAR and PD-1 iCAR or mutant CTLA-
4 iCAR failed to kill 3T3-CD19-PSMA cells due to the inhibitory signal. In vivo experiments also
proved the function of CAR-T cells. This iCAR offers temporary and reversible function and takes
advantages of minimizing unacceptable side effects. Wu et al. developed an on-switch splitting
CAR that was small molecule dependent. CAR T cells activity can be controlled by the dose of
drug remotely (196). In their design, conventional CAR was separated into two parts: one with
scFv that recognized the tumor antigen, hinge, transmembrane, chemical sensitive protein that can
dimerize and costimulatory domain, and another part only contained costimulatory domain,
heterodimerizing domain and CD3ζ. Without small molecule, CAR T cells can’t be activated to
kill the tumor cells. And cytotoxicity was associated with the concentration of chemical compound.
More importantly, physicians can decide the right time, dosage and location to precisely treat
patients. However, rapamycin analogs are still toxic and immune-suppressive via binding to
mTOC. To future application, the chemical induced heterodimerizing protein can be changed in
order to broaden its range of use, and enhance safety concerns, by using light sensitive proteins
(197). One strategy termed Bi-specific T-cell engager (BiTE) first came from 1995, (198). And
blinatumomab, an anti-CD3 X CD19 bi-specific antibody was used in precursor B-ALL (199). The
concept of using antibody as a bridge is widely adopted then. An early study termed as “universal”
CAR-T cells that were transferred with biotin-binding immune receptor (BBIR), a modified avidin
that linked to intracellular signaling domain. By using biotin labeled monoclonal antibody, target
tumor cells were specific recognized by mAb and BBIR expressing T cells were recruited and
activated by biotin-avidin axis (200). Though this method didn’t achieve satisfactory result in mice
study and had potential host immune response to BBIR (201, 202), it created a new era for
42
engineering T cells with multiple strategies. Later on, an anti-FITC CAR-T cells showed great
antitumor activity both in vitro and in vivo with complete tumor regression after injection of FITC
conjugated mAb targeting tumor cells (203). This progress can be reversed by using FITC labeled
nonspecific IgG or FITC to compete with FITC labeled tumor specific antibody. Kudo et al.
modified this strategy by combining CAR with ADCC (204).

43

Figure 1- 12 Overcoming on-target, off-tumor toxicities of CAR T cells.
(Adapted from Nat Rev Clin Oncol,. 2020 Mar;17(3):147-167. doi: 10.1038/s41571-019-0297-y.)

They designed CD16 variant CAR that contained a FcγR that bound to the Fc part of an antibody,
triggering ADCC, which significantly increased the antitumor activity. Unlike other tag specific
CAR, Ma et al. used site specific protein conjugation strategy that allowed FITC linked to the site
of scFv with bio-orthogonal chemical reaction (205). This method permitted the overall control
over the stoichiometry and geometry between tumor cells and CAR-T cells when T cells interacted
with tumor cells. Same time from the same institute, Rodgers et al. engineered CAR by introducing
44
peptide neo-epitopes (PNE), which doesn’t exist in human endogenous tissues (206). Another
genetically modified T cells with Strep-tag II at the specific sites of CAR could use for rapid
identification and purification of CAR positive T cells, facilitating to obtain large scale and pure
populations in a short time for clinical therapy (207). Advantages as in vivo trafficking and
retrieving T cells for analysis were also applicable. Desnoyers et al. engineered EGFR antibody
cetuximab by binding a masking peptide and substrate on it as probody (208). This masked CAR
can be cleaved by proteases sensitively in tumor sites while proteolytic activity is minimal in
healthy tissues. Upon cleavage at substrate by proteases, inhibitory masking peptide released and
probody regained the full function. Recently, a novel system came out called “synNotch”, a
modular synthetic Notch receptor, that could sense novel environmental input and activate
downstream transcriptional factors (209). In this model, an extracellular recognition domain and
intracellular transcriptional factor were linked by a small key regulatory domain from Notch.
Besides, the ectodomain and endodomain can both be switched with diverse motifs based on
different situations. Roybal et al. from the same lab tested the system in vivo with dual receptor
circuits (210). An anti-GPF SynNotch with Gal4VP64 intracellular receptor together with an
inducible anti-CD19 CAR construct were transfected into T cells. After recognizing and targeting
antigen 1, here as GFP, Gal4 was cleaved and binding to corresponding response elements, which
triggered CD19-CAR expression and bound to antigen 2, here as CD19, which activated T cells
and resulted in T-cell function. These kind of T cells can really discriminate tumor cells with two
combinatorial antigens from bystander tissues that only contain one antigen, preventing off target
toxicity.
45

Figure 1- 13 Improving the efficacy of CAR T cell therapy.
(Adapted from Nat Rev Clin Oncol,. 2020 Mar;17(3):147-167. doi: 10.1038/s41571-019-0297-y.)

46
1.5.3.4 Improvement of CAR-T signaling and persistence
T-cell exhaustion is a common issue in current CAR-T cells with the phenomena of poor effector
function and high expression of inhibitory genes. The fine tune of T-cell signaling is vital to the
outcome of immunotherapy. However, the concept is changing from enhanced signaling (the more,
the better) to reduced and balanced signaling (less is more). The first generation of CAR contained
only CD3ζ signaling domain, which was not efficient in eliminating tumor cells. The incorporation
of CD28 or 41BB costimulatory domain is the hallmark of the second-generation of CARs, which
provides supportive secondary T-cell signaling to improve cell proliferation, survival and function.
Stronger signaling is equipped in the third generation of CAR via tandem fused two costimulatory
molecules. However, the benefit of strong signaling is unclear and even contradicted. In some
preclinical data, the third-generation of CAR-T cells indeed have better efficacy in T-cell
persistence and tumor elimination (134, 173). However, other groups found not beneficial
compared to the second-generation of CAR (211-213). One possible reason is strong activation of
third-generation of CAR-T cells that lead to cell apoptosis (211, 214). The fourth-generation of
CAR was modified based on the second-generation, which a fusion protein such as IL-12 was
added. The secretion of IL-12 promotes T cell function synergistically via release of
perforin/granzyme or triggering Fas-FasL and TRAIL systems (215). Kagoya et al. reported that
by using a truncated IL-2 receptor β cytoplasmic domain integrated into the second-generation
CAR, T cells were able to increase the phosphorylation of STAT3/5, which provided full signals
for T-cell activation and proliferation (216). Others also demonstrated the enhanced anti-tumor
responses by the co-expression of 4-1bbl, which is the ligand for 4-1bb (176). And a phase I
clinical trials has been conducted to evaluate the safety and efficacy (217). Another application
was using constitutively active MyD88/CD40 to improve CAR-T cells proliferation, survival and
47
anti-tumor activity against blood cancer (218). CAR-T bearing 4-1BB costimulatory domain with
LCK overexpression also enhanced antitumor activity (219). A CD28 based CAR with TRAF2
domain (1928zT2) demonstrated superior anti-tumor function compared with 1928z as well (220).
It is well-known that strong activation would lead to cell apoptosis as well as exhaustion (221,
222). Several strategies were used to reduce the exhaustion event. One way used CRISPR/Cas9
technology to knock in CAR cassette into TRAC locus, which helped generate universal CAR
expression and reduce exhaustion in vivo (223). Other ways to maintain T cell potency were
developed by attenuating the redundancy of CD28 and CD3ζ. There are three ITAMs in the CD3ζ,
which may contribute to the T-cell exhaustion. By mutation or deletion of two ITAMs, 1928z CAR
with one ITAM in the CD3ζ cytoplasmic domain exerted memory-phenotype with lower
expression of exhaustion markers and higher percentage of long-lived memory T cells while
maintaining the similar cytotoxic ability compared to conventional CAR (224). In consistent, a
single mutation in the CD28 from YMNM to YMFM enhanced T-cells persistence. YMNM motif
interacted with Grb2, leading to NFAT translocation and increasing IL-2 promoter activity (225).
Substitution of asparagine (N) to phenylalanine (F) reduced Grb2 binding and IL-2 production. On
the contrary, replacement of the YMFM in the ICOS costimulatory molecule to YMNM induced
Grb2 binding and NFAT activation (226). Thus, CAR-T cells with CD28-YMFM indicated less
calcium signaling and thereafter less exhaustion by reduced transcriptional activity of NR4A and
TOX (227, 228). Besides the costimulatory and signaling domain, modifications in the length of
hinge and transmembrane also contributed to the intensity of signaling. Zhitao Ying investigated
different length of hinge and transmembrane domain compared with the protype 19bbz. They
found that 19bbz (86) T cells produced lower cytokines while retaining cytolytic activity (175).
Importantly, no neurological toxicity or cytokine-release syndrome (greater than grade 1) was
48
observed in the 25 patients treated with modified CAR-T products. Furthermore, CAR-T cells
equipped with a low-affinity scFv derived from CAT131E10 hybridoma had greater antigen
specific killing ability and proliferation in vitro, and those findings were also confirmed in vivo
(229). The affinity of CAT scFv for CD19 was found to be 40-folder lower compared to FMC63
scFv, which contributed to the enhanced signaling due to shorter interaction duration between
ligand on the tumor cells and receptor on the T cells. Similarly, introducing negative feedback into
CARs also generated long-lived T cells with lower cytokine release. SHP1 is a phosphatase that
deactivates a series of kinases such as Lck and Zap70 in the TCR signaling pathway upon binding
to the immunoreceptor tyrosine-based inhibition motifs (ITIMs) via 2 tandem SH2 domains (230,
231). A CD19-CAR T cells encoding CD28 with SHP1 phosphatase had attenuated signaling and
ameliorated cytokine release syndrome, although no significant difference in overall survival was
observed (219). Interestingly, Wei’s group identified the difference between four CD3 subunits in
phosphorylation after T-cell activation (232). They found that CD3ε ITAMs was mono-
phosphorylated due to the selectivity of Lck, while others were at least dual phosphorylated in the
ITAMs to interact with the tandem SH2 domains containing proteins. CD3ε specifically recruites
Csk, a kinase that negatively regulates TCR signaling through the ITIM. Incorporation of CD3ε
intracellular domain to a second-generation CAR with CD28 altered CAR-T cell signaling and
improved antitumor activity with enhanced persistence. Besides the methods by introducing
negative regulators to regulate CAR-T signaling, temporal control of CAR expression could also
avoid tonic signaling and T-cells over-activation upon stimulation. A destabilizing domain (DD)
in the C-terminus of CAR was able to control CAR expression level in a drug dose-dependent
manner (233). Transient rest of CAR-T cells restored the anti-tumor function in the exhausted T
cells and redirected them to a memory-like phenotype. Similarly, an FDA-approved drug, dasatinib,
49
which is a tyrosine kinase inhibitor, could reversibly inhibit CAR signaling and improve
therapeutic efficacy. On the other hand, inhibition of negative regulators also improves the anti-
tumor activity. CAR-T cells with PTPN2 knockout increased Lck expression and STAT5
phosphorylation, leading to increased CAR-T cells activation and homing, thereby eliminating the
Her2+ tumor in vivo (234, 235) The canonic AP-1 transcriptional factor c-jun overexpression
enhanced CAR-T cell proliferation and expansion potential with increased anti-tumor activity and
reduced terminal differentiation (236). A CAR construct with CD40L rendered the CAR-T cells
the ability to upregulate costimulatory markers on CD40+ tumor cells and recruit immune effector
cells such as DCs, resulting in increased antitumor response and prolonged mice overall survival
(237). Zhi-chun Ding’s group reported that CAR-T cells co-expressed with constitutively active
STAT5 generated exhaustion-resistant and multi-functional CD4 T-cells and elicited CD8 T-cells’
anti-tumor responses (238). A CAR construct with all lysine mutated in the CAR cytoplasmic
domain (CAR
KR
) blocked CAR recycle from cell surface and lysosomal degradation via
ubiquitination (239). CAR
KR
T-cells had enhanced ability to recycle the internalized CAR back to
cell surface, promoting the persistence of 4-1BB containing CAR-T cells and long-term killing
ability with increased oxidative phosphorylation and memory T differentiation. Linchun Jin et al.
discovered that upon radiation induction, tumor cells secrete IL-8, which attracted CXCR1 or
CXCR2 expressing CAR-T cells to the tumor sites, enhancing anti-tumor response, inducing long-
lasting memory T cells and resulting in completely tumor rejection (240). Similarly, CAR-T cells
engineered with CCL19/IL7 achieved tumor free in immunocompetent mice via the mechanism of
increased DCs infiltrating. The cooperation between CAR-T cells and innate cells triggered
augmented and sustained anti-tumor immune response in vivo (241). Constitutively signaling
cytokine receptor IL7R equipped CAR-T cells had durable anti-tumor response and T-cell
50
persistence (242). Interestingly, tri-CARs (243) composed of one anti-PSMA CAR with CD3ζ
signaling domain, one anti-TGF-β CAR with 4-1BB costimulatory domain and one domain
negative CAR to convert IL-4 signaling outside to IL-7 signaling intracellularly resulted in T cells
expansion and persistence in the tumor microenvironment (244). IL-15 signaling also enhanced
anti-tumor activity by reducing mTORC1, increasing metabolic fitness and preserving stem cell
like memory phenotype (245). A group of researchers from Dr. Shi Hu discovered that CAR
exosome did not express PD-1 but highly express cytotoxic molecules, demonstrating safety and
anti-tumor response in a preclinical model in vivo (246). A synthetic T-cell receptor (TCR) and
antigen receptor (STAR) engineered T cells used full TCR-CD3 signaling with no tonic signaling
to prevent early dysfunction of CAR-T cells, increase sensitivity to tumor with low-copy number,
demonstrating robust tumor regression in an established solid tumor model (247).
However, the efficacy of all CARs has not been compared systemically. It is still a mystery that
whether more or less signaling is better for CAR-T cell therapy. Besides, most approaches are only
tested in the CD19 CAR-T model, while results may change with other types of CAR due to the
different affinity of scFvs and lack of ideal hinge length. One possible inference is that for the
19bbz CAR construct, there could be more signaling to enhance the anti-tumor response, where
for the 1928z CAR construct, less signaling may lead to better therapeutic result. Finally, clinical
responses are correlated with in vivo persistence of CAR-T cells. Memory T cells have the ability
of death-resistance even after repetitive encounters with tumor antigen. Central-memory T cells
(TCM) and stem cell like memory T cells (TSCM) are critical for in vivo expansion, proliferation,
survival and long-term persistence. To generate more less differentiated memory T-cell subsets in
the ultimate product is key to the success of clinical use in cancer patients.

51
Table 1- 5 Genes involved in the regulation of exhaustion and senescence pathways in T cells.
Gene name Pathway Mechanism of action Study in CAR T
PD-1 Exhaustion Immune checkpoint Yes (164, 248-256)
CTLA-4 Exhaustion Immune checkpoint Yes (257, 258)
TIM-3 Exhaustion/senescence Immune checkpoint Yes (259)
LAG-3 Exhaustion/senescence Immune checkpoint No
CD160 Exhaustion Immune checkpoint No
VISTA Exhaustion Immune checkpoint No
BTLA Exhaustion Immune checkpoint No
KLRG-1 Senescence Immune checkpoint No
CD57 Senescence Immune checkpoint No
TIGIT Exhaustion/senescence Immune checkpoint Yes (260)
2B4 Exhaustion Immune checkpoint No
CD39 Exhaustion Immune checkpoint No
CD73 Exhaustion Immune checkpoint No
c-JUN Exhaustion Gene expression regulation Yes (236)
c-FOS Exhaustion Gene expression regulation Yes (236)
JunB Exhaustion Gene expression regulation Yes (236)
IRF4 Exhaustion Gene expression regulation No
BATF Exhaustion Gene expression regulation Yes (236)
BATF3 Exhaustion Gene expression regulation Yes (236)
NFAT Exhaustion Gene expression regulation No
Eomes Exhaustion Gene expression regulation Yes (261)
T-bet Exhaustion Gene expression regulation Yes (262)
TOX Exhaustion Gene expression regulation Yes (263)
NR4A Exhaustion Gene expression regulation Yes (264)
BLIMP1 Exhaustion Gene expression regulation No
TCF1 Exhaustion Gene expression regulation Yes (265)
DNMT3A Exhaustion Gene expression regulation No
PI3K Exhaustion/senescence Signaling mediator Yes (266, 267)
AKT Exhaustion/senescence Signaling mediator Yes (268)
52
Gene name Pathway Mechanism of action Study in CAR T
mTOR Exhaustion/senescence
Signaling mediator, cell
cycle regulation
Yes (245)
FOXO Exhaustion/senescence
Signaling mediator, cell
cycle regulation
Yes (262)
PTPN2 Exhaustion Signaling mediator Yes (269)
PP2A Exhaustion Signaling mediator Yes (270)
LCK Exhaustion Signaling mediator Yes (219)
SHP1/SHP2 Exhaustion Signaling mediator Yes (219)
A2AR Exhaustion Signaling mediator Yes (271, 272)
PKA Exhaustion Signaling mediator Yes (273)
TGFβ Exhaustion Signaling mediator Yes (274-280)
TGFBR1/TGFBR2 Exhaustion Signaling mediator Yes (163, 276, 281)
PDK1 Exhaustion Signaling mediator No
PKC Exhaustion Signaling mediator No
p38 Senescence Signaling mediator No
PIR-B Exhaustion Signaling mediator No
p21
CIP1
Senescence Cell cycle regulation No
p16
INK4A
Senescence Cell cycle regulation No
p53 Senescence Cell cycle regulation No
RB Senescence Cell cycle regulation No
hTERT Senescence Telomere’s stabilization Yes (282)
CAT Exhaustion/senescence Oxidative stress response Yes (283)
(Adapted from Oncogene volume 40, pages421–435(2021))
53
Chapter 2: Development of TCR-Like Antibody and Chimeric Antigen Receptor for
Cancer Immunotherapy
2.1 Abstract
The current therapeutic antibodies and chimeric antigen receptor (CAR) T-cells are solely capable
to recognize surface antigens but not intracellular proteins, which limits the target options for drug
development. To mimic the feature of TCR that recognizes the complex of peptide and major
histocompatibility class I (MHC-I) on the cell surface derived from the processed intracellular
antigen, we used NY-ESO-1, a cancer-testis gene as a target, to develop a TCR-like fully human
IgG1 antibody and its derivative- CAR-T cells. Monoclonal antibody 2D2 (mAb 2D2) bound to
NY-ESO-1157-165 in the context of human leukocyte antigen HLA-A*02:01, but not to non-A2 or
NY-ESO-1 negative cells. Furthermore, the second-generation CAR-T cells engineered from mAb
2D2 clone fused with 4-1BB and CD3ζ specifically recognized and eliminated A2+/NY-ESO-1+
tumor cells in vitro, impaired tumor growth and prolonged the overall survival of mice in vivo.
The generation of TCR-like antibody and CAR-T cells provides the state-of-the-art platform and
proof-of-concept validation broadens the scope of target antigen recognition, and sheds light on
the development of novel therapeutics for cancer immunotherapy.

2.2 Introduction
Cancer is the leading cause of death worldwide, posting as one of the most prevalent major public
health issues of today. Although surgery, chemotherapy and radiotherapy have been widely
adopted as effective cancer treatment options, drawbacks such as severe side effects and
incapability to refractory cases reflect the limitations of these methods. Immunotherapies which
include therapeutic monoclonal antibodies are emerging as a major option to cancer treatment
(284). As an important branch of immunotherapy, chimeric antigen receptor (CAR) engineered T
54
cells show impressive clinical benefits in leukemia and lymphoma (130, 131). For instance, Emily
Whitehead, the first patient who received this new treatment in 2012, has been living cancer-free
for more than 9 years. However, mainly due to a paucity of ideal and targetable tumor-associated
antigens (TAAs) expressed on tumor surface, the application of CAR-T therapy has been severely
limited in patients with blood cancer (285-287). Although this may be the case for surface antigens,
there are plenty of intracellular antigens overexpressed in tumor cells which are awaiting novel
strategies for targeting (288).
Cancer-testis antigens are considered promising target antigens for cancer immunotherapy (289).
For example, expression of the New York Esophageal Squamous Cell Carcinoma-1 (NY-ESO-1)
is limited in germ cells such as testis but not in normal somatic tissue, while it is highly expressed
in a range of tumor cells including melanoma, sarcoma and multiple myeloma (41, 42). Multiple
vaccination strategies using NY-ESO-1’s most immunogenic peptides: NY-ESO-180–109 for CD4+
T cells and NY-ESO-1157–165 for CD8+ T cells, have induced limited immune response (290).
Although there have been promising results achieved by vaccines designed as a treatment in
patients with cancer, the multiplicity of concerns regarding the distinctive structures apparent in
vaccine induced TCRs and natural TCRs indicate that vaccination strategy may not accurately
reflect true anti-tumor responses (291-293). On the other hand, TCR engineered T cells presented
durable clinical responses in HLA-A2+ patients with metastatic or refractory melanoma and
sarcoma (128, 294). However, difficulties in generation of high specific TCRs and manipulation
of TCR constructs impair its further application.
A possible approach in combining the advantages of both CAR and TCR technology is to generate
TCR-like antibodies and derivatives, which are able to recognize intracellular antigen processed
and presented onto the cell surface by MHC molecules. Antigen-specific antibodies could be
55
screened from synthetic human scFv, Fab phage library or hybridomas generated from immunized
animals such as mice (116, 295). Those TCR-like mAbs displayed highly specific binding affinity
and killing ability in vitro and in vivo (63). Moreover, mAbs can be readily further modified and
optimized, and derivatives from TCR-like antibody, such as antibody drug conjugates (ADCs), bi-
specific T cells engagers (BiTEs) and CAR-T cells have yielded impressive results (79, 82, 117,
296, 297).
Here, we report the development of a TCR-like antibody mAb 2D2 that recognizes HLA-A2+/NY-
ESO-1+ tumor cells with high specificity. CAR construct derived from scFv of 2D2 demonstrates
the activity in eradicating target tumor cells. This is the first report of CAR-T cells targeting NY-
ESO-1, an ideal TAA for cancer immunotherapy, serving as a proof of principle to expand the
tumor antigen from existing surface expressed tumor antigens to promising intracellular TAAs.
Collectively, our data highlights a novel of CAR-T technology and a new strategic application to
immunotherapy.

2.3 Materials and methods
2.3.1 Animal
Six- to eight-week-old NSG mice were purchased from Jackson Laboratory or bred in the animal
facility at Houston Methodist Research Institute. All procedures have been approved by Houston
Methodist Research Institute Animal Care and Use Committee (IACUC).
2.3.2 Cell lines
HEK293T, MDA-MB-231-ESO1, and PC3-A2-ESO1 were cultured in DMEM supplied with 10%
inactivated FBS and 100 unit/ml of Penicillin and 100 µg/ml of Streptomycin. T2 cells, Mel 586,
Mel 624 and Mel 1558 were cultured with RPMI-1640 containing 10% inactivated FBS and 100
56
unit/ml of Penicillin and 100 µg/ml of Streptomycin. All cells were routinely tested as mycoplasma
negative.
2.3.3 Panning of phage-displayed scFv antibody library
Human scFv phage-display antibody library (~10
11
clones) was constructed in the lab (298). For
peptide-MHC complex panning (synthesized by the NIH tetramer facility), an in-solution method
was adopted to avoid the disadvantage of the immobilization method that may cause
conformational change of the pMHC complex. Briefly, the scFv phage was blocked with an equal
amount of 10% milk for 1 hour at room temperature. 100 µl streptavidin-conjugated Dynabeads
M-280 (Thermo Fisher) were blocked with 5% milk at room temperature for 1 hour. The first
round of negative selection against control biotinylated-pMHC (pp65 peptide/HLA*0201, 200nM)
was mixed with blocked phage and beads. After incubation at room temperature for 1 hour, beads
were pulled down through a magnetic rack and the deselected phages were transferred to a new
tube and incubated with biotinylated NY-ESO-1/HLA*0201 complex for 1 hour. Mixed with 100
µl streptavidin-conjugated dynabeads and incubated for 1 more hour. Beads were pulled down and
washed quickly with PBST (0.05%) twice, followed by three-time wash with a 5 min incubation,
and then quickly washed with PBS twice. The remaining phages on beads were eluted by adding
200 µl fresh 100 mM TEA with 20 min incubation. The supernatant was transferred to a 50 ml
tube and neutralized with ½ volume 1 M Tris-HCI (pH 7.5). Next, 10 mL fresh prepared TG1 cells
(OD600: 0.5-0.8) were added to the neutralized phage and incubated at 37 °C for 1 hour at 250
rpm. The infected TG1 cells were inoculated on a 2xYTA plate with antibiotics and incubated at
30 °C overnight. The input and output phage were tittered, and the enrichment ratio was calculated.
The panning process was repeated 3 rounds, with decreased biotinylated NY-ESO-1/HLA*0201
complex concentration (200 nM-50 nM-10nM).
57
2.3.4 Phage ELISA
After 3 rounds of phage panning, the output phage-infected TG1 clones were picked by colony
picker (Molecular Devices) into 96-well plates and cultured at 775 rpm at 37 °C with 80%
humidity overnight. Phage ELISA was exactly performed as following: first, transfer 3 µl
overnight cultured bacteria to a new 96 well plate with 120 µl 2xYTAG medium; secondly,
incubate 1.5 - 2 hours at 37 °C at 775 rpm with 80% humidity until OD600 reaches 0.4 - 0.8;
then, add 20 μl/well diluted M13K07 helper phage to obtain a ratio of 10 helper phages : 1 bacterial
cell and incubate 1 hour; after that, pellet the bacteria and resuspend with 150 μl/well 2xYTAK
medium containing 0.5 mM IPTG and culture at 30 °C, 775 rpm with 80% humidity overnight;
finally, centrifuge the plates at 2,500 g for 20 min and use the supernatants for the ELISA.
ELISA was performed as follows: 96 well high binding plates were coated with 100 µl/well
streptavidin (2µg/ml) overnight at 4 °C. The next day, plates were blocked with 5% BSA and then
incubated for 1 hour at room temperature with 100 µl/well NY-ESO-1/HLA-A2 complex (2 µg/ml).
Then 100 µl/well supernatants were added and incubated for 1 hour followed by washes 3 times
with PBST and 2 times with PBS. HRP conjugated anti-M13 IgG (Santa Cruz Biotechnology) was
used to detect the remaining phage. TMB was used as substrate, and OD450 was measured.
2.3.5 Antibody production and purification
Phagemids of positive clones were extracted for DNA sequencing. After sequencing analysis with
IMGT, CDR diversity was summarized and unique combinations of heavy chain and light chain
nucleotide sequences were obtained. Specific infusion primers were designed to PCR the heavy
chain and light chain from the phagemid DNA. The purified PCR product was infused into human
IgG heavy chain and light chain expression vector. The clones were picked for Sanger sequencing
58
to confirm the correct infusion of antibody sequence. Heavy and light chain plasmids were co-
transfected in Expi-293 cells, and antibodies were purified by protein A resin.
2.3.6 ELISA of purified NY-ESO-1 antibodies
ELISA was performed similarly as mentioned in phage ELISA, but used purified antibodies in
replacement of Phage and used HRP anti-human-IgG as a secondary antibody for detection.
2.3.7 Generation of retroviral constructs and transduction
Codon optimized 2D2 scFv was synthesized from Integrated DNA Technologies, Inc. (Skokie, IL),
with a (G4S)3 linker between the heavy chain and light chain. A GM-CSF leader sequence was
added in front of the viable heavy chain. The fragment was cloned into pMSGV1 retroviral vector
containing CD8α hinge and transmembrane domain, followed by 4-1BB costimulatory domain
and CD3ζ signaling domain. All constructs were sequencing confirmed.
Blood from healthy donors was obtained from Gulf Coast Regional Blood Center. Fresh PBMCs
were isolated with Ficoll reagent following the manufacturer’s instruction. Buffy layer was
collected and washed twice with PBS. T-cell medium suspended PBMCs then were seeded into
anti-human CD3 antibody (OKT3) coated plate for activation. Furthermore, retrovirus was
packaged in HEK 293T cells with envelop plasmid RD114 and packaging plasmid Gag-pol. Virus
was harvested at 48- and 72-hours post-transfection and filtered with 0.45 µm filter. Activated
PBMCs were transduced twice with retrovirus with the presence of RetroNectin as per the
manufacturer’s guide. T cells were cultured for 3-7 days before use.
2.3.8 Cytokine detection
HEK293T (HLA-A2
+
/NY-ESO-1
-
), MDA-MB-231 (HLA-A2
+
/NY-ESO-1
-
breast cancer cell),
MDA-MB-231-A2-ESO (MM231-ESO: HLA-A2
+
/NY-ESO-1+), PC3-ESO (NY-ESO-1
+
/HLA-
A2
-
prostate cancer cell), and PC3-A2-ESO were seeded in a 96-well round bottom plate with
59
triplicates (10
4
cells/well). T cells (0.1 million/well) were co-cultured with tumor cells overnight.
NY-ESO-1157-165 peptide (20 μg/ml) was added into HEK293T cells as a positive control. On the
following day, 50 μl supernatants were added into human IFN-γ (1:1000, Thermo, M700A) pre-
coated and 1% BSA blocked plate for a 1-hour incubation at room temperature with gentle shake.
The plate was then washed twice and incubated with biotin conjugated IFN-γ antibody (1:1000,
Thermo M700B) for 1 hour, followed by another two washes and avidin-HRP (1:5000) incubation
for 30 minutes in the dark. After washing, 100 μl TMB was added for reaction, which was stopped
by 50 μl 2.5 N sulfuric acid after 15 minutes. The absorbance was read on a spectrophotometer
(Bio-Tek) at 450 nm.
2.3.9 Flow Cytometry
Flow cytometric analysis was performed by using BD LSR II. T cells were stained with protein L
and biotinylated HLA-A2/NY-ESO-1 monomer for CD19 CAR-T and 2D2 CAR-T cells,
respectively, followed by PE conjugated streptavidin, while using biotinylated HLA-A2/CMV
monomer as control. Tumor cells were stained with mAb 2D2 for 30 min and followed by goat-
anti-human IgG-Alexa fluor 594. Data was analyzed with FlowJo V10.0.7 software (TreeStar).
2.3.10 Confocal imaging
Cells were seeded in a 4-chamber glass bottom dish. HEK 293T cells were pulsed with 20 µg/ml
NY-ESO-1 or control peptide. Cells were fixed by 4% PFA for 15 min at the room temperature.
After washing, cells were blocked with 5% normal goat serum for 1 hour and incubated with 10
µg/ml mAb 2D2 and APC conjugated anti-human HLA-A2 antibody at 4 °C overnight. The next
day, cells were washed three times with PBS and incubated with 5 µg/ml Alexa Fluor 488 or 594
conjugated goat-anti-human (H+L) secondary antibody for one hour in the dark. Nucleus was
60
stained with Hoechst 33342 for 5 min. Imaging was acquired with a Nikon A1 confocal
microscopy.
2.3.11 Immunohistochemistry
Formalin fixed samples were embedded by paraffin. Blocks were cut at 5 µm and mounted onto
positively charged glass slides. After deparaffinization and hydration using graded concentrations
of ethanol to deionized water, sections were stained with mouse-anti-human CD3 (Invitrogen,
MA5-12577, 1:20) and mouse-anti-human CD8α (Abcam, ab187279, 1:200), respectively. DAB
(3,3′diaminobenzidine) was used as a chromogen, followed by nuclear counterstaining. Then
slides were washed and dehydrated and covered by coverslips with a permount mounting medium
(Fisher, SP15-100). Imaging was captured by Olympus microscopy equipped with a DP74 camera.
2.3.12 LDH cytotoxicity release assay
Transduced T cells were co-cultured with tumor cells with a series of E: T ratio in 96-well plate
for 6 hours and 24 hours, respectively. Supernatant containing LDH was transferred into a new
enzymatic plate for cytotoxicity assay as per the manufacturer’s instruction. The absorbance was
read on a spectrophotometer (Bio-Tek) at 490 nm. Percentage of specific lysis was calculated as
the formula: % Cytotoxicity = (Experimental – Effector Spontaneous – Target Spontaneous) /
(Target Maximum – Target Spontaneous) * 100. All values were substrated by medium control
first.
2.3.13 Toxicity studies
Mice were treated with the same dose used to achieve effective therapy (10 million T cells,
intravenously), and the in vivo toxicity was determined by potential clinical signs such as body
weight loss and histopathological microscopic evaluation of the major tissues at day 6 and 14.
61
2.3.14 Statistical analysis
Data were presented as mean ± SEM. Student’s t-tests (unpaired, two-sided) were used to study
the differences between groups; Kaplan-Meier analysis, and log-rank tests were used in the
survival comparisons; Statistical analysis was performed with GraphPad Prism 8 (GraphPad
Software, Inc). P values of <0.05 were considered to be significant.

62
2.4 Results
2.4.1 Screening and selection of specific scFv for HLA-A2/NY-ESO-1 complex and engineering
of full-length human mAb
To begin with, quality and specificity of biotinylated monomer were verified by using previously
identified NY-ESO-1/A2 TCR-T cells. Irrelevant HLA-A2/CMV complex and CT83/A2 TCR-T
cells were used as control. HLA-A2/NY-ESO-1 complex but not HLA-A2/CMV complex could
specifically induce activation and cytokine releases of ESO/A2 TCR T cells. On the contrary,
neither HLA-A2/CMV or HLA-A2/NY-ESO-1 complex could be recognized by CT83/A2 TCR-
T cells. Those data suggest that HLA-A2/NY-ESO-1 complex could be used for downstream of
phage screening (Figure 2- 1).

Figure 2- 1 Verification of specificity and quality of HLA-A2/NY-ESO-1 complex by IFN-γ ELISA.ESO/A2 TCR-
T and CT83/A2 TCR-T cells were pulsed with HLA-A2/NY-ESO-1 peptide and HLA-A2/CMV peptide overnight
in a series of concentrations, respectively. Supernatant were harvested for IFN-γ detection. Only HLA-A2/NY-ESO-
1 monomer complex specifically triggered ESO/A2 TCR-T cells release of I IFN-γ.

Human single chain variable antbiody fragment (scFv) was selected by a negative biopanning of
a phage-displayed scFv antibody library on biotinylated HLA-A2/CMV pp65495-503
63
(NLVPMVATV) control peptide monomer followed by a positive biopanning on HLA-A2/NY-
ESO-1157-165 (SLLMWITQC) monomer. Hence, phages that bind to HLA-A2 and an irrelevant
peptide or biotin would have been eliminated in this step (Figure 2- 2A). After 3~4 rounds of
panning, 40 clones showed positive binding to HLA-A2/NY-ESO-1 via phage ELISA (Figure 2-
2B, Figure 2- 3A). Those clones were sequenced and diversity of genotype was analyzed according
to the IMGT repertoire (www.imgt.org) (Figure 2- 3B). Ten clones with unique antibody
sequences were further cloned into expression vectors and eight fully human IgG1 antibodies were
expressed and purified. Two purified mAb E5 and mAb 2D2 showed high specificity in
recognition of 10 µg/ml HLA-A2/NY-ESO-1 complex but not HLA-A2/CMV complex (Figure 2-
3C). However, mAb E5 showed no recognition of HLA-A2/NY-ESO-1 complex at a low
concentration of 1 µg/ml while mAb 2D2 maintained the specificity in recognizing target antigen
but not control antigen (Figure 2- 2C). An antibody titration experiment against HLA-A2/NY-
ESO-1 showed EC50 of E5 was 66 nM, while mAb 2D2 had an EC50 of 0.608 nM (Figure 2- 2D,
Figure 2- 3D). This could explain the difference in recognition of antigen between mAb E5 and
mAb 2D2 mAb at the low concentration. Thus, mAb 2D2 was selected for further validation.
64

Figure 2- 2 Selection of scFvs specific for HLA-A2/NY-ESO-1 complex.(A) The schematic diagram of screening of
HLA-A2/NY-ESO-1 complex specific antibodies from human scFv phage-displayed library. Phage library was
negative and positive selected against HLA-A2/CMV pp65 (495-503) and HLA-A2/NY-ESO-1 (157-165),
respectively. Final binders were sequenced and converted to full-length IgG1. (B) Example plate of phage ELISA
against biotin conjugated HLA-A2/NY-ESO-1
157-165
monomer. Positive clones were considered as three times higher
than the threshold calculated by the average value of negative control wells. (C) ELISA validation of purified
monoclonal antibodies against HLA-A2/NY-ESO-1 and control pMHC complex at concentration of 1 µg/ml. (D)
Antibody titration of positive clone mAb 2D2 via ELISA.
65

Figure 2- 3 Screening strategy of HLA-A2/NY-ESO-1 specific antibodies from human scFv phage library.(A)
Positive “hits” were confirmed by phage ELISA against HLA-A2/NY-ESO-1 complex but not HLA-A2/CMV
complex. Sequencing identified clones were further cloned to expression vector to express full length human IgG1.
Proteins were purified and validated with ELISA. (B) Diversity of heavy chain and light chain of positive clones that
categorized by IMGT. (C) ELISA validation of purified monoclonal antibodies against HLA-A2/NY-ESO-1 and
control pMHC complex at concentration of 10 µg/ml. (D) Antibody titration of positive clone E5 via ELISA.
66
2.4.2 Characterization of 2D2 mAb
To further characterize the specificity of mAb 2D2, we first measured the affinity of mAb 2D2 to
HLA-A2/NY-ESO-1 complex by the bio-layer interferometry (BLI) on an Octet instrument, and a
moderate high affinity interaction between mAb 2D2 to HLA-A2/NY-ESO-1 complex was
reflected in the Kd value of 5.74 ± 0.221 nM (Figure 2- 4A). Flow cytometry showed that mAb
2D2 specifically recognizes NY-ESO-1 peptide pulsed HEK 293T cells, which form HLA-
A2/NY-ESO-1 complex, in a dose-dependent manner but not CMV peptide pulsed HEK 293T
cells that present HLA-A2/CMV control complex (Figure 2- 4B). Increasing the concentration of
mAb 2D2 from 0.5 µg/ml to 4 µg/ml dramatically enhanced the percentage of positive cells from
32.7% to 80.2%, while further increased the concentration of antibody only slightly changed the
positive rate (Figure 2- 4B). Similarly, mean fluorescence intensity (MFI) also indicated the
specificity of mAb 2D2 binding to HLA-A2/NY-ESO-1 complex, with a saturated concentration
above 16 µg/ml (Figure 2- 4C). We also used immunofluorescence to confirm our result by
confocal microscopy imaging. HEK 293T cells were pulsed with NY-ESO-1 and CMV peptide,
respectively. Cells were co-stained with anti-HLA-A2 and mAb 2D2, as well as DAPI for the
nucleus. mAb 2D2 co-localized with HLA-A2 in NY-ESO-1 peptide pulsed HEK 293T cells but
not in CMV control peptide pulsed cells (Figure 2- 4D), indicating the antigen specific binding of
mAb 2D2 on the cell surface, which is a critical prerequisite for targeted therapy such as CAR-T.

67

Figure 2- 4 Characterization of 2D2 mAb and its specificity. (A) Binding affinity of mAb 2D2 to the HLA-A2/NY-
ESO-1 complex measured by the bio-layer interferometry (BLI) on an Octet instrument. (B) Flow cytometry
68
analysis of mAb 2D2 with a series of dilution. HEK 293T cells were pulsed with 20 µg/ml NY-ESO-1 or CMV
peptide for 1 hour at 37 °C. Cells were washed and stained with a series dilution of mAb 2D2 followed by Alexa
Fluor 594 conjugated goat-anti-human (H+L) secondary antibody. mAb 2D2 could recognize NY-ESO-1 pulsed
HEK 293T cells but not CMV peptide pulsed HEK 293T cells. (C) Mean fluorescence intensity analysis from panel
B. (D) Confocal imaging of mAb 2D2 staining in NY-ESO-1 peptide pulsed HEK 293T. HEK 293T cells were
pulsed with 20 µg/ml NY-ESO-1 or CMV peptide for 1 hour. Cells were fixed with 2% PFA and then stained with
APC conjugated HLA-A2 and mAb 2D2 followed by Alexa Fluor 594. Hoechst 33342 was used for nuclear
staining.

2.4.3 Retrovirally transduced T cells express the 2D2-BBZ CAR
The 2D2-BBZ CAR was engineered using variable heavy and light chain sequences from the 2D2
scFv connected by a (Gly4Ser)3 flexible linker. The 2D2 scFv with a GM-CSF leader sequence
was ligated upstream to the CD8α hinge and transmembrane and 4-1BB costimulatory domain and
CD3ζ signaling domain. The resulting 2D2-BBZ gene was cloned into a pMSGV1 gamma-
retroviral vector and confirmed by sequencing (Figure 2- 5A). Following retroviral transduction,
T cells expressed high levels of 2D2-BBZ CAR, as assessed by flow cytometric analysis utilizing
a biotinylated HLA-A2/NY-ESO-1 monomer followed by streptavidin-PE (Figure 2-5B). The
transduction efficiency of the CAR T cells was between 30% and 90% for all experiments. To
confirm that the 2D2-BBZ CAR was not artificially binding to HLA-A2/NY-ESO-1 monomer due
to high avidity for the antigen, a cytomegalovirus (CMV)-HLA-A2 monomer was used to stain
CAR T cells. No binding of the HLA-A2/CMV monomer was observed on 2D2-BBZ CAR T cells
(Figure 2- 6A).

2.4.4 2D2-BBZ CAR T cells specifically recognize and lyse HLA-A2
+
, NY-ESO-1
+
cells in vitro.
The specific recognition capability of 2D2-BBZ CAR T cells was assessed by IFN- ELISA
against a range of HLA-A2
+
and/or NY-ESO-1
+
cancer cell lines and HLA-A2
+
cells pulsed with
NY-ESO-1157-165 peptide. 2D2-BBZ CAR T cells specifically and significantly recognized TAP-
deficient T2 cells pulsed with 20 µg/ml NY-ESO-1 peptide but not T2 cells loaded with CMV
69
peptide (Figure 2- 5C). Meanwhile, 2D2-BBZ CAR T cells could also recognize a range of tumor
type including HEK 293T pulsed with 20 µg/ml NY-ESO-1 peptide, triple negative breast cancer
overexpressing NY-ESO-1 (MDA-MB-231-ESO1) and prostate cancer cells expressing HLA-A2
and NY-ESO-1 (PC3-A2-ESO1) as well as Mel 624 and Mel 1558, endogounous A2 and NY-
ESO-1 double positive tumor cell lines but not Mel 586 (A2-, NY-ESO-1+) (Figure 2- 5D, E).
Proliferation assay using CFSE labeled T cells indicated 2D2-CAR specific T cells divided quickly
after co-culture with tumor cells (Figure 2- 6B). Activation marker such as CD25 and CD69 were
significantly up-regulated in both CD4 and CD8 T cells upon recognition of tumor cells (Figure
2- 6C, D). To demonstrate the killing ability of 2D2-CAR T cells, a range of effector-to-target
ratios were set. 2D2-CAR T cells could lyze T2 cells pulsed with NY-ESO-1 but not CMV peptide
(Figure 2- 5F). Furthermore, 2D2-CAR T cells exhibited specific killing of MDA-MB-231-NY-
ESO1 and PC3-A2-NY-ESO1 tumor cell lines as compared with control T cells or genetically
engineered T cells targeting CD19 (19BBZ) (Figure 2- 5G). However, there was no difference
between 2D2-CAR and CD19-CAR against a control cell line HEK 293T (Figure 2- 5G).
Siginificantly, 2D2-BBZ CAR-T could also kill Mel 624 and Mel 1558 but not Mel 586 (Figure
2- 5H). Moreover, a similar experiment was conducted by co-culturing 2D2-CAR T cells with
CFSE labelled NY-ESO-1 peptide pulsed T2 cells overnight. Flow cytometry analysed the
remaining CFSE postive tumor cells. 2D2-CAR T cells dramatically eliminiated tumor cells
compared with control CD19 CAR-T cells (0.28% versus 28.1%) (Figure 2- 6E). More importantly,
NY-ESO-1 mRNA expression level can be significantly induced by FDA-approved DNA
demethylating agent 5-aza-2'-deoxycytidine (DAC) in MCF7 and MDA-MB-231 tumor cell lines
(Figure 2- 7A). Enhanced expression led to recognition by 2D2-BBZ CAR-T cells and killing
ability (Figure 2- 7B, C).
70

71
Figure 2- 5 2D2-bbz CAR T cells specifically recognize and lyze HLA-A2+, NY-ESO-1+ cells in vitro. (A)
Schematic diagram of 2D2 CAR construct. 2D2 scFv was cloned into pMSGV1 retroviral vector with CD8α hinge
and transmembrane, 4-1BB co-stimulatory and CD3ζ signaling domain. (B) Surface expression of CAR detected by
HLA-A2/NY-ESO-1 complex. (C) IFN-γ cytokine release measured by ELISA. T2 cells were pulsed with 20 µg/ml
NY-ESO-1 or CMV peptide for 1 hour. 2D2-bbz CAR T cells were co-cultured with target cells with 10:1 (E: T)
ratio overnight. (D) IFN-g cytokine release measured by ELISA. 2D2-bbz CAR T cells were co-cultured with HEK
293T cells pulsed with NY-ESO-1 or CMV peptide, PC3-A2-NY-ESO-1, MDA-MB-231-NY-ESO-1 at 10:1 ratio
overnight. (E) 2D2-bbz CAR T cells were co-cultured with endogenously expression cell lines Mel 586 (A2-/NY-
ESO-1+), Mel 624 (A2+/NY-ESO-1+) and Mel 1558 (A2+/NY-ESO-1+). (F) LDH cytotoxicity assay. 2D2-bbz
CAR T cells were co-cultured with T2 cells that were pulsed with 20 µg/ml NY-ESO-1 or CMV peptide for 1 hour
for 4 hours. (G) LDH cytotoxicity assay. 2D2-bbz CAR T cells were co-cultured with MDA-MB-231-NY-ESO-1
and PC3-A2-NY-ESO-1 and HEK293T for 24 hours, respectively. (H) LDH cytotoxicity assay for 2D2-BBZ and
control T cells against Mel 586, Mel 624 and Mel 1558. (*: p<0.05; **: p<0.01; ***: p<0.001; ****: p<0.0001; ns:
not significant)

Figure 2- 6 2D2-bbz CAR T cells specifically recognize and lyze HLA-A2+, NY-ESO-1+ cells in vitro. (A)
Untransduced T cells and 2D2 retroviral transduced T cells were stained with biotinylated HLA-A2/CMV, followed
by Avidin-Alexa Fluor 594. (B) Proliferation of control T cells and 2D2-BBZ CAR-T cells. (C) and (D) Flow
cytometry detection of activation markers of T cells CD25 and CD69, respectively upon co-culture with MBA-MD-
72
231-NY-ESO-1 tumor cells. (E) Specific killing of CFSE labeled T2 cells pulsed with NY-ESO-1 peptide by 2D2-
CAR-T cells was measured by flow cytometry.

Figure 2- 7 DAC could enhance NY-ESO-1 expression in mRNA level and lead to recognize and kill by 2D2-BBZ
CAR-T cells.(A) MCF 7 and MDA-MB-231 tumor cell lines were treated in the presence of DAC for 3 days. mRNA
was extracted and NY-ESO-1 expression was detected by agarose electrophoresis. GAPDH was used as an internal
control. (B) IFN release after 2D2-BBZ CAR-T cells co-cultured with DAC treated MDA-MB-231 (MM-231) and
MCF7. (C) LDH cytotoxicity assay of 2D2-BBZ-CAR-T cells and GFP transduced control T cells against DAC
treated MM231 and MCF7. (*: p<0.05; **: p<0.01; ***: p<0.001; ****: p<0.0001; ns: not significant)

2.4.5 2D2-BBZ CAR T cells prolong the survival of mice bearing triple negative breast cancer in
vivo.
To assess the efficacy of 2D2-directed CAR T cells in a solid tumor model in vivo, human triple
negative breast cancer MDA-MB-231 expressing NY-ESO-1 was injected to the fat pad of NSG
mice. Mice were randomized to be treated with 2D2-CAR T cells or control T cells via i.v. four
days post-tumor inoculation (Figure 2- 8A). A significant release of IFN-γ in mice serum was
73
detected on day 5 post adoptive cell transfer (Figure 2- 8B). A single dose of 2D2-CAR T cells
significantly impaired tumor growth compared to mice from control group (P=0.0018) (Figure 2-
8C-E). In addition, Mice treated with 2D2-CAR T cells greatly enhanced overall survival from a
median survival of 31 days to 41 days (Ctrl vs 2D2-CAR T: P=0.0027) (Figure 2- 8F). Through
further investigation in the mice spleen, we detected more CD3+ T cells in 2D2-BBZ CAR-T cell
treated group than control group (Figure 2- 9A). The CD3 positive T cells were counted and
percentage in the spleen indicated 10-fold higher in the 2D2-BBZ CAR-T group compared with
control group (Figure 2- 9B). Furthermore, significantly T cell infiltration (CD3 and CD8) into
tumor cells were detected in the tumor section from 2D2-CAR T treated mice (Figure 2- 9C, D).
These data suggest that 2D2-CAR T cells can effectively infiltrate into tumor, kill tumor cells,
impair tumor growth and prolong mice overall survaival.

74

75
Figure 2- 8 2D2-BBZ CAR T cells impair tumor growth and prolong the survival of mice bearing triple negative
breast cancer in vivo.(A) A schematic diagram of the animal experiment. NSG mice were injected 2M MDA-MB-
231 expressing NY-ESO-1 s.c. on day 0. Day 4, 10 M 2D2 CAR T cells or control T in 200 µL PBS were injected
i.v. followed by three continuous 50, 000 units rhIL-2 i.p. (B) IFN-g ELISA with mice serum at day 5 after T cells
injected. (C) Tumor volume analysis between control group and 2D2-CAR T cells treated group. (D) Picture of
tumor at the time of endpoint. (E) Tumor weight was quantified from panel D. 2D2-CAR T treated group
significantly reduced the volumes of tumors. (F) Representative survival analysis of MBA-MD-231-NY-ESO-1
bearing mice treated with 2D2-CAR T cells compared with control group. (**: p<0.01; ***: p<0.001)

Figure 2- 9 2D2-CAR T cells have increased persistence in spleen and enhanced ability in tumor infiltration. (A)
Immunohistochemistry detection of human CD3 in spleen. (B) Statistical analysis of CD3 in spleen from panel A.
(C and D) T cells infiltrated into tumor. (C) IHC detection using anti-human CD3 and (D) anti-human CD8.

2.4.6 2D2-CAR T cells demonstrates anti-tumor activity against an endogenously expressing
A2/NY-ESO-1 tumor model in vivo.
To further demonstrate the anti-tumor response in a more clinical relevant applicaiton, we chose a
tumor cell line Mel 1558 that endogenously exresses A2/NY-ESO-1. Two million tumor cells were
76
subcutanously implanted at right flank of NSG mice. 2.5 million 2D2-CAR T cells were injected
at day 4 followed by 50,000 IU rhIL-2 via i.p. Cytokine was detected on day 6 after T cell injection
from mice serum (Figure 2- 10A). We noticed significant difference in IFN-γ release between
control and treated groups, even through the amount is very low (Figure 2- 10A). 2D2-CAR T
treated mice had dramatically reduction in tumor growth starting from day 35 (Figure 2- 10B). The
tumors harvested from 2D2-CAR T treated mice were about 50% smaller compared to control
groups (Figure 2- 10C). Further analysis in the tumor section by IHC revealed that significant
increasment of T cells infiltrated in the tumor in the 2D2-CAR T treated group than control group
(Figure 2- 10D). Consistently, flow cytometry also proved the existance of T cells in the tumor
section with more than 5-fold higher in 2D2 group (Figure 2- 10E). All these data suggest that
2D2-CAR T cells can inhibit the growth of tumor endogenously expressing A2/NY-ESO-1 in vivo.
77

78
Figure 2- 10 2D2-CAR T cells demonstrate anti-tumor activity against an endogenously expressing A2/ESO tumor
model in vivo (A) 2 million Mel 1558 tumor cells were inoculated at right flank of NSG mice followed by control T
or 2D2-CAR T cells treatment, respectively. IFN-γ was detected from the mice serum harvested 6 days after T cell
injection. (B) Tumor growth of Mel1558 in NSG mice was measured weekly via calipers. 2D2-CAR T cells treated
mice had significantly impaired tumor growth. (C) Image of tumor size harvested from mice. (D) Tumor weight of
the tumor. (E) T cell infiltration into tumor detected by CD3 IHC. (F) T cell infiltration into tumor detected by flow
cytometry. (*: p<0.05; ****: p<0.0001)
2.4.7 Safety assessment of 2D2-CAR T cells demonstrates no damage to key organs in vivo.
To evaluate the potential side effect of 2D2-CAR T cells, NSG mice were treated with 10 M 2D2-
CAR T cells and control T cells, respectively. Body weight was monitored as schedule and key
organs were harvested on day 6 and day 14 for histopathology analysis (Figure 2- 11A). No severe
body loss was observed after 6 days and 14 days (Figure 2- 11B). H&E staining of key organs
such as heart, spleen, lung, kidney, brain and liver indicated normal tissue form compared to
control group. No tissue damage was observed (Figure 2- 11C).

79

80
Figure 2- 11 Safety assessment of 2D2-CAR T cell in vivo. (A) A schematic diagram of the animal experiment. NSG
mice were infused with 10 M 2D2-CAR T cells or control T cells on day 0. Body weight was measure as indicated.
On day 6 and day 14, mice were sacrificed for histopathology assessment of the acute and chronic side effect,
respectively. (B) Body weight change after T cells injection. (C) H&E staining for the key organs, heart, spleen,
lung, kidney, brain and liver with 10x magnification.

2.5 Discussion
Identification of available TAAs that are highly expressed in tumors but with no expression in
essential normal organs or limited expression in non-essential normal organs is one key factor to
the success of immunotherapy. Current TAAs that serve as targets of CAR-T therapies are all cell
surface proteins, such as the well-studied CD19, CD22 and BCMA molecules. The lack of
targetable surface expressed TAAs or the inability of utilizing intracellular antigens impair the
extension of CAR technology for clinical purposes. One strategy to target those intracellular TAAs
is through the generation of TCR-like antibodies and its derivatives to mimic the feature of TCR
in specifically recognizing intracellular epitopes presented onto cell surface in the context of HLA
molecules. Recent advances in monoclonal antibody screening allow the isolation of highly
specific scFvs to pMHC complexes. Herein we report the discovery of mAb 2D2, a novel TCR-
like human full-length IgG1 monoclonal antibody against an intracellular cancer-testis antigen
NY-ESO-1, which is an ideal target for various types of tumor (42, 299, 300). We demonstrate
that mAb 2D2 screened from human scFv phage-displayed library could specifically recognize
HLA-A2/NY-ESO-1 monomer as well as NY-ESO-1157-165 pulsed T2 or HEK 293T cells and
tumor cells expression A2 and NY-ESO-1, but neither HLA-A2/CMV control monomer nor cells
without HLA-A2/NY-ESO-1 expression on the surface.
We also demonstrate that genetically engineered 2D2-CAR T cells could specifically recognize
HLA-A2/NY-ESO-1 complex and consequently lyse tumor cells both in vitro and in vivo. Mice
treated with 2D2-CAR T cells significantly impaired the growth of A2 and NY-ESO-1 double
81
positive breast cancer cells and enhanced overall survival. Notably, no adverse effect was observed
in the key organs of the normal mice treated with 2D2-CAR T cells along, demonstrating the safety
of the 2D2-CAR T cells.
Our work presented here is the first study to demonstrate the practicability of TCR-like antibody
derived CAR targeting cancer-testis antigens in vivo. In 2004, instead of non-immune, human scFv
phage-displayed library, Held et al. used a semi-synthetic Fab repertoire to screen antibodies that
could bind to HLA-A2/NY-ESO157-165 (69). Although they removed streptavidin binders, there
was no negative selection round against the HLA-A2 complex with non-relevant peptide. The
affinity of antibody (3M4E5) isolated from the screening was 60 nM, which was further modified
to increase the affinity via the comparison between high-resolution structure of 1G4 TCR and
3M4E5 bound to HLA-A2/NY-ESO-1. Using computer model analysis, a new library with point
mutations in the residues not contacting with the peptide was generated (70). This super-high
affinity antibody (T1) exceeded the affinity of TCR by 1000-fold. Specific lysis of HLA-A2
positive T2 cells pulsed with NY-ESO-1 peptide was observed. However, no evidence indicated
the killing ability of primary tumor cells. Moreover, CAR derived from T1 antibody didn’t
maintain the specificity (72). The non-specificity was possibly due to the high affinity of T1
antibody similar to high affinity TCRs that excessive CAR binding to HLA caused the loss of
specificity (301-304). High affinity is not always associated with high anti-tumor activity. Inaguma
et al. also implicated that although TCR-like CAR had higher affinity, they need high-density of
minor histocompatibility antigen HA-1H presented at cell surface (95). A native TCR of WT1 was
also compared with CAR derived from TCR-like antibody. Similarly, αβ-TCR with relatively low-
affinity maintained specificity and cytotoxic activity, while the high-affinity CAR loss of
specificity and reduced killing ability (121). We did notice dramatically reduced cytokine release
82
in CAR T cells stimulated with pMHC complex or tumor cells, while the cytotoxic activity was
only minimally affected in comparison with NY-ESO-1 TCR in vitro (data not shown). mAb 2D2
has an affinity of 5.74nM, a moderate high affinity for a monoclonal antibody, which somehow
maintains the specificity, promoting the success of CAR-T therapy later. Interestingly, the
immunoglobin type of mAb 2D2 VL chain was same as T1, while it differed in the heavy chain
variable region. However, 2D2-CAR T cells did not display “off-target” issue, as proved by the in
vivo experiment.
Considerable research and clinical trials targeting the NY-ESO-1 cancer-testis gene have been
done (305). By stimulating the host immune system with humoral and cytotoxic T lymphocytes’
responses to peptide, NY-ESO-1 vaccine could target and lyse tumor cells expressing NY-ESO-1
(306). In combination with adjuvants or checkpoint inhibitors, NY-ESO-1 vaccine increases the
anti-tumor activity (290, 307). However, the efficacy in those studies was not as satisfied as
expected. Adoptive cell transfer with TCR engineered T cells showed impressive clinical
responses in melanoma, sarcoma and multiple myeloma, but not in breast cancer, lung cancer and
other types of cancer. Here, we demonstrated the success of 2D2-CAR T cells in treating triple
negative breast cancer MDA-MB-231 expressing NY-ESO-1 as well as melanoma model with Mel
1558 that endogenously expresses A2/NY-ESO-1 in vivo. Our TCR-like antibody derived CAR-T
cells bypassed the requirement of pre-existing NY-ESO-1 specific T cells induced by vaccination
and the potential mis-pair with endogenous TCR caused by transgenic TCR. The limited success
of current cancer vaccine and other immunotherapy strategies may be markedly enhanced by our
TCR-like CAR T cells. However, limitations of TCR-like CAR are that it is still HLA-dependent,
and it lacks suitable targets so far. Another disadvantage is considering its potential off-target
caused by recognizing large invariable MHC molecules instead of pMHC complex. The minor
83
change in peptide buried in the groove of HLA could broaden or impair the application. Although
we didn’t observe severe off-target issues in key organs, it still needs further investigation to fully
understand before clinical use.
In summary, our results presented here provide a proof-of-concept that TCR-like antibody derived
CAR-T cells could successfully inhibit tumor cell growth and enhance mice overall survival.
Unlike current CAR technology that only recognizes surface antigens, TCR-like CAR could
bypass the restriction of TAAs expressed intracellularly, and in turn apply to a number of related
malignancies. This strategy could be further expanded to other commonly expressed tumor
antigens in a range of tumor types. The specificity and cytotoxicity of our CAR would significantly
impact our future plan on patients with relapsed and refractory HLA-A2+/NY-ESO-1+ tumors in
clinical trials. Finally, with the advance of next-generation sequencing, neo-antigens and common
mutated antigens would be another perfect but difficult choice for development of TCR-like
antibody and derivatives, greatly broadening the application of current immunotherapy strategies
(86, 87).

84
Chapter 3: A novel Chimeric Antigen Receptor with Zap70 enhances anti-tumor activity
by generating long-lived memory cells and lowering exhaustion markers
3.1 Abstract
The adoptive cell transfer (ACT) of chimeric antigen receptor (CAR) engineered T cells
specifically for CD19 positive leukemia and lymphoma has shown impressive and durable clinical
responses. However, the severe side effects associated with CAR-T therapy and the limited
efficacy in treating solid tumors constrain the application of clinical use. Here, we constructed a
novel CAR with the signaling domain from Zap70 instead of conventionally used CD3 zeta. This
brand-new CAR not only lowered T cell exhaustion markers in vivo, but also increased T cell
proliferation, persistence and anti-tumor activity. More importantly, CARs with Zap70 direct T
cells to long-lived memory phenotype, enhancing mice overall survival.

3.2 Introduction
It has been more than 25 years since the development of the first-generation chimeric antigen
receptor (CAR) (308-310). Diverse efforts have been made to improve the efficacy and safety
matters concerning the adoptive transfer of genetically engineered CAR-T cells. CD19-targeted
CARs achieved clinically durable and impressive responses in patients with refractory CD19-
positive B cell leukemia (130, 131, 151, 311, 312) and lymphoma (313, 314) and were approved
by the US Food and Drug Administration (FDA) recently (315). However, the success in treating
hematological malignancies have yet to exceed beyond the limited therapeutic benefits for solid
tumors (136, 201, 316). One possible reason is due to poor trafficking and complicated tumor
microenvironment which suppress T cell immune responses. Another explanation may be strong
85
T-cell activation that leads to exhaustion accentuated by current CARs with CD3 zeta signaling
(224, 317).
The recognition of peptide-MHC complex by TCR induces conformational changes of associated
proteins and facilitates phosphorylation in the immunoreceptor tyrosine-based activation motifs
(ITAMs) of CD3 by the Src kinase leukocyte-specific tyrosine kinase (318) (319, 320). Doubly
phosphorylated CD3 ITAMs recruit the Syk family kinase Zeta- activated protein 70 kDa (Zap70)
via tandem Src- homology-2 (SH2)-domain’s interactions, releasing Zap70 from an autoinhibition
conformation to promote catalytic activity by Lck (321). Activated Zap70 subsequently
phosphorylates a number of downstream signaling proteins such as the linker for the activation of
T cells (LAT) and the SH2-domain-containing leukocyte protein of 76 kDa (SLP-76), which
function as adaptors and scaffolds to recruit more signaling molecules, eventually contributing to
T cell activation, proliferation and differentiation (322). Similarly, the extracellular ligand binding
domain of CAR recognizes antigen and triggers downstream signaling through the CD3 molecule.
The CD3ζ was used from the first CAR generation and continued to serve the molecule for signal
transduce from second-generation and third generation, as well as the fourth generation. Though
diverse of researches fused other molecules to enhance anti-tumor response, the core molecule
CD3ζ was still maintained, even the two FDA-approved CAR products. CAR construct consists
of antigen-binding domain, hinge and transmembrane domain, as well as costimulatory domain
and signal transduce domain. Dozens of targets have been investigated for a range of cancer types,
and the length of hinge and the origin of transmembrane from other genes have also been studied.
Various costimulatory domains including CD27, CD28, OX-40, 4-1BB and ICOS affect the
outcome as well. Although several groups tried to replace CD3ζ with other molecules, the results
86
failed to have comparable anti-tumor activities. Thus, the query on whether CD3ζ can be replaced
with other viable candidates is still unknown.
Here, we hypothesized that the currently synthetic CARs design contributes to strong T cell
activation and toxic signaling. As a strategy to redirect T cell signaling with low toxicity, we
developed CAR constructs with a new signal domain from Zap70 in replacement of CD3ζ chain.
Our results demonstrate the superiority over conventional CAR construct in a pre-clinical
lymphoma model with a significant extension in mice overall survival.

3.3 Materials and methods
3.3.1 Plasmids
The 19bbz CAR-encoding gene was generated by linking the sequences derived from FMC63
scFV to those of the CD8α extracellular, transmembrane and cytoplasmic domain of 4-1BB, and
the cytoplasmic domain of CD3ζ, while 1928z used CD28 hinge, transmembrane domain and
intracellular domain. 1928zz300 and 1928zz327 were generated by fusing Zap70 starting from
300 a.a and 327 a.a, respectively to the end of the CD3ζ chain. 1928z300 and 1928z327 was
generated by replacing CD3z with Zap70 (a.a. 300-619 and a.a. 327-619, respectively). All
constructs were cloned into the pMSGV1 vector and sequencing confirmed.
3.3.2 Human PBMC and transduction
Blood from healthy donors was obtained through the Gulf Coast Regional Blood Center. Fresh
PBMCs were isolated with Ficoll reagent following the manufacturer’s instruction. Buffy layer
was collected and washed twice with PBS. T-cell medium suspended PBMCs then were seeded
into anti-human CD3 antibody (OKT3) coated-plate for activation. Retrovirus was harvested from
stably transduced PG13 virus packaging cell lines. Otherwise, retrovirus was packaged in HEK
87
293T cells with envelop plasmid RD114 and packaging plasmid Gag-pol. Virus was harvested at
48 hours post-transfection and filtered with 0.45 µm filter. Activated PBMCs were transduced
twice with retrovirus with the presence of RetroNectin as per manufacturer’s guild. T cells were
cultured for at least 3 days before use.
3.3.3 Flow cytometry
The following antibodies were used for the flow cytometry analysis. Pierce™ Recombinant
Protein L, Biotinylated; Streptavidin PE/APC; anti-mCD45 ; anti-CD19 ; anti-CD3 ; anti-CD4 ;
anti-CD8 ; anti-CD45RO ; anti-CD62L and anti-CCR7 . For the CFSE cell proliferation assay, T
cells were labeled with 2 μM CFSE (Thermo Fisher Scientific) before culture. The stained cells
were analyzed with a BD LSR II instrument (BD Biosciences). The data analysis was performed
using the FlowJo software (Tree Star).
3.3.4 Cell lines
HEK293T, MDA-231-CD19, B16-CD19 were cultured in DMEM supplied with 10% inactivated
FBS and 100 unit/ml of Penicillin and 100 µg/ml of Streptomycin. THP-1, Daudi, Jeko-1, Raji,
Raji-GFP, Raji-ffluc and NALM-6 were cultured with RPMI-1640 containing 10% inactivated
FBS and 100 unit/ml of Penicillin and 100 µg/ml of Streptomycin. All cells were routinely tested
as mycoplasma negative.
3.3.5 ELISA
Virus transduced T cells were cooled down in the absence of IL-2 for 1-2 days. Cells were co-
cultured with tumor cells in different E:T ratios. In the following day, diluted supernatant was
added into human IFN-γ (1:1000, Thermo, M700A) pre-coated and 1% BSA blocked plate for a
1-hour incubation at room temperature with gentle shake. The plate was then washed twice and
incubated with biotin conjugated IFN-γ antibody (1:1000, Thermo M700B) for 1 hour, followed
88
by another two washes and avidin-HRP (1:5000) incubation for 30 min in dark. After washing,
100 μl TMB was added for reaction, which was stopped by 50 μl 2.5 N sulfuric acid.
3.3.6 LDH cytotoxicity release assay
Transduced T cells were co-cultured with tumor cells per a series of E:T ratios in 96-well plate for
6 hours or 24 hours, respectively. Supernatant containing LDH was transferred into a new
enzymatic plate for cytotoxicity assay following manufacturer’s instruction. The absorbance was
read on a spectrophotometer (Bio-Tek) at 490 nm. Percentage of specific lysis was calculated as
the formula: % Cytotoxicity = (Experimental – Effector Spontaneous – Target Spontaneous) /
(Target Maximum – Target Spontaneous) * 100.
3.3.7 Serum
Peripheral blood was collected from the mice tail vein. Blood was left for 30 min at room
temperature and centrifugated at 8000 g for 15 min, 4 °C. Serum concentrations of human IL-2,
IFN-γ and TNF-α in Raji-bearing mice were measured using an enzyme-linked immunosorbent
assay (ELISA). The concentration was calculated using a four-parameter logistic regression (4-PL)
model.
3.3.8 Statistical analysis
Statistically significant differences between two groups were assessed using unpaired t-test.
Comparisons between more than two groups were carried out by an ANOVA with Tukey’s
multiple-comparisons test. Differences were considered statistically significant at a P value <0.05.
In the mouse experiments, the overall survival of the mice that were treated with the T cells were
depicted by a Kaplan–Meier curve, and the survival difference between the groups was compared
using the log-rank test. All statistical analyses were performed using GraphPad Prism 8 software.
No statistical method was used to predetermine the sample size.
89
3.3.9 Animal
Six- to eight-week-old NSG mice were purchased from Jackson Laboratory or bred in the animal
facility at Houston Methodist Research Institute. All procedures have been approved by Houston
Methodist Research Institute Animal Care and Use Committee (IACUC). In the CD19 positive B
cell lymphoma mouse model, mice were intravenously injected with 5 million Raji-ffluc cells.
Tumor burden was confirmed by bioluminescence imaging with Xenogen IVIS Spectrum and
analyzed with Living Image software (Perkin Elmer). One infusion of 0.5 million CAR+ T cells
was administered to the mice on day 4 after transplantation of tumor cells. Mice were monitored
at least once daily and euthanized by CO2 inhalation after they became moribund and hinder leg
paralysis due to the leukemia progression or if they had more than 20% weight loss. For assessment
of CAR-T function, 2 million Raji cells were injected intravenously on day 0, followed by 2 million
CAR-T cells injection on day 4 via i.v. Mice were sacrificed on day 17. Peripheral blood, liver,
spleen, lung and bone marrow were harvested for flow cytometry to detect CD3+CAR+ T cells
and CD19 positive tumor cells, as well as memory T cells.

3.4 Results
3.4.1 Fusion of Zap70 kinase domain to CD3ζ chain enhances anti-tumor activity.
CD3ζ chain is one important component of the TCR-CD3 complex, which play a critical role in
signaling transducing. The goal of CD3ζ is to recruit Zap70 after phosphorylated in the ITAMs.
Current CARs contain a CD3ζ chain for the purpose of T cell activation. We hypothesized that
CAR with Zap70 would contribute to the CAR signaling. We first fused Zap70 kinase domain
(starting from 300 a.a. of Zap70) to the end of CD3ζ chain with CD28 as costimulatory domain
under the conventional CD19 CAR, namely 1928zz300 (Figure 3-1A). Two phosphorylation sites
90
Try-315 and Try-319 in the interdomain B play important roles in TCR activation. Thus, another
CAR construct with Zap70 kinase domain (starting from 327 a.a.) was also made (1928zz327)
(Figure 3-2A). Flow cytometry demonstrated that 1928zz300 had equal level of CAR expression
to 1928z (Figure 3-1B). CAR expression in all experiments were between 20% and 90%. To test
whether Zap70-associated CAR could trigger downstream signaling upon binding to antigens, we
co-cultured 1928z and 1928zz300 gamma-retrovirus transduced T cells with CD19 positive target
cells and CD19 negative cells as control. Only Raji, Daudi and Jeko-1 could specifically induce
cytokine interferon-γ (IFN-γ) release, but not THP-1, HEK293T cells (Figure 3-1C). Similarly,
1928zz327 CAR-T cells could also recognize Raji cells, releasing comparable and more IFN-γ to
conventional CAR-T cells (Figure 3-2B). Furthermore, mixture of similar size Raji-GFP cells with
THP-1 cells at a 1:1 ratio was co-cultured with 1928z and 1928zz300 overnight, respectively.
Remaining CD19 positive Raji cells were analyzed with flow cytometry. About 90% of Raji cells
were eliminated by both CAR-T cells (Figure 3-1D). They were also found to directly kill target
cells in a non-radioactive LDH cytotoxicity assay with a series dilution of E:T ratios (Figure 3-1E,
3-2C).
91

Figure 3- 1 Fusion of Zap70 kinase domain to CD3ζ chain (1928zz300) enhances anti-tumor activity. A). Diagram
of conventional CAR construct 1928z and modified CAR construct 1928zz300. B). Flow cytometry analysis of CAR
surface expression on the T cells. C). IFN-γ ELISA against CD19 positive cell lines Raji, Daudi and Jeko-1 as well
92
as CD19 negative cell lines THP-1 and HEK293T cells. D). Flow cytometry based killing assay. Raji-GFP and
THP-1 were mixed at 1:1 ratio and co-cultured with control T, 1928z and 1928zz300 CAR-T cells overnight,
respectively. The percentage of live Raji cells were analyzed by GFP signal. E). Non-radiative cytotoxicity assay
was measured by LDH release with different E:T ratio. F). In vivo detection of human CD3 T cells in blood, liver
and spleen with mouse CD45 as internal control. G). Percentage of human CD19/ mouse CD45 in the liver. H).
Raji-bearing mice were treated with 5 × 10
5
CAR+ T cells. Kaplan–Meier analysis of survival of mice treated with
1928z compared with 1928zz300. Control refers to untreated mice. P values were determined by a one-sided log-
rank Mantel–Cox test. (***: p<0.001)
While the Zap70 kinase domain fused CAR did not noticeably alter short-term in vitro function, it
outperformed 1928z in vivo. Both 1928zz300 and 1928zz327 dramatically prolonged overall
survival in a well-established Raji lymphoma mouse model (Figure 3-1F, 3-2D). To detail examine
the difference between 1928z and 1928zz300, we challenged mice with 5M Raji tumor cells
followed by CAR-T cells injection (Figure 3-3A). Body weight was monitored every 1-3 days as
indicated. Without CAR-T cells treatment (control group), mice lost body weight dramatically
starting from day 9 and became paralysis of hinder legs around day 17. Mice treated either 1928z
or 1928zz300 CAR-T cells maintained normal and healthy growth rate (Figure 3-3B). Serum was
collected from those mice before and after treatment. Both 1928z and 1928zz300 groups detected
significant increasement of IFN-γ after CAR-T cells injection and peaked at day 7. It went down
to undetectable level at day 11 (Figure 3-3C). Further analysis in the blood, liver and spleen, higher
percentage of human CD3/ mouse CD45 but lower percentage of human CD19/mouse CD45 were
found in 1928zz300 group compared to 1928z group (Figure 3-1F, 3-1G, 3-3C, 3-3D). H&E
staining indicated obvious tumor lesions in the section as well as positive Ki67 and CD19 IHC
staining in spleen, bone marrow and liver (Figure 3-3E-G). However, there was no obvious change
in 1928z and 1928zz300 group. But we still could find that mice treated with 1298zz300 CAR-T
cells showed better histological results in H&E staining.
93

Figure 3- 2 Fusion of Zap70 kinase domain to CD3ζ chain (1928zz327) enhances anti-tumor activity. A). Diagram of
conventional CAR construct1928zz327. B). IFN-γ ELISA against CD19 positive cell line Raji. C). Non-radiative
cytotoxicity assay was measured by LDH release with different E:T ratio. D). Raji-bearing mice were treated with 5
× 10
5
CAR+ T cells. Kaplan–Meier analysis of survival of mice treated with 5 × 10
5
1928z, 1928zz300 and
1928zz327. P values were determined by a one-sided log-rank Mantel–Cox test.
94

Figure 3- 3 CD19-CAR genetically engineered T cells specifically eliminate tumor cells in vivo. A) Schematic graph
of in vivo experiment. B) Body weight change after tumor injection at day 0. C) Serum IFN-gamma release after
CAR-T cells injection measured at indicated days. D) Tumor cells (CD19) percentage in blood and spleen using
mouse CD45 as internal control. E-G) H&E, Ki67 and CD19 IHC staining in spleen, bone marrow and liver. (**:
p<0.01; ***: p<0.001; ****: p<0.0001; ns: not significant)

95
3.4.2 Replacement of CD3ζ chain with Zap70 kinase domain remains anti-tumor response in vitro
To further determine the potential advantages of Zap70, we totally removed the CD3ζ signal
domain and replaced with Zap70 kinase domain instead (Figure 3-4A, 3-5A). Signal triggered
from outside went through the linear CAR construct and transduced downstream signal through
Zap70. Upon activation, T-cells transduced with clinical validated retroviral particles, 1928z327
T cells showed detectable CAR surface expression in comparison to 1928z (Figure 3-4B). 1928z
had slightly higher expression than 1928z327 (66.2% vs 43.2%). After stimulation with CD19
positive tumor cells, the magnitude of activation of 1928z and 1928z327 CAR-T cells was
measured. 1928z327 CAR-T cells showed a significantly lower magnitude of activation than
1928z CAR-T cells as measured by T-cell activation marker CD69 in both CD4 and CD8 T cells
(Figure 3-4C). Accordingly, 1928z327 CAR-T cells released less IFN-γ than 1928z CAR-T cells
upon co-culturing with Raji or NALM-6 tumor cells (Figure 3-4D, 3-4E). In contract, no
significant differences in the expression of activation markers were observed when 1928z or
1928z327 CAR-T cells without stimulation (Figure 3-5B). However, we observed higher level of
IFN-γ in the 1928z327 CAR-T cells compared with 1928z CAR-T cells in absence of tumor cells.
Similar results were obtained from 1928z300 CAR-T cells (Figure 3-5C). In consistent with
1928z327, CAR construct with 4-1BB as a costimulatory domain (19bbz327) also performed
lower cytokine release against MDA-MB-231-CD19 (Figure 3-6A). Cytokines such as IFN-γ, IL-
2 and TNF-α were significantly reduced in the 19bbz327 CAR-T group than 19bbz CAR-T cells
transduced from three different health donors (Figure 3-6B). Interestingly, cytotoxicity of both
1928z327 and 1928z300 CAR-T cells was comparable to 1928z CAR-T cells and the percentage
of tumor cells killed by 19bbz327 CAR-T cells equaled to 19bbz CAR-T cells as well (Figure 3-
96
4F, 3-5D, 3-6C). All those evidences suggest that replacement with Zap70 demonstrates excellent
anti-tumor response in vitro.
97

98
Figure 3- 4 Replacement of CD3 zeta chain with Zap70 kinase domain (1928z327) presents anti-tumor activity. A)
schematic diagram of the anti-CD19 CAR constructs used in this study. An FMC63-derived scFv was linked to
CD28 and CD3ζ (to generate 1928z), to CD28 and Zap70 (to generate 1928z327). B) Flow cytometric analysis
showing the expression levels of CAR for the indicated constructs. Data are representative of at least five
independent experiments with similar results. Ctrl, untransduced T cells were used as the control, C) Detection of
early activation marker CD69 in both CD4 and CD8 CAR-T cells transduced with 1928z or 1928z327 CARs after
co-culturing with Raji cells overnight. D-E) 1928z327 gamma retrovirus transduced T cells specifically recognized
CD19 positive tumor cells but not control tumor cells via IFN-γ ELISA against Raji and NALM-6 tumor cells
between 1928z and 1928z327 CAR-T cells. F) LDH cytotoxicity indicated comparable killing ability between 1928z
and 1928z327 CAR-T cells.

However, we also replaced CD3ζ with Linker for activation of T-cells (LAT), the downstream
adaptor molecule of Zap70, named 1928lat (Figure 3-7A). LAT is phosphorylated by Zap70
following activation of TCR signaling transduction pathway. 1928lat displayed normal expression
of CAR on cell surface detected via flow cytometry (Figure 3-7B). But there was barely cytokine
release detected including IFN-γ and TNF-α in the presence of tumor cells (Figure 3-7C). More
importantly, no cytotoxicity was detected via LDH assay, indicating the failure of killing tumor
cells in vitro due to signaling issue (Figure 3-7D).
99

Figure 3- 5 Replacement of CD3 zeta chain with Zap70 kinase domain (1928z300) presents anti-tumor activity. A)
schematic diagram of the anti-CD19 CAR constructs used in this study. An FMC63-derived scFv was linked to
CD28 and CD3z (to generate 1928z), to CD28 and Zap70 (to generate 1928z300). B) Flow cytometric analysis
showing the comparable expression level of early activation marker CD69 in both CD4 and CD8 T cells between
1928z CAR-T cells and 1928z327 CAR-T cells in the absence of antigen stimulus. C) 1928z300 gamma retrovirus
100
transduced T cells specifically recognized CD19 positive tumor cells but not control tumor cells with comparable
level to 1928z via IFN-γ ELISA. D) LDH cytotoxicity indicated killing ability with a series dilution of effector to
target ratios. E) Raji-bearing mice were treated with 5 × 10
5
CAR+ T cells. Kaplan–Meier analysis of survival of
mice treated with 1928z300 CAR-T cells, 1928z327 CAR-T cells compared with 1928z CAR-T cells. Control refers
to untreated mice. P values were determined by a one-sided log-rank Mantel–Cox test.

Figure 3- 6 Replacement of CD3ζ chain with Zap70 kinase domain (19bbz327) presents anti-tumor activity. A)
schematic diagram of the anti-CD19 CAR constructs used in this study. An FMC63-derived scFv was linked to 4-
1BB and CD3ζ (to generate 19bbz), to 4-1BB and Zap70 (to generate 19bbz327). B) 19bbz327 gamma retrovirus
transduced T cells specifically recognized CD19 positive tumor cells MDA-MB-231 expressing CD19 with less
cytokine release compared to 19bbz CAR-T cells via IFN-γ, IL-2 and TNF-α ELISA with different donors. C) LDH
cytotoxicity indicated killing ability was comparable to 19bbz CAR-T cells from three donors. D) Raji-bearing mice
were treated with 5 × 10
5
CAR+ T cells. Kaplan–Meier analysis of survival of mice treated with 19bbz327 CAR-T
cells compared with 19bbz CAR-T cells. Control refers to untreated mice. P values were determined by a one-sided
log-rank Mantel–Cox test.

101

Figure 3- 7 Replacement of CD3ζ chain with LAT intracellular domain (1928lat) losses anti-tumor activity. A)
schematic diagram of the anti-CD19 CAR constructs used in this study. An FMC63-derived scFv was linked to
CD28 and LAT (to generate 1928lat). B) Flow cytometric analysis showing the expression levels of CAR for the
indicated constructs. Data are representative of at least five independent experiments with similar results. Ctrl,
untransduced T cells were used as the control, C) 1928lat gamma retrovirus transduced T cells failed to recognize
102
CD19 positive tumor cells via IFN-γ and TNF-α ELISA. D) LDH cytotoxicity indicated loss of killing ability in
1928lat CAR-T cells.

3.4.3 Replacement of CD3ζ chain with Zap70 kinase domain enhances anti-tumor response in vivo
To determine the therapeutical efficacy of Zap70 associated CARs in vivo, we challenged mice
with 5 million Raji tumor cells at day 0 as a well-established lymphoma model. Mice were treated
with 0.5 million 1928z or 1928z327 CAR-T-ffluc cells at day 5, respectively. Serum were collected
at day 3 post T-cell injection via vein tail. Cytokines related to T-cell activation were measured
via ELISA. Both groups released IFN-γ, IL-2 and TNF-α at detectable level. 1928z327 CAR-T
cells presented slightly lower cytokine concentration than 1928z CAR-T cells (Figure 3-8A-C). In
contrast, the proliferation of T-cells after encountering tumor cells was stronger in 1928z327 as
measured by luciferase imaging (Figure 3-8D). Both groups displayed similar luciferase signal at
the beginning, but 1928z327 CAR-TT cells proliferated faster and peaked after day 3 and
decreased during the following weeks. On day 7, 1928z327 CAR-T cells still maintained high
signal while 1928z CAR-T cells decreased significantly. After two weeks, there was little signal
left in either 1928z or 1928z327 CAR-T group as calculated by average radiance (Figure 3-8E).
The capacity of proliferation dramatically prolonged mice overall survival (Figure 3-8F). The
median survival time for mice treated with 1928z CAR-T cells was 24 days while 1928z327 CAR-
T cells prolonged median survival time to 56 days. As expected, increasing dosage of T cells to 2
million significantly extended mice overall survival with a median survival time of 60 days for
1928z CAR-T cells treated group but undefined for mice treated with 1928z327 CAR-T cells
(Figure 3-8G). In summary, CAR-T cells with Zap70 kinase domain unequivocally demonstrated
the therapeutic superiority to CAR with CD3ζ.
103

104
Figure 3- 8 Replacement of CD3ζ chain with Zap70 kinase domain enhances anti-tumor response in vivo. A-C)
Cytokines, IFN-γ, IL-2 and TNF-α were measured from mice serum harvested three days after T-cell injection. D) Luciferase
signal of CAR-T cells were detected via IVIS imaging. E) Average radiance was analyzed from panel D. F) Raji-bearing mice
were treated with 5 × 10
5
CAR+ T cells. Kaplan–Meier analysis of survival of mice treated with 1928Z327 CAR-T
cells compared with 1928z CAR-T cells. Control refers to untreated mice. G) Kaplan–Meier analysis of survival of
mice treated with 2 million 19bbz327 CAR-T cells compared with 19bbz CAR-T cells.
3.4.4 1928z327 prolongs mice survival by increasing long-lived memory phenotype T cells and
lowering exhaustion markers
To rule out potentially mechanism that CAR-T cells with1928z327 excelled 1928z to some extent,
we analyzed the T-cell memory markers and exhaustion markers. A higher percentage of Tcm
CAR-T cells was associated with increased CAR-T cells persistence. The percentage of T cells
population in bone marrow, lung and spleen were compared after mice were sacrificed. We found
dramatically increasement of CD3 in 1928z327 CAR-T cells treated group than 1928z (Figure 3-
9A-C). The percentage of CD3 in bone marrow increased from 2.38% to 5.13%, from 0.14% to
2.51% in lung and from 0.77% to 2.58% in spleen (Figure 3-9D-F). Central memory (Tcm) was
defined as CD45RO+CD62L+. The percentage of Tcm in mice treated with 1928z327 CAR-T
cells was significantly higher compared to mice treated with 1928z CAR-T cells, with 1.76-fold
increasement, while there was no change in Tem (Figure 3-9G, H). More detailed, the difference
in Tcm population mainly came from CD4 T cells while CD8 T cells kept similar percentage
(Figure 3-9I). Consistently, in vitro study indicated the percentage of Tcm in CD4+CAR+ was
also slightly higher in 1928z327 CAR-T cells compared with 1928z CAR-T cells while no
difference was found in CD8+CAR+ T cells. CD45RO-CD62L+CD95+CCR7+ stem cell like
memory cells (Tscm) were also presented higher in 1928z327 CAR-T cells. CD45RO+CD62L-
effector memory cells (Tem) were equal in both CD4 and CD8 in 1928z and 1928z327 group
(Figure 3-10A). More importantly, after encountering tumor cells, 1928z327 CAR-T cells showed
lower exhaustion markers than 1928z CAR-T cells, especially PD1 in both CD4 and CD8 CAR+
cells (Figure 3-10B).
105

106
Figure 3- 9 1928z327 prolongs mice survival by increasing the persistence of T cells and generating long-lived
memory phenotype T cells. A-C) Percentage of T-cells detected in bone marrow, lung and spleen of mice treated
with 1928z and 1928z327 CAR-T cells respectively. D-F) Statistical analysis of T-cells in bone marrow, lung and
spleen. G) Memory phenotype detected via flow cytometry by CD45RO and CD62L. H) Percentage of central
memory and effector memory in CAR-T cells. I) Percentage of central memory and effector memory in CD4 and
CD8 CAR-T cells.

Figure 3- 10 1928z327 increases the percentage of memory phenotype T cells and lowers exhaustion markers in
vitro. A) Percentage of central memory, effector memory and stem cell like memory cells in CD4 and CD8 CAR-T
cells. B) Negative regulators: PD-1, LAG3 and TIM3 in CD4 and CD8 CAR-T cells.
107
3.5 Discussion
In our current study, we demonstrate how CAR constructs can be modified with different tandem
elements that have superior anti-tumor function. Using a well-established pre-clinical CD19
positive lymphoma mouse model, our genetically engineered CAR-T cells successfully recognized
and eliminated tumor cells. Those CAR-T cells had lower expression of negative regulators on cell
surface and displayed memory phenotype. This proof-of-concept study indicates how CARs can
be engineered to not only enhance the anti-tumor function but also assure the safety of transgenic
T cells by reducing cytokine release.
Chimeric antigen receptor (CAR) technology was developed about 30 years ago. Since the first
generation of CAR, CD3ζ chain was mostly used as the intracellular signal domain. And four
CD19-CAR products have been approved by FDA recently for the treatment of CD19 positive
lymphoma and leukemia. However, other intracellular signal domains such as FcRγ was not well-
documented. To improve the persistence of current CAR-T cells without compromising the anti-
tumor potency, Dr. Michel Sadelain calibrated the immunoreceptor tyrosine-based activation
motifs (ITAMs) within the CD3ζ (224). They mutated each tyrosine in ITAM or combination in
1928z CAR, resulting different T-cell fates. Those T cells were prone to differentiate memory
phenotype and thus enhancing therapeutic outcome. Here, instead of editing CD3ζ, we directly
adopted Zap70, a downstream kinase of CD3ζ, into our CAR construct. The expression of CAR
was comparable to conventional CAR as the modification is inside the cytoplasm. Similarly, the
recognition of CAR was maintained by the specificity of scFv outside of the cell. We didn’t see
much difference in T-cell activation and cytotoxicity measured by ELISA and LDH, respectively
in vitro study, but we noticed lower cytokine release and prolonged mice overall survival in vivo
in the 1928z327 and 19bbz327 groups. Consequently, expression of LAT, a key adaptor molecule
108
in TCR signaling was more stable in vitro, especially at first two days and became equally at day
3 when T cells were totally cooled down. LAT protein will be degraded if T cells rest after
activation (322). That means higher expression of LAT, more activated T cells. Unquestionably,
more IFNγ release was detected in the absence of tumor antigen after anti-CD3 activation. High
level of cytokine release is a double-edged sword. The size of Zap70 is pretty large than CD3ζ.
Even we truncated Zap70 with its kinase domain, it still has about 300 amino acids compared to
40 a.a. from the intracellular domain of CD3ζ. This would reduce the expression level of CAR to
some extend though not much as the vector size increases about 1000bp. However, there is no
study about the minimal domain of the Zap70 kinase so far. To determine the minimal functional
domain like the tail of CD28, 4-1BB or CD3ζ is quite important for the extension of current work.
T cell persistence is one direction that scientists try much effort to improve. Several strategies that
help prolong the lifespan of transgenic T cells have been developed. One way is to add co-
stimulatory domain such as 4-1BB, CD28, CD27 and OX40. Those molecules provide additional
signal to increase expression of the anti-apoptosis genes to support T cell survival. Another way
uses invert CARs that have extracellular domain of negative regulators such as PD-1, followed by
co-stimulatory domain and activation domain, thus converting negative signal while binding to
PD-L1 on the tumor site to positive signal for T cell activation (323). Others investigate the
importance of cytokines and cytokine receptors. Dr. Cliona M. Rooney developed constitutively
active signaling C7R system that provide IL-7 signaling separately along with CAR. However, the
activation of pSTAT5 was antigen independent manner. Dr. Juan Vera divides CAR construct into
three CARs, each provides intracellular signaling, co-stimulatory signaling and cytokine signaling.
In this way, engineered T cells were able to recognize tumor cells selectively expressing PSCA,
TGFβ and IL-4. Meanwhile, this strategy benefited CAR-T cells to resist the immunosuppressive
109
cytokine at tumor site. Instead of multiple constructs, Dr. Naoto Hirano included truncated
intracellular domain of IL2Rβ and STAT3 binding motif into current 1928z CAR (216). By this
way, JAK-STAT pathway activation in those CAR-T cells was antigen-dependent. And they
demonstrated superior antitumor activity and minimal toxicity. It is known that both IL-2 and IL15
share IL2Rβ and γc receptor (324). IL-15 promotes CD8+ memory T cells. However, IL-2 is
critical for the differentiation and expansion of CD4+CD25+ Treg cells. It is not clear that the final
combination of differentiated CD4 and CD8 T cells. On the contrary, IL-7 is considered to support
the memory development of both CD4 and CD8 T cells. This feature may show advantages in
adoptive cell immunotherapy as Dr. Maloney’s group demonstrated the benefit of defined CD4:
CD8 ratio in treating patients (325). In another word, CD4 T cells are indispensable, which may
provide help for CD8 T cell in anti-tumor activity. CAR-T cells equipped with IL7 signaling
showed improved cell proliferation ability and were prone to be memory phenotype. Meanwhile,
we also tried truncated IL-7R with its key motif (box 1) and IL-15Rα. Both have slightly prolonged
overall survival than the conventional CAR. Box 1 motif and Y449 are essential for the signaling
transduce upon binding to the ligand. But the activation of Jak1 only requires Box 1 but not Y449,
as Y449F mutant could also induce the phosphorylation of Jak1 (326). This may explain the result
that CAR with truncated IL-7R still has advantages than CAR construct only and why Dr. Naoto
Hirano deleted middle parts of IL2Rβ, which has similar structure with IL-7R(216). Interestingly,
IL-15 receptor complex consists of a unique alpha unit, an IL-2/IL-15 receptor beta and a common
gamma receptor. IL-15Rα along doesn’t transduce signaling. Unlike IL-2, IL-15 directly binds IL-
15Rα with very high affinity, which then associated with beta and gamma units in a cis-
presentation or trans-presentation manner. In our case, the binding of scFv to CD19 is considered
110
the association of IL-15 and IL-15Rα, which in a cis-presentation way, forms a complex with IL-
2/IL-15Rβ and γc units on the same cell.
TCR engineered T cells presented durable clinical responses in HLA-A2+/NY-ESO1+ patients
with metastatic or refractory melanoma and sarcoma (128, 294). Comparably, CAR technology
shows limited progress in solid tumors. Several groups tried to take the advantage from both TCR
and CAR technology. Dr. Jonathan L. Bramson designed a T cell antigen coupler (TAC) platform
to co-opt the endogenous TCR. TAC is an alternative CAR, composing an antigen-binding domain,
a TCR recruitment domain and a co-receptor domain. Those T cells showed no auto-activation
without the antigen stimulation and expressed low level of checkpoint receptors (327). Dr. Cheng
Liu used an antibody-TCR (AbTCR) that contained a Fab to recognize the antigen and a
gamma/delta TCR to transduce signaling (328). AbTCR transduced T cells had a higher
percentage of stem cell memory T cells and less exhausted surface marker as well. Others used
single chain TCR with co-stimulatory domain and signal domain. TCR α and β chain linked with
Gly-Ser flexible polypeptide is not rigid enough to recognize tumor antigen as lack of disulfate
bridge at the constant region. So, scientists kept Cβ chain in the CAR construct to maintain the
specificity (329) or did mutagenesis in framework with phage display to change the electric charge,
making it stable. We analyzed all three CD3 molecules that were linked to scFv. Interestingly, the
extracellular domain of CD3 molecules could affect the detection of CAR expression by protein
L, but didn’t impair its function for recognition and killing when co-cultured with CD19 positive
tumor cells. GFP-tag CD3 components CAR-T cells to balance the expression were injected in
Raji-bearing mice. And overall survival result was not as good as conventional CAR T cells. Add
a co-stimulatory domain after CD3 molecules could enhance the outcome to superior but not
significantly conventional CAR to some extent, even though we did notice the fast killing at the
111
first several days after CD3 CAR-T cells injection by short-time co-culture LDH in vitro and
bioluminescence in vivo. Deletion of extracellular domain could restore the detection of expression,
which further improved the design from the minimal element of CD3 molecules. One potential
improvement could be the length of CD3 molecule. Although charge interactions in the
transmembrane domain are critical for complex assembling, a membrane-proximal tetra-cysteine
motif near the membrane also contributes to the structure integrity (330, 331). Thus, optimizing
the length of transmembrane domain including extracellular and intracellular key motifs would
further improve the idea to design a better CAR for immunotherapy.
In closing, T cell trafficking and persistence are two remaining issues for current immunotherapy.
Here, we have used genetically modified CAR-T cells with novel intracellular signal domain from
Zap70. In our knowledge, this is the first study that uses different signal domain other than CD3ζ
and has better anti-tumor response. Equipped with signal 3 to provide cytokine support and co-
opted with TCR to reduce toxicity in the absence of tumor antigen, those CAR-T cells have the
characteristics of high specificity and long-term persistence required for anti-tumor activity in vivo.
Although this idea will need refinements before clinical use, it provides the information that each
component of CAR could be modified. The best combination of CAR would not only solve the
trafficking and persistence issues, it could also have advantages in solid tumors.

112
Chapter 4: Conclusion and prospect
Genetically engineered T-cell therapy has proven itself to be exceptionally promising and has
achieved remarkable success against advanced refractory B-cell malignancies. However, many
challenges from the large-scaled clinical production of CAR-engineered T-cells, regarding
administration and observation, still remain unsolved. Additionally, considerable improvement is
urgently needed to deal with the lack of available targets, low efficiency towards solid tumors and
safety issues.
Firstly, the optimal design of the CAR’s construct has not yet been well-decided. The second
generation of CAR transduced T cells undoubtedly are most widely used because of persistence
and antitumor activity, and all five FDA-approved CARs are all belonged to the second generation
(332). Transmembrane domains-like CD8α and CD28 stably and highly express on the surface of
T cells (169). However, ICOS transmembrane domain is unique for ICOS signaling. Replacement
of ICOS transmembrane domain with CD8α transmembrane domain reduced the expansion and
persistence of CAR-T cells (174). Additionally, the length of hinge domain for T cell function is
unclear. Not all CARs use the same hinge, not to mention different scFvs may require different
lengths of hinge (166, 333). Even some CARs without hinge showed super function against tumors
(168). Despite this, the molecular mechanism of how CAR-T cells work when targeting tumor
cells needs further investigation. The association between the intensity of T-cell activation and T-
cell persistence is not well studies, either. In addition, majority of scFvs are derived from murine
antibody, which will cause human anti-mouse antibody (HAMA). A further step to produce
humanized or fully human antibodies are required to reduce or even avoid the clinical HAMA
reaction (334).
113
Secondly, the availability of ideal targets is limited. Except for the well-defined CD19 antigen, no
other ideal targets have been investigated quantitively. Several antigens against solid tumors have
been studied: prostate specific membrane antigen (PSMA) (142, 205, 335, 336), mesothelin (334,
337-339), fibroblast activation protein alpha (FAP) (340-343), EGFR and its variants (289, 344-
347), carcinoembryonic antigen (348-351), CD171 (L1-CAM) (352), disialoganglioside GD2 (353,
354), glypican-3 (355, 356), receptor tyrosine-protein kinase erbB2 (HER2) (316) and IL-13Ra
(357-359). Recently, a group from the University of Pennsylvania developed a Tn-MUC-1 CAR
that has the ability to recognize a serial of cancer cells that express glycopeptide but not normal
cells expressing natural MUC-1 (360). In vivo experiments showed proof-of-concept, but more
studies should be conducted to investigate and determine the safety and efficiency. Moreover,
TCR-like antibody represents a new approach to target intracellular antigens, thus broadening the
application of immunotherapy. The flexibility of modifications and diversity of forms make
antibody-based therapy more expedient than others. Any form of antibody- bi-specific antibodies,
tri-specific antibodies, antibody-drug conjugates, chimeric antigen receptors and T cell engagers
could have the potential for therapeutic use. However, despite the discovery of massive TCR-like
antibodies, none of them have been applied into human clinical trials. One potential issue is off-
target due to the small linear peptide buried in the large HLA molecules. Slight change of the
residues in the peptide may render off-target problem. Even though studies about WT1 have
demonstrated the rare possibility of off-target, more efforts and attention should be directed before
the use in human to evaluate the safety issue. Continually, the ongoing standard procedure of
immunotherapy is using IHC as an evidence for recruiting patients. For example, an amount
greater than 5% of PD-L1 expression detected in IHC was required for the phase III clinical trial
of Nivolumab (361). Whereas in 2016, Pembrolizumab was approved for the Non–Small-Cell
114
Lung Cancer (NSCLC) patients with more than 50% PD-L1 expression (362). PD-L1 as a surface
marker, is essential to evaluate the clinical response in patients treated with anti-PD-L1 antibody.
Direct access of the expression of PD-L1 is correlated with prognosis of the patients. On the other
hand, antigens used by TCR-T cells also used IHC to evaluate the expression of target proteins.
Taking NY-ESO-1 as an example, detection of expression and intensity of NY-ESO-1 by IHC is
requisite for patients who want to join these clinical trials. However, TCR-T cells recognize the
pMHC complex instead of protein only. This is important because in most cases, tumor cells have
the ability to down-regulate MHC expression. Thus, detection of protein doesn’t indicate the level
of pMHC on the cell surface. Evidences indicated that T cell recognition and killing capacity was
not correlated with the protein level only (data not shown). Thus, to develop antibodies that
recognize the surface pMHC molecules is vital to the success of immunotherapy.
Thirdly, the efficiency and efficacy in treating solid tumors with CAR-T cells is not comparable
to blood malignancies because of poor T-cell trafficking and persistence in the tumor. For example,
cancer cells are able to overexpress endothelin B receptor to down-regulate the expression of
ICAM to prevent T-cell trafficking outside the blood vessels (363). Besides, the migration of T-
cells depends on chemokines, while tumor cells have the mechanism to secrete less chemokines to
block the attract of T cells to tumor sites. Thus, it is rationally proposed that administration of
CAR-T cells intratumorally would be more effective. Strategies like co-expressing chemokine
CCR2, CCR4 or CCR7 can home T cells to tumor lesions (364-366). Another challenge is the
extremely complicated tumor microenvironment that hampers T trafficking into tumor sites (367,
368). Immunosuppressive cells such as tumor associated macrophage, regulatory T cells (Treg)
and myeloid-derived suppressor cells (MDSCs) prevent CAR-T cells function properly in the
tumor site. Negative molecules also play roles as barriers to block T-cells activation and restrict
115
immune responses against tumor cells. PD-1/PD-L1 and CTLA-4 blockade have been shown to
increase the immune reaction after adoptive T cell transfer (249, 369-372). Meanwhile, mutations
associated with disease relapse also make it much hard to predict the efficiency. For example,
CD19 splicing alternative causes resistant to CD19-CAR T-cell therapy (373). JAK mutation with
loss of function also found in patients who didn’t response to PD-1 blockade therapy (374).
Being the golden age for immunotherapy, years of basic scientific research and clinical trials have
paved the road to Roma. Profound and impressive responses have proven ACT feasible and
powerful clearly. Unprecedented achievement in relapse and refractory cancers have dramatically
inspired scientists to move forward. Lessons from previous studies are very valuable in the study
of further designing ACT and in better understand the barriers met in solid cancers. Likewise, there
are some new methods currently being tested to overcome solid cancers. One instance is ICOS,
OX40 and CD27, instead of 4-1BB or CD28 which are being studied and under investigation (375,
376). Replacement of CD3ς with KIR2DS2 in the first-generation CAR and co-expression with
DAP12, which fused to the KIR domain, showed an antitumor effect (377). Efforts to improve the
safety by controlling input is important, but to understand the intrinsic mechanism is really the key
to success. There should be much to look forward to in witnessing more success with these new
weapons in the future.

116
REFERENCES
1. Dal Porto JM, Gauld SB, Merrell KT, Mills D, Pugh-Bernard AE, Cambier J. B cell antigen
receptor signaling 101. Mol Immunol. 2004;41(6-7):599-613. Epub 2004/06/29. doi:
10.1016/j.molimm.2004.04.008. PubMed PMID: 15219998.
2. Lyseng-Williamson KA, Robinson DM. Spotlight on bevacizumab in advanced colorectal
cancer, breast cancer, and non-small cell lung cancer. BioDrugs. 2006;20(3):193-5. Epub
2006/05/27. doi: 10.2165/00063030-200620030-00007. PubMed PMID: 16724868.
3. Harding J, Burtness B. Cetuximab: an epidermal growth factor receptor chemeric human-
murine monoclonal antibody. Drugs Today (Barc). 2005;41(2):107-27. Epub 2005/04/12. doi:
10.1358/dot.2005.41.2.882662. PubMed PMID: 15821783.
4. Cohen MH, Chen H, Shord S, Fuchs C, He K, Zhao H, Sickafuse S, Keegan P, Pazdur R.
Approval summary: Cetuximab in combination with cisplatin or carboplatin and 5-fluorouracil for
the first-line treatment of patients with recurrent locoregional or metastatic squamous cell head
and neck cancer. Oncologist. 2013;18(4):460-6. Epub 2013/04/12. doi:
10.1634/theoncologist.2012-0458. PubMed PMID: 23576486; PMCID: PMC3639534.
5. Molhoj M, Crommer S, Brischwein K, Rau D, Sriskandarajah M, Hoffmann P, Kufer P,
Hofmeister R, Baeuerle PA. CD19-/CD3-bispecific antibody of the BiTE class is far superior to
tandem diabody with respect to redirected tumor cell lysis. Mol Immunol. 2007;44(8):1935-43.
Epub 2006/11/07. doi: 10.1016/j.molimm.2006.09.032. PubMed PMID: 17083975.
6. Hoffman LM, Gore L. Blinatumomab, a Bi-Specific Anti-CD19/CD3 BiTE((R)) Antibody
for the Treatment of Acute Lymphoblastic Leukemia: Perspectives and Current Pediatric
Applications. Front Oncol. 2014;4:63. Epub 2014/04/20. doi: 10.3389/fonc.2014.00063. PubMed
PMID: 24744989; PMCID: PMC3978294.
7. Sewell AK. Why must T cells be cross-reactive? Nat Rev Immunol. 2012;12(9):669-77.
Epub 2012/08/25. doi: 10.1038/nri3279. PubMed PMID: 22918468; PMCID: PMC7097784.
8. Call ME, Pyrdol J, Wiedmann M, Wucherpfennig KW. The organizing principle in the
formation of the T cell receptor-CD3 complex. Cell. 2002;111(7):967-79. Epub 2003/01/01. doi:
10.1016/s0092-8674(02)01194-7. PubMed PMID: 12507424; PMCID: PMC3420808.
9. Gregoire C, Rebai N, Schweisguth F, Necker A, Mazza G, Auphan N, Millward A,
Schmitt-Verhulst AM, Malissen B. Engineered secreted T-cell receptor alpha beta heterodimers.
Proc Natl Acad Sci U S A. 1991;88(18):8077-81. Epub 1991/09/15. doi: 10.1073/pnas.88.18.8077.
PubMed PMID: 1716770; PMCID: PMC52449.
10. Garcia KC, Degano M, Stanfield RL, Brunmark A, Jackson MR, Peterson PA, Teyton L,
Wilson IA. An alphabeta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC
complex. Science. 1996;274(5285):209-19. Epub 1996/10/11. doi: 10.1126/science.274.5285.209.
PubMed PMID: 8824178.
11. Richman SA, Kranz DM. Display, engineering, and applications of antigen-specific T cell
receptors. Biomol Eng. 2007;24(4):361-73. Epub 2007/04/06. doi: 10.1016/j.bioeng.2007.02.009.
PubMed PMID: 17409021.
12. Stone JD, Chervin AS, Aggen DH, Kranz DM. T cell receptor engineering. Methods
Enzymol. 2012;503:189-222. Epub 2012/01/11. doi: 10.1016/B978-0-12-396962-0.00008-2.
PubMed PMID: 22230570.
13. Molloy PE, Sewell AK, Jakobsen BK. Soluble T cell receptors: novel immunotherapies.
Curr Opin Pharmacol. 2005;5(4):438-43. Epub 2005/06/09. doi: 10.1016/j.coph.2005.02.004.
PubMed PMID: 15939669.
117
14. Boulter JM, Glick M, Todorov PT, Baston E, Sami M, Rizkallah P, Jakobsen BK. Stable,
soluble T-cell receptor molecules for crystallization and therapeutics. Protein Eng.
2003;16(9):707-11. Epub 2003/10/16. doi: 10.1093/protein/gzg087. PubMed PMID: 14560057.
15. Withoff S, Helfrich W, de Leij LF, Molema G. Bi-specific antibody therapy for the
treatment of cancer. Curr Opin Mol Ther. 2001;3(1):53-62. Epub 2001/03/16. PubMed PMID:
11249732.
16. McCormack E, Adams KJ, Hassan NJ, Kotian A, Lissin NM, Sami M, Mujic M, Osdal T,
Gjertsen BT, Baker D, Powlesland AS, Aleksic M, Vuidepot A, Morteau O, Sutton DH, June CH,
Kalos M, Ashfield R, Jakobsen BK. Bi-specific TCR-anti CD3 redirected T-cell targeting of NY-
ESO-1- and LAGE-1-positive tumors. Cancer Immunol Immunother. 2013;62(4):773-85. Epub
2012/12/25. doi: 10.1007/s00262-012-1384-4. PubMed PMID: 23263452; PMCID:
PMC3624013.
17. Liddy N, Bossi G, Adams KJ, Lissina A, Mahon TM, Hassan NJ, Gavarret J, Bianchi FC,
Pumphrey NJ, Ladell K, Gostick E, Sewell AK, Lissin NM, Harwood NE, Molloy PE, Li Y,
Cameron BJ, Sami M, Baston EE, Todorov PT, Paston SJ, Dennis RE, Harper JV, Dunn SM,
Ashfield R, Johnson A, McGrath Y, Plesa G, June CH, Kalos M, Price DA, Vuidepot A, Williams
DD, Sutton DH, Jakobsen BK. Monoclonal TCR-redirected tumor cell killing. Nat Med.
2012;18(6):980-7. Epub 2012/05/09. doi: 10.1038/nm.2764. PubMed PMID: 22561687.
18. Karpanen T, Olweus J. T-cell receptor gene therapy--ready to go viral? Mol Oncol.
2015;9(10):2019-42. Epub 2015/11/10. doi: 10.1016/j.molonc.2015.10.006. PubMed PMID:
26548533; PMCID: PMC5528733.
19. Card KF, Price-Schiavi SA, Liu B, Thomson E, Nieves E, Belmont H, Builes J, Jiao JA,
Hernandez J, Weidanz J, Sherman L, Francis JL, Amirkhosravi A, Wong HC. A soluble single-
chain T-cell receptor IL-2 fusion protein retains MHC-restricted peptide specificity and IL-2
bioactivity. Cancer Immunol Immunother. 2004;53(4):345-57. Epub 2003/11/12. doi:
10.1007/s00262-003-0450-3. PubMed PMID: 14610621.
20. Belmont HJ, Price-Schiavi S, Liu B, Card KF, Lee HI, Han KP, Wen J, Tang S, Zhu X,
Merrill J, Chavillaz PA, Wong JL, Rhode PR, Wong HC. Potent antitumor activity of a tumor-
specific soluble TCR/IL-2 fusion protein. Clin Immunol. 2006;121(1):29-39. Epub 2006/06/30.
doi: 10.1016/j.clim.2006.05.005. PubMed PMID: 16807113.
21. Wen J, Zhu X, Liu B, You L, Kong L, Lee HI, Han KP, Wong JL, Rhode PR, Wong HC.
Targeting activity of a TCR/IL-2 fusion protein against established tumors. Cancer Immunol
Immunother. 2008;57(12):1781-94. Epub 2008/03/29. doi: 10.1007/s00262-008-0504-7. PubMed
PMID: 18369620.
22. Fishman MN, Thompson JA, Pennock GK, Gonzalez R, Diez LM, Daud AI, Weber JS,
Huang BY, Tang S, Rhode PR, Wong HC. Phase I trial of ALT-801, an interleukin-2/T-cell
receptor fusion protein targeting p53 (aa264-272)/HLA-A*0201 complex, in patients with
advanced malignancies. Clin Cancer Res. 2011;17(24):7765-75. Epub 2011/10/14. doi:
10.1158/1078-0432.CCR-11-1817. PubMed PMID: 21994418; PMCID: PMC3972922.
23. Mosquera LA, Card KF, Price-Schiavi SA, Belmont HJ, Liu B, Builes J, Zhu X, Chavaillaz
PA, Lee HI, Jiao JA, Francis JL, Amirkhosravi A, Wong RL, Wong HC. In vitro and in vivo
characterization of a novel antibody-like single-chain TCR human IgG1 fusion protein. J Immunol.
2005;174(7):4381-8. Epub 2005/03/22. doi: 10.4049/jimmunol.174.7.4381. PubMed PMID:
15778403.
118
24. Wulfing C, Pluckthun A. Correctly folded T-cell receptor fragments in the periplasm of
Escherichia coli. Influence of folding catalysts. J Mol Biol. 1994;242(5):655-69. Epub 1994/10/07.
doi: 10.1006/jmbi.1994.1615. PubMed PMID: 7932722.
25. Corr M, Slanetz AE, Boyd LF, Jelonek MT, Khilko S, al-Ramadi BK, Kim YS, Maher SE,
Bothwell AL, Margulies DH. T cell receptor-MHC class I peptide interactions: affinity, kinetics,
and specificity. Science. 1994;265(5174):946-9. Epub 1994/08/12. doi: 10.1126/science.8052850.
PubMed PMID: 8052850.
26. Matsui K, Boniface JJ, Steffner P, Reay PA, Davis MM. Kinetics of T-cell receptor binding
to peptide/I-Ek complexes: correlation of the dissociation rate with T-cell responsiveness. Proc
Natl Acad Sci U S A. 1994;91(26):12862-6. Epub 1994/12/20. doi: 10.1073/pnas.91.26.12862.
PubMed PMID: 7809136; PMCID: PMC45540.
27. Kaplon H, Muralidharan M, Schneider Z, Reichert JM. Antibodies to watch in 2020.
MAbs. 2020;12(1):1703531. Epub 2019/12/19. doi: 10.1080/19420862.2019.1703531. PubMed
PMID: 31847708; PMCID: PMC6973335.
28. Kohler G, Milstein C. Continuous cultures of fused cells secreting antibody of predefined
specificity. Nature. 1975;256(5517):495-7. Epub 1975/08/07. doi: 10.1038/256495a0. PubMed
PMID: 1172191.
29. Lonberg N. Human antibodies from transgenic animals. Nat Biotechnol. 2005;23(9):1117-
25. Epub 2005/09/10. doi: 10.1038/nbt1135. PubMed PMID: 16151405.
30. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens
on the virion surface. Science. 1985;228(4705):1315-7. Epub 1985/06/14. doi:
10.1126/science.4001944. PubMed PMID: 4001944.
31. Parmley SF, Smith GP. Antibody-selectable filamentous fd phage vectors: affinity
purification of target genes. Gene. 1988;73(2):305-18. Epub 1988/12/20. doi: 10.1016/0378-
1119(88)90495-7. PubMed PMID: 3149606.
32. McCafferty J, Griffiths AD, Winter G, Chiswell DJ. Phage antibodies: filamentous phage
displaying antibody variable domains. Nature. 1990;348(6301):552-4. Epub 1990/12/06. doi:
10.1038/348552a0. PubMed PMID: 2247164.
33. Sidhu SS, Weiss GA, Wells JA. High copy display of large proteins on phage for functional
selections. J Mol Biol. 2000;296(2):487-95. Epub 2000/02/12. doi: 10.1006/jmbi.1999.3465.
PubMed PMID: 10669603.
34. Lowman HB CT. Phage display: a practical approach. Oxford: Oxford University Press;
2004.
35. Wylie DE, Klinman NR. The murine B cell repertoire responsive to an influenza-infected
syngeneic cell line. J Immunol. 1981;127(1):194-8. Epub 1981/07/01. PubMed PMID: 6165762.
36. Wylie DE, Sherman LA, Klinman NR. Participation of the major histocompatibility
complex in antibody recognition of viral antigens expressed on infected cells. J Exp Med.
1982;155(2):403-14. Epub 1982/02/01. doi: 10.1084/jem.155.2.403. PubMed PMID: 6173456;
PMCID: PMC2186597.
37. Froscher BG, Klinman NR. Immunization with SV40-transformed cells yields mainly
MHC-restricted monoclonal antibodies. J Exp Med. 1986;164(1):196-210. Epub 1986/07/01. doi:
10.1084/jem.164.1.196. PubMed PMID: 3014034; PMCID: PMC2188216.
38. Catipovic B, Dal Porto J, Mage M, Johansen TE, Schneck JP. Major histocompatibility
complex conformational epitopes are peptide specific. J Exp Med. 1992;176(6):1611-8. Epub
1992/12/01. doi: 10.1084/jem.176.6.1611. PubMed PMID: 1281212; PMCID: PMC2119460.
119
39. Hogquist KA, Grandea AG, 3rd, Bevan MJ. Peptide variants reveal how antibodies
recognize major histocompatibility complex class I. Eur J Immunol. 1993;23(11):3028-36. Epub
1993/11/01. doi: 10.1002/eji.1830231145. PubMed PMID: 8223880.
40. Chames P, Hufton SE, Coulie PG, Uchanska-Ziegler B, Hoogenboom HR. Direct selection
of a human antibody fragment directed against the tumor T-cell epitope HLA-A1-MAGE-A1 from
a nonimmunized phage-Fab library. Proc Natl Acad Sci U S A. 2000;97(14):7969-74. Epub
2000/07/08. doi: 10.1073/pnas.97.14.7969. PubMed PMID: 10884427; PMCID: PMC16654.
41. Odunsi K, Jungbluth AA, Stockert E, Qian F, Gnjatic S, Tammela J, Intengan M, Beck A,
Keitz B, Santiago D, Williamson B, Scanlan MJ, Ritter G, Chen YT, Driscoll D, Sood A, Lele S,
Old LJ. NY-ESO-1 and LAGE-1 cancer-testis antigens are potential targets for immunotherapy in
epithelial ovarian cancer. Cancer Res. 2003;63(18):6076-83. Epub 2003/10/03. PubMed PMID:
14522938.
42. Jungbluth AA, Chen YT, Stockert E, Busam KJ, Kolb D, Iversen K, Coplan K, Williamson
B, Altorki N, Old LJ. Immunohistochemical analysis of NY-ESO-1 antigen expression in normal
and malignant human tissues. Int J Cancer. 2001;92(6):856-60. Epub 2001/05/15. doi:
10.1002/ijc.1282. PubMed PMID: 11351307.
43. Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW.
Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC.
Science. 1997;275(5307):1787-90. Epub 1997/03/21. doi: 10.1126/science.275.5307.1787.
PubMed PMID: 9065402.
44. Schechter AL, Stern DF, Vaidyanathan L, Decker SJ, Drebin JA, Greene MI, Weinberg
RA. The neu oncogene: an erb-B-related gene encoding a 185,000-Mr tumour antigen. Nature.
1984;312(5994):513-6. Epub 1984/12/06. doi: 10.1038/312513a0. PubMed PMID: 6095109.
45. King CR, Kraus MH, Aaronson SA. Amplification of a novel v-erbB-related gene in a
human mammary carcinoma. Science. 1985;229(4717):974-6. Epub 1985/09/06. doi:
10.1126/science.2992089. PubMed PMID: 2992089.
46. Scheuermann RH, Racila E. CD19 antigen in leukemia and lymphoma diagnosis and
immunotherapy. Leuk Lymphoma. 1995;18(5-6):385-97. Epub 1995/08/01. doi:
10.3109/10428199509059636. PubMed PMID: 8528044.
47. Maude SL, Laetsch TW, Buechner J, Rives S, Boyer M, Bittencourt H, Bader P, Verneris
MR, Stefanski HE, Myers GD, Qayed M, De Moerloose B, Hiramatsu H, Schlis K, Davis KL,
Martin PL, Nemecek ER, Yanik GA, Peters C, Baruchel A, Boissel N, Mechinaud F, Balduzzi A,
Krueger J, June CH, Levine BL, Wood P, Taran T, Leung M, Mueller KT, Zhang Y, Sen K,
Lebwohl D, Pulsipher MA, Grupp SA. Tisagenlecleucel in Children and Young Adults with B-
Cell Lymphoblastic Leukemia. N Engl J Med. 2018;378(5):439-48. Epub 2018/02/01. doi:
10.1056/NEJMoa1709866. PubMed PMID: 29385370; PMCID: PMC5996391.
48. Yewdell JW, Reits E, Neefjes J. Making sense of mass destruction: quantitating MHC class
I antigen presentation. Nat Rev Immunol. 2003;3(12):952-61. Epub 2003/12/04. doi:
10.1038/nri1250. PubMed PMID: 14647477.
49. Bourdetsky D, Schmelzer CE, Admon A. The nature and extent of contributions by
defective ribosome products to the HLA peptidome. Proc Natl Acad Sci U S A.
2014;111(16):E1591-9. Epub 2014/04/10. doi: 10.1073/pnas.1321902111. PubMed PMID:
24715725; PMCID: PMC4000780.
50. Dubrovsky L, Dao T, Gejman RS, Brea EJ, Chang AY, Oh CY, Casey E, Pankov D,
Scheinberg DA. T cell receptor mimic antibodies for cancer therapy. Oncoimmunology.
120
2016;5(1):e1049803. Epub 2016/03/05. doi: 10.1080/2162402X.2015.1049803. PubMed PMID:
26942058; PMCID: PMC4760335.
51. Zhang QJ, Gavioli R, Klein G, Masucci MG. An HLA-A11-specific motif in nonamer
peptides derived from viral and cellular proteins. Proc Natl Acad Sci U S A. 1993;90(6):2217-21.
Epub 1993/03/15. doi: 10.1073/pnas.90.6.2217. PubMed PMID: 8384718; PMCID: PMC46057.
52. Angell TE, Lechner MG, Jang JK, LoPresti JS, Epstein AL. MHC class I loss is a frequent
mechanism of immune escape in papillary thyroid cancer that is reversed by interferon and
selumetinib treatment in vitro. Clin Cancer Res. 2014;20(23):6034-44. Epub 2014/10/09. doi:
10.1158/1078-0432.CCR-14-0879. PubMed PMID: 25294906; PMCID: PMC4252612.
53. Khanna R. Tumour surveillance: missing peptides and MHC molecules. Immunol Cell
Biol. 1998;76(1):20-6. Epub 1998/04/29. doi: 10.1046/j.1440-1711.1998.00717.x. PubMed
PMID: 9553772.
54. Hallermalm K, Seki K, Wei C, Castelli C, Rivoltini L, Kiessling R, Levitskaya J. Tumor
necrosis factor-alpha induces coordinated changes in major histocompatibility class I presentation
pathway, resulting in increased stability of class I complexes at the cell surface. Blood.
2001;98(4):1108-15. Epub 2001/08/09. doi: 10.1182/blood.v98.4.1108. PubMed PMID:
11493458.
55. Wan S, Pestka S, Jubin RG, Lyu YL, Tsai YC, Liu LF. Chemotherapeutics and radiation
stimulate MHC class I expression through elevated interferon-beta signaling in breast cancer cells.
PLoS One. 2012;7(3):e32542. Epub 2012/03/08. doi: 10.1371/journal.pone.0032542. PubMed
PMID: 22396773; PMCID: PMC3291570.
56. Adachi K, Kano Y, Nagai T, Okuyama N, Sakoda Y, Tamada K. IL-7 and CCL19
expression in CAR-T cells improves immune cell infiltration and CAR-T cell survival in the tumor.
Nat Biotechnol. 2018. Epub 2018/03/06. doi: 10.1038/nbt.4086. PubMed PMID: 29505028.
57. Almstedt M, Blagitko-Dorfs N, Duque-Afonso J, Karbach J, Pfeifer D, Jager E, Lubbert
M. The DNA demethylating agent 5-aza-2'-deoxycytidine induces expression of NY-ESO-1 and
other cancer/testis antigens in myeloid leukemia cells. Leuk Res. 2010;34(7):899-905. Epub
2010/04/13. doi: 10.1016/j.leukres.2010.02.004. PubMed PMID: 20381863.
58. Coral S, Sigalotti L, Altomonte M, Engelsberg A, Colizzi F, Cattarossi I, Maraskovsky E,
Jager E, Seliger B, Maio M. 5-aza-2'-deoxycytidine-induced expression of functional cancer testis
antigens in human renal cell carcinoma: immunotherapeutic implications. Clin Cancer Res.
2002;8(8):2690-5. Epub 2002/08/13. PubMed PMID: 12171902.
59. Andersen PS, Stryhn A, Hansen BE, Fugger L, Engberg J, Buus S. A recombinant antibody
with the antigen-specific, major histocompatibility complex-restricted specificity of T cells. Proc
Natl Acad Sci U S A. 1996;93(5):1820-4. Epub 1996/03/05. doi: 10.1073/pnas.93.5.1820. PubMed
PMID: 8700842; PMCID: PMC39865.
60. Altman JD, Moss PA, Goulder PJ, Barouch DH, McHeyzer-Williams MG, Bell JI,
McMichael AJ, Davis MM. Phenotypic analysis of antigen-specific T lymphocytes. Science.
1996;274(5284):94-6. Epub 1996/10/04. doi: 10.1126/science.274.5284.94. PubMed PMID:
8810254.
61. Garboczi DN, Hung DT, Wiley DC. HLA-A2-peptide complexes: refolding and
crystallization of molecules expressed in Escherichia coli and complexed with single antigenic
peptides. Proc Natl Acad Sci U S A. 1992;89(8):3429-33. Epub 1992/04/15. doi:
10.1073/pnas.89.8.3429. PubMed PMID: 1565634; PMCID: PMC48881.
62. Denkberg G, Cohen CJ, Reiter Y. Critical role for CD8 in binding of MHC tetramers to
TCR: CD8 antibodies block specific binding of human tumor-specific MHC-peptide tetramers to
121
TCR. J Immunol. 2001;167(1):270-6. Epub 2001/06/22. doi: 10.4049/jimmunol.167.1.270.
PubMed PMID: 11418659.
63. Dahan R, Reiter Y. T-cell-receptor-like antibodies - generation, function and applications.
Expert Rev Mol Med. 2012;14:e6. Epub 2012/03/01. doi: 10.1017/erm.2012.2. PubMed PMID:
22361332.
64. Denkberg G, Cohen CJ, Lev A, Chames P, Hoogenboom HR, Reiter Y. Direct visualization
of distinct T cell epitopes derived from a melanoma tumor-associated antigen by using human
recombinant antibodies with MHC- restricted T cell receptor-like specificity. Proc Natl Acad Sci
U S A. 2002;99(14):9421-6. Epub 2002/07/03. doi: 10.1073/pnas.132285699. PubMed PMID:
12093904; PMCID: PMC123156.
65. Denkberg G, Lev A, Eisenbach L, Benhar I, Reiter Y. Selective targeting of melanoma and
APCs using a recombinant antibody with TCR-like specificity directed toward a melanoma
differentiation antigen. J Immunol. 2003;171(5):2197-207. Epub 2003/08/21. doi:
10.4049/jimmunol.171.5.2197. PubMed PMID: 12928363.
66. Klechevsky E, Gallegos M, Denkberg G, Palucka K, Banchereau J, Cohen C, Reiter Y.
Antitumor activity of immunotoxins with T-cell receptor-like specificity against human melanoma
xenografts. Cancer Res. 2008;68(15):6360-7. Epub 2008/08/05. doi: 10.1158/0008-5472.CAN-
08-0928. PubMed PMID: 18676861; PMCID: PMC2728007.
67. Willemsen RA, Debets R, Hart E, Hoogenboom HR, Bolhuis RL, Chames P. A phage
display selected fab fragment with MHC class I-restricted specificity for MAGE-A1 allows for
retargeting of primary human T lymphocytes. Gene Ther. 2001;8(21):1601-8. Epub 2002/03/16.
doi: 10.1038/sj.gt.3301570. PubMed PMID: 11894998.
68. Willemsen RA, Ronteltap C, Chames P, Debets R, Bolhuis RL. T cell retargeting with
MHC class I-restricted antibodies: the CD28 costimulatory domain enhances antigen-specific
cytotoxicity and cytokine production. J Immunol. 2005;174(12):7853-8. Epub 2005/06/10. doi:
10.4049/jimmunol.174.12.7853. PubMed PMID: 15944290.
69. Held G, Matsuo M, Epel M, Gnjatic S, Ritter G, Lee SY, Tai TY, Cohen CJ, Old LJ,
Pfreundschuh M, Reiter Y, Hoogenboom HR, Renner C. Dissecting cytotoxic T cell responses
towards the NY-ESO-1 protein by peptide/MHC-specific antibody fragments. Eur J Immunol.
2004;34(10):2919-29. Epub 2004/09/16. doi: 10.1002/eji.200425297. PubMed PMID: 15368308.
70. Stewart-Jones G, Wadle A, Hombach A, Shenderov E, Held G, Fischer E, Kleber S, Nuber
N, Stenner-Liewen F, Bauer S, McMichael A, Knuth A, Abken H, Hombach AA, Cerundolo V,
Jones EY, Renner C. Rational development of high-affinity T-cell receptor-like antibodies. Proc
Natl Acad Sci U S A. 2009;106(14):5784-8. Epub 2009/03/25. doi: 10.1073/pnas.0901425106.
PubMed PMID: 19307587; PMCID: PMC2667008.
71. Chames P, Willemsen RA, Rojas G, Dieckmann D, Rem L, Schuler G, Bolhuis RL,
Hoogenboom HR. TCR-like human antibodies expressed on human CTLs mediate antibody
affinity-dependent cytolytic activity. J Immunol. 2002;169(2):1110-8. Epub 2002/07/05. doi:
10.4049/jimmunol.169.2.1110. PubMed PMID: 12097420.
72. Maus MV, Plotkin J, Jakka G, Stewart-Jones G, Riviere I, Merghoub T, Wolchok J, Renner
C, Sadelain M. An MHC-restricted antibody-based chimeric antigen receptor requires TCR-like
affinity to maintain antigen specificity. Mol Ther Oncolytics. 2016;3:1-9. Epub 2017/01/11. doi:
10.1038/mto.2016.23. PubMed PMID: 29675462; PMCID: PMC5904357.
73. Dao T, Yan S, Veomett N, Pankov D, Zhou L, Korontsvit T, Scott A, Whitten J, Maslak
P, Casey E, Tan T, Liu H, Zakhaleva V, Curcio M, Doubrovina E, O'Reilly RJ, Liu C, Scheinberg
DA. Targeting the intracellular WT1 oncogene product with a therapeutic human antibody. Sci
122
Transl Med. 2013;5(176):176ra33. Epub 2013/03/15. doi: 10.1126/scitranslmed.3005661.
PubMed PMID: 23486779; PMCID: PMC3963696.
74. Mundlos S, Pelletier J, Darveau A, Bachmann M, Winterpacht A, Zabel B. Nuclear
localization of the protein encoded by the Wilms' tumor gene WT1 in embryonic and adult tissues.
Development. 1993;119(4):1329-41. Epub 1993/12/01. PubMed PMID: 8306891.
75. Keilholz U, Menssen HD, Gaiger A, Menke A, Oji Y, Oka Y, Scheibenbogen C, Stauss H,
Thiel E, Sugiyama H. Wilms' tumour gene 1 (WT1) in human neoplasia. Leukemia.
2005;19(8):1318-23. Epub 2005/05/28. doi: 10.1038/sj.leu.2403817. PubMed PMID: 15920488.
76. Takigawa N, Kiura K, Kishimoto T. Medical treatment of mesothelioma: anything new?
Curr Oncol Rep. 2011;13(4):265-71. Epub 2011/04/20. doi: 10.1007/s11912-011-0172-1. PubMed
PMID: 21503595.
77. Raja S, Murthy SC, Mason DP. Malignant pleural mesothelioma. Curr Oncol Rep.
2011;13(4):259-64. Epub 2011/05/17. doi: 10.1007/s11912-011-0177-9. PubMed PMID:
21573909.
78. Veomett N, Dao T, Liu H, Xiang J, Pankov D, Dubrovsky L, Whitten JA, Park SM,
Korontsvit T, Zakhaleva V, Casey E, Curcio M, Kharas MG, O'Reilly RJ, Liu C, Scheinberg DA.
Therapeutic efficacy of an Fc-enhanced TCR-like antibody to the intracellular WT1 oncoprotein.
Clin Cancer Res. 2014;20(15):4036-46. Epub 2014/05/23. doi: 10.1158/1078-0432.CCR-13-2756.
PubMed PMID: 24850840; PMCID: PMC4119489.
79. Dao T, Pankov D, Scott A, Korontsvit T, Zakhaleva V, Xu Y, Xiang J, Yan S, de Morais
Guerreiro MD, Veomett N, Dubrovsky L, Curcio M, Doubrovina E, Ponomarev V, Liu C, O'Reilly
RJ, Scheinberg DA. Therapeutic bispecific T-cell engager antibody targeting the intracellular
oncoprotein WT1. Nat Biotechnol. 2015;33(10):1079-86. Epub 2015/09/22. doi:
10.1038/nbt.3349. PubMed PMID: 26389576; PMCID: PMC4600043.
80. Ataie N, Xiang J, Cheng N, Brea EJ, Lu W, Scheinberg DA, Liu C, Ng HL. Structure of a
TCR-Mimic Antibody with Target Predicts Pharmacogenetics. J Mol Biol. 2016;428(1):194-205.
doi: 10.1016/j.jmb.2015.12.002. PubMed PMID: 26688548; PMCID: PMC4738012.
81. Mareeva T, Martinez-Hackert E, Sykulev Y. How a T cell receptor-like antibody
recognizes major histocompatibility complex-bound peptide. J Biol Chem. 2008;283(43):29053-
9. Epub 2008/08/16. doi: 10.1074/jbc.M804996200. PubMed PMID: 18703505; PMCID:
PMC2570882.
82. Rafiq S, Purdon TJ, Daniyan AF, Koneru M, Dao T, Liu C, Scheinberg DA, Brentjens RJ.
Optimized T-cell receptor-mimic chimeric antigen receptor T cells directed toward the
intracellular Wilms Tumor 1 antigen. Leukemia. 2017;31(8):1788-97. Epub 2016/12/08. doi:
10.1038/leu.2016.373. PubMed PMID: 27924074; PMCID: PMC5495623.
83. Shen Y, Li YM, Zhou JJ, Zhou Z, Xu YC, Zhao WB, Chen SQ. The Antitumor Activity of
TCR-Mimic Antibody-Drug Conjugates (TCRm-ADCs) Targeting the Intracellular Wilms Tumor
1 (WT1) Oncoprotein. Int J Mol Sci. 2019;20(16). Epub 2019/08/15. doi: 10.3390/ijms20163912.
PubMed PMID: 31408937; PMCID: PMC6720711.
84. Tran E, Ahmadzadeh M, Lu YC, Gros A, Turcotte S, Robbins PF, Gartner JJ, Zheng Z, Li
YF, Ray S, Wunderlich JR, Somerville RP, Rosenberg SA. Immunogenicity of somatic mutations
in human gastrointestinal cancers. Science. 2015;350(6266):1387-90. Epub 2015/11/01. doi:
10.1126/science.aad1253. PubMed PMID: 26516200; PMCID: PMC7445892.
85. Li D, Bentley C, Anderson A, Wiblin S, Cleary KLS, Koustoulidou S, Hassanali T, Yates
J, Greig J, Nordkamp MO, Trenevska I, Ternette N, Kessler BM, Cornelissen B, Cragg MS,
Banham AH. Development of a T-cell Receptor Mimic Antibody against Wild-Type p53 for
123
Cancer Immunotherapy. Cancer Res. 2017;77(10):2699-711. Epub 2017/04/02. doi:
10.1158/0008-5472.CAN-16-3247. PubMed PMID: 28363997.
86. Hsiue EH, Wright KM, Douglass J, Hwang MS, Mog BJ, Pearlman AH, Paul S, DiNapoli
SR, Konig MF, Wang Q, Schaefer A, Miller MS, Skora AD, Azurmendi PA, Murphy MB, Liu Q,
Watson E, Li Y, Pardoll DM, Bettegowda C, Papadopoulos N, Kinzler KW, Vogelstein B, Gabelli
SB, Zhou S. Targeting a neoantigen derived from a common TP53 mutation. Science.
2021;371(6533). Epub 2021/03/03. doi: 10.1126/science.abc8697. PubMed PMID: 33649166.
87. Douglass J, Hsiue EH, Mog BJ, Hwang MS, DiNapoli SR, Pearlman AH, Miller MS,
Wright KM, Azurmendi PA, Wang Q, Paul S, Schaefer A, Skora AD, Molin MD, Konig MF, Liu
Q, Watson E, Li Y, Murphy MB, Pardoll DM, Bettegowda C, Papadopoulos N, Gabelli SB,
Kinzler KW, Vogelstein B, Zhou S. Bispecific antibodies targeting mutant RAS neoantigens. Sci
Immunol. 2021;6(57). Epub 2021/03/03. doi: 10.1126/sciimmunol.abd5515. PubMed PMID:
33649101.
88. McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach EM, Collins M, Byrne MC.
CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for
the glucocorticoid-induced TNF receptor. Immunity. 2002;16(2):311-23. Epub 2002/03/01. doi:
10.1016/s1074-7613(02)00280-7. PubMed PMID: 11869690.
89. Rech AJ, Mick R, Martin S, Recio A, Aqui NA, Powell DJ, Jr., Colligon TA, Trosko JA,
Leinbach LI, Pletcher CH, Tweed CK, DeMichele A, Fox KR, Domchek SM, Riley JL,
Vonderheide RH. CD25 blockade depletes and selectively reprograms regulatory T cells in concert
with immunotherapy in cancer patients. Sci Transl Med. 2012;4(134):134ra62. Epub 2012/05/18.
doi: 10.1126/scitranslmed.3003330. PubMed PMID: 22593175; PMCID: PMC4425934.
90. Cote AL, Zhang P, O'Sullivan JA, Jacobs VL, Clemis CR, Sakaguchi S, Guevara-Patino
JA, Turk MJ. Stimulation of the glucocorticoid-induced TNF receptor family-related receptor on
CD8 T cells induces protective and high-avidity T cell responses to tumor-specific antigens. J
Immunol. 2011;186(1):275-83. Epub 2010/11/26. doi: 10.4049/jimmunol.1001308. PubMed
PMID: 21106849; PMCID: PMC3050990.
91. Gerena-Lewis M, Crawford J, Bonomi P, Maddox AM, Hainsworth J, McCune DE, Shukla
R, Zeigler H, Hurtubise P, Chowdhury TR, Fletcher B, Dyehouse K, Ghalie R, Jazieh AR. A Phase
II trial of Denileukin Diftitox in patients with previously treated advanced non-small cell lung
cancer. Am J Clin Oncol. 2009;32(3):269-73. Epub 2009/05/13. doi:
10.1097/COC.0b013e318187dd40. PubMed PMID: 19433964.
92. Attia P, Maker AV, Haworth LR, Rogers-Freezer L, Rosenberg SA. Inability of a fusion
protein of IL-2 and diphtheria toxin (Denileukin Diftitox, DAB389IL-2, ONTAK) to eliminate
regulatory T lymphocytes in patients with melanoma. J Immunother. 2005;28(6):582-92. Epub
2005/10/15. doi: 10.1097/01.cji.0000175468.19742.10. PubMed PMID: 16224276; PMCID:
PMC1533764.
93. Dao T, Mun SS, Scott AC, Jarvis CA, Korontsvit T, Yang Z, Liu L, Klatt MG, Guerreiro
M, Selvakumar A, Brea EJ, Oh C, Liu C, Scheinberg DA. Depleting T regulatory cells by targeting
intracellular Foxp3 with a TCR mimic antibody. Oncoimmunology. 2019;8(7):1570778. Epub
2019/05/31. doi: 10.1080/2162402X.2019.1570778. PubMed PMID: 31143508; PMCID:
PMC6527296.
94. Makler O, Oved K, Netzer N, Wolf D, Reiter Y. Direct visualization of the dynamics of
antigen presentation in human cells infected with cytomegalovirus revealed by antibodies
mimicking TCR specificity. Eur J Immunol. 2010;40(6):1552-65. Epub 2010/03/23. doi:
10.1002/eji.200939875. PubMed PMID: 20306470.
124
95. Inaguma Y, Akahori Y, Murayama Y, Shiraishi K, Tsuzuki-Iba S, Endoh A, Tsujikawa J,
Demachi-Okamura A, Hiramatsu K, Saji H, Yamamoto Y, Yamamoto N, Nishimura Y, Takahashi
T, Kuzushima K, Emi N, Akatsuka Y. Construction and molecular characterization of a T-cell
receptor-like antibody and CAR-T cells specific for minor histocompatibility antigen HA-1H.
Gene Ther. 2014;21(6):575-84. Epub 2014/04/04. doi: 10.1038/gt.2014.30. PubMed PMID:
24694533.
96. Sastry KS, Too CT, Kaur K, Gehring AJ, Low L, Javiad A, Pollicino T, Li L, Kennedy PT,
Lopatin U, Macary PA, Bertoletti A. Targeting hepatitis B virus-infected cells with a T-cell
receptor-like antibody. J Virol. 2011;85(5):1935-42. Epub 2010/12/17. doi: 10.1128/JVI.01990-
10. PubMed PMID: 21159876; PMCID: PMC3067764.
97. Neethling FA, Ramakrishna V, Keler T, Buchli R, Woodburn T, Weidanz JA. Assessing
vaccine potency using TCRmimic antibodies. Vaccine. 2008;26(25):3092-102. Epub 2008/03/21.
doi: 10.1016/j.vaccine.2008.02.025. PubMed PMID: 18353510.
98. Wittman VP, Woodburn D, Nguyen T, Neethling FA, Wright S, Weidanz JA. Antibody
targeting to a class I MHC-peptide epitope promotes tumor cell death. J Immunol.
2006;177(6):4187-95. Epub 2006/09/05. doi: 10.4049/jimmunol.177.6.4187. PubMed PMID:
16951384.
99. Weidanz JA, Nguyen T, Woodburn T, Neethling FA, Chiriva-Internati M, Hildebrand WH,
Lustgarten J. Levels of specific peptide-HLA class I complex predicts tumor cell susceptibility to
CTL killing. J Immunol. 2006;177(8):5088-97. Epub 2006/10/04. doi:
10.4049/jimmunol.177.8.5088. PubMed PMID: 17015692.
100. Weidanz JA, Piazza P, Hickman-Miller H, Woodburn D, Nguyen T, Wahl A, Neethling F,
Chiriva-Internati M, Rinaldo CR, Hildebrand WH. Development and implementation of a direct
detection, quantitation and validation system for class I MHC self-peptide epitopes. J Immunol
Methods. 2007;318(1-2):47-58. Epub 2006/12/01. doi: 10.1016/j.jim.2006.09.019. PubMed
PMID: 17134715.
101. Herschhorn A, Marasco WA, Hizi A. Antibodies and lentiviruses that specifically
recognize a T cell epitope derived from HIV-1 Nef protein and presented by HLA-C. J Immunol.
2010;185(12):7623-32. Epub 2010/11/16. doi: 10.4049/jimmunol.1001561. PubMed PMID:
21076072.
102. Nunoya J, Nakashima T, Kawana-Tachikawa A, Kiyotani K, Ito Y, Sugimura K, Iwamoto
A. Short communication: generation of recombinant monoclonal antibodies against an
immunodominant HLA-A*2402-restricted HIV type 1 CTL epitope. AIDS Res Hum Retroviruses.
2009;25(9):897-904. Epub 2009/08/20. doi: 10.1089/aid.2009.0036. PubMed PMID: 19689201.
103. Lev A, Denkberg G, Cohen CJ, Tzukerman M, Skorecki KL, Chames P, Hoogenboom HR,
Reiter Y. Isolation and characterization of human recombinant antibodies endowed with the
antigen-specific, major histocompatibility complex-restricted specificity of T cells directed toward
the widely expressed tumor T-cell epitopes of the telomerase catalytic subunit. Cancer Res.
2002;62(11):3184-94. Epub 2002/05/31. PubMed PMID: 12036932.
104. Cohen CJ, Sarig O, Yamano Y, Tomaru U, Jacobson S, Reiter Y. Direct phenotypic
analysis of human MHC class I antigen presentation: visualization, quantitation, and in situ
detection of human viral epitopes using peptide-specific, MHC-restricted human recombinant
antibodies. J Immunol. 2003;170(8):4349-61. Epub 2003/04/12. doi:
10.4049/jimmunol.170.8.4349. PubMed PMID: 12682272.
105. Yamano Y, Cohen CJ, Takenouchi N, Yao K, Tomaru U, Li HC, Reiter Y, Jacobson S.
Increased expression of human T lymphocyte virus type I (HTLV-I) Tax11-19 peptide-human
125
histocompatibility leukocyte antigen A*201 complexes on CD4+ CD25+ T Cells detected by
peptide-specific, major histocompatibility complex-restricted antibodies in patients with HTLV-I-
associated neurologic disease. J Exp Med. 2004;199(10):1367-77. Epub 2004/05/12. doi:
10.1084/jem.20032042. PubMed PMID: 15136590; PMCID: PMC2211812.
106. Biddison WE, Turner RV, Gagnon SJ, Lev A, Cohen CJ, Reiter Y. Tax and M1
peptide/HLA-A2-specific Fabs and T cell receptors recognize nonidentical structural features on
peptide/HLA-A2 complexes. J Immunol. 2003;171(6):3064-74. Epub 2003/09/10. doi:
10.4049/jimmunol.171.6.3064. PubMed PMID: 12960332.
107. Bernardeau K, Gouard S, David G, Ruellan AL, Devys A, Barbet J, Bonneville M, Cherel
M, Davodeau F. Assessment of CD8 involvement in T cell clone avidity by direct measurement
of HLA-A2/Mage3 complex density using a high-affinity TCR like monoclonal antibody. Eur J
Immunol. 2005;35(10):2864-75. Epub 2005/09/16. doi: 10.1002/eji.200526307. PubMed PMID:
16163672.
108. Held G, Wadle A, Dauth N, Stewart-Jones G, Sturm C, Thiel M, Zwick C, Dieckmann D,
Schuler G, Hoogenboom HR, Levy F, Cerundolo V, Pfreundschuh M, Renner C. MHC-peptide-
specific antibodies reveal inefficient presentation of an HLA-A*0201-restricted, Melan-A-derived
peptide after active intracellular processing. Eur J Immunol. 2007;37(7):2008-17. Epub
2007/06/15. doi: 10.1002/eji.200636545. PubMed PMID: 17559180.
109. Hawkins O, Verma B, Lightfoot S, Jain R, Rawat A, McNair S, Caseltine S, Mojsilovic A,
Gupta P, Neethling F, Almanza O, Dooley W, Hildebrand W, Weidanz J. An HLA-presented
fragment of macrophage migration inhibitory factor is a therapeutic target for invasive breast
cancer. J Immunol. 2011;186(11):6607-16. Epub 2011/04/26. doi: 10.4049/jimmunol.1003995.
PubMed PMID: 21515791.
110. Cohen CJ, Hoffmann N, Farago M, Hoogenboom HR, Eisenbach L, Reiter Y. Direct
detection and quantitation of a distinct T-cell epitope derived from tumor-specific epithelial cell-
associated mucin using human recombinant antibodies endowed with the antigen-specific, major
histocompatibility complex-restricted specificity of T cells. Cancer Res. 2002;62(20):5835-44.
Epub 2002/10/18. PubMed PMID: 12384546.
111. Schuberth PC, Jakka G, Jensen SM, Wadle A, Gautschi F, Haley D, Haile S, Mischo A,
Held G, Thiel M, Tinguely M, Bifulco CB, Fox BA, Renner C, Petrausch U. Effector memory and
central memory NY-ESO-1-specific re-directed T cells for treatment of multiple myeloma. Gene
Ther. 2013;20(4):386-95. Epub 2012/06/29. doi: 10.1038/gt.2012.48. PubMed PMID: 22739387.
112. Li D, Bentley C, Yates J, Salimi M, Greig J, Wiblin S, Hassanali T, Banham AH.
Engineering chimeric human and mouse major histocompatibility complex (MHC) class I
tetramers for the production of T-cell receptor (TCR) mimic antibodies. PLoS One.
2017;12(4):e0176642. Epub 2017/04/28. doi: 10.1371/journal.pone.0176642. PubMed PMID:
28448627; PMCID: PMC5407768.
113. Verma B, Hawkins OE, Neethling FA, Caseltine SL, Largo SR, Hildebrand WH, Weidanz
JA. Direct discovery and validation of a peptide/MHC epitope expressed in primary human breast
cancer cells using a TCRm monoclonal antibody with profound antitumor properties. Cancer
Immunol Immunother. 2010;59(4):563-73. Epub 2009/09/26. doi: 10.1007/s00262-009-0774-8.
PubMed PMID: 19779714.
114. Chang AY, Dao T, Gejman RS, Jarvis CA, Scott A, Dubrovsky L, Mathias MD, Korontsvit
T, Zakhaleva V, Curcio M, Hendrickson RC, Liu C, Scheinberg DA. A therapeutic T cell receptor
mimic antibody targets tumor-associated PRAME peptide/HLA-I antigens. J Clin Invest.
126
2017;127(9):3557. Epub 2017/09/02. doi: 10.1172/JCI96860. PubMed PMID: 28862643;
PMCID: PMC5669580.
115. Sergeeva A, Alatrash G, He H, Ruisaard K, Lu S, Wygant J, McIntyre BW, Ma Q, Li D,
St John L, Clise-Dwyer K, Molldrem JJ. An anti-PR1/HLA-A2 T-cell receptor-like antibody
mediates complement-dependent cytotoxicity against acute myeloid leukemia progenitor cells.
Blood. 2011;117(16):4262-72. Epub 2011/02/08. doi: 10.1182/blood-2010-07-299248. PubMed
PMID: 21296998; PMCID: PMC3087478.
116. Sergeeva A, He H, Ruisaard K, St John L, Alatrash G, Clise-Dwyer K, Li D, Patenia R,
Hong R, Sukhumalchandra P, You MJ, Gagea M, Ma Q, Molldrem JJ. Activity of 8F4, a T-cell
receptor-like anti-PR1/HLA-A2 antibody, against primary human AML in vivo. Leukemia.
2016;30(7):1475-84. Epub 2016/04/09. doi: 10.1038/leu.2016.57. PubMed PMID: 27055866;
PMCID: PMC4935597.
117. Ma Q, Garber HR, Lu S, He H, Tallis E, Ding X, Sergeeva A, Wood MS, Dotti G, Salvado
B, Ruisaard K, Clise-Dwyer K, John LS, Rezvani K, Alatrash G, Shpall EJ, Molldrem JJ. A novel
TCR-like CAR with specificity for PR1/HLA-A2 effectively targets myeloid leukemia in vitro
when expressed in human adult peripheral blood and cord blood T cells. Cytotherapy.
2016;18(8):985-94. Epub 2016/06/07. doi: 10.1016/j.jcyt.2016.05.001. PubMed PMID:
27265873; PMCID: PMC4935572.
118. Epel M, Carmi I, Soueid-Baumgarten S, Oh S, Bera T, Pastan I, Berzofsky J, Reiter Y.
Targeting TARP, a novel breast and prostate tumor-associated antigen, with T cell receptor-like
human recombinant antibodies. Eur J Immunol. 2008;38(6):1706-20. Epub 2008/05/01. doi:
10.1002/eji.200737524. PubMed PMID: 18446790; PMCID: PMC2682370.
119. Michaeli Y, Denkberg G, Sinik K, Lantzy L, Chih-Sheng C, Beauverd C, Ziv T, Romero
P, Reiter Y. Expression hierarchy of T cell epitopes from melanoma differentiation antigens:
unexpected high level presentation of tyrosinase-HLA-A2 Complexes revealed by peptide-
specific, MHC-restricted, TCR-like antibodies. J Immunol. 2009;182(10):6328-41. Epub
2009/05/06. doi: 10.4049/jimmunol.0801898. PubMed PMID: 19414786.
120. Dubrovsky L, Pankov D, Brea EJ, Dao T, Scott A, Yan S, O'Reilly RJ, Liu C, Scheinberg
DA. A TCR-mimic antibody to WT1 bypasses tyrosine kinase inhibitor resistance in human BCR-
ABL+ leukemias. Blood. 2014;123(21):3296-304. Epub 2014/04/12. doi: 10.1182/blood-2014-01-
549022. PubMed PMID: 24723681; PMCID: PMC4046427.
121. Oren R, Hod-Marco M, Haus-Cohen M, Thomas S, Blat D, Duvshani N, Denkberg G,
Elbaz Y, Benchetrit F, Eshhar Z, Stauss H, Reiter Y. Functional comparison of engineered T cells
carrying a native TCR versus TCR-like antibody-based chimeric antigen receptors indicates
affinity/avidity thresholds. J Immunol. 2014;193(11):5733-43. Epub 2014/11/02. doi:
10.4049/jimmunol.1301769. PubMed PMID: 25362181.
122. Zhao Q, Ahmed M, Tassev DV, Hasan A, Kuo TY, Guo HF, O'Reilly RJ, Cheung NK.
Affinity maturation of T-cell receptor-like antibodies for Wilms tumor 1 peptide greatly enhances
therapeutic potential. Leukemia. 2015;29(11):2238-47. Epub 2015/05/20. doi:
10.1038/leu.2015.125. PubMed PMID: 25987253; PMCID: PMC4788467.
123. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016;66(1):7-
30. doi: 10.3322/caac.21332. PubMed PMID: 26742998.
124. Morgan DA, Ruscetti FW, Gallo R. Selective in vitro growth of T lymphocytes from
normal human bone marrows. Science. 1976;193(4257):1007-8. PubMed PMID: 181845.
125. Rosenberg SA, Packard BS, Aebersold PM, Solomon D, Topalian SL, Toy ST, Simon P,
Lotze MT, Yang JC, Seipp CA, et al. Use of tumor-infiltrating lymphocytes and interleukin-2 in
127
the immunotherapy of patients with metastatic melanoma. A preliminary report. N Engl J Med.
1988;319(25):1676-80. doi: 10.1056/NEJM198812223192527. PubMed PMID: 3264384.
126. Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC, Sherry RM, Royal RE,
Topalian SL, Kammula US, Restifo NP, Zheng Z, Nahvi A, de Vries CR, Rogers-Freezer LJ,
Mavroukakis SA, Rosenberg SA. Cancer regression in patients after transfer of genetically
engineered lymphocytes. Science. 2006;314(5796):126-9. doi: 10.1126/science.1129003. PubMed
PMID: 16946036; PMCID: PMC2267026.
127. Robbins PF, Morgan RA, Feldman SA, Yang JC, Sherry RM, Dudley ME, Wunderlich JR,
Nahvi AV, Helman LJ, Mackall CL, Kammula US, Hughes MS, Restifo NP, Raffeld M, Lee CC,
Levy CL, Li YF, El-Gamil M, Schwarz SL, Laurencot C, Rosenberg SA. Tumor regression in
patients with metastatic synovial cell sarcoma and melanoma using genetically engineered
lymphocytes reactive with NY-ESO-1. J Clin Oncol. 2011;29(7):917-24. doi:
10.1200/JCO.2010.32.2537. PubMed PMID: 21282551; PMCID: PMC3068063.
128. Robbins PF, Kassim SH, Tran TL, Crystal JS, Morgan RA, Feldman SA, Yang JC, Dudley
ME, Wunderlich JR, Sherry RM, Kammula US, Hughes MS, Restifo NP, Raffeld M, Lee CC, Li
YF, El-Gamil M, Rosenberg SA. A pilot trial using lymphocytes genetically engineered with an
NY-ESO-1-reactive T-cell receptor: long-term follow-up and correlates with response. Clin
Cancer Res. 2015;21(5):1019-27. Epub 2014/12/30. doi: 10.1158/1078-0432.CCR-14-2708.
PubMed PMID: 25538264; PMCID: PMC4361810.
129. Essand M, Loskog AS. Genetically engineered T cells for the treatment of cancer. J Intern
Med. 2013;273(2):166-81. doi: 10.1111/joim.12020. PubMed PMID: 23198862; PMCID:
PMC3607417.
130. Grupp SA, Kalos M, Barrett D, Aplenc R, Porter DL, Rheingold SR, Teachey DT, Chew
A, Hauck B, Wright JF, Milone MC, Levine BL, June CH. Chimeric antigen receptor-modified T
cells for acute lymphoid leukemia. N Engl J Med. 2013;368(16):1509-18. doi:
10.1056/NEJMoa1215134. PubMed PMID: 23527958; PMCID: PMC4058440.
131. Porter DL, Levine BL, Kalos M, Bagg A, June CH. Chimeric antigen receptor-modified T
cells in chronic lymphoid leukemia. N Engl J Med. 2011;365(8):725-33. doi:
10.1056/NEJMoa1103849. PubMed PMID: 21830940; PMCID: PMC3387277.
132. Muul LM, Spiess PJ, Director EP, Rosenberg SA. Identification of specific cytolytic
immune responses against autologous tumor in humans bearing malignant melanoma. J Immunol.
1987;138(3):989-95. Epub 1987/02/01. PubMed PMID: 3100623.
133. Jimenez-Reinoso A, Nehme-Alvarez D, Dominguez-Alonso C, Alvarez-Vallina L.
Synthetic TILs: Engineered Tumor-Infiltrating Lymphocytes With Improved Therapeutic
Potential. Front Oncol. 2020;10:593848. Epub 2021/03/09. doi: 10.3389/fonc.2020.593848.
PubMed PMID: 33680923; PMCID: PMC7928359.
134. Zhong XS, Matsushita M, Plotkin J, Riviere I, Sadelain M. Chimeric antigen receptors
combining 4-1BB and CD28 signaling domains augment PI3kinase/AKT/Bcl-XL activation and
CD8+ T cell-mediated tumor eradication. Mol Ther. 2010;18(2):413-20. doi:
10.1038/mt.2009.210. PubMed PMID: 19773745; PMCID: PMC2839303.
135. Tammana S, Huang X, Wong M, Milone MC, Ma L, Levine BL, June CH, Wagner JE,
Blazar BR, Zhou X. 4-1BB and CD28 signaling plays a synergistic role in redirecting umbilical
cord blood T cells against B-cell malignancies. Hum Gene Ther. 2010;21(1):75-86. doi:
10.1089/hum.2009.122. PubMed PMID: 19719389; PMCID: PMC2861957.
136. Pule MA, Savoldo B, Myers GD, Rossig C, Russell HV, Dotti G, Huls MH, Liu E, Gee
AP, Mei Z, Yvon E, Weiss HL, Liu H, Rooney CM, Heslop HE, Brenner MK. Virus-specific T
128
cells engineered to coexpress tumor-specific receptors: persistence and antitumor activity in
individuals with neuroblastoma. Nat Med. 2008;14(11):1264-70. Epub 2008/11/04. doi:
10.1038/nm.1882. PubMed PMID: 18978797; PMCID: PMC2749734.
137. Carpenito C, Milone MC, Hassan R, Simonet JC, Lakhal M, Suhoski MM, Varela-Rohena
A, Haines KM, Heitjan DF, Albelda SM, Carroll RG, Riley JL, Pastan I, June CH. Control of
large, established tumor xenografts with genetically retargeted human T cells containing CD28
and CD137 domains. Proc Natl Acad Sci U S A. 2009;106(9):3360-5. Epub 2009/02/13. doi:
10.1073/pnas.0813101106. PubMed PMID: 19211796; PMCID: PMC2651342.
138. Milone MC, Fish JD, Carpenito C, Carroll RG, Binder GK, Teachey D, Samanta M, Lakhal
M, Gloss B, Danet-Desnoyers G, Campana D, Riley JL, Grupp SA, June CH. Chimeric receptors
containing CD137 signal transduction domains mediate enhanced survival of T cells and increased
antileukemic efficacy in vivo. Mol Ther. 2009;17(8):1453-64. Epub 2009/04/23. doi:
10.1038/mt.2009.83. PubMed PMID: 19384291; PMCID: PMC2805264.
139. Wang J, Jensen M, Lin Y, Sui X, Chen E, Lindgren CG, Till B, Raubitschek A, Forman
SJ, Qian X, James S, Greenberg P, Riddell S, Press OW. Optimizing adoptive polyclonal T cell
immunotherapy of lymphomas, using a chimeric T cell receptor possessing CD28 and CD137
costimulatory domains. Hum Gene Ther. 2007;18(8):712-25. doi: 10.1089/hum.2007.028.
PubMed PMID: 17685852.
140. Zhao Y, Wang QJ, Yang S, Kochenderfer JN, Zheng Z, Zhong X, Sadelain M, Eshhar Z,
Rosenberg SA, Morgan RA. A herceptin-based chimeric antigen receptor with modified signaling
domains leads to enhanced survival of transduced T lymphocytes and antitumor activity. J
Immunol. 2009;183(9):5563-74. doi: 10.4049/jimmunol.0900447. PubMed PMID: 19843940.
141. Till BG, Jensen MC, Wang J, Qian X, Gopal AK, Maloney DG, Lindgren CG, Lin Y, Pagel
JM, Budde LE, Raubitschek A, Forman SJ, Greenberg PD, Riddell SR, Press OW. CD20-specific
adoptive immunotherapy for lymphoma using a chimeric antigen receptor with both CD28 and 4-
1BB domains: pilot clinical trial results. Blood. 2012;119(17):3940-50. Epub 2012/02/07. doi:
10.1182/blood-2011-10-387969. PubMed PMID: 22308288; PMCID: PMC3350361.
142. Maher J, Brentjens RJ, Gunset G, Riviere I, Sadelain M. Human T-lymphocyte cytotoxicity
and proliferation directed by a single chimeric TCRzeta /CD28 receptor. Nat Biotechnol.
2002;20(1):70-5. doi: 10.1038/nbt0102-70. PubMed PMID: 11753365.
143. Imai C, Mihara K, Andreansky M, Nicholson IC, Pui CH, Geiger TL, Campana D.
Chimeric receptors with 4-1BB signaling capacity provoke potent cytotoxicity against acute
lymphoblastic leukemia. Leukemia. 2004;18(4):676-84. doi: 10.1038/sj.leu.2403302. PubMed
PMID: 14961035.
144. Zhao Z, Condomines M, van der Stegen SJ, Perna F, Kloss CC, Gunset G, Plotkin J,
Sadelain M. Structural Design of Engineered Costimulation Determines Tumor Rejection Kinetics
and Persistence of CAR T Cells. Cancer Cell. 2015;28(4):415-28. doi:
10.1016/j.ccell.2015.09.004. PubMed PMID: 26461090.
145. Ying Z, He T, Wang X, Zheng W, Lin N, Tu M, Xie Y, Ping L, Zhang C, Liu W, Deng L,
Qi F, Ding Y, Lu XA, Song Y, Zhu J. Parallel Comparison of 4-1BB or CD28 Co-stimulated
CD19-Targeted CAR-T Cells for B Cell Non-Hodgkin's Lymphoma. Mol Ther Oncolytics.
2019;15:60-8. Epub 2019/10/28. doi: 10.1016/j.omto.2019.08.002. PubMed PMID: 31650026;
PMCID: PMC6804784.
146. Kawalekar OU, RS OC, Fraietta JA, Guo L, McGettigan SE, Posey AD, Jr., Patel PR,
Guedan S, Scholler J, Keith B, Snyder NW, Blair IA, Milone MC, June CH. Distinct Signaling of
Coreceptors Regulates Specific Metabolism Pathways and Impacts Memory Development in CAR
129
T Cells. Immunity. 2016;44(3):712. Epub 2016/03/15. doi: 10.1016/j.immuni.2016.02.023.
PubMed PMID: 28843072.
147. Weinkove R, George P, Dasyam N, McLellan AD. Selecting costimulatory domains for
chimeric antigen receptors: functional and clinical considerations. Clin Transl Immunology.
2019;8(5):e1049. Epub 2019/05/22. doi: 10.1002/cti2.1049. PubMed PMID: 31110702; PMCID:
PMC6511336.
148. Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ, Chew A, Gonzalez VE,
Zheng Z, Lacey SF, Mahnke YD, Melenhorst JJ, Rheingold SR, Shen A, Teachey DT, Levine BL,
June CH, Porter DL, Grupp SA. Chimeric antigen receptor T cells for sustained remissions in
leukemia. N Engl J Med. 2014;371(16):1507-17. doi: 10.1056/NEJMoa1407222. PubMed PMID:
25317870; PMCID: PMC4267531.
149. Davila ML, Riviere I, Wang X, Bartido S, Park J, Curran K, Chung SS, Stefanski J,
Borquez-Ojeda O, Olszewska M, Qu J, Wasielewska T, He Q, Fink M, Shinglot H, Youssif M,
Satter M, Wang Y, Hosey J, Quintanilla H, Halton E, Bernal Y, Bouhassira DC, Arcila ME, Gonen
M, Roboz GJ, Maslak P, Douer D, Frattini MG, Giralt S, Sadelain M, Brentjens R. Efficacy and
toxicity management of 19-28z CAR T cell therapy in B cell acute lymphoblastic leukemia. Sci
Transl Med. 2014;6(224):224ra25. Epub 2014/02/21. doi: 10.1126/scitranslmed.3008226.
PubMed PMID: 24553386; PMCID: PMC4684949.
150. Kochenderfer JN, Dudley ME, Kassim SH, Somerville RP, Carpenter RO, Stetler-
Stevenson M, Yang JC, Phan GQ, Hughes MS, Sherry RM, Raffeld M, Feldman S, Lu L, Li YF,
Ngo LT, Goy A, Feldman T, Spaner DE, Wang ML, Chen CC, Kranick SM, Nath A, Nathan DA,
Morton KE, Toomey MA, Rosenberg SA. Chemotherapy-refractory diffuse large B-cell
lymphoma and indolent B-cell malignancies can be effectively treated with autologous T cells
expressing an anti-CD19 chimeric antigen receptor. J Clin Oncol. 2015;33(6):540-9. doi:
10.1200/JCO.2014.56.2025. PubMed PMID: 25154820; PMCID: PMC4322257.
151. Lee DW, Kochenderfer JN, Stetler-Stevenson M, Cui YK, Delbrook C, Feldman SA, Fry
TJ, Orentas R, Sabatino M, Shah NN, Steinberg SM, Stroncek D, Tschernia N, Yuan C, Zhang H,
Zhang L, Rosenberg SA, Wayne AS, Mackall CL. T cells expressing CD19 chimeric antigen
receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-
escalation trial. Lancet. 2015;385(9967):517-28. Epub 2014/10/17. doi: 10.1016/S0140-
6736(14)61403-3. PubMed PMID: 25319501.
152. Gardner RA, Finney O, Annesley C, Brakke H, Summers C, Leger K, Bleakley M, Brown
C, Mgebroff S, Kelly-Spratt KS, Hoglund V, Lindgren C, Oron AP, Li D, Riddell SR, Park JR,
Jensen MC. Intent-to-treat leukemia remission by CD19 CAR T cells of defined formulation and
dose in children and young adults. Blood. 2017;129(25):3322-31. Epub 2017/04/15. doi:
10.1182/blood-2017-02-769208. PubMed PMID: 28408462; PMCID: PMC5482103.
153. Lamers CH, Sleijfer S, Vulto AG, Kruit WH, Kliffen M, Debets R, Gratama JW, Stoter G,
Oosterwijk E. Treatment of metastatic renal cell carcinoma with autologous T-lymphocytes
genetically retargeted against carbonic anhydrase IX: first clinical experience. J Clin Oncol.
2006;24(13):e20-2. doi: 10.1200/JCO.2006.05.9964. PubMed PMID: 16648493.
154. Lamers MH, Broekman MM, Boucher CA, Brouwer JT, Burger DM, van Hoek B,
Hoepelman AI, de Knegt RJ, Reesink HW, Drenth JP, Netherlands Association of H-g,
Netherlands Association of Internal M, Dutch Association for the Study of Liver D. Treatment of
hepatitis C monoinfection in adults--Dutch national guidelines. Neth J Med. 2013;71(7):377-85.
PubMed PMID: 24038567.
130
155. Morgan RA, Yang JC, Kitano M, Dudley ME, Laurencot CM, Rosenberg SA. Case report
of a serious adverse event following the administration of T cells transduced with a chimeric
antigen receptor recognizing ERBB2. Mol Ther. 2010;18(4):843-51. Epub 2010/02/25. doi:
10.1038/mt.2010.24. PubMed PMID: 20179677; PMCID: PMC2862534.
156. Crunelle CL, Cappelle D, Covaci A, van Nuijs AL, Maudens KE, Sabbe B, Dom G,
Michielsen P, Yegles M, Neels H. Hair ethyl glucuronide as a biomarker of alcohol consumption
in alcohol-dependent patients: role of gender differences. Drug Alcohol Depend. 2014;141:163-6.
doi: 10.1016/j.drugalcdep.2014.05.014. PubMed PMID: 24928477.
157. Lee DW, Gardner R, Porter DL, Louis CU, Ahmed N, Jensen M, Grupp SA, Mackall CL.
Current concepts in the diagnosis and management of cytokine release syndrome. Blood.
2014;124(2):188-95. doi: 10.1182/blood-2014-05-552729. PubMed PMID: 24876563; PMCID:
PMC4093680.
158. Maude SL, Barrett D, Teachey DT, Grupp SA. Managing cytokine release syndrome
associated with novel T cell-engaging therapies. Cancer J. 2014;20(2):119-22. doi:
10.1097/PPO.0000000000000035. PubMed PMID: 24667956; PMCID: PMC4119809.
159. Scheller J, Chalaris A, Schmidt-Arras D, Rose-John S. The pro- and anti-inflammatory
properties of the cytokine interleukin-6. Biochim Biophys Acta. 2011;1813(5):878-88. doi:
10.1016/j.bbamcr.2011.01.034. PubMed PMID: 21296109.
160. Jayaraman J, Mellody MP, Hou AJ, Desai RP, Fung AW, Pham AHT, Chen YY, Zhao W.
CAR-T design: Elements and their synergistic function. EBioMedicine. 2020;58:102931. Epub
2020/08/03. doi: 10.1016/j.ebiom.2020.102931. PubMed PMID: 32739874; PMCID:
PMC7393540.
161. Stoiber S, Cadilha BL, Benmebarek MR, Lesch S, Endres S, Kobold S. Limitations in the
Design of Chimeric Antigen Receptors for Cancer Therapy. Cells. 2019;8(5). Epub 2019/05/22.
doi: 10.3390/cells8050472. PubMed PMID: 31108883; PMCID: PMC6562702.
162. Park S, Shevlin E, Vedvyas Y, Zaman M, Park S, Hsu YS, Min IM, Jin MM. Micromolar
affinity CAR T cells to ICAM-1 achieves rapid tumor elimination while avoiding systemic
toxicity. Sci Rep. 2017;7(1):14366. Epub 2017/11/01. doi: 10.1038/s41598-017-14749-3. PubMed
PMID: 29085043; PMCID: PMC5662687.
163. Kloss CC, Lee J, Zhang A, Chen F, Melenhorst JJ, Lacey SF, Maus MV, Fraietta JA, Zhao
Y, June CH. Dominant-Negative TGF-beta Receptor Enhances PSMA-Targeted Human CAR T
Cell Proliferation And Augments Prostate Cancer Eradication. Mol Ther. 2018;26(7):1855-66.
Epub 2018/05/29. doi: 10.1016/j.ymthe.2018.05.003. PubMed PMID: 29807781; PMCID:
PMC6037129.
164. Cherkassky L, Morello A, Villena-Vargas J, Feng Y, Dimitrov DS, Jones DR, Sadelain M,
Adusumilli PS. Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-
mediated inhibition. J Clin Invest. 2016;126(8):3130-44. Epub 2016/07/28. doi:
10.1172/JCI83092. PubMed PMID: 27454297; PMCID: PMC4966328.
165. Derer S, Glorius P, Schlaeth M, Lohse S, Klausz K, Muchhal U, Desjarlais JR, Humpe A,
Valerius T, Peipp M. Increasing FcgammaRIIa affinity of an FcgammaRIII-optimized anti-EGFR
antibody restores neutrophil-mediated cytotoxicity. MAbs. 2014;6(2):409-21. Epub 2014/02/05.
doi: 10.4161/mabs.27457. PubMed PMID: 24492248; PMCID: PMC3984330.
166. Hudecek M, Lupo-Stanghellini MT, Kosasih PL, Sommermeyer D, Jensen MC, Rader C,
Riddell SR. Receptor affinity and extracellular domain modifications affect tumor recognition by
ROR1-specific chimeric antigen receptor T cells. Clin Cancer Res. 2013;19(12):3153-64. doi:
10.1158/1078-0432.CCR-13-0330. PubMed PMID: 23620405; PMCID: PMC3804130.
131
167. Choudhuri K, Wiseman D, Brown MH, Gould K, van der Merwe PA. T-cell receptor
triggering is critically dependent on the dimensions of its peptide-MHC ligand. Nature.
2005;436(7050):578-82. doi: 10.1038/nature03843. PubMed PMID: 16049493.
168. Guest RD, Hawkins RE, Kirillova N, Cheadle EJ, Arnold J, O'Neill A, Irlam J, Chester
KA, Kemshead JT, Shaw DM, Embleton MJ, Stern PL, Gilham DE. The role of extracellular
spacer regions in the optimal design of chimeric immune receptors: evaluation of four different
scFvs and antigens. J Immunother. 2005;28(3):203-11. PubMed PMID: 15838376.
169. Zhang T, He X, Tsang TC, Harris DT. Transgenic TCR expression: comparison of single
chain with full-length receptor constructs for T-cell function. Cancer Gene Ther. 2004;11(7):487-
96. Epub 2004/05/22. doi: 10.1038/sj.cgt.7700703. PubMed PMID: 15153936.
170. Alabanza L, Pegues M, Geldres C, Shi V, Wiltzius JJW, Sievers SA, Yang S, Kochenderfer
JN. Function of Novel Anti-CD19 Chimeric Antigen Receptors with Human Variable Regions Is
Affected by Hinge and Transmembrane Domains. Mol Ther. 2017;25(11):2452-65. Epub
2017/08/16. doi: 10.1016/j.ymthe.2017.07.013. PubMed PMID: 28807568; PMCID:
PMC5675490.
171. Brown CE, Alizadeh D, Starr R, Weng L, Wagner JR, Naranjo A, Ostberg JR, Blanchard
MS, Kilpatrick J, Simpson J, Kurien A, Priceman SJ, Wang X, Harshbarger TL, D'Apuzzo M,
Ressler JA, Jensen MC, Barish ME, Chen M, Portnow J, Forman SJ, Badie B. Regression of
Glioblastoma after Chimeric Antigen Receptor T-Cell Therapy. N Engl J Med.
2016;375(26):2561-9. Epub 2016/12/29. doi: 10.1056/NEJMoa1610497. PubMed PMID:
28029927; PMCID: PMC5390684.
172. Zhang T, Wu MR, Sentman CL. An NKp30-based chimeric antigen receptor promotes T
cell effector functions and antitumor efficacy in vivo. J Immunol. 2012;189(5):2290-9. Epub
2012/08/02. doi: 10.4049/jimmunol.1103495. PubMed PMID: 22851709; PMCID: PMC3633481.
173. Guedan S, Posey AD, Jr., Shaw C, Wing A, Da T, Patel PR, McGettigan SE, Casado-
Medrano V, Kawalekar OU, Uribe-Herranz M, Song D, Melenhorst JJ, Lacey SF, Scholler J, Keith
B, Young RM, June CH. Enhancing CAR T cell persistence through ICOS and 4-1BB
costimulation. JCI Insight. 2018;3(1). Epub 2018/01/13. doi: 10.1172/jci.insight.96976. PubMed
PMID: 29321369; PMCID: PMC5821198.
174. Wan Z, Shao X, Ji X, Dong L, Wei J, Xiong Z, Liu W, Qi H. Transmembrane domain-
mediated Lck association underlies bystander and costimulatory ICOS signaling. Cell Mol
Immunol. 2020;17(2):143-52. Epub 2018/12/12. doi: 10.1038/s41423-018-0183-z. PubMed
PMID: 30523347; PMCID: PMC7000777.
175. Ying Z, Huang XF, Xiang X, Liu Y, Kang X, Song Y, Guo X, Liu H, Ding N, Zhang T,
Duan P, Lin Y, Zheng W, Wang X, Lin N, Tu M, Xie Y, Zhang C, Liu W, Deng L, Gao S, Ping
L, Wang X, Zhou N, Zhang J, Wang Y, Lin S, Mamuti M, Yu X, Fang L, Wang S, Song H, Wang
G, Jones L, Zhu J, Chen SY. A safe and potent anti-CD19 CAR T cell therapy. Nat Med.
2019;25(6):947-53. Epub 2019/04/24. doi: 10.1038/s41591-019-0421-7. PubMed PMID:
31011207.
176. Zhao Z, Condomines M, van der Stegen SJC, Perna F, Kloss CC, Gunset G, Plotkin J,
Sadelain M. Structural Design of Engineered Costimulation Determines Tumor Rejection Kinetics
and Persistence of CAR T Cells. Cancer Cell. 2015;28(4):415-28. Epub 2015/10/16. doi:
10.1016/j.ccell.2015.09.004. PubMed PMID: 26461090; PMCID: PMC5003056.
177. Salter AI, Ivey RG, Kennedy JJ, Voillet V, Rajan A, Alderman EJ, Voytovich UJ, Lin C,
Sommermeyer D, Liu L, Whiteaker JR, Gottardo R, Paulovich AG, Riddell SR. Phosphoproteomic
analysis of chimeric antigen receptor signaling reveals kinetic and quantitative differences that
132
affect cell function. Sci Signal. 2018;11(544). Epub 2018/08/23. doi: 10.1126/scisignal.aat6753.
PubMed PMID: 30131370; PMCID: PMC6186424.
178. Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC. Detection and
isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with
cutaneous T-cell lymphoma. Proc Natl Acad Sci U S A. 1980;77(12):7415-9. PubMed PMID:
6261256; PMCID: PMC350514.
179. Suerth JD, Schambach A, Baum C. Genetic modification of lymphocytes by retrovirus-
based vectors. Curr Opin Immunol. 2012;24(5):598-608. doi: 10.1016/j.coi.2012.08.007. PubMed
PMID: 22995202.
180. Feldman SA, Goff SL, Xu H, Black MA, Kochenderfer JN, Johnson LA, Yang JC, Wang
Q, Parkhurst MR, Cross S, Morgan RA, Cornetta K, Rosenberg SA. Rapid production of clinical-
grade gammaretroviral vectors in expanded surface roller bottles using a "modified" step-filtration
process for clearance of packaging cells. Hum Gene Ther. 2011;22(1):107-15. doi:
10.1089/hum.2010.064. PubMed PMID: 20662590; PMCID: PMC3026655.
181. Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F, Yvon E, Nusbaum P, Selz
F, Hue C, Certain S, Casanova JL, Bousso P, Deist FL, Fischer A. Gene therapy of human severe
combined immunodeficiency (SCID)-X1 disease. Science. 2000;288(5466):669-72. PubMed
PMID: 10784449.
182. Li L, Allen C, Shivakumar R, Peshwa MV. Large volume flow electroporation of mRNA:
clinical scale process. Methods Mol Biol. 2013;969:127-38. doi: 10.1007/978-1-62703-260-5_9.
PubMed PMID: 23296932.
183. Bai YK, S.; Zhou, S.; Wang, Y.; Xu, J.; Cooke, J.; Wen, J. & Deng, H. Enhancement of
the in vivo persistence and antitumor efficacy of CD19 chimeric antigen receptor T cells through
the delivery of modified TERT mRNA. CELL DISCOVERY. 2015. doi:
10.1038/celldisc.2015.40.
184. Huang X, Wilber AC, Bao L, Tuong D, Tolar J, Orchard PJ, Levine BL, June CH, McIvor
RS, Blazar BR, Zhou X. Stable gene transfer and expression in human primary T cells by the
Sleeping Beauty transposon system. Blood. 2006;107(2):483-91. doi: 10.1182/blood-2005-05-
2133. PubMed PMID: 16189271; PMCID: PMC1895607.
185. Huang X, Guo H, Kang J, Choi S, Zhou TC, Tammana S, Lees CJ, Li ZZ, Milone M,
Levine BL, Tolar J, June CH, Scott McIvor R, Wagner JE, Blazar BR, Zhou X. Sleeping Beauty
transposon-mediated engineering of human primary T cells for therapy of CD19+ lymphoid
malignancies. Mol Ther. 2008;16(3):580-9. doi: 10.1038/sj.mt.6300404. PubMed PMID:
18227839; PMCID: PMC4539139.
186. Singh H, Manuri PR, Olivares S, Dara N, Dawson MJ, Huls H, Hackett PB, Kohn DB,
Shpall EJ, Champlin RE, Cooper LJ. Redirecting specificity of T-cell populations for CD19 using
the Sleeping Beauty system. Cancer Res. 2008;68(8):2961-71. doi: 10.1158/0008-5472.CAN-07-
5600. PubMed PMID: 18413766; PMCID: PMC2424272.
187. Kebriaei P, Huls H, Jena B, Munsell M, Jackson R, Lee DA, Hackett PB, Rondon G, Shpall
E, Champlin RE, Cooper LJ. Infusing CD19-directed T cells to augment disease control in patients
undergoing autologous hematopoietic stem-cell transplantation for advanced B-lymphoid
malignancies. Hum Gene Ther. 2012;23(5):444-50. doi: 10.1089/hum.2011.167. PubMed PMID:
22107246; PMCID: PMC3360496.
188. Rafiq S, Hackett CS, Brentjens RJ. Engineering strategies to overcome the current
roadblocks in CAR T cell therapy. Nat Rev Clin Oncol. 2020;17(3):147-67. Epub 2019/12/19. doi:
10.1038/s41571-019-0297-y. PubMed PMID: 31848460; PMCID: PMC7223338.
133
189. Liu X, Jiang S, Fang C, Yang S, Olalere D, Pequignot EC, Cogdill AP, Li N, Ramones M,
Granda B, Zhou L, Loew A, Young RM, June CH, Zhao Y. Affinity-Tuned ErbB2 or EGFR
Chimeric Antigen Receptor T Cells Exhibit an Increased Therapeutic Index against Tumors in
Mice. Cancer Res. 2015;75(17):3596-607. doi: 10.1158/0008-5472.CAN-15-0159. PubMed
PMID: 26330166; PMCID: PMC4560113.
190. Kloss CC, Condomines M, Cartellieri M, Bachmann M, Sadelain M. Combinatorial
antigen recognition with balanced signaling promotes selective tumor eradication by engineered T
cells. Nat Biotechnol. 2013;31(1):71-5. doi: 10.1038/nbt.2459. PubMed PMID: 23242161.
191. Bonini C, Ferrari G, Verzeletti S, Servida P, Zappone E, Ruggieri L, Ponzoni M, Rossini
S, Mavilio F, Traversari C, Bordignon C. HSV-TK gene transfer into donor lymphocytes for
control of allogeneic graft-versus-leukemia. Science. 1997;276(5319):1719-24. PubMed PMID:
9180086.
192. Straathof KC, Pule MA, Yotnda P, Dotti G, Vanin EF, Brenner MK, Heslop HE, Spencer
DM, Rooney CM. An inducible caspase 9 safety switch for T-cell therapy. Blood.
2005;105(11):4247-54. doi: 10.1182/blood-2004-11-4564. PubMed PMID: 15728125; PMCID:
PMC1895037.
193. Di Stasi A, Tey SK, Dotti G, Fujita Y, Kennedy-Nasser A, Martinez C, Straathof K, Liu E,
Durett AG, Grilley B, Liu H, Cruz CR, Savoldo B, Gee AP, Schindler J, Krance RA, Heslop HE,
Spencer DM, Rooney CM, Brenner MK. Inducible apoptosis as a safety switch for adoptive cell
therapy. N Engl J Med. 2011;365(18):1673-83. doi: 10.1056/NEJMoa1106152. PubMed PMID:
22047558; PMCID: PMC3236370.
194. Wang X, Chang WC, Wong CW, Colcher D, Sherman M, Ostberg JR, Forman SJ, Riddell
SR, Jensen MC. A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and
ablation of engineered cells. Blood. 2011;118(5):1255-63. doi: 10.1182/blood-2011-02-337360.
PubMed PMID: 21653320; PMCID: PMC3152493.
195. Fedorov VD, Themeli M, Sadelain M. PD-1- and CTLA-4-based inhibitory chimeric
antigen receptors (iCARs) divert off-target immunotherapy responses. Sci Transl Med.
2013;5(215):215ra172. doi: 10.1126/scitranslmed.3006597. PubMed PMID: 24337479; PMCID:
PMC4238416.
196. Wu CY, Roybal KT, Puchner EM, Onuffer J, Lim WA. Remote control of therapeutic T
cells through a small molecule-gated chimeric receptor. Science. 2015;350(6258):aab4077. doi:
10.1126/science.aab4077. PubMed PMID: 26405231; PMCID: PMC4721629.
197. Huang Z, Wu Y, Allen ME, Pan Y, Kyriakakis P, Lu S, Chang YJ, Wang X, Chien S, Wang
Y. Engineering light-controllable CAR T cells for cancer immunotherapy. Sci Adv.
2020;6(8):eaay9209. Epub 2020/03/05. doi: 10.1126/sciadv.aay9209. PubMed PMID: 32128416;
PMCID: PMC7030928.
198. Mack M, Riethmuller G, Kufer P. A small bispecific antibody construct expressed as a
functional single-chain molecule with high tumor cell cytotoxicity. Proc Natl Acad Sci U S A.
1995;92(15):7021-5. PubMed PMID: 7624362; PMCID: PMC41463.
199. Topp MS, Kufer P, Gokbuget N, Goebeler M, Klinger M, Neumann S, Horst HA, Raff T,
Viardot A, Schmid M, Stelljes M, Schaich M, Degenhard E, Kohne-Volland R, Bruggemann M,
Ottmann O, Pfeifer H, Burmeister T, Nagorsen D, Schmidt M, Lutterbuese R, Reinhardt C,
Baeuerle PA, Kneba M, Einsele H, Riethmuller G, Hoelzer D, Zugmaier G, Bargou RC. Targeted
therapy with the T-cell-engaging antibody blinatumomab of chemotherapy-refractory minimal
residual disease in B-lineage acute lymphoblastic leukemia patients results in high response rate
134
and prolonged leukemia-free survival. J Clin Oncol. 2011;29(18):2493-8. doi:
10.1200/JCO.2010.32.7270. PubMed PMID: 21576633.
200. Urbanska K, Lanitis E, Poussin M, Lynn RC, Gavin BP, Kelderman S, Yu J, Scholler N,
Powell DJ, Jr. A universal strategy for adoptive immunotherapy of cancer through use of a novel
T-cell antigen receptor. Cancer Res. 2012;72(7):1844-52. doi: 10.1158/0008-5472.CAN-11-3890.
PubMed PMID: 22315351; PMCID: PMC3319867.
201. Kershaw MH, Westwood JA, Parker LL, Wang G, Eshhar Z, Mavroukakis SA, White DE,
Wunderlich JR, Canevari S, Rogers-Freezer L, Chen CC, Yang JC, Rosenberg SA, Hwu P. A
phase I study on adoptive immunotherapy using gene-modified T cells for ovarian cancer. Clin
Cancer Res. 2006;12(20 Pt 1):6106-15. Epub 2006/10/26. doi: 10.1158/1078-0432.CCR-06-1183.
PubMed PMID: 17062687; PMCID: PMC2154351.
202. Lamers CH, Willemsen R, van Elzakker P, van Steenbergen-Langeveld S, Broertjes M,
Oosterwijk-Wakka J, Oosterwijk E, Sleijfer S, Debets R, Gratama JW. Immune responses to
transgene and retroviral vector in patients treated with ex vivo-engineered T cells. Blood.
2011;117(1):72-82. doi: 10.1182/blood-2010-07-294520. PubMed PMID: 20889925.
203. Tamada K, Geng D, Sakoda Y, Bansal N, Srivastava R, Li Z, Davila E. Redirecting gene-
modified T cells toward various cancer types using tagged antibodies. Clin Cancer Res.
2012;18(23):6436-45. doi: 10.1158/1078-0432.CCR-12-1449. PubMed PMID: 23032741.
204. Kudo K, Imai C, Lorenzini P, Kamiya T, Kono K, Davidoff AM, Chng WJ, Campana D.
T lymphocytes expressing a CD16 signaling receptor exert antibody-dependent cancer cell killing.
Cancer Res. 2014;74(1):93-103. doi: 10.1158/0008-5472.CAN-13-1365. PubMed PMID:
24197131.
205. Junghans RP, Ma Q, Rathore R, Gomes EM, Bais AJ, Lo AS, Abedi M, Davies RA, Cabral
HJ, Al-Homsi AS, Cohen SI. Phase I trial of anti-PSMA designer CAR-T cells in prostate cancer:
Possible role for interacting interleukin 2-T cell pharmacodynamics as a determinant of clinical
response. Prostate. 2016. doi: 10.1002/pros.23214. PubMed PMID: 27324746.
206. Rodgers DT, Mazagova M, Hampton EN, Cao Y, Ramadoss NS, Hardy IR, Schulman A,
Du J, Wang F, Singer O, Ma J, Nunez V, Shen J, Woods AK, Wright TM, Schultz PG, Kim CH,
Young TS. Switch-mediated activation and retargeting of CAR-T cells for B-cell malignancies.
Proc Natl Acad Sci U S A. 2016;113(4):E459-68. doi: 10.1073/pnas.1524155113. PubMed PMID:
26759369; PMCID: PMC4743815.
207. Liu L, Sommermeyer D, Cabanov A, Kosasih P, Hill T, Riddell SR. Inclusion of Strep-tag
II in design of antigen receptors for T-cell immunotherapy. Nat Biotechnol. 2016;34(4):430-4. doi:
10.1038/nbt.3461. PubMed PMID: 26900664; PMCID: PMC4940167.
208. Desnoyers LR, Vasiljeva O, Richardson JH, Yang A, Menendez EE, Liang TW, Wong C,
Bessette PH, Kamath K, Moore SJ, Sagert JG, Hostetter DR, Han F, Gee J, Flandez J, Markham
K, Nguyen M, Krimm M, Wong KR, Liu S, Daugherty PS, West JW, Lowman HB. Tumor-specific
activation of an EGFR-targeting probody enhances therapeutic index. Sci Transl Med.
2013;5(207):207ra144. doi: 10.1126/scitranslmed.3006682. PubMed PMID: 24132639.
209. Morsut L, Roybal KT, Xiong X, Gordley RM, Coyle SM, Thomson M, Lim WA.
Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors.
Cell. 2016;164(4):780-91. doi: 10.1016/j.cell.2016.01.012. PubMed PMID: 26830878; PMCID:
PMC4752866.
210. Roybal KT, Rupp LJ, Morsut L, Walker WJ, McNally KA, Park JS, Lim WA. Precision
Tumor Recognition by T Cells With Combinatorial Antigen-Sensing Circuits. Cell.
135
2016;164(4):770-9. doi: 10.1016/j.cell.2016.01.011. PubMed PMID: 26830879; PMCID:
PMC4752902.
211. Kunkele A, Johnson AJ, Rolczynski LS, Chang CA, Hoglund V, Kelly-Spratt KS, Jensen
MC. Functional Tuning of CARs Reveals Signaling Threshold above Which CD8+ CTL
Antitumor Potency Is Attenuated due to Cell Fas-FasL-Dependent AICD. Cancer Immunol Res.
2015;3(4):368-79. Epub 2015/01/13. doi: 10.1158/2326-6066.CIR-14-0200. PubMed PMID:
25576337.
212. Abate-Daga D, Lagisetty KH, Tran E, Zheng Z, Gattinoni L, Yu Z, Burns WR, Miermont
AM, Teper Y, Rudloff U, Restifo NP, Feldman SA, Rosenberg SA, Morgan RA. A novel chimeric
antigen receptor against prostate stem cell antigen mediates tumor destruction in a humanized
mouse model of pancreatic cancer. Hum Gene Ther. 2014;25(12):1003-12. Epub 2014/04/04. doi:
10.1089/hum.2013.209. PubMed PMID: 24694017; PMCID: PMC4270113.
213. Yi Z, Prinzing BL, Cao F, Gottschalk S, Krenciute G. Optimizing EphA2-CAR T Cells for
the Adoptive Immunotherapy of Glioma. Mol Ther Methods Clin Dev. 2018;9:70-80. Epub
2018/03/20. doi: 10.1016/j.omtm.2018.01.009. PubMed PMID: 29552579; PMCID:
PMC5852415.
214. Long AH, Haso WM, Shern JF, Wanhainen KM, Murgai M, Ingaramo M, Smith JP,
Walker AJ, Kohler ME, Venkateshwara VR, Kaplan RN, Patterson GH, Fry TJ, Orentas RJ,
Mackall CL. 4-1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of
chimeric antigen receptors. Nat Med. 2015;21(6):581-90. Epub 2015/05/06. doi:
10.1038/nm.3838. PubMed PMID: 25939063; PMCID: PMC4458184.
215. Martinez-Lostao L, Anel A, Pardo J. How Do Cytotoxic Lymphocytes Kill Cancer Cells?
Clin Cancer Res. 2015;21(22):5047-56. Epub 2015/11/15. doi: 10.1158/1078-0432.CCR-15-0685.
PubMed PMID: 26567364.
216. Kagoya Y, Tanaka S, Guo T, Anczurowski M, Wang CH, Saso K, Butler MO, Minden
MD, Hirano N. A novel chimeric antigen receptor containing a JAK-STAT signaling domain
mediates superior antitumor effects. Nat Med. 2018;24(3):352-9. Epub 2018/02/06. doi:
10.1038/nm.4478. PubMed PMID: 29400710; PMCID: PMC5839992.
217. Batlevi CL, Palomba ML, Park J, Mead E, Santomasso B, Riviere I, Wang X, Senechal B,
Furman R, Yang J, Kane P, Hall M, Bernal Y, Lund N, Diamonte C, Pineda J, Halton E,
Moskowitz C, Younes A, Sadelain M, Brentjens R. PHASE I CLINICAL TRIAL OF CD19-
TARGETED 19-28Z/4-1BBL “ARMORED” CAR T CELLS IN PATIENTS WITH RELAPSED
OR REFRACTORY NHL AND CLL INCLUDING RICHTER TRANSFORMATION.
Hematological Oncology. 2019;37(S2):166-7. doi: https://doi.org/10.1002/hon.124_2629.
218. Collinson-Pautz MR, Chang WC, Lu A, Khalil M, Crisostomo JW, Lin PY, Mahendravada
A, Shinners NP, Brandt ME, Zhang M, Duong M, Bayle JH, Slawin KM, Spencer DM, Foster AE.
Constitutively active MyD88/CD40 costimulation enhances expansion and efficacy of chimeric
antigen receptor T cells targeting hematological malignancies. Leukemia. 2019;33(9):2195-207.
Epub 2019/03/01. doi: 10.1038/s41375-019-0417-9. PubMed PMID: 30816327; PMCID:
PMC6756044.
219. Sun C, Shou P, Du H, Hirabayashi K, Chen Y, Herring LE, Ahn S, Xu Y, Suzuki K, Li G,
Tsahouridis O, Su L, Savoldo B, Dotti G. THEMIS-SHP1 Recruitment by 4-1BB Tunes LCK-
Mediated Priming of Chimeric Antigen Receptor-Redirected T Cells. Cancer Cell.
2020;37(2):216-25 e6. Epub 2020/02/01. doi: 10.1016/j.ccell.2019.12.014. PubMed PMID:
32004441.
136
220. Lai Y, Weng J, Wei X, Qin L, Lai P, Zhao R, Jiang Z, Li B, Lin S, Wang S, Wu Q, Tang
Z, Liu P, Pei D, Yao Y, Du X, Li P. Toll-like receptor 2 costimulation potentiates the antitumor
efficacy of CAR T Cells. Leukemia. 2018;32(3):801-8. Epub 2017/08/26. doi:
10.1038/leu.2017.249. PubMed PMID: 28841215.
221. Youngblood B, Davis CW, Ahmed R. Making memories that last a lifetime: heritable
functions of self-renewing memory CD8 T cells. Int Immunol. 2010;22(10):797-803. Epub
2010/08/25. doi: 10.1093/intimm/dxq437. PubMed PMID: 20732857; PMCID: PMC2946216.
222. Wherry EJ, Kurachi M. Molecular and cellular insights into T cell exhaustion. Nature
Reviews Immunology. 2015;15(8):486-99. doi: 10.1038/nri3862.
223. Eyquem J, Mansilla-Soto J, Giavridis T, van der Stegen SJ, Hamieh M, Cunanan KM,
Odak A, Gonen M, Sadelain M. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances
tumour rejection. Nature. 2017;543(7643):113-7. Epub 2017/02/23. doi: 10.1038/nature21405.
PubMed PMID: 28225754; PMCID: PMC5558614.
224. Feucht J, Sun J, Eyquem J, Ho YJ, Zhao Z, Leibold J, Dobrin A, Cabriolu A, Hamieh M,
Sadelain M. Calibration of CAR activation potential directs alternative T cell fates and therapeutic
potency. Nat Med. 2018. Epub 2018/12/19. doi: 10.1038/s41591-018-0290-5. PubMed PMID:
30559421.
225. Harada Y, Ohgai D, Watanabe R, Okano K, Koiwai O, Tanabe K, Toma H, Altman A, Abe
R. A single amino acid alteration in cytoplasmic domain determines IL-2 promoter activation by
ligation of CD28 but not inducible costimulator (ICOS). J Exp Med. 2003;197(2):257-62. Epub
2003/01/23. doi: 10.1084/jem.20021305. PubMed PMID: 12538664; PMCID: PMC2193818.
226. Guedan S, Madar A, Casado-Medrano V, Shaw C, Wing A, Liu F, Young RM, June CH,
Posey AD, Jr. Single residue in CD28-costimulated CAR-T cells limits long-term persistence and
antitumor durability. J Clin Invest. 2020;130(6):3087-97. Epub 2020/02/19. doi:
10.1172/JCI133215. PubMed PMID: 32069268; PMCID: PMC7260017.
227. Martinez GJ, Pereira RM, Aijo T, Kim EY, Marangoni F, Pipkin ME, Togher S,
Heissmeyer V, Zhang YC, Crotty S, Lamperti ED, Ansel KM, Mempel TR, Lahdesmaki H, Hogan
PG, Rao A. The transcription factor NFAT promotes exhaustion of activated CD8(+) T cells.
Immunity. 2015;42(2):265-78. Epub 2015/02/15. doi: 10.1016/j.immuni.2015.01.006. PubMed
PMID: 25680272; PMCID: PMC4346317.
228. Scott-Browne JP, Lopez-Moyado IF, Trifari S, Wong V, Chavez L, Rao A, Pereira RM.
Dynamic Changes in Chromatin Accessibility Occur in CD8(+) T Cells Responding to Viral
Infection. Immunity. 2016;45(6):1327-40. Epub 2016/12/13. doi: 10.1016/j.immuni.2016.10.028.
PubMed PMID: 27939672; PMCID: PMC5214519.
229. Ghorashian S, Kramer AM, Onuoha S, Wright G, Bartram J, Richardson R, Albon SJ,
Casanovas-Company J, Castro F, Popova B, Villanueva K, Yeung J, Vetharoy W, Guvenel A,
Wawrzyniecka PA, Mekkaoui L, Cheung GW, Pinner D, Chu J, Lucchini G, Silva J, Ciocarlie O,
Lazareva A, Inglott S, Gilmour KC, Ahsan G, Ferrari M, Manzoor S, Champion K, Brooks T,
Lopes A, Hackshaw A, Farzaneh F, Chiesa R, Rao K, Bonney D, Samarasinghe S, Goulden N,
Vora A, Veys P, Hough R, Wynn R, Pule MA, Amrolia PJ. Enhanced CAR T cell expansion and
prolonged persistence in pediatric patients with ALL treated with a low-affinity CD19 CAR. Nat
Med. 2019;25(9):1408-14. Epub 2019/09/04. doi: 10.1038/s41591-019-0549-5. PubMed PMID:
31477906.
230. Raab M, Rudd CE. Hematopoietic cell phosphatase (HCP) regulates p56LCK
phosphorylation and ZAP-70 binding to T cell receptor zeta chain. Biochem Biophys Res
137
Commun. 1996;222(1):50-7. Epub 1996/05/06. doi: 10.1006/bbrc.1996.0696. PubMed PMID:
8630073.
231. Chiang GG, Sefton BM. Specific dephosphorylation of the Lck tyrosine protein kinase at
Tyr-394 by the SHP-1 protein-tyrosine phosphatase. J Biol Chem. 2001;276(25):23173-8. Epub
2001/04/11. doi: 10.1074/jbc.M101219200. PubMed PMID: 11294838.
232. Wu W, Zhou Q, Masubuchi T, Shi X, Li H, Xu X, Huang M, Meng L, He X, Zhu H, Gao
S, Zhang N, Jing R, Sun J, Wang H, Hui E, Wong CC, Xu C. Multiple Signaling Roles of
CD3epsilon and Its Application in CAR-T Cell Therapy. Cell. 2020. Epub 2020/07/31. doi:
10.1016/j.cell.2020.07.018. PubMed PMID: 32730808.
233. Weber EW, Parker KR, Sotillo E, Lynn RC, Anbunathan H, Lattin J, Good Z, Belk JA,
Daniel B, Klysz D, Malipatlolla M, Xu P, Bashti M, Heitzeneder S, Labanieh L, Vandris P,
Majzner RG, Qi Y, Sandor K, Chen L-C, Prabhu S, Gentles AJ, Wandless TJ, Satpathy AT, Chang
HY, Mackall CL. Transient rest restores functionality in exhausted CAR-T cells through
epigenetic remodeling. Science (New York, NY). 2021;372(6537). doi: 10.1126/science.aba1786.
PubMed PMID: 33795428.
234. Wiede F, Lu KH, Du X, Liang S, Hochheiser K, Dodd GT, Goh PK, Kearney C, Meyran
D, Beavis PA, Henderson MA, Park SL, Waithman J, Zhang S, Zhang ZY, Oliaro J, Gebhardt T,
Darcy PK, Tiganis T. PTPN2 phosphatase deletion in T cells promotes anti-tumour immunity and
CAR T-cell efficacy in solid tumours. EMBO J. 2019:e103637. Epub 2019/12/06. doi:
10.15252/embj.2019103637. PubMed PMID: 31803974.
235. Flosbach M, Oberle SG, Scherer S, Zecha J, von Hoesslin M, Wiede F, Chennupati V,
Cullen JG, List M, Pauling JK, Baumbach J, Kuster B, Tiganis T, Zehn D. PTPN2 Deficiency
Enhances Programmed T Cell Expansion and Survival Capacity of Activated T Cells. Cell Rep.
2020;32(4):107957. Epub 2020/07/30. doi: 10.1016/j.celrep.2020.107957. PubMed PMID:
32726622; PMCID: PMC7408006.
236. Lynn RC, Weber EW, Sotillo E, Gennert D, Xu P, Good Z, Anbunathan H, Lattin J, Jones
R, Tieu V, Nagaraja S, Granja J, de Bourcy CFA, Majzner R, Satpathy AT, Quake SR, Monje M,
Chang HY, Mackall CL. c-Jun overexpression in CAR T cells induces exhaustion resistance.
Nature. 2019;576(7786):293-300. Epub 2019/12/06. doi: 10.1038/s41586-019-1805-z. PubMed
PMID: 31802004.
237. Kuhn NF, Purdon TJ, van Leeuwen DG, Lopez AV, Curran KJ, Daniyan AF, Brentjens
RJ. CD40 Ligand-Modified Chimeric Antigen Receptor T Cells Enhance Antitumor Function by
Eliciting an Endogenous Antitumor Response. Cancer Cell. 2019;35(3):473-88 e6. Epub
2019/03/20. doi: 10.1016/j.ccell.2019.02.006. PubMed PMID: 30889381.
238. Ding ZC, Shi H, Aboelella NS, Fesenkova K, Park EJ, Liu Z, Pei L, Li J, McIndoe RA, Xu
H, Piazza GA, Blazar BR, Munn DH, Zhou G. Persistent STAT5 activation reprograms the
epigenetic landscape in CD4(+) T cells to drive polyfunctionality and antitumor immunity. Sci
Immunol. 2020;5(52). Epub 2020/11/01. doi: 10.1126/sciimmunol.aba5962. PubMed PMID:
33127608.
239. Li W, Qiu S, Chen J, Jiang S, Chen W, Jiang J, Wang F, Si W, Shu Y, Wei P, Fan G, Tian
R, Wu H, Xu C, Wang H. Chimeric Antigen Receptor Designed to Prevent Ubiquitination and
Downregulation Showed Durable Antitumor Efficacy. Immunity. 2020. Epub 2020/08/08. doi:
10.1016/j.immuni.2020.07.011. PubMed PMID: 32758419.
240. Jin L, Tao H, Karachi A, Long Y, Hou AY, Na M, Dyson KA, Grippin AJ, Deleyrolle LP,
Zhang W, Rajon DA, Wang QJ, Yang JC, Kresak JL, Sayour EJ, Rahman M, Bova FJ, Lin Z,
Mitchell DA, Huang J. CXCR1- or CXCR2-modified CAR T cells co-opt IL-8 for maximal
138
antitumor efficacy in solid tumors. Nat Commun. 2019;10(1):4016. Epub 2019/09/07. doi:
10.1038/s41467-019-11869-4. PubMed PMID: 31488817; PMCID: PMC6728370.
241. Adachi K, Kano Y, Nagai T, Okuyama N, Sakoda Y, Tamada K. IL-7 and CCL19
expression in CAR-T cells improves immune cell infiltration and CAR-T cell survival in the tumor.
Nat Biotechnol. 2018;36(4):346-51. Epub 2018/03/06. doi: 10.1038/nbt.4086. PubMed PMID:
29505028.
242. Shum T, Omer B, Tashiro H, Kruse RL, Wagner DL, Parikh K, Yi Z, Sauer T, Liu D,
Parihar R, Castillo P, Liu H, Brenner MK, Metelitsa LS, Gottschalk S, Rooney CM. Constitutive
Signaling from an Engineered IL7 Receptor Promotes Durable Tumor Elimination by Tumor-
Redirected T Cells. Cancer Discov. 2017;7(11):1238-47. Epub 2017/08/24. doi: 10.1158/2159-
8290.CD-17-0538. PubMed PMID: 28830878; PMCID: PMC5669830.
243. McAndrew D, Grice DM, Peters AA, Davis FM, Stewart T, Rice M, Smart CE, Brown
MA, Kenny PA, Roberts-Thomson SJ, Monteith GR. ORAI1-mediated calcium influx in lactation
and in breast cancer. Mol Cancer Ther. 2011;10(3):448-60. doi: 10.1158/1535-7163.MCT-10-
0923. PubMed PMID: 21224390.
244. Sukumaran S, Watanabe N, Bajgain P, Raja K, Mohammed S, Fisher WE, Brenner MK,
Leen AM, Vera JF. Enhancing the Potency and Specificity of Engineered T Cells for Cancer
Treatment. Cancer Discovery. 2018;8(8):972-87. doi: 10.1158/2159-8290.Cd-17-1298. PubMed
PMID: WOS:000440825900025.
245. Alizadeh D, Wong RA, Yang X, Wang D, Pecoraro JR, Kuo CF, Aguilar B, Qi Y, Ann
DK, Starr R, Urak R, Wang X, Forman SJ, Brown CE. IL15 Enhances CAR-T Cell Antitumor
Activity by Reducing mTORC1 Activity and Preserving Their Stem Cell Memory Phenotype.
Cancer Immunol Res. 2019;7(5):759-72. Epub 2019/03/21. doi: 10.1158/2326-6066.CIR-18-
0466. PubMed PMID: 30890531; PMCID: PMC6687561.
246. Fu W, Lei C, Liu S, Cui Y, Wang C, Qian K, Li T, Shen Y, Fan X, Lin F, Ding M, Pan M,
Ye X, Yang Y, Hu S. CAR exosomes derived from effector CAR-T cells have potent antitumour
effects and low toxicity. Nat Commun. 2019;10(1):4355. Epub 2019/09/27. doi: 10.1038/s41467-
019-12321-3. PubMed PMID: 31554797; PMCID: PMC6761190.
247. Liu Y, Liu G, Wang J, Zheng ZY, Jia L, Rui W, Huang D, Zhou ZX, Zhou L, Wu X, Lin
S, Zhao X, Lin X. Chimeric STAR receptors using TCR machinery mediate robust responses
against solid tumors. Sci Transl Med. 2021;13(586). Epub 2021/03/26. doi:
10.1126/scitranslmed.abb5191. PubMed PMID: 33762437.
248. Rafiq S, Yeku OO, Jackson HJ, Purdon TJ, van Leeuwen DG, Drakes DJ, Song M, Miele
MM, Li Z, Wang P, Yan S, Xiang J, Ma X, Seshan VE, Hendrickson RC, Liu C, Brentjens RJ.
Targeted delivery of a PD-1-blocking scFv by CAR-T cells enhances anti-tumor efficacy in vivo.
Nat Biotechnol. 2018;36(9):847-56. Epub 2018/08/14. doi: 10.1038/nbt.4195. PubMed PMID:
30102295; PMCID: PMC6126939.
249. John LB, Devaud C, Duong CP, Yong CS, Beavis PA, Haynes NM, Chow MT, Smyth MJ,
Kershaw MH, Darcy PK. Anti-PD-1 antibody therapy potently enhances the eradication of
established tumors by gene-modified T cells. Clin Cancer Res. 2013;19(20):5636-46. Epub
2013/07/23. doi: 10.1158/1078-0432.CCR-13-0458. PubMed PMID: 23873688.
250. Huang B, Luo L, Wang J, He B, Feng R, Xian N, Zhang Q, Chen L, Huang G. B7-H3
specific T cells with chimeric antigen receptor and decoy PD-1 receptors eradicate established
solid human tumors in mouse models. Oncoimmunology. 2020;9(1):1684127. Epub 2020/02/01.
doi: 10.1080/2162402X.2019.1684127. PubMed PMID: 32002297; PMCID: PMC6959446.
139
251. Rupp LJ, Schumann K, Roybal KT, Gate RE, Ye CJ, Lim WA, Marson A. CRISPR/Cas9-
mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T
cells. Sci Rep. 2017;7(1):737. Epub 2017/04/09. doi: 10.1038/s41598-017-00462-8. PubMed
PMID: 28389661; PMCID: PMC5428439.
252. Zou F, Lu L, Liu J, Xia B, Zhang W, Hu Q, Liu W, Zhang Y, Lin Y, Jing S, Huang M,
Huang B, Liu B, Zhang H. Engineered triple inhibitory receptor resistance improves anti-tumor
CAR-T cell performance via CD56. Nat Commun. 2019;10(1):4109. Epub 2019/09/13. doi:
10.1038/s41467-019-11893-4. PubMed PMID: 31511513; PMCID: PMC6739330.
253. Odorizzi PM, Pauken KE, Paley MA, Sharpe A, Wherry EJ. Genetic absence of PD-1
promotes accumulation of terminally differentiated exhausted CD8+ T cells. J Exp Med.
2015;212(7):1125-37. Epub 2015/06/03. doi: 10.1084/jem.20142237. PubMed PMID: 26034050;
PMCID: PMC4493417.
254. Xie YJ, Dougan M, Jailkhani N, Ingram J, Fang T, Kummer L, Momin N, Pishesha N,
Rickelt S, Hynes RO, Ploegh H. Nanobody-based CAR T cells that target the tumor
microenvironment inhibit the growth of solid tumors in immunocompetent mice. Proc Natl Acad
Sci U S A. 2019;116(16):7624-31. Epub 2019/04/03. doi: 10.1073/pnas.1817147116. PubMed
PMID: 30936321; PMCID: PMC6475367.
255. Tanoue K, Rosewell Shaw A, Watanabe N, Porter C, Rana B, Gottschalk S, Brenner M,
Suzuki M. Armed Oncolytic Adenovirus-Expressing PD-L1 Mini-Body Enhances Antitumor
Effects of Chimeric Antigen Receptor T Cells in Solid Tumors. Cancer Res. 2017;77(8):2040-51.
Epub 2017/02/27. doi: 10.1158/0008-5472.CAN-16-1577. PubMed PMID: 28235763; PMCID:
PMC5392365.
256. Suarez ER, Chang de K, Sun J, Sui J, Freeman GJ, Signoretti S, Zhu Q, Marasco WA.
Chimeric antigen receptor T cells secreting anti-PD-L1 antibodies more effectively regress renal
cell carcinoma in a humanized mouse model. Oncotarget. 2016;7(23):34341-55. Epub 2016/05/05.
doi: 10.18632/oncotarget.9114. PubMed PMID: 27145284; PMCID: PMC5085160.
257. Yin Y, Boesteanu AC, Binder ZA, Xu C, Reid RA, Rodriguez JL, Cook DR, Thokala R,
Blouch K, McGettigan-Croce B, Zhang L, Konradt C, Cogdill AP, Panjwani MK, Jiang S,
Migliorini D, Dahmane N, Posey AD, Jr., June CH, Mason NJ, Lin Z, O'Rourke DM, Johnson LA.
Checkpoint Blockade Reverses Anergy in IL-13Ralpha2 Humanized scFv-Based CAR T Cells to
Treat Murine and Canine Gliomas. Mol Ther Oncolytics. 2018;11:20-38. Epub 2018/10/12. doi:
10.1016/j.omto.2018.08.002. PubMed PMID: 30306125; PMCID: PMC6174845.
258. Ren J, Zhang X, Liu X, Fang C, Jiang S, June CH, Zhao Y. A versatile system for rapid
multiplex genome-edited CAR T cell generation. Oncotarget. 2017;8(10):17002-11. Epub
2017/02/16. doi: 10.18632/oncotarget.15218. PubMed PMID: 28199983; PMCID: PMC5370017.
259. Yazdanifar M, Zhou R, Grover P, Williams C, Bose M, Moore LJ, Wu ST, Maher J, Dreau
D, Mukherjee AP. Overcoming Immunological Resistance Enhances the Efficacy of A Novel
Anti-tMUC1-CAR T Cell Treatment against Pancreatic Ductal Adenocarcinoma. Cells. 2019;8(9).
Epub 2019/09/14. doi: 10.3390/cells8091070. PubMed PMID: 31514488; PMCID: PMC6770201.
260. Hoogi S, Eisenberg V, Mayer S, Shamul A, Barliya T, Cohen CJ. A TIGIT-based chimeric
co-stimulatory switch receptor improves T-cell anti-tumor function. J Immunother Cancer.
2019;7(1):243. Epub 2019/09/11. doi: 10.1186/s40425-019-0721-y. PubMed PMID: 31500665;
PMCID: PMC6734436.
261. Chong EA, Melenhorst JJ, Lacey SF, Ambrose DE, Gonzalez V, Levine BL, June CH,
Schuster SJ. PD-1 blockade modulates chimeric antigen receptor (CAR)-modified T cells:
140
refueling the CAR. Blood. 2017;129(8):1039-41. Epub 2016/12/30. doi: 10.1182/blood-2016-09-
738245. PubMed PMID: 28031179; PMCID: PMC5391777.
262. Chmielewski M, Abken H. CAR T Cells Releasing IL-18 Convert to T-Bet(high)
FoxO1(low) Effectors that Exhibit Augmented Activity against Advanced Solid Tumors. Cell Rep.
2017;21(11):3205-19. Epub 2017/12/16. doi: 10.1016/j.celrep.2017.11.063. PubMed PMID:
29241547.
263. Seo H, Chen J, Gonzalez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, Lopez-
Moyado IF, Georges RO, Zhang W, Onodera A, Wu CJ, Lu LF, Hogan PG, Bhandoola A, Rao A.
TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8(+)
T cell exhaustion. Proc Natl Acad Sci U S A. 2019;116(25):12410-5. Epub 2019/06/04. doi:
10.1073/pnas.1905675116. PubMed PMID: 31152140; PMCID: PMC6589758.
264. Chen J, Lopez-Moyado IF, Seo H, Lio CJ, Hempleman LJ, Sekiya T, Yoshimura A, Scott-
Browne JP, Rao A. NR4A transcription factors limit CAR T cell function in solid tumours. Nature.
2019;567(7749):530-4. Epub 2019/03/01. doi: 10.1038/s41586-019-0985-x. PubMed PMID:
30814732; PMCID: PMC6546093.
265. Batra SA, Rathi P, Guo L, Courtney AN, Fleurence J, Balzeau J, Shaik RS, Nguyen TP,
Wu MF, Bulsara S, Mamonkin M, Metelitsa LS, Heczey A. Glypican-3-Specific CAR T Cells
Coexpressing IL15 and IL21 Have Superior Expansion and Antitumor Activity against
Hepatocellular Carcinoma. Cancer Immunol Res. 2020;8(3):309-20. Epub 2020/01/19. doi:
10.1158/2326-6066.CIR-19-0293. PubMed PMID: 31953246.
266. Zheng W, O'Hear CE, Alli R, Basham JH, Abdelsamed HA, Palmer LE, Jones LL,
Youngblood B, Geiger TL. PI3K orchestration of the in vivo persistence of chimeric antigen
receptor-modified T cells. Leukemia. 2018;32(5):1157-67. Epub 2018/02/27. doi:
10.1038/s41375-017-0008-6. PubMed PMID: 29479065; PMCID: PMC5943191.
267. Bowers JS, Majchrzak K, Nelson MH, Aksoy BA, Wyatt MM, Smith AS, Bailey SR, Neal
LR, Hammerbacher JE, Paulos CM. PI3Kdelta Inhibition Enhances the Antitumor Fitness of
Adoptively Transferred CD8(+) T Cells. Front Immunol. 2017;8:1221. Epub 2017/10/17. doi:
10.3389/fimmu.2017.01221. PubMed PMID: 29033940; PMCID: PMC5626814.
268. Klebanoff CA, Crompton JG, Leonardi AJ, Yamamoto TN, Chandran SS, Eil RL, Sukumar
M, Vodnala SK, Hu J, Ji Y, Clever D, Black MA, Gurusamy D, Kruhlak MJ, Jin P, Stroncek DF,
Gattinoni L, Feldman SA, Restifo NP. Inhibition of AKT signaling uncouples T cell differentiation
from expansion for receptor-engineered adoptive immunotherapy. JCI Insight. 2017;2(23). Epub
2017/12/08. doi: 10.1172/jci.insight.95103. PubMed PMID: 29212954; PMCID: PMC5752304.
269. Wiede F, Lu KH, Du X, Liang S, Hochheiser K, Dodd GT, Goh PK, Kearney C, Meyran
D, Beavis PA, Henderson MA, Park SL, Waithman J, Zhang S, Zhang ZY, Oliaro J, Gebhardt T,
Darcy PK, Tiganis T. PTPN2 phosphatase deletion in T cells promotes anti-tumour immunity and
CAR T-cell efficacy in solid tumours. EMBO J. 2020;39(2):e103637. Epub 2019/12/06. doi:
10.15252/embj.2019103637. PubMed PMID: 31803974; PMCID: PMC6960448.
270. Cui J, Wang H, Medina R, Zhang Q, Xu C, Indig IH, Zhou J, Song Q, Dmitriev P, Sun
MY, Guo L, Wang Y, Rosenblum JS, Kovach JS, Gilbert MR, Zhuang Z. Inhibition of PP2A with
LB-100 Enhances Efficacy of CAR-T Cell Therapy Against Glioblastoma. Cancers (Basel).
2020;12(1). Epub 2020/01/16. doi: 10.3390/cancers12010139. PubMed PMID: 31935881;
PMCID: PMC7017120.
271. Masoumi E, Jafarzadeh L, Mirzaei HR, Alishah K, Fallah-Mehrjardi K, Rostamian H,
Khakpoor-Koosheh M, Meshkani R, Noorbakhsh F, Hadjati J. Genetic and pharmacological
targeting of A2a receptor improves function of anti-mesothelin CAR T cells. J Exp Clin Cancer
141
Res. 2020;39(1):49. Epub 2020/03/11. doi: 10.1186/s13046-020-01546-6. PubMed PMID:
32151275; PMCID: PMC7063771.
272. Beavis PA, Henderson MA, Giuffrida L, Mills JK, Sek K, Cross RS, Davenport AJ, John
LB, Mardiana S, Slaney CY, Johnstone RW, Trapani JA, Stagg J, Loi S, Kats L, Gyorki D,
Kershaw MH, Darcy PK. Targeting the adenosine 2A receptor enhances chimeric antigen receptor
T cell efficacy. J Clin Invest. 2017;127(3):929-41. Epub 2017/02/07. doi: 10.1172/JCI89455.
PubMed PMID: 28165340; PMCID: PMC5330718.
273. Newick K, O'Brien S, Sun J, Kapoor V, Maceyko S, Lo A, Pure E, Moon E, Albelda SM.
Augmentation of CAR T-cell Trafficking and Antitumor Efficacy by Blocking Protein Kinase A
Localization. Cancer Immunol Res. 2016;4(6):541-51. Epub 2016/04/06. doi: 10.1158/2326-
6066.CIR-15-0263. PubMed PMID: 27045023; PMCID: PMC4891259.
274. Hou AJ, Chang ZL, Lorenzini MH, Zah E, Chen YY. TGF-beta-responsive CAR-T cells
promote anti-tumor immune function. Bioeng Transl Med. 2018;3(2):75-86. Epub 2018/08/02.
doi: 10.1002/btm2.10097. PubMed PMID: 30065964; PMCID: PMC6063867.
275. Hartley J, Abken H. Chimeric antigen receptors designed to overcome transforming growth
factor-beta-mediated repression in the adoptive T-cell therapy of solid tumors. Clin Transl
Immunology. 2019;8(6):e1064. Epub 2019/06/27. doi: 10.1002/cti2.1064. PubMed PMID:
31236274; PMCID: PMC6589154.
276. Tang N, Cheng C, Zhang X, Qiao M, Li N, Mu W, Wei XF, Han W, Wang H. TGF-beta
inhibition via CRISPR promotes the long-term efficacy of CAR T cells against solid tumors. JCI
Insight. 2020;5(4). Epub 2020/01/31. doi: 10.1172/jci.insight.133977. PubMed PMID: 31999649;
PMCID: PMC7101140.
277. Stuber T, Monjezi R, Wallstabe L, Kuhnemundt J, Nietzer SL, Dandekar G, Wockel A,
Einsele H, Wischhusen J, Hudecek M. Inhibition of TGF-beta-receptor signaling augments the
antitumor function of ROR1-specific CAR T-cells against triple-negative breast cancer. J
Immunother Cancer. 2020;8(1). Epub 2020/04/19. doi: 10.1136/jitc-2020-000676. PubMed
PMID: 32303620; PMCID: PMC7204619.
278. Morgan MA, Schambach A. Engineering CAR-T Cells for Improved Function Against
Solid Tumors. Front Immunol. 2018;9:2493. Epub 2018/11/14. doi: 10.3389/fimmu.2018.02493.
PubMed PMID: 30420856; PMCID: PMC6217729.
279. Li Y, Xiao F, Zhang A, Zhang D, Nie W, Xu T, Han B, Seth P, Wang H, Yang Y, Wang
L. Oncolytic adenovirus targeting TGF-beta enhances anti-tumor responses of mesothelin-targeted
chimeric antigen receptor T cell therapy against breast cancer. Cell Immunol. 2020;348:104041.
Epub 2020/01/28. doi: 10.1016/j.cellimm.2020.104041. PubMed PMID: 31983398.
280. Golumba-Nagy V, Kuehle J, Hombach AA, Abken H. CD28-zeta CAR T Cells Resist
TGF-beta Repression through IL-2 Signaling, Which Can Be Mimicked by an Engineered IL-7
Autocrine Loop. Mol Ther. 2018;26(9):2218-30. Epub 2018/07/30. doi:
10.1016/j.ymthe.2018.07.005. PubMed PMID: 30055872; PMCID: PMC6127517.
281. Boyerinas B, Miller SM, Murray RC, Evans JW, Parsons GB, Seidl KJ, Friedman KM,
Morgan RA. A Novel TGF-β2/Interleukin Receptor Signal Conversion Platform That Protects
CAR/TCR T Cells from TGF-β2-Mediated Immune Suppression and Induces T Cell Supportive
Signaling Networks. Blood. 2017;130(Supplement 1):1911-. doi:
10.1182/blood.V130.Suppl_1.1911.1911.
282. Bai Y, Kan S, Zhou S, Wang Y, Xu J, Cooke JP, Wen J, Deng H. Enhancement of the in
vivo persistence and antitumor efficacy of CD19 chimeric antigen receptor T cells through the
142
delivery of modified TERT mRNA. Cell Discov. 2015;1:15040. Epub 2015/01/01. doi:
10.1038/celldisc.2015.40. PubMed PMID: 27462436; PMCID: PMC4860832.
283. Ligtenberg MA, Mougiakakos D, Mukhopadhyay M, Witt K, Lladser A, Chmielewski M,
Riet T, Abken H, Kiessling R. Coexpressed Catalase Protects Chimeric Antigen Receptor-
Redirected T Cells as well as Bystander Cells from Oxidative Stress-Induced Loss of Antitumor
Activity. J Immunol. 2016;196(2):759-66. Epub 2015/12/18. doi: 10.4049/jimmunol.1401710.
PubMed PMID: 26673145; PMCID: PMC4705591.
284. Weiner LM, Dhodapkar MV, Ferrone S. Monoclonal antibodies for cancer
immunotherapy. Lancet. 2009;373(9668):1033-40. Epub 2009/03/24. doi: 10.1016/S0140-
6736(09)60251-8. PubMed PMID: 19304016; PMCID: PMC2677705.
285. Ma S, Li X, Wang X, Cheng L, Li Z, Zhang C, Ye Z, Qian Q. Current Progress in CAR-T
Cell Therapy for Solid Tumors. Int J Biol Sci. 2019;15(12):2548-60. Epub 2019/11/23. doi:
10.7150/ijbs.34213. PubMed PMID: 31754328; PMCID: PMC6854376.
286. Sterner RC, Sterner RM. CAR-T cell therapy: current limitations and potential strategies.
Blood Cancer J. 2021;11(4):69. Epub 2021/04/08. doi: 10.1038/s41408-021-00459-7. PubMed
PMID: 33824268; PMCID: PMC8024391.
287. Martinez M, Moon EK. CAR T Cells for Solid Tumors: New Strategies for Finding,
Infiltrating, and Surviving in the Tumor Microenvironment. Front Immunol. 2019;10:128. Epub
2019/02/26. doi: 10.3389/fimmu.2019.00128. PubMed PMID: 30804938; PMCID: PMC6370640.
288. Xu Y, Salazar GT, Zhang N, An Z. T-cell receptor mimic (TCRm) antibody therapeutics
against intracellular proteins. Antib Ther. 2019;2(1):22-32. Epub 2019/01/21. doi:
10.1093/abt/tbz001. PubMed PMID: 33928218; PMCID: PMC7990144.
289. Han J, Chu J, Keung Chan W, Zhang J, Wang Y, Cohen JB, Victor A, Meisen WH, Kim
SH, Grandi P, Wang QE, He X, Nakano I, Chiocca EA, Glorioso JC, 3rd, Kaur B, Caligiuri MA,
Yu J. CAR-Engineered NK Cells Targeting Wild-Type EGFR and EGFRvIII Enhance Killing of
Glioblastoma and Patient-Derived Glioblastoma Stem Cells. Sci Rep. 2015;5:11483. doi:
10.1038/srep11483. PubMed PMID: 26155832; PMCID: PMC4496728.
290. Odunsi K, Matsuzaki J, James SR, Mhawech-Fauceglia P, Tsuji T, Miller A, Zhang W,
Akers SN, Griffiths EA, Miliotto A, Beck A, Batt CA, Ritter G, Lele S, Gnjatic S, Karpf AR.
Epigenetic potentiation of NY-ESO-1 vaccine therapy in human ovarian cancer. Cancer Immunol
Res. 2014;2(1):37-49. Epub 2014/02/19. doi: 10.1158/2326-6066.CIR-13-0126. PubMed PMID:
24535937; PMCID: PMC3925074.
291. Le Gal FA, Ayyoub M, Dutoit V, Widmer V, Jager E, Cerottini JC, Dietrich PY, Valmori
D. Distinct structural TCR repertoires in naturally occurring versus vaccine-induced CD8+ T-cell
responses to the tumor-specific antigen NY-ESO-1. J Immunother. 2005;28(3):252-7. Epub
2005/04/20. PubMed PMID: 15838382.
292. Sahin U, Derhovanessian E, Miller M, Kloke BP, Simon P, Lower M, Bukur V, Tadmor
AD, Luxemburger U, Schrors B, Omokoko T, Vormehr M, Albrecht C, Paruzynski A, Kuhn AN,
Buck J, Heesch S, Schreeb KH, Muller F, Ortseifer I, Vogler I, Godehardt E, Attig S, Rae R,
Breitkreuz A, Tolliver C, Suchan M, Martic G, Hohberger A, Sorn P, Diekmann J, Ciesla J,
Waksmann O, Bruck AK, Witt M, Zillgen M, Rothermel A, Kasemann B, Langer D, Bolte S,
Diken M, Kreiter S, Nemecek R, Gebhardt C, Grabbe S, Holler C, Utikal J, Huber C, Loquai C,
Tureci O. Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity
against cancer. Nature. 2017;547(7662):222-6. Epub 2017/07/06. doi: 10.1038/nature23003.
PubMed PMID: 28678784.
143
293. Ott PA, Hu Z, Keskin DB, Shukla SA, Sun J, Bozym DJ, Zhang W, Luoma A, Giobbie-
Hurder A, Peter L, Chen C, Olive O, Carter TA, Li S, Lieb DJ, Eisenhaure T, Gjini E, Stevens J,
Lane WJ, Javeri I, Nellaiappan K, Salazar AM, Daley H, Seaman M, Buchbinder EI, Yoon CH,
Harden M, Lennon N, Gabriel S, Rodig SJ, Barouch DH, Aster JC, Getz G, Wucherpfennig K,
Neuberg D, Ritz J, Lander ES, Fritsch EF, Hacohen N, Wu CJ. An immunogenic personal
neoantigen vaccine for patients with melanoma. Nature. 2017;547(7662):217-21. Epub
2017/07/06. doi: 10.1038/nature22991. PubMed PMID: 28678778; PMCID: PMC5577644.
294. Rapoport AP, Stadtmauer EA, Binder-Scholl GK, Goloubeva O, Vogl DT, Lacey SF,
Badros AZ, Garfall A, Weiss B, Finklestein J, Kulikovskaya I, Sinha SK, Kronsberg S, Gupta M,
Bond S, Melchiori L, Brewer JE, Bennett AD, Gerry AB, Pumphrey NJ, Williams D, Tayton-
Martin HK, Ribeiro L, Holdich T, Yanovich S, Hardy N, Yared J, Kerr N, Philip S, Westphal S,
Siegel DL, Levine BL, Jakobsen BK, Kalos M, June CH. NY-ESO-1-specific TCR-engineered T
cells mediate sustained antigen-specific antitumor effects in myeloma. Nat Med. 2015;21(8):914-
21. Epub 2015/07/21. doi: 10.1038/nm.3910. PubMed PMID: 26193344; PMCID: PMC4529359.
295. Veomett N, Dao T, Scheinberg DA. Therapeutic antibodies to intracellular targets in cancer
therapy. Expert Opin Biol Ther. 2013;13(11):1485-8. Epub 2013/09/03. doi:
10.1517/14712598.2013.833602. PubMed PMID: 23991764.
296. Lowe DB, Bivens CK, Mobley AS, Herrera CE, McCormick AL, Wichner T, Sabnani MK,
Wood LM, Weidanz JA. TCR-like antibody drug conjugates mediate killing of tumor cells with
low peptide/HLA targets. MAbs. 2017;9(4):603-14. Epub 2017/03/09. doi:
10.1080/19420862.2017.1302630. PubMed PMID: 28273004; PMCID: PMC5419083.
297. Lai J, Wang Y, Wu SS, Ding D, Sun ZY, Zhang Y, Zhou J, Zhou Z, Xu YC, Pan LQ, Chen
SQ. Elimination of melanoma by sortase A-generated TCR-like antibody-drug conjugates (TL-
ADCs) targeting intracellular melanoma antigen MART-1. Biomaterials. 2018;178:158-69. Epub
2018/06/23. doi: 10.1016/j.biomaterials.2018.06.017. PubMed PMID: 29933102.
298. Ku Z, Xie X, Davidson E, Ye X, Su H, Menachery VD, Li Y, Yuan Z, Zhang X, Muruato
AE, AG IE, Tyrell B, Doolan K, Doranz BJ, Wrapp D, Bates PF, McLellan JS, Weiss SR, Zhang
N, Shi PY, An Z. Molecular determinants and mechanism for antibody cocktail preventing SARS-
CoV-2 escape. Nat Commun. 2021;12(1):469. Epub 2021/01/22. doi: 10.1038/s41467-020-20789-
7. PubMed PMID: 33473140; PMCID: PMC7817669.
299. Sugita Y, Wada H, Fujita S, Nakata T, Sato S, Noguchi Y, Jungbluth AA, Yamaguchi M,
Chen YT, Stockert E, Gnjatic S, Williamson B, Scanlan MJ, Ono T, Sakita I, Yasui M, Miyoshi
Y, Tamaki Y, Matsuura N, Noguchi S, Old LJ, Nakayama E, Monden M. NY-ESO-1 expression
and immunogenicity in malignant and benign breast tumors. Cancer Res. 2004;64(6):2199-204.
Epub 2004/03/18. PubMed PMID: 15026363.
300. Gnjatic S, Nishikawa H, Jungbluth AA, Gure AO, Ritter G, Jager E, Knuth A, Chen YT,
Old LJ. NY-ESO-1: review of an immunogenic tumor antigen. Adv Cancer Res. 2006;95:1-30.
Epub 2006/07/25. doi: 10.1016/S0065-230X(06)95001-5. PubMed PMID: 16860654.
301. Holler PD, Chlewicki LK, Kranz DM. TCRs with high affinity for foreign pMHC show
self-reactivity. Nat Immunol. 2003;4(1):55-62. Epub 2002/12/07. doi: 10.1038/ni863. PubMed
PMID: 12469116.
302. Weber KS, Donermeyer DL, Allen PM, Kranz DM. Class II-restricted T cell receptor
engineered in vitro for higher affinity retains peptide specificity and function. Proc Natl Acad Sci
U S A. 2005;102(52):19033-8. Epub 2005/12/21. doi: 10.1073/pnas.0507554102. PubMed PMID:
16365315; PMCID: PMC1323173.
144
303. Zhao Y, Bennett AD, Zheng Z, Wang QJ, Robbins PF, Yu LY, Li Y, Molloy PE, Dunn
SM, Jakobsen BK, Rosenberg SA, Morgan RA. High-affinity TCRs generated by phage display
provide CD4+ T cells with the ability to recognize and kill tumor cell lines. J Immunol.
2007;179(9):5845-54. Epub 2007/10/20. PubMed PMID: 17947658; PMCID: PMC2140228.
304. Li Y, Moysey R, Molloy PE, Vuidepot AL, Mahon T, Baston E, Dunn S, Liddy N, Jacob
J, Jakobsen BK, Boulter JM. Directed evolution of human T-cell receptors with picomolar
affinities by phage display. Nat Biotechnol. 2005;23(3):349-54. Epub 2005/02/22. doi:
10.1038/nbt1070. PubMed PMID: 15723046.
305. Thomas R, Al-Khadairi G, Roelands J, Hendrickx W, Dermime S, Bedognetti D, Decock
J. NY-ESO-1 Based Immunotherapy of Cancer: Current Perspectives. Front Immunol. 2018;9:947.
Epub 2018/05/18. doi: 10.3389/fimmu.2018.00947. PubMed PMID: 29770138; PMCID:
PMC5941317.
306. Dhodapkar MV, Sznol M, Zhao B, Wang D, Carvajal RD, Keohan ML, Chuang E, Sanborn
RE, Lutzky J, Powderly J, Kluger H, Tejwani S, Green J, Ramakrishna V, Crocker A, Vitale L,
Yellin M, Davis T, Keler T. Induction of antigen-specific immunity with a vaccine targeting NY-
ESO-1 to the dendritic cell receptor DEC-205. Sci Transl Med. 2014;6(232):232ra51. Epub
2014/04/18. doi: 10.1126/scitranslmed.3008068. PubMed PMID: 24739759; PMCID:
PMC6151129.
307. Craig L. Slingluff HMZ, Michael A. Postow, Philip Adam Friedlander, Craig E. Devoe,
Kelly Smith, Donna Deacon, Mary J. Macri, Aileen Ryan, Ralph Rudolph Venhaus, Jedd D.
Wolchok Phase 1 study of NY-ESO-1 vaccine + ipilimumab (IPI) in patients with unresectable or
metastatic melanoma. Journal of clinical oncology. 2018.
308. Gross G, Waks T, Eshhar Z. Expression of immunoglobulin-T-cell receptor chimeric
molecules as functional receptors with antibody-type specificity. Proc Natl Acad Sci U S A.
1989;86(24):10024-8. Epub 1989/12/01. PubMed PMID: 2513569; PMCID: PMC298636.
309. Eshhar Z, Waks T, Gross G, Schindler DG. Specific activation and targeting of cytotoxic
lymphocytes through chimeric single chains consisting of antibody-binding domains and the
gamma or zeta subunits of the immunoglobulin and T-cell receptors. Proc Natl Acad Sci U S A.
1993;90(2):720-4. Epub 1993/01/15. PubMed PMID: 8421711; PMCID: PMC45737.
310. Kuwana Y, Asakura Y, Utsunomiya N, Nakanishi M, Arata Y, Itoh S, Nagase F, Kurosawa
Y. Expression of chimeric receptor composed of immunoglobulin-derived V regions and T-cell
receptor-derived C regions. Biochem Biophys Res Commun. 1987;149(3):960-8. Epub
1987/12/31. PubMed PMID: 3122749.
311. Brentjens RJ, Davila ML, Riviere I, Park J, Wang X, Cowell LG, Bartido S, Stefanski J,
Taylor C, Olszewska M, Borquez-Ojeda O, Qu J, Wasielewska T, He Q, Bernal Y, Rijo IV, Hedvat
C, Kobos R, Curran K, Steinherz P, Jurcic J, Rosenblat T, Maslak P, Frattini M, Sadelain M.
CD19-targeted T cells rapidly induce molecular remissions in adults with chemotherapy-refractory
acute lymphoblastic leukemia. Sci Transl Med. 2013;5(177):177ra38. Epub 2013/03/22. doi:
10.1126/scitranslmed.3005930. PubMed PMID: 23515080; PMCID: PMC3742551.
312. Park JH, Riviere I, Gonen M, Wang X, Senechal B, Curran KJ, Sauter C, Wang Y,
Santomasso B, Mead E, Roshal M, Maslak P, Davila M, Brentjens RJ, Sadelain M. Long-Term
Follow-up of CD19 CAR Therapy in Acute Lymphoblastic Leukemia. N Engl J Med.
2018;378(5):449-59. Epub 2018/02/01. doi: 10.1056/NEJMoa1709919. PubMed PMID:
29385376.
313. Neelapu SS, Locke FL, Bartlett NL, Lekakis LJ, Miklos DB, Jacobson CA, Braunschweig
I, Oluwole OO, Siddiqi T, Lin Y, Timmerman JM, Stiff PJ, Friedberg JW, Flinn IW, Goy A, Hill
145
BT, Smith MR, Deol A, Farooq U, McSweeney P, Munoz J, Avivi I, Castro JE, Westin JR, Chavez
JC, Ghobadi A, Komanduri KV, Levy R, Jacobsen ED, Witzig TE, Reagan P, Bot A, Rossi J,
Navale L, Jiang Y, Aycock J, Elias M, Chang D, Wiezorek J, Go WY. Axicabtagene Ciloleucel
CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N Engl J Med. 2017;377(26):2531-
44. Epub 2017/12/12. doi: 10.1056/NEJMoa1707447. PubMed PMID: 29226797; PMCID:
PMC5882485.
314. Locke FL, Neelapu SS, Bartlett NL, Siddiqi T, Chavez JC, Hosing CM, Ghobadi A, Budde
LE, Bot A, Rossi JM, Jiang Y, Xue AX, Elias M, Aycock J, Wiezorek J, Go WY. Phase 1 Results
of ZUMA-1: A Multicenter Study of KTE-C19 Anti-CD19 CAR T Cell Therapy in Refractory
Aggressive Lymphoma. Mol Ther. 2017;25(1):285-95. Epub 2017/01/28. doi:
10.1016/j.ymthe.2016.10.020. PubMed PMID: 28129122; PMCID: PMC5363293.
315. Sadelain M. CD19 CAR T Cells. Cell. 2017;171(7):1471. Epub 2017/12/16. doi:
10.1016/j.cell.2017.12.002. PubMed PMID: 29245005.
316. Ahmed N, Brawley VS, Hegde M, Robertson C, Ghazi A, Gerken C, Liu E, Dakhova O,
Ashoori A, Corder A, Gray T, Wu MF, Liu H, Hicks J, Rainusso N, Dotti G, Mei Z, Grilley B,
Gee A, Rooney CM, Brenner MK, Heslop HE, Wels WS, Wang LL, Anderson P, Gottschalk S.
Human Epidermal Growth Factor Receptor 2 (HER2) -Specific Chimeric Antigen Receptor-
Modified T Cells for the Immunotherapy of HER2-Positive Sarcoma. J Clin Oncol.
2015;33(15):1688-96. Epub 2015/03/25. doi: 10.1200/JCO.2014.58.0225. PubMed PMID:
25800760; PMCID: PMC4429176.
317. Acuto O, Michel F. CD28-mediated co-stimulation: a quantitative support for TCR
signalling. Nat Rev Immunol. 2003;3(12):939-51. Epub 2003/12/04. doi: 10.1038/nri1248.
PubMed PMID: 14647476.
318. Reinhard K, Rengstl B, Oehm P, Michel K, Billmeier A, Hayduk N, Klein O, Kuna K,
Ouchan Y, Woll S, Christ E, Weber D, Suchan M, Bukur T, Birtel M, Jahndel V, Mroz K, Hobohm
K, Kranz L, Diken M, Kuhlcke K, Tureci O, Sahin U. An RNA vaccine drives expansion and
efficacy of claudin-CAR-T cells against solid tumors. Science. 2020. Epub 2020/01/04. doi:
10.1126/science.aay5967. PubMed PMID: 31896660.
319. Alarcon B, Gil D, Delgado P, Schamel WW. Initiation of TCR signaling: regulation within
CD3 dimers. Immunol Rev. 2003;191:38-46. Epub 2003/03/05. PubMed PMID: 12614350.
320. Chakraborty AK, Weiss A. Insights into the initiation of TCR signaling. Nat Immunol.
2014;15(9):798-807. Epub 2014/08/20. doi: 10.1038/ni.2940. PubMed PMID: 25137454; PMCID:
PMC5226627.
321. Wang H, Kadlecek TA, Au-Yeung BB, Goodfellow HE, Hsu LY, Freedman TS, Weiss A.
ZAP-70: an essential kinase in T-cell signaling. Cold Spring Harb Perspect Biol.
2010;2(5):a002279. Epub 2010/05/11. doi: 10.1101/cshperspect.a002279. PubMed PMID:
20452964; PMCID: PMC2857167.
322. Balagopalan L, Coussens NP, Sherman E, Samelson LE, Sommers CL. The LAT story: a
tale of cooperativity, coordination, and choreography. Cold Spring Harb Perspect Biol.
2010;2(8):a005512. Epub 2010/07/09. doi: 10.1101/cshperspect.a005512. PubMed PMID:
20610546; PMCID: PMC2908767.
323. Liu X, Ranganathan R, Jiang S, Fang C, Sun J, Kim S, Newick K, Lo A, June CH, Zhao
Y, Moon EK. A Chimeric Switch-Receptor Targeting PD1 Augments the Efficacy of Second-
Generation CAR T Cells in Advanced Solid Tumors. Cancer Res. 2016;76(6):1578-90. Epub
2016/03/17. doi: 10.1158/0008-5472.CAN-15-2524. PubMed PMID: 26979791; PMCID:
PMC4800826.
146
324. de Jong JL, Farner NL, Widmer MB, Giri JG, Sondel PM. Interaction of IL-15 with the
shared IL-2 receptor beta and gamma c subunits. The IL-15/beta/gamma c receptor-ligand complex
is less stable than the IL-2/beta/gamma c receptor-ligand complex. J Immunol. 1996;156(4):1339-
48. Epub 1996/02/15. PubMed PMID: 8568232.
325. Turtle CJ, Hanafi LA, Berger C, Gooley TA, Cherian S, Hudecek M, Sommermeyer D,
Melville K, Pender B, Budiarto TM, Robinson E, Steevens NN, Chaney C, Soma L, Chen X,
Yeung C, Wood B, Li D, Cao J, Heimfeld S, Jensen MC, Riddell SR, Maloney DG. CD19 CAR-
T cells of defined CD4+:CD8+ composition in adult B cell ALL patients. J Clin Invest.
2016;126(6):2123-38. Epub 2016/04/26. doi: 10.1172/JCI85309. PubMed PMID: 27111235;
PMCID: PMC4887159.
326. Jiang Q, Li WQ, Hofmeister RR, Young HA, Hodge DR, Keller JR, Khaled AR, Durum
SK. Distinct regions of the interleukin-7 receptor regulate different Bcl2 family members. Mol
Cell Biol. 2004;24(14):6501-13. Epub 2004/07/01. doi: 10.1128/MCB.24.14.6501-6513.2004.
PubMed PMID: 15226449; PMCID: PMC434255.
327. Helsen CW, Hammill JA, Lau VWC, Mwawasi KA, Afsahi A, Bezverbnaya K, Newhook
L, Hayes DL, Aarts C, Bojovic B, Denisova GF, Kwiecien JM, Brain I, Derocher H, Milne K,
Nelson BH, Bramson JL. The chimeric TAC receptor co-opts the T cell receptor yielding robust
anti-tumor activity without toxicity. Nat Commun. 2018;9(1):3049. Epub 2018/08/05. doi:
10.1038/s41467-018-05395-y. PubMed PMID: 30076299; PMCID: PMC6076291.
328. Xu Y, Yang Z, Horan LH, Zhang P, Liu L, Zimdahl B, Green S, Lu J, Morales JF, Barrett
DM, Grupp SA, Chan VW, Liu H, Liu C. A novel antibody-TCR (AbTCR) platform combines
Fab-based antigen recognition with gamma/delta-TCR signaling to facilitate T-cell cytotoxicity
with low cytokine release. Cell Discov. 2018;4:62. Epub 2018/11/28. doi: 10.1038/s41421-018-
0066-6. PubMed PMID: 30479831; PMCID: PMC6242878 are employees of and have equity
ownership and/or stock options in Eureka Therapeutics, Inc. S.A.G. is a scientific advisor to
Eureka Therapeutics with stock options in the company. D.M.B. is a consultant to Eureka
Therapeutics. Other associations: S.A.G. has received research and/or clinical trial support from
Novartis, Servier and Kite. He consults for, has participated in ad boards, or serves on study
steering committees or scientific advisory boards for the following companies: Novartis,
Adaptimmune, TCR2, Juno, GlaxoSmithKline, Cellectis, Vertex, Roche and Janssen. He is listed
on a patent related to toxicity management in cell therapy managed by University of Pennsylvania
and CHOP policies.
329. Alajez NM, Schmielau J, Alter MD, Cascio M, Finn OJ. Therapeutic potential of a tumor-
specific, MHC-unrestricted T-cell receptor expressed on effector cells of the innate and the
adaptive immune system through bone marrow transduction and immune reconstitution. Blood.
2005;105(12):4583-9. Epub 2005/03/05. doi: 10.1182/blood-2004-10-3848. PubMed PMID:
15746083; PMCID: PMC1894994.
330. Xu C, Call ME, Wucherpfennig KW. A membrane-proximal tetracysteine motif
contributes to assembly of CD3deltaepsilon and CD3gammaepsilon dimers with the T cell
receptor. J Biol Chem. 2006;281(48):36977-84. Epub 2006/10/07. doi: 10.1074/jbc.M607164200.
PubMed PMID: 17023417; PMCID: PMC4515964.
331. Kuhns MS, Davis MM. Disruption of extracellular interactions impairs T cell receptor-
CD3 complex stability and signaling. Immunity. 2007;26(3):357-69. Epub 2007/03/21. doi:
10.1016/j.immuni.2007.01.015. PubMed PMID: 17368054.
332. Savoldo B, Ramos CA, Liu E, Mims MP, Keating MJ, Carrum G, Kamble RT, Bollard
CM, Gee AP, Mei Z, Liu H, Grilley B, Rooney CM, Heslop HE, Brenner MK, Dotti G. CD28
147
costimulation improves expansion and persistence of chimeric antigen receptor-modified T cells
in lymphoma patients. J Clin Invest. 2011;121(5):1822-6. doi: 10.1172/JCI46110. PubMed PMID:
21540550; PMCID: PMC3083795.
333. Haso W, Lee DW, Shah NN, Stetler-Stevenson M, Yuan CM, Pastan IH, Dimitrov DS,
Morgan RA, FitzGerald DJ, Barrett DM, Wayne AS, Mackall CL, Orentas RJ. Anti-CD22-
chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia. Blood.
2013;121(7):1165-74. doi: 10.1182/blood-2012-06-438002. PubMed PMID: 23243285; PMCID:
PMC3575759.
334. Lanitis E, Poussin M, Hagemann IS, Coukos G, Sandaltzopoulos R, Scholler N, Powell
DJ, Jr. Redirected antitumor activity of primary human lymphocytes transduced with a fully human
anti-mesothelin chimeric receptor. Mol Ther. 2012;20(3):633-43. doi: 10.1038/mt.2011.256.
PubMed PMID: 22127019; PMCID: PMC3293635.
335. Ma Q, Gomes EM, Lo AS, Junghans RP. Advanced generation anti-prostate specific
membrane antigen designer T cells for prostate cancer immunotherapy. Prostate. 2014;74(3):286-
96. doi: 10.1002/pros.22749. PubMed PMID: 24174378.
336. Zuccolotto G, Fracasso G, Merlo A, Montagner IM, Rondina M, Bobisse S, Figini M,
Cingarlini S, Colombatti M, Zanovello P, Rosato A. PSMA-specific CAR-engineered T cells
eradicate disseminated prostate cancer in preclinical models. PLoS One. 2014;9(10):e109427. doi:
10.1371/journal.pone.0109427. PubMed PMID: 25279468; PMCID: PMC4184866.
337. Beatty GL, Haas AR, Maus MV, Torigian DA, Soulen MC, Plesa G, Chew A, Zhao Y,
Levine BL, Albelda SM, Kalos M, June CH. Mesothelin-specific chimeric antigen receptor
mRNA-engineered T cells induce anti-tumor activity in solid malignancies. Cancer Immunol Res.
2014;2(2):112-20. doi: 10.1158/2326-6066.CIR-13-0170. PubMed PMID: 24579088; PMCID:
PMC3932715.
338. Morello A, Sadelain M, Adusumilli PS. Mesothelin-Targeted CARs: Driving T Cells to
Solid Tumors. Cancer Discov. 2016;6(2):133-46. doi: 10.1158/2159-8290.CD-15-0583. PubMed
PMID: 26503962; PMCID: PMC4744527.
339. Adusumilli PS, Cherkassky L, Villena-Vargas J, Colovos C, Servais E, Plotkin J, Jones
DR, Sadelain M. Regional delivery of mesothelin-targeted CAR T cell therapy generates potent
and long-lasting CD4-dependent tumor immunity. Sci Transl Med. 2014;6(261):261ra151. doi:
10.1126/scitranslmed.3010162. PubMed PMID: 25378643; PMCID: PMC4373413.
340. Wang LC, Lo A, Scholler J, Sun J, Majumdar RS, Kapoor V, Antzis M, Cotner CE,
Johnson LA, Durham AC, Solomides CC, June CH, Pure E, Albelda SM. Targeting fibroblast
activation protein in tumor stroma with chimeric antigen receptor T cells can inhibit tumor growth
and augment host immunity without severe toxicity. Cancer Immunol Res. 2014;2(2):154-66. doi:
10.1158/2326-6066.CIR-13-0027. PubMed PMID: 24778279; PMCID: PMC4007316.
341. Tran E, Chinnasamy D, Yu Z, Morgan RA, Lee CC, Restifo NP, Rosenberg SA. Immune
targeting of fibroblast activation protein triggers recognition of multipotent bone marrow stromal
cells and cachexia. J Exp Med. 2013;210(6):1125-35. doi: 10.1084/jem.20130110. PubMed
PMID: 23712432; PMCID: PMC3674706.
342. Schuberth PC, Hagedorn C, Jensen SM, Gulati P, van den Broek M, Mischo A, Soltermann
A, Jungel A, Marroquin Belaunzaran O, Stahel R, Renner C, Petrausch U. Treatment of malignant
pleural mesothelioma by fibroblast activation protein-specific re-directed T cells. J Transl Med.
2013;11:187. doi: 10.1186/1479-5876-11-187. PubMed PMID: 23937772; PMCID:
PMC3751305.
148
343. Kakarla S, Chow KK, Mata M, Shaffer DR, Song XT, Wu MF, Liu H, Wang LL, Rowley
DR, Pfizenmaier K, Gottschalk S. Antitumor effects of chimeric receptor engineered human T
cells directed to tumor stroma. Mol Ther. 2013;21(8):1611-20. doi: 10.1038/mt.2013.110. PubMed
PMID: 23732988; PMCID: PMC3734659.
344. Johnson LA, Scholler J, Ohkuri T, Kosaka A, Patel PR, McGettigan SE, Nace AK,
Dentchev T, Thekkat P, Loew A, Boesteanu AC, Cogdill AP, Chen T, Fraietta JA, Kloss CC,
Posey AD, Jr., Engels B, Singh R, Ezell T, Idamakanti N, Ramones MH, Li N, Zhou L, Plesa G,
Seykora JT, Okada H, June CH, Brogdon JL, Maus MV. Rational development and
characterization of humanized anti-EGFR variant III chimeric antigen receptor T cells for
glioblastoma. Sci Transl Med. 2015;7(275):275ra22. doi: 10.1126/scitranslmed.aaa4963. PubMed
PMID: 25696001; PMCID: PMC4467166.
345. Morgan RA, Johnson LA, Davis JL, Zheng Z, Woolard KD, Reap EA, Feldman SA,
Chinnasamy N, Kuan CT, Song H, Zhang W, Fine HA, Rosenberg SA. Recognition of glioma
stem cells by genetically modified T cells targeting EGFRvIII and development of adoptive cell
therapy for glioma. Hum Gene Ther. 2012;23(10):1043-53. doi: 10.1089/hum.2012.041. PubMed
PMID: 22780919; PMCID: PMC3472555.
346. Caruso HG, Hurton LV, Najjar A, Rushworth D, Ang S, Olivares S, Mi T, Switzer K, Singh
H, Huls H, Lee DA, Heimberger AB, Champlin RE, Cooper LJ. Tuning Sensitivity of CAR to
EGFR Density Limits Recognition of Normal Tissue While Maintaining Potent Antitumor
Activity. Cancer Res. 2015;75(17):3505-18. doi: 10.1158/0008-5472.CAN-15-0139. PubMed
PMID: 26330164; PMCID: PMC4624228.
347. Zhou X, Li J, Wang Z, Chen Z, Qiu J, Zhang Y, Wang W, Ma Y, Huang N, Cui K, Li J,
Wei YQ. Cellular immunotherapy for carcinoma using genetically modified EGFR-specific T
lymphocytes. Neoplasia. 2013;15(5):544-53. PubMed PMID: 23633926; PMCID: PMC3638357.
348. Shi H, Moriceau G, Kong X, Lee MK, Lee H, Koya RC, Ng C, Chodon T, Scolyer RA,
Dahlman KB, Sosman JA, Kefford RF, Long GV, Nelson SF, Ribas A, Lo RS. Melanoma whole-
exome sequencing identifies (V600E)B-RAF amplification-mediated acquired B-RAF inhibitor
resistance. Nat Commun. 2012;3:724. Epub 2012/03/08. doi: 10.1038/ncomms1727. PubMed
PMID: 22395615; PMCID: PMC3530385.
349. Parkhurst MR, Yang JC, Langan RC, Dudley ME, Nathan DA, Feldman SA, Davis JL,
Morgan RA, Merino MJ, Sherry RM, Hughes MS, Kammula US, Phan GQ, Lim RM, Wank SA,
Restifo NP, Robbins PF, Laurencot CM, Rosenberg SA. T cells targeting carcinoembryonic
antigen can mediate regression of metastatic colorectal cancer but induce severe transient colitis.
Mol Ther. 2011;19(3):620-6. doi: 10.1038/mt.2010.272. PubMed PMID: 21157437; PMCID:
PMC3048186.
350. Chmielewski M, Hahn O, Rappl G, Nowak M, Schmidt-Wolf IH, Hombach AA, Abken
H. T cells that target carcinoembryonic antigen eradicate orthotopic pancreatic carcinomas without
inducing autoimmune colitis in mice. Gastroenterology. 2012;143(4):1095-107 e2. doi:
10.1053/j.gastro.2012.06.037. PubMed PMID: 22750462.
351. Katz SC, Burga RA, McCormack E, Wang LJ, Mooring W, Point GR, Khare PD, Thorn
M, Ma Q, Stainken BF, Assanah EO, Davies R, Espat NJ, Junghans RP. Phase I Hepatic
Immunotherapy for Metastases Study of Intra-Arterial Chimeric Antigen Receptor-Modified T-
cell Therapy for CEA+ Liver Metastases. Clin Cancer Res. 2015;21(14):3149-59. doi:
10.1158/1078-0432.CCR-14-1421. PubMed PMID: 25850950; PMCID: PMC4506253.
352. Kunkele A, Taraseviciute A, Finn LS, Johnson AJ, Berger C, Finney O, Chang CA,
Rolczynski LS, Brown C, Mgebroff S, Berger M, Park JR, Jensen MC. Preclinical Assessment of
149
CD171-Directed CAR T Cell Adoptive Therapy For Childhood Neuroblastoma: CE7 Epitope
Target Safety and Product Manufacturing Feasibility. Clin Cancer Res. 2016. doi: 10.1158/1078-
0432.CCR-16-0354. PubMed PMID: 27390347.
353. Louis CU, Savoldo B, Dotti G, Pule M, Yvon E, Myers GD, Rossig C, Russell HV, Diouf
O, Liu E, Liu H, Wu MF, Gee AP, Mei Z, Rooney CM, Heslop HE, Brenner MK. Antitumor
activity and long-term fate of chimeric antigen receptor-positive T cells in patients with
neuroblastoma. Blood. 2011;118(23):6050-6. doi: 10.1182/blood-2011-05-354449. PubMed
PMID: 21984804; PMCID: PMC3234664.
354. Gargett T, Brown MP. Different cytokine and stimulation conditions influence the
expansion and immune phenotype of third-generation chimeric antigen receptor T cells specific
for tumor antigen GD2. Cytotherapy. 2015;17(4):487-95. doi: 10.1016/j.jcyt.2014.12.002.
PubMed PMID: 25573334.
355. Gao H, Li K, Tu H, Pan X, Jiang H, Shi B, Kong J, Wang H, Yang S, Gu J, Li Z.
Development of T cells redirected to glypican-3 for the treatment of hepatocellular carcinoma.
Clin Cancer Res. 2014;20(24):6418-28. doi: 10.1158/1078-0432.CCR-14-1170. PubMed PMID:
25320357.
356. Li K, Pan X, Bi Y, Xu W, Chen C, Gao H, Shi B, Jiang H, Yang S, Jiang L, Li Z. Adoptive
immunotherapy using T lymphocytes redirected to glypican-3 for the treatment of lung squamous
cell carcinoma. Oncotarget. 2016;7(3):2496-507. doi: 10.18632/oncotarget.6595. PubMed PMID:
26684028; PMCID: PMC4823050.
357. Brown CE, Badie B, Barish ME, Weng L, Ostberg JR, Chang WC, Naranjo A, Starr R,
Wagner J, Wright C, Zhai Y, Bading JR, Ressler JA, Portnow J, D'Apuzzo M, Forman SJ, Jensen
MC. Bioactivity and Safety of IL13Ralpha2-Redirected Chimeric Antigen Receptor CD8+ T Cells
in Patients with Recurrent Glioblastoma. Clin Cancer Res. 2015;21(18):4062-72. doi:
10.1158/1078-0432.CCR-15-0428. PubMed PMID: 26059190; PMCID: PMC4632968.
358. Kong S, Sengupta S, Tyler B, Bais AJ, Ma Q, Doucette S, Zhou J, Sahin A, Carter BS,
Brem H, Junghans RP, Sampath P. Suppression of human glioma xenografts with second-
generation IL13R-specific chimeric antigen receptor-modified T cells. Clin Cancer Res.
2012;18(21):5949-60. doi: 10.1158/1078-0432.CCR-12-0319. PubMed PMID: 22966020;
PMCID: PMC4337849.
359. Krenciute G, Krebs S, Torres D, Wu MF, Liu H, Dotti G, Li XN, Lesniak MS,
Balyasnikova IV, Gottschalk S. Characterization and Functional Analysis of scFv-based Chimeric
Antigen Receptors to Redirect T Cells to IL13Ralpha2-positive Glioma. Mol Ther.
2016;24(2):354-63. doi: 10.1038/mt.2015.199. PubMed PMID: 26514825; PMCID:
PMC4817815.
360. Posey AD, Jr., Schwab RD, Boesteanu AC, Steentoft C, Mandel U, Engels B, Stone JD,
Madsen TD, Schreiber K, Haines KM, Cogdill AP, Chen TJ, Song D, Scholler J, Kranz DM,
Feldman MD, Young R, Keith B, Schreiber H, Clausen H, Johnson LA, June CH. Engineered
CAR T Cells Targeting the Cancer-Associated Tn-Glycoform of the Membrane Mucin MUC1
Control Adenocarcinoma. Immunity. 2016;44(6):1444-54. doi: 10.1016/j.immuni.2016.05.014.
PubMed PMID: 27332733.
361. Carbone DP, Reck M, Paz-Ares L, Creelan B, Horn L, Steins M, Felip E, van den Heuvel
MM, Ciuleanu TE, Badin F, Ready N, Hiltermann TJN, Nair S, Juergens R, Peters S, Minenza E,
Wrangle JM, Rodriguez-Abreu D, Borghaei H, Blumenschein GR, Jr., Villaruz LC, Havel L,
Krejci J, Corral Jaime J, Chang H, Geese WJ, Bhagavatheeswaran P, Chen AC, Socinski MA,
CheckMate I. First-Line Nivolumab in Stage IV or Recurrent Non-Small-Cell Lung Cancer. N
150
Engl J Med. 2017;376(25):2415-26. Epub 2017/06/22. doi: 10.1056/NEJMoa1613493. PubMed
PMID: 28636851; PMCID: PMC6487310.
362. Reck M, Rodriguez-Abreu D, Robinson AG, Hui R, Csoszi T, Fulop A, Gottfried M, Peled
N, Tafreshi A, Cuffe S, O'Brien M, Rao S, Hotta K, Leiby MA, Lubiniecki GM, Shentu Y,
Rangwala R, Brahmer JR, Investigators K-. Pembrolizumab versus Chemotherapy for PD-L1-
Positive Non-Small-Cell Lung Cancer. N Engl J Med. 2016;375(19):1823-33. Epub 2016/10/11.
doi: 10.1056/NEJMoa1606774. PubMed PMID: 27718847.
363. Vedvyas Y, McCloskey JE, Yang Y, Min IM, Fahey TJ, Zarnegar R, Hsu YS, Hsu JM,
Van Besien K, Gaudet I, Law P, Kim NJ, Hofe EV, Jin MM. Manufacturing and preclinical
validation of CAR T cells targeting ICAM-1 for advanced thyroid cancer therapy. Sci Rep.
2019;9(1):10634. Epub 2019/07/25. doi: 10.1038/s41598-019-46938-7. PubMed PMID:
31337787; PMCID: PMC6650612.
364. Chanmee T, Ontong P, Konno K, Itano N. Tumor-associated macrophages as major players
in the tumor microenvironment. Cancers (Basel). 2014;6(3):1670-90. doi:
10.3390/cancers6031670. PubMed PMID: 25125485; PMCID: PMC4190561.
365. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T
lymphocytes with distinct homing potentials and effector functions. Nature. 1999;401(6754):708-
12. doi: 10.1038/44385. PubMed PMID: 10537110.
366. Xu Y, Zhang M, Ramos CA, Durett A, Liu E, Dakhova O, Liu H, Creighton CJ, Gee AP,
Heslop HE, Rooney CM, Savoldo B, Dotti G. Closely related T-memory stem cells correlate with
in vivo expansion of CAR.CD19-T cells and are preserved by IL-7 and IL-15. Blood.
2014;123(24):3750-9. doi: 10.1182/blood-2014-01-552174. PubMed PMID: 24782509; PMCID:
PMC4055922.
367. Enblad G, Karlsson H, Loskog AS. CAR T-Cell Therapy: The Role of Physical Barriers
and Immunosuppression in Lymphoma. Hum Gene Ther. 2015;26(8):498-505. doi:
10.1089/hum.2015.054. PubMed PMID: 26230974; PMCID: PMC4554546.
368. Newick K, Moon E, Albelda SM. Chimeric antigen receptor T-cell therapy for solid
tumors. Mol Ther Oncolytics. 2016;3:16006. doi: 10.1038/mto.2016.6. PubMed PMID: 27162934;
PMCID: PMC4849432.
369. Moon EK, Wang LC, Dolfi DV, Wilson CB, Ranganathan R, Sun J, Kapoor V, Scholler J,
Pure E, Milone MC, June CH, Riley JL, Wherry EJ, Albelda SM. Multifactorial T-cell
hypofunction that is reversible can limit the efficacy of chimeric antigen receptor-transduced
human T cells in solid tumors. Clin Cancer Res. 2014;20(16):4262-73. doi: 10.1158/1078-
0432.CCR-13-2627. PubMed PMID: 24919573; PMCID: PMC4134701.
370. Moon EK, Ranganathan R, Eruslanov E, Kim S, Newick K, O'Brien S, Lo A, Liu X, Zhao
Y, Albelda SM. Blockade of Programmed Death 1 Augments the Ability of Human T Cells
Engineered to Target NY-ESO-1 to Control Tumor Growth after Adoptive Transfer. Clin Cancer
Res. 2016;22(2):436-47. doi: 10.1158/1078-0432.CCR-15-1070. PubMed PMID: 26324743;
PMCID: PMC4715990.
371. Kobold S, Grassmann S, Chaloupka M, Lampert C, Wenk S, Kraus F, Rapp M, Duwell P,
Zeng Y, Schmollinger JC, Schnurr M, Endres S, Rothenfusser S. Impact of a New Fusion Receptor
on PD-1-Mediated Immunosuppression in Adoptive T Cell Therapy. J Natl Cancer Inst.
2015;107(8). doi: 10.1093/jnci/djv146. PubMed PMID: 26105028; PMCID: PMC4609553.
372. Mahvi DA, Meyers JV, Tatar AJ, Contreras A, Suresh M, Leverson GE, Sen S, Cho CS.
Ctla-4 blockade plus adoptive T-cell transfer promotes optimal melanoma immunity in mice. J
151
Immunother. 2015;38(2):54-61. doi: 10.1097/CJI.0000000000000064. PubMed PMID:
25658614; PMCID: PMC4321765.
373. Sotillo E, Barrett DM, Black KL, Bagashev A, Oldridge D, Wu G, Sussman R, Lanauze
C, Ruella M, Gazzara MR, Martinez NM, Harrington CT, Chung EY, Perazzelli J, Hofmann TJ,
Maude SL, Raman P, Barrera A, Gill S, Lacey SF, Melenhorst JJ, Allman D, Jacoby E, Fry T,
Mackall C, Barash Y, Lynch KW, Maris JM, Grupp SA, Thomas-Tikhonenko A. Convergence of
Acquired Mutations and Alternative Splicing of CD19 Enables Resistance to CART-19
Immunotherapy. Cancer Discov. 2015;5(12):1282-95. Epub 2015/11/01. doi: 10.1158/2159-
8290.CD-15-1020. PubMed PMID: 26516065; PMCID: PMC4670800.
374. Zaretsky JM, Garcia-Diaz A, Shin DS, Escuin-Ordinas H, Hugo W, Hu-Lieskovan S,
Torrejon DY, Abril-Rodriguez G, Sandoval S, Barthly L, Saco J, Homet Moreno B, Mezzadra R,
Chmielowski B, Ruchalski K, Shintaku IP, Sanchez PJ, Puig-Saus C, Cherry G, Seja E, Kong X,
Pang J, Berent-Maoz B, Comin-Anduix B, Graeber TG, Tumeh PC, Schumacher TN, Lo RS, Ribas
A. Mutations Associated with Acquired Resistance to PD-1 Blockade in Melanoma. N Engl J Med.
2016. doi: 10.1056/NEJMoa1604958. PubMed PMID: 27433843.
375. Guedan S, Chen X, Madar A, Carpenito C, McGettigan SE, Frigault MJ, Lee J, Posey AD,
Jr., Scholler J, Scholler N, Bonneau R, June CH. ICOS-based chimeric antigen receptors program
bipolar TH17/TH1 cells. Blood. 2014;124(7):1070-80. doi: 10.1182/blood-2013-10-535245.
PubMed PMID: 24986688; PMCID: PMC4133482.
376. Song DG, Ye Q, Poussin M, Harms GM, Figini M, Powell DJ, Jr. CD27 costimulation
augments the survival and antitumor activity of redirected human T cells in vivo. Blood.
2012;119(3):696-706. doi: 10.1182/blood-2011-03-344275. PubMed PMID: 22117050.
377. Wang E, Wang LC, Tsai CY, Bhoj V, Gershenson Z, Moon E, Newick K, Sun J, Lo A,
Baradet T, Feldman MD, Barrett D, Pure E, Albelda S, Milone MC. Generation of Potent T-cell
Immunotherapy for Cancer Using DAP12-Based, Multichain, Chimeric Immunoreceptors. Cancer
Immunol Res. 2015;3(7):815-26. doi: 10.1158/2326-6066.CIR-15-0054. PubMed PMID:
25941351; PMCID: PMC4490943.

152
APPENDICES
Appendix 1 Primers used in the study
HR-CD19CAR-F GGACCATCCTCTAGACCGCCCGCCATGCTTCTCCTGGTGACAAG
CD19SCFV-R CGGCCGCTGAGGAGACGGTGACT
19-CD8A-F CACCGTCTCCTCAGCGGCCGCAACCACGACGCCAGCGCCGCGAC
CD8-R GAGTTTCTTTCTGCCCCGTTTGCAGTAAAGGGTGATAACCAGTG
41BB-F AAACGGGGCAGAAAGAAACTC
41BB-CD3Z-R GCGCTCCTGCTGAACTTCACTCTCAGTTCACATCCTCCTTCTTC
19-CD28-F CTCAGTCACCGTCTCCTCAGCGGCCGCAATTGAAGTTATGTATCCTC
CD28-CD3Z-R GCGCTCCTGCTGAACTTCACTCTGGAGCGATAGGCTGCGAAGTCG
CD3Z-F AGAGTGAAGTTCAGCAGGAGC
HR-CD3Z-R ATCCCGGGCCCGCGGTACCGTCGACTTAGCGAGGGGGCAGGGCCTG
CD3Z-Z300-R
CATCGGCCGCGGTTTGTCTGGGGACGTTCCGGATCCGGAGCGAGGGGGCAG
GGCCTGCATG
CD3Z-Z327-R
ATCGCGCTTCAGGAAGAGCTTCTTGTCTCCGGATCCGGAGCGAGGGGGCAGG
GCCTGCATG
Z300-F ACGTCCCCAGACAAACCGCGGCCGATG
Z327-F GACAAGAAGCTCTTCCTGAAG
HR-ZAP70-R ATCCCGGGCCCGCGGTACCGTCGACTCAGGCACAGGCAGCCTCAGCCTTCTG
41BB-Z300-F
GAAGAAGAAGGAGGATGTGAACTGGAATTCACGTCCCCAGACAAACCGCGG
CCGATG
41BB-Z327-F
GAAGAAGAAGGAGGATGTGAACTGGAATTCGACAAGAAGCTCTTCCTGAAG
CGCG
CD28-Z300-F
ACGCGACTTCGCAGCCTATCGCTCCGAATTCACGTCCCCAGACAAACCGCGG
CCGATG
CD28-Z327-F
ACGCGACTTCGCAGCCTATCGCTCCGAATTCGACAAGAAGCTCTTCCTGAAG
CGCG
LAT-FL-F CCGTCTCCTCAGCGGCCGCAGAGGAGGCCATCCTGGTCC
CD8-LAT-CP28-F CTGGTTATCACCCTTTACTGCCACTGCCACAGACTGCCAGGCT
CD8-LAT-CP30-F CTGGTTATCACCCTTTACTGCAGACTGCCAGGCTCCTACGAC
41BB-LAT-CP28-F GAAGAAGAAGAAGGAGGATGTGAACACTGCCACAGACTGCCAGGCT
41BB-LAT-CP30-F GAAGAAGAAGAAGGAGGATGTGAAAGACTGCCAGGCTCCTACGAC
LAT-R TTACCCTGTTATCCCTAGGATCCTCAGTTCAGCTCCTGCAGATTC
Leader-R TGGGATCAGGAGGAATGC
2D2-H-F CAGCATTCCTCCTGATCCCACAGGTCCAGTTGGTGCAGTC
2D2-GS-R CTTCCACCGCCTCCAGAACCTCCTCCACCACTAGACACTGTTACCATCG
2D2-L-F
TGGAGGCGGTGGAAGTGGTGGCGGAGGTAGCCAGTCAGTTCTCACGCAGCC
G
2D2-L-R CGGCGCTGGCGTCGTGGTTGCGGCCGCTAGGACAGTAAGTTGAGTAC

153
Appendix 2 Reagents used in the study
Reagent Manufacture Category Number
mouse-anti-human CD8a Abcam ab187279
Blotting Grade Blocker Non-Fat Dry Milk Bio-rad 1706404XTU
Human AB Serum Corning 35060CI
Fetal Bovine Serum Gendepot F0901-050
NEBuilder® HiFi DNA Assembly Master Mix NEB E2621X
EcoRI-HF NEB R3101L
SalI-HF NEB R3138L
NotI-HF NEB R3189L
NcoI-HF NEB R3193L
Recombinant Human IL-2 Peprotech 200-02
CytoTox 96® Non-Radioactive Cytotoxicity Assay Promega G1780
IPTG Sigma Aldrich I6758-1G
RetroNectin Takara Bio T100B
CD3-efluor 780 Thermo Scientific 47-0038-42
CD4-AF700 Thermo Scientific 56-0048-82
CD8-FITC Thermo Scientific 53-0086-42
CD45RO-SB600 Thermo Scientific 63-0457-42
CD62L-ef450 Thermo Scientific 48-0629-42
CD28-SB645 Thermo Scientific 64-0289-42
CD95-Percp-ef710 Thermo Scientific 46-0959-42
CCR7-PE Thermo Scientific 12-1979-42
CD127-PE-cy7 Thermo Scientific 25-1278-42
PD1-SB702 Thermo Scientific 67-9985-82
TIM3-SB780 Thermo Scientific 78-3109-42
LAG3-PE-ef610 Thermo Scientific 61-2239-42
Fixable dye Thermo Scientific 65-0866-18
Pierce™ Recombinant Protein L, Biotinylated Thermo Scientific 29997
Streptavidin, R-Phycoerythrin Conjugate (SAPE) Thermo Scientific S866
Streptavidin, Allophycocyanin Conjugate (SA-APC) Thermo Scientific S868
RPMI 1640 Medium Thermo Scientific 11875085
DMEM, high glucose, pyruvate Thermo Scientific 11995040
GlutaMAX Thermo Scientific 35050061
HEPES (1M) Thermo Scientific 15630130
2-Mercaptoethanol Thermo Scientific 21985023
Penicillin-Streptomycin (10,000 U/mL) Thermo Scientific 15140122
Dynabeads M-280 SA Thermo Scientific 11206D
154
Reagent Manufacture Category Number
IFN gamma Monoclonal Antibody (2G1) Thermo Scientific M700A
IFN gamma Monoclonal Antibody (XMG1.2), Biotin Thermo Scientific MM700B
IL-2 Monoclonal Antibody (MQ1-17H12) Thermo Scientific 14-7029-81
IL-2 Polyclonal Antibody, Biotin Thermo Scientific 13-7028-81
TNF alpha Monoclonal Antibody (MAb1) Thermo Scientific 14-7348-81
TNF alpha Monoclonal Antibody (MAb11), Biotin Thermo Scientific 13-7349-81
Poly-HRP Streptavidin Thermo Scientific N200
HLA-A2 Monoclonal Antibody (BB7.2), APC Thermo Scientific 17-9876-42
Goat anti-Human IgG (H+L) Cross-Adsorbed Secondary
Antibody, Alexa Fluor 488
Thermo Scientific A-11013
mouse-anti-human CD3 Thermo Scientific MA5-12577
CellTrace™ CFSE Cell Proliferation Thermo Scientific C34554
CD45 Monoclonal Antibody (30-F11), PE Thermo Scientific 12-0451-82
CD19 Monoclonal Antibody (HIB19), FITC Thermo Scientific 11-0199-42

Abstract (if available)

Abstract Chimeric antigen receptor (CAR) engineered T cells have shown promising clinical responses in patients with blood cancer. However, the efficacy towards solid tumors is dramatically reduced partially due to the limited ideal surface antigens for targeting, while most antigens are intracellular and undruggable yet. Other possible reasons may owe to CAR-T cells exhaustion caused by redundant signaling in the current CAR construct associated with overexpressed immune inhibitory markers, poor T-cell trafficking, and persistence in the complicated tumor microenvironment. This thesis focuses on these issues by expanding the availability of targets for CAR-T cells and increasing the persistence of CAR-T cells with enhanced anti-tumor responses. Here in our first study, we developed a novel TCR-like antibody-based immunotherapy that can access intracellular antigens processed and presented on the cell surface, broadening the application of current therapeutic approaches. The antibody screened from the phage-displayed library has high specificity towards target peptide/MHC complex, but not other antigens. Besides, antibody-derived chimeric antigen receptor engineered T-cells also demonstrated antigen specificity both in vitro and in vivo. In a triple-negative breast cancer model, CAR-T cells specifically impaired tumor growth and prolonged mice overall survival. In our second part, we modified the conventional CAR construct with a novel kinase domain from Zap70, resulting in improved anti-tumor activity by increasing the memory T-cell population and reducing the expression of negative regulators.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Self-secretion of checkpoint blockade enhances antitumor immunity by murine chimeric antigen receptor-engineered T cells

PDF

Engineering chimeric antigen receptor (CAR) -modified T cells for enhanced cancer immunotherapy

PDF

Novel approaches of mobilizing human iNKT cells for cancer immunotherapies

PDF

Lym-1 epitope targeted chimeric antigen receptor (CAR) T cells for the immunotherapy of cancer

PDF

Novel design and combinatory therapy to enhance chimeric antigen receptor engineered T cells (CAR-T) efficacy against solid tumor

PDF

Generation and characterization of anti-CD138 chimeric antigen receptor T (CAR-T) cells for the treatment of hematologic malignancies

PDF

Generation and characterization of fully human anti-CD19 chimeric antigen receptor T (CAR-T) cells for the treatment of hematologic malignancies

PDF

Generation and characterization of humanized anti-CD19 chimeric antigen receptor T (CAR-T) cells for the treatment of hematologic malignancies

PDF

Immunotherapy of cancer

PDF

Chimeric Antigen Receptor targeting Prostate Specific Membrane Antigen (PSMA)

PDF

Engineering chimeric antigen receptor-directed immune cells for enhanced antitumor efficacy in solid tumors

PDF

Improving antitumor efficacy of chimeric antigen receptor-engineered immune cell therapy with synthetic biology and combination therapy approaches

PDF

Therapeutic resistance in acute lymphoblastic leukemia: cIAP2 inhibition sensitizes B cell acute lymphoblastic leukemia to anti-CD19 chimeric antigen receptor T cell

PDF

Construction and testing of chimeric antigen receptor targeting CS1 for treatment of primary effusion lymphoma

PDF

Enhancing chimeric antigen receptor-engineered immune cell therapy with synthetic biology and nanomedicine

PDF

Comparative analysis of scFv and non-scFv based chimeric antigen receptors (CARs) against B cell maturation antigen (BCMA)

PDF

Development of an NFAT-GFP Jurkat T cell reporter system for acceleration of T Cell receptor affinity screening

PDF

Enhancing the specificity and cytotoxicity of chimeric antigen receptor Natural Killer cells

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Let there be LIGHT: TNFSF14 immunomodulating properties for cancer immunotherapy

Asset Metadata

Creator Liu, Xin (author)

Core Title Development of TCR-like antibody and novel chimeric antigen receptor for cancer immunotherapy

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Infectious Diseases, Immunology and Pathogenesis

Degree Conferral Date 2021-08

Publication Date 07/23/2023

Defense Date 04/30/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag antibody,cancer immunotherapy,chimeric antigen receptor,OAI-PMH Harvest,TCR-like

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Yuan, Weiming (committee chair), Morsut, Leonardo (committee member), Wang, Rongfu (committee member)

Creator Email XIN.1990.LIU@GMAIL.COM,xliu0200@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15622689

Unique identifier UC15622689

Legacy Identifier etd-LiuXin-9892

Document Type Dissertation

Format application/pdf (imt)

Rights Liu, Xin

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu