University of Southern California Dissertations and Theses

Novel long non-coding RNA, LINC00824, contributes to stemness in hepatocytes

(USC Thesis Other)

Novel long non-coding RNA, LINC00824, contributes to stemness in hepatocytes

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

NOVEL LONG NON-CODING RNA, LINC00824, CONTRIBUTES TO STEMNESS IN
HEPATOCYTES
by
Antonio Carmona

A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
MOLECULAR MICROBIOLOGY AND IMMUNOLOGY

August 2021

Copyright 2021 Antonio Carmona
ii

For my father, Antonio Carmona. Without your sacrifice, support, and love I would have never
been able to accomplish my goals.
And for Erica Ascencio, you continuously inspire and drive me to reach great heights.
iii
Acknowledgments

I would like to extend my gratitude to Dr. Keigo Machida for giving me the wonderful
opportunity to work in his lab. The advice and support he provided were essential in the
completion of my work.
I am grateful to the many lab members in the Dr. Machida lab for always providing great insight
and thoughtful conversations. Specifically, I would like to thank Dr. Da-Wei Yeh for his
demonstration and instruction of various lab techniques and Juan Carlos Hernandez for always
being supportive and aiding in lab procedures.

iv

TABLE OF CONTENTS
Dedication……………………………………………………………………………………….ii

Acknowledgments……………………………………………………………………………....iii

List of Tables ………..………………………………………………………………………….vi

List of Figures…………………………………………………………………………………..vii

Abstract………………………………………………………………………………………….viii

Chapter 1: Introduction…………………………………………………………………………..1
1.1 Hepatocellular Carcinoma…………………………………………………………...1
1.2 Long Non-coding RNA……………………………………………………………...1
1.3 Tumor Initiating Cells……………………………………………………………….2
1.4 Musashi 2……………………………………………………………………………3

Chapter 2: Materials and Methods……………………………………………………………....3
2.1 Cell culture…………………………………………………………………………..3
2.2 Quantitative Real-Time PCR (qRT-PCR)…………………………………………...4
2.3 Isolation of CD133+ cells……………………………………………………………4
2.4 Transfection of cells…………………………………………………………………4
v
2.5 Construction of overexpression vector for LINC00824……………………………..4
2.6 Knockdown of LINC00824………………………………………………………….5
2.7 Overexpression of MSI2……………………………………………………………..5

Chapter 3: Results………………………………………………………………………………..6
3.1 LINC00824 has an HCC associated isoform………………………………………....6
3.2 Basal LINC00824 expression in hepatocytes………………………………………...6
3.3 LINC00824 expression when MSI2 is overexpressed…..…………………………....7
3.4 Knockdown of LINC00824…………………………………………………………..8
3.5 Construction of LINC00824 overexpression vector………………………………….9

Chapter 4: Conclusion…………………………………………………………………………...12
4.1 LINC00824 is expressed in multiple hepatocytes…………………………………...12
4.2 MSI2 increases expression of LINC00824…………………………………………..12
4.3 Knockdown of LINC00824………………………………………………………….12
4.4 Construction of LINC00824 overexpression vector…………………………………12

Chapter 5: Discussion……………………………………………………………………………13

References…………………………………………………………………………………….….15

vi

List of Tables
Table 1: Antisense Oligonucleotides used for knockdown of LINC00824………………………9
Table 2: LINC00824 sequence produced by IDT………………………………………………..11
vii
List of Figures

Figure 1: Expression of LINC00824 transcript isoforms…………………………………………6
Figure 2: Expression of LINC00824 HCC associated transcript in different hepatocytes………..7
Figure 3: Expression of MSI2 and LINC00824 in cells when MSI2 is overexpressed…………...8
Figure 4: Knockdown efficiency of antisense oligonucleotides………………………………….9

viii

Abstract
Hepatocellular carcinoma (HCC) is a heterogeneous disease with its occurrence being the
seventh highest cancer type worldwide. Musashi 2 (MSI2) is an RNA binding protein that
primarily binds to transcription factor and cell cycle transcripts. Employing Circular Chromatin
Conformation Capture (4C-seq) we identified regions within the 8q24 gene desert interacting
with MYC when MSI2 is overexpressed. LINC00824 was found to be one such region that
interacted with MYC. It was found that LINC00824 had several transcripts but only one transcript
that was expressed in HCC tissues. RT-qPCR analysis of several hepatocyte cell types
demonstrated the LINC00824 transcript is highly expressed in CD133- populations compared to
CD133+ populations. RT-qPCR analysis of cells overexpressing MSI2 showed that there was an
increase in LINC00824 presence compared to control cells. The RT-qPCR analysis also
demonstrated that the LINC00824 transcript can be knocked down by antisense oligonucleotide
(ASO). The data gathered in this study suggests that LINC00824 could be causing TIC
differentiation and allowing for a permissive microenvironment for tumor growth and
development.
1

Chapter 1: Introduction
1.1 Hepatocellular Carcinoma
Worldwide, liver cancer was the fifth leading cause of cancer related deaths and had the
seventh highest incidence rate
1
. Deaths due to liver cancer are projected to total up to 173,000 in
high-income countries by 2030
2
. Hepatocellular carcinoma (HCC) comprises the majority of
primary liver cancer incidence. HCC is a heterogeneous disease and arises in patients that sustain
chronic liver injury either by a viral infection of hepatitis B or hepatitis C or environmental
factors like excessive alcohol consumption or aflatoxin consumption derived from Aspergillus
fungi.
HCC is a heterogeneous disease not only due to its differing etiological factors but also in
that HCC can originate from a diverse set of cells ranging from mature hepatocytes to progenitor
cells such as tumor initiating stem cells (TICs) and even change morphologically and
molecularly as the disease progresses. Because of this, there are multiple metabolic pathways
involved in the regulation and upkeep of HCC tumor cells. Studies have shown Wnt/Catenin b
4,5
,
p53
5
, and Myc
6
pathways are involved in HCC, demonstrating the varying and complex
molecular mechanisms that can be implicated in HCC progression. Though these molecular
mechanisms have been well detailed in how HCC is capable of expressing the hallmarks of
cancer as described by Weinberg and Hanahan
7
the transcriptomic contribution to carcinogenesis
in HCC has yet to be fully elucidated.

1.2 Long Non-coding RNA
With the emergence of next-generation sequencing, it was quickly realized that about
70% of the human genome is transcribed to RNA templates that are untranslated to proteins
8
.
2
These unproductive templates have been termed non-coding RNA (ncRNA). ncRNAs are further
categorized by either function, localization, or size, such as small interfering RNA (siRNA)
small nucleolar RNA (snoRNA), microRNA (miRNA), and long non-coding RNA (lncRNA).
lncRNAs are RNA transcripts greater than 200 bp and are generally not translated into proteins
9
.
lncRNAs have gained interest because studies have pointed to the ability of these lncRNAs to
modulate transcription within cells and even activate oncogene transcription
10,13
. A recent study
has shown that the lncRNA CCAT1, which is coded within the 8q24 gene desert, modulates MYC
expression by regulating long-range chromatin interactions
13
. Our lab’s previous study showed
that MSI2 overexpression did not increase transcription of MYC but instead increased translation
of Myc and increased MYC loci interactions with the neighboring gene loci, LINC00824
11
.
LINC00824 is a gene within the 8q24 gene desert and transcribes multiple lncRNA isoforms.
With these experiments in mind, we wanted to determine the effects of LINC00824
overexpression on stemness in hepatocytes.

1.3 Musashi 2
Musashi 2 (MSI2) is an RNA binding protein found to be a key regulator in
hematopoietic stem cell regulation and malignant hematopoiesis
14
. MSI2 is found to be
upregulated in various tumor tissues, such as HCC, colorectal cancer, pancreatic cancer, and
even bladder cancer. MSI2 primarily binds to transcription factors and cell cycle regulating
transcripts. In malignant tissues, MSI2 regulates cell transcription by specifically binding to
tumor-suppressing transcripts, rendering the transcripts from effectively suppressing
oncogenisis
14,16
. MSI2 has also been found to interact with oncogenic transcript IRES regions to
promote the translation of oncogenic genes
16
.
3

1.4 Tumor Initiating Cells
Recent research has supported the “Stem Cell model of Carcinogenesis” where a
subpopulation of cells are responsible for tumor growth and maintenance. The subpopulation of
cells are termed Tumor Initiating Cells (TICs). TICs drive tumor formation by conferring
chemoresistance
18
, evasion to immune system
19
and, a conducive environment for tumor growth.
TICs have been identified and isolated by the cell surface marker CD133. These CD133+ cells
have stem cell like properties and are capable of differentiation and self renewal
20
.

Chapter 2: Materials and Methods
2.1 Cell Culture
Huh7, Hep3B, HepG2, primary human hepatocytes, and human fetal hepatocytes were
used in this study. Huh7 is derived from a well-differentiated hepatocyte originating from the
liver tumor of a 57-year old male-Japanese patient in 1982. Hep3B is a hepatocyte cell line
originating from an 8-year old black female, the cell line expresses the hepatitis B virus antigen
on the cell surface. HepG2 is a human liver cancer cell line originating from a 15-year old
Caucasian male. Primary human hepatocytes were obtained and cryopreserved by GIBCO and
thawed in lab for analysis. Human fetal hepatocytes were provided by the Maternal Fetal
Medicine Division at Children’s Hospital Los Angeles. Huh7, Hep3B, HepG2 cells were
cultured in Dulbecco’s Modified Essential Medium with heat-inactivated 10% bovine serum and
1% antibiotics. The cells were cultured in T25 and T75 flasks at 37°C in a 5% CO2 humidified
incubator. Fetal hepatocytes were cryopreserved using CELLBANKER® 2 and stored at -80°C,
the cells were reconstituted by quickly thawing in a 37°C water bath.
4

2.2 Quantitative Real-Time PCR (qRT-PCR)
Hepatocytes Total RNA was isolated by using TRIzol™ reagent and used according to
the manufacturer’s instructions. The concentration of the total RNA extracted was measured
using Nanodrop™ 2000/2000c spectrophotometer. cDNA was then produced using
Photoscript® II Reverse Transcriptase by following the manufacturer’s protocol. RT-qPCR
analysis was done on a StepOnePlus™ Real-Time PCR System Upgrade using PowerUp™
SYBR™ Green PCR Master Mix according to the manufacturer’s instructions. GAPDH and
ACTINB were used to normalize LINC00824 and MSI2.

2.3 Isolation of CD133+ cells
Hep3B and Huh7 cells were used for CD133+ cell isolation. Human CD133+ MicroBead
kit was used to isolate CD133+ cells. Briefly, Hep3B and Huh7 cells were grown in a T75 flask
and treated with FcR blocking reagent and CD133 MicroBeads then allowed to incubate for 30
minutes. The cells were then separated into different, CD133+ and CD133-, fractions using a
MACS column and MACS separator.

2.4 Transfection of cells
Transfection of cells was accomplished using BioT by following Bioland Scientific
LLC’s BioT plasmid transfection protocol. Briefly, cells were grown to about 50% confluence in
a T25 flask and treated with BioT and plasmid. Then allowed to expand to about 90% confluence
then used for analysis.

5
2.5 Construction of overexpression vector for LINC00824
The LINC00824 transcript associated with HCC was determined using the UCSC Xena
tool
15
, which compared wild type and HCC samples from publicly available data (n=423). The
double-stranded sequence was then manufactured by IDT via their gBlock™ and an attempt to
ligate to a PCDH-CMV backbone was conducted.

2.6 Knockdown of LINC00824
Knockdown of LINC00824 was accomplished by the use of antisense oligonucleotides
(ASO). ASOs were manufactured by IDT. ASO design was done by first looking at the open
regions of LINC00824 HCC isoform then BLASTn was used to ensure there are no homologous
transcripts within the human transcriptome. The ASO probes were also examined in silico to
ensure there were no stem-loops. ASOs were introduced to hepatocytes once they reached 80%
confluence and transfected using BioT by following Bioland Scientific LLC’s BioT ASO
transfection protocol

2.7 MSI2 overexpression vector
MSI2 overexpression vector was obtained by Dr. Da-Wei Yeh (University of Southern
California). The vector was comprised of a PCDH-CMV backbone with the MSI2 gene insert.

6
Chapter 3: Results
3.1 LINC00824 has an HCC associated isoform
4C-Seq data showed that MSI2 overexpression increased loci interactions between MYC
and LINC00824
12
. Due to the increased interaction, we decided to further investigate the
LINC00824 gene. Using the UCSC Xena tool
15
, and publicly available data, we found there was
one LINC00824 transcript that was predominantly expressed in HCC samples compared to wild-
type liver samples (Fig.1).

Figure 1: LINC00824 transcript expression of wildtype liver and HCC liver samples (n=423).
Expression is shown in transcripts per million (TPM).

3.2 Basal expression of LINC00824 in hepatocytes
After discovering that there was a LINC00824 transcript that was associated with HCC
we wanted to see to what degree do different hepatocytes express this transcript. We performed
an RT-qPCR assay on Huh7, HepG2, Hep3B, adult human hepatocytes, fetal hepatocytes,
CD133+ Huh7, CD133+ Hep3B, CD133- Huh, and CD133- Hep3B cells (Fig.2). The data shows
that LINC00824 was expressed at about equal levels among the stable cell lines Hep3B, Huh7,
7
and HepG2 but had higher expression than the wild-type hepatocytes. Surprisingly, there was a
significant difference in the expression of LINC00824 expression between CD133+ and CD133-
cells. The CD133 cell surface marker is a well categorized and known indicator for tumor
initiating cells
20
. This data led us to believe that LINC00824 is acting on the cell’s stemness.

Figure 2: Bar graph demonstrating expression of LINC00824 in different hepatocytes by RT-
qPCR. The data were normalized with ACTINB. The bars represent the average of the triplicates,
individual points mark each respective experiment with the error bars showing standard
deviation (n=3). Asterisks show significant difference (P<0.01).

3.3 LINC00824 expression when MSI2 is overexpressed
To investigate the extent of MSI2’s influence on LINC00824 expression in hepatocytes
we used an MSI2 overexpression (OE) vector to determine the fold change of HCC associated
isoform of LINC00824. When MSI2 was overexpressed there was an increase in HCC associated
isoforms of LINC00824 (Fig.3).
Adult Hepatocytes
Fetal hepatocytes
Hep3B
HepG2
Huh7
Huh7 CD133+
Huh7 CD133-
Hep3B CD133+
Hep3B CD133-
0
5
10
15
20
25
LINC00824
*
*
**
**
8

Figure 3: RT-qPCR of Huh7 total RNA for MSI2 and LINC00824 when transfected with MSI2
OE vector. The data were normalized with GAPDH. Values are the mean of triplicate
experiments, individual points mark each respective experiment and, error bars represent
standard deviation. Asterisks show significant difference (P<0.01).

3.4 Knockdown of LINC00824
To better understand the LINC00824 transcript’s role in HCC, we designed a knockdown
experiment by the use of Antisense Oligonucleotides (ASOs). ASOs were used to knockdown
LINC00824 over other methods because ASOs tend to be retained in the nucleus and we believe
the LINC00824 transcript is also retained in the nucleus. Hep3B cells showed to have the highest
expression of LINC00824 transcripts and were therefore used to determine the efficacy of
LINC00824 ASO mediated knockdown. The sequences for the probes used in the experiment are
shown in Table 1. ASO’s efficiency on LINC00824 knockdown was measured by RT-qPCR and
is shown in Figure4.

3 3 3
MSI2 LINC00824 Control
0
1
2
3
4
log2 Fold Change
*
*
*
*
9

Figure 4: RT-qPCR results of ASO treated Hep3B cells targeting LINC00824 transcript. Data
were normalized using GAPDH. Error bars denote standard deviation and points represent each
individual sample (n=3, P>0.1).

Oligonucleotide Sequence
Scramble G*T*T*T*TCAAATACACCT*T*C*A*T
ASO 1 G*T*T*T*CTGGTGATGCCA*T*G*G*A
ASO 2 T*C*T*G*CCACCTCCAGGC*C*T*T*A
ASO 3 T*T*G*T*ATTTGTGCTTATTTC*T*C*T
ASO 4 T*T*G*T*GCTTCTTGAT*A*T*C*T
Table 1: The table above shows the Antisense Oligonucleotides used for knockdown
experiments. Asterisks denote phosphorothioate bonds.

3.5 Construction of LINC00824 overexpression vector

In order to determine the effects of LINC00824 transcripts on stemness in hepatocytes,
we attempted to create an overexpression vector containing the LINC00824 transcript. The first
step was to isolate and clone the LINC00824 transcript. We used a PCR method to clone the
transcript from genomic DNA. We were unable to get any distinguishable bands when the PCR
product was run through an electrophoresis gel. After failing to procure any good results, we
moved on to a nested PCR method to isolate the LINC00824 transcript. In this method, we used
n=3
Scrambble
ASO1
ASO2
ASO3
ASO4
0
2000
4000
6000
8000
log2 Fold Change
10
primers that are set farther apart, upstream and downstream, from the sequence of interest to get
a first-round PCR product that is larger than the sequence we are trying to isolate, and then that
product is run through a second round of PCR were the primers used are specific for just the
sequence of interest. With the nested PCR, we also failed to see a band that corresponded to the
LINC00824 sequence. We then proceeded to try a two-step PCR approach to isolate the
LINC00824 sequence. In this method, we use two sets of primers one in the 5’ end and 3’ middle
of the sequence and the other in the 3’ end and 5’ middle of the sequence, and the two products
are then ligated and the whole sequence is cloned. We were able to clone a product that
corresponded for the 3’ end portion of the LINC0084 two-step PCR however, we were unable to
recover a product of the corresponding length for the LINC00824 5’ end. Our next attempt at
isolating the LINC00824 sequence employed 5’ & 3’ Rapid Amplification of cDNA Ends
(RACE). RACE is a powerful technique used in the isolation of transcripts with low abundance
and is highly specific. When using 5’ & 3’ RACE we were unable to isolate a single distinct
band that corresponded with the LINC00824 transcript. Exhausting all of these different methods
we then turned to a gBlock™ solution by IDT. Here, the sequence is manufactured and sent to
the lab, the sequence is shown in Table 2. The sequence was then digested with BAMHI and
ECOR1 restriction enzymes and ligated to a linearized PCDH-CMV vector.

11
Sequence manufactured by IDT
CATGTGAATTCATGGCATCACCAGAAACCAAGAAGATGGTAAGGCCTGGAGGTGG
CAGAGCTGAAGAGAGTACATGACCCAGCAGAAGAAATAAGCACAAATACAAATG
GTGACAGAAAAATAAGATGTGTCACAACTGACTTAGATTCCAACAACCACAACAG
CACAGAGGAGGAAGCGAGGTGGTGCTCCCTGGAATGACCCAAACACAACAATAT
CTGAGCTTGCTCTTGAAGGACTAGCAGTTTACCAAGCAAAATGGAAAACAGAAAT
TGAGTCCAGGTCTAGATATCAAGAAGCACAAAGAGATCCAGAAAAGACCATGGA
GAAGTTCAAAGACCAGCAACAGGCTTCAAAAGCCTTCTATGAATAGGGCATGTAA
GGATTTGCTGGGGGCAAGGGTGGGTTTGAGAGCTGGAGATGGAGATGAAATTAGT
GAACACCATGCCTCTCTCTTGTACTAAAGAGGCCGCAGGGAAGACAAAGCTCAGT
TGTATTCAACAAAGGCCACTCAGGTAGCACCATAAAGGAAGAGCTGTAACACGGA
CACGGGAGTAGTGGAATCAGTCAAGAGGGAATTTCAAAGGTCAAAGATGAAAGG
CTGGCTGGGCGCGGTGGCTCACGCTTGTAATCCCAGCACTTTGGGAGGCCGAGGT
GGGCGGATCACGGGGTCAGGAGATAGAGACCATCCTGGCCAACAAGGTGAAACC
GCATCTCTACTAAAATACAAAAAATTAGCCGGGCATGGTGGTGCGTGCCTATAGT
TCCAGCTACTCCGGAGGCTGAGGCAGGGGAATCTCTTGAACCCAGGAGGCAGAGC
TTGCAGTGAGCCAAGATCGCGCCACTGCACTCAAGCCTGGAGACAGAGGGAAAGT
CCATCTCAAAAAAAAAAAAAGGATCCCAGTC
Table 2: The sequence in the table above is the sequence produced by IDT. The sequence
contains an ECOR1 digestion site in the 5’ end and a BAMHI restriction site in the 3’ end. A
cytosine residue was added to the middle of the sequence in order to remove an endogenous
ECOR1 digestion site.

12
Chapter 4: Conclusion
4.1 LINC00824 expression in hepatocytes
We can conclude from this study that the LINC00824 transcript is present in various
hepatocytes, but its presence is increased in HCC cell lines compared to wild-type hepatocytes.
We also see a significant difference in the expression of LINC00824 transcript between CD133+
and CD133- cells with lower expression in the former than the latter.

4.2 MSI2 increases expression of LINC00824
Since our previous study showed that OE of MSI2 led to increased chromatin interaction
between MYC and LINC00824 loci, we wanted to see if this also related to increased
transcription of LINC00824. This study shows that overexpression of MSI2 is associated with an
increase in LINC00824 transcripts by about 50% compared to unaltered cells.

4.3 Knockdown of LINC00824
ASO’s 2, 3, and, 4 reduced expression of LINC00824 transcript in the Hep3B
hepatocytes, however ASO 1 increased LINC00824 transcripts.

4.4 Construction of LINC00824 overexpression vector
While the isolation of the LINC00824 transcript proved to be difficult, we were able to
attain the sequence via the manufacture, IDT. IDT’s gBlock™ allowed us to continue to attempt
to ligate the LINC00824 transcript sequence to a PCDH-CMV vector.
13
Chapter 5: Discussion
In this study, we wanted to elucidate the role of the novel lncRNA, LINC00824’s role in
HCC propagation and maintenance. Astonishingly, we found that while there was an isoform
that was predominantly expressed in HCC tissues, that same transcript was notably reduced in
CD133+ cells but increased in CD133- hepatocytes. This finding was surprising because CD133
is a well-known cell marker for TICs and this data suggests that LINC00824 transcripts are
behaving as tumor suppressors within HCC hepatocytes. Even more curious is the increased
expression of the LINC00824 transcript when MSI2 is overexpressed. Increased MSI2 expression
has been associated with aggressive tumor phenotypes.
Our ASO data showed that LINC00824 expression can be modulated by antisense
oligonucleotides. Unfortunately, the internal controls were inconsistent throughout the
experiment and therefore are not a good indication of the efficacy of the knockdown capabilities
of ASO technology on LINC00824 transcripts. Further experimentation and fine-tuning of the
methods are required to definitively state if the ASOs reduced LINC00824 transcript presence in
the hepatocytes.
The data gathered in this study show the complexity of the inner workings in HCC TIC
development. Since the highest expression of LINC00824 transcripts was within the CD133-
population of cells, it is an indication that the LINC00824 transcript must be essential to TIC
differentiation. As previously stated, HCC is a heterogeneous disease and is comprised of
various cell types and these different cells create a micro-climate that is permissive to tumor
growth and development. While LINC00824 transcripts are increased in CD133- populations the
transcript can be enabling an environment for the tumor to grow. A recent study has shown how
long non-coding RNA can cause differentiation within cells and allow for a permissive
14
environment for the tumor to evade the immune system
17
. Viewing the data in this context we
can make sense of how LINC00824 transcripts are significantly expressed more in HCC and at
the same time reduced in TIC (CD133+) populations.

15
References

1.International Agency for Research on Cancer, World Health Organization. Cancer today
(https://gco .iarc .fr/ today/ home).

2. World Health Organization. Projections of mortality and causes of death, 2016 to 2060
(http://www .who .int/ healthinfo/global_burden_disease/ projections/ en/ ).

3.Carr B. Hepatocellular Carcinoma: Diagnosis and Treatment. Springer International
Publishing AG; 2016.

4.Mercer H. Alcohol Consumption, Wnt/β-Catenin Signaling, and
Hepatocarcinogenesis. Biological Basis of Alcohol-Induced Cancer. 2014;815:185-195.
doi:10.1007/978-3-319-09614-8_11

5. Teufel M. Next generation sequencing of HCC from European and Asian HCC cohorts. Back
to p53 and Wnt/β-catenin. Journal of hepatology. 2012;58(3):622-624.
doi:10.1016/j.jhep.2012.10.006

6. Wu Z. ID1 overexpression promotes HCC progression by amplifying the AURKA/Myc
signaling pathway. International journal of oncology. 2020;57(3):845-857.
doi:10.3892/ijo.2020.5092

7.Hanahan W. The hallmarks of cancer. Cell (Cambridge). 2000;100(1):57-.

8. Tony Gutschner & Sven Diederichs (2012) The hallmarks of cancer, RNA Biology, 9:6, 703-
719, DOI: 10.4161/rna.20481

9. Verheggen K, Volders P-J, Mestdagh P, et al. Noncoding after All: Biases in Proteomics Data
Do Not Explain Observed Absence of lncRNA Translation Products. Journal of proteome
research. 2017;16(7):2508-2515. doi:10.1021/acs.jproteome.7b00085

10Rinn C. Genome Regulation by Long Noncoding RNAs. Annual review of biochemistry.
2012;81(1):145-166. doi:10.1146/annurev-biochem-051410-092902

11. Narayanan P. Musashi-2 Promotes c-MYC Expression through IRES-Dependent Translation
and Self-Renewal Ability in Hepatocellular Carcinoma. Los Angeles, California; 2015.

12.Machida K. Unpublished data. Los Angeles, California; 2015

13. Xiang Y. Human colorectal cancer-specific CCAT1-L lncRNA regulates long-range
chromatin interactions at the MYC locus. Cell research. 2014;24(9):1150-1150.
doi:10.1038/cr.2014.117

16

14. Wang S, Li N, Yousefi M, et al. Transformation of the intestinal epithelium by the MSI2
RNA-binding protein. Nature communications. 2015;6(1):6517-6517. doi:10.1038/ncomms7517
15. Goldman, M.J., Craft, B., Hastie, M. et al. Visualizing and interpreting cancer genomics data
via the Xena platform. Nat Biotechnol (2020). https://doi.org/10.1038/s41587-020-0546-8
16. Yeh, D.-W., Siddique, H. R., Zheng, M., Choi, H. Y., Machida, T., Narayanan, P., Kou, Y.,
Punj, V., Tahara, S. M., Feldman, D. E., Chen, L., & Machida, K. (n.d.). MSI2 promotes MYC
and viral translation to induce self-renewal of tumor-initiating cells.

17. Jiang R, Tang J, Chen Y, et al. The long noncoding RNA lnc-EGFR stimulates T-regulatory
cells differentiation thus promoting hepatocellular carcinoma immune evasion. Nature
communications. 2017;8(1):15129-15129. doi:10.1038/ncomms15129
18. Ma S, Lee TK, Zheng BJ, Chan KW, Guan XY. CD133
þ
HCC cancer stem cells confer
chemoresistance by preferential expression of the Akt/ PKB survival pathway. Oncogene
2008;27:1749-1758.
19. Hou Y-C, Chao Y-J, Hsieh M-H, Tung H-L, Wang H-C, Shan Y-S. Low CD8
+
T Cell
Infiltration and High PD-L1 Expression Are Associated with Level of CD44
+
/CD133
+
Cancer
Stem Cells and Predict an Unfavorable Prognosis in Pancreatic Cancer. Cancers. 2019;11(4).
20. Nakabayashi H, Taketa K, Miyano K, Yamane T, Sato J. Growth of human hepatoma cells
lines with differentiated functions in chemically defined medium. Cancer Res 1982;42:3858-
3863.

Abstract (if available)

Abstract Hepatocellular carcinoma (HCC) is a heterogeneous disease with its occurrence being the seventh highest cancer type worldwide. Musashi 2 (MSI2) is an RNA binding protein that primarily binds to transcription factor and cell cycle transcripts. Employing Circular Chromatin Conformation Capture (4C-seq) we identified regions within the 8q24 gene desert interacting with MYC when MSI2 is overexpressed. LINC00824 was found to be one such region that interacted with MYC. It was found that LINC00824 had several transcripts but only one transcript that was expressed in HCC tissues. RT-qPCR analysis of several hepatocyte cell types demonstrated the LINC00824 transcript is highly expressed in CD133? populations compared to CD133+ populations. RT-qPCR analysis of cells overexpressing MSI2 showed that there was an increase in LINC00824 presence compared to control cells. The RT-qPCR analysis also demonstrated that the LINC00824 transcript can be knocked down by antisense oligonucleotide (ASO). The data gathered in this study suggests that LINC00824 could be causing TIC differentiation and allowing for a permissive microenvironment for tumor growth and development.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

MSI2 level alters histone transcription rate in HepG2 cells

PDF

Musashi-2 promotes c-MYC expression through IRES-dependent translation and self-renewal ability in hepatocellular carcinoma

PDF

Polycomb repressive complex 2 subunit stabilizes NANOG to maintain self-renewal in hepatocellular carcinoma tumor-initiating stem-like cells

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

WAVE1 is a novel mediator of HPV trafficking to the Golgi apparatus

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

Tri-specific T cell engager immunotherapy targeting tumor initiating cells

PDF

Evaluating the impact of long non-coding RNAs on tumor mutational burden in cancer

PDF

SARS-CoV-2 interaction with the CD1d/NKT cell antigen presentation system

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

Lnc-RNA and WNT signal synergistically promotes self-renewal of tumor initiating stem-like cells via epigenetic regulation

PDF

c-JUN mediated alteration of SLC2A2 expression in hepatoma cell line HepG2

PDF

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

The role of amphisomes and Rab11 protein in release of mature hepatitis B viral particles and analysis of the arginine-rich C-terminal domain of HBV precore protein

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

UVRAG maintains genomic integrity

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

The C3ORF37/SRAP1: a candidate tumor suppressor that promotes removal of methylated DNA

Asset Metadata

Creator Carmona, Antonio (author)

Core Title Novel long non-coding RNA, LINC00824, contributes to stemness in hepatocytes

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Degree Conferral Date 2021-08

Publication Date 07/19/2021

Defense Date 06/04/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag 8q24,CD133,HCC,hepatocellular carcinoma,LINC00824,lncRNA,MSI2,Musashi2,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Machida, Keigo (committee chair), Lu, Zhipeng (committee member), Yuan, Weiming (committee member)

Creator Email antonio.carmona@usc.edu,carmona462@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15610519

Unique identifier UC15610519

Legacy Identifier etd-CarmonaAnt-9795

Document Type Thesis

Format application/pdf (imt)

Rights Carmona, Antonio

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu