University of Southern California Dissertations and Theses

Study of the role of bone morphogenetic proteins in prostate cancer progression

(USC Thesis Other)

Study of the role of bone morphogenetic proteins in prostate cancer progression

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content STUDY OF THE ROLE OF BONE MORPHOGENETIC PROTEINS IN
PROSTATE CANCER PROGRESSION

by

Minyoung Lim

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(GENETIC, MOLECULAR AND CELLULAR BIOLOGY)

May 2010

Copyright 2010 Minyoung Lim

ii
Acknowledgements
I deeply appreciate my mentor, Dr. Pradip Roy-Burman for all his support to complete
this work. I thank Dr. Baruch Frenkel and Dr. Cheng-Ming Chuong for their invaluable
advice in conducting my dissertation study. It was a great pleasure to work with members
of Roy-Burman lab. Finally I appreciate my husband, my daughter Noori and both of my
families in Korea for all sacrifice they paid to support my research.

iii
Table of Contents
Acknowledgements............................................................................................................. ii
List of Tables ..................................................................................................................... iv
List of Figures......................................................................................................................v
Abbreviations..................................................................................................................... vi
Abstract............................................................................................................................. vii
Chapter 1: Introduction........................................................................................................1
Bone morphogenetic proteins in prostate cancer ...................................................... 2
Effect of bone morphogenetic protein 7 on prostate cancer cells............................. 3
Hypotheses & experimental design .......................................................................... 5
Chapter 2: Runx2 regulates survivin expression in prostate cancer cells............................7
Chapter 2 abstract ..................................................................................................... 7
Introduction............................................................................................................... 8
Materials and methods ............................................................................................ 10
Results..................................................................................................................... 16
Discussion............................................................................................................... 31
Chapter 3 : Characterization of epithelial-mesenchymal transition in prostate cancer
cells induced by BMP7 ..................................................................................36

Chapter 3 abstract ................................................................................................... 36
Introduction............................................................................................................. 37
Materials and methods ............................................................................................ 39
Results..................................................................................................................... 44
Discussion............................................................................................................... 62
Chapter 4: Conclusions and future directions....................................................................67
References..........................................................................................................................73

iv
List of Tables
Table 1. Summary of immunostaining results with human prostate cancer specimens. .. 28
Table 2. PCR primer sequences used in the study............................................................ 41

v
List of Figures
Figure 1. Downregulation of survivin expression and induction of cell apoptosis by
AML1-ETO or Runx2 siRNA in C4-2B cells. .................................................. 17
Figure 2. In vivo occupancy of the human survivin gene promoter by Runx2 in
C4-2B cells cultured in full serum medium....................................................... 19
Figure 3. Effect of BMP7 on survivin expression and binding of Runx2 to survivin
promoter in serum starved C4-2B cells. ............................................................ 22
Figure 4. Stimulation of Runx2 expression by BMP7 in serum starved C4-2B cells. ..... 26
Figure 5. Analysis of Runx2 and survivin expression in prostate cancer cells................. 29
Figure 6. Morphologic changes in PC-3 cells induced by BMPs but not by TGFβ1. ...... 45
Figure 7. Distinctive structural transformation is observed in BMP7-treated spheroids
of PC-3, but not in other prostatic cells. ............................................................ 47
Figure 8. Decrease of E-cadherin expression is accompanied with morphologic
conversion in 2D and 3D. .................................................................................. 50
Figure 9. Protease expression pattern and cell invasion are affected by BMP7............... 52
Figure 10. Two signaling pathway, Akt and Erk conduct cell migration and 2D
morphology of EMT induced by BMP7............................................................ 55
Figure 11. Akt and Erk activity is also required in 3D morphology of EMT induced
by BMP7............................................................................................................ 57
Figure 12. Expression of transcription factors that play a role in EMT induction were
determined by semi-quantitative PCR............................................................... 59
Figure 13. Cancer-associated fibroblasts induced 3D morphology change similar to
that of BMP7-treated cancer cells...................................................................... 61

vi
Abbreviations
BMP bone morphogenetic protein
EMT epithelial-mesenchymal transition
CAF cancer-associated fibroblast
NPF normal prostatic fibroblast
cPten
-/-
conditional Pten deletion by Cre recombinase
TGFβ1 transforming growth factor β1
2D two dimensional
3D three dimensional
FBS fetal bovine serum
siRNA small interfering RNA
TUNEL terminal deoxynucleotidyltransferase–mediated dUTP nick end labeling
ChIP chromatin immunoprecipitation
DMSO dimethyl sulfoxide
cDNA complementary DNA
H&E Hematoxylin and Eosin

vii
Abstract
High expression of bone morphogenetic protein 7 (BMP7) in bone metastasis of
the human prostate tumor and increased BMP7 expression with progression of prostatic
adenocarcinoma in a mouse model imply a role for this protein in the advanced cancer.
We examined the effect of BMP7 on various human prostatic cell lines to investigate its
function on their oncologic properties in prostate cancer progression. The cancer cell
lines presented various features of cancer progression such as anti-apoptotic activity or
enhanced cell migration and invasion that were modulated by BMP7. We identified
survivin as a key player in the anti-apoptotic protection in C4-2B prostatic cancer cell
line. A master transcription factor of osteoblastic differentiation, Runx2, was found to
regulate survivin expression and cell protection. BMP7 maintained the level of Runx2 as
well as enhanced the association of Runx2 on survivin gene promoter. Moreover, Runx2
played an important role in avoiding cell death in normal culture conditions. Runx2
inhibition using either siRNA or AML1-ETO fusion protein, which suppressed Runx
target gene expressions, significantly increased cancer cell apoptosis. The expression
pattern of Runx2 was also correlated with the tumor growth in the mouse model of
prostate cancer. It was noted that BMP7 induced phenotypic conversion similar to
epithelial-mesenchymal transition (EMT) in PC-3 human prostate cancer cells. EMT is
widely accepted as an important event of cancer metastasis, we pursued to identify the
conversion. We characterized the major features of EMT in the cells; morphologic
conversion, alteration in molecular expressions, increased cell invasion and migration,

viii
signal transduction of BMP and the expression of transcription factors that execute EMT.
We also examined the effect of cancer microenvironment on EMT. Cancer-associated
fibroblasts (CAFs), but not its normal counterparts, were able to induce morphologic
change similar to that induced by BMP7. The results are consistent with the notion that
cancer activated stroma play a role in metastatic progression. To sum up, this study
confirms that BMP7 can enhance the malignant potential of prostate cancer cells via
protection from apoptotic stress and induction of invasive properties.

1
Chapter 1
Introduction
Progression of prostate cancer
Prostate cancer is the second leading cause of cancer-related death in American
males. In 2007, prostate cancer took first in place for cancer incidents worldwide, with
782,600 new cases reported
(42)
. Incidence of invasive adenocarcinoma of prostate is
ranked second, following skin cancer, which is strongly correlated with aging. About one
third of males, fifty years or older in age, is found to have prostatic abnormality including
hyperplastic disorder and prostate cancer
(64, 144)
. Race, family history of the disease, and
diet also have an effect, but aging is the most critical factor in the development of
prostate adenocarcinoma
(1)
. More than 60% of diagnosed cancer cases are found in men
aged 65 or older. Recent statistics show a trend in a slight reduction of mortality from
prostate cancer. Still the fatality of prostate cancer cannot be underestimated as both life
expectancy and the population of the elderly is continuously growing.
Tumor metastasis is the cause of over 90% of human cancer-related death,
including prostate cancer. Bone is the most frequent site for prostate cancer metastasis,
about 65 to 75 % of metastasis is found in the skeleton. Once prostate tumor cells
successfully colonize the bone, it is almost impossible to cure. Bone metastasis is
accompanied with excruciating pain, compromised motility, and frequent bone fracture.
Eventually, it causes death in over 90% of patients who have metastasis. Despite the
existence of widely used diagnostics for the detection of prostatic abnormality, such as
prostate specific antigen test and digital rectum examination, and effective therapeutics

2
such as hormone retraction therapy and prostatectomy, unpredictable progression to
recurrence and metastasis of prostate cancer becomes an obstacle to cure the disease.
Better understanding of prostatic tumor progression will improve the selection of cancer
therapy and reduce unnecessary medical expenditure. In this regard, it will be essential
question to ask what factors of bone microenvironment favorably affect prostate cancer
and promote tumor malignancy.

Bone morphogenetic proteins in prostate cancer
Bone morphogenetic proteins (BMPs), which belong to the TGFβ superfamily,
are growth factors that regulate critical embryonic development processes in the
formation of the heart, the central nervous system, and the prostate etc. As the name
indicates, BMPs play an indispensable role in skeletal development, such as
differentiation of osteoblasts and cartilages
(22, 25, 85, 121)
. BMPs also mediate cell
proliferation, differentiation and migration in various physiological events
(35, 40, 60, 100)
,
most remarkably postnatal bone homeostasis.
Several BMPs are associated with prostate cancer. BMP2, 3, 4, 6, and 7 were
found in human prostate and the expression of BMP4, 6, and 7 was found to be increased
in bone metastasis of prostatic tumor
(9, 12, 13, 30, 47, 50, 68, 86, 115)
.
The role of BMP7 in prostate cancer progression remains mostly unknown
compared to of other BMPs. BMP7 is highly homologous with other members of the
BMP family, with about 90% homology to BMP5 and 6, and about 60% homology to
BMP2 and 4. BMP7 is believed to be involved in postnatal bone homeostasis as well as

3
in prenatal skeletal development. The activity of BMP7 for bone formation in vivo and
for proliferation and differentiation of human bone cells in vitro was well-established
(7, 8,
87, 94, 120, 143)
and the use of BMP7 for clinical purpose was approved by the Food and
Drug Administration. Human recombinant BMP7 is already marketed for surgical
auxiliary use and for dietary supplement for bone health. Prospectively, its application
may be expanded to treatment of kidney diseases. Deletion of BMP7 gene is associated
with the failure of kidney and eye development
(24, 34)
.
The connection between BMP, especially BMP7 as our specific interest, and
prostate tumor progression is indicated by several lines of evidence. BMP7 expression
was significantly increased in bone metastasis of human prostate cancer, even higher than
bone itself
(23)
. There is an association of BMP7 with tumor growth in the prostate of
conditional Pten deletion mouse, which spontaneously develops invasive
adenocarcinoma and metastasis, similar to the progression of human prostate cancer
(80,
107, 119, 127, 140)
. Hence we further examined the effect of BMP7 on various human prostate
cancer cells.

Effect of bone morphogenetic protein 7 on prostate cancer cells
In our previous study, BMP7 presents diverse effects on prostatic cells. BMP
inhibits cell proliferation in benign hyperplasia cell line, BPH-1
(142)
, but its effects on
prostatic cancer cells are likely promoting malignancy of the cancer. Two of the effects
draw our attention, anti-apoptotic protection and enhanced cell invasion and motility
accompanied with morphologic change.

4
In C4-2B prostate cancer cells, serum starvation in culture media induced cell
apoptosis. Either exogenously given BMP7 or endogenously overexpressed BMP7 was
able to salvage the cancer cells from cell death
(140)
. The effector molecule of cell
protection was Survivin, which belong to the inhibitor of apoptosis protein family.
Survivin has been intensely studied for a therapeutic development for cancer since
Survivin expression has been reported in nearly all kinds of human tumor but not in their
normal counterparts
(3, 4)
. The association of Survivin expression with prostatic tumor
progression was unraveled and the anti-apoptotic protection of Survivin was obvious in
the cancer cells
(97, 98, 111, 149)
. Similar to the observation made in human cancer, prostatic
tumor in mouse model carrying conditional Pten deletion presented a gradual increase of
Survivin along with the growth of the tumor
(140)
.
BMP7-mediated cell protection was achieved through transcription of the survivin
gene and subsequent up-regulation of Survivin protein expression
(140)
. We also observed
two signaling pathways that participated in the protection process. The canonical
transduction pathway of BMP signaling, Smad pathway was the one of them and c-Jun
NH
2
-terminal kinase (JNK) was the other. Among these two independent signal
transduction pathways, only inhibition of Smad pathway affected survivin transcription
activity.

5
Hypotheses & experimental design
Cancer cells must overcome many obstacles to survive and progress; they should
acquire the ability to proliferate regardless of environmental cues, evade programmed cell
death and eventually colonize different organs, which is widely accepted as ‘hallmarks of
cancer’
(48)
. Our previous studies indicated a role of BMPs in prostate cancer progression
since the effects of BMP7 on the cancer cells met some of these criteria. As mentioned
above, the association of BMPs with human prostatic tumor was already described and
the expression of BMPs is enriched in the bone microenvironment to regulate skeletal
homeostasis. In this regard, it was perceived that a description of the physiological effects
of BMPs on prostate cancer cells at a molecular level might enhance our understanding of
the underlying mechanisms of tumor advancement.
This dissertation work has been studied two distinct features of BMP7, which are
likely to promote cancer progression. First, we describe how the anti-apoptotic effect,
specifically how the transcriptional regulation of Survivin is achieved in C4-2B cells. The
search for transcription factors in the regulation of survivin was carried out among the
interaction partners of Smad signaling, as the DNA binding of the activated Smads
complex is rather promiscuous. The gene-specific regulation of Smads is accomplished
by combining with other transcription cofactors in various cellular contexts. The
universal dysregulation of Survivin in cancer cells confers much significance to the study.
Second, BMP7-induced phenotypic conversion similar to epithelial-mesenchymal
transition (EMT) is scrutinized in PC-3 cancer cells. EMT in cancer cells is commonly

6
considered as an early process of metastasis as the cells underwent EMT become
migratory and invasive. EMT is currently a topic of emerging research interest since it is
associated with tumor malignancy and potentially implicated in the generation of tumor-
initiating cells. Thus, the BMP7-induced physiological alteration is scrutinized to
characterize the features of EMT and to unravel the mechanism of the EMT induction in
the cancer cells.
This study is mainly focused on the role of BMP7 in prostate cancer progression.
Our previous studies described similar effects of BMP7 and other BMPs. Considering
high structural homology among these proteins, the study of BMP7 is likely to shed light
on other BMPs as well. This research gains more importance as BMP7 is already in use
for clinical purpose, and thereby, calling for more careful evaluation for its systemic
administration.

7
Chapter 2
Runx2 regulates survivin expression in prostate cancer cells
Chapter 2 abstract
Previously we described that bone morphogenetic protein 7 (BMP7) could protect
prostate cancer C4-2B cells from serum starvation-induced apoptosis via survivin
induction. Here, for the first time, we identify Runx2 as a key regulator of survivin
transcription. In C4-2B cells grown normally, suppression of Runx2 reduced survivin
expression. Using ChIP assays, two regions of the survivin promoter, -1953 to -1812 (I)
and -1485 to -1119 (II) encompassing consensus Runx binding sites were examined.
Runx2 was found to be associated with both regions with a stronger affinity to region I.
In serum-starved cells neither region was occupied but BMP7 restored the association to
region II, not I. In reporter assays, transcription activity by BMP7 was significantly
reduced when sequences including binding sites of region II were deleted. Additionally,
Runx2 expression was enhanced by BMP7 in these cells. Along with a strong survivin
expression, a trend in increased Runx2 expression in human prostate cancer cells and
tissues was noted. In the conditional Pten knockout mouse, Runx2 level increased with
the growth of prostate tumor. The data define a novel role of Runx2 in regulating
survivin expression in malignant epithelial cells and identify it as a critical factor in BMP
signaling that protects cancer cells against apoptosis.

8
Introduction
The family of bone morphogenetic protein (BMP) that belongs to the transforming
growth factor-β (TGF-β) superfamily, was originally identified as osteogenic factors.
(22)

Soon it became evident that BMP also played important roles in multiple cellular
processes such as cell growth, differentiation, migration, apoptosis, and in cancer.
(33)
We
were particularly interested in the role of BMP7 in prostate cancer. BMP7 expression was
reported in human metastatic prostate cancer specimens
(18)
and was most abundant in
prostate cancer skeletal metastasis.
(86)
Furthermore, a regulation of BMP7 expression by
androgen was described.
(85)
Previously, we reported that in the Pten conditional deletion
mouse model of prostate cancer
(76, 127)
BMP7 protein expression increased with the
growth of the prostate adenocarcinoma
(142)
and correlated with the induction of tumor-
promoting heterotypic cell interactions
(141)
. We also demonstrated that BMP7 could
induce epithelial-mesenchymal trans-differentiation in PC-3 human prostate cancer cells
and exert a strong protection against stress-induced apoptosis in another aggressive
prostate cancer cell line, C4-2B.
(142)
In C4-2B cells under serum starvation, the effect of
BMP7 was found to be mediated by survivin, a member of the inhibitor of apoptosis
(IAP) protein family. Under serum starvation BMP7 maintained the level of survivin
protein but not XIAP of the IAP family or any of the Bcl-2 family members examined in
these cells.
(142)

Survivin is considered as a cancer therapeutic target as aberrant high expression of
survivin was documented in many different types of human cancer.
(5)
It is thought that
survivin over-expression might allow accumulation of mutations in transformed cells and

9
thereby promoting tumor progression. Transcription of the survivin gene that is
prominent in the mitosis phase of the cell cycle is also regulated by various growth
factors and cytokines.
(6)

When we analyzed the human survivin promoter with the TF Search program
(51)

multiple potential binding sequences for transcription factors were apparent. Among
them were sites that could serve to recruit Smad and Runx proteins. The Smad pathway is
indeed a canonical pathway for BMP function and we showed earlier that introduction of
a dominant negative mutant of Smad 5 could inhibit the activity of the survivin
promoter.
(140)
In mammalian cells, the Runx family, also known as the acute myeloid
leukemia (AML), core-binding factor-α (CBFα) or polyoma enhancer-binding protein-2α
(PEBP2α) family, include three structurally similar members (Runx1, -2 and -3). Runx
proteins were described to bind to a common non-DNA binding partner, CBFβ, to form a
heterodimeric complex, the target of which appeared to be a conserved nucleotide
sequence.
(39, 88)
Despite their similarities, Runx proteins, however, were determined to
play divergent biological roles that were consistent with the distinct phenotypes observed
in the corresponding gene knockout in mice.
(17)

There is evidence that activated Smad proteins may interact with Runx2, the
“master” transcription factor for the differentiation of osteoblasts, in regulating
transcriptional activity.
(49, 54, 55)
Considering these sets of existing knowledge, and our
earlier demonstration that BMP-induced Smad signaling is indeed involved in
transcriptional activation of the survivin gene in prostate cancer cells,
(142)
we
hypothesized that Runx2 might also be critical in regulation of survivin expression in

10
malignant epithelial cells and consequently required for the anti-apoptotic effect of
BMP7 in the C4-2B test system. Hence, among the Runx members, we wished to focus
on Runx2 for this study. Here, we describe for the first time that Runx2 interacts with the
survivin promoter in vivo and it regulates transcription of the survivin gene in C4-2B
cells grown under either normal conditions or under serum starvation but with exposure
to BMP7. We also show that BMP7 regulates expression of Runx2 in these cells and that
in the conditional Pten deletion mouse model,
(76, 127)
similar to our previous observation
of survivin over-expression,
(140)
there is a strong correlation of increased Runx2
expression with the prostate tumor growth. In the human prostate cancer specimens, we
confirm up-regulation of survivin expression and a readily detectable Runx2 expression.

Materials and methods
Materials
Human recombinant BMP7 protein (generously provided by Dr. A. Hari Reddi of
University of California Davis or purchased from R&D) was diluted in the 0.1% serum
medium and used at concentration of 50 ng/mL in all experiments unless specified
otherwise. The survivin gene promoter constructs (pLuc1430 and pLuc649)
(74)
were
generously provided by Dr. Dario Altieri of the University of Massachusetts. The
pAML1-ETO vector
(89)
was kindly provided by Dr. Baruch Frenkel of the University of
Southern California. The pCMV5 empty vector was used as a control in all experiments
using pAML1-ETO.

11
Cell culture and transient transfection
C4-2B cells were maintained

in culture medium with 10% fetal bovine serum
(FBS) as described previously
(142)
. For serum starvation, the cells were cultured in
medium containing 0.1% FBS. Transient transfection was performed with either Tfx-
20/50

Reagent (Promega) or lipofectamine 2000 (Invitrogen) according to the
manufacturer’s instruction.
Small interfering RNA (siRNA) treatment
C4-2B cells were seeded in six-well plates

at 1.5 x 10
5
cells per well and grown in
the antibiotics-free medium for two days to reach 30-50% confluence. The cells were
transfected with siRNA duplexes at final concentrations of 50 nmol/mL. control siRNA
duplex [sense 5'-UUCUCCGAACGUGUCACGUdTdT, 3'-Fluorescein labeled; antisense
5'-ACGUGACACGUUCGGAGAAdTdT] and siRNA specific for Runx2
(101)
[sense 5'-
CUCUGCACCAAGUCCUUUUdTdT; antisense 5' -
AAAAGGACUUGGUGCAGAGdTdT] were purchased from Qiagen. siRNA for human
survivin [sense 5'-CUGGACAGAGAAAGAGCCAdTdT; antisense 5'-
UGGCUCUUUCUCUGUCCAGdTdT] was produced by Ambion.
Terminal deoxynucleotidyltransferase–mediated dUTP nick end labeling
(TUNEL) assay
The TUNEL assay was carried out to measure apoptotic cell proportion using
APO-BrdU kit (Phoenix Flow Systems). Cell death was also monitored under light

12
microscope every day during cell culture for a period of 24 to 96 hours after treatment or
transfection.
Chromatin immunoprecipitation (ChIP) assay
Crosslinking ChIP assay was performed using ChIP-IT Express kit (Active Motif)
following the manufacturer’s instruction. Formaldehyde cross-linking was performed for
10 minutes. Nuclei were pelleted and chromatin was sheared with sonication using VirTis
Virsonic 600. Approximately 9 µg sheared chromatin was immunoprecipitated with 4 µg
anti-PEBP2α antibody (M-70X; Santa Cruz) or normal rabbit IgG using magnetic protein
G beads. For native ChIP, the experiments were conducted in the same way except that
the step of the formaldehyde cross-linking was omitted.
(105)
The primers designed to
amplify various regions of the human survivin gene promoters were as follows: 5’-
CGGTTAGCGAGCCAATCAGCA-3’ and 5’-
ACCATACTACCCCGAAATACTTCATTCT-3’ (region I); 5’-
GCAATTATCTTTTATTTAAATTGACATCG-3’ and 5’-
GCCCCCATTCTTTAATACAGTAACTT-3’ (region II); and 5’-
GCGTTCTTTGAAAGCAGTCGAG-3’ and 5’-GGAGCGCACGCCCTCTTA-3’ (a
control region). All ChIP assays were performed at least three times and the most
representative results are illustrated in the figures.
Generation of luciferase reporter plasmids
The truncated fragment of the survivin promoter (pLuc1270) was generated by
PCR amplification using pLuc1430 as a template and using a forward primer 5'-

13
GACACCGACGGATCCAGGCTGAGGCAGGAGAATCGC-3' and reverse primer 5'-
GAATTCTAGAAGCTTAA ATCTGGCGGTTAA-3'. The DNA fragment was cloned
using TA Cloning Kit with One Shot
®
TOP10F' Chemically Competent E. coli and
subcloned to the BamHI and HindIII sites of pLuc1430.
Luciferase reporter assay
C4-2B cells were seeded in six-well plates

at 2 x 10
5
cells per well and grown for
two to three days. For serum starvation, cells were pretreated

in 0.1% serum medium for
24 hours prior to cell transfection.

When cells reached 70% to 80% confluence, 1 µg of
each reporter constructs and 0.5 µg of pSV-β-Galactosidase

control vector were co-
transfected. When needed, 0.5-1.0 ug pAML1-ETO or 1 ug empty vector was also
transfected into the cells along with the reporter constructs and the pSV-β-Galactosidase

control. The transfected cells were then lysed in 1x lysis buffer included in Luciferase
Assay System (Promega) at 24 hours post transfection. The lysed supernatants were used
for

either luciferase assay or β-galactosidase assay as

described
(140)
and the results were
normalized to the activity of β-galactosidase.

The expression of AML1-ETO was confirmed by semi-quantitative RT-PCR
following a reported procedure.
(136)
The primers used were: forward, AML1-ES: 5’-
GAGGGAAAAGCTTCACTCTG-3’, and reverse, ETO-EA: 5’-
TCGGGTGAAATGTCATTGCC-3’, and the thermocycle setup included denaturation at
95C
0
for 30 sec, annealing at 58C
0
for 30 sec, and polymerization at 72C
0
for 90 sec for
40 cycles.

14
RNA extraction, cDNA synthesis and comparative quantitative PCR
Total RNA was extracted by TRIzol Reagent (Invitrogen) following
manufacturer’s protocol and genomic DNA was digested by DNaseI (Ambion). cDNAs
were synthesized with 2 μg of total RNA using iScript cDNA Synthesis kit (Bio-Rad).

Quantitative PCR analyses for Runx2 expression were

carried out with forward primer 5'-
CCTCGGAGAGGTACCAGATG-3' and reverse primer 5'-
AGGTGAAACTCTTGCTGCA-3' using the Stratagene Mx3000P PCR machine. The
reaction mix contained 13 µL of 2x Brilliant

SYBR Green QPCR Master Mix
(Stratagene) or Faststart Universal SYBR Green Master Mix (Roche) with 1 µL of

cDNA
in a total volume of 25 µL.

GAPDH was used for each sample as control for
normalization.
Preparation of whole cell lysates of human prostatic cell lines or mouse prostate
tissues and western blot analysis
Whole cell lysates of prostatic cell lines and the mouse prostatic tissues were
prepared following the protocols described previously.
(142)
The antibodies used for
Western blot analysis were rabbit anti-PEBP2αA and goat anti-Actin (Santa Cruz), and
rabbit anti-survivin (Novus Biologicals).
Human prostate cancer specimens and immunohistochemistry
Tissue microarrays were constructed using a manual arrayer (Beecher Instruments,
WI) from 59 cases of prostate cancer, all adenocarcinomas, diagnosed and graded in the

15
Department of Pathology at University of Iowa Hospitals and Clinics, Iowa City, from
2001 to 2003. Core tissue biopsies (diameter 2.0 mm, height 3-4 mm) were taken from
morphologically representative regions of formalin-fixed paraffin-embedded blocks (45 x
20 mm) containing original tissue and arrayed into a regular recipient paraffin block.
An immunoperoxidase reaction for survivin and Runx2 proteins was performed
on each case using ABC method. Both primary antibodies for survivin (Lab Vision) and
Runx2 (Santa Cruz) were diluted to 1:100 for the analysis. Antigen unmasking was
accomplished using citrate buffer (pH 6.0) and a heating method (microwave or
preheated steamer). Slides were allowed to cool at room temperature. Nonspecific
background staining was prevented by application of horse or goat serum. Sections were
covered with primary antiserum, incubated and rinsed. A counterstain of 10% Harris
hematoxylin for 3 minutes was used. Negative control slides were prepared by
substituting rabbit immunoglobulin. Immunoreactivity for benign and malignant prostate
epithelium, as well as stroma cells, was evaluated using both proportion and intensity
scores graded from 0 to 3 for a total quantitative score range of 0 to 6. Intensity staining
was graded as follows: 0 = no staining, ranging to 3 = strongly positive. Proportion
staining was graded as follows: 0 = no staining, 1 = 1-33% of cells positive, 2 = 33 to
66% of cells positive, 3 = over 66% of cells positive. Comparison of expression between
malignant and benign epithelium, by assigned grade, and between epithelium and
intervening stroma was performed for both proteins.

16
Statistical analysis
All experiments were done in triplicates

and repeated at least three times.
Statistical comparisons were made

by an unpaired two-tailed t test.

Results
Modulation of survivin expression in C4-2B cells and their sensitivity to
apoptosis by AML1-ETO or Runx2 siRNA
Previously we described that survivin expression was elevated by BMP7 in serum
starved C4-2B cells, and that increased survivin was associated with the anti-apoptotic
effect of BMP7.
(142)
Thus we were motivated to further investigate the regulation of
survivin expression in this cell line. Analysis of the upstream -2.8 kb fragment of the
human survivin gene promoter showed the presence of multiple putative Runx2 binding
sites within this region.
(51, 14)
To investigate the possible involvement of Runx2 in
survivin expression and subsequent cell apoptosis, we first examined the effect of AML1-
ETO on C4-2B cells cultured under normal culture conditions. AML1-ETO is encoded
by a fusion gene resulted from the translocation (t8:21) which is commonly associated
with AML.
(89)
It represses the expression of Runx domain targets by functioning as a
constitutive transcription repressor.
(130)
C4-2B cells were transfected with various
amounts of the AML1-ETO expression vector and the levels of survivin in the transfected
cells were determined. As illustrated in Figure 1a, while transfection with 0.5 ug of the
plasmid did not cause a significant reduction in survivin expression, the effect was robust

17
when 1 µg of the plasmid DNA was used. The results also showed that pAML1-ETO
transfection did result in the expression of the gene in the cells, and that Smad activation
or the level of expression of the Runx2 protein was not affected by AML1-ETO
expression to any significant extent (Figure 1a). Consistent with the down-regulation of
survivin expression, the apoptotic rate of the cells treated with 1 µg plasmid increased to
60% compared to 10% of the untreated cells (Figure 1b).

Figure 1. Downregulation of survivin expression and induction of cell apoptosis by
AML1-ETO or Runx2 siRNA in C4-2B cells.
(a) Effect of AML1-ETO on survivin expression. C4-2B cells at 50-70% confluence were
transfected with 0.5 μg or 1 μg pAML1-ETO per well in 6-well plates. The expression
levels of survivin in the cells at 48 hours post transfection were analyzed with Western
Blot and compared with those in control cells transfected with the pCMV5 empty vector.
Equal loading of the cells lysates was shown using actin as a control. The expression of
AML1-ETO in the transfected cells was determined by semi-quantitative RT-PCR using
GAPDH expression as control.
(b) Induction of apoptosis by expression of AML1-ETO. C4-2B cells transfected with
indicated amount of pAML1-ETO were subjected to TUNEL assay. Compared to control
cells or cells transfected with 0.5 μg pAML1-ETO, cells treated with 1 μg of pAML1-
ETO had significantly higher apoptotic rate (P<0.05).

18

Figure 1, Continued (c) Reduction of survivin expression in cells treated with Runx2
siRNA (siRunx2) or survivin siRNA (siSurv). C4-2B cells at 30-50% confluence were
transfected with siSurv, siRunx2 or control siRNA (siCtrl) at a final concentration of 50
nmol/mL. The protein levels of Runx2 and survivin were examined with Western blot.
Treatment of siRunx2 led to significantly decreased levels of Runx2 and survivin, while
siSurv reduced the protein level of survivin but not Runx2. (d) Induction of cell
apoptosis by siRunx2 or siSurv. The apoptotic rates of the cells at 4 days post-
transfection were determined with TUNEL assay.

Considering that AML1-ETO exerts repression on all tested Runx-dependent
genes,
(93)
and that Runx1 and Runx3 proteins are also expressed in C4-2B cell, we
further utilized the RNAi technique to examine the specific effect of Runx2. As shown in
Figure 1c, at 72 hrs or 96 hrs post-transfection of Runx2 siRNA, Runx2 level was
significantly decreased, so did that of survivin. In addition, cells transfected with Runx2
siRNA underwent apoptosis to an extent similar to that of cells transfected with survivin

19
siRNA (Figure 1d). These results implied that Runx2 might be pivotal for survivin
expression and therefore potentially critical to block apoptosis of C4-2B cells.
Runx2 association with the survivin promoter in C4-2B cells
Multiple putative Runx binding sites on the -2.8 kb fragment of the survivin
promoter were identified by TFsearch program
(51)
with default settings (Figure 2a).

Figure 2. In vivo occupancy of the human survivin gene promoter by Runx2 in C4-
2B cells cultured in full serum medium.
(a) Line diagram of the survivin promoter (-2.8 kb) indicating positions of the various
potential Runx2 binding sites. The sequence is numbered relative to the ATG translation
initiation site and each site is marked by the number of the first nucleotide. The number
in the parentheses indicates the weighted score of sequence conservation at that site
calculated.
(51)
Underscored regions I and II were analyzed by ChIP assays for which a
region marked as Ctrl served as negative control for the binding assays. The nucleotide
sequence encompassing region I and region II is presented underscoring the theoretical
Runx and Smad interacting elements. Runx sites are indicated in bold and underlined
with the score of conservation in the parenthesis. The unmatched nucleotide is italicized.
Smad elements,
(72, 146)
in italics, are also underlined.

20

Figure 2, Continued (b) Detection of Runx2 binding to regions I and II with the cross-
linking ChIP assay. The immunoprecipitates were subjected to PCR analysis to determine
the binding affinity.
(c) Detection of Runx2 binding to region I with native ChIP assay.

ChIP assays were performed in order to examine the association of Runx2 to the
promoter. Highly specific primers could be designed to amplify two different regions
each containing a fully consensus binding site. These were: -1953 to -1812 region
containing the -1853 to -1848 binding site (region I), and -1485 to -1119 region
encompassing the -1314 to -1309 binding site (region II). Region II also harbored an 89%
homologous sequence at -1391 to -1386. Specific primers were used to amplify a region
(-267 to -76) to serve as a control for the binding study. The specificity of the primer sets
was analyzed with the UCSC BLAT server,
(62)
and further confirmed by sequencing the
PCR products. The results obtained with ChIP assays supported in vivo occupancy of the
survivin promoter by Runx2 in C4-2B cells. For example, when cross-linking ChIP was
performed on these cells cultured in full serum medium, interaction of Runx2 with
regions I and II was clearly evident (Figure 2b). No significant occupancy of Runx2 at

21
the control region was detected under the conditions used. Native ChIP was then carried
out to examine the relative affinities of the two binding regions detected by the cross-
linking ChIP. Primarily, occupancy of region I by Runx2 was detected in the native ChIP
assay (Figure 2c), implying that the interaction this site was relatively stable while that to
the region II was not strong enough to survive the harsh sonication procedure. Since the
native ChIP was performed in a way similar to that of cross-linking ChIP except for the
fixation step, the results also indicated that chromosome shearing was sufficient to
separate regions I and II.
Runx2-dependence of the effect of BMP7 on survivin expression
In cells cultured in 0.1% serum medium, BMP7 treatment up-regulated survivin
expression and protected the cells from apoptosis, which was consistent with our
previous results.
(140)
However, in the presence of optimal AML1-ETO, survivin
expression was greatly inhibited (Figure 3a) and protective effect of BMP7 was
counteracted (Figure 3b), suggesting involvement of Runx proteins. We performed cross-
linking ChIP assays with C4-2B cells that were treated with BMP7 for one day with those
of the untreated cells. The ChIP results showed that the extent of interaction of Runx2 to
either region I or II was below the level of detection in the serum starved cells (Figure 3c).
However, when these cells were treated with BMP7, occupation of Runx2 to region II but
not I could be demonstrated. Since the protein level of Runx2 was determined to be
similar in both untreated cells and one day BMP7-treated cells (data not shown), the
results indicated that exposure to BMP7 enhanced the association of Runx2 with region II.

22
Considering that Runx2 was found to interact with both regions under normal culture
conditions, these results also indicated that the regulation of survivin transcription might
be different under varying cellular environment.

Figure 3. Effect of BMP7 on survivin expression and binding of Runx2 to survivin
promoter in serum starved C4-2B cells.
(a) Effect of BMP7 on survivin expression. C4-2B cells were pretreated with medium
containing 0.1% serum for 24 hours followed by supplementation of BMP7 with or
without transfection of pAML1-ETO. The expression levels of survivin protein in the
cells at 48 hours post-transfection were compared to the corresponding controls. Equal
loading of the cells lysates was determined using actin levels. Semi-quantitative RT-PCR
was used to determine the expression of the transfected AML1-ETO gene.
(b) Suppression of anti-apoptotic effect of BMP7 by AML1-ETO. C4-2B cells cultured
in 0.1% serum with or without BMP7 treatment were transfected with indicated amount
of pAML1-ETO and subjected to TUNEL assay. BMP7 treatment significantly reduced
cell apoptosis (P<0.05). However, cells treated with 1 μg of pAML1-ETO showed
significantly higher apoptotic rate (P<0.01) compared to control cells or cells transfected
with 0.5 μg pAML1-ETO, indicating that AML-ETO had a counteracting effect and the
effect was dose-dependent.

23
Figure 3, Continued (c) Increased occupancy of region II of the human survivin
promoter by Runx2 in BMP7-treated cells. Serum starved C4-2B cells were cultured with
or without BMP7 and the cross-linking ChIP was performed to examine the Runx2
(Figure 3binding to region I (upper panel) and region II (lower panel) of the survivin
promoter, respectively. Runx2 binding was only evident for region II of the promoter in
cells stimulated with BMP7.
(d) Luciferase reporter constructs that contained various lengths of survivin promoter
(pLuc1430, pLuc1270, and pLuc649) are shown on the upper panel. The promoter
pLuc1430 retained the Runx2 binding sites of the region II as marked. Effect of BMP7
on the activity of the promoter constructs in serum starved C4-2B cells is illustrated in
the lower panel. The activity of each construct was analyzed in serum-starved cells with

24
(Figure 3d, Continued) or without supplementation of BMP7. The pAML1-ETO
plasmids were also transfected as indicated to examine the effect of Runx2 binding on the
promoter activity. The cells were co-transfected with β-galactosidase and all activities are
presented relative to the activity of pLuc1430 after normalization with respect to β-
galactosidase activity. For pLuc1430 plasmid, p values determined were as follows: +/-
BMP7 (<0.01); +BMP7, +/- 0.5 µg AML1-ETO (<0.01); +BMP7, +/- 1 µg AML1-ETO
(<0.001). For pLuc 1270 plasmid, the corresponding values were <0.01, not significant
and <0.05, and for pLuc649, none significant.

The effect of Runx2 on the survivin promoter was further investigated with
luciferase reporter assays. A luciferase reporter construct pLuc1430
(74)
was used in our
previous study to assess the effect of Smad signaling on the survivin promoter activity.
(140)

To further evaluate the sequences immediately downstream of -1430, we constructed
pLuc1270 in which the potential Runx- and Smad- binding sites of region II was deleted
(Figure 3d, upper panel). A shorter construct pLuc649 was also included in this study. As
illustrated in the lower part of Figure 3d, the transcriptional activity of pLuc1430
increased over 200% after 24 hours of BMP7 treatment in serum starved cells, while
under the similar conditions pLuc1270 displayed a relatively much smaller response, and
pLuc649 practically failed to respond to BMP7. This observation suggested that the -
1430 to -1271 region might be important for the effect of BMP on survivin transcription.
As Smad-interacting sequences are juxtaposed in this region and we showed earlier that
activated Smad was indeed involved in BMP-induced survivin expression,
(140)
we
introduced AML1-ETO to the luciferase reporter assays to examine the role of Runx2 in
response to BMP7 treatment in the serum starved cells (Figure 3d, bottom panel). When
AML1-ETO was present, the effect of BMP7 on the promoter activity of pLuc1430 was
indeed strongly inhibited in a dose dependent manner. AML1-ETO had no significant

25
negative effect on the activity of pLuc1270 at 0.5 µg, although there was a slight
inhibitory effect noted at 1 µg concentration, and the activity of pLuc649 was not
affected by AML1-ETO. These results suggested a lack of functionally prominent Runx
interaction sites downstream of -1270 on the survivin promoter.
Induction of Runx2 expression by BMP7 in C4-2B cells
It was reported that Runx2 expression could be positively influenced by BMP2 or
BMP7 in mouse chondrocyte and myoblast cells
(56, 72, 73, 118)
and in human pancreatic
cancer cells.
(61)
Interestingly, in differentiating fibroblasts Runx2 was reported to bind to
a repressive element within its own promoter to auto-regulate gene transcription.
(56, 118)

We examined the effect of BMP7 on Runx2 expression in serum starved C4-2B cells by
quantitative PCR. During the first 4 hours post BMP7 treatment, the Runx2 mRNA level
peaked at 1 hour and was 3.2-fold of that of the control and then appeared to decline to
almost normal levels (Figure 4a). It appeared from Western blot analysis that at this 1 hr
time point there was an increase in the level of Runx2 protein (Figure 4b). The effect of
BMP7 dose on Runx2 protein expression was also examined at 1 hr post-exposure; the
effect appeared to be dose-dependent with the most robust effect observed at 50 ng/mL
(Figure 4b).

26

Figure 4. Stimulation of Runx2 expression by BMP7 in serum starved C4-2B cells.
(a) Examination of Runx2 mRNA levels by quantitative real-time PCR at early time
points after BMP7 treatment. The fold increase was determined by 2-delta Ct analysis
and normalized to GAPDH expression. The increase in Runx2 at 1 hr post-treatment was
significant (P<0.05).
(b) Dose-dependent effect by BMP7. BMP7 protein at indicated concentrations was
supplemented to C4-2B for an hour after 24 hours of serum starvation and Runx2 protein
levels were analyzed by Western blot.
(c, d) Examination of changes in Runx2 mRNA or protein levels, respectively, at two-day
intervals during the 6 days of BMP7 treatment.

27
In our previous study, we found that the elevated survivin protein level continued to
persist up to 6 days of BMP7 treatment in starved C4-2B cells.
(142)
Hence we continued to
investigate Runx2 expression every two days up to 6 days post BMP7 treatment. The
mRNA level of Runx2 was highest (2.7-fold compared to that of the control cells) on day
2, and then declined to become similar to that of the control cells by day 6 (Figure 4c).
The protein level of Runx2 was not significantly different from the controls at day 2
following exposure to BMP7 but increased maximally at day 4 (Figure 4d). Thus, there
appeared to be a complex regulation of Runx2 expression by BMP7 in the C4-2B cells.
The effect might also be complicated by the constant adjustment of the cells to the stress
from serum starvation as well by the factors directly related to Runx2 protein
modification, stability, degradation as well as auto-regulation of Runx2 gene expression.
Although an overall cell survival is relatively strong in the serum-starved condition in the
presence of BMP7 compared to that without added BMP7, there was still a progressive
loss of cells in both situations over the period of observation (6 days). In the population
of control cells that continued to survive under serum starvation, a trend in increased
level of Runx2 protein expression was also noted (Figure 4d).
Expression of Runx2 in prostate cancer cells and tissues
Considering the important role of Runx2 on survivin expression and cell survival,
we examined Runx2 expression in various human prostatic cell lines. As shown in Figure
5a, the expression in the immortalized “normal” MLC and benign BPH-1 prostate cell

28
lines was practically undetected, whereas all prostate cancer cell lines examined, in
particular C4-2B and LNCaP, showed a robust expression.
By immunohistochemistry we demonstrate the expression of both survivin and
Runx2 proteins in malignant and benign human prostate epithelium. Survivin expression
was found predominantly in cytoplasm, and it was qualitatively and significantly higher
in the cancerous epithelium (Figure 5b). Additionally, our data implied a possible trend
of decreased expression with higher tumor grade (Table 1). A trend of increased
expression of Runx2 (nuclear) in the malignant epithelium relative to the benign
epithelium was also noted (Figure 5b), although the analysis could not point to any
remarkable changes with respect to Gleason grades (Table 1). It would be necessary to
confirm these initial immunohistochemical findings by other more quantitative means,
such as Western blot analysis, whenever such means are available. Given the limited
cohort size statistical analysis was not performed at this time point.
Table 1. Summary of immunostaining results with human prostate cancer
specimens.

Antigen
a
PrCa BPH Gleason 3 Gleason 4 Gleason 5 Stroma
Survivin 5.10 (42)
b
2.67 (18) 5.84 (7) 5.30 (20) 4.47 (15) 0.04 (49)
Runx2 4.47 (34) 3.52 (23) 4.50 (6) 4.52 (21) 4.29 (7) 0.90 (39)

a
Antigen expression was examined in the following histopathologic areas: PrCa, prostate
cancer; BPH, adjacent benign prostatic hyperplasia; Gleason 3-5, Gleason grades of 3 to
5; and Stroma, stromal cells in the specimen.
b
Combined staining score is shown with the number of cases indicated within parenthesis.

29

Figure 5. Analysis of Runx2 and survivin expression in prostate cancer cells.
(a) Protein expression in various human prostate cancer cell lines in comparison to
immortalized normal prostate epithelial (MLC) and benign hyperplastic (BPH-1) cells.
For each cell line approximately 40ug whole cell lysates were assayed by Western blot
and actin served as a loading control.
(b) Examples of immunostaining in benign and malignant human prostate cancer tissues:
A, B, survivin (case 1), strong staining of malignant epithelium relative to adjacent
benign epithelium and stroma; C,D, survivin (case 2), similarly strong staining of
malignant epithelium relative to benign epithelium and stroma; E,F, Runx2 (case 1),
moderate staining of malignant epithelium with weak stromal staining;

30

(Figure 5b, Continued) G,H, Runx2 (case 2), comparable moderate staining of
malignant epithelium with weak stromal staining. Benign epithelium displayed low to
moderate staining: A,C,E,G, magnification X25, and B,D,F,H, magnification X100.
(c) Correlation of Runx2 expression with tumor growth in the conditional Pten deletion
mouse model of prostate cancer. Runx2 expression in the anterior prostate tissues of the
knockout mice (KO) and in the corresponding normal prostate lobe of the littermate
controls (C) were analyzed by Western blot. The tissues were obtained from mice at age
ranging from 1.6 to 11 months.
(d) Detection of increased Runx2 expression by Western blot in tumors from all the lobes
from an 11-month old mouse as compared to its littermate control. AP, VP, DLP denote
anterior, ventral, and dorsolateral lobes, respectively.

Previously, we showed that survivin expression is progressively increased with the
growth of mouse prostate tumors.
(140)
To determine if a similar change occurs for Runx2,
we examined Runx2 expression in prostatic tumors of the conditional Pten deletion
mouse model. Western blot analysis showed that Runx2 levels in anterior prostate (AP)
were gradually increased with the tumor growth in the mutant mice ranging in age from
1.6 to 11 months while the levels remained consistently low in the normal tissues of the
normal littermate controls (Figure 5c), similar to what was observed for BMP7 and

31
survivin.
(142),(140)
Additionally, each prostatic lobe obtained from the 11-month-old Pten
knockout mouse was examined. In all three lobes, anterior, ventral and dorsolateral,
Runx2 expression was remarkably higher in tumor tissues as compared to the
corresponding tissues in the littermate controls, although the expression levels appeared
to vary from lobe to lobe (Figure 5d). It is recognized that epithelial cells in the various
lobes of the mouse prostate differ in the height of the epithelium, amount of epithelial
infolding, and the size of the nuclei.
(106)
The changes between normal and tumor-bearing
lobes, however, remain striking. This type of distinctive changes in Runx2 expression, on
the other hand, was not apparent from the human prostate cancer specimens. The
apparent differences between human and mouse prostate cancer specimens could be due
to multiple parameters, such as, variations between species, increased homogeneity of
cancer cells in the genetically engineered mouse model over the complex heterogeneity
of the sporadic human cancer, and the differences in the techniques used, namely,
Western blots for the mouse tissues and immunohistochemistry for the human tissues.

Discussion
The survivin gene promoter could be a cancer-specific promoter as expression of
survivin is documented in nearly all human tumors with minimal or no expression in
most of the normal adult tissues with the exception of hematopoietic cells.
(5)
The basal
transcriptional requirements of survivin gene expression have been defined to include
Sp1 sites.
(74)
With ChIP assays we show that Runx2 can interact with at least two regions
(regions I and II) in the survivin promoter in C4-2B cells cultured under normal

32
conditions with the association with region I being relatively stronger. When the cells are
deprived of serum, these regions remain free of bound Runx2. However, upon BMP7
stimulation, Runx2 localization to region II, but not to region I, is rescued in the serum
starved cells. Thus, there seems to be a differential utilization of up-stream promoter
sequences for survivin transcription in vivo in response to BMP signaling. The elevated
survivin expression is unlikely to be related to cell cycle as no significant changes in the
number of cells at G2-M phase were apparent when the cells were treated with BMP7.
(140)

The scenario projects a complex and dynamic Runx2 interaction with the survivin
promoter for the regulation of this important gene activity in cancer cells.
In analysis of reporter gene activity, a putative role for region II is indicated as well.
BMP7 substantially enhanced the promoter activity of pLuc1430 which retained the full
complements of region II. However, when a truncated construct (pLuc1270) that lacks
the stretch of up-stream 160 nucleotide sequences including the Runx binding sites of
region II was used, the BMP7 effect was significantly reduced. It should be noted that
region II not only harbors Runx binding sites, but also carries multiple Smad binding
elements, and, in fact, we described earlier that transcription of the pLuc1430 promoter
was Smad-dependent with respect to the BMP effect.
(140)
It was reported that Runx
proteins may indeed recruit Smads to specific subnuclear foci that are coupled to active
transcription.
(146)
Furthermore, in BMP2-induced osteoblast differentiation, Smad and
Runx2 appeared to be structurally coupled in rendering a biological signal.
(55)
Therefore,
it is likely that in BMP-induced activation of survivin gene transcription in the malignant
epithelial cells such an interaction between Runx2 and Smad may also be occurring for

33
the recruitment of the complex to the appropriate responsive elements. The details of
these interactions and their sequence specificity, however, remain to be elucidated.
BMP7 enhancement of Runx2 binding to the survivin promoter may be influenced
by multiple other factors. For example, the ability of Runx2 to bind DNA has been
reported to be influenced by both phosphorylation
(110),(56, 129)
and acetylation.
(56)
There are
factors, such as HDAC4 that may bind to Runt domain of Runx2 to inhibit its activity.
(123)

Finally, the biological function of Runx2 is dependent on the mechanisms that facilitate
nuclear translocation of this and related molecules.
Besides the dynamics of the recruitment of Runx2 to the various sites on the
survivin promoter in the cancer cells under diverse cellular environments, we propose
that the molecular basis of over-expression of survivin may also be linked to Runx2
levels in cancer. Runx2 mRNA level is reported to be significantly increased in human
pancreatic ductal adenocarcinoma tissues
(61)
and esophageal squamous cell carcinoma.
(117)

Runx2 expression has also been implicated in bone metastasis of breast cancer,
(11)
and in
human prostate cancer tissues and cells lines the expression of Runx2 protein has been
reported.
(20)
Here we describe elevated expression of Runx2 protein in human prostate
cancer cell lines relative to non-tumorigenic cell lines. Most remarkably, in a relatively
homogeneous model system of prostate tumor, namely the conditional Pten deletion
mice,
(76, 127)
we demonstrate a strong correlation between increased Runx2 levels with the
growth of the tumor, an observation that is very similar to what we described for survivin
protein levels in the same model.
(140)
Compared to this cancer of the mouse model,
human prostate cancer is, however, highly heterogeneous with diversity in the cellular

34
types. Still, consistent with previous observations with a variety of cancers, we confirm
that there is an overall and apparently significant elevation in the level of survivin protein
expression in the human prostate cancer specimens relative to either benign epithelium or
the surrounding stroma. Runx2 expression is also readily detected in these cancer tissues.
Both malignant and benign epithelia appear to express Runx2 significantly more than the
stroma, and a tendency of higher expression in malignant relative to benign tissues is
noted. Perhaps, to reach or maintain a threshold level is what is needed to amplify the
Runx2 activity in the cancer cells. It would be important now to critically examine
intracellular Runx2 protein modifications, stability, and parameters of nuclear
translocation to correlate with the potential functional attributes of this important
transcription factor in neoplastic cells.
Finally, we show that in the serum-starved C4-2B cancer cells, BMP7 treatment
enhances Runx2 level, an effect that is likely to increase responsiveness of the cells to
BMP signaling to diverse biological functions including gain in the potential for survival.
Since there is detectable early transcriptional up-regulation of Runx2 as well as late
increases in the level of this protein, the observed BMP7 effect may be both direct and
indirect. For instance, BMP2 is described to inhibit Smurf-mediated ubiquitination and
degradation of Runx2 by stimulating p300-mediated Runx2 acetylation.
(56)
It is possible
that, in addition to its action on Runx2 transcription, BMP7 may, perhaps influence
Runx2 level in a similar way. Taken together, our results indicate that among various
factors that determine cancer-selective activation of the survivin promoter, Runx2 is an

35
important molecular entity and that Runx2 threshold or activation may be linked to tumor
cell survival and cancer progression.

36
Chapter 3
Characterization of epithelial-mesenchymal transition
in prostate cancer cells induced by BMP7
Chapter 3 abstract
Bone morphogenetic protein 7 (BMP7) was previously found to induce
physiological alterations such as morphologic conversion and enhanced motility, similar
to epithelial-mesenchymal transition (EMT). In this study, we demonstrate BMP7-
induced EMT in PC-3 prostate cancer cells in three dimensional (3D) conditions. The
results from two dimensional (2D) cultures were compared in parallel. All human
prostatic cell lines tested developed spheroid structures with hollow lumens in 3D
cultures, except LNCaP. However, only PC-3 cells displayed filamentous outgrowth from
spheroids when BMP7 was given under low serum condition. BMP2 and BMP6 were
also able to induce the filamentous morphologies similar to BMP7, but TGFβ1 did not
have a significant effect though it is a well-recognized inducer of EMT in mammary cells.
E-cadherin expression, which is essential for the integrity of the epithelial phenotype, was
remarkably decreased with morphologic switch both in 2D and 3D cultures. Scratch
assay was performed with cells in culture dishes, to determine the signaling pathways of
BMP7 that are implicated in the enhanced cell migration. Chemical inhibitors of PI3
kinase and Erk successfully reduced BMP-induced cell migration in 2D. The structural
changes in 3D cultures were also mediated by activation of PI3 kinase and Erk. Next, we
examined the expression of transcription factors that orchestrate the molecular alteration
of EMT. Twist and Slug were transactivated by BMP7, but Sip1 and Snail transcription

37
was decreased. The effect of cancer-associated fibroblasts (CAFs) was explored to
investigate a possible role in EMT induction. Either coculture or conditioned media of
CAF induced the filamentous outgrowth of spheroids and E-cadherin downregulation,
while normal prostatic fibroblasts (NPFs) did not have significant effect. These results
suggests that the 3D approach can be employed for the study of EMT as a better
representation of in vivo conditions and the EMT phenotype found in 3D culture
condition may be associated with prostate cancer progression.

Introduction
EMT is a term originally used to describe a critical process of embryonic
development. Epithelial cells on the primitive streak undergo EMT to precede
gastrulation and achieve endodermal and mesodermal differentiation. At later stages of
embryonic development, EMT occurs to generate neural crest cells, cardiac valve
structure, palatal fusion and peripheral nerve. All of these events of EMT are under
precise temporal and spatial regulation. Unlike finalized differentiation, EMT is generally
accepted as a considerably reversible and transient event. The reversed process of EMT,
mesenchymal-epithelia transition (MET) also occurs during organogenesis of kidney,
liver, neuron and ovary.
EMT happens in many postnatal events as well, such as wound healing,
reorganization of mammary duct as well as pathogenesis of fibrosis, tumor progression
and metastasis. Normal tissues have organized structures of cells that tightly tether each

38
other through cell junctions and adhere to embedded extracellular matrix (ECM).
Histological abnormality is considered as a sign of advanced tumor, the orderly tissue
structure is disrupted and the aberration is also obvious at the cellular level. In the region
of advanced adenocarcinoma, occasionally it is found that cancer cells lose their
epitheloid morphology, cell junction molecules and cell polarity, simultaneously obtained
mesenchymal characteristics. This is considered as an EMT occurrence in cancer.
Emerging evidence supports a role of EMT in various aspects of cancer progression. Its
role in reorganization of mammary duct structure and in metastasis of breast cancer has
been extensively investigated and well defined
(10, 14, 15, 124, 134)
.
EMT is a holistic physiological change regulated by master transcription factors,
Twist, Snail, Slug, Sip1 and so forth
(28, 36, 53, 59, 66, 82, 92, 108, 138, 139)
. EMT is primarily
observed as a morphologic change accompanied with loss of polarity and alteration of
cell-cell interaction. Down-regulation of epithelial marker expression, most remarkably
the decrease of E-cadherin level, is obvious. Expression of vimentin, N-cadherin and
smooth muscle actin (SMA) are often used to evaluate mesenchymal expressions in cells
undergoing EMT. Enhanced motility and invasiveness are also essential elements of
EMT, along with up-regulation of secretory proteases.
We previously found phenotypic switch of EMT in prostate cancer cells that was
examined in 2D environment. Cells on tissue culture plate and glass slides are under
extreme mechanical stress that is far different from physiological condition. Cells in 2D
culture are placed at about a giga Pascal of force while mechanical stress of soft tissue is
generally less than 3000 Pascals. Mechanotransduction profoundly affects cell

39
morphology, cytoskeleton arrangement, cell-cell adhesion and migration
(103)
. These are
all important criteria to determine occurrence of EMT. Often microscopic observation of
cell morphology is subjective and inadequate to determine EMT occurrence. There is no
objective standard of EMT morphologic change and occasionally it is not obvious due to
mixed morphology of the cells. Use of 3D cultures allows prostatic epithelial cells to
form the organized 3D structures. Ductal structures of the cells similar to mammosphere
were generated in Matrigel culture in vitro
(69, 70)
. Matrix embedded culture may represent
physiological conditions better than conventional methods using tissue culture plates. In
this regard, we characterize EMT in PC-3 prostate cancer cells in 3D matrix in parallel
with the cells grown in 2D culture dishes and investigate the effect of prostate tumor
microenvironment on this morphologic conversion that is associated with metastatic
potential of the cancer cells.

Materials and methods
Materials
Recombinant human BMP7 protein (generously provided by Dr. A. Hari Reddi of
University of California Davis or purchased from R&D) was diluted in low serum
medium (either 0.1% or 0.5%) at a concentration of 50 ng/mL in all experiments.
Recombinant human BMP2, BMP6, TGFβ1 and recombinant mouse Noggin were
purchased from R&D and reconstructed in 4mM HCl buffer containing 0.1% bovine
serum albumin. The chemical inhibitor U0126 was bought from Cell Signaling and other

40
inhibitors, LY20049, SP600125 and SB203580 were manufactured by EMD Biosciences.
Inhibitors were dissolved in dimethyl sulfoxide (DMSO) and added in culture medium.
HCl buffer and DMSO solution were used in all control experiments.
Two dimensional and three dimensional culture of cells
PC-3 prostate cancer cells were obtained from ATCC and maintained in DMEM
media supplemented 10% of fetal bovine serum (FBS). Other prostatic cell lines were
cultured as previously described
(140)
and cells were placed in low serum containing
media, either 0.1% or 0.5%. Three dimensional culture method was modified from the
method of Debnath et al.
(31)
. Growth Factor Reduced Matrigel Matrix (BD Biosciences)
was solidified at 37
o
C and single cell suspensions were mixed with Matrigel at a final
concentration of 2.5%. Culture media was replaced with low serum media with or
without cytokine, either BMPs or TGFβ1, when spheroid structures reached at an average
of 50μm in diameter (approximately 6 to 7 days of culture). Culture media was replaced
every 3 to 4 days and cell morphology was observed daily. Transmission light
microscope and Spot Advanced Plus software were used to collect and analyze images of
2D or 3D cultures.
Hematoxylin and Eosin staining
Culture media in 3D cultures were discarded and solid Matrigel matrix containing
cell structure was frozen in OCT compound (Sakura Fineteck USA). Sections were sliced
at 8 μm thickness using Microm 505E Cyrostat. Cryosections of 3D structure were fixed
in 4% PFA for 10 minutes, rinsed with PBS for 5 minutes, three times. Then cell

41
membranes were permeabilized in 70% ethanol for 2 minutes and washed 2 minutes in
tap water. Rest of procedure was followed the method of Liao et al. (manuscript in
progress, Cancer Research).
Semi-quantitative and quantitative PCR
RNA extraction, cDNA synthesis and quantitative PCR were performed following
protocol described previously
(77)
. The sequences of primers used for semi-quantitative
are described in Table 2.
Table 2. PCR primer sequences used in the study.

Gene Forward primer Reverse primer reference
GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCAC
(63)

E-cadherin GAACGCATTGCCACATACACT CTGTGGAGGTGGTGAGAGAGA
(142)

MMP-1 ATGGATCCAGGTTATCCCAA CCTTCTTTGGACTCACACCA This study
MMP-9 GCAGCTGGCAGAGGAATAC CTATCCAGCTCACCGGTCTC This study
MMP-13 CCTTCAAAGTTTGGTCCGAT CGCAGCAACAAGAAACAAGT This study
uPA TACGGCTCTGAAGTCACCAC GCCATTCTCTTCCTTGGTGT This study
Twist CAGTCGCTGAACGAGGCGTT CCCACGCCCTGTTTCTTTGA This study
Slug GCGCTCCTTCCTGGTCAAGA CGCCCAGGCTCACATATTCC This study
Snail CCTCGCTGCCAATGCTCATC GCTTCTCGCCAGTGTGGGTC This study
Sip1 GCCTCTGTAGATGGTCCAGAAGA CATTTGGTGCTGATCTGTCCC This study

2 delta Ct analysis was made to describe the differences in mRNA expressions
(78, 109, 145)
.

42
Immunofluorescence staining
Frozen sections or intact 3D structures embedded in Matrigel matrix was used for
staining. Specimens were washed by PBS twice, fixed with 4% paraformaldehyde (w/v)
for 15 minutes, and permeabilized by 0.2% Triton X-100 for 10 minutes. Matrigel
embedded samples had an extra rinse with PBS buffer containing 100 mM glycine. The
rest of staining process was carried out as refered to in Debnath et al
(31)
. Mouse anti-
human E-cadherin (Zymed) was used and mounting solution (Vector Labs) stained nuclei
shortly before microscopic observation. Fluorescence images were obtained using
epifluorescence microscope (Leica), Spinning disk confocal microscope (PerkinElmer) or
multiphoton laser scanning confocal microscope (Zeiss LSM510). Volocity software
(PerkinElmer) performed fluorescence images analysis including 3D image
reconstruction.
Cell invasion assays
PC-3 cells were originally cultured with or without BMP7 in low serum media for
2 days, 4 days and 6 days after a day in low serum media. Cells in 2D culture were
trypsinized to prepare single cell suspension and 10
5
cells per 8 μm pore-sized Cell
Culture Insert (BD Biosciences) were loaded on top of a layer of Matrigel inside the
chamber. Matrigel was diluted 1:9 in the culture media. Migrated cells at the bottom of
cell culture insert were stained in Giemsa staining solution (Sigma-Aldrich) and the every
cell with visible nucleus staining was counted.

43
Scratch assay
Scratch assay was performed as described by Yang et al.
(142)
, in different
conditions indicated in the result description.
Use of stroma conditioned media and stroma cell coculture
Human stroma cells from prostate cancer patients, Gleason score 7 without
metastasis or lymphovascular invasion, were generously provided by Dr. Amir Goldkorn
of Norris Cancer Institute. Both NPFs and CAFs were cultured on tissue culture plates in
Bfs media
(137)
and used in the preparation of conditioned media. Cells were eliminated
from collected conditioned media using cell strainers and centrifugation. Number of cells
used for conditioned media were counted and used for 3D culture with a 1: 10 ratio of
PC-3 cancer cells to fibroblasts. For coculture of cells, human fibroblast cells were placed
on top of thin Matrigel layer generated inside of cell culture insert, also in a 1:10 ratio to
PC-3 cells. In all experiments, paired CAFs and NPFs obtained from tumor and adjacent
normal tissue were used.
Statistical Analysis
All experiments were triplicated

and repeated in more than three independent
trials. Statistical comparisons were made

by an unpaired two-tailed t test.

44
Results
BMPs induce morphologic change in PC-3 prostate cancer cells but TGFβ1
does not have significant effect.
TGFβ1 activity in EMT induction has been extensively studied
(10, 14, 15, 32, 96, 99, 134,
147, 148)
. Kumano et al. reported 1ng/ml of TGFβ1 induced EMT in PC-3 prostate cancer
cells
(65)
in contrast to our previous finding
(142)
. To elaborate the discordance, PC-3 cells
were obtained from ATCC and examined for EMT induction by BMPs or TGFβ1.
TGFβ1 was not able to present the EMT morphology at any concentration tested. The
discrepancy may due to heterogeneity of cancer cells, phenotypic alteration caused by
extended 2D culture and absence of precise measure of morphologic conversion of EMT.
BMP7 and other BMPs, BMP6 and BMP2, altered cell shape after 4 days of culture
(Figure 6a). There was no significant difference in the morphology of PC-3 cells in full
serum (10% FBS) or in low serum (0.5% FBS) conditions (data not shown). With the
increase of BMP7 concentration in culture media, more number of cells showed the
elongated cell morphology at 4 days of culture (Figure 6b). Cells with BMP7 treatment
were also observed to have filopodia. When the BMP7 function was disrupted by Noggin,
conversion to fibroblastoid morphology was interrupted (Figure 6c).

45

Figure 6. Morphologic changes in PC-3 cells induced by BMPs but not by TGFβ1.
(a) Cell morphology was compared in PC-3 cells cultured in low serum control and with
growth factor treatment by transmission light microscopy. The images were collected
after 4 days of culture in 50ng/ml of BMP7, BMP2 or BMP6, or 1ng/ml or 10ng/ml of
TGF-β1 under low serum condition. BMP-treated cells showed extended and elongated
cell shape while cells in TGFβ1 media did not induce mesenchymal morphologic change.
(b) Number of elongated cells increased with higher concentrations of BMP7 treatments.
(c) Recombinant mouse Noggin (mNoggin) was used to inhibit BMP7-induced
morphologic conversion.

46
Spheroids formed in 3D cultures shift to filamentous outgrowth with BMP7
treatment
3D culture method consisted of two phases. Full serum medium was given to
allow cell proliferation in Matrigel matrix, and then replaced with low serum medium
containing specific growth factors (Figure 7a). Low serum condition was used for better
exhibition of the effect of growth factor treatment. PC-3 cells were plated as a single cell
suspension. These cells actively divided, formed cell clusters and further developed
spheroids with an interior hollow (Figure 7b, upper panel). Both daily microscopic
observation and nuclei staining results (data not shown) excluded the possibility that the
3D structures were derived from the aggregation of migratory cells.. The efficiency of
spheroid formation in Matrigel was about 1% or less.
In PC-3 prostate cancer cells, BMP7 induced fibroblastoid morphology and
overall structural change from spheroid to filamentous outgrowth (Figure 7b, middle and
bottom panel). The cells started to bud out from spheroid structures with BMP7 treatment
and the strands of elongated cells further migrated out. Each of cells in the filamentous
structure displayed obvious morphologic characteristic of EMT. This structural change
was unlikely due to cell proliferation. Growth of PC-3 cancer cells ceased in low serum
condition when cultured on tissue culture dishes (data not shown). Cell proliferation did
not have an effect on this morphologic conversion.

47

Figure 7. Distinctive structural transformation is observed in BMP7-treated
spheroids of PC-3, but not in other prostatic cells.
(a) Scheme of 3D culture method used in the study. 3D structures were primarily
generated in 10% FBS media, then the media were replaced low serum (either 0.1% or
0.5% FBS) media with or without growth factor treatment when spheroids were reached
at averaged size of 50μm or more.
(b) Upper panel: Ball-shaped structures were developed from single cells of PC-3 in
10% serum condition. Middle and bottom panel: Low serum conditions were given to
cells with or without BMP7 treatment. BMP7 stimulated morphology switch, from
spheroids to filamentous outgrowth, while cells in low serum condition maintained the
original structure.

48

Figure 7, Continued (c) Left panel: Images of PC-3 spheroids and filamentous structure
were shown by higher magnification of transmission light microscopy. Empty hollow is
visible in the spheroid in upper left panel. Elongated fibroblastoid morphology of PC-3
cells in the filamentous structure is obvious in the bottom left panel. Right panel: H&E
staining of frozen section was performed to visualize a 2D planar of the structures.
(d) BMP7 did not affect the 3D structure in benign hyperplastic cells, BPH1 or other
human prostate cancer cells, DU145, LNCaP and C4-2B. Under the full serum condition
prior to BMP7 treatment, identical spheroid structures were formed in all prostatic cells
shown in (b) upper panel, except LNCaP.

49
3D structures in low serum condition or with BMP7 treatment were examined by
a higher magnification of microscopy (Figure 7c). Similar to the morphologic changes in
2D culture, BMP2 and BMP6 induced the same phenotypic conversion with that of
BMP7, but TGFβ1 did not (data not shown). To note, the structural transformations in 3D
became evident within 2 to 3 days of BMP treatment while the 2D morphology changes
were occasionally insignificant even after 6 days of the treatment.
Next, we examined 3D structure formation in various other prostatic cells, as we
previously reported EMT induction in 2D condition is unique in PC-3. Figure 7d shows
no significant effect of BMP7 in any of the other prostatic cell lines. Non-neoplastic
BPH1, DU145 derived from brain metastasis of prostate tumor, LNCaP established from
lymph node metastasis and C4-2B, a derivative of LNCaP cells, which was developed in
murine system through selection of bone metastatic cells, were examined. Except LNCaP,
all of prostatic cell lines tested developed global structure in full serum supplemented
media, like PC-3 spheroids showed in Figure 7b, top panel. Efficiency of structure
formation was not different between prostatic cell lines. However, the responses to low
serum or BMP7 treatment were different from PC-3 cells. In low serum condition,
spheroids formed in BPH1 and DU145 became flat while C4-2B remained unchanged.
However, cell proliferation was not significantly affected by low serum stress, at least
during the period of observation.
E-cadherin expression is decreased during BMP7-induced EMT conversion
Downregulation of E-cadherin is a distinguished and remarkable feature of the
EMT process. Suppression of E-cadherin expression is enough to induce an invasive

50
phenotype
(125)
. Inversely, ectopic expression of E-cadherin in fibroblasts alters cell
adhesion pattern similar to epithelial cells
(91)
. Change of cadherin expression is
associated with the progression of human tumor as well
(21, 116)
. Thus, the BMP7 effect on
E-cadherin downregulation was primarily investigated as molecular evidence of EMT,
both in 2D and 3D conditions.
Both E-cadherin transcription and protein expression were reduced by BMP7 in
2D condition (Figure 8a), as well as in 3D structures (Figure 8b). Transcription of
cytokeratin 18, expressed in epithelial cells, was decreased in BMP-treated PC-3 cells
and BMP7 increased the staining of α-smooth muscle actin, characteristics of activated
fibroblast, in the 3D structure as well (data not shown).

Figure 8. Decrease of E-cadherin expression is accompanied with morphologic
conversion in 2D and 3D.
(a) Both E-cadherin mRNA transcription and protein expression were reduced in BMP7-
treated cancer cells compared to non-treated cells. Low serum condition did not have a
significant effect on the level of E-cadherin. Semi-quantitative PCR and Western blot
assay were used.

51
Figure8, Continued (b) Immunofluorescence staining of intact 3D structure embedded
in Matrigel was carried out. Loss of E-cadherin was apparent in the filamentous structure
induced by 3 days of BMP7 treatment, compared to the spheroids under low serum
condition. Global structure and stellate, filamentous 3D structure was confirmed through
reconstitution of Z-stack images (data not shown).

BMP7 enhances protease expression and subsequent cell invasion
Invasiveness of cells is tightly associated with and increased protease activities
during EMT
(71)
. To escape from the primary site where tumor arose from, it is imperative
for cancer cells to break through the basement membrane to travel to distal organ via the
blood stream.
We investigated expression of proteases that can influence cell invasiveness.
Among mRNA expression of proteases examined, MMP1 (interstitial collagenase, which
cleaves fibrillar collagen type I, II and III), MMP13 (collagenase 3) and uPA (urokinase
type-plasminogen activator) expressions were increased by BMP7 by 3-, 2- and 2.5-fold,
respectively (Figure 9a). mRNA of MMP3, MMP10 and MMP12 were also elevated by
BMP7 but not in a statistically significant manner (data not shown). Protease activity
was also examined in PC-3 conditioned media. Among MMP substrates included in
SensoLyte™520 MMP Substrate Sampler Kit (AnaSpec), digestion of Substrate 2, 6 and

52
10 was significantly increased in BMP-treated cells (Figure 9b). The substrates are
susceptible to activities of MMP1/7/8/12/13, MMP2/13 and MMP13, respectively. It was
noticed that the MMP degradation of these substrates was gradually increased with
extended culture, both in low serum or low serum with BMP7 treatment. In contrast,
MMP9 transcription was slightly decreased by BMP7 (Figure 9a).

Figure 9. Protease expression pattern and cell invasion are affected by BMP7.
(a) The transcription of MMP1, MMP13 and uPA proteases was significantly increased
while MMP9 expression was decreased after BMP7 treatment. Transcription of each
protease was compared to the expression in low serum condition for 2 days of culture. 2-
delta Ct method determined the mRNA change in folds and statistical assay was carried
out to assure the statistically significant difference between BMP-treated and –untreated
specimen.

53

Figure 9, Continued (b) Secretory protease activity was evaluated using PC-3
conditioned media that were collected from cells in low serum or with BMP treatment.
SensoLyte™520 MMP Substrate Sampler Kit was used.
(c) 6 days of BMP treatment enhanced cell invasion assessed by Matrigel invasion assays.

With the increase of protease expression and activity in secretion, cell invasion
was evidently enhanced after 6 days of BMP7 treatment (Figure 9c). Majority of PC-3
cells that successfully migrated to the bottom of cell culture inserts displayed elongated
cell shapes and extended filopodia. Other observations on the migratory cells include a
higher nuclear to cytoplasm ratio, which is rather characteristic of basal cells
(131)
.

54
BMP7-induced cell migration and morphologic switch are mediated by Akt and
Erk signaling transduction.
PI3K/Akt activation plays a pivotal role in the rearrangement of the cytoskeleton
and cell migration in many physiological events including TGFβ1-induced EMT
(71)
,
(10,
44)
. Signal transduction of EMT is also mediated by many pathways such as Wnt, Notch
and NFκB as well as the Smad pathway, which is a canonical signaling pathway of
TGFβ1 superfamily
(53, 83, 84, 132)
. Since the role of BMP in EMT has not been studied well,
we explored the signal transduction of BMP7 in EMT induction.
Scratch assay was selected to search for signal pathways that moderate BMP-
induced EMT, using chemical inhibitors of various kinases. Cell morphology and
motility were also noted simultaneously.

55

Figure 10. Two signaling pathway, Akt and Erk conduct cell migration and 2D
morphology of EMT induced by BMP7.
Scratch assays were performed to compare motility of cells in low serum, with BMP7
treatment or in combination of BMP7 and various kinase inhibitors.
(a) Use of LY20049, a PI3K/Akt inhibitor, counteracted the BMP7 effect on both cell
migration and morphology.
(b) Chemical inhibitor of MEK1/2, U0126 that disrupts Erk phosphorylation and
activation, significantly reduced migration of cells in BMP7 culture.

56

Figure 10, Continued (c) Inactivation of JNK by SP600125 affected cell viability but the
effect on cell migration was not determined because of cell death.

PI3K/Akt signaling activation was required to transduce the BMP7 signal and to
induce EMT conversion, cell morphologic switch and increased cell migration (Figure
10a). Use of the inhibitor at 40μM concentration caused significant cell apoptosis, rather
than affected EMT phenotype.
MAP kinase activation is less conserved and the mechanism of signal transfer in
BMP signaling is not clearly defined yet. MAPK signaling is deregulated in many cancer
cells and often is a target of anti-cancer therapy. Hence, we attempted to address the
implication of MAPK in the phenotypic conversion induced by BMP7. Figure 10b
showed that Erk activation might be involved in the motility increase of BMP7-treated
cells, however, inhibition of the signaling eventually caused cell apoptosis. Increase of
apoptotic cells was obvious; rounded cell shape, detachment from culture surface and
enhanced light reflection in transmission light microscopy (Figure 10b, bottom right

57
panel). Involvement of JNK could not be determined by scratch assay as the inhibitor
induced cell death like the Erk inhibitor (Figure 10c).
Akt and Erk signal transduction also regulate the morphologic change induced
by BMP7 in 3D matrix culture
Next, we examined the effect of kinase inhibition on the 3D morphologic
conversion. As stated above, it was difficult to interpret the results of scratch assays
performed in 2D condition when the inhibition caused cell apoptosis. Also, further
characterization was required to compare the morphologic conversion of the cellular
structures formed in 3D cultures and the EMT phenotype in 2D.

Figure 11. Akt and Erk activity is also required in 3D morphology of EMT induced
by BMP7.
(a) Inhibition of PI3K/Akt effectively prevented the filamentous structure formation
causes by BMP7, at all concentration of inhibitor used, 5μM/ml and 20μM/ml.

58

Figure 11, Continued (b) Erk inhibitor was able to suppress the morphologic change at
10μM/ml concentration but the effect was less obvious at a lower concentration, 1μM/ml.
(c) Both JNK inhibitor (SP600125) and p38 kinase inhibitor (SB203580) were not able to
inhibit the BMP7 effect on 3D structure.

Observation of 3D structure with BMP7 treatment in presence of various kinase
inhibitors confirmed that Akt and Erk activation is important for the filamentous
outgrowth (Figure 11a, b) as well as the enhanced cell migration and 2D morphology
(Figure 10a, b). Interruption of JNK or p38 kinase activity could not prevent the BMP7-
induced conversion.
BMP7 transactivates Twist and Slug transcription factors but not Snail and Sip1.
A number of transcription factors that govern gene expression for transition from
epithelial to mesenchymal phenotype are already well defined. Ectopic overexpression of
a single transcription factor is enough to affect both EMT conversion and cancer
metastasis, inversely, inhibition of the transcription factor function disrupts EMT

59
phenomenon
(28, 66, 114, 138)
. Down-regulation of E-cadherin is the most common and
critical molecular feature of EMT for its profound impact on cell-cell interaction and
structural integrity. Several transcription factors such as Twist, Snail, Slug, and Sip1 were
found to play a role in suppression of E-cadherin transcription
(28, 36, 53, 59, 66, 82, 138)
.
We investigated whether the expression of these transcription factors is increased
by BMP7 to coordinate EMT conversion in the cancer cells. Among four transcription
factors mentioned above, two of transcription factors, Twist and Slug were transactivated
by BMP7 (Figure 12). In contrast to what we expected, Sip1 and Snail transcription was
significantly reduced in PC-3 cells in BMP-containing media.

Figure 12. Expression of transcription factors that play a role in EMT induction
were determined by semi-quantitative PCR.
Up to 4 days of BMP7 treatment, twist and slug transcription was enhanced in cancer
cells cultured in 2D. In contrast, Sip1 and Snail expressions were decreased in BMP-
treated cells.

60
Twist and slug expression patterns were changed after 6 days of BMP treatment,
BMP effect on the transcription was disappeared. However, Twist protein level at 6 days
of culture in BMP7 was significantly higher (data not shown). The expression of these
transcription factors will be further determined at the protein level.
Cancer-associated fibroblasts but not normal prostatic fibroblasts stimulate
alteration of 3D structure of cancer cells, similar to that of BMP7-treated cells.
PC-3 cells express relatively low level of BMPs among prostatic cells tested in
the study
(29, 79, 142)
, it is reasonable to presume that the signal for EMT conversion is from
the exogenous environment, rather than the cancer cells themselves. Emerging evidence
also suggests that cancer microenvironment such as activated fibroblasts and immune
cells in the stroma promote tumor malignancy and metastasis. In this regards, the effect
of CAF on EMT conversion was investigated in Matrigel culture.

61

Figure 13. Cancer-associated fibroblasts induced 3D morphology change similar to
that of BMP7-treated cancer cells.
Spheroid structures of PC-3 cells were cultured for 2 days in CAF-conditioned media or
cocultured with CAF in cell culture inserts. The ratio of epithelial cancer cells to prostatic
fibroblast was adjusted to 1 to 10 for coculture as well as for the dilution of conditioned
media.

As we hypothesized, CAF but not NPF was able to induce same morphologic
switch with that of BMP7 in 3D cultures (Figure 13). E-cadherin downregulation in the
filamentous structure was also confirmed by immunofluorescence staining (data not
shown), still further assessments at the molecular level might be required to identify this
phenomenon. Both fibroblast conditioned media and coculture with viable fibroblasts
confirmed paracrine induction of EMT. The number of fibroblast cells used for coculture
was 10 times that of epithelial cells plated for 3D culture, taking into consideration of the

62
stroma expansion in tumors.. Also, fibroblasts cells were counted when conditioned
media was prepared and then used in proper dilution to adjust the ratio of fibroblasts to
PC-3 cells to 10 to 1. Spheroids in coculture with CAF displayed filamentous structure
slower than in CAF-conditioned media but the structural changes eventually became
evident. Giemsa staining of cells enabled the comparison of NPFs and CAFs used for
cocultures (data not shown). Still it needs to be clarified that whether BMP is secreted by
CAFs and induces the structural change, which will be addressed using Noggin, the
inhibitor of BMP signaling.

Discussion
One of the biggest challenges of cancer treatment is the fatal metastasis to distal
organs from the primary carcinoma in situ. Enormous effort has been paid to illuminate
the process of metastasis at the molecular level and it is imperative that the mechanism
studied in vitro gain physiological relevance. EMT conversion has been observed in
various cells on tissue culture dishes and its connection to metastasis has been well
established. Nevertheless, EMT occurrence is not commonly found in histopathological
observation of human tumor specimen and the morphologic alteration of cells is usually
confined within a small portion of the tissue. It is very challenging to develop a model of
metastasis which allows both temporal and spatial observation of the events of metastatic
progress. We employed the 3D ‘on-top’ culture model to characterize BMP7-induced
EMT in prostate cancer.

63
Various features of EMT were compared between PC-3 cancer cells cultured on
tissue culture plate and cells in 3D matrix. Both in 2D and 3D conditions, BMP2, -6 and -
7 exerted the mesenchymal transition in PC-3 cancer cells, while TGFβ1 did not have any
significant effect. As we first described that prostate cancer cells underwent EMT
conversion, environmental cues other than BMPs or TGFβ1 might be explored as an
EMT inducer as well. Diverse factors have been reported to affect the physiological
transition such as epidermal growth factor, platelet-derived growth factor, hypoxia
inducible factor HIF and so forth
(19, 37, 53, 114)
. Alteration of cell junction molecule or
change in ECM composition and stiffness are also related to cell morphology and
invasiveness
(16, 52, 57, 58)
.
The BMP effect on 3D morphology appeared as filamentous, stellate outgrowth
from global, spheroid structures.. Individual cells in spheroids became extended and
migrated outwards while they maintained cell-cell association. It has been hypothesized
that movement of cancer cells during metastatic process is collaborative or collective, in
the form of clusters, sheets or lines of cells, rather than a migration of a single cell
(41, 43)
.
By means of a 3D model of EMT, we observed this collective migration of prostate
cancer cells that display a distinctive morphologic switch from epitheloid to fibroblastoid.
Another observation was made on the temporal regulation of EMT conversion.
Consistent with our previous observation
(142)
, cell morphologic change and increased cell
motility and cell invasion became obvious after 6 days of treatment in 2D conditions.
Enhanced cell motility was maintained even after BMP7 was withdrawn after 6 days.
BMP7 transactivation of Twist and Slug were continuously up-regulated until 4 days of

64
culture, but disappeared at 6 days. Invasive potential of BMP-treated cells was also
significantly increased after 6 days of culture. It may imply that there is a temporal
commitment to EMT conversion between 4 days and 6 days of culture in 2D. It may be
worthwhile to attempt a continuous observation of EMT process in 3D culture as the
EMT process became evident within 2 to 3 days in Matrigel culture and temporal and
spatial assessment is possible under those conditions.
Akt and Erk signaling pathways were found to mediate the phenotypic conversion
in both 2D and 3D culture with BMP treatment. PI3kinase/Akt pathway has been well
recognized by its role in the regulation of cell cytoskeleton and migration in various types
of cells, and in diverse cellular events including EMT
(10, 15, 46, 71, 122, 133)
. Signal
transduction of BMP via Akt activation and the effect on cell migration have been
reported
(45, 67)
, it is compelling that Akt plays a role in the BMP-induced EMT
conversion.
Since BMP/TGFβ signal transduction is primarily mediated by Smad
phosphorylation, we attempted to mitigate cell migration by inhibition of BMP-Smad
activation. Use of dominant negative protein expression of Smad5, one of the reactive
Smad proteins, induced cell apoptosis instead of inhibition of EMT phenotype in PC-3
cells. It is very likely that BMP-Smad activation also confer anti-apoptotic protection to
PC-3 prostate cancer cells as we previously described
(77)
. Survivin up-regulation by
BMP-Smad signaling may be a common moderator of anti-apoptotic protection in
prostate cancer cells. The effect of Smad signal transduction in EMT conversion will
need other means to be addressed.

65
Tumor stroma contains activated fibroblasts that display altered molecular
characteristics from normal quiescent fibroblasts, commonly described as cancer-
associated fibroblasts (CAFs). CAF cells actively remodel extracellular matrix and secret
various cytokines and growth factors to the tumor microenvironment. It is widely
accepted that the interaction between carcinoma cells and CAFs play crucial roles in
cancer progression. Also, it is hypothesized that cells of adenocarcinoma themselves may
contribute some portion of CAF through EMT conversion. Here we confirmed that CAF
generates paracrine signal to induce morphologic conversion of EMT in the prostate
cancer cells. Either coculture or conditioned media was successfully able to induce
similar phenotypic switch to that of BMP7 in 3D conditions. The result also implies that
the alteration of 3D structure in vitro is reliable simulation of EMT process in vivo. CAF-
induced phenotype change will be scrutinized at the molecular level and the signal
activation will be addressed as well. Further investigation will be carried on to identify
the EMT inducer, primarily BMPs.
Notably the use of the 3D approach in EMT study must be carefully premeditated.
Matrigel matrix, widely used material for 3D culture, is hard to handle and the
composition of the material cannot be controlled precisely as it is a byproduct of
Engelbreth-Holm-Swarm mouse sarcoma. Also, it contains cytokines and growth factors
of undetermined concentration that may interfere with the experiments as well
(126)
. As
the benefit of ‘on-top culture’ methods was described by Debnath et al.
(31)
, structures
formed using this method were more uniform in size and shape than that of mixed culture.

66
In mixed culture, cells are placed differentially in matrix and maybe under differential
influence of oxygen accessibility and mechanical stress from the tissue culture dish.
In summary, this study describes successful application of 3D culture methods to
investigate BMP7-induced EMT conversion in prostate cancer cells, which is
comparative to the assessment performed in 2D conditions.. 3D approach to EMT
phenomenon bestows advanced physiological relevance to the research as it is more
likely to resemble physiological conditions in vivo as well as allowing for both spatial
and temporal analysis of the process. Also, BMP effects on morphologic conversion
gains more biological significance as CAF induces similar phenotypic alterations that we
will further scrutinize. The role of EMT in cancer progression is continuously expanding
and may be involved in the generation of tumor-initiating cells. It will be an interesting
topic to explore whether BMP-induced EMT is associated with that property as well.

67
Chapter 4
Conclusions and Future Directions
Cancer cells treated with BMP7 became resilient and resistant to cell death
induced by low serum stress. The anti-apoptotic effecter of this protection was found to
be survivin, which belongs to the inhibitor of apoptosis protein family. Aberrantly high
expression of survivin has been found in various types of human tumors and cancer cells
but not in normal, differentiated tissues. We also found significant levels of survivin in all
prostatic cancer cell lines and prostatic tissue specimens derived from either from human
patients or from a mouse model of human tumor. Nonetheless, how the abnormal
transcriptional activity of survivin is achieved in cancer cell needs more investigations for
better understanding.
We have found that Runx2 plays a crucial role in survivin transcription and
cancer cell survival. Runx1 has been widely recognized for its oncofunction in leukemia,
originally discovered in a study of acute myeloid leukemia. All Runx transcription factors
share high structural homology but not much is known on the oncogenic role of the other
two factors, Runx2 and Runx3. This work describes, for the first time, that Runx2
regulates survivin transcription in cancer cells. This transactivation of survivin may
promote tumor progression via anti-apoptotic effect on cancer cells. Expression pattern of
Runx2 shows robust correlation with survivin levels, both in prostate tumors of human
and of mouse. Runx2 maintains survivin level and prevents cell death, either in normal
culture condition or when a protective effect is exerted by BMP7. Under low serum stress,

68
BMP7 sustains survivin expression through conserving Runx2 levels while the
expression is reduced by decreasing the serum concentration in culture media. Also,
Runx2 interaction with survivin promoter is different in low serum than in full serum
conditions. The survivin promoter region for Runx2 transcription factor binding with
BMP treatment is particularly clustered with Smad interacting sequences. The result
strongly suggests that this transactivation is executed in cooperation with the Smad
complex, probably similar to the interaction of Runx2-Smad that has been described well
during osteoblastic differentiation.
Runx2 is an essential moderator of skeletal development such as osteoblastic
differentiation and cartilage formation. Often prostate cancer cells of bone metastasis
display physiologically significant mimicry of bone cells. Hence, it would be an
interesting question to ask whether metastatic cancer cells develop the oncogenic
function of Runx2 during active interaction with the bone microenvironment, or cancer
cells are more prone to skeletal metastasis once they acquired anti-apoptotic protection by
survivin up-regulation of Runx2.
Runx2-Survivin axis seems to have a significant contribution in cancer cell
survival both in C4-2B and PC-3 but not in LNCaP cells. LNCaP cells are less
susceptible to apoptosis induced by low serum stress and do not respond to survivin
transactivation of BMP7, except JNK activation by BMP7 can affect viability of the
cancer cells. Instead, the role of androgen receptor in survivin regulation has been
reported in LNCaP cells
(149)
. It may be interesting to elaborate the difference between

69
these cancer cells with respect to the anti-apoptotic role of androgen and androgen
receptor, since recurrent tumor often becomes insensitive to androgen-deprivation
therapy and becomes more aggressive.
Metastasis is a consecutive process that includes escape from primary site of
tumor, successful survival in circulation, adhesion to metastatic site, extravasation into
the tissue and resumption of active proliferation
(37, 38, 48, 102, 113)
. Each step of the
metastatic process is a huge challenge for the development of cancer treatment since as of
now there is no satisfactory model for tumor metastasis, which recapitulates or simulates
any of these events with sufficient physiological relevance. Among the factors of cancer
malignancy, EMT has long been suggested as an early stage of metastatic process and
proved its impact on the metastatic potential of cancer cells in vivo.
We previously reported that BMP7 induces morphologic conversion similar to
EMT in PC-3 prostate cancer cells maintained in tissue culture dishes. BMP-induced
physiological change has been shown to fulfill essential criteria of EMT, both in 2D and
3D condition. Morphologic conversion from epitheloid to fibroblastoid morphology,
downregulation of E-cadherin, enhanced cell migration and Akt and Erk signal
transduction to mediate the morphologic switch are observed similarly in cells in culture
plates or in cells embedded in Matrigel matrix. There was a noticeable 3D morphologic
change induced by CAF secretion, which is quite similar to the transformation stimulated
by BMP7. Further identification of the phenomenon is in process, including the
assessment of BMPs in the paracrine interaction with CAF. These results imply that the

70
3D model system for EMT research is a very useful tool to recapitulate dynamic process
of the transition and to investigate the molecular mechanism of EMT, which can
compensate or replace conventional approaches in 2D conditions. Also, this study
describes that EMT can be induced identically by both a growth factor enriched in the
tumor microenvironment or by cancer-activated fibroblasts.
The cancer stem cell hypothesis has long been suggested, as early as the 19
th

century. The conventional idea of tumor malignancy relies on a few essential properties
such as indefinite proliferation and evasion from cell apoptosis
(48)
. Enormous effort has
been made to discover ‘common oncogenes’ of cancer that regulate these key properties,
but most of the research has failed due to the heterogeneity of cancer. Not all cancer cells
equally meet these criteria or have equal potential to advance the disease. In these
contexts, it is postulated that a subset of cells arise in the tumor that is able to ‘initiate’
new tumor. These ‘tumor-initiating cells’, or cancer stem cells (CSCs), has been believed
to contribute to growth of carcinoma in situ and to metastatic progression. Cancer stem
cells have been identified in various types of solid tumor, including breast, colon, brain
and prostate tumor
(2, 95, 104, 112)
. Prostate cancer stem cells were first described by Collins
et al., three surface molecules in combination were used to isolate the subpopulation,
CD44
+
, integrin α
2
β
1
hi
, CD133
+

(26, 27)
. Tumor initiating cells have been reported in mouse
models of prostate cancer as well
(90, 128)
.
The concept of cancer stem cells is still controversial issue as the origin of the
stem cell remains largely unknown. There are two possible sources of cancer stem cells

71
that are not mutually exclusive; one is that normal stem cells acquire malignant
phenotype through genetic or epigenetic alteration, and the other is that cancer cells
become dedifferentiated or transdifferentiated to gain stem cell properties. Researchers
noticed similarities between cells undergoing EMT conversion and CSCs in many
different aspects. Acquisition of stem-like properties from early stages of metastatic
progress seems imperative, since cancer cells are quiescent in blood circulation but
simultaneously should bear the potential to actively regenerate colonies in a new organ.
In this regard, EMT is highlighted as one of the possible mechanisms that transform
cancer cells into CSCs. Emerging lines of evidence supports that the connection between
EMT and CSCs. For instance, Mani et al. reported that EMT induced the properties of
stem cells in mammary epithelia, and furthermore, ‘stem-like’ cells in the normal tissue
or in breast cancer presented EMT markers as well
(81)
. Interestingly, PC-3 cancer cells
were also found to contain small proportions of stem cells
(75)
. These lines of evidence
raised the possibility that BMP7 facilitates cancer progression via generating CSCs by
means of EMT conversion.
The study of CSC is mostly focused on proof of its stemness; clonogeneity,
combinatorial expression of molecular markers which is specific for each cell type,
reconstitution of its original structure in vivo and so forth. Hence, future research will be
directed to evaluate the BMP7 effect on cancer cells whether it generates and expands the
cancer stem cell population in human cancer cell lines, in terms of the criteria of stemness
described above. Spheroid forming efficiency will be compared in BMP7-treated and –
untreated cells to assess clonogeneity in vitro and the structural regeneration in vivo will

72
determine the potential to regenerate prostatic tumor in an ectopic organ, such as renal
capsule
(135)
. A few known markers will be used to isolate the CSC population. CD44,
CD133 and Oct4, are primary candidates to isolate the tumor-initiating subpopulation in
BMP7-treated PC-3 cancer cells.
In summary, this dissertation study suggests that the role of bone morphogenetic
proteins, specifically focused on BMP7, which is already in clinical use for surgical
treatments, in the progression of prostate cancer is through protecting cells from
apoptosis and promoting EMT phenotypic conversion. The significance of this work will
also be found in consideration of the strong inclination for bone metastasis of prostate
cancer and of the severity and fatality of the advanced, metastasized disease.

73
References
1. Abate-Shen, C. and M. M. Shen (2000). "Molecular genetics of prostate cancer."
Genes Dev 14(19): 2410-2434.
2. Al-Hajj, M., M. S. Wicha, et al. (2003). "Prospective identification of tumorigenic
breast cancer cells." Proc Natl Acad Sci U S A 100(7): 3983-3988.
3. Altieri, D. C. (2003). "Survivin, versatile modulation of cell division and apoptosis in
cancer." Oncogene 22(53): 8581-8589.
4. Altieri, D. C. (2003). "Validating survivin as a cancer therapeutic target." Nat Rev
Cancer 3(1): 46-54.
5. Altieri, D. C. (2008). "Survivin, cancer networks and pathway-directed drug
discovery." Nat Rev Cancer 8(1): 61-70.
6. Aoki, Y., G. M. Feldman, et al. (2003). "Inhibition of STAT3 signaling induces
apoptosis and decreases survivin expression in primary effusion lymphoma." Blood
101(4): 1535-1542.
7. Asahina, I., T. K. Sampath, et al. (1996). "Human osteogenic protein-1 induces
chondroblastic, osteoblastic, and/or adipocytic differentiation of clonal murine target
cells." Exp Cell Res 222(1): 38-47.
8. Asahina, I., T. K. Sampath, et al. (1993). "Human osteogenic protein-1 induces both
chondroblastic and osteoblastic differentiation of osteoprogenitor cells derived from
newborn rat calvaria." J Cell Biol 123(4): 921-933.
9. Autzen, P., C. N. Robson, et al. (1998). "Bone morphogenetic protein 6 in skeletal
metastases from prostate cancer and other common human malignancies." Br J Cancer
78(9): 1219-1223.
10. Bakin, A. V., A. K. Tomlinson, et al. (2000). "Phosphatidylinositol 3-kinase function
is required for transforming growth factor beta-mediated epithelial to mesenchymal
transition and cell migration." J Biol Chem 275(47): 36803-36810.
11. Barnes, G. L., K. E. Hebert, et al. (2004). "Fidelity of Runx2 activity in breast cancer
cells is required for the generation of metastases-associated osteolytic disease." Cancer
Res 64(13): 4506-4513.

74
12. Barnes, J., C. T. Anthony, et al. (1995). "Bone morphogenetic protein-6 expression in
normal and malignant prostate." World J Urol 13(6): 337-343.
13. Bentley, H., F. C. Hamdy, et al. (1992). "Expression of bone morphogenetic proteins
in human prostatic adenocarcinoma and benign prostatic hyperplasia." Br J Cancer 66(6):
1159-1163.
14. Bhowmick, N. A., M. Ghiassi, et al. (2001). "Transforming growth factor-beta1
mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent
mechanism." Mol Biol Cell 12(1): 27-36.
15. Bhowmick, N. A., R. Zent, et al. (2001). "Integrin beta 1 signaling is necessary for
transforming growth factor-beta activation of p38MAPK and epithelial plasticity." J Biol
Chem 276(50): 46707-46713.
16. Birchmeier, W. and J. Behrens (1994). "Cadherin expression in carcinomas: role in
the formation of cell junctions and the prevention of invasiveness." Biochim Biophys
Acta 1198(1): 11-26.
17. Blyth, K., E. R. Cameron, et al. (2005). "The RUNX genes: gain or loss of function in
cancer." Nat Rev Cancer 5(5): 376-387.
18. Bobinac, D., I. Maric, et al. (2005). "Expression of bone morphogenetic proteins in
human metastatic prostate and breast cancer." Croat Med J 46(3): 389-396.
19. Boyer, B., A. M. Valles, et al. (2000). "Induction and regulation of epithelial-
mesenchymal transitions." Biochem Pharmacol 60(8): 1091-1099.
20. Brubaker, K. D., R. L. Vessella, et al. (2003). "Prostate cancer expression of runt-
domain transcription factor Runx2, a key regulator of osteoblast differentiation and
function." Prostate 56(1): 13-22.
21. Bussemakers, M. J., A. Van Bokhoven, et al. (2000). "Complex cadherin expression
in human prostate cancer cells." Int J Cancer 85(3): 446-450.
22. Celeste, A. J., J. A. Iannazzi, et al. (1990). "Identification of transforming growth
factor beta family members present in bone-inductive protein purified from bovine bone."
Proc Natl Acad Sci U S A 87(24): 9843-9847.

75
23. Chen, D., M. Zhao, et al. (2004). "Bone morphogenetic proteins." Growth Factors
22(4): 233-241.
24. Chen, M. Y., D. Carpenter, et al. (1999). "Expression of bone morphogenetic protein
7 in murine epididymis is developmentally regulated." Biol Reprod 60(6): 1503-1508.
25. Cheng, H., W. Jiang, et al. (2003). "Osteogenic activity of the fourteen types of
human bone morphogenetic proteins (BMPs)." J Bone Joint Surg Am 85-A(8): 1544-
1552.
26. Collins, A. T., P. A. Berry, et al. (2005). "Prospective identification of tumorigenic
prostate cancer stem cells." Cancer Res 65(23): 10946-10951.
27. Collins, A. T., F. K. Habib, et al. (2001). "Identification and isolation of human
prostate epithelial stem cells based on alpha(2)beta(1)-integrin expression." J Cell Sci
114(Pt 21): 3865-3872.
28. Comijn, J., G. Berx, et al. (2001). "The two-handed E box binding zinc finger protein
SIP1 downregulates E-cadherin and induces invasion." Mol Cell 7(6): 1267-1278.
29. Dai, J., J. Keller, et al. (2005). "Bone morphogenetic protein-6 promotes osteoblastic
prostate cancer bone metastases through a dual mechanism." Cancer Res 65(18): 8274-
8285.
30. De Pinieux, G., T. Flam, et al. (2001). "Bone sialoprotein, bone morphogenetic
protein 6 and thymidine phosphorylase expression in localized human prostatic
adenocarcinoma as predictors of clinical outcome: a clinicopathological and
immunohistochemical study of 43 cases." J Urol 166(5): 1924-1930.
31. Debnath, J., S. K. Muthuswamy, et al. (2003). "Morphogenesis and oncogenesis of
MCF-10A mammary epithelial acini grown in three-dimensional basement membrane
cultures." Methods 30(3): 256-268.
32. Deckers, M., M. van Dinther, et al. (2006). "The tumor suppressor Smad4 is required
for transforming growth factor beta-induced epithelial to mesenchymal transition and
bone metastasis of breast cancer cells." Cancer Res 66(4): 2202-2209.
33. Ducy, P. and G. Karsenty (2000). "The family of bone morphogenetic proteins."
Kidney Int 57(6): 2207-2214.

76
34. Dudley, A. T., K. M. Lyons, et al. (1995). "A requirement for bone morphogenetic
protein-7 during development of the mammalian kidney and eye." Genes Dev 9(22):
2795-2807.
35. Dudley, A. T. and E. J. Robertson (1997). "Overlapping expression domains of bone
morphogenetic protein family members potentially account for limited tissue defects in
BMP7 deficient embryos." Dev Dyn 208(3): 349-362.
36. Elloul, S., M. B. Elstrand, et al. (2005). "Snail, Slug, and Smad-interacting protein 1
as novel parameters of disease aggressiveness in metastatic ovarian and breast
carcinoma." Cancer 103(8): 1631-1643.
37. Fidler, I. J. (2002). "The organ microenvironment and cancer metastasis."
Differentiation 70(9-10): 498-505.
38. Fidler, I. J. (2003). "The pathogenesis of cancer metastasis: the 'seed and soil'
hypothesis revisited." Nat Rev Cancer 3(6): 453-458.
39. Fowler, M., E. Borazanci, et al. (2006). "RUNX1 (AML-1) and RUNX2 (AML-3)
cooperate with prostate-derived Ets factor to activate transcription from the PSA
upstream regulatory region." J Cell Biochem 97(1): 1-17.
40. Franzen, A. and N. E. Heldin (2001). "BMP-7-induced cell cycle arrest of anaplastic
thyroid carcinoma cells via p21(CIP1) and p27(KIP1)." Biochem Biophys Res Commun
285(3): 773-781.
41. Friedl, P. and D. Gilmour (2009). "Collective cell migration in morphogenesis,
regeneration and cancer." Nat Rev Mol Cell Biol 10(7): 445-457.
42. Garcia M, J. A., Ward EM, Center MM, Hao Y, Siegel RL, Thun MJ. (2007). Global
Cancer Facts & Figures 2007. Atlanta, GA, American Cancer Society.
43. Giampieri, S., C. Manning, et al. (2009). "Localized and reversible TGFbeta
signalling switches breast cancer cells from cohesive to single cell motility." Nat Cell
Biol 11(11): 1287-1296.
44. Gotzmann, J., H. Huber, et al. (2002). "Hepatocytes convert to a fibroblastoid
phenotype through the cooperation of TGF-beta1 and Ha-Ras: steps towards
invasiveness." J Cell Sci 115(Pt 6): 1189-1202.

77
45. Graham, T. R., V. A. Odero-Marah, et al. (2009). "PI3K/Akt-dependent
transcriptional regulation and activation of BMP-2-Smad signaling by NF-kappaB in
metastatic prostate cancer cells." Prostate 69(2): 168-180.
46. Grille, S. J., A. Bellacosa, et al. (2003). "The protein kinase Akt induces epithelial
mesenchymal transition and promotes enhanced motility and invasiveness of squamous
cell carcinoma lines." Cancer Res 63(9): 2172-2178.
47. Hamdy, F. C., P. Autzen, et al. (1997). "Immunolocalization and messenger RNA
expression of bone morphogenetic protein-6 in human benign and malignant prostatic
tissue." Cancer Res 57(19): 4427-4431.
48. Hanahan, D. and R. A. Weinberg (2000). "The hallmarks of cancer." Cell 100(1): 57-
70.
49. Hanai, J., L. F. Chen, et al. (1999). "Interaction and functional cooperation of
PEBP2/CBF with Smads. Synergistic induction of the immunoglobulin germline Calpha
promoter." J Biol Chem 274(44): 31577-31582.
50. Harris, S. E., M. A. Harris, et al. (1994). "Expression of bone morphogenetic protein
messenger RNAs by normal rat and human prostate and prostate cancer cells." Prostate
24(4): 204-211.
51. Heinemeyer, T., E. Wingender, et al. (1998). "Databases on transcriptional regulation:
TRANSFAC, TRRD and COMPEL." Nucleic Acids Res 26(1): 362-367.
52. Hirohashi, S. (1998). "Inactivation of the E-cadherin-mediated cell adhesion system
in human cancers." Am J Pathol 153(2): 333-339.
53. Huber, M. A., N. Kraut, et al. (2005). "Molecular requirements for epithelial-
mesenchymal transition during tumor progression." Curr Opin Cell Biol 17(5): 548-558.
54. Javed, A., F. Afzal, et al. (2009). "Specific residues of RUNX2 are obligatory for
formation of BMP2-induced RUNX2-SMAD complex to promote osteoblast
differentiation." Cells Tissues Organs 189(1-4): 133-137.
55. Javed, A., J. S. Bae, et al. (2008). "Structural coupling of Smad and Runx2 for
execution of the BMP2 osteogenic signal." J Biol Chem 283(13): 8412-8422.

78
56. Jeon, E. J., K. Y. Lee, et al. (2006). "Bone morphogenetic protein-2 stimulates Runx2
acetylation." J Biol Chem 281(24): 16502-16511.
57. Kalluri, R. and E. G. Neilson (2003). "Epithelial-mesenchymal transition and its
implications for fibrosis." J Clin Invest 112(12): 1776-1784.
58. Kalluri, R. and M. Zeisberg (2006). "Fibroblasts in cancer." Nat Rev Cancer 6(5):
392-401.
59. Kang, Y. and J. Massague (2004). "Epithelial-mesenchymal transitions: twist in
development and metastasis." Cell 118(3): 277-279.
60. Katagiri, T., S. Boorla, et al. (1998). "Skeletal abnormalities in doubly heterozygous
Bmp4 and Bmp7 mice." Dev Genet 22(4): 340-348.
61. Kayed, H., X. Jiang, et al. (2007). "Regulation and functional role of the Runt-related
transcription factor-2 in pancreatic cancer." Br J Cancer 97(8): 1106-1115.
62. Kent, W. J. (2002). "BLAT--the BLAST-like alignment tool." Genome Res 12(4):
656-664.
63. Kishi, H., M. Igawa, et al. (2004). "Expression of the survivin gene in prostate cancer:
correlation with clinicopathological characteristics, proliferative activity and apoptosis." J
Urol 171(5): 1855-1860.
64. Konstantinos, H. (2005). "Prostate cancer in the elderly." Int Urol Nephrol 37(4):
797-806.
65. Kumano, M., H. Miyake, et al. (2008). "Enhanced progression of human prostate
cancer PC3 cells induced by the microenvironment of the seminal vesicle." Br J Cancer
98(2): 356-362.
66. Kwok, W. K., M. T. Ling, et al. (2005). "Up-regulation of TWIST in prostate cancer
and its implication as a therapeutic target." Cancer Res 65(12): 5153-5162.
67. Lai, T. H., Y. C. Fong, et al. (2008). "Osteoblasts-derived BMP-2 enhances the
motility of prostate cancer cells via activation of integrins." Prostate 68(12): 1341-1353.

79
68. Lamm, M. L., C. A. Podlasek, et al. (2001). "Mesenchymal factor bone
morphogenetic protein 4 restricts ductal budding and branching morphogenesis in the
developing prostate." Dev Biol 232(2): 301-314.
69. Lang, S. H., R. M. Sharrard, et al. (2001). "Prostate epithelial cell lines form
spheroids with evidence of glandular differentiation in three-dimensional Matrigel
cultures." Br J Cancer 85(4): 590-599.
70. Lang, S. H., M. Stark, et al. (2001). "Experimental prostate epithelial morphogenesis
in response to stroma and three-dimensional matrigel culture." Cell Growth Differ
12(12): 631-640.
71. Larue, L. and A. Bellacosa (2005). "Epithelial-mesenchymal transition in
development and cancer: role of phosphatidylinositol 3' kinase/AKT pathways."
Oncogene 24(50): 7443-7454.
72. Leboy, P., G. Grasso-Knight, et al. (2001). "Smad-Runx interactions during
chondrocyte maturation." J Bone Joint Surg Am 83-A Suppl 1(Pt 1): S15-22.
73. Lee, K. S., H. J. Kim, et al. (2000). "Runx2 is a common target of transforming
growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2
and Smad5 induces osteoblast-specific gene expression in the pluripotent mesenchymal
precursor cell line C2C12." Mol Cell Biol 20(23): 8783-8792.
74. Li, F. and D. C. Altieri (1999). "Transcriptional analysis of human survivin gene
expression." Biochem J 344: 305-311.
75. Li, H., X. Chen, et al. (2008). "PC3 human prostate carcinoma cell holoclones contain
self-renewing tumor-initiating cells." Cancer Res 68(6): 1820-1825.
76. Liao, C. P., C. Zhong, et al. (2007). "Mouse models of prostate adenocarcinoma with
the capacity to monitor spontaneous carcinogenesis by bioluminescence or fluorescence."
Cancer Res 67(15): 7525-7533.
77. Lim, M., C. Zhong, et al. (2009). "Runx2 regulates survivin expression in prostate
cancer cells." Lab Invest.
78. Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4):
402-408.

80
79. Lu, Y., Z. Cai, et al. (2007). "Monocyte chemotactic protein-1 mediates prostate
cancer-induced bone resorption." Cancer Res 67(8): 3646-3653.
80. Majumder, P. K., J. J. Yeh, et al. (2003). "Prostate intraepithelial neoplasia induced
by prostate restricted Akt activation: the MPAKT model." Proc Natl Acad Sci U S A
100(13): 7841-7846.
81. Mani, S. A., W. Guo, et al. (2008). "The epithelial-mesenchymal transition generates
cells with properties of stem cells." Cell 133(4): 704-715.
82. Martin, T. A., A. Goyal, et al. (2005). "Expression of the transcription factors snail,
slug, and twist and their clinical significance in human breast cancer." Ann Surg Oncol
12(6): 488-496.
83. Massague, J. (1998). "TGF-beta signal transduction." Annu Rev Biochem 67: 753-
791.
84. Massague, J. and D. Wotton (2000). "Transcriptional control by the TGF-beta/Smad
signaling system." Embo J 19(8): 1745-1754.
85. Masuda, H., Y. Fukabori, et al. (2004). "Expression of bone morphogenetic protein-7
(BMP-7) in human prostate." Prostate 59(1): 101-106.
86. Masuda, H., Y. Fukabori, et al. (2003). "Increased expression of bone morphogenetic
protein-7 in bone metastatic prostate cancer." Prostate 54(4): 268-274.
87. Merrihew, C., S. Soeder, et al. (2003). "Modulation of endogenous osteogenic
protein-1 (OP-1) by interleukin-1 in adult human articular cartilage." J Bone Joint Surg
Am 85-A Suppl 3: 67-74.
88. Meyers, S., J. R. Downing, et al. (1993). "Identification of AML-1 and the (8;21)
translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt
homology domain is required for DNA binding and protein-protein interactions." Mol
Cell Biol 13(10): 6336-6345.
89. Meyers, S., N. Lenny, et al. (1995). "The t(8;21) fusion protein interferes with AML-
1B-dependent transcriptional activation." Mol Cell Biol 15(4): 1974-1982.
90. Mulholland, D. J., L. Xin, et al. (2009). "Lin-Sca-1+CD49fhigh Stem/Progenitors Are
Tumor-Initiating Cells in the Pten-Null Prostate Cancer Model." Cancer Res.

81
91. Nagafuchi, A., Y. Shirayoshi, et al. (1987). "Transformation of cell adhesion
properties by exogenously introduced E-cadherin cDNA." Nature 329(6137): 341-343.
92. Nieto, M. A. (2002). "The snail superfamily of zinc-finger transcription factors." Nat
Rev Mol Cell Biol 3(3): 155-166.
93. Ning, Y. M. and D. M. Robins (1999). "AML3/CBFalpha1 is required for androgen-
specific activation of the enhancer of the mouse sex-limited protein (Slp) gene." J Biol
Chem 274(43): 30624-30630.
94. Nishihara, A., M. Fujii, et al. (2003). "Bone morphogenetic protein signaling in
articular chondrocyte differentiation." Biochem Biophys Res Commun 301(2): 617-622.
95. O'Brien, C. A., A. Pollett, et al. (2007). "A human colon cancer cell capable of
initiating tumour growth in immunodeficient mice." Nature 445(7123): 106-110.
96. Oft, M., J. Peli, et al. (1996). "TGF-beta1 and Ha-Ras collaborate in modulating the
phenotypic plasticity and invasiveness of epithelial tumor cells." Genes Dev 10(19):
2462-2477.
97. Pennati, M., M. Binda, et al. (2004). "Ribozyme-mediated inhibition of survivin
expression increases spontaneous and drug-induced apoptosis and decreases the
tumorigenic potential of human prostate cancer cells." Oncogene 23(2): 386-394.
98. Pennati, M., M. Binda, et al. (2004). "Ribozyme-mediated down-regulation of
survivin expression sensitizes human melanoma cells to topotecan in vitro and in vivo."
Carcinogenesis 25(7): 1129-1136.
99. Piek, E., A. Moustakas, et al. (1999). "TGF-(beta) type I receptor/ALK-5 and Smad
proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast
epithelial cells." J Cell Sci 112 ( Pt 24): 4557-4568.
100. Piscione, T. D., T. Phan, et al. (2001). "BMP7 controls collecting tubule cell
proliferation and apoptosis via Smad1-dependent and -independent pathways." Am J
Physiol Renal Physiol 280(1): F19-33.
101. Pratap, J., A. Javed, et al. (2005). "The Runx2 osteogenic transcription factor
regulates matrix metalloproteinase 9 in bone metastatic cancer cells and controls cell
invasion." Mol Cell Biol 25(19): 8581-8591.

82
102. Reddi, A. H., D. Roodman, et al. (2003). "Mechanisms of tumor metastasis to the
bone: challenges and opportunities." J Bone Miner Res 18(2): 190-194.
103. Rhee, S. and F. Grinnell (2007). "Fibroblast mechanics in 3D collagen matrices."
Adv Drug Deliv Rev 59(13): 1299-1305.
104. Ricci-Vitiani, L., D. G. Lombardi, et al. (2007). "Identification and expansion of
human colon-cancer-initiating cells." Nature 445(7123): 111-115.
105. Roca, H. and R. T. Franceschi (2008). "Analysis of transcription factor interactions
in osteoblasts using competitive chromatin immunoprecipitation." Nucleic Acids Res
36(5): 1723-1730.
106. Roy-Burman, P., H. Wu, et al. (2004). "Genetically defined mouse models that
mimic natural aspects of human prostate cancer development." Endocr Relat Cancer
11(2): 225-254.
107. Sansal, I. and W. R. Sellers (2004). "The biology and clinical relevance of the PTEN
tumor suppressor pathway." J Clin Oncol 22(14): 2954-2963.
108. Savagner, P. (2001). "Leaving the neighborhood: molecular mechanisms involved
during epithelial-mesenchymal transition." Bioessays 23(10): 912-923.
109. Schmittgen, T. D., B. A. Zakrajsek, et al. (2000). "Quantitative reverse transcription-
polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time
methods." Anal Biochem 285(2): 194-204.
110. Selvamurugan, N., E. Shimizu, et al. (2009). "Identification and characterization of
Runx2 phosphorylation sites involved in matrix metalloproteinase-13 promoter
activation." FEBS Lett 583(7): 1141-1146.
111. Shariat, S. F., Y. Lotan, et al. (2004). "Survivin expression is associated with
features of biologically aggressive prostate carcinoma." Cancer 100(4): 751-757.
112. Singh, S. K., C. Hawkins, et al. (2004). "Identification of human brain tumour
initiating cells." Nature 432(7015): 396-401.
113. Tantivejkul, K., L. M. Kalikin, et al. (2004). "Dynamic process of prostate cancer
metastasis to bone." J Cell Biochem 91(4): 706-717.

83
114. Thiery, J. P. (2002). "Epithelial-mesenchymal transitions in tumour progression."
Nat Rev Cancer 2(6): 442-454.
115. Thomas, B. G. and F. C. Hamdy (2000). "Bone morphogenetic protein-6: potential
mediator of osteoblastic metastases in prostate cancer." Prostate Cancer Prostatic Dis
3(4): 283-285.
116. Tomita, K., A. van Bokhoven, et al. (2000). "Cadherin switching in human prostate
cancer progression." Cancer Res 60(13): 3650-3654.
117. Tonomoto, Y., M. Tachibana, et al. (2007). "Differential expression of RUNX genes
in human esophageal squamous cell carcinoma: downregulation of RUNX3 worsens
patient prognosis." Oncology 73(5-6): 346-356.
118. Tou, L., N. Quibria, et al. (2003). "Transcriptional regulation of the human
Runx2/Cbfa1 gene promoter by bone morphogenetic protein-7." Mol Cell Endocrinol
205(1-2): 121-129.
119. Trotman, L. C., M. Niki, et al. (2003). "Pten dose dictates cancer progression in the
prostate." PLoS Biol 1(3): 385-396.
120. Tsai, A. D., L. C. Yeh, et al. (2003). "Effects of osteogenic protein-1 (OP-1, BMP-7)
on gene expression in cultured medial collateral ligament cells." J Cell Biochem 90(4):
777-791.
121. Urist, M. R. (1965). "Bone: formation by autoinduction." Science 150(698): 893-
899.
122. Uzgare, A. R. and J. T. Isaacs (2004). "Enhanced redundancy in Akt and mitogen-
activated protein kinase-induced survival of malignant versus normal prostate epithelial
cells." Cancer Res 64(17): 6190-6199.
123. Vega, R. B., K. Matsuda, et al. (2004). "Histone deacetylase 4 controls chondrocyte
hypertrophy during skeletogenesis." Cell 119(4): 555-566.
124. Vincent-Salomon, A. and J. P. Thiery (2003). "Host microenvironment in breast
cancer development: epithelial-mesenchymal transition in breast cancer development."
Breast Cancer Res 5(2): 101-106.

84
125. Vleminckx, K., L. Vakaet, Jr., et al. (1991). "Genetic manipulation of E-cadherin
expression by epithelial tumor cells reveals an invasion suppressor role." Cell 66(1): 107-
119.
126. Vukicevic, S., H. K. Kleinman, et al. (1992). "Identification of multiple active
growth factors in basement membrane Matrigel suggests caution in interpretation of
cellular activity related to extracellular matrix components." Exp Cell Res 202(1): 1-8.
127. Wang, S., J. Gao, et al. (2003). "Prostate-specific deletion of the murine Pten tumor
suppressor gene leads to metastatic prostate cancer." Cancer Cell 4(3): 209-221.
128. Wang, X., M. Kruithof-de Julio, et al. (2009). "A luminal epithelial stem cell that is
a cell of origin for prostate cancer." Nature 461(7263): 495-500.
129. Wee, H. J., G. Huang, et al. (2002). "Serine phosphorylation of RUNX2 with novel
potential functions as negative regulatory mechanisms." EMBO Rep 3(10): 967-974.
130. Wildonger, J. and R. S. Mann (2005). "The t(8;21) translocation converts AML1
into a constitutive transcriptional repressor." Development 132(10): 2263-2272.
131. William Brewster Isaacs, M. F. H. (2007). Prostate Cancer: Biology, Genetics, And
the New Therapeutics Humana Press Inc.
132. Wrana, J. L. (2000). "Crossing Smads." Sci STKE 2000(23): RE1.
133. Xie, L., B. K. Law, et al. (2003). "Transforming growth factor beta-regulated gene
expression in a mouse mammary gland epithelial cell line." Breast Cancer Res 5(6):
R187-198.
134. Xie, L., B. K. Law, et al. (2004). "Activation of the Erk pathway is required for
TGF-beta1-induced EMT in vitro." Neoplasia 6(5): 603-610.
135. Xin, L., H. Ide, et al. (2003). "In vivo regeneration of murine prostate from
dissociated cell populations of postnatal epithelia and urogenital sinus mesenchyme."
Proc Natl Acad Sci U S A 100 Suppl 1: 11896-11903.
136. Yan, M., E. Kanbe, et al. (2006). "A previously unidentified alternatively spliced
isoform of t(8;21) transcript promotes leukemogenesis." Nat Med 12(8): 945-949.

85
137. Yang, F., J. A. Tuxhorn, et al. (2005). "Stromal expression of connective tissue
growth factor promotes angiogenesis and prostate cancer tumorigenesis." Cancer Res
65(19): 8887-8895.
138. Yang, J., S. A. Mani, et al. (2004). "Twist, a master regulator of morphogenesis,
plays an essential role in tumor metastasis." Cell 117(7): 927-939.
139. Yang, J., S. A. Mani, et al. (2006). "Exploring a new twist on tumor metastasis."
Cancer Res 66(9): 4549-4552.
140. Yang, S., M. Lim, et al. (2006). "Bone morphogenetic protein 7 protects prostate
cancer cells from stress-induced apoptosis via both Smad and c-Jun NH2-terminal kinase
pathways." Cancer Res 66(8): 4285-4290.
141. Yang, S., L. K. Pham, et al. (2008). "A novel bone morphogenetic protein signaling
in heterotypic cell interactions in prostate cancer." Cancer Res 68(1): 198-205.
142. Yang, S., C. Zhong, et al. (2005). "Diverse biological effect and Smad signaling of
bone morphogenetic protein 7 in prostate tumor cells." Cancer Res 65(13): 5769-5777.
143. Yeh, L. C., K. P. Betchel, et al. (1998). "Inhibition of BMP receptor synthesis by
antisense oligonucleotides attenuates OP-1 action in primary cultures of fetal rat calvaria
cells." J Bone Miner Res 13(12): 1870-1879.
144. Yu, Y. P., D. Landsittel, et al. (2004). "Gene expression alterations in prostate
cancer predicting tumor aggression and preceding development of malignancy." J Clin
Oncol 22(14): 2790-2799.
145. Yuan, J. S., A. Reed, et al. (2006). "Statistical analysis of real-time PCR data." BMC
Bioinformatics 7: 85.
146. Zaidi, S. K., A. J. Sullivan, et al. (2002). "Integration of Runx and Smad regulatory
signals at transcriptionally active subnuclear sites." Proc Natl Acad Sci U S A 99(12):
8048-8053.
147. Zavadil, J., M. Bitzer, et al. (2001). "Genetic programs of epithelial cell plasticity
directed by transforming growth factor-beta." Proc Natl Acad Sci U S A 98(12): 6686-
6691.

86
148. Zavadil, J., L. Cermak, et al. (2004). "Integration of TGF-beta/Smad and
Jagged1/Notch signalling in epithelial-to-mesenchymal transition." Embo J 23(5): 1155-
1165.
149. Zhang, M., D. E. Latham, et al. (2005). "Survivin mediates resistance to
antiandrogen therapy in prostate cancer." Oncogene 24(15): 2474-2482.

Abstract (if available)

Abstract High expression of bone morphogenetic protein 7 (BMP7) in bone metastasis of the human prostate tumor and increased BMP7 expression with progression of prostatic adenocarcinoma in a mouse model imply a role for this protein in the advanced cancer. We examined the effect of BMP7 on various human prostatic cell lines to investigate its function on their oncologic properties in prostate cancer progression. The cancer cell lines presented various features of cancer progression such as anti-apoptotic activity or enhanced cell migration and invasion that were modulated by BMP7. We identified survivin as a key player in the anti-apoptotic protection in C4-2B prostatic cancer cell line. A master transcription factor of osteoblastic differentiation, Runx2, was found to regulate survivin expression and cell protection. BMP7 maintained the level of Runx2 as well as enhanced the association of Runx2 on survivin gene promoter. Moreover, Runx2 played an important role in avoiding cell death in normal culture conditions. Runx2 inhibition using either siRNA or AML1-ETO fusion protein, which suppressed Runx target gene expressions, significantly increased cancer cell apoptosis. The expression pattern of Runx2 was also correlated with the tumor growth in the mouse model of prostate cancer. It was noted that BMP7 induced phenotypic conversion similar to epithelial-mesenchymal transition (EMT) in PC-3 human prostate cancer cells. EMT is widely accepted as an important event of cancer metastasis, we pursued to identify the conversion. We characterized the major features of EMT in the cells

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Bimodal effects of bone morphogenetic proteins in prostate cancer

PDF

Exploration of the roles of cancer stem cells and survivin in the pathogenesis and progression of prostate cancer

PDF

Study of bone morphogenetic protein-2 and stromal cell derived factor-1 in prostate cancer

PDF

Homologous cell systems for the study of progression of androgen-dependent prostate cancer to castration-resistant prostate cancer

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

Modulation of Runx proteins by steroid hormone receptors

PDF

Studies of murine prostate cancer stem / progenitor cells

PDF

Role of cancer-associated fibroblast secreted annexin A1 in generation and maintenance of prostate cancer stem cells

PDF

RUNX2 & sex steroids: molecular mechanisms in regulating bone turnover

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

The effect of tumor-mediated immune suppression on prostate cancer immunotherapy

PDF

Harnessing the power of stem cell self-renewal pathways in cancer: dissecting the role of BMI-1 in Ewing’s sarcoma initiation and maintenance

PDF

Targeting molecular signals involved in the development of castration resistant prostate cancer

PDF

LIGHT-ing up prostate cancer: remodeling the tumor microenvironment and enhancing therapeutic vaccine efficacy through forced LIGHT expression in prostate cancer

PDF

The role of bone morphogenetic protien 4 in the pathogenesis of choroidal neovascularization in age-related macular degeneration

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

PTEN deletion induced tumor initiating cells: Strategies to accelerate the disease progression of liver cancer

PDF

The mechanism by which extracellular Hsp90α promotes cell migration: implications in wound healing and cancer

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

Asset Metadata

Creator Lim, Minyoung (author)

Core Title Study of the role of bone morphogenetic proteins in prostate cancer progression

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Genetic, Molecular and Cellular Biology

Publication Date 01/25/2010

Defense Date 12/16/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag apoptosis,Bone Morphogenetic Protein,cancer progression,Metastasis,OAI-PMH Harvest,Prostate

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Roy-Burman, Pradip (committee chair), Chuong, Cheng-Ming (committee member), Frenkel, Baruch (committee member)

Creator Email minylim@gmail.com,minyounl@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2812

Unique identifier UC1180181

Identifier etd-Lim-3439 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-288537 (legacy record id),usctheses-m2812 (legacy record id)

Legacy Identifier etd-Lim-3439.pdf

Dmrecord 288537

Document Type Dissertation

Rights Lim, Minyoung

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu