University of Southern California Dissertations and Theses

In vitro lineage tracing of immortalized human alveolar epithelial cells

(USC Thesis Other)

In vitro lineage tracing of immortalized human alveolar epithelial cells

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content In Vitro Lineage Tracing of Immortalized Human Alveolar
Epithelial Cells
By
Ziben Zhou
A Thesis Presented to the
FACULTY OF THE USC KECK SCHOOL OF MEDICINE
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfil lment of the Requirement for the Degree
MASTER OF SCIENCE
(BIOCHEMISTRY AND MOLECULAR MEDICINE)
August 2021
Copyright 2021 Ziben Zhou
ii
Acknowledgements

Doing science is always teamwork, especially nowadays. Even the best scientists need to work as
team members to conduct the most efficient research. Not to mention I am just a young man at
the very early stage of my science career. Thus, I do need to say thank you to a lot of people.

First, I'd like to express my appreciation to all the lab members of the Offringa lab and
Marconett lab. Without your help, I won't make this far on the path of doing science. Especially,
Evelyn, you are such a role model to show me how to do science and guided me to design and
conduct all experiments. Chunli, you offered me a lot of help when I encountered countless
problems. You are the best lab technician I could ever imagine. And Tianchun, thanks for
providing me the precious emotional support when there were ups and downs. I love you so
much.

Second, of course, I want to say thank you to all my committee members. Thanks for being at
my defense. I feel excited to share with you my thesis research. Most importantly, I want to show
my most profound appreciation for Dr. Ite Offringa, my dearest PI. Even if we haven't met in
person for more than one year now, it is your support, passion, tolerance, and patience that
guided me through this unprecedented tough covid time.

Finally, I want to express my gratitude to my parents, who are in China and not reading this right
now, but I do hope they are. This is the ninth year of me not living close to them. For a
traditional Chinese family with only one child, this is not usual, and I know that they don't like
iii
this. But they still love me as much as they can and always respect my choices. I can't ask for
more from them, and I hope in one day I can be as supportive as they are right now when they
need me. I love you, mom and dad. You always say you feel proud to be my parents. But for me,
I feel proud to be your son.

我很爱你们。 That means I can't love you more.

iv
Table of Contents
Acknowledgements ........................................................................................................................ ii

List of Figures .................................................................................................................................. v

Abstract ........................................................................................................................................... vi

Chapter 1: Introduction .................................................................................................................... 1
1.1 Lung Adenocarcinoma .......................................................................................................... 1
1.2 Modeling Lung Adenocarcinoma .......................................................................................... 3
1.3 Lineage Tracing and Development of the Brainbow System ................................................ 6
1.4 AAVS1 Genetic Safe Harbor .............................................................................................. 12

Chapter 2: Materials and Methods ................................................................................................ 13
2.1 Materials .............................................................................................................................. 13
2.1.1 Plasmids ........................................................................................................................ 13
2.1.2 Cell line ........................................................................................................................ 13
2.1.3 Chemicals ..................................................................................................................... 13
2.2 Methods ............................................................................................................................... 13
2.2.1 Molecular Cloning ........................................................................................................ 14
2.2.2 Generation of A549-Brainbow-3.2 Cells ..................................................................... 14
2.2.3 Validation of Transgene Expression in A549-Brainbow3.2 cells ................................ 15

Chapter 3: Results .......................................................................................................................... 16
3.1 Design of the pAAVS1-P-CAG-Brainbow-3.2 Construct .................................................. 16
3.2 Targeted integration of the pAAVS1-P-CAG-Brainbow-3.2 plasmid in A549 cells .......... 17
3.3 Genotyping of A549-Brainbow-3.2 cell line ....................................................................... 18

Chapter 4: Discussion .................................................................................................................... 20

References ..................................................................................................................................... 24

Appendix I: Primers ...................................................................................................................... 27
Plasmid sequencing primers: ..................................................................................................... 27
Genotyping PCR primers: ......................................................................................................... 27

Appendix II: pAAVS1-P-CAG-Brainbow-3.2 sequence .............................................................. 28
v
List of Figures
Figure 1: Histological Classification of Lung Cancer ..................................................................... 1
Figure 2: The Distribution of Oncogenic Driver Genes in Lung Adenocarcinoma ........................ 3
Figure 3: Immortalization of human alveolar epithelial cells (AECs) ............................................ 5
Figure 4: AEC-ON in 2D and 3D cultures ...................................................................................... 6
Figure 5: Decision Tree for Choosing an Appropriate Lineage Tracing Strategy .......................... 7
Figure 6: Brainbow-1: Stochastic Recombination Using Incompatible lox Variants ..................... 9
Figure 7: Brainbow-2: Stochastic Recombination Using Cre-mediated Inversion ....................... 10
Figure 8: Design of Brainbow-3 System ....................................................................................... 11
Figure 9: Design of pAAVS1-P-CAG-Brainbow-3.2 plasmid ...................................................... 17
Figure 10: Schematic of Targeted Integration of pAAVS1-P-CAG-Brainbow-3.2 ...................... 18
Figure 11: PCR Genotyping of A549-Brainbow-3.2 monoclonal colonies #1 to #5 .................... 19
Figure 12: Using lineage tracing to examine cellular diversity within an alveolar-like spheroid . 22
Figure 13: Schematic of cancer initiation of AEC-ON-Brainbow-3.2-oncogene cells in 3D
spheroid assay ................................................................................................................................ 22

vi
Abstract

Lung cancer causes the most cancer-related deaths in the United States. Lung adenocarcinoma
(LUAD) is its most frequent subtype. Alveolar epithelial cells (AECs) are the cell of origin of
LUAD. The Offringa lab recently succeeded in immortalizing human AECs. These cells grow
like cobblestones in two dimensions (2D) and form alveolar-like organoids in 3D culture. An in
vitro cell lineage tracing tool that tracks the growth and differentiation of immortalized AECs
would be valuable in modeling organoid growth and in vitro LUAD development. Here, we
generated a Cre recombinase-inducible “rainbow” construct driven by a CAG promoter, for
incorporation into a “safe harbor” genomic site in AEC cells. The construct can provide 3
stochastically expressed colors upon Cre expression following adenovirus-Cre infection,
allowing visualization of organoid development and the interaction between cells in 3D culture.
We are testing the construct in A549 LUAD cells as we develop monoclonal recipient AECs.

1
Chapter 1: Introduction

1.1 Lung Adenocarcinoma

Lung cancer is the leading cause of cancer-related death worldwide, with more than 1.8 million
estimated deaths each year (Ferlay et al., 2021). Lung cancer is clinically grouped into small cell
lung cancer (SCLC, ~15%) and non-small cell lung cancer (NSCLC, ~85%). The most frequent
histological subtype of NSCLC is lung adenocarcinoma (LUAD) (Schabath & Cote, 2019).

Figure 1: Histological Classification of Lung Cancer
Modified from (Schabath & Cote, 2019)

Lung adenocarcinoma arises in the alveoli or air sacs that make up the distal lung. Alveoli are
formed by a simple, one-cell thick epithelium composed of type I and type II alveolar epithelial
cells (AECs). In the alveolar region, type I AECs, which cover ~95% of the total alveolar surface
2
with their thin squamous cell extensions, facilitate gas exchange. Type II AECs produce essential
surfactant and are the resident stem cells that provide renewal and repair functions in the distal
lung (Knudsen & Ochs, 2018). They are also considered a cell of origin of lung adenocarcinoma
(Xu et al., 2012).

Identifying potential oncogenes that drive the development of lung adenocarcinoma can be
beneficial in diagnosing and treating patients. In recent years, mutations in 3 particular genes
have been identified to inform the biology of at least 50% of all lung adenocarcinoma cases:
KRAS (Dogan et al., 2012), EGFR (Tateishi et al., 1990), and ALK (Soda et al., 2007) (Figure 2).
EGFR and ALK are now widely recognized as therapeutic targets for treating lung
adenocarcinoma patients (Sholl, 2015). Treatments targeting tyrosine kinase inhibitor (TKIs)
such as gefitinib targeting the EGFR mutation (Nan et al., 2017) and ALK inhibitors such as
crizotinib targeting the EML4-ALK fusion gene (Gridelli et al., 2014) have already been shown to
provide better survival outcomes than conventional chemotherapy.

Although basic research on lung adenocarcinoma has made significant progress in recent years,
the mortality of lung adenocarcinoma remains high compared to other cancer types. Even with
newly developed treatments targeting specific oncogenes, the 5-year overall survival (OS) rate of
lung adenocarcinoma patients can still be as low as 14.6% (Lin et al., 2016).

3

Figure 2: The Distribution of Oncogenic Driver Genes in Lung Adenocarcinoma
Modified from (Sholl, 2015)

To further our knowledge of lung adenocarcinoma, an in vitro model system that mimics the
formation and development of lung adenocarcinoma from its cell of origin, human alveolar
epithelial cells (AECs), can be beneficial. The next section summarizes some of the existing
immortalized human lung epithelial cell lines that serve as model systems for lung
carcinogenesis.

1.2 Modeling Lung Adenocarcinoma

In order to generate non-cancer cell models to mimic lung adenocarcinoma, cells should be able
to survive long enough under ex vivo conditions. Thus, cells must overcome cellular senescence,
4
an irreversible proliferative arrest, and telomere shortening, which (in the absence of active
telomerase) happens with each round of cell division and eventually limits the proliferation of
cells. These are the two challenges that prevent cells from being immortal.

A traditional way to model lung carcinogenesis is to use immortalized human bronchial
epithelial cells (Lundberg et al., 2002). In 1988, Reddel et al. infected human bronchial epithelial
cells with Ad12-SV40 Large T hybrid virus and created cell line BEAS-2B, which exhibited
unlimited proliferative potential (Reddel et al., 1988). The generation of this immortalized cell
line exemplified that transduction with SV40 Large T antigen is a feasible way for lung epithelial
cell immortalization. In 2002, Lundberg et al. reported that the introduction of oncogene HRAS
and KRAS in immortalized human bronchial epithelial cells resulted in the formation of
xenograft tumors that had histological features similar to lung squamous cell carcinoma
(Lundberg et al., 2002), thus providing a non-cancer cell model mimicking lung carcinogenesis.
However, the modeling system discussed above was derived from bronchial epithelial cells in the
airway region. Thus, it is not a suitable tool for modeling lung adenocarcinoma, which is
believed to originate from type II alveolar epithelial cells of the alveoli in the distal lung region
(Xu et al., 2012).

Due to the notable absence of a proper non-cancer cell system modeling lung adenocarcinoma,
Tran et al. in 2020 generated an immortalized alveolar epithelial cell line (AEC-ON) by first
expanding isolated human type II alveolar epithelial cells in media containing ROCK inhibitor
(Y-27632) and then transducing them with viral oncogene SV40 Large T antigen together with a
green fluorescent protein (GFP) sequence (Figure 3, Tran et al., 2020).
5

Figure 3: Immortalization of human alveolar epithelial cells (AECs)
A) Purified AT2 cells were cultured in media containing ROCK inhibitor (Y-27632) for expansion, and then B) transduced with
SV40 LgT-GFP. Successful transduction was confirmed by observation of green fluorescent protein under the microscope.
(Tran et al., 2020)

In 2-dimention (2D) culture, the AEC-ON cells grow as epithelial monolayers expressing lung
progenitor markers SOX9 and SOX2 (Figure 4a, Tran et al., 2020), when co-cultured in a 3-
dimention (3D) spheroid assay with mouse fibroblast, these cells form an intricate alveolar-like
organoid expressing the mature AEC type I cell marker AQP5 (Figure 4b, (Tran et al., 2020).
The formation of the organoid was also previously reported as a phenotype for type II AECs
(Barkauskas et al., 2013). Therefore, the AEC-ON cell line is a valuable tool to model the distal
lung in vitro. More importantly, it shows great potential as a non-cancer cell system to model
distal-lung-originated lung adenocarcinoma, once an exogenous oncogenic driver gene, such as
KRAS, is transfected into the cell line and expressed.

In order to understand the formation of the alveolar-like organoids by AEC-ON cells in 3D, a
tool that would enable us to track and visualize the proliferation and development of AEC-ON
6
cells would be very valuable. In the next section, lineage tracing, a technology often used to
identify and track cell populations, will be discussed.

Figure 4: AEC-ON in 2D and 3D cultures
a) AEC-ON cells grown in 2D express lung progenitor markers SOX9 and SOX2. b) AEC-ON cells form alveolar-like organoids
in 3D culture and express mature AEC marker AQP5.
(Tran et al., 2020)

1.3 Lineage Tracing and Development of the Brainbow System

Lineage tracing, by definition, is to identify all progeny of a single cell or a group of cells.
In the 1870s, Charles Otis Whitman observed leech embryo division at early stage and tracked
the cell fate of individual cells from the one-cell stage to the germ layer. This work suggested
that the fate of each cell may not be stochastic as previously believed but instead is assigned to
each cell following specific rules. Although the development of lineage tracing started as early as
the 19
th
century, it is now a widely used tool to keep track of cell proliferation and
7
developmental processes, especially in stem cell research and in modeling cellular heterogeneity
in cancer (Hsu, 2015).

In current lineage tracing experiments, a single cell is irreversibly marked in such a way that the
mark is passed to all of the cell’s all progeny, thus providing information about the number of
descendants of the single parental cell, their location, and their differentiation status. Some of the
available lineage tracing methods include direct observation (CHILD, 1906), labeling cells with
dye (Axelrod, 1979), introduction of genetic markers by transfection or transduction (Holt et al.,
1990), transplantation of cells or tissues (Notta et al., 2011), genetic mosaics (Schmidt et al.,
1987) and cell marking (with one or more reporter genes) via genetic recombination (Livet et al.,
2007). An appropriate lineage tracing strategy could be chosen based on several factors
(Kretzschmar & Watt, 2012).

Figure 5: Decision Tree for Choosing an Appropriate Lineage Tracing Strategy
8
Modified from (Kretzschmar & Watt, 2012)

Among available lineage tracing tools, Brainbow, a Cre-Lox recombination based multicolor
labeling tool, was first introduced in 2007 for detailed analysis of in vivo neuron network
architecture. The Brainbow-1 system (Figure 6,Livet et al., 2007), once stably transfected into
cells, uses Cre-mediated excision between pairs of incompatible lox sites to stochastically give
two (Brainbow-1.0) or three (Brainbow-1.1) exclusive color expression outcomes to label cells
(Livet et al., 2007).

9
a Brainbow-1.0

b Brainbow-1.1

Figure 6: Brainbow-1: Stochastic Recombination Using Incompatible lox Variants
a) The Brainbow-1.0 system utilizes two incompatible pairs of lox sites. When Cre protein is present, the sequence between a
random pair of loxP sites is excised to express either yellow fluorescent protein (YFP) or cyan fluorescent protein (M-CFP). b)
The Brainbow-1.1 system utilizes three incompatible pairs of loxP sites. When Cre particles are present, the sequence between a
random pair of lox sites is excised to express either red fluorescent protein (RFP), yellow fluorescent protein (YFP) or cyan
fluorescent protein (M-CFP).
(Livet et al., 2007)

While the Brainbow-1 system utilizes Cre-mediated deletion, the Brainbow-2 system (Figure 7,
Livet et al., 2007) employed Cre-mediated inversion (Brainbow-2.0) to produce two random
color outcomes depending on which fluorescent protein sequence remains closest to the promoter
10
region after Cre-mediated recombination. The Brainbow-2.1 system then combined Cre-
mediated deletion and inversion into the same construct, eventually enabling four stochastically
expressed colors for cell labeling (Livet et al., 2007).

a Brainbow-2.0

b. Brainbow-2.1

Figure 7: Brainbow-2: Stochastic Recombination Using Cre-mediated Inversion
a) The Brainbow-2.0 system utilizes one pair of loxP sites. When Cre protein is present, the sequence between the loxP sites is
reversed to express either red fluorescent protein (RFP) or cyan fluorescent protein (M-CFP). b) The Brainbow-2.1 system
utilizes 2 pairs of loxP sites, when Cre particles are present, sequence between a random pair of loxP site is either excised or
reversed to give one of four outcomes: red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein
(M-CFP), or green fluorescent protein (GFP). pA, polyadenylation sequence.
(Livet et al., 2007)

11

To further refine the Brainbow system, Cai et al. in 2013 released the design of the Brainbow-3
system (Figure 8). Different fluorescent proteins with minimal spectral overlap and minimal
sequence homology were chosen (Brainbow-3.0) to ensure that fluorescent proteins are
antigenically distinct and minimize spectral interference. To address the concern that a “default”
XFP might be expressed in most cells and reduce spectral diversity among recombined cells, an
extra pair of lox sites and a mutated version (no fluorescence) of yellow fluorescent protein (phi-
YFP) was added to the promoter region (Brainbow-3.1) to make transfected cells “by default”
colorless yet still detectable with anti-phi-YFP before Cre-mediated recombination. Finally, a
sequence of Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) that
stabilizes mRNA structure was added following each fluorescent protein (Brainbow 3.2) to
improve transgene expression (Cai et al., 2013).

Figure 8: Design of Brainbow-3 System
The Brainbow-3.0 version utilized fluorescent proteins with minimal spectral overlap. Brainbow-3.1 contains a mutated version
of Phi-YFP to make cells after transfection “by default” colorless. In the Brainbow-3.2 system, WPRE sequences were added to
enhance mRNA stability. P, LoxP; 2, Lox2272; N, LoxN; W, WPRE; pA, polyadenylation sequence.
(Cai et al., 2013)

12

1.4 AAVS1 Genetic Safe Harbor

Silencing and variegated transgene expression are problems that often happen after the
conventional transfection of exogenous genes into human cells. The fact that a random number
of copies of a gene are integrated into random positions of the cell genome makes it difficult to
generate cell lines with robust and stable transgene expression.

The Adeno-associated virus integration site 1 (AAVS1) locus, within the PPP1R12C gene on
human chromosome 19, was first described as a preferred site for adeno-associated virus
integration (Kotin et al., 1992). In 2008, Smith et al. found that targeted integration of genes into
human AAVS1 locus allows robust and persistent transgene expression (Smith et al., 2008),
potentially due to the potent insulator sequence identified at the locus (Ogata et al., 2003). Since
the AAVS1 locus is not known to be associated with any human disease, the site is now
considered a “genetic safe harbor” for transgene targeting. Thus, several methods, including ones
based on zinc finger proteins (Hockemeyer et al., 2009), TALEN (Hockemeyer et al., 2011), and
CRISPR-Cas9 (Oceguera-Yanez et al., 2016), have been developed to enable targeted integration
into this genome location.

Taking all the information together, I believe introduction of Brainbow-3.2, a lineage tracing
system, into the AAVS1 human genetic safe harbor of immortalized alveolar epithelial cells
(AEC-ON) appears to be a strong choice to provide insight into alveolar-like organoid formation
and will provide a more powerful model to study lung adenocarcinoma development.

13
Chapter 2: Materials and Methods

2.1 Materials

2.1.1 Plasmids
For molecular cloning:
• pThy1-Brainbow-3.2 (Addgene Plasmid #45179): Provides Brainbow-3.2 cassette
• Gateway™ pDONR™221 Vector (intermediate cloning vector)
• pAAVS1-P-CAG-DEST (Addgene Plasmid #80490): Gateway DEST vector, provides
puromycin resistance gene and universal CAG promoter.
For co-transfection and targeted integration:
• pXAT2 (Addgene Plasmid #80494): Cas9 expressing with single gRNA targeting the
AAVS1 locus
2.1.2 Cell line
• A549 lung adenocarcinoma cells (ATCC#: CCL-185)
2.1.3 Chemicals
• Puromycin (Santa Cruz Biotechnology, CAS# 58-58-2)
• RPMI 1640 (Corning, cat#: 10-040-CV, lot#: 09921007)
• Fetal bovine serum (GenClone, cat#: 25-514, lot#: P083165)
• Penicillin-streptomycin solution (GenClone, cat#: 25-512, lot#: N634S006W)
• Trypsin-Versene Mixture (Lonza, cat#: 17-161E)
• Fugene HD transfection reagent (Promega, cat#: E2311)
2.2 Methods

14
2.2.1 Molecular Cloning

Through Gateway cloning (Thermo Fisher BP Clonase 11789020 and LR Clonase 11791020),
the Brainbow-3.2 construct from neuron-specific plasmid pThy1-Brainbow3.2 (Addgene
#45179) was transferred into empty backbone plasmid pAAVS1-P-CAG-DEST (Addgene
#80490), which contains a puromycin-resistance gene and a universal CAG promoter. The final
product pAAVS1-P-CAG-Brainbow-3.2 (El-Nachef et al., 2020) had the CAG-Brainbow3.2+
Puro
R
construct flanked by two AAVS1 locus homology arms to facilitate targeted integration of
the CAG driven Brainbow-3.2 construct into the AAVS1 human genetic safe harbor for robust
and stable transgene expression (El-Nachef et al., 2020; Oceguera-Yanez et al., 2016).

2.2.2 Generation of A549-Brainbow-3.2 Cells

A549 cells were cultured in RPMI 1640 medium (Corning) supplemented with 10% of fetal
bovine serum (GenClone) and 1% of penicillin-streptomycin solution (10,000 U/mL)
(GenClone). Cell passaging was done with trypsin versene mixture (Lonza). Before transfection,
cells were plated into a 96-well plate at 70% to 80% confluency. To integrate the Brainbow
construct into the AAVS1 locus, pXAT2 (Addgene#80494), a plasmid encoding Cas9 protein
and a guide RNA sequence targeting the AAVS1 locus, was co-transfected with pAAVS1-P-
CAG-Brainbow-3.2 into A549 cells. Stable transfection selection was done with 0.625ug/mL
puromycin (Santa Cruz Biotechnology).

15
2.2.3 Validation of Transgene Expression in A549-Brainbow3.2 cells

After 10-12 days of puromycin (Santa Cruz Biotechnology) selection, several monoclonal
colonies were observed, each in an isolated well on the 96-well plate. Colonies were then picked
and expanded. Genomic DNA was extracted (Qiagen 69504) and screened using PCR reaction
and gel electrophoresis.

16
Chapter 3: Results

3.1 Design of the pAAVS1-P-CAG-Brainbow-3.2 Construct

The pAAVS1-P-CAG-Brainbow-3.2 plasmid construct (Fig. 9) was generated based on the
Brainbow-3.2 system (Cai et al., 2013). The Brainbow-3.2 system has, in the first position, a
mutated version (no fluorescence) of yellow fluorescent protein (Phi-YFP), followed by three
distinct fluorescent protein sequences (mOrange2, EGFP, and mKate2) flanked by incompatible
pairs of loxP sites. Driving the expression of the Brainbow-3.2 system is a universal CAG
promoter (CMV early enhancer, chicken β-actin promoter, and rabbit β-globin splice acceptor),
allowing robust and stable transgene expression across different cell types. A puromycin
resistance gene was included in the construct for stable transfection selection purposes. Flanking
the gene expression cassette were two homology arms (HA-L and HA-R) complementary to the
human AAVS1 genetic safe harbor sequence to facilitate targeted integration. Once the
pAAVS1-CAG-P-Brainbow-3.2 construct is transfected into the cell genome and selected by
puromycin, cells will be colorless by default because of the mutated fluorescence-free Phi-YFP.
Upon adenovirus-mediated Cre recombinase treatment, the DNA sequence between a random
pair of lox sites will be excised, thus stochastically and permanently marking the cell with a
unique color.

17

Figure 9: Design of pAAVS1-P-CAG-Brainbow-3.2 plasmid
pAAVS1-P-CAG-Brainbow-3.2 allows random expression of 3 distinct fluorescent proteins upon adeno-Cre treatment. If the
sequence between the loxP pair is excised, the outcome [1] will be that mOrange2 is expressed. The same rule also applies to
lox2272 sites to express EGFP (outcome [2]) and loxN sites to express mKate2 (outcome [3]).

3.2 Targeted integration of the pAAVS1-P-CAG-Brainbow3.2 plasmid in A549 cells

Ideally our immortalized alveolar epithelial cells (AEC-ON) cells would be our model system of
choice, but they currently contain both GFP and tdTOMATO as an artifact of the method in
which they were immortalized, rendering the lineage tracing via Brainbow3.2 impossible until
this issue is addressed. Therefore, we utilized colorless A549 lung adenocarcinoma cells which
were readily available to transfect as a model for what we will later perform in colorless AEC-
ON cells. To target the AAVS1 human genetic safe harbor for stable and robust transgene
expression, the pAAVS1-P-CAG-Brainbow3.2 plasmid was co-transfected with pXAT2 that
encodes for a Cas9 protein directed by a guide RNA targeting the AAVS1 locus, thus creating a
double-strand break (DSB) at the AAVS1 human genetic safe harbor. Homology directed repair
(HDR) then uses pAAVS1-P-CAG-Brainbow-3.2 as a template to repair the double-strand break.
The end result is integration of the Brainbow-3.2 construct into the AAVS1 locus (Figure 10).
18

Figure 10: Schematic of Targeted Integration of pAAVS1-P-CAG-Brainbow-3.2
After a double-strand break is created by the gRNA-directed Cas9 protein, the cell’s endogenous homology-directed repair
mechanism uses pAAVS1-P-CAG-Brainbow-3.2 as a template strand for repair, resulting in targeted integration into the AAVS1
locus.

3.3 Genotyping of A549-Brainbow-3.2 cell line

After puromycin selection of monoclonal colonies for Puro
R
+ cells, genomic DNA was extracted
from each monoclonal colony (Qiagen 69504). PCR primer pairs were designed to determine the
presence or absence of Brainbow-3.2 knock-in (Figure 11A) and the presence or absence of
wild-type AAVS1 locus (Figure 11B). The screening PCR reaction confirmed that the CAG-
driven Brainbow-3.2 gene expression cassette was integrated into the AAVS1 locus in
monoclonal colonies #1, #3, and #5 (Figure 11 C-D).

19
With the work performed in my thesis, I have successfully integrated a desired lineaging tracing
system (Brainbow-3.2) into the AAVS1 human genetic safe harbor site of A549 cells for robust
and stable transgene expression and thus provided a tool with great potential to study the
initiation of lung adenocarcinoma once cooperating with the colorless version of immortalized
AEC cells.

Figure 11: PCR Genotyping of A549-Brainbow-3.2 monoclonal colonies #1 to #5
A) Primer 5’F was designed to sit outside the left homology arm, while primer 5’R was designed to be included in the pAAVS1-
P-CAG-Brainbow-3.2 plasmid. Thus, PCR using primer pair 5’F and 5’R (product size 1.2kb) could determine if the intended
construct was integrated into the AAVS1 locus. B) Primer 5’F was designed to sit outside the left homology arm, while primer
3’R was designed to sit on the right homology arm. PCR using primer pair 5’F and 3’R (product size 1.4kb) could result in a
band only if wild type AAVS1 locus is present. If targeted integration happened, the product would be too big to be amplified. C-
D) PCR results showed that in monoclonal colony #1, #3, and #5 the targeted integration happened. While in colony #1 appears
to show a homozygous insertion in which wilt type AAVS1 no longer exists, colonies #3 and #5 appear to be heterozygous for
the insertion. Ac and Bc are controls using wild type A549 genomic DNA. A1-A5 and B1-B5 means A and B reactions for
monoclonal colonies #1 to #5.

20
Chapter 4: Discussion

Lung adenocarcinoma has remained a significant challenge to human health worldwide. The lack
of an efficient human non-cancer cell system to model the development and progression of lung
adenocarcinoma has hampered scientists in obtaining a more profound understanding of the
initiation and development of lung adenocarcinoma. Conventionally, scientists have tried to model
lung carcinogenesis by introducing oncogenic driver genes, such as KRAS and HRAS, into
immortalized bronchial epithelial cells. This system is useful to mimic the initiation and
development of lung squamous cell carcinoma (LUSC) (Lundberg et al., 2002). However, it is not
suitable when it comes to modeling lung adenocarcinoma. The reason is simple: these two types
of lung carcinoma originate in different lung compartments and arise from different cell types.
(Borthwick et al., 2001; Xu et al., 2012).

The most recently immortalized alveolar epithelial cell line (AEC-ON) (Tran et al., 2020) seems
to be a promising tool. Unlike other systems using immortalized airway epithelial cells to model
lung carcinogenesis (Reddel et al., 1988), the SV40 large T viral oncogene immortalized AEC-
ON cell line was directly derived from human type II alveolar epithelial cells (Xu et al., 2012),
which are the presumed cell of origin of lung adenocarcinoma. AEC-ON cells grow in a monolayer
in 2D but form alveolar-like organoids in 3D culture. Introducing the Brainbow-3.2 lineage tracing
system into cell lines like AEC-ON will provide insight into 3-dimensional organoid formation
and provide a better model to study lung adenocarcinoma development.

21
Through genotyping, we were able to show the successful integration of the Brainbow-3.2
construct into the intended AAVS1 human genetic safe harbor locus of A549 lung adenocarcinoma
cells. Our next step will be to further characterize the A549-Brainbow-3.2 cell line. First, PCR will
be used to screen the the 3’ end of the construct to confirm proper integration, similar to what was
done for the 5’ end. The PCR product of the whole integrated sequence needs to be sent out for
sequencing to ensure all the integrated sequences are in the correct order without mutations.
Southern blotting experiments could be done to determine whether the Brainbow-3.2 system was
homozygously or heterozygously integrated. After genotyping of the cell line, A549-Brainbow-
3.2 cells will be incubated with varying multiplicities of infection (MOI) of adeno-Cre to activate
color expression. The result will be assessed under fluorescent microscopy for the visualization of
color expression.

In the future, we plan to transduce pAAVS1-P-CAG-Brainbow-3.2 with the pXAT2 Cas9-
containing plasmid into a colorless version of immortalized alveolar epithelial cells (AEC-ON)
(Tran et al., 2020). We then can use these cells to study organoid formation by treating them with
different MOIs of adenovirus-Cre and visualizing the color pattern of the resulting alveolar-like
spheroid (Figure 12). This will allow us to determine whether the spheroid originated from
numerous different immortalized alveolar epithelial cells or a few cells that proliferated
extensively.

22

Figure 12: Using lineage tracing to examine cellular diversity within an alveolar-like spheroid

We also plan to create a non-cancer cell system to model lung adenocarcinoma initiation by
introducing Cre-activatable oncogenic driver genes such as mutant KRAS or EGFR, which are
frequently found in primary lung adenocarcinoma tumors, into AEC-ON-Brainbow-3.2 cells
(Tran et al., 2020). When culturing these AEC-ON-Brainbow-3.2-oncogene cells in the 3D
spheroid assay, we plan to activate the Brainbow color expression system as well as known
oncogenic driver genes at the same time with relatively low MOIs. Thus, we can limit the
expression of oncogenes to a small number of cells, and with the help of the Brainbow-3.2
system, track and monitor the initiation of tumors from the cancerous cells in vitro (Figure 13).

Figure 13: Schematic of cancer initiation of AEC-ON-Brainbow-3.2-oncogene cells in 3D spheroid assay

23
Furthermore, the gene expression cassette we have generated, which is driven by the universal
CAG promoter and targets the human AAVS1 locus also provides a great tool for other lung
adenocarcinoma-related research. With the work performed in my thesis, we are now able to
perform stable and robust transgene expression in A549 cells by switching other intended genes
with the Brainbow-3.2 sequence.

24
References

Axelrod, D. (1979). Carbocyanine dye orientation in red cell membrane studied by microscopic
fluorescence polarization. Biophys J, 26(3), 557-573. https://doi.org/10.1016/S0006-
3495(79)85271-6
Barkauskas, C. E., Cronce, M. J., Rackley, C. R., Bowie, E. J., Keene, D. R., Stripp, B. R.,
Randell, S. H., Noble, P. W., & Hogan, B. L. (2013). Type 2 alveolar cells are stem cells
in adult lung. J Clin Invest, 123(7), 3025-3036. https://doi.org/10.1172/JCI68782
Borthwick, D. W., Shahbazian, M., Krantz, Q. T., Dorin, J. R., & Randell, S. H. (2001).
Evidence for stem-cell niches in the tracheal epithelium. Am J Respir Cell Mol Biol,
24(6), 662-670. https://doi.org/10.1165/ajrcmb.24.6.4217
Cai, D., Cohen, K. B., Luo, T., Lichtman, J. W., & Sanes, J. R. (2013). Improved tools for the
Brainbow toolbox. Nat Methods, 10(6), 540-547. https://doi.org/10.1038/nmeth.2450
CHILD, C. M. (1906). The Organization and Cell-lineage of the Ascidian Egg. Science, 23(583),
340-344. https://doi.org/10.1126/science.23.583.340
Dogan, S., Shen, R., Ang, D. C., Johnson, M. L., D'Angelo, S. P., Paik, P. K., Brzostowski, E.
B., Riely, G. J., Kris, M. G., Zakowski, M. F., & Ladanyi, M. (2012). Molecular
epidemiology of EGFR and KRAS mutations in 3,026 lung adenocarcinomas: higher
susceptibility of women to smoking-related KRAS-mutant cancers. Clin Cancer Res,
18(22), 6169-6177. https://doi.org/10.1158/1078-0432.CCR-11-3265
El-Nachef, D., Shi, K., Beussman, K. M., Martinez, R., Regier, M. C., Everett, G. W., Murry, C.
E., Stevens, K. R., Young, J. E., Sniadecki, N. J., & Davis, J. (2020). A Rainbow
Reporter Tracks Single Cells and Reveals Heterogeneous Cellular Dynamics among
Pluripotent Stem Cells and Their Differentiated Derivatives. Stem Cell Reports, 15(1),
226-241. https://doi.org/10.1016/j.stemcr.2020.06.005
Ferlay, J., Colombet, M., Soerjomataram, I., Parkin, D. M., Piñeros, M., Znaor, A., & Bray, F.
(2021). Cancer statistics for the year 2020: An overview. Int J Cancer.
https://doi.org/10.1002/ijc.33588
Gridelli, C., Peters, S., Sgambato, A., Casaluce, F., Adjei, A. A., & Ciardiello, F. (2014). ALK
inhibitors in the treatment of advanced NSCLC. Cancer Treat Rev, 40(2), 300-306.
https://doi.org/10.1016/j.ctrv.2013.07.002
Hockemeyer, D., Soldner, F., Beard, C., Gao, Q., Mitalipova, M., DeKelver, R. C., Katibah, G.
E., Amora, R., Boydston, E. A., Zeitler, B., Meng, X., Miller, J. C., Zhang, L., Rebar, E.
J., Gregory, P. D., Urnov, F. D., & Jaenisch, R. (2009). Efficient targeting of expressed
and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol,
27(9), 851-857. https://doi.org/10.1038/nbt.1562
Hockemeyer, D., Wang, H., Kiani, S., Lai, C. S., Gao, Q., Cassady, J. P., Cost, G. J., Zhang, L.,
Santiago, Y., Miller, J. C., Zeitler, B., Cherone, J. M., Meng, X., Hinkley, S. J., Rebar, E.
J., Gregory, P. D., Urnov, F. D., & Jaenisch, R. (2011). Genetic engineering of human
pluripotent cells using TALE nucleases. Nat Biotechnol, 29(8), 731-734.
https://doi.org/10.1038/nbt.1927
Holt, C. E., Garlick, N., & Cornel, E. (1990). Lipofection of cDNAs in the embryonic vertebrate
central nervous system. Neuron, 4(2), 203-214. https://doi.org/10.1016/0896-
6273(90)90095-w
25
Hsu, Y. C. (2015). Theory and Practice of Lineage Tracing. Stem Cells, 33(11), 3197-3204.
https://doi.org/10.1002/stem.2123
Knudsen, L., & Ochs, M. (2018). The micromechanics of lung alveoli: structure and function of
surfactant and tissue components. Histochem Cell Biol, 150(6), 661-676.
https://doi.org/10.1007/s00418-018-1747-9
Kotin, R. M., Linden, R. M., & Berns, K. I. (1992). Characterization of a preferred site on human
chromosome 19q for integration of adeno-associated virus DNA by non-homologous
recombination. EMBO J, 11(13), 5071-5078.
Kretzschmar, K., & Watt, F. M. (2012). Lineage tracing. Cell, 148(1-2), 33-45.
https://doi.org/10.1016/j.cell.2012.01.002
Lin, J. J., Cardarella, S., Lydon, C. A., Dahlberg, S. E., Jackman, D. M., Jänne, P. A., & Johnson,
B. E. (2016). Five-Year Survival in EGFR-Mutant Metastatic Lung Adenocarcinoma
Treated with EGFR-TKIs. J Thorac Oncol, 11(4), 556-565.
https://doi.org/10.1016/j.jtho.2015.12.103
Livet, J., Weissman, T. A., Kang, H., Draft, R. W., Lu, J., Bennis, R. A., Sanes, J. R., &
Lichtman, J. W. (2007). Transgenic strategies for combinatorial expression of fluorescent
proteins in the nervous system. Nature, 450(7166), 56-62.
https://doi.org/10.1038/nature06293
Lundberg, A. S., Randell, S. H., Stewart, S. A., Elenbaas, B., Hartwell, K. A., Brooks, M. W.,
Fleming, M. D., Olsen, J. C., Miller, S. W., Weinberg, R. A., & Hahn, W. C. (2002).
Immortalization and transformation of primary human airway epithelial cells by gene
transfer. Oncogene, 21(29), 4577-4586. https://doi.org/10.1038/sj.onc.1205550
Nan, X., Xie, C., Yu, X., & Liu, J. (2017). EGFR TKI as first-line treatment for patients with
advanced EGFR mutation-positive non-small-cell lung cancer. Oncotarget, 8(43), 75712-
75726. https://doi.org/10.18632/oncotarget.20095
Notta, F., Doulatov, S., Laurenti, E., Poeppl, A., Jurisica, I., & Dick, J. E. (2011). Isolation of
single human hematopoietic stem cells capable of long-term multilineage engraftment.
Science, 333(6039), 218-221. https://doi.org/10.1126/science.1201219
Oceguera-Yanez, F., Kim, S. I., Matsumoto, T., Tan, G. W., Xiang, L., Hatani, T., Kondo, T.,
Ikeya, M., Yoshida, Y., Inoue, H., & Woltjen, K. (2016). Engineering the AAVS1 locus
for consistent and scalable transgene expression in human iPSCs and their differentiated
derivatives. Methods, 101, 43-55. https://doi.org/10.1016/j.ymeth.2015.12.012
Ogata, T., Kozuka, T., & Kanda, T. (2003). Identification of an insulator in AAVS1, a preferred
region for integration of adeno-associated virus DNA. J Virol, 77(16), 9000-9007.
https://doi.org/10.1128/jvi.77.16.9000-9007.2003
Reddel, R. R., Ke, Y., Gerwin, B. I., McMenamin, M. G., Lechner, J. F., Su, R. T., Brash, D. E.,
Park, J. B., Rhim, J. S., & Harris, C. C. (1988). Transformation of human bronchial
epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or
transfection via strontium phosphate coprecipitation with a plasmid containing SV40
early region genes. Cancer Res, 48(7), 1904-1909.
Schabath, M. B., & Cote, M. L. (2019). Cancer Progress and Priorities: Lung Cancer. Cancer
Epidemiol Biomarkers Prev, 28(10), 1563-1579. https://doi.org/10.1158/1055-9965.EPI-
19-0221
Schmidt, G. H., Blount, M. A., & Ponder, B. A. (1987). Immunochemical demonstration of the
clonal organization of chimaeric mouse epidermis. Development, 100(3), 535-541.
26
Sholl, L. M. (2015). Biomarkers in lung adenocarcinoma: a decade of progress. Arch Pathol Lab
Med, 139(4), 469-480. https://doi.org/10.5858/arpa.2014-0128-RA
Smith, J. R., Maguire, S., Davis, L. A., Alexander, M., Yang, F., Chandran, S., ffrench-Constant,
C., & Pedersen, R. A. (2008). Robust, persistent transgene expression in human
embryonic stem cells is achieved with AAVS1-targeted integration. Stem Cells, 26(2),
496-504. https://doi.org/10.1634/stemcells.2007-0039
Soda, M., Choi, Y. L., Enomoto, M., Takada, S., Yamashita, Y., Ishikawa, S., Fujiwara, S.,
Watanabe, H., Kurashina, K., Hatanaka, H., Bando, M., Ohno, S., Ishikawa, Y.,
Aburatani, H., Niki, T., Sohara, Y., Sugiyama, Y., & Mano, H. (2007). Identification of
the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature,
448(7153), 561-566. https://doi.org/10.1038/nature05945
Tateishi, M., Ishida, T., Mitsudomi, T., Kaneko, S., & Sugimachi, K. (1990).
Immunohistochemical evidence of autocrine growth factors in adenocarcinoma of the
human lung. Cancer Res, 50(21), 7077-7080.
Tran, E., Shi, T., Li, X., Chowdhury, A. Y., Jiang, D., Liu, Y., Wang, H., Yan, C., Wallace, W.
D., Lu, R., Ryan, A. L., Marconett, C. N., Zhou, B., Borok, Z., & Offringa, I. A. (2020).
Development of novel in vitro human alveolar epithelial cell models to study
distal lung biology and disease. bioRxiv, 2020.2012.2025.424415.
https://doi.org/10.1101/2020.12.25.424415
Xu, X., Rock, J. R., Lu, Y., Futtner, C., Schwab, B., Guinney, J., Hogan, B. L., & Onaitis, M. W.
(2012). Evidence for type II cells as cells of origin of K-Ras-induced distal lung
adenocarcinoma. Proc Natl Acad Sci U S A, 109(13), 4910-4915.
https://doi.org/10.1073/pnas.1112499109

27
Appendix I: Primers

Plasmid sequencing primers:

pCAG-F: 5’-GCAACGTGCTGGTTATTGTG -3’
Bglob-pA-R: 5’- TTTTGGCAGAGGGAAAAAGA -3’
mOrange2 primer: 5’- CCAGTAATGACCTCAGAACTCC -3’
puro-F: 5’- GCAACCTCCCCTTCTACGAGC -3’
puro-R: 5’- GTGGGCTTGTACTCGGTCAT -3’
T7: 5’- TAATACGACTCACTATAGGG -3’
M13F: 5’- TGTAAAACGACGGCCAGT -3’

Genotyping PCR primers:

• 5’ Knock-in (1.2kb product):
5’F primer: TCGACTTCCCCTCTTCCGATG
5’R primer: GAGCCTAGGGCCGGGATTCTC
• 3’ Knock-in (0.9kb product):
3’F primer: ACCCAGCTTTCTTGTACAAAGT,
3’R primer: CTCAGGTTCTGGGAGAGGGTAG
• WT allele (1.4kb product):
5’F primer: TCGACTTCCCCTCTTCCGATG
3’R primer: CTCAGGTTCTGGGAGAGGGTAG (Oceguera-Yanez et al., 2016).
28
Appendix II: pAAVS1-P-CAG-Brainbow3.2 sequence

gcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaat
gcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcac
ccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatcc
ttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaa
gagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagta
agagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg
cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacacc
acgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatg
gaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtc
tcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaa
cgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaa
cttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcaga
ccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtg
gtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagcc
gtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataa
gtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccag
cttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggac
aggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgg
gtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacg
gttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgatac
cgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccg
cgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagct
cactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagct
atgaccatgattacgccaagctcgaaattaaccctcactaaagggaacaaaagctgtgctttctctgaccagcattctctcccctgggcctgtg
ccgctttctgtctgcagcttgtggcctgggtcacctctacggctggcccagatccttccctgccgcctccttcaggttccgtcttcctccactcc
ctcttccccttgctctctgctgtgttgctgcccaaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcgg
atcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctg
gggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcacc
gtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtgga
ttcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatct
tccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcct
gtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtgg
ggcaagcttctgacctcttctcttcctcccacagggcctcgagagatctggcagcggagagggcagaggaagtcttctaacatgcggtgac
gtggaggagaatcccggccctaggctcgagatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggcc
gtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagc
tgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccac
gccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagca
acagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccaggg
caagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgcc
ccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgaccc
gcaagcccggtgcctgatctagagggcccgtttaaacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctc
ccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcatt
29
ctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctat
gggctagcggtggcggcctcgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttcc
gcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagta
acgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagta
cgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatcta
cgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtattta
tttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcgg
ggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcg
gcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccccgctccgcgccgcctcgcgc
cgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggttt
aatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggccctttgtgcggggggagcggctcggggggtgc
gtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgt
gcgctccgcagtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgc
gtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttg
ctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtg
ggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctg
tcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccg
aaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagg
gccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacgg
ggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgg
gcaacgtgctggttattgtgctgtctcatcattttggcaaagaattcgcggccgcggtaccggcgcgccggatcctgcaggttatcacaagttt
gtacaaaaaagcaggct(attB1)ttaaaggaacgcacgtaactataacggtcctaaggtagcgaacctaggataacttcgtatagcataca
ttatacgaagttat(LoxP)cggcgcgcataacttcgtataggatactttatacgaagttat(Lox2272)caagcgctataacttcgtatagt
ataccttatacgaagttat(LoxN)ctgatatcgccaccatggctcctaagaagaagaggaaggtgatgagcagcggcgccctgctgttcc
acggcaagatcccctacgtggtggagatggagggcaatgtggatggccacaccttcagcatccgcggcaagggctacggcgatgccag
cgtgggcaaggtggatgcccagttcatctgcaccaccggcgatgtgcccgtgccctggagcaccctggtgaccaccctgaccgcaggcg
cccagtgcttcgccaagtacggccccgagctgaaggatttctacaagagctgc(phiYFP)atgcccgatggctacgtgcaggagcgca
ccatcaccttcgagggtgatggcaatttcaagacccgcgccgaggtgaccttcgagaatggcagcgtgtacaatcgcgtgaagctgaatgg
ccagggcttcaagaaggatggccacgtgctgggcaagaatctggagttcaatttcaccccccactgcctgtacatctggggcgatcaggcc
aatcacggcctgaagagcgccttcaagatctgccacgagatcaccggcagcaagggcgatttcatcgtggccgatcacacccagatgaat
acccccatcggcggcggccccgtgcacgtgcccgagtaccaccacatgagctaccacgtgaagctgagcaaggatgtgaccgatcacc
gcgataatatgagcctgaaggagaccgtgcgcgccgtggattgccgcaagacctacctgtgaagcttaattagctgagcttggactcctgtt
gatagatccagtaatgacctcagaactccatctggccgcgactctagatcataatcagccataccacatttgtagaggttttacttgctttaaaa
aacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttataatggttacaaataaagca
atagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaaggcgtgctagcataa
cttcgtatagcatacattatacgaagttat(LoxP)ctaacgttgccaccatggtgagcaagggcgaggagaataacatggccatcatcaag
gagttcatgcgcttcaaggtgcgcatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacg
agggctttcagaccgctaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcatttcacctacggctcc
aaggcctacgtgaagcaccccgccgacatcccc(mOrange)gactacttcaagctgtccttccccgagggcttcaagtgggagcgcgt
gatgaactacgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcg
gcaccaacttcccctccgacggccccgtgatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacgg
tgccctgaagggcaagatcaagatgaggctgaagctgaaggacggcggccactacacctccgaggtcaagaccacctacaaggccaag
aagcccgtgcagctgcccggcgcctacatcgtcgacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtac
gaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagagtgcacgcgtgagtaagctgaaccctcctgatgaga
gtggccccggctgcatgagctgcaagtgtgtgctctcctgagcggccgctaatcaacctctggattacaaaatttgtgaaagattgactggta
ttcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgta
30
taaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactg
gttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgc
ccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgtt
gccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctg
cggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgtcgagactgctgcac
cagatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgc
aattgttgttgttaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattct
agttgtggtttgtccaaactcatcaatgtatcttaaggcgtgtttaaacatataacttcgtataggatactttatacgaagttat(Lox2272)cgc
gtacggccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggcca
caagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccg
tgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttc(E
GFP)aagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtg
aagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctgg
agtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcg
aggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacct
gagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactc
tcggcatggacgagctgtacaagagtgcacgcgtgagtaagctgaaccctcctgatgagagtggccccggctgcatgagctgcaagtgtg
tgctctcctgagcggccgctaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtgga
tacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttg
tggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctt
tccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttggg
cactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttct
gctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctc
agacgagtcggatctccctttgggccgcctccccgcatcgataccgtcgagactgctgcaccagatcataatcagccataccacatttgtag
aggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagcttat
aatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatct
taaggcgtgaagatcttcatataacttcgtatagtataccttatacgaagttat(LoxN)caagtactgccaccatggtgagcgagctgattaa
ggagaacatgcacatgaagctgtacatggagggcaccgtgaacaaccaccacttcaagtgcacatccgagggcgaaggcaagccctac
gagggcacccagaccatgagaatcaaggcggtcgagggcggccctctccccttcgccttcgacatcctggctaccagcttcatgtacggc
agcaaaaccttcatcaaccacacccagggcatccccgacttctttaagcagtccttc(mKate2)cccgagggcttcacatgggagagagt
caccacatacgaagacgggggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagag
gggtgaacttcccatccaacggccctgtgatgcagaagaaaacactcggctgggaggcctccaccgagaccctgtaccccgctgacggc
ggcctggaaggcagagccgacatggccctgaagctcgtgggcgggggccacctgatctgcaacttgaagaccacatacagatccaaga
aacccgctaagaacctcaagatgcccggcgtctactatgtggacagaagactggaaagaatcaaggaggccgacaaagagacctacgtc
gagcagcacgaggtggctgtggccagatactgcgacctccctagcaaactggggcacagaagtgcacgcgtgagtaagctgaaccctcc
tgatgagagtggccccggctgcatgagctgcaagtgtgtgctctcctgagcggccgctaatcaacctctggattacaaaatttgtgaaagatt
gactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctc
ctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaac
ccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgc
ctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctc
gcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctg
ccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcATCGATACCG
TCGAGACTGCTGCACCAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTT
GCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATT
GTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC
ACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAAC
31
TCATCAATGTATCTTAAGGCGTACTAGTGAAGTTCCTATTCTCTAGAAAGTATAGGA
ACTTCCGTAACTATAACGGTCCTAAGGTAGCGAATGCATCTAGacccagctttcttgtacaaagtg
gtgataactctagagaattcactcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccac
tgagatctttttccctctgccaaaaattatggggacatcatgaagccccttgagcatctgacttctggctaataaaggaaatttattttcattgcaat
agtgtgttggaattttttgtgtctctcactcggaaggacatatgggagggcaaatcatttaaaacatcagaatgagtatttggtttagagtttggc
aacatatgccatatgctggctgccatgaacaaaggtggctataaagaggtcatcagtatatgaaacagccccctgctgtccattccttattcca
tagaaaagccttgacttgaggttagattttttttatattttgttttgtgttatttttttctttaacatccctaaaattttccttacatgttttactagccagattt
ttcctcctctcctgactactcccagtcatagctgtccctcttctcttatgaagatccctcgacctgcagcccaagcttggatccctcgagttaatta
aatctagaagtcgacagtactaagctttgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacct
cctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagc
cagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggccaccct
gcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaaga
ggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctcc
gtgcgtcagttttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaact
ccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtcccca
gtgctatctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaagccc
aggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccctacaggggttcctggctct
gctctagcgatcgccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgtta
cccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcg
cagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttg
ccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctt
tagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacgg
tttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgattt
ataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaattt
aggtg

Abstract (if available)

Abstract Lung cancer causes the most cancer-related deaths in the United States. Lung adenocarcinoma (LUAD) is its most frequent subtype. Alveolar epithelial cells (AECs) are the cell of origin of LUAD. The Offringa lab recently succeeded in immortalizing human AECs. These cells grow like cobblestones in two dimensions (2D) and form alveolar-like organoids in 3D culture. An in vitro cell lineage tracing tool that tracks the growth and differentiation of immortalized AECs would be valuable in modeling organoid growth and in vitro LUAD development. Here, we generated a Cre recombinase-inducible “rainbow” construct driven by a CAG promoter, for incorporation into a “safe harbor” genomic site in AEC cells. The construct can provide 3 stochastically expressed colors upon Cre expression following adenovirus-Cre infection, allowing visualization of organoid development and the interaction between cells in 3D culture. We are testing the construct in A549 LUAD cells as we develop monoclonal recipient AECs.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

PDF

Long-term expansion of human alveolar epithelial cells as a novel model system to study lung disease progression in vitro

PDF

Elucidating the cellular origins of lung adenocarcinoma

PDF

Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

PDF

Generation of an epigenetic toggle switch to test LINC00261 function on lung adenocarcinoma cellular response to the chemotherapeutics oxaliplatin and carboplatin

PDF

Evaluating the impact of long non-coding RNAs on tumor mutational burden in cancer

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

Determining the epigenetic contribution of basal cell identity in cystic fibrosis

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

Tight junction protein CLDN18.1 attenuates malignant properties and related signaling pathways of human lung adenocarcinoma in vivo and in vitro

PDF

Mechanism of a new CK2 inhibitor triggering senescence in breast cancer cells

PDF

Examination of the effect of oleandrin on head and neck cancer cells

PDF

DNA methylation markers for blood-based detection of small cell lung cancer in mouse models

PDF

Development of DNA methylation based biomarkers for the early detection of squamous cell lung cancer

PDF

Development of immunotherapy for small cell lung cancer using iso-aspartylated antigen

PDF

LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

PDF

Limit of detection analysis for cell-free DNA methylation using targeted bisulfite sequencing

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

Studies of murine prostate cancer stem / progenitor cells

Asset Metadata

Creator Zhou, Ziben (author)

Core Title In vitro lineage tracing of immortalized human alveolar epithelial cells

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Degree Conferral Date 2021-08

Publication Date 07/28/2021

Defense Date 06/04/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag A549,Brainbow,immortalized alveolar epithelial cells,lineage tracing,lung cancer,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Offringa, Ite (committee chair), Chen, Ya-Wen (committee member), Marconett, Crystal (committee member)

Creator Email zibenzho@usc.edu,zolazzb@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15657564

Unique identifier UC15657564

Legacy Identifier etd-ZhouZiben-9907

Document Type Thesis

Format application/pdf (imt)

Rights Zhou, Ziben

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu