University of Southern California Dissertations and Theses

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

(USC Thesis Other)

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

IDENTIFICATION OF MOLECULAR MECHANISM FOR CELL-FATE DECISION IN
LIVER
&
SARS-COV REPLICON INHIBITOR HIGH THROUGHPUT DRUG SCREENING

By

Xuyao Zhao

A Thesis Presented to the
FACULTY OF THE USC KECK MEDICAL SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

August 2021

Copyright 2021 Xuyao Zhao
ii

Acknowledgements

Thanks to Dr. Keigo Machida, Dr. Axel Schonthal and Dr. James Ou for being my
committee members. And thanks a lot for their help and advice during my
experiments. Thanks for Dr. Da-Wei Yeh for patient guidance.

iii

TABLE OF CONTENTS
Acknowledgements ......................................................................................................................... ii
List of Tables ................................................................................................................................. iv
List of Figures ................................................................................................................................. v
Abbreviations ................................................................................................................................. vi
Abstract ......................................................................................................................................... vii
Section 1: Identification of Molecular Mechanism for Cell-Fate Decision in Liver ...................... 1
Introduction .................................................................................................................... 1
Materials and methods ................................................................................................... 5
Results .......................................................................................................................... 11
Discussion and Future Direction .................................................................................. 15
Section 2: SARS-CoV Replicon Inhibitor High Throughput Drug Screening ............................ 18
Introduction ................................................................................................................. 18
Materials and methods ................................................................................................ 21
Results ......................................................................................................................... 24
Discussion and Future Direction ................................................................................. 30
References ..................................................................................................................................... 32

iv

List of Tables

Table 1: plasmids used in the study. ............................................................................................... 9
Table 2: Oligonucleotides for generating plasmid constructs for shRNA. ..................................... 9
Table 3 primers sequence used in the RT-qPCR. ........................................................................... 9
Table 4: antibodies used in the study. ........................................................................................... 10

v

List of Figures

Figure 1. Hypothetical models for regulation of PD-L1 by TBC1D15. ......................................... 4
Figure 2: Notch 1 is inactivated by knocking down TBC1D15. ................................................... 11
Figure 4: TBC1D15 regulated gene. ............................................................................................. 13
Figure 5: PD-L1 expression in Notch signaling pathway reactivated Huh 7 knock down cell. ... 14
Figure 1 SARS-CoV-2 is having a similar conservative ORF1ab replicon with SARS-CoV and
Mers-Cov (Yan et al., 2020. License ID: 1126191-1, ISSN: 1052-9276) ................................... 19
Figure 2, SARS-CoV bacmid construct (Almazán et al., 2006. License ID 1126190-1, ISSN:
0022-538X) ................................................................................................................................... 23
Figure 3. Bacmid identification by restriction enzyme digestion and concentration quantification.
....................................................................................................................................................... 24
Figure 4. Bacmid usage optimization ........................................................................................... 25
Figure 5. Correlation outcome between GFP signal point and fluorescent outcome. .................. 27
Figure 6. Drug screening candidates that have significant effect. ................................................ 29

vi

Abbreviations

Abbreviation Full name
ACE2 Angiotensin-converting enzyme 2
AKT Protein kinase B
BHK21 Baby Hamster Kidney cell line
ChIP-Seq Chromatin immunoprecipitation -sequencing
CHUK Conserved Helix-loop-helix Ubiquitous Kinase
COVID19 Coronavirus Disease 2019
DLL Delta-like
DMEM Dulbecco’s Modified Eagle’s Medium
FACS Fluorescence-activated cell sorting
FBS Fetal Bovine Serum
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GFP Green fluorescent protein
HBV Hepatitis B virus
HCC Hepatocellular carcinoma
HCV Hepatitis C virus
HEK293T Human Embryonic Kidney cells
HNF4 Hepatocyte Nuclear Factor 4
Huh7 Hereafter Huh7
IKK IκB kinase
IκB Inhibitor of nuclear factor kappa B
MHC histocompatibility complex
NAFLD Non-Alcoholic Fatty Liver Disease
NCI National Cancer Institute
NFKBIA NFκB Inhibitor Alpha
NFκB Nuclear factor kappa-light-chain-enhancer of activated B cells
NIH National Institutes of Health
ORF open reading frame
PD-1 Programmed death- 1
PD-L1 Programmed death-ligand 1
PPARγ Peroxisome proliferator-activated receptor gamma
RBD receptor-binding domain
RT-qPCR Reverse Transcription and Real-Time Quantitative-PCR
RXR Retinoid X receptor
SARS Severe Acute Respiratory Syndrome
SARS-COV SARS-coronavirus
SARS-COV-2 SARS-coronavirus-2
SDS-PAGE Sodium Dodecyl Sulphate–PolyAcrylamide Gel Electrophoresis
SREBF1 Sterol Regulatory Element Binding Transcription Factor 1
TBC1D15 TBC1 Domain Family Member 15
TIC Tumor initiating cell
vii

Abstract
Identification of Molecular Mechanism for Cell-Fate Decision in Liver
Tumor-initiating cells (TICs) are a rare subpopulation important in hepatocellular carcinoma
(HCC) progression, and responsible for the recurrence and unsatisfactory outcomes of traditional
chemotherapy and radiotherapy. Our previous studies identified that activation and stabilization
of NOTCH1 through the interaction with TBC1 Domain Family Member 15 (TBC1D15)
upregulates NANOG which is essential for TICs expansion. However, other downstream effector
genes activated by TBC1D15 expression and NOTCH1 stabilization are still not completely
explored. We generated Tbc1d15 knockout mice and isolated hepatic progenitor cells which
were subjected to anti-Notch1 chromosome immunoprecipitation to identify candidate genes
downstream of Tbc1d15-Notch1 interaction. We validated the results of pathway analysis in
Huh7 TBC1D15 knockdown cells. The results of RT-qPCR and Western Blot analysis showed
that TBC1D15 may regulate the expression of Inhibitor of nuclear factor kappa B (IκB), IκB
kinase (IKKα), Protein kinase B (AKT), Hepatocyte Nuclear Factor 4 (HNF4) and Programmed
death-ligand 1 (PD-L1) that are related to immune responses and cell differentiation. And some
of the downregulated genes in TBC1D15 knockdown Huh7 cells can be restored by re-activating
Notch signaling pathway. Therefore, as an upstream regulator, TBC1D15 may be a potential
therapeutic target for HCC treatment.

SARS-CoV Replicon Inhibitor High Throughput Drug Screening
Coronavirus Disease 2019 (COVID-19) caused by SARS-CoV-2 is spreading worldwide
and has caused serious losses in public health and economy. Mutations in SARS-CoV-2 has
viii

caused a decrease in the vaccines protection which makes the new drugs identification an urgent
task to resolve the public health issues. Compared with the emerging SARS-CoV-2, another
similar virus SARS-CoV has well-studied replicon systems which also can be applied on the
screening of some antiviral drugs previously. In the present study, we used BHK21 cells
ectopical expressing bacmid-based SARS-CoV replicon to screen candidate compounds from
National Cancer Institute (NCI). We identified the drug impacts on SARS-CoV replicon by
measuring the expression of green fluorescent protein (GFP). Some NCI drugs were suggested to
have inhibitory effect on viral RNA.
1

Section 1: Identification of Molecular Mechanism for Cell-Fate Decision in
Liver
Introduction
Hepatocellular carcinoma (HCC) is almost 3rd highest cause of death in all different
tumors (McGivern & Lemon, 2011). Some well-known causes of HCC are cirrhosis and chronic
viral hepatitis. Viruses that can induce HCC are Hepatitis B virus (HBV) and Hepatitis C virus
(HCV) (Fung et al., 2009). However, Hepatitis B is getting prevented by vaccination and
Hepatitis C treatment is getting developed in these years, incident of HCC in America is still
increasing. In developing countries, obesity, type 2 diabetes and heavy drinking are inducing
fatty liver diseases and inducing HCC (Tsoulfas, 2019). Obesity not only induces diabetes, but
also non-alcoholic fatty liver disease (NAFLD), which is also a high risk factor for developing
HCC (Vanni & Bugianesi, 2014).
Tumor initiating cells (TICs) are a small but important subgroup in many different types
of cancer cells (Ishizawa et al., 2010). TICs function like stem cells as they have an ability to
regenerate an entire new tumor and have resistance to common chemotherapy and radiotherapy
(Feldman et al., 2013). Treating TICs are an important part in tumor treatment and prognosis.
Normal stem cells usually have asymmetric division. Asymmetric cell division produces two
daughter cells with different fates, that is, one will maintain the self-renewal ability as the mother
cell, while the other will differentiate and eventually lose the self-renewal ability (Gao, 2008).
During cell division, cell fate-determining molecule NUMB gathers in one daughter cell and
forms a clear crescent at the cell membrane to define different cell fates (Cicalese et al., 2009).
However, in some instances NUMB evenly present in whole cell cortex in both daughter cells for
2

TICs , so they seem to have more symmetrical division instead of asymmetric ones, this also
increase replication potential (Cicalese et al., 2009). NUMB can interact and stabilize tumor
suppressor P53 to influence cell cycle (Colaluca et al., 2008). Insufficient P53 and Numb may be
the reason for uncontrolled proliferation.
TBC1D15 is an oncoprotein, which can competitively interact with NUMB and replace
P53 (Feldman et al., 2013). P53 may be degraded without the protection from NUMB, thereby
promoting the development of cells to carcinogenesis. The role of TBC1D15 in the occurrence of
cancer should not only be in the process of division but should also be able to regulate normal
gene expression. However, TBC1D15 is usually found in the cytoplasm rather than the nucleus,
so it may require some help to indirectly regulate gene expression. Previous studies suggest that
TBC1D15 can corporate with Fis1 to regulate mitochondrial morphology (Onoue et al., 2013). In
addition, notch was previously suggested to be one of the tooling pathways that work for
TBC1D15 regulation (Choi et al., 2020).
Notch signaling is composed of receptors, ligands, and DNA-binding proteins. At present,
4 transmembrane Notch receptors (Notch1, 2, 3, and 4), and 2 families of Notch ligands (Jagged-
1, 2 and Delta-like (DLL-1, 3, 4) have been found in mammals. Notch signaling is functional in
both normal cell proliferation and carcinogenesis. However, it was found highly activated in
HCC samples compared with normal tissues (Huang et al., 2019). Thus, Notch signaling can be
important in tumorigenesis.
NFκB is an important pathway in immune system and inflammation. However, NFκB
pathway has also been shown to promote tumorigenesis. Furthermore, it was found to be
activated in many different types of cancer and working in the proliferation and metastasis
(Dolcet et al., 2005). Retinoid X receptor (RXR) activation pathway is involved in many
3

metabolic processes. RXRα is suggested to be a possible target for cancer treatment because of
its involvement in cancer proliferation and anti-apoptosis (Crowe & Chandraratna, 2004).
Programmed death receptor ‐ 1 (PD ‐ 1) is a T cell suppressor, that is activated by
interacting with its ligand Programmed death-ligand 1 (PD-L1). PD1/PD-L1 immune checkpoint
is one of the most well-known immunotherapy targets. In many patients, PD-L1 is overexpressed
on cancer cells, so they can escape from immune responses (Zhang et al., 2016).
Immunotherapy is currently used in cancer treatment and the outcome shows that its much safer
and causes less side effects to patients (Nishijima et al., 2017). Targeting PD1/PD-L1 inhibitors
or understanding the molecular mechanism of PD1/PD-L1 overexpression can led to new cancer
treatment. A few studies suggested that Notch is working in PD-1 expressing process (Palaga et
al., 2018). However, the relationship between TBC1D15, notch signaling and PD-L1 in cancer
cells is still unclear and controversial.
The possible mode for regulation of PD-L1 by TBC1D15 is that TBC1D15 actives Notch
signaling pathway and helps Notch 1 intracellular domain to translocate into the nuclear. Then
the Notch 1 intracellular domain combines with its DNA binding protein RBP-J and activate PD-
L1 expression (Fig. 1).

4

Figure 1. Hypothetical models for regulation of PD-L1 by TBC1D15.
The hypothetical model for regulation of PD-L1 is that TBC1D15 can activate NOTCH 1 and it
can release its intracellular domain to regulate PD-L1 expression.
5

Materials and methods
Mice and Feeding
Hepatocyte-specific knockout of Tbc1d15 was generated by Cre/Flox gene targeting system. Cre
protein was expressed by liver-specific albumin promoter (Tbc1d15
Flox/Flox
; Alb::Cre-ER-T2) in
HCV NS5A Tg mice(Choi et al., 2020). Activities of Cre-ERT2 can be induced by Tamoxifen
injection. Both TBC1D15
+/+
NS5A Tg mice and TBC1D15
Flox/Flox
; Alb::Cre-ER-T2 NS5A Tg
mice were fed with alcohol-containing western diet including anhydrous milk fat, lard, corn oil
and cholesterol and 4.13% ethanol for 4 weeks after injected Tamoxifen (75 mg/kg) 5 times
(every other day) at the age of 8 weeks. After treatment, mice were euthanized for collection of
hepatic progenitor cells. All mice experiments were approved by the Institutional Animal Care
and Use Committee.

ChIP-Seq
All collected hepatic progenitor cells from TBC1D15WT NS5A Tg and Tbc1d15 ko NS5A Tg
mice were sent to USC pharmacy school for anti-Notch 1 chIP-Seq.

Pathway analysis
Outcome acquired from company were analyzed by Ingenuity Pathway Analysis (QIAGEN,
Hilden, Germany).

Cell culture
6

Huh7 and HEK293T cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM)
(Genclone) supplemented with 10% heat-inactivated fetal bovine serum (Gemini), 1X
GlutaMAX (Gibco), and 1X Antibiotic-Antimycotic (Gibco). Cells were kept in humidified
incubator at 37 C in 5% CO2.

Transient transfection
Huh7 cells were plated in 6-well plate at 7 ×10
5
cell per well one day before transfection. Next
day, DNA in blank DMEM was mixed with liposome based transfection reagent (BioT) in a ratio
of 1 μg DNA to 1.5 μl BioT. After sitting at room temperature for 15 min, the mixture was added
to cells in DMEM with 5% Fetal Bovine Serum (FBS). The media was replaced 12 hours post-
transfection. Cells were harvested 24h post-transfection for total RNA extraction and qRT-PCR
toidentify transient transfection efficiency for gene knock down experiment.

Lentiviral production and transduction of shRNA
TBC1D15 knockdown was stabilized in Huh7 cells by lentiviral transduction of shRNA against
TBC1D15 followed by puromycin (2 μg/ml) selection. HEK293T cells were plated in T75 flasks.
Plasmid DNA for packaging (pPAX2 and pMD2G), and shTBC1D15 were mixed in a ratio of
2:1:3 in serum free DMEM. Then transfection reagent (BioT) was added in a ratio of 1 (μg):
DNA to 1.5 (μl) into the mixture, mixed well and incubated at room temperature for 20 minutes.
Then the mixture was added into HEK293T cells. The media containing BioT was replaced with
complete media 12 hours post-transfection. Then harvest the supernatant containing lentiviral
pseudoparticles 48 hours and 72 hours post-transfection. The supernatant was purified by
7

centrifuge and pressed through 0.22um syringe filter. The lentiviral pseudoparticles in
supernatant were kept at -80C. Huh7 cells were lentiviral transduced with control shRNA or
shRNA against TBC1D15 and selected by puromycin at concentration of 2 μg/ml.

Reverse Transcription and Real-Time Quantitative-PCR (RT-qPCR)
Total cellular RNA was isolated from Huh7 cells by using TRIzol reagent (Invitrogen, Carlsbad,
CA, USA) following manufacturer’s instruction. First-strand cDNA library was synthesized from
total cellular RNA by SuperScript III First-Strand Synthesis system according to manufacturer’s
protocol (Invitrogen). RT-qPCR was carried out using ABI StepOnePlus system and PowerUp
SYBR green. The 2
−ΔΔCt
method described in the ABI user manual were used for data analysis.
The expression of mRNA were normalized to Glyceraldehyde 3-phosphate dehydrogenase
(GAPDH).

SDS-PAGE and Western Blot
Huh7 cells were harvested and lysed using NP-40 lysis buffer containing protease inhibitor
(Thermo Scientific). Protein quantification was done by Bradford assay (Biorad) according to
manufacturer’s instruction. Protein lysates wrer analyzed by sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to 0.45um polyvinylidene
fluoride membrane (Immobilon, IPVH00010). Then block the membrane with 5% skim milk in
PBS-T for 30min and incubate with primary antibody overnight at 4 C followed by secondary
antibodies incubation for 2 hours. The immunoreactive bands were visualized with HRP
chemiluminescent substrates (Advansta) and ChemiDoc MP imager (Bio-Rad).
8

Immunohistochemistry
Huh7 cells were seed on poly-L-lysine incubated glass pieces in 12 well plate. Cells were fixed
by 0.1% FPA and then blocked by blocking buffer. Apply PD-L1 primary antibody and incubate
overnight. Cells were then applied secondary antibody and DAPI (H-1200, Vector), keep in dark.
The picture was captured by confocal microscopy using Leica software.

Drug treatment
Huh7 cells transduced with sh-control or sh-TBC1D15 were plated one day before the treatment.
The next day, Huh7 cells was incubated with oxaliplatin, a Notch signaling activator, at
concentration of 0.75 and 1.5 μM in the 37 C incubator for 24 and 48 hours. The harvested cells
were separated into two portions for total RNA and protein isolation. TRIzol and NP-40 lysis
buffer containing protease inhibitors were used for RNA and protein lysate preparation,
respectively.

9

Table 1: plasmids used in the study.
Plasmid name Backbone Insertion
Sh-TBC1D15 pGreenPuro (system Bioscience) TBC1D15 ShRNA (table 2)

Table 2: Oligonucleotides for generating plasmid constructs for shRNA.
Sequence
Sh-
TBC1D1
5-1 Fwd
5’-
GATCATGACCAAGACGGCTTGATTTCTCGAGAAATCAAGCCGTCTTGGTC
ATTTTTTG-3’
Sh-
TBC1D1
5-1 Rev
5’-
AATTCAAAAAATGACCAAGACGGCTTGATTTCTCGAGAAATCAAGCCGTC
TTGGTCAT-3’
Sh-
TBC1D1
5-2 Fwd
5’-
GATCGCATTAGATTCCTCTAGTATTCTCGAGAATACTAGAGGAATCTAAT
GCTTTTTG-3’
Sh-
TBC1D1
5-2 Rev
5’-
AATTCAAAAAGCATTAGATTCCTCTAGTATTCTCGAGAATACTAGAGGAA
TCTAATGC-3’
Sh-
TBC1D1
5-3 Fwd
5’-
GATCCGATTGTTAGACAGTGGATTTCTCGAGAAATCCACTGTCTAACAAT
CGTTTTTG-3’
Sh-
TBC1D1
5-3 Rev
5’-
AATTCAAAAACGATTGTTAGACAGTGGATTTCTCGAGAAATCCACTGTCT
AACAATCG-3’
Sh-
TBC1D1
5-4 Fwd
5’-
GATCTAAGTGGATTGGCAGTATATTCTCGAGAATATACTGCCAATCCACT
TATTTTTG-3’
Sh-
TBC1D1
5-4 Rev
5’-
AATTCAAAAATAAGTGGATTGGCAGTATATTCTCGAGAATATACTGCCAA
TCCACTTA-3’

Table 3 primers sequence used in the RT-qPCR.
Primer Sequence
CD274 F ACTGTCACGGTTCCCAAGGA
CD274 R CATTTCCCAGGGAGAGCTGG
AKT2 F AGCTAGGTGACAGCGTACCA
AKT2 R GGCCTCTCGGTCTTCATCAG
CHUK F TGTACACAGAGTTCTGCCCG
10

CHUK R TGTGCTGAAGTCTCCCCATCT
NFKBIA F CTACACCTTGCCTGTGAGCA
NFKBIA R GACATCAGCACCCAAGGACA
RXRA F CAAACATTTCCTGCCGCTCG
RXRA R CTGATGACCGAGAAAGGCGG
HNF4A F TGCGACTCTCCAAAACCCTC
HNF4A R ATTGCCCATCGTCAACACCT
SREBF1 F GCTCCCTAGGAAGGGCCGTA
SREBF1 R ACTTCACCTTCGATGTCGGTC
PPARG F TCGAGGACACCGGAGAGG
PPARG R CACGGAGCTGATCCCAAAGT

Table 4: antibodies used in the study.
Designation Manufacturer and
Catalogue number
Antibody
characterization
Dilution (WB)
TBC1D15 GeneTex, Catalog
# gtx121082
Rabbit Monoclonal 1:1000
PD-L1 Invitrogen, Catalog
# PA5-20343
Rabbit Monoclonal 1:1000
β-ACTIN Santa cruz, Catalog
# sc-8432
Mouse Monoclonal 1:1000
Notch 1 Cell signaling,
3608s
Rabbit Monoclonal 1:1000

11

Results
Notch 1 is activated and released the Notch 1 intracellular domain by high level of Tbc1d15.
In normal high level TBC1D15 Huh7 cells, the Notch is normally Notch 1 intracellular
domain (Fig. 2, line 1). By knocking down TBC1D15 using lentivirus, Notch 1intracellular
domain decreased and more in inactivate full length (Fig. 2, Line 2,3,4). So Notch 1 downstream
gene expression can be altered by TBC1D15 expression difference.

Figure 2: Notch 1 is inactivated by knocking down TBC1D15.
Immunoblotting analysis showed knockdown of TBC1D15 in Huh7 cells decreased protein level
of Notch 1 intracellular domain.

Notch 1 downstream TBC1D15 regulated pathways and targets.
Chip-seq suggested 1,251 different Notch 1 parterner binding genes that regulated by
TBC1D15. After pathway analysis, most of them are founded having some link in pathways (Fig.
3). Most of pathways that suggested are related to metabolism and immune responses. The high
rank genes are Akt2 (AKT), Chuk (IKKα), Hnf4a (HNF4α), Nfkbia (IκB), Pparg (PPARγ), Rxra
(RXRα), and Srebf1 (SREBP). Most genes suggested in immune response pathways are IκB
kinase families and AKT related proteins. So these pathways are not mainly targeted in this study.
12

Figure 3. IPA pathway analysis top pathways.
IPA program analysis for Notch ChIP-Seq outcome showed candiate genes were categorized into
differnet patwhays, such as immune responses related pathways, metabolism related pathways
and proliferation related pathways.

PD-L1 is positively regulated by TBC1D15
By knocking down TBC1D15 in Huh 7 cells, most gene showed a significat regulation (Fig. 4A).
In these genes, PD-L1 showed the most significant positive regulation. NFKBIA (IκB), RXRA
(RXRα), CHUK (IKKα), and AKT2 (AKT) also showed significant positive regulation. HNF4A
(HNF4α), showed a significant negative regulation. And this also confirmed by the western blot
(Fig. 4B).
13

A

Figure 4: TBC1D15 regulated gene.
(A) RT-qPCR analysis of TBC1D15-knockdown Huh7 showed PD-L1 (CD274), NFKBIA (IκB),
RXRA (RXRα), CHUK (IKKα), and AKT2 (AKT) are significantly down-regluated, while
HNF4A (HNF4α) is significatlly up-regulated by knocking down of TBC1D15. (B)
Immunoblotting analysis of TBC1D15-knockdown Huh7 showed expression of PD-L1 protein
was down-regulated by knocking down of TBC1D15..

PD-L1 is regulated by TBC1D15 activated Notch signaling pathway.
By knocking down TBC1D15, protein level of PD-L1 has the same patten with Notch 1
intracellular domain (Fig. 5A ). By adding notch signaling activator oxalipatin for 0.75uM and
1.5 μM to re-activating Notch, RNA level of TBC1D15 is not showing any signifacant
difference(Fig. 5B). By re-activatig Notch, expression level of PD-L1 is restored in RNA level
(Fig. 5C). Which is suggesting that PD-L1 down-regulation that caused by TBC1D15 knocking
down can be rescued by Notch signaling activation. So TBC1D15 is regulating PD-L1 by
activating Notch signaling pathway. NFKBIA (IκB), CHUK (IKKα), and AKT2 (AKT) are also
rescused by re-activating Notch signaling pathway, suggesting that they are also at the
downstream of Notch (Fig. 5D/F/G). RXRA (RXRα) showed almost no different from none drug
treatment (Fig. 5E). HNF4A (HNF4α) showed a negative regulation by TBC1D15 but it still
B
A
14

showed a up-regulation when activating Notch, this may caused by the high level of up-
regulation by drug treatment itself (Fig. 5H).

Figure 5: PD-L1 expression in Notch signaling pathway reactivated Huh 7 knock down cell.
(A) Western blot showed a same pattern for Notch 1 intracellular domain and PD-L1. (B) qRT-
PCR result showed TBC1D15 had no significant different by adding 0.75 μM or 1.5M of Notch
pathway activator oxalipatin. (C-H) qRT-PCR result showed upregulation of CD274, CHUK,
AKT2, and NFKBIA by activating Notch pathway induced by oxalipatin treatment; (G) however,
HNF4A and RXRA was not affected by oxalipatin treatment.
control Tbc1d15 kd
0
1
2
3
3
8
13
18
CD274 (PDL1)
Relative RNA fold change
✱
CHUK (IKKa)
control Tbc1d15 kd
0
1
2
3
4
Relative RNA fold change
✱✱
AKT2
control Tbc1d15 kd
0.0
0.5
1.0
1.5
2.0
Relative RNA fold change
✱
NFKBIA (IkB)
control Tbc1d15 kd
0
1
2
3
4
Relative RNA fold change
✱
RXRa
control Tbc1d15 kd
0.0
0.5
1.0
1.5
Relative RNA fold change
control Tbc1d15 kd
0
5
10
15
20
20
40
60
80
HNF4a (HNF)
Relative RNA fold change
control Tbc1d15 kd
0
1
2
3
3
8
13
18
CD274 (PDL1)
Relative RNA fold change
✱
CHUK (IKKa)
control Tbc1d15 kd
0
1
2
3
4
Relative RNA fold change
✱✱
AKT2
control Tbc1d15 kd
0.0
0.5
1.0
1.5
2.0
Relative RNA fold change
✱
NFKBIA (IkB)
control Tbc1d15 kd
0
1
2
3
4
Relative RNA fold change
✱
RXRa
control Tbc1d15 kd
0.0
0.5
1.0
1.5
Relative RNA fold change
control Tbc1d15 kd
0
5
10
15
20
20
40
60
80
HNF4a (HNF)
Relative RNA fold change
A B
C D E
F G H
15

Discussion and Future Direction
Notch signaling has been studied in different carcinogenesis. Recently, Notch 1 was
shown to be activated by TBC1D15 and release the Notch 1 intracellular domain (N1ICD) (Choi
et al., 2020). TBC1D15 can regulate gene expression by activating Notch signaling pathway.
IPA Pathway analysis suggested many Iκb and AKT related pathways. Notch has
beenreported to have conflict interaction with NFκB pathway. Specifically, low expression of
Notch 1 may stimulate NFκB, while high level of Notch 1 may accidently inhibit NFκB related
gene expression (Osipo et al., 2008). The weaker Notch activation caused by TBC1D15 may
cause the activation of the NFκB pathway in some cells. This may also be one of the reasons for
the co-activation of Notch pathway and NFκB pathway found in some cancer cells (Ramdass et
al., 2007). This activated NFκB may promote the progression of cancer and also contribute to
resistance to chemotherapy and radiotherapy (Dolcet et al., 2005). Although NFκB pathway is
being studied in the immune response, it is also being studied as a potential target for cancer
treatment.(Tafani et al., 2013). Indirect regulation through TBC1D15 may be a viable alternative
treatment.
RXR is suggested to be a possible target for cancer treatment (Crowe & Chandraratna,
2004). And nuclear receptor HNF4α was suggested to be a tumor suppressor that can promote
P21 expression (Wang et al., 2020). The inhibition of TBC1D15 can both suppress oncoprotein
RXR and induce tumor suppressor HNF4α which may be a good up stream target for cancer
treatment.
The expression level of immune checkpoint molecular like PD-L1 is increased by
overexpressing TBC1D15 in TICs. PD-L1 is a down-stream molecular that regulated by
16

TBC1D15. This may explain the rise of TBC1D15 in some breast cancers that can be treated with
PD-1/PD-L1 immunotherapy (Mirghani et al., 2014).
This project is only limited in in vitro study, not in any in vivo model. So, the study of
overall outcome for TBC1D15 inhibitor treatment is still needed. Also, the inhibition of Notch 1
is only confirmed by western blot, the most important part in Notch activation may be the Notch
intracellular domain to translocated into the nuclear, so an immunostaining for the location of
Notch maybe essential. And the study only used Notch 1 for a present of Notch receptors, the
detection of other receptors maybe still needed. Because some studies suggested a conflict
outcome for different level of Notch signaling pathway, the activation level that done by
TBC1D15 also worth doing. The different activation level can be achieved by using gradient
does of TBC1D15 inhibitor drugs. Also, because directly knock out or knock down is not
convenience for clinic, some TBC1D15 inhibitor drugs can be good candidate for the treatment.
If Notch signaling is related to PD-L1 expressing is having some controversy. Some
studies suggest that Notch signaling can activate PD-L1 related DNA binding protein STAT3 to
induce PD-L1 (Hildebrand et al., 2018). Other papers suggest that Notch 1 DNA binding protein
RBP-J has a DNA binding region on PD-L1 enhancer (Yanagi et al., 2021). While other paper
even suggested that Notch 1 is not affecting PD-L1 expression (Mansour et al., 2020). Our
studies shows that the PD-L1 that down-regulated by TBC1D15 knocking down can be
recovered by adding Notch activator oxaliplatin. This suggests that Notch is involved in this PD-
L1 regulation. The specific regulation mechanism may still need further study.
It was worth discussing that our pathway analysis suggested many different immune
checkpoint related pathways because of fold change of histocompatibility complex (MHC) II
molecule. Normally MHC II molecules are only expressed by antigen presenting cells like
17

dendritic cells and B cells. However, some paper suggested that cancer cells sometimes may also
express cancer specific MHC II, which may related to CD4+ T cell activation (Axelrod et al.,
2019). If the expression of MHC II molecular H2-DMa is regulated in TBC1D15
high
mouse cells,
this may also happen in human HCC. If TBC1D15 can also regulate MHC II level and combine
with PD-L1, there may be some improvement in the prognosis of cancer treatment.
18

Section 2: SARS-CoV Replicon Inhibitor High Throughput Drug Screening
Introduction
COVID-19 is caused by Severe Acute Respiratory Syndrome-Coronavirus 2 (SARS-
CoV-2) has been spreading and causing pandemics all over the world since 2019 (Chen et al.,
2020). As of Jun this year, more than 30,000,000 people have been infected with COVID-19
causing more than 600,000 deaths in the United States (CDC, 2021). Although compared with
SARS-CoV, patients with SARS-CoV-2 normally have more mild clinical manifestations, but its
spread seems to be wider and has caused a longer epidemic. As an airborne respiratory disease,
COVID-19 can be transmitted by respiratory droplets (Wu et al., 2020). The symptoms of
COVID include fever, cough, and fatigue. Depending on the severity of the illness, it may
progress to breathing difficulties or even death.
Like other virus, the life cycle of SARS-CoV-2 has 5 main steps: fusion and entry, viral
genome release, RNA replication and protein production, assembly and maturation, and release.,
The most well-known mechanism for entry studies is the ACE2/RBD binding, so ACE2 is now a
important target for entry inhibitor (Walls et al., 2020). During viral genome replication and
transcription, some proteins, such as Nsp10/16, are made to modify the genomic RNA so that it
can imitate host mRNA to ensure transcription and replication (Viswanathan et al., 2020). As a
result, methyltransferase is also a popular target for inhibitor screening to treat Covid-19
infection. Then for the viruses to leave host cell, they may need to budding from Golgi apparatus
to finally be released (Lebeau et al., 2020). Some drugs are modify to target this budding process.
As a member of the Coronaviridae family, SARS-CoV-2 is also an enveloped large virus
with a positive single-strand RNA genome. The genome can be up to 30kb length which is large
19

for normal virus. The genome is composed of 4 structural proteins, S, E, M and N and several
nonstructural proteins. For some Coronavirus, their structural protein and replicon are more
conservative, and others are changeable (Fig. 1, Yan et al., 2020). So, their replicon ORF1 is
some kind of similar with each other.

Figure 1 SARS-CoV-2 is having a similar conservative ORF1ab replicon with SARS-CoV and
Mers-Cov (Yan et al., 2020. License ID: 1126191-1, ISSN: 1052-9276)

Though COVID-19 vaccine now has been produced by several companies, it may still be
difficult stopping the pandemic. For developing countries, especially some countries with
immature technology, the cold storage required for vaccine transportation and storage may
exceed the overall cold storage capacity(Ortiz et al., 2021). Even in developed countries,
increasingly anti-vaccination activities may hinder large-scale universal vaccination (Burki,
2020). Therefore, there is still a very urgent need for the screening of SARS-COV therapeutic
drugs.
At present, some drugs, such as chloroquine, have been used in clinical trials for the
treatment of COVID-19, but there are still some controversies about their therapeutic effects and
20

safety(Hoffmann et al., 2020; Liu et al., 2020). The development of new drugs still takes time, so
high-throughput screening of existing drugs seems to be a good alternative other than remdesivir.
As an emerging virus, the research on SARS-CoV-2 is not as sophisticated as SARS-CoV
and MERS-CoV. Moreover, because they share similar replicons, the well-studied SARS-CoV
replicon can be used as a good tool for SARS-CoV-2 related drug research. At the same time,
since SARS-CoV-2 is a BSL3 virus, its live virus use is relatively complicated, and it is difficult
to conduct high throughput research. Therefore, using replicon for drug research may be a better
way to do drug screening.

21

Materials and methods
Cell culture
BHK21 cells were maintained in Dulbecco’s Modified Eagle’s Medium (Genclone)
supplemented with 10% heat-inactivated fetal bovine serum (CAT 100-106, Gemini), 1%
GlutaMAX (CAT 35050061 Gibco), and 1X Antibiotic-Antimycotic (CAT 15240062 Gibco).
Cells were kept in humidified incubator at 37 C in 5% CO2.

Drug pretreatment
All NCI plated compound sets were bought from National Institutes of Health (NIH). Drugs
were originally kept in 20 μl DMSO. Each drug was diluted from 0.01 M to 0.2 mM with
DMEM. Then each drug was stored in -80C.

Bacmid preparation
A Bacmid containing SARS-CoV replicon is a gift from Dr. Sonia Zuñiga Lucas (Fig. 2Almazán
et al., 2006). And a Green fluorescent protein (GFP) signal is added at the end of replicon region.
Transformed E.coli cells are grown in LB medium plus 12.5 μg/ml chloramphenicol at 37 C
incubator overnight. Bacmid was purified by QIAGEN Large Construct Kit (QIAGEN). Bacmid
was checked by HindIII and SphI restriction enzyme digestion. Because the nanodrop of bacmid
showed some misleading, plasmid concentration was measured by comparison of concentration
in agarose gel with 1kb plus ladder (Generuler). The usage is optimized by Fluorescence-
activated cell sorting (FACS) and imaging (Cytation 5).
22

Transfection
BHK21 were grown to 90-95% confluency in T75 flask and transiently transfected by
Lipofectamine 2000 (Invitrogen). Each component was added into DMEM and mixed by a ratio
of 2 (μl):1 (μg). Cells were washed by bland DMEM media without any antibiotic for 3 times,
then the mixture was stranded in room temperature for 15 minutes and added into cells with
DMEM media with 10% FBS and the flasks were returned to incubator. 4 hours after incubation,
cells were detached and seeded into black side 96 well plate (Costar).

Drug screening
Add 1.5 μl of each drug into each well, incubate in 37 C incubator overnight. GFP signal were
detected by FACs and the picture was captured by Cytation 5. For high throughput screening,
Fluorescence Quick Read is also used for GFP detection and caculation.
23

Figure 2, SARS-CoV bacmid construct (Almazán et al., 2006. License ID 1126190-1, ISSN:
0022-538X)
(A) Original SARS-CoV genome composed of rep 1a, 1b and several structural and accessary
proteins. (B) They were inserted into bacmid driven by CMV promoter to form a pBAC-SARS-
CoV replicon expression plasmid. (C) These separated gene fragments were cloned sequentially
into 5 sets of restriction enzyme digestion sites.

24

A
Results
Plasmid identification and quantification.
Bacmid were purified and confirmed by the HindIII and SphI digestion (Fig. 3A). The
concentration measured by nanodrop was about 5000 ng/μl while the real concentration in DNA
gel looks different (Fig. 3B). Then the real concentration suggested by agarose gel was about 3
ng/μl.

Figure 3. Bacmid identification by restriction enzyme digestion and concentration quantification.
(A) Bacmid digested with HindIII or SphI shows 6 and 7 different bands respectively, which
confirmed the identity of bacmid-based SARS CoV replicon. (B) Bacmid that digested by
HindIII was ran on 7.5% Agarose gel, the brightness of each band suggested a concentration far
from 5000 ng/μl.

Bacmid dosage optimization.
By detecting GFP signal in FACs (Fig. 4A), the outcome supported the concentration that
calculated from Agarose gel electrophoresis. By detecting through imaging and plate reader,
detected best dosage of bacmid is 100 ng/ml together with 12.5 μl/ml Lipofectamine 2000.
B
25

Control 15 ng/ml 30 ng/ml

45 ng/ml 60 ng/ml overlap

Figure 4. Bacmid usage optimization
(A) Different 15 ng/ml, 30 ng/ml, 45 ng/ml, and 60 ng/ml of bacmid was transfected into BHK21
cells, GFP signal can be detected by FACs over the dosage of 30 ng/ml. (B) However, to clearly
seen GFP from imaging system and detecting clearly read from fluorescent plate reader, 30
ng/ml bacmid transfection is not bright enough for cell count and detection. (C)The final bacmid
dosage for transfection can be up to 100 ng/ml.
B

C
A
26

Drug screening correlation.
For the drugs used for first round selection, most of them showed a enhanced outcome for
viral replication. The GFP signal enhanced in FACs, imaging and plate reading (Fig. 5A). By
counting the bright dots in each selected area, and compare with plate reading outcome, positive
linear correlation is founded. The outcomes suggests that R² = 0.8778>0.85 (Fig. 5B). Therefore,
the data of the plate reader is representative, which can be used to express the content of GFP,
that is, the strength of viral replication.
Control
Plate reading
outcome: 47.628

Lumefantrine
Plate reading
outcome: 80.656

Plate reading
outcome: 63.987

A

A

27

Figure 5. Correlation outcome between GFP signal point and fluorescent outcome.
(A) Outcome from plate reader, imaging and FACs are having consistency. (B) R² =0.8778>0.85,
so GFP signal point shows a positive correlation with fluorescent outcome.

Possible drug candidates in NCI drugs and antiviral drugs.
Some drugs that were previously reported as antiviral drugs. like Lumefantrine and
Quinacrine that normally used as Malaria drug, were suggested as anti-SARS drugs used
clinically. However, in replicon study, they may at least promote viral RNA replication (Fig. 6A).
Some NCI drugs like 1-(Furan-2-ylmethyl)-3-(3-nitrophenyl)urea (Fig. 6C) and 1,3,7-Trimethyl-
8-(1-piperidinyl)purine-2,6-dione (Fig. 6D) that are normally chemotherapy drugs, also have a
significant ability to induce viral RNA replication.
y = 0.7299x + 3.1741
R² = 0.8778
B
28

A

B
C D
29

Figure 6. Drug screening candidates that have significant effect.
(A) Malaria drugs that have been suggested to have viral inhibiting effect are actually promoting
viral RNA replication. (B) NCI drugs are showing different effects on viral RNA replication. (C)
2D structure of 1-(Furan-2-ylmethyl)-3-(3-nitrophenyl)urea. (D) 2D structure of 1,3,7-Trimethyl-
8-(1-piperidinyl)purine-2,6-dione.

30

Discussion and Future Direction
High throughput drug screening previously have been used for guanine-N7-
methyltransferase inhibitor study (Sun et al., 2014). It is very important to use substrates that are
easy to produce and store in large quantities, and to choose easy-to-read detection methods.
BHK21 cells are easy to culture to use as a substrate, and GFP is a good reporter to be detected
to reflect the viral RNA replication. In previous experiments, most replicon RNA is supplied by
in vitro transcription and delivered by electroporation. However, this process maybe time-
consuming and not available for high through-put screening. At the same time, because FACs
may be time consuming and imaging may cause observational error, fluorescent plate reader can
be a good alternative to report GFP level.
For drug screening, in about 300 NCI compounds, 1-(Furan-2-ylmethyl)-3-(3-
nitrophenyl)urea and 1,3,7-Trimethyl-8-(1-piperidinyl)purine-2,6-dione show significant
inhibition effect to viral RNA replication. Both of them were suggested working in histone. And
related to protein production.
Anti-malaria drugs like lumefantrine and quinacrine was suggested to have anti-viral
effects, while this project suggested that some of them may even have an inducing effect on viral
RNA replication. This may be caused by the different effect processes that drugs may work on.
Lumefantrine was suggested to suppress viral replication by suppressing viral protein production
while quinacrine was suggested to inhibit viral replication by blocking entry stage (Cao et al.,
2020; Puhl et al., 2021). And tizanidine was also suggested to have a good expectation to inhibit
SARS-CoV M protein (Sencanski et al., 2020). These drugs are still good anti-SARS-CoV drugs,
but they may not be using in RNA replication step.
31

Take together, in all SARS-COV replication inhibitor drug candidates, 1-(Furan-2-
ylmethyl)-3-(3-nitrophenyl)urea shows a good effect on suppressing viral RNA replication.
Pervious results may suggest that 1-(Furan-2-ylmethyl)-3-(3-nitrophenyl)urea drugs and other
drug like 1-((2-Carbamoylguanidino) (furan-2-ylmethyl)urea may also have a inhibiting effects
(Donlawson et al., 2020).
The life cycle of SARS-COV-2 can be divided into many steps, and RNA replication is
only one part of them. Like lumefantrine can suppress viral protein production while inducing
RNA replication, drugs to suppress viral RNA replication like 1-(Furan-2-ylmethyl)-3-(3-
nitrophenyl)urea may also induce other process in viral replication. So live virus screening is still
needed to conclude the overall effect that drugs may have on SARS-COV-2 infection.

32

References
Almazán, F., DeDiego, M. L., Galán, C., Escors, D., Álvarez, E., Ortego, J., Sola, I., Zuñiga, S.,
Alonso, S., Moreno, J. L., Nogales, A., Capiscol, C., & Enjuanes, L. (2006). Construction
of a Severe Acute Respiratory Syndrome Coronavirus Infectious cDNA Clone and a
Replicon To Study Coronavirus RNA Synthesis. Journal of Virology, 80(21), 10900–
10906. https://doi.org/10.1128/JVI.00385-06
Axelrod, M. L., Cook, R. S., Johnson, D. B., & Balko, J. M. (2019). Biological Consequences of
Major Histocompatibility Class-II Expression by Tumor Cells in Cancer. Clinical Cancer
Research : An Official Journal of the American Association for Cancer Research, 25(8),
2392–2402. https://doi.org/10.1158/1078-0432.CCR-18-3200
Burki, T. (2020). The online anti-vaccine movement in the age of COVID-19. The Lancet Digital
Health, 2(10), e504–e505. https://doi.org/10.1016/S2589-7500(20)30227-2
Cao, R., Hu, H., Li, Y., Wang, X., Xu, M., Liu, J., Zhang, H., Yan, Y., Zhao, L., Li, W., Zhang,
T., Xiao, D., Guo, X., Li, Y., Yang, J., Hu, Z., Wang, M., & Zhong, W. (2020). Anti-
SARS-CoV-2 Potential of Artemisinins In Vitro. ACS Infectious Diseases.
https://doi.org/10.1021/acsinfecdis.0c00522
CDC. (2021, May 10). COVID Data Tracker. Centers for Disease Control and Prevention.
https://covid.cdc.gov/covid-data-tracker
Chen, L., Liu, W., Zhang, Q., Xu, K., Ye, G., Wu, W., Sun, Z., Liu, F., Wu, K., Zhong, B., Mei,
Y., Zhang, W., Chen, Y., Li, Y., Shi, M., Lan, K., & Liu, Y. (2020). RNA based mNGS
approach identifies a novel human coronavirus from two individual pneumonia cases in
2019 Wuhan outbreak. Emerging Microbes & Infections, 9(1), 313–319.
https://doi.org/10.1080/22221751.2020.1725399
33

Choi, H. Y., Siddique, H. R., Zheng, M., Kou, Y., Yeh, D.-W., Machida, T., Chen, C.-L., Uthaya
Kumar, D. B., Punj, V., Winer, P., Pita, A., Sher, L., Tahara, S. M., Ray, R. B., Liang, C.,
Chen, L., Tsukamoto, H., & Machida, K. (2020). P53 destabilizing protein skews
asymmetric division and enhances NOTCH activation to direct self-renewal of TICs.
Nature Communications, 11(1), 3084. https://doi.org/10.1038/s41467-020-16616-8
Cicalese, A., Bonizzi, G., Pasi, C. E., Faretta, M., Ronzoni, S., Giulini, B., Brisken, C., Minucci,
S., Di Fiore, P. P., & Pelicci, P. G. (2009). The Tumor Suppressor p53 Regulates Polarity
of Self-Renewing Divisions in Mammary Stem Cells. Cell, 138(6), 1083–1095.
https://doi.org/10.1016/j.cell.2009.06.048
Colaluca, I. N., Tosoni, D., Nuciforo, P., Senic-Matuglia, F., Galimberti, V., Viale, G., Pece, S.,
& Di Fiore, P. P. (2008). NUMB controls p53 tumour suppressor activity. Nature,
451(7174), 76–80. https://doi.org/10.1038/nature06412
Crowe, D. L., & Chandraratna, R. A. (2004). A retinoid X receptor (RXR)-selective retinoid
reveals that RXR-α is potentially a therapeutic target in breast cancer cell lines, and that it
potentiates antiproliferative and apoptotic responses to peroxisome proliferator-activated
receptor ligands. Breast Cancer Research, 6(5), R546. https://doi.org/10.1186/bcr913
Dolcet, X., Llobet, D., Pallares, J., & Matias-Guiu, X. (2005). NF-kB in development and
progression of human cancer. Virchows Archiv, 446(5), 475–482.
https://doi.org/10.1007/s00428-005-1264-9
Donlawson, C., Nweneka, D. O., Orie, K. J., & Okah, R. (2020). Synthesis and Bioactivity of 1-
((2-Carbamoylguanidino) (furan-2-ylmethyl)urea. American Journal of Analytical
Chemistry, 11(7), 280–288. https://doi.org/10.4236/ajac.2020.117022
34

Feldman, D. E., Chen, C., Punj, V., & Machida, K. (2013). The TBC1D15 Oncoprotein Controls
Stem Cell Self-Renewal through Destabilization of the Numb-p53 Complex. PLOS ONE,
8(2), e57312. https://doi.org/10.1371/journal.pone.0057312
Fung, J., Lai, C.-L., & Yuen, M.-F. (2009). Hepatitis B and C virus-related carcinogenesis.
Clinical Microbiology and Infection, 15(11), 964–970. https://doi.org/10.1111/j.1469-
0691.2009.03035.x
Gao, J.-X. (2008). Cancer stem cells: The lessons from pre-cancerous stem cells. Journal of
Cellular and Molecular Medicine, 12(1), 67–96. https://doi.org/10.1111/j.1582-
4934.2007.00170.x
Hildebrand, D., Uhle, F., Sahin, D., Krauser, U., Weigand, M. A., & Heeg, K. (2018). The
Interplay of Notch Signaling and STAT3 in TLR-Activated Human Primary Monocytes.
Frontiers in Cellular and Infection Microbiology, 8.
https://doi.org/10.3389/fcimb.2018.00241
Hoffmann, M., Mösbauer, K., Hofmann-Winkler, H., Kaul, A., Kleine-Weber, H., Krüger, N.,
Gassen, N. C., Müller, M. A., Drosten, C., & Pöhlmann, S. (2020). Chloroquine does not
inhibit infection of human lung cells with SARS-CoV-2. Nature, 585(7826), 588–590.
https://doi.org/10.1038/s41586-020-2575-3
Huang, Q., Li, J., Zheng, J., & Wei, A. (2019). The Carcinogenic Role of the Notch Signaling
Pathway in the Development of Hepatocellular Carcinoma. Journal of Cancer, 10(6),
1570–1579. https://doi.org/10.7150/jca.26847
Ishizawa, K., Rasheed, Z. A., Karisch, R., Wang, Q., Kowalski, J., Susky, E., Pereira, K.,
Karamboulas, C., Moghal, N., Rajeshkumar, N. V., Hidalgo, M., Tsao, M., Ailles, L.,
Waddell, T. K., Maitra, A., Neel, B. G., & Matsui, W. (2010). Tumor-Initiating Cells Are
35

Rare in Many Human Tumors. Cell Stem Cell, 7(3), 279–282.
https://doi.org/10.1016/j.stem.2010.08.009
Lebeau, G., Vagner, D., Frumence, É., Ah-Pine, F., Guillot, X., Nobécourt, E., Raffray, L., &
Gasque, P. (2020). Deciphering SARS-CoV-2 Virologic and Immunologic Features.
International Journal of Molecular Sciences, 21(16), 5932.
https://doi.org/10.3390/ijms21165932
Liu, J., Cao, R., Xu, M., Wang, X., Zhang, H., Hu, H., Li, Y., Hu, Z., Zhong, W., & Wang, M.
(2020). Hydroxychloroquine, a less toxic derivative of chloroquine, is effective in
inhibiting SARS-CoV-2 infection in vitro. Cell Discovery, 6(1), 1–4.
https://doi.org/10.1038/s41421-020-0156-0
Mansour, F. A., Al-Mazrou, A., Al-Mohanna, F., Al-Alwan, M., & Ghebeh, H. (2020). PD-L1 is
overexpressed on breast cancer stem cells through notch3/mTOR axis. OncoImmunology,
9(1), 1729299. https://doi.org/10.1080/2162402X.2020.1729299
McGivern, D. R., & Lemon, S. M. (2011). Virus-specific mechanisms of carcinogenesis in
hepatitis C virus associated liver cancer. Oncogene, 30(17), 1969–1983.
https://doi.org/10.1038/onc.2010.594
Mirghani, H., Ugolin, N., Ory, C., Lefèvre, M., Baulande, S., Hofman, P., St Guily, J. L.,
Chevillard, S., & Lacave, R. (2014). A predictive transcriptomic signature of
oropharyngeal cancer according to HPV16 status exclusively. Oral Oncology, 50(11),
1025–1034. https://doi.org/10.1016/j.oraloncology.2014.07.019
Nishijima, T. F., Shachar, S. S., Nyrop, K. A., & Muss, H. B. (2017). Safety and Tolerability of
PD‐1/PD‐L1 Inhibitors Compared with Chemotherapy in Patients with Advanced Cancer:
36

A Meta‐Analysis. The Oncologist, 22(4), 470–479.
https://doi.org/10.1634/theoncologist.2016-0419
Onoue, K., Jofuku, A., Ban-Ishihara, R., Ishihara, T., Maeda, M., Koshiba, T., Itoh, T., Fukuda,
M., Otera, H., Oka, T., Takano, H., Mizushima, N., Mihara, K., & Ishihara, N. (2013).
Fis1 acts as a mitochondrial recruitment factor for TBC1D15 that is involved in
regulation of mitochondrial morphology. Journal of Cell Science, 126(1), 176–185.
https://doi.org/10.1242/jcs.111211
Ortiz, J. R., Robertson, J., Hsu, J.-S., Yu, S. L., Driscoll, A. J., Williams, S. R., Chen, W. H.,
Fitzpatrick, M. C., Sow, S., Biellik, R. J., & Neuzil, K. M. (2021). The potential effects
of deploying SARS-Cov-2 vaccines on cold storage capacity and immunization workload
in countries of the WHO African Region. Vaccine, 39(15), 2165–2176.
https://doi.org/10.1016/j.vaccine.2021.02.037
Osipo, C., Golde, T. E., Osborne, B. A., & Miele, L. A. (2008). Off the beaten pathway: The
complex cross talk between Notch and NF- κ B. Laboratory Investigation, 88(1), 11–17.
https://doi.org/10.1038/labinvest.3700700
Palaga, T., Wongchana, W., & Kueanjinda, P. (2018). Notch Signaling in Macrophages in the
Context of Cancer Immunity. Frontiers in Immunology, 9.
https://doi.org/10.3389/fimmu.2018.00652
Puhl, A. C., Fritch, E. J., Lane, T. R., Tse, L. V., Yount, B. L., Sacramento, C. Q., Fintelman-
Rodrigues, N., Tavella, T. A., Maranhão Costa, F. T., Weston, S., Logue, J., Frieman, M.,
Premkumar, L., Pearce, K. H., Hurst, B. L., Andrade, C. H., Levi, J. A., Johnson, N. J.,
Kisthardt, S. C., … Ekins, S. (2021). Repurposing the Ebola and Marburg Virus
Inhibitors Tilorone, Quinacrine, and Pyronaridine: In Vitro Activity against SARS-CoV-
37

2 and Potential Mechanisms. ACS Omega, 6(11), 7454–7468.
https://doi.org/10.1021/acsomega.0c05996
Ramdass, B., Maliekal, T. T., Lakshmi, S., Rehman, M., Rema, P., Nair, P., Mukherjee, G.,
Reddy, B. K. M., Krishna, S., & Radhakrishna Pillai, M. (2007). Coexpression of Notch1
and NF-κB signaling pathway components in human cervical cancer progression.
Gynecologic Oncology, 104(2), 352–361. https://doi.org/10.1016/j.ygyno.2006.08.054
Sencanski, M., Perovic, V., Pajovic, S. B., Adzic, M., Paessler, S., & Glisic, S. (2020). Drug
Repurposing for Candidate SARS-CoV-2 Main Protease Inhibitors by a Novel In Silico
Method. Molecules, 25(17), 3830. https://doi.org/10.3390/molecules25173830
Sun, Y., Wang, Z., Tao, J., Wang, Y., Wu, A., Yang, Z., Wang, K., Shi, L., Chen, Y., & Guo, D.
(2014). Yeast-based assays for the high-throughput screening of inhibitors of coronavirus
RNA cap guanine-N7-methyltransferase. Antiviral Research, 104, 156–164.
https://doi.org/10.1016/j.antiviral.2014.02.002
Tafani, M., Pucci, B., Russo, A., Schito, L., Pellegrini, L., Perrone, G. A., Villanova, L.,
Salvatori, L., Ravenna, L., Petrangeli, E., & Russo, M. A. (2013). Modulators of HIF1α
and NFkB in Cancer Treatment: Is it a Rational Approach for Controlling Malignant
Progression? Frontiers in Pharmacology, 4. https://doi.org/10.3389/fphar.2013.00013
Tsoulfas, G. (2019). Hepatocellular carcinoma and metabolic syndrome: The times are changing
and so should we. World Journal of Gastroenterology, 25(29), 3842–3848.
https://doi.org/10.3748/wjg.v25.i29.3842
Vanni, E., & Bugianesi, E. (2014). Obesity and liver cancer. Clinics in Liver Disease, 18(1),
191–203. https://doi.org/10.1016/j.cld.2013.09.001
38

Viswanathan, T., Arya, S., Chan, S.-H., Qi, S., Dai, N., Misra, A., Park, J.-G., Oladunni, F.,
Kovalskyy, D., Hromas, R. A., Martinez-Sobrido, L., & Gupta, Y. K. (2020). Structural
basis of RNA cap modification by SARS-CoV-2. Nature Communications, 11(1), 3718.
https://doi.org/10.1038/s41467-020-17496-8
Walls, A. C., Park, Y.-J., Tortorici, M. A., Wall, A., McGuire, A. T., & Veesler, D. (2020).
Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell,
181(2), 281-292.e6. https://doi.org/10.1016/j.cell.2020.02.058
Wang, Z., Li, Y., Wu, D., Yu, S., Wang, Y., & Leung Chan, F. (2020). Nuclear receptor HNF4α
performs a tumor suppressor function in prostate cancer via its induction of p21-driven
cellular senescence. Oncogene, 39(7), 1572–1589. https://doi.org/10.1038/s41388-019-
1080-3
Wu, D., Wu, T., Liu, Q., & Yang, Z. (2020). The SARS-CoV-2 outbreak: What we know.
International Journal of Infectious Diseases, 94, 44–48.
https://doi.org/10.1016/j.ijid.2020.03.004
Yan, Y., Chang, L., & Wang, L. (2020). Laboratory testing of SARS‐CoV, MERS‐CoV, and
SARS‐CoV‐2 (2019‐nCoV): Current status, challenges, and countermeasures. Reviews in
Medical Virology, 30(3). https://doi.org/10.1002/rmv.2106
Yanagi, Y., Okuno, Y., Narita, Y., Masud, H. M. A. A., Watanabe, T., Sato, Y., Kanda, T.,
Kimura, H., & Murata, T. (2021). RNAseq analysis identifies involvement of EBNA2 in
PD-L1 induction during Epstein-Barr virus infection of primary B cells. Virology, 557,
44–54. https://doi.org/10.1016/j.virol.2021.02.004
Zhang, T., Xie, J., Arai, S., Wang, L., Shi, X., Shi, N., Ma, F., Chen, S., Huang, L., Yang, L., Ma,
W., Zhang, B., Han, W., Xia, J., Chen, H., & Zhang, Y. (2016). The efficacy and safety
39

of anti-PD-1/PD-L1 antibodies for treatment of advanced or refractory cancers: A meta-
analysis. Oncotarget, 7(45), 73068–73079. https://doi.org/10.18632/oncotarget.12230

Abstract (if available)

Abstract Identification of Molecular Mechanism for Cell-Fate Decision in Liver ? Tumor-initiating cells (TICs) are a rare subpopulation important in hepatocellular carcinoma (HCC) progression, and responsible for the recurrence and unsatisfactory outcomes of traditional chemotherapy and radiotherapy. Our previous studies identified that activation and stabilization of NOTCH1 through the interaction with TBC1 Domain Family Member 15 (TBC1D15) upregulates NANOG which is essential for TICs expansion. However, other downstream effector genes activated by TBC1D15 expression and NOTCH1 stabilization are still not completely explored. We generated Tbc1d15 knockout mice and isolated hepatic progenitor cells which were subjected to anti-Notch1 chromosome immunoprecipitation to identify candidate genes downstream of Tbc1d15-Notch1 interaction. We validated the results of pathway analysis in Huh7 TBC1D15 knockdown cells. The results of RT-qPCR and Western Blot analysis showed that TBC1D15 may regulate the expression of Inhibitor of nuclear factor kappa B (I?B), I?B kinase (IKK?), Protein kinase B (AKT), Hepatocyte Nuclear Factor 4 (HNF4) and Programmed death-ligand 1 (PD-L1) that are related to immune responses and cell differentiation. And some of the downregulated genes in TBC1D15 knockdown Huh7 cells can be restored by re-activating Notch signaling pathway. Therefore, as an upstream regulator, TBC1D15 may be a potential therapeutic target for HCC treatment. ? SARS-CoV Replicon Inhibitor High Throughput Drug Screening ? Coronavirus Disease 2019 (COVID-19) caused by SARS-CoV-2 is spreading worldwide and has caused serious losses in public health and economy. Mutations in SARS-CoV-2 have caused a decrease in the vaccines protection which makes the new drugs identification an urgent task to resolve the public health issues. Compared with the emerging SARS-CoV-2, another similar virus SARS-CoV has well-studied replicon systems which also can be applied on the screening of some antiviral drugs previously. In the present study, we used BHK21 cells ectopical expressing bacmid-based SARS-CoV replicon to screen candidate compounds from National Cancer Institute (NCI). We identified the drug impacts on SARS-CoV replicon by measuring the expression of green fluorescent protein (GFP). Some NCI drugs were suggested to have inhibitory effect on viral RNA.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Targeting mitochondrion-nucleus PDH1 transfer to suppress self-renewal and epigenetic NANOG reprogramming of tumor-initiating cells

PDF

SARS-CoV-2 suppression of CD1d expression and NKT cell function

PDF

Mechanism of ethanol-mediated increase of SARS-COV-2 entry through GRP78 induction

PDF

Cell fate reprogramming of liver tumor-initiating stem-like cells via phosphorylated NUMB and TBC1D15

PDF

The analysis and modeling of signaling pathways induced by the interactions of the SARS-CoV-2 spike protein with cellular receptors

PDF

The interaction of SARS-CoV-2 with CD1d/NKT antigen presentation pathway

PDF

Polycomb repressive complex 2 subunit stabilizes NANOG to maintain self-renewal in hepatocellular carcinoma tumor-initiating stem-like cells

PDF

SARS-CoV-2 interaction with the CD1d/NKT cell antigen presentation system

PDF

Hepatitis B virus X protein regulation of β-catenin and NANOG and co-regulatory role with YAP1 in HCC malignancy

PDF

The role of envelope protein in SARS-CoV-2 evasion of CD1d antigen presentation pathway

PDF

Mechanisms of nuclear translocation of pyruvate dehydrogenase and its effects on tumorigenesis of hepatocellular carcinoma…

Asset Metadata

Creator Zhao, Xuyao (author)

Core Title Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology and Immunology

Degree Conferral Date 2021-08

Publication Date 07/28/2021

Defense Date 06/02/2021

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag COVID-19,drug screening,HCC,hepatocellular carcinoma,notch,Numb,OAI-PMH Harvest,PD-L1,SARS-CoV,TBC1D15,TIC

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Machida, Keigo (committee chair), Ou, Jing-Hsiung James (committee member), Schonthal, Axel (committee member)

Creator Email gabumon.zhao@gmail.com,xuyaozha@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC15659359

Unique identifier UC15659359

Legacy Identifier etd-ZhaoXuyao-9918

Document Type Thesis

Format application/pdf (imt)

Rights Zhao, Xuyao

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu