University of Southern California Dissertations and Theses

Differential regulation of monoamine oxidase A and B genes

(USC Thesis Other)

Differential regulation of monoamine oxidase A and B genes

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

DIFFERENTIAL REGULATION OF MONOAMINE OXIDASE A AND B GENES

by
Boyang Wu
________________________________________________________________________

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(MOLECULAR PHARMACOLOGY AND TOXICOLOGY)

December 2009

Copyright 2009 Boyang Wu

ii

Dedication

To my family

iii

Acknowledgements

I would like to express my first and earnest gratitude to my advisor and my
Committee Chair, Prof. Jean C. Shih, for her invaluable guidance, supervision,
encouragement and constant support during my Ph.D. study at the University of Southern
California. Her mentorship was paramount in shaping various aspects of my professional
and personal life.
I am also sincerely thankful to Dr. Roger F. Duncan, Dr. Bangyan L. Stiles and Dr.
Joseph R. Landolph for their advice and serving in my Qualifying Exam and Dissertation
Committees, and to Prof. Enrique Cadenas for serving in my Qualifying Exam
Committee.
Special thanks are conveyed to past and current members in Prof. Shih’s group, Dr.
Kevin Chen, Dr. Xiao-Ming Ou, Dr. Marco Bortolato, Dr. Eric K-W. Hui, Dr. Jassmine
Ren, Dr. Zhiqiang Wang, Bin Qian, Jia Lu, Anna Scott and Sean Godar for their technical
support and helpful discussions. They also made my life in USC more enjoyable and
memorable.
My final and most heartfelt acknowledgement must go to my parents for their
encouragement and love. Without them this work would never has come into existence.

iv
Table of Contents

Dedication........................................................................................................................... ii
Acknowledgements............................................................................................................ iii
List of Tables .................................................................................................................... vi
List of Figures.................................................................................................................. vii
Abstract.............................................................................................................................. ix
Chapter I:
Background on Monoamine Oxidase ................................................................................. 1

Chapter II:
Regulation of Monoamine Oxidase A by the SRY Gene on the Y Chromosome............... 6
Introduction and Rationale............................................................................................ 6
Results........................................................................................................................... 7
MAO A gene up-regulation by SRY in human neuroblastoma BE(2)C cells ......... 7
Identification and validation of an effective SRY-binding site in the MAO A
0.24-kb core promoter in vitro and in vivo ........................................................... 12
Synergistic enhancing effect of Sp1 on the SRY activaiton of MAO A promoter 17
Crosstalk between SRY and Sp1 in up-regulating MAO A core promoter in
vivo........................................................................................................................ 20
Discussion................................................................................................................... 23
Chapter III:
Monoamine Oxidae B Gene Regulation by Antioxidant t-Butylhydroquinone ............... 26
Introduction and Rationale.......................................................................................... 26
Results......................................................................................................................... 29
Repression of MAO B by antioxidant tBHQ through Akt signaling pathway in
human hepatoma HepG2 cells .............................................................................. 29
Characterization of MAO B catalytic activity in cell cycle progression since
G
0
/early G
1
phases after serum starvation ............................................................ 37
MAO B gene up-regulation by Akt pathway-dependent cyclin D1 ...................... 39
Discussion................................................................................................................... 42
Chapter IV:
Transcriptional Regulation of Monoamine Oxidase B by Retinoic Acid ....................... 43
Introduction and Rationale.......................................................................................... 43
Results......................................................................................................................... 45

v

Transcriptional acivation of MAO B gene by RA in human neuroblastoma
BE(2)C cells.......................................................................................................... 45
Mediation of the RA induction of MAO B promoter by RARα/RXRα through
the third retinoic acid response element................................................................ 47
Characterization of Sp1-binding sites in RA induction of MAO B promoter....... 55
Crosstalk between RARα and Sp1 in RA induction of MAO B promoter............ 64
MAO A gene up-regulation by RA in human neuroblastoma BE(2)C cells ......... 72
Identification of co-regulated genes with MAO A by microarray analysis........... 74
Discussion................................................................................................................... 78
Chapter V:
Materials and Methods...................................................................................................... 83
Bibliography ..................................................................................................................... 97
Appendix: Summary of MAO gene regulation ............................................................... 110

vi
List of Tables

Table 1: Sp1- and SRY-binding sites in MAO A 0.24-kb promoter (-303/-64)................ 16
Table 2: Summary of co-regulated genes with MAO A in BE(2)C cells treated with
RA..................................................................................................................................... 77

vii
List of Figures

Figure 1: Schematic diagram of MAO A gene regulation................................................... 4
Figure 2: Schematic diagram of MAO B gene regulation................................................... 5

Figure 3: Discovery of MAO A as a novel targe gene for SRY by ChIP-chip assay.......... 8
Figure 4: MAO A gene up-regulation by SRY in BE(2)C cells........................................ 11

Figure 5: Identification and validation of an effective SRY-binding site in MAO A
0.24-kb core promoter....................................................................................................... 15

Figure 6: Synergistic enhancing effect of Sp1 on the SRY activation of MAO A
promoter............................................................................................................................ 19

Figure 7: Crosstalk between SRY and Sp1 in MAO A core promoter in vivo .................. 22
Figure 8: Schematic diagram of the effects of antioxidants on reductases and oxidases
with its consequences on the maintenance of ROS levels ................................................ 28

Figure 9: Repression of MAO B gene expression by antioxidant tBHQ in HepG2 cells . 31

Figure 10: Repression of MAO B catalytic activity by the antioxidants, sulforaphane
and curcumin, in HepG2 cells........................................................................................... 32

Figure 11: Repression of MAO B catalytic activity by tBHQ through Akt signaling
pathway............................................................................................................................. 36

Figure 12: Characterization of MAO B catalytic activity in cell cycle progression......... 38

Figure 13: MAO B gene regulation by Akt-pathway-dependent cyclin D1...................... 41

Figure 14: MAO B transcriptional activation by RA in BE(2)C cells .............................. 46

Figure 15: Mediation of RA induction of MAO B promoter by RARα and RXRα.......... 50

Figure 16: Identification and validation of an effective retinoic acid response element
in MAO B 2-kb promoter .................................................................................................. 54

Figure 17: Mediation of RA induction of MAO B promoter by Sp1-binding sites .......... 57

viii
Figure 18: Down-regulation of RA induction of MAO B promoter by interference of
Sp1 binding ....................................................................................................................... 59

Figure 19: MAO B promoter activation by RA via both Sp1 sites and the third retinoic
acid response element ....................................................................................................... 63

Figure 20: Interaction of RARα with Sp1 in vitro............................................................ 67

Figure 21: Crosstalk between RARα and Sp1 in MAO B core promoter in vivo.............. 71

Figure 22: MAO A gene up-regulation by RA in BE(2)C cells ........................................ 73

Figure 23: Identification and characterization of co-regulated genes with MAO A by
microarray analysis ........................................................................................................... 76

Figure 24: Comparison of RARα and RXRα expression levels and its consequences in
RA induction of MAO B promoter in three human neruonal cell lines ............................ 81

ix
Abstract

This study has investigated the transcriptional regulation of MAO A and B genes.
MAO A and B are a crucial pair of oxidative isoenzymes, which degrade biogenic and
dietary amines, including monoamine neurotransmitters, and produce hydrogen peroxide.
Abnormal MAO A or B activity has been implicated in numerous neurological and
psychiatric disorders. These two isoenzymes have different but overlapping substrate and
inhibitor selectivity. There is a 70% amino acid sequences identity and different tissue-
and cell-specific expression between the two enzymes. MAO A and B promoters share
approximately 60% sequence identity with distinct organization. Both MAO A and B are
regulated by Sp-family proteins, such as Sp1 and Sp3. MAO B is uniquely regulated by
protein kinase C and mitogen-activated protein kinase signaling pathways, whereas MAO
A is involved in the c-Myc-induced proliferative signaling pathway.
This study further demonstrates the similar and unique transcriptional regulation of
MAO A and B genes. The results show that the SRY (the sex-determining region Y) gene
activates the MAO A but not the MAO B gene; in contrast, the antioxidant t-butyl
hydroquinone (tBHQ) only represses MAO B activity. The SRY gene, encoding a putative
transcription factor responsible for sex determination during embryogenesis, activates
MAO A gene expression through a functional SRY-binding site in MAO A promoter,
which is synergistically enhanced by Sp1. On the other hand, tBHQ represses MAO B
activity through the Akt signaling pathway and cell cycle progression, and the
downstream cyclin D1 directly regulates MAO B. Moreover, we demonstrate that RA

x
activates MAO B transcription through both effective retinoic acid response elements and
Sp1 sites in the promoter, which involves crosstalk between the retinoic acid receptor α
and Sp1 in MAO B core promoter region.
In summary, these studies identified novel regulators of the MAO A and B genes and
their molecular mechanisms and suggested novel potential role(s) of MAO in certain
physiological processes and diseases states. The differential regulation of MAO A and B
genes further supports the different physiological functions of these two isoenzymes.

1
Chapter I
Background on Monoamine Oxidase

Monoamine oxidase (MAO) oxidatively deaminates a number of biogenic and dietary
amines in the brain and peripheral tissues by generating the byproduct hydrogen peroxide
(H
2
O
2
). MAO exists in two forms, A and B, with different but overlapping substrate and
inhibitor specificities. MAO A preferentially oxidizes serotonin, norepinephrine and
dopamine, and is irreversibly inhibited by low concentrations of clorgyline. MAO B
preferentially oxidizes phenylethylamine and benzylamine, and is irreversibly inhibited
by low concentrations of pargyline and deprenyl (Bach et al., 1988; Shih, 1991; Shih et
al., 1999). MAO A and B are encoded by two independent genes with identical exon-
intron organization on Xp11.23-11.4. MAO A and B proteins share 70% amino acid
sequence identity and are located in the outer membrane of mitochondria (Lan et al.,
1989; Shih et al., 1999). Although MAO A and B are widely co-distributed in the central
nervous system and in the peripheral nervous system; MAO A is predominantly found in
catecholaminergic neurons, whereas MAO B is more abundant in serotonergic and
histaminergic neurons and glial cells (Shih et al., 1999).
Abnormal MAO activity has been implicated in a variety of neurological and
psychiatric disorders, such as depression and social anxiety (Bortolato et al., 2008; Shih
et al., 1999; Tadic et al., 2003). MAO A deficiency caused by a spontaneous mutation in
the MAO A gene led to impulsive aggressive behavior and mild mental retardation in
affected males in a Dutch family (Brunner et al., 1993). Consistent with this finding in

2
humans, Mao a-knockout mice also show aggressive behavior (Cases et al., 1995; Scott
et al., 2008; Shih et al., 1999). Low platelet MAO B activity with increasing levels of
phenylethylamine is associated with alcoholism and stress-related disorders (Devor et al.,
1993; Faraj et al., 1994; Shih et al., 1999). 1-Methyl-4-phenylpyridine (MPP
+
), a
metabolite converted from 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) by
MAO B, selectively destroys nigrostriatal neurons and induces Parkinson’s disease-like
symptoms in rodents and humans (Langston et al., 1984; Nicotra and Parvez, 2000). The
neurodegeneration induced by MPTP can be prevented by the MAO B inhibitor, deprenyl
(Heikkila et al., 1984). Mao b-knockout mice lack neurodegenerative effects induced by
MPTP (Grimsby et al., 1997). Moreover, MAO B activity is significantly increased in the
brain with age in rats (Arai and Kinemuchi, 1988) and humans (Fowler et al., 1997).
These studies suggest that MAO B may play an important role in aging and
neurodegeneration.
The transcriptional regulation of MAO A and B has been extensively studied in recent
years since the first cloning of MAO A and B promoters in the early 1990s. The maximal
promoter activities for MAO A and B were found in a 0.24-kb and 0.15-kb fragment,
respectively. Both fragments are GC-rich, contain potential Sp1-binding sites, and share
approximately 60% sequence identity. However, the organization of the transcription
factor binding elements is different between these two promoters. The MAO A 0.24-kb
core promoter lacks a TATA box, consists of four Sp1 sites, and exhibits bidirectional
promoter activity (Zhu et al., 1994; Zhu et al., 1992). The MAO B 0.15-kb core promoter
consists of two clusters of overlapping Sp1 sites separated by a CACCC element (Ou et

3
al., 2004; Wong et al., 2001). The different promoter organization of MAO A and B genes
may underline their different tissue- and cell-specific expressions.
Sp1 and Sp4 activate both MAO A and B core promoters via Sp1 sites, whereas Sp3
represses this activation by competing with Sp1 and Sp4 (Wong et al., 2001; Zhu et al.,
1992). R1 (RAM2/CDCA7L/JPO2), as a novel transcription repressor, down-regulates
MAO A gene expression by competing with Sp1 for binding to Sp1 sites as well (Chen et
al., 2005). MAO A and R1 are also involved in the serum starvation-induced apoptotic
and c-Myc-induced proliferative signaling pathways (Ou et al., 2006b). DNA methylation
of CpG sites in the MAO B promoter exerts epigenetically repressing effect on MAO B
gene expression (Wong et al., 2003). Moreover, MAO B but not MAO A can be activated
by the tumor promoter, phorbol 12-myristate 13-acetate, which activates protein kinase C
and mitogen-activated protein (MAP) kinase signaling pathways, including Ras, MEK1,
MEK3, MEK7, ERK2, JNK1 and p38/RK, with the transcription factors c-Jun and Egr1
as the ultimate targets (Wong et al., 2002) (Figures 1 and 2).

!
4
FIGURE 1. Schematic diagram of MAO A gene regulation.

The size is not proportional to the promoter structure.

!
5
FIGURE 2. Schematic diagram of MAO B gene regulation.

The size is not proportional to the promoter structure. Representative ERE is shown.

6
Chapter II
Regulation of Monoamine Oxidase A by the SRY Gene on the Y Chromosome

INTRODUCTION AND RATIONALE
The sex-determining region on the Y chromosome (SRY) gene, encoding a putative
transcription factor, is the master switch regulator responsible for initiating testis
determination and differentiation during embryogenesis (Chan and Rennert, 2002; Kim
and Capel, 2006; Wilhelm et al., 2007). Although many of the pathways regulating
sexual differentiation have been elucidated, direct downstream targets of SRY are still
unclear. Recently, we have identified the MAO A, but not the MAO B, as a novel neural
target for the SRY gene in a genome-wide chromatin immunoprecipitation (ChIP) and
promoter tiling microarray analysis. Interestingly, some of MAO A-associated
neuropsychiatric disorders show significant sex differences. For example, the prevalence
of autism (Williams et al., 2008) and attention deficit hyperactivity disorder (Dulcan,
1997) is about 4 and 2 times as frequent in males as in females, respectively. However,
the roles of the Y-chromosome genes in such sexual dimorphisms have not yet been
explored in detail. Here, we demonstrate the molecular mechanisms of MAO A gene
regulation by SRY. We also propose that this sexually dimorphic regulation may provide
new insight into the initiation/progression of neurodevelopmental disorders associated
with MAO A dysfunction and suggest the role of Y-chromosome genes in these
processes.

7
RESULTS
MAO A gene up-regulation by SRY in human neuroblastoma BE(2)C cells
We initially identified Mao a as a potential target gene for Sry in E11.5 embryonic
mouse gonadal cells using a genome-wide ChIP assay on a 2.5-kb mouse-promoter tiling
microarray (ChIP-chip) (Figure 3) (Ren and Dynlacht, 2004; Taketo et al., 2005). Given
the approximately 70% sequence identify shared between human and mouse MAO A
promoters, we speculate that MAO A could be regulated by SRY in humans as well. This
is also consistent with the result predicted from the human genome that multiple putative
SRY-binding sites are present in MAO A 2-kb promoter. The brain has been recently
suggested as an important sexual organ that begins to develop differentially between
males and females prior to the formation of the respective sex organs and synthesis of sex
hormones during embryogenesis (Dennis, 2004; Dewing et al., 2006; Mayer et al., 1998).
However, the exact molecular mechanisms for such sexually dimorphic differentiation
are currently uncertain, and this process may be influenced by specific genes on the sex
chromosomes, such as Y-chromosome-encoded SRY. In light of the importance of MAO
A and SRY implicated in brain, we used a human male neuroblastoma BE(2)C cell line,
in which both genes are well expressed, to explore the molecular mechanisms by which
SRY regulates MAO A expression.

8
FIGURE 3. Discovery of MAO A as a novel target gene for SRY by ChIP-chip assay.
Fetal gonads were dissected from E11.5 mouse embryo and subjected to chromatin
immunoprecipitation, using a monoclonal antibody against the mouse Sry protein. The
precipitated chromatin DNA was used as a hybridization probe on mouse promoter tiling
microarrays (ChIP-chip) to identify putative target genes for the mouse Sry, using the
NimbleGen 2.5-kb mouse promoter tiling microarray. Mao a gene was identified as a
target for Sry. The left panel shows a SignalMap output of the 2.5-kb promoter tiles along
the mouse Mao a gene from duplicate experiments. Subsequent analysis using semi-
quantitative PCR and gene-specific primers on input, mock and Sry-ChIP DNAs
confirmed Mao a to be target for Sry (right panel). As indicated by the SignalMap, the
putative peak of Sry binding was located at the 5’ sequences proximal to the transcription
initiation site of the mouse Mao a gene. The present study also confirmed such SRY
binding at the core promoter of the human MAO A gene.

9
In order to study the effect of SRY on MAO A expression, we established a stable
BE(2)C cell line overexpressing SRY. In this cell line, both MAO A mRNA (Figure 4A)
and catalytic activity (Figure 4B) significantly increased, by 340 and 30%, respectively.
We also introduced SRY siRNA to knock down endogenous SRY in BE(2)C cells by
siRNA interference technology. Successful SRY knockdown, as confirmed by Western
blot (Figure 4C), dramatically repressed MAO A catalytic activity by 45% (Figure 4D).
To determine the SRY effect on MAO A promoter, we cotransfected an MAO A 2-kb-
promoter luciferase reporter construct (MAO A 2-kb-luc) with various amounts of FLAG-
tagged SRY expression construct into BE(2)C cells, followed by luciferase activity
determination. As shown in Figure 4E, MAO A promoter activity increased up to 6-fold in
an SRY-concentration-dependent manner. The transfection efficiency of SRY was
confirmed by Western blot (Figure 4F). In addition, a significant reduction of both MAO
A 2- and 0.24-kb core promoter activities to less than 40% was observed in cells after
endogenous SRY knockdown (Figure 4G). MAO A 0.24-kb core promoter (-303/-64)
contains a 240-bp region immediately upstream from the transcription initiation site and
exhibits the maximum MAO A promoter activity (Zhu et al., 1992). Taken together, these
results demonstrate that SRY activates both MAO A promoter and catalytic activities.

10
FIGURE 4. MAO A gene up-regulation by SRY in BE(2)C cells. (A) Effect of SRY
overexpression on MAO A mRNA expression. MAO A mRNA levels were determined by
quantitative real-time PCR in BE(2)C cells overexpressing SRY. In control (ctrl) cells,
pCMV vector carrying the neomycin-resistant gene was stably transfected. GAPDH was
used as an internal control. Data were analyzed by 2
-ΔΔCT
method. MAO A mRNA
expression level in control cells was arbitrarily set as 1. (B) Effect of SRY
overexpression on MAO A catalytic activity. MAO A catalytic activity was determined
by MAO A catalytic activity assay in BE(2)C cells overexpressing SRY. MAO A
catalytic activity in control cells was set as 100%. (C) Knockdown of endogenous SRY in
BE(2)C cells. SRY siRNA was transfected into BE(2)C cells; 48 h later, cells were
harvested and analyzed by Western blot using anti-SRY antibody. β-Actin was used as
loading control. Nonsense (NS) siRNA was transfected similarly in control cells. (D)
Effect of SRY knockdown on MAO A catalytic activity. BE(2)C cells were transfected
with SRY siRNA; 48-72 h later, cells were harvested and analyzed by MAO A catalytic
activity assay. MAO A catalytic activity in control cells was set as 100%. (E) Effect of
SRY on MAO A-promoter activity. MAO A 2-kb-luc was cotransfected with various
amounts of FLAG-SRY expression construct into BE(2)C cells; 24-48 h later, cells were
harvested, and the luciferase activity was determined. Activity of MAO A 2-kb-luc
(expressing firefly luciferase) was normalized with cotransfected pRL-TK (expressing
Renilla luciferase). pcDNA was added to keep the DNA amount of each transfection
constant. Activity of MAO A 2-kb-luc without transfection of SRY was set as 1. (F)
Analysis of transfection efficiency of FLAG-SRY. Western blot was performed to
document the FLAG-SRY expression in BE(2)C cells using anti-FLAG antibody. β-
Actin was used as loading control. (G) MAO A 2- or 0.24-kb-luc was cotransfected with
SRY siRNA into BE(2)C cells; 48 h later, cells were harvested, and the luciferase activity
was determined. Activity of MAO A 2- or 0.24-kb-luc without transfection of SRY siRNA
was set as 100%. *, P<0.05; **, P<0.01

11

12
Identification and validation of an effective SRY-binding site in the MAO A 0.24-kb
core promoter in vitro and in vivo
Previous studies have shown that SRY binds to promoter sequences of its target genes
and mediates their expressions (Harley et al., 2003; Poulat et al., 1995; Werner et al.,
1995). In order to identify putative SRY-binding sites in the MAO A 2-kb promoter, we
cotransfected various MAO A promoter-luc constructs of different lengths with an SRY
expression construct into BE(2)C cells. Interestingly, MAO A 2-, 1.6-, 1.3- and 0.24-kb
promoter-luc constructs were all activated by SRY to a similar extent (Figure 3A),
suggesting that SRY-binding sites are most likely located in the 0.24-kb core promoter
region. Moreover, MAO A 0.24-kb promoter contains 4 Sp1-binding sites (Table 1) (Zhu
et al., 1992), and deletion of these sites abolished the basal MAO A 2-kb promoter activity,
as well as SRY-induced promoter activation (Figure 5A).
To determine whether SRY is associated with the MAO A 0.24-kb promoter, we
conducted a ChIP assay with BE(2)C cells transiently transfected with FLAG-tagged SRY
expression construct followed by PCR using specific primers targeting this 0.24-kb
region (Figure 5B). As shown in Figure 3B, the ectopically expressed SRY is indeed
associated with the 0.24-kb region. By screening this 0.24-kb region, we identified a
putative SRY-binding site (-117/-111) (Figure 5C, middle panel) that is identical to the
canonical motif (Figure 5C, top panel) (Harley et al., 1994). Mutation of this site (Figure
5C, bottom panel) reduced the SRY activation of MAO A 0.24-kb promoter by 30%
(Figure 5D), suggesting that this site is functional.

13
To determine whether SRY directly interacts with this element, we conducted
electrophoretic mobility shift analysis (EMSA) with radioactively labeled MAO A-0.24-
kb-promoter-derived SRY-binding oligonucleotide as a probe. Our results showed only
one band indicating a DNA-protein complex on the gel when in vitro translated SRY
protein was incubated with the probe (Figure 5E), which suggests a direct binding of
SRY to this element. This band was abolished in the presence of 100-fold excess of
unlabeled probes as a competitor, suggesting it is specific for SRY (Figure 5E).
Furthermore, there was no band observed when mock protein synthesized from vector
DNA was incubated in DNA-protein binding reaction (Figure 5E). In line with these
observations, these results demonstrate that SRY binds to a functional SRY-binding site
in MAO A 0.24-kb promoter both in vitro and in vivo.

14
FIGURE 5. Identification and validation of an effective SRY-binding site in MAO A
0.24-kb core promoter. (A) Serial deletion analysis of MAO A-promoter activation by
SRY. MAO A-promoter-luc with various deletions were cotransfected with SRY into
BE(2)C cells; 24 to 48 h later, cells were harvested, and the luciferase activity was
determined. Promoterless pGL2-Basic vector was used as control. Fold of activation of
MAO A-promoter-luc by SRY is indicated. Activity of MAO A 2-kb-luc without
transfection of SRY was set as 1. (B) Demonstration of SRY binding to MAO A 0.24-kb
core promoter in vivo. Schematic representation of MAO A 2-kb (-2072/-64) and 0.24-kb
(-303/-64) promoter structure is not proportional to the real promoter length. A in the
start codon was set as +1. BE(2)C cells were transiently transfected with FLAG-SRY; 48
h later, cells were subjected to ChIP assay using anti-FLAG antibody and PCR with
primers specific for MAO A core promoter region (-360/-17). IgG was used as a negative
control for IP. BE(2)C genomic DNA (gDNA) and ddH
2
O was used as positive and
negative controls, respectively, for PCR. (C) Sequence of canonical SRY-binding site
(top panel), a potential SRY-binding site (-117/-111) in MAO A 0.24-kb promoter
(middle panel), and the introduced point mutations (in italic) used to inactivate the
potential SRY-binding site (bottom panel). (D) Effect of SRY on wild-type (wt) and
mutated (mut) MAO A 0.24-kb-luc construct in BE(2)C cells. Fold of activation of wt
MAO A 0.24-kb-luc by SRY was set as 100%. (E) EMSA of in vitro translated SRY
protein with MAO A 0.24-kb-promoter-derived,
32
P-labeled oligonucleotide containing wt
SRY-binding site. In vitro translation product using pcDNA vector as a template was
used as mock. *, P<0.05.

15

16
TABLE 1. Sp1- and SRY-binding sites in MAO A 0.24-kb promoter (-303/-64).

17
Synergistic enhancing effect of Sp1 on the SRY activation of MAO A promoter
Both SRY- and Sp1-binding sites are located, but do not overlap, in the MAO A 0.24-
kb core promoter region (Table 1). SRY and Sp1 bind to AT-rich (Harley et al., 1994)
and GC-rich sites (Briggs et al., 1986; Suske, 1999), respectively. Sp1, a ubiquitous
transcription factor in mammals (Suske, 1999), is in particular a key activator of the MAO
A promoter (Shih et al., 1995; Zhu et al., 1994; Zhu et al., 1992). Sp1 directly binds to
GC-boxes in the promoter of target genes and synergistically transactivates target genes
with a large variety of transcription factors such as RelA (Perkins et al., 1993) and Oct-1
(Strom et al., 1996). Moreover, Sp1 plays various roles in embryonic development, such
as acting as a transcription regulator in spermatogenesis (Lee et al., 2006; Marin et al.,
1997; Zhao and Meng, 2005).
To study the involvement of Sp1 in the SRY activation of MAO A promoter, we
cotransfected MAO A 0.24-kb-luc with various amounts of HA-tagged Sp1 in the absence
or presence of SRY into BE(2)C cells followed by luciferase activity determination
(Figure 6A). The transfection efficiency of Sp1 was confirmed by Western blotting
analysis (Figure 6C). As summarized in Figure 6B, Sp1 increases MAO A promoter
activity by 37, 50 and 70% in an Sp1-concentration-dependent manner in the absence of
SRY. SRY itself activated the MAO A promoter by 361%, and this activation was
synergistically enhanced to 426, 583 and 800% when various amounts of Sp1 was
cotransfected. Thus, Sp1 increased the SRY-mediated MAO A promoter activation with
an additional increase of 65, 222 and 439%, respectively. However, knockdown of
endogenous Sp1 reduced its own stimulating effect on MAO A promoter as well as its

18
synergistic action on SRY-mediated MAO A promoter activation to a similar extent
(Figure 6E). The knockdown efficiency of Sp1 was confirmed by Western blot (Figure
6D). Taken together, these data suggest that Sp1 synergistically enhances but is not
essentially required for the SRY activation of MAO A promoter in BE(2)C cells.

19
FIGURE 6. Synergistic enhancing effect of Sp1 on the SRY activation of MAO A
promoter. (A) Effect of Sp1 on MAO A-promoter activation by SRY. MAO A 0.24-kb-
luc was cotransfected with various amounts of HA-Sp1 in the presence or absence of SRY
into BE(2)C cells; 24 to 48 later, cells were assayed for luciferase activity. Activity of
MAO A 0.24-kb-luc transfected alone was set as 1. (B) Summary of increases of MAO A-
promoter activity obtained in (A). (C) Western blot analysis of transfected cells
correlating the transfection efficiency of HA-Sp1 used in (A). (D) Knockdown of
endogenous Sp1 in BE(2)C cells by siRNA interference technology. (E) Effect of Sp1
knockdown on the SRY activation of MAO A promoter. MAO A 0.24-kb-luc was
cotransfected with SRY together with or without Sp1 siRNA into BE(2)C cells; 48 h later,
cells were assayed for luciferase activity. Activity of MAO A 0.24-kb-luc transfected
alone was set as 1. *, P<0.05; **, P<0.01.

20
Crosstalk between SRY and Sp1 in up-regulating MAO A core promoter in vivo
SRY has been demonstrated to interact with a variety of transcription factors in
regulating its target genes (Chen et al., 2005; Lau et al., 2009; Li et al., 2006). Given that
SRY and Sp1 bind to the same region of MAO A 0.24-kb promoter, we hypothesize that
they may physically interact and synergize in their transactivation of MAO A promoter.
To explore this possibility, we conducted a co-IP assay with BE(2)C cells using anti-Sp1
antibody. As shown in Figure 7A, Sp1 retained SRY in the anti-Sp1 immunoprecipitates,
as revealed by Western blot using an anti-SRY antibody, suggesting a physical
interaction of Sp1 with SRY. To further determine whether Sp1 and SRY are
simultaneously present in the natural MAO A core promoter, we conducted a ChIP assay
with BE(2)C cells transiently transfected with FLAG-tagged SRY using anti-FLAG
antibody followed by a re-ChIP assay with anti-FLAG immunoprecipitates using anti-
Sp1 antibody. As expected, SRY was associated with the natural MAO A core promoter
(Figure 7B, top panel), and Sp1 was also detected in the anti-FLAG immunoprecipitates
(Figure 7B, bottom panel), supporting the postulation that Sp1 forms a complex with
SRY in the natural MAO A core promoter. In addition, higher SRY occupancy in the
natural MAO A core promoter was observed in cells overexpressing Sp1 (Figure 7C),
which is consistent with the synergistic transactivation of MAO A promoter by SRY and
Sp1 and also suggest a physiological effect of this interaction. Hence, Sp1 enhances
SRY-induced MAO A transcriptional activation by interacting and forming a
transcriptional regulatory complex with SRY in the MAO A core promoter (Figure 7D).

21
FIGURE 7. Crosstalk between SRY and Sp1 in MAO A core promoter in vivo. (A)
Co-immunoprecipitation and Western blot analysis of interaction between SRY and Sp1
in BE(2)C cells. Rabbit polyclonal anti-Sp1 antibody was used for IP, and mouse
monoclonal anti-SRY antibody was used for Western blot. IgG was used as a negative
control for IP. 10% input was loaded as control. (B) ChIP/re-ChIP analysis demonstrating
the simultaneous presence of Sp1 and SRY in natural MAO A core promoter. BE(2)C
cells were transiently transfected with FLAG-SRY; 48 h later, cells were subjected to
ChIP assay using anti-FLAG antibody. Anti-FLAG immunoprecipitates were subjected to
re-ChIP assay using anti-Sp1 antibody. IgG was used as a negative control for IP. PCR
was performed using primers targeting MAO A core promoter region. Distilled H
2
O was
used as a negative control (NTC) for PCR. (C) Overexpression of Sp1 enhanced SRY
binding to MAO A core promoter in vivo. BE(2)C cells were transiently transfected with
FLAG-SRY together with or without Sp1; 48 h later, cells were subjected to ChIP assay
using anti-FLAG antibody. PCR was performed using primers targeting MAO A core
promoter region. Intensity of DNA bands was quantified by Labworks analysis software.
(D) Schematic diagram of MAO A transcriptional activation cooperatively regulated by
SRY and Sp1.

22

23
DISCUSSION
We have for the first time demonstrated the presence of a functional SRY-binding site
in the MAO A core promoter both in vitro and in vivo (Figure 5). The SRY-binding site is
located proximal to these well-characterized Sp1-binding sites (Table 1). The human
SRY protein harbors a high mobility group (HMG) box DNA-binding domain, which can
bind and bend target DNA sequences (Harley et al., 1994; Sinclair et al., 1990). These
DNA-binding and -bending activities are essential for SRY as a sex-determining factor,
since mutations at the HMG box abolish such DNA binding properties and result in XY
sex reversal (Harley et al., 2003; Pontiggia et al., 1994). Previous studies demonstrated
that various cofactors could interact with SRY to form transcriptional regulatory
complexes in regulating SRY target genes (Li et al., 2006; Oh et al., 2005). The present
study demonstrates that SRY is capable of interacting with Sp1 synergistically in
transactivation of MAO A gene. Since other factors, such as Sp3, Sp4 and R1, also utilize
the same Sp1 sites in their transcriptional regulation of MAO A, it will be interesting to
determine whether these MAO A regulators could also interact with SRY, thereby
exerting potential transcriptional complex interplays and sexually dimorphic
physiological effects.
The identification of MAO A as a novel neural target for SRY has raised several
significant issues regarding the potential contribution of this Y-chromosome-encoded
transcription factor to neural development and mental disorders. MAO A is subjected to X
inactivation, and hence, in principle, it is only active in one of the two X chromosomes in
females (Nordquist and Oreland, 2006). However, other studies have suggested that the

24
levels of serotonin, the substrate for MAO A, could vary between males and females
(Chugani et al., 1998; Nishizawa et al., 1997), suggesting that there might be sexual
dimorphism in MAO A functions. Indeed, sexual dimorphisms in brain structures and
manifestation of mental illnesses and neurodegenerative diseases have long been
observed (Cohen et al., 2003; Spring et al., 2007). Hence, the SRY influence on MAO A
expression could be part of such a sexually dimorphic program in neural structure and
physiology. Alternatively, the MAO A locus could be subjected to incomplete X
inactivation, resulting in higher MAO A activities in females. The synergistic regulation
of MAO A by SRY and Sp1 could be a normal physiological and compensational function
in males, which raises the levels of MAO A to those in females. On the basis of this
postulation, deficiency in X inactivation of MAO A locus could increase the levels of
MAO A activities in females, which are prone to depressive disorders. Conversely, an
inadequate up-regulation of MAO A by SRY-Sp1 could decrease MAO A activities in
males. It is uncertain what effects, such as a decline in MAO A activity, might have on
male physiology and cognitive functions.
In addition to depressive disorders, MAO A, among other genes/genetic factors, has
been implicated to play a role in the pathogenesis of some of other psychiatric disorders,
such as autism, schizophrenia and attention deficit hyperactivity disorder (Bortolato et al.,
2008; Cohen et al., 2003; Davis et al., 2008; Hranilovic et al., 2008; Jonsson et al., 2003;
Shih et al., 1999; Yoo et al., 2009). However, the exact mechanisms for these disorders
have not yet been identified. Since SRY expression has been demonstrated in the brain
during embryonic development and/or adulthood (Dennis, 2004; Dewing et al., 2006;

25
Mayer et al., 1998), it could be a male-specific genetic modifier in regulation of MAO A
gene, thereby exerting sexual dimorphisms in neural development and/or development
and progression of psychiatric/cognitive disorders associated with abnormal MAO A
activities (Bortolato et al., 2008; Dennis, 2004; Wilson and Davies, 2007).
The fact that a Y-located transcription factor is capable of transactivating an X-
located gene is intriguing. The molecular mechanisms leading to sexual dimorphisms in
brain structures and cognitive disorders have been debated in numerous publications
(Arnold et al., 2004; Cosgrove et al., 2007; Dewing et al., 2006; Westlund et al., 1988).
One hypothesis suggests that dosage differences of X-located genes that escape X
inactivation could have contributed to such physiological or disease phenomena. The
current demonstration of the regulatory and exacerbating roles of SRY on MAO A
transcription and enzymatic activities has clearly raised the possibility that Y-
chromosome genes and epigenetic gene regulation could be significant players in sexual
dimorphisms in both normal human physiology and diseases.

26
Chapter III
Monoamine Oxiase B Gene Regulation by Antioxidant t-Butylhydroquinone

INTRODUCTION AND RATIONALE
The maintenance of normal levels of reactive oxygen species (ROS) is an important
cellular function, which prevents the potential damaging effects of oxidative stress within
cells. High levels of ROS may result in lipid peroxidation, DNA oxidation, and protein
carbonylation, which functionally impair cellular components (Banning et al., 2005;
Emerit et al., 2004; Ischiropoulos and Beckman, 2003; Klein and Ackerman, 2003). One
mechanism that cells use to maintain redox homeostasis is the antioxidant response
pathway via the nuclear factor-erythroid 2 p45-related factor 2 (Nrf2)/ Kelch-like ECH-
associated protein 1 (Keap1) transcription factor system. Antioxidant response elements
(AREs) are cis-acting elements located in the regulatory sequences of phase II
detoxification enzymes such as glutathione S-transferases (GST) and NAD(P)H:quinone
oxidoreductase (NQO1). Activation of Nrf2 results in its dissociation from its negative
regulator Keap1, and allows Nrf2 to translocate into the nucleus to bind to the ARE, and
to induce these specific ARE-containing genes (Banning et al., 2005; Nguyen et al.,
2003; Rushmore and Kong, 2002). Compounds such as the synthetic phenolic
antioxidant, tert-butylhydroquinone (tBHQ), and the electrophilic vegetable extract
components, sulforaphane and curcumin, are well-known inducers of Nrf2-mediated
transcription. Treatment of cells with tBHQ has shown protection against H
2
O
2
and
neutralization of oxidative insults (Banning et al., 2005; Kraft et al., 2004; Li et al.,

27
2002). However, the critical role of tBHQ-like antioxidants in maintaining cellular redox
status have long been observed by enhancing the activities of reductases such as GST and
NQO1, and very little is known about whether these antioxidants also influence the
activities of various oxidases to control the cellular level of ROS (Figure 8).
Monoamine oxidases (MAOs) degrade a number of biogenic and dietary amines with
the release of the byproduct of H
2
O
2
. Hence, the appropriate levels of MAO activity are
necessary for maintaining normal cellular redox status. Aberrant MAO B activity along
with increasing ROS level has been associated with aging and certain neurodegenerative
diseases such as Parkinson’s disease. Apart from the key functions in the brain, MAO B
is also abundant in the liver and responsible for the metabolism of amines from different
sources such as diet (Shih et al., 1999). The administration of the MAO B inhibitor,
deprenyl, has been shown to significantly decrease the levels of lipid peroxidation caused
by oxidative stress in aged rat livers (Kiray et al., 2007). We have recently found that
tBHQ represses human MAO B, but not MAO A, activity in a human hepatoma HepG2
cell line. In this study, we investigated the corresponding molecular mechanisms and
physiological outcomes.

28
FIGURE 8. Schematic diagram of the effects of antioxidants on reductases and
oxidases with its consequences on the maintenance of ROS levels.

29
RESULTS
Repression of MAO B by antioxidant tBHQ through Akt signaling pathway in
human hepatoma HepG2 cells
In light of the importance and physiological implications of MAO B in the liver, we
used human hepatoma HepG2 cells as a model system in the present study. HepG2 cells
highly express MAO B and responds to tBHQ. tBHQ has been demonstrated to induce
apoptosis at high concentrations in a previous study. Thus, we first performed MTT assay
to determine the appropriate concentrations of tBHQ without affecting viability in HepG2
cells. As revealed in Figure 9A, cell viability was significantly decreased with tBHQ at a
concentration of 100 µM or greater for 24 h. The concentration of 50 µM was used in
subsequent experiments to avoid cytotoxicity. To examine the effect of tBHQ on MAO B
activity, HepG2 cells were treated with various concentrations of tBHQ for 24 h, and a
significant decrease of MAO B catalytic activity by up to ~50% of inhibition was
observed, which was also tBHQ-concentration-dependent (Figure 9B). To determine
whether this repression is also reflected at the protein level, we performed Western
blotting analysis with HepG2 cells treated with tBHQ (50 µM) for 24 h. As MAO B is a
mitochondrial protein, mitochondrial isolation was conducted prior to Western blotting,
and the mitochondrial protein COX IV was used as a loading control. As expected, tBHQ
was shown to repress MAO B protein levels by ~30% (Figure 9C). This difference is
statistically significant (Figure 9D). In addition, the natural antioxidants, sulforaphane
and curcumin, also showed repressing effects on MAO B activity in HepG2 cells with an
inhibition of 33 and 50%, respectively (Figures 10A and B), and the concentrations of

30
these compounds used in the current experiments are not toxic to cells (data not shown).
Taken together, these results suggest a negative response of MAO B to these
antioxidants.

31
FIGURE 9. Repression of MAO B gene expression by antioxidant tBHQ in HepG2
cells. (A) HepG2 cell viability under tBHQ treatment. HepG2 cells were treated with
tBHQ at various concentrations for 24 h (DMSO used as a vehicle) followed by MTT
assay. Viability of cells treated with DMSO alone was set as 100%. (B) Effect of tBHQ
on MAO B catalytic activity. HepG2 cells were treated with tBHQ at various
concentrations for 24 followed by MAO B catalytic activity assay. MAO B catalytic
activity in cells treated with DMSO alone was set as 100%. (C) Effect of tBHQ on MAO
B protein expression. HepG2 cells were treated with tBHQ (50 µM) for 24 h followed by
mitochondria isolation and Western blot using anti-MAO B antibody. Mitochondrial
protein COX IV was used as loading control. (D) The intensity of MAO B protein bands
in (C) was quantified and normalized with COX IV protein expression. Normalized
MAO B protein expression in control (ctrl) cells treated with DMSO alone was set as
100%. *, P<0.05; **, P<0.01.

32
FIGURE 10. Repression of MAO B catalytic activity by the antioxidants,
sulforaphane and curcumin, in HepG2 cells. (A) Effect of sulforaphane on MAO B
catalytic activity. HepG2 cells were treated with sulforaphane at various concentrations
for 24 h followed by MAO B catalytic activity assay. (B) Effect of curcumin on MAO B
catalytic activity. HepG2 cells were treated with curcumin at various concentrations for
24 h followed by MAO B catalytic activity assay. DMSO was used as a vehicle in (A)
and (B). Activity in cells treated with DMSO alone was set s 100%. *, P<0.05; **,
P<0.01.

33
Interestingly, tBHQ had no effect on MAO B at the transcriptional level, and both
MAO B promoter activity and mRNA level remained the same in response to tBHQ (data
not shown). Moreover, there is no canonical or consensus ARE found by screening the
MAO B 2-kb promoter. Thus, we hypothesized that this repression of MAO B activity
may be coupled with specific cellular events under the control of certain signaling
pathways when cells are exposed to antioxidants. Previous studies have reported that
tBHQ is capable of inducing the mitogenic signaling and cellular survival pathway that
involve MAP kinases and phosphatidylinositol-3 (PI3) kinase/Akt (Kang et al., 2001; Lee
et al., 2006; Wang et al., 1998). MAO B expression can be induced by the activation of
MAP kinase signaling pathway, with c-Jun and Egr1 as the ultimate targets of this
regulatory cascade at the transcriptional level in HepG2 cells (Wong et al., 2002). This
suggests that the MAP kinase pathway is not likely to be responsible for the tBHQ
inhibition of MAO B activity, whereas whether PI3K/Akt pathway can regulate MAO B
expression has not been fully studied yet.
To explore the possibility that tBHQ represses MAO B activity via the PI3K/Akt
pathway, we treated HepG2 cells with tBHQ in the absence or presence of LY 492002, a
well-known potent inhibitor of PI3K, for different times up to 12 h, and dissected the
expression levels of an array of proteins involved in PI3K/Akt pathway. As shown in
Figure 11A (left panel), tBHQ increased the phosphorylation level of Akt from 30 min
through 12 h, a downstream consequence of PI3K activation, whereas this
phosphorylation was abolished in the presence of LY 492002 (right panel). Moreover,
the PI3K/Akt pathway-dependent cyclin D1 was significantly up-regulated by tBHQ in a

34
time-dependent manner, which led to the activation of downstream cyclin E, indicating
the promotion of cell cycle progression (Figure 11A, left panel). Accordingly, cell cycle
analysis revealed that the proportion of cells in the S phase increased by 35% (this was
statistically significant at ps level) after 12-h tBHQ treatment, which was abolished with
the co-incubation of LY 492002, a well-known potent PI3K inhibitor (Figure 11C).
Representative graphs of cell cycle analysis were shown in Figure 11B. As expected,
tBHQ repressed MAO B catalytic activity by up to 40% in a 12-h treatment period, which
is time-dependent, but this repression was not observed in cells co-incubated with LY
492002 (Figure 11D). In line with these observations, the repression of MAO B activity
by tBHQ is mediated through Akt pathway.

35
FIGURE 11. Repression of MAO B catalytic activity by tBHQ through Akt signaling
pathway. (A) Induction of PI3K/Akt pathway by tBHQ. HepG2 cells were treated with
tBHQ (50 µM) in the absence (left panel) or presence (right panel) of LY 492002 (20
µM) for different time followed by Western blot using anti-phospho-Akt (Thr308), anti-
cyclin D1, anti-cyclin E antibodies. Akt and β-actin were used as loading control. (B, C)
Cell cycle analysis of cell proportion in the S phase. HepG2 cells were treated with tBHQ
(50 µM) in the absence or presence of LY 492002 (20 µM) for 12 h, and harvested and
prepared for cell cycle analysis by flow cytometry. Cells treated with DMSO were used
as control (ctrl). Cell proportion in the S phase was quantified by ModFit LT software.
Representative graphs were shown in (B). Left arrow, G
1
phase; right arrow, G
2
phase;
middle shallow, S phase. (D) Combining effect of tBHQ and LY 492002 on MAO B
catalytic activity. MAO B catalytic activity was determined in cells used in (A). *,
P<0.05.

36

37
Characterization of MAO B catalytic activity in cell cycle progression since G
0
/early
G
1
phases after serum starvation
It is notable that the repression of MAO B activity by tBHQ concurred with the
elevated levels of cyclin D1 and cyclin E and also the promotion of cell cycle progression
(Figure 11). Hence, we hypothesized that tBHQ may affect MAO B activity through the
modulation of cell cycle progression. Cyclin D1, a G
1
-phase cyclin that participates in the
control of cell cycle progression at the G
1
to S phase transition, has been demonstrated to
be capable of promoting mitogen-independent cell cycle progression in rat hepatocytes
(Albrecht and Hansen, 1999). To test this hypothesis, we mimicked an ascending
inclination of cyclin D1 expression in cells and determined MAO B activity accordingly.
HepG2 cells were starved without serum for 24-48 h, which led to low levels of cyclin
D1, suggesting an effective cell cycle arrest (Figure 12A). With addition of 20% serum,
cyclin D1 expression increased in a time-dependent manner within a 12-h time period
(Figure 9A), which is associated with a gradual decrease of MAO B catalytic activity by
up to ~50% of reduction (Figure 12B). These results suggest a novel link between the
modulation of MAO B activity and cell cycle progression.

38
FIGURE 12. Characterization of MAO B catalytic activity in cell cycle progression.
(A) Induction of cyclin D1 expression after serum starvation in HepG2 cells. HepG2 cells
were starved without serum for 24 h followed by the addition of 20% serum into culture
medium, and the induction of cyclin D1 expression in cell cycle progression was
analyzed by Western blot. β-Actin was used as loading control. (B) Determination of
MAO B catalytic activity in cell cycle progression. MAO B catalytic activity assay was
performed with cells used in (A). *, P<0.05; **, P<0.01.

39
MAO B gene up-regulation by Akt pathway-dependent cyclin D1 Overexpression of cyclin D1 has been reported to shorten the G
1
phase and to
accelerate entry into the S phase (Quelle et al., 1993). To examine the direct effect of
cyclin D1 on MAO B activity, we transfected a constitutively active form of HA-tagged
cyclin D1 (T286A) that cannot be degraded via the ubiquitin pathway into HepG2 cells
(Newman et al., 2004). Overexpression of cyclin D1 (T286A) dramatically reduced MAO
B catalytic activity by 47% (Figure 13A). The transfection efficiency was confirmed by
Western blot (Figure 13B). We also knocked down the endogenous cyclin D1 synthesis
in HepG2 cells by siRNA interference technology. Successful cyclin D1 knockdown, as
confirmed by Western blot (Figure 13D), significantly increased MAO B catalytic
activity by 30% (Figure 13C). In addition, knockout of PTEN, a negative regulator of Akt,
has been demonstrated to activate Akt-dependent cyclin D1 expression. As expected,
there was a 54% reduction of MAO B catalytic activity observed in Pten-knockout mouse
hepatocytes (Figure 13E). Taken together, these results suggest that cyclin D1 is a direct
mediator in Akt pathway that represses MAO B activity.

40
FIGURE 13. MAO B gene regulation by Akt pathway-dependent cyclin D1. (A)
Effect of overexpression of cyclin D1 on MAO B catalytic activity. HA-tagged cyclin D1
(T286A) expression construct was transiently transfected into HepG2 cells; 24 h after
transfection, MAO B catalytic activity was determined. pcDNA was transfected in
control (ctrl) cells. (B) Transfection efficiency in (A) was examined by Western blot
using both anti-HA and anti-cyclin D1 antibodies. β-Actin was used as loading control.
(C) Effect of cyclin D1 knockdown on MAO B catalytic activity. HepG2 cells were
transfected with cyclin D1 siRNA; 48 h after transfection, MAO B catalytic activity was
determined. Nonsense (NS) siRNA was transfected in control cells. (D) Efficiency of
cyclin D1 knockdown in (C) was examined by Western blot. β-Actin was used as loading
control. (E) MAO B catalytic activity was determined in Pten-knockout mouse
hepatocytes. Activity of MAO B in control HepG2 cells or wild-type (wt) mouse
hepatocyes was set as 100%. *, P<0.05; **, P<0.01.

41

42
DISSCUSION
In this study, we have for the first time demonstrated the repressing effect of a
specific class of antioxidants represented by tBHQ on the MAO B activity in HepG2 cells.
Interestingly, this repression is solely for MAO B but not MAO A. Moreover, there was
no such repression of either MAO A or B in response to tBHQ in two other human brain
cell lines tested, the human glioblastoma 1242-MG cells and human neuroblastoma SH-
SY5Y cells (data not shown). SH-SY5Y cells have been shown as tBHQ-responsive with
activation of Nrf2 upon tBHQ treatment (Cao et al., 2005). Hence, the repressing effect
of tBHQ on MAO B reflects a cell-specific manner.
Both MAO A and B share high sequence identity in their amino acid composition and
promoter structure, but differ slightly in their distribution in certain tissues and organs
(Shih et al., 1999). MAO B protein is >10-fold more abundant than MAO A protein in
the liver, suggesting an indispensable role of MAO B in metabolic functions of the liver.
MAO B degrades amines from various sources in the liver, and the byproduct of H
2
O
2
is
released. Hence, it would be interesting to determine whether the repression of MAO B
by tBHQ has any physiological effect on the cellular level of ROS. In summary, this
study demonstrates novel regulatory mechanisms of MAO B gene via the Akt/cyclin D1
pathway, and also provides new insight into the established role of tBHQ in regulating
cellular redox status by repressing specific oxidases.

43
Chapter IV
Transcriptional Regulation of Monoamine Oxidase B by Retinoic Acid

INTRODUCTION AND RATIONALE Emerging evidence has recently suggested the importance of MAO gene regulation by
hormones, because hormones such as androgen, glucocorticoid, and estrogen may
influence neurotransmitter levels by modulating MAO activity, which further affects
mood and behaviors in humans (de Kloet et al., 1990; Prochazka et al., 2003; Zhang et
al., 2006). We have recently found that retinoic acid (RA) activates MAO B transcription
in a neuroblastoma BE(2)C cell line, and also identified a consensus retinoic acid
response element (RARE) (-303/-287) in MAO B 2-kb promoter.
RA, a non-steroid hormone, plays a crucial role in mammalian embryogenesis and
development through their regulatory effects on cell differentiation, cell proliferation and
apoptosis (Altucci and Gronemeyer, 2001; Bastien and Rochette-Egly, 2004; Ross et al.,
2000). RA directly transactivates downstream target genes through retinoic acid receptors
(RARs) and retinoid X receptors (RXRs) that bind to RAREs in the regulatory sequences
of target genes (Bastien and Rochette-Egly, 2004). A canonical RARE can be a 7-bp-
spaced inverted repeat (referred to as IR7), 5’-GGTAANNNNNNNTGACC-3’ (N is any
nucleotide) (Vansant and Reynolds, 1995), as identified in the MAO B promoter.
Moreover, several recent studies have also reported crosstalk between RAR/RXR and
other transcription factors. In this study, the molecular mechanisms of transcriptional
regulation of MAO B gene by RA are dissected in detail.

44
In addition to MAO B, we also extended this study by examining the RA effect on
MAO A gene expression, and MAO A was demonstrated to be up-regulated by RA in
BE(2)C cells as well. Previous studies have shown that RA regulates downstream target
gene expressions by diverse regulatory mechanisms and crosstalk among multiple
signaling pathways. However, the precise changes of specific co-regulated gene
expression that accompany and may correlate to the RA induction of MAO A remains
unknown. Microarray analysis is a powerful tool to screen co-regulated genes along with
RA induction of MAO A, by which we are able to identify shared regulators and
mediators that may directly or indirectly contribute to MAO A up-regulation. This also
provides an efficient means of gaining critical insight into potentially novel functions of
MAO genes implicated in RA-associated biological and physiological processes.

45
RESULTS
Transcriptional activation of MAO B by RA in human neuroblastoma BE(2)C cells
In light of the importance of MAO B implicated in the brain, we used a human
neuroblastoma BE(2)C cell line to investigate the regulatory effect of RA on MAO B in
the present student. This cell line is also RA-responsive and tends to differentiate under
long-term RA treatment. To examine the effect of RA on the MAO B promoter, we
transfected MAO B 2-kb promoter-luciferase reporter construct (MAO B 2-kb-luc) into
human neuroblastoma BE(2)C cells, and determined luciferase activity after 24-h RA (10
µM) treatment. As shown in Figure 14A, RA increased the MAO B promoter in a
concentration-dependent manner with increases of 1.4-, 5.3- and 13.2-fold at 10
-7
, 10
-6

and 10
-5
M, respectively. This activation was also time-dependent, and the highest
induction was observed after 24-h treatment with RA (10 µM) (Figure 14B). We next
performed quantitative real-time RT-PCR to study the RA effect on the MAO B
transcript. Consistent with the promoter activation, MAO B mRNA increased by 2-fold
after 48-h RA treatment (10 µM) in BE(2)C cells (Figure 14C).

46
FIGURE 14. MAO B transcriptional activation by RA in BE(2)C cells. (A) MAO B 2-
kb-luc was transfected into BE(2)C cells, 24 h after transfection, cells were treated with
RA at various concentrations for another 24 h (B) or with RA(10 µM) for different time
followed by luciferase activity determination. Activity of MAO B 2-kb-luc without RA
treatment was set as 1. (C) Quantitative real-time RT-PCR analysis of MAO B mRNA
level in BE(2)C cells under 48-h RA (10 µM) treatment. GAPDH was used as an internal
control for PCR. The data were analyzed by 2
-ΔΔCT
method. MAO B mRNA level in
untreated group was arbitrarily set as 1. (D) Agarose gel electrophoresis showed that only
a single DNA fragment was amplified for each gene. Distilled H
2
O was used as the
template for a negative control (NTC) in PCR. *, P<0.05; **, P<0.01.

47
Mediation of the RA induction of MAO B promoter by RARα/RXRα through the
third retinoic acid response element
In order to study the involvement of nuclear retinoid receptors (RARs and RXRs) in
the RA induction of MAO B promoter, we cotransfected the MAO B 2-kb-luc construct
with the human RARα/RXRα expression constructs into BE(2)C cells, and treated cells
with RA (10 µM) for 24 h followed by luciferase activity determination. As shown in
Figure 15A, cotransfections of RARα alone, RXRα alone, and both receptors increased
MAO B promoter activity by 60, 50 and 370%, respectively (Figure 15A, compare lanes
3, 5 and 7 with lane 1). There was an additional increase up to 60-fold (lane 8) observed
in the presence of RARα/RXRα in response to RA, suggesting a mediation of this
activation via RARα and RXRα. Moreover, both RARα and RXRα are well expressed in
BE(2)C cells (Figure 15B, lane 1) with higher expression levels when transfected into
cells (Figure 15B, compare lane 3 with lane 1), which confirms the transfection
efficiency. However, the activation of RA receptors upon ligand binding did not increase
their expression levels in both endogenous and exogenous forms (Figure 15B, compare
lane 3 with lane 1, lane 4 with lane 2). To determine whether these receptors are
necessarily required for this activation, we also introduced siRNA to knock down the
endogenous RARα and RXRα in BE(2)C cells, and the knockdown efficiency was
confirmed by Western blot (Figure 15D). Knockdown of RARα, RXRα and both reduced
the RA activation of MAO B promoter by 74, 48 and 69%, respectively (Figure 15C,
compare lanes 2-4 with lane 1). The basal MAO B promoter activity was not affected by

48
the knockdown of these RA receptors (data not shown). In line with these observations,
the MAO B promoter activation by RA depends on RARα and RXRα.

49
FIGURE 15. Mediation of RA induction of MAO B promoter by RARα and RXRα.
(A) BE(2)C cells were transiently transfected with MAO B 2-kb-luc and human
RARα/RXRα expression constructs, and treated with RA (10 µM) for 24 h followed by
luciferase activity determination. (B) Western blot analysis of endogenous and
transfected RARα and RXRα protein expression levels in BE(2)C cells. β-Actin was used
as loading control. (C) MAO B 2-kb-luc was cotransfected with RARα siRNA or/and
RXRα siRNA into BE(2)C cells followed by 24-h RA (10 µM) treatment and luciferase
activity determination. Nonsense (NS) siRNA was used as control for siRNA
transfection. (D) Western blot analysis of siRNA-mediated knockdown of endogenous
RARα and RXRα in BE(2)C cells. Activity of MAO B 2-kb-luc transfected along without
RA treatment was set as 1 (A) or 100% (C). **, P<0.01.

50

51
We identified four putative RAREs in the MAO B 2-kb promoter, which all contain
consensus sequence of a 7-bp-spaced inverted repeat 5’-GGTAANNNNNNNTGACC-3’
(N is any nucleotide) (Figure 16A, top and middle boxes). To determine the functional
RARE for the RA activation of MAO B promoter, site-directed mutagenesis was
conducted to specifically mutate each RARE (Figure 16A, bottom box). Our results
showed that only mutation of the third RARE repressed the RA-induced MAO B
promoter activation by 50%, whereas mutations of RARE1, -2 and -4 had no effect
(Figure 16B). To study whether there is a direct binding of RARα and RXRα at the third
RARE, electrophoretic mobility shift analysis (EMSA) was conducted, using
radiolabeled RARE3 as the probe. One radioactive band, indicating a DNA-protein
complex, was shown on the gel after the BE(2)C cell nuclear extract was incubated with
the probe (Figure 16C, lane 2). This band was not observed in the presence of 500-fold
excess of unlabeled probes as competitor, indicating it is specific (Figure 16C, lane 3).
Furthermore, this band was shifted when anti-RARα, but not anti-RXRα, antibody was
incubated with nuclear extract in the DNA-protein binding reaction (Figure 16C, lanes 4
and 5).
To study whether this binding exists in vivo, we performed chromatin
immunoprecipitation (ChIP) assay coupled with PCR using primers specifically targeting
this region with BE(2)C cells. The association of endogenous RARα to the RARE3 was
demonstrated with anti-RARα antibody (Figure 16D, upper panel), suggesting that RARα
indeed interacts with the RARE3-containing region in natural MAO B promoter.
Similarly, the ectopically expressed RARα (with EGFP tag) was also associated with the

52
RARE3 (Figure 16D, lower panel). In addition, both associations turned to be stronger
upon 24-h RA (10 µM) treatment (Figure 16D, 2.34- and 2.93-fold increase for
endogenous and ectopically expressed RARα, respectively). Hence, these results
demonstrate that RARα is associated with the functional RARE3 both in vitro and in
vivo.

53
FIGURE 16. Identification and validation of an effective retinoic acid response
element in MAO B 2-kb promoter. (A) The canonical RARE, four potential RAREs as
identified in the MAO B 2-kb promoter with their specific locations upstream from the
first transcription-initiation site, and the introduced point mutation (in italic) used to
inactivated each RARE. (B) BE(2)C cells were transfected with wild-type (wt) or mutant
(with each RARE mutated separately, m1-4) MAO B 2-kb-luc, and treated with RA (10
µM) for 24 h followed by luciferase activity determination. (C) Electrophoretic mobility
shift analysis demonstrating the RARα binding to the RARE3 in vitro. Nuclear extract
from BE(2)C cells treated with RA (10 µM) for 48 h was incubated with radiolabeled
RARE3 probe (lanes 2-5). An excess of unlabeled probes as competitor (lane 3), anti-
RARα antibody (lane 4) or anti-RXRα antibody (lane 5) was added into the DNA-protein
binding reaction when required. Arrows showed free probes, RARα-DNA complex and
supershifted RARα-DNA complex conjugated with anti-RARα antibody. (D) ChIP assay
demonstrating the association of RARα with the RARE3 in vivo. BE(2)C cells were
treated with RA (10 µM) for 24 h followed by ChIP assay with anti-RARα antibody
targeting the endogenous RARα (upper panel). A separate ChIP assay was performed
with BE(2)C cells transiently transfected with EGFP-RARα followed by RA (10 µM)
treatment for 24 h, and anti-GFP antibody was used to target the transfected RARα
(lower panel). PCR was conducted with primers targeting the RARE3-containing region.
IgG was used as a negative control for IP. Genomic DNA (gDNA) isolated from BE(2)C
cells was used as the template as a positive control for PCR. Distilled H
2
O was used as
the template as a negative control (NTC) for PCR. The intensity of DNA bands was

54
quantified as indicated by Labworks analysis software. RA-fold activation of the wt MAO
B 2-kb-luc was set as 100%. Representative DNA gels are shown. **, P<0.01.

55
Characterization of Sp1-binding sites in the RA induction of MAO B promoter
There are two clusters of Sp1-binding sites in the MAO B 0.15-kb core promoter region
without overlapping with any RARE: two and three sites in the distal and proximal
cluster, respectively (Figure 17A). To study the involvement of Sp1 in the RA induction
of MAO B promoter, we mutated all five Sp1 sites (Figure 17A), and this mutation
resulted in a lower basal MAO B promoter activity as expected (Figure 17B, compare mut
with wt without RA treatment). We also cotransfected wild-type (wt) or mutant (mut)
MAO B 2-kb-luc with various amounts of Sp1 expression construct into BE(2)C cells, and
determined the luciferase activity after 24-h RA (10 µM) treatment. As shown in Figure
17B, MAO B promoter activity was activated by RA up to 50-fold in a Sp1-concentration-
dependent manner (lanes 1-3); however, there was only marginal activation observed
with mutations of all five Sp1 sites (lanes 4-6). The transfection efficiency of Sp1 was
confirmed by Western blotting analysis (Figure 17C). To determine the importance of
each Sp1 cluster, we generated three MAO B 0.15-kb-luc mutants containing Sp1 sites
only: m1 (with distal Sp1 sites mutated), m2 (with proximal Sp1 sites mutated) and m3
(with both sites mutated) (Figure 17D). Mutation of distal Sp1 sites repressed the RA
activation of MAO B promoter by 50% (Figure 17D, compare the fold activation of m1
with wt), whereas this activation was reduced to 30% with proximal Sp1 sites mutated
(Figure 17D, compare m2 with wt). Interestingly, mutation of both sites did not
completely abolish the promoter activation, and a 25% of increase was observed,
compared to the control of wt (Figure 17D, compare m3 with wt).

56
FIGURE 17. Mediation of RA induction of MAO B promoter by Sp1-binding sites.
(A) A schematic diagram showing four consensus RAREs and five Sp1-binding sites
within two clusters in the MAO B 2-kb promoter. Sequences of five Sp1 sites as indicated
within boxes are shown. Mutated nucleotides of each Sp1 site are shown in small letters.
(B) BE(2)C cells were transfected with wild-type (wt) or mutant (mut) MAO B 2-kb-luc
together with various amounts of Sp1 expression construct, and treated with RA (10 µM)
for 24 h followed by luciferase activity determination. (C) Western blot analysis of
endogenous and transfected Sp1 protein expression levels in BE(2)C cells. β-Actin was
used as loading control. (D) BE(2)C cells were transfected with wt or mutant (m1, with
distal Sp1 sites mutated; m2, with proximal Sp1 sites mutated; m3, with both sites
mutated) MAO B 0.15-kb-luc, and treated with RA (10 µM) for 24 h followed by
luciferase activity determination. Activity of the wt MAO B 2- or 0.15-kb-luc without RA
treatment was set as 1. *, P<0.05; **, P<0.01.

57

58
Further studies were subsequently carried out to determine the role of endogenous
Sp1 in the RA-mediated induction of MAO B promoter employing RNA interference
technology. As shown in Figure 18A, the introduction of Sp1 siRNA successfully
knocked down endogenous Sp1 in BE(2)C cells, and this Sp1 knockdown significantly
reduced the basal MAO B 2-kb promoter activity by 37% (Figure 18B, compare lane 3
with lane 1) in BE(2)C cells. However, the extent of MAO B promoter activation in
response to RA remained the same after Sp1 was knocked down (Figure 18B, 5.6-fold
increase with nonsense siRNA in lanes 1 and 2, and 5.7-fold increase with Sp1 siRNA in
lanes 3 and 4), suggesting that Sp1 is not essentially required for this activation. In
addition, we treated cells with mithramycin, a well-known specific inhibitor that
interferes with Sp1 binding to Sp1 sites, to further examine the role of Sp1 in the MAO B
promoter activation by RA. As shown in Figure 18C, the MAO B promoter was activated
in a RA-concentration-dependent manner in BE(2)C cells (upper curve), whereas
mithramycin treatment attenuated this activation (lower curve). Taken together, we
conclude that Sp1 enhances but is not essentially required for the MAO B promoter
activation by RA.

59
FIGURE 18. Down-regulation of RA induction of MAO B promoter by interference
of Sp1 binding. (A) Western blot analysis of the endogenous Sp1 protein expression
level after Sp1 was knocked down in BE(2)C cells by siRNA. BE(2)C cells were
transfected with either nonsense (NS) siRNA or Sp1 siRNA, 48 h after transfection, cells
were harvested for Western blot with anti-Sp1 antibody. β-Actin was used as loading
control. (B) BE(2)C cells were transfected with MAO B 2-kb-luc together with either
nonsense siRNA or Sp1 siRNA, and treated with RA (10 µM) for 24 h followed by
luciferase activity determination. (C) BE(2)C cells were transfected with MAO B 2-kb-
luc, and treated with RA at different concentrations in either the absence (upper curve) or
the presence (lower curve) of mithramycin (50 nM, PBS used as a vehicle) for 24 h
followed by luciferase activity determination. *, P<0.05; ** P<0.01.

60
As shown in Figure 17D, RA activated the activity of the MAO B 0.15-kb promoter
containing Sp1 sites only, suggesting a possible transactivaiton of the MAO B promoter
by RAR and RXR via a RARE-independent mechanism. To explore the possibility that
RAR and RXR activate the MAO B promoter through Sp1 sites, we transfected wild-type
(wt, 2 kb) and deletion (0.15 kb with Sp1 sites and the TATA box only, and 2 kb without
Sp1 sites) MAO B promoter-luc into cells (Figure 19A). As shown in Figure 19A, the
basal activities of deletion MAO B promoters with and without Sp1 sites were 230 and
37% of wt, respectively (Figure 19A, compare lanes 5 and 9 with lane 1), indicating a
necessary role of Sp1 sites in driving the MAO B promoter. Interestingly, the induction of
basal promoter activities of all three constructs was uniformly enhanced in the presence
of RARα and RXRα (Figure 19A, compare lanes 3, 7 and 11 with lanes 1, 5 and 9,
respectively), which suggests that RARα/RXRα-responsive elements may exist both
inside and outside Sp1 sites in the MAO B 2-kb promoter. As expected, these promoter
inductions were augmented in response to RA (Figure 19A, lanes 4, 8 and 12). The
strongest induction of the MAO B promoter by RARα and RXRα was observed when the
MAO B 0.15-kb-luc with Sp1 sites only was transfected (Figure 19A, lanes 7 without RA,
and lane 8 with RA), which implies a possibly direct or indirect interaction of RARα and
RXRα with the Sp1 sites. Moreover, RARα and RXRα significantly activated a promoter
reporter construct driven by three tandem Sp1 sites only, and this activation turned to be
higher upon RA treatment (Figure 19B), which also suggests a possible interaction of
RARα and RXRα with the Sp1 sites in the MAO B promoter via a direct or indirect way.
In addition, we also examined the combining effect of the RARE3 and Sp1 sites on the

61
MAO B promoter activation by RA. We transfected various MAO B 2-kb-luc constructs
including wt and mutants (with RARE3 mutated, with Sp1 sites mutated and with both
sites mutated) into cells. As shown in Figure 19C, mutation of either site dramatically
repressed the MAO B promoter activation by RA, and more repression was observed
when the Sp1 sites were mutated (compare lanes 3 and 2 with lane 1), suggesting an
involvement of both the RARE3 and Sp1 sites in this activation with Sp1 sites more
potent.

62
FIGURE 19. MAO B promoter activation by RA via both Sp1 sites and the third
retinoic acid response element. (A) Transient transfection and luciferase assays
demonstrating the effect of RARα and RXRα on MAO B promoter activity with various
deletion promoter reporter construct used in BE(2)C cells. Wild-type (wt, 2 kb) or
deletion (0.15 kb with Sp1 sites and TATA box only, or 2 kb without Sp1 sites) MAO B
promoter-luc was cotransfected with RARα/RXRα expression constructs into BE(2)C
cells. Cells were treated with RA (10 µM) for 24 h followed by luciferase activity
determination. (B) Luciferase reporter construct containing three tandem Sp1 sites only
was cotransfected with RARα/RXRα into BE(2)C cells followed by 24 -h RA (10 µM)
treatment and luciferase activity determination. Promoterless pGL2-Basic luciferase
reporter construct was used as a negative control. (C) BE(2)C cells were transfected with
wt (lane 1) or mutant MAO B 2-kb-luc (lane 2 with RARE3 mutated, lane 3 with Sp1
sites mutated or lane 4 with both sites mutated), and treated with RA (10 µM) for 24 h
followed by luciferase activity determination. Activity of the wt MAO B 2-kb-luc without
cotransfection of RARα/RXRα and RA treatment was set as 1.

63

64
Crosstalk between RARα and Sp1 in RA induction of MAO B promoter
In light of the distinct nucleotide composition of Sp1 sites (Li et al., 2004; Suske,
1999) and RAREs (Bastien and Rochette-Egly, 2004), we hypothesized an indirect
interaction of RARα/RXRα with Sp1 sites via the association with Sp1. To explore this
possibility, we incubated equal amounts of Sp1 protein with RARα or RXRα protein
(Figure 20A, lanes 3 and 4) followed by co-immunoprecipitation (co-IP) assay (with anti-
RARα or anti-RXRα antibody) and Western blot (with anti-Sp1 antibody). Incubations of
Sp1 protein with either anti-RARα or anti-RXRα antibody served as a negative control
for IP (Figure 20A, lanes 6 and 7). As revealed in Figure 17A, RARα physically interacts
with Sp1 (compare lane 4 with lane 6); however, there was no association between
RXRα and Sp1 observed (compare lane 5 with lane 7). Pure RARα and RXRα proteins
used as input in the co-IP assay, were also analyzed by Western blotting with anti-RARα
and anti-RXRα antibodies, respectively (Figure 20A, lanes 8 and 9).
To determine which region in Sp1 is necessarily responsible for RARα binding, we
incubated in vitro translated RARα with various in vitro translated wt/truncated HA-
tagged Sp1 in equal amounts followed by co-IP assay (with anti-RARα antibody) and
Western blotting (with anti-HA antibody) (Figure 20B). As shown in Figure 20B, RARα
retained HA-Sp1 (1-668) and HA-Sp1 (622-788) but not HA-Sp1 (1-293), HA-Sp1 (1-
621) and HA-Sp1 (1-648). The incubation of RARα with full-length HA-Sp1 (1-788) was
used as a positive control. Prior to co-IP assay, 20% input fraction was analyzed by
Western blotting (with anti-HA and anti-RARα antibody) (Figure 20C). In summary, the
amino acids 622-668 in Sp1 are sufficient for RARα binding, which contains the first and

65
partial of the second zinc finger domains (Figure 20D); and this interaction may
contribute to the transactivation of MAO B promoter by RARα and Sp1 via Sp1 sites.

66
FIGURE 20. Interaction of RARα with Sp1 in vitro. (A) RARα but not RXRα interacts
with Sp1. 200 ng of human recombinant Sp1 protein was incubated with either 200 ng of
GST-RARα protein or 200 ng of GST-RXRα protein in 50 µl of PBS on ice for 2 h
followed by immunoprecipitation with rabbit polyclonal anti-RARα antibody (lane 4) or
rabbit polyclonal anti-RXRα antibody (lane 5) at 4
o
C overnight. With the addition of
Protein A beads, samples were incubated at 4
o
C for another 2 h. After extensive washes,
beads were boiled in 2X SDS sample buffer for 5 min followed by Western blot with
mouse monoclonal anti-Sp1 antibody. Incubations of Sp1 protein with anti-RARα
antibody (lane 6) or anti-RXRα antibody (lane 7) only were used as a negative control for
IP. Pure GST-RARα and GST-RXRα proteins as input used in co-IP assay was verified
by Western blot with anti-RARα (lane 8) and anti-RXRα (lane 9) antibody, respectively.
All inputs shown were 100% input. (B) Both in vitro translated RARα (10 µl) and
wt/truncated HA-tagged Sp1 (10 µl) proteins were incubated in TNE buffer on ice for 3 h
followed by immunoprecipitation with rabbit polyclonal anti-RARα antibody at 4
o
C for
4 h and incubation with Protein A beads at 4
o
C for another 1 h. Interactions of RARα
with various wt/truncated Sp1 were analyzed by Western blot with mouse monoclonal
anti-HA antibody and TrueBlot HRP anti-mouse IgG (secondary antibody). The
incubation of in vitro translated wt HA-Sp1 with anti-RARα antibody only was used as a
negative control (NTC) for IP. (C) Western blot analysis of 20% input fraction used in co-
IP assay (B) with anti-HA and anti-RARα antibodies. (D) A schematic representation of
wt/truncated HA-tagged Sp1 protein structures and their respective RARα-binding
abilities.

67

68
To determine whether RARα is associated with Sp1 sites in the natural MAO B
promoter, we performed ChIP assays with BE(2)C cells, coupled with PCR using primers
specifically targeting the Sp1-binding region, and Sp1 occupancy in this region was
examined as a positive control. As shown in Figure 21A, the region encompassing Sp1
sites was prominently amplified from both anti-RARα (upper panel) and anti-Sp1 (lower
panel) immunoprecipitates, suggesting associations of both RARα and Sp1 with Sp1 sites
in vivo. Moreover, these associations turned to be stronger upon 48-h RA (10 µM)
treatment (Figure 21A, 3.48- and 2.47-fold increase for RARα and Sp1, respectively).
To determine the possibly simultaneous presence of RARα and Sp1 at Sp1 sites, we
conducted ChIP assay with BE(2)C cells using anti-Sp1 antibody followed by a re-ChIP
assay with anti-Sp1 immunoprecipitates using anti-RARα antibody. As shown in Figure
21B, RARα was detected in the anti-Sp1 immunoprecipitates, indicating a formation of
RARα-Sp1 complex at the Sp1 sites of natural MAO B promoter. Higher occupancy of
RARα-Sp1 complex at Sp1 sites upon 48-h RA (10 µM) treatment was also observed
(Figure 21B, 1.86- and 2.54-fold increase for Sp1 and RARα, respectively).
We further studied the possible recruitment of RARα to Sp1 sites in the MAO B
promoter by Sp1 employing ChIP/re-ChIP assays coupled with RNA interference
approach in BE(2)C cells. We introduced Sp1 siRNA to knock down endogenous Sp1 in
BE(2)C cells followed by 24-h treatment with or without RA (10 µM). As expected, this
Sp1 knockdown dramatically attenuated the association of Sp1 with Sp1 sites by 79 and
68% in the absence and presence of RA, respectively (Figure 21C, top panel). Re-ChIP
assay was subsequently conducted with the anti-Sp1 immunoprecipitates using anti-

69
RARα antibody. As a consequence of Sp1 knockdown, less RARα in the anti-Sp1
immunoprecipitates was shown to be associated with Sp1 sites, with a reduction of 95
and 87% in the absence and presence of RA, respectively (Figure 21C, middle panel).
Lower RARα occupancy at Sp1 sites was also observed after the endogenous Sp1 was
knocked down, with a respective decrease of 90 and 77% in control and treated cells,
employing a ChIP assay directly using anti-RARα antibody (Figure 21C, bottom panel).
Taken together, these in vivo studies demonstrate that RARα is recruited by Sp1 and
forms a complex with Sp1 at the Sp1 sites to modulate the MAO B transcription in
response to RA.

70
FIGURE 21. Crosstalk between RARα and Sp1 in MAO B core promoter in vivo. (A)
ChIP assay demonstrating the association of both RARα and Sp1 with the Sp1 sites of
natural MAO B promoter. BE(2)C cells treated with or without RA (10 µM) for 48 h were
used for ChIP assays with anti-RARα or anti-Sp1 antibody. (B) ChIP/re-ChIP assays
demonstrating the simultaneous presence of Sp1 and RARα at the Sp1 sites of natural
MAO B promoter. BE(2)C cells treated with or without RA (10 µM) for 48 h were used
for ChIP assay with anti-Sp1 antibody. The remaining proteins bound within beads in the
anti-Sp1 immunoprecipitates were recovered in DTT buffer at 37
o
C for 30 min twice,
and subjected to the second ChIP assay (re-ChIP) with anti-RARα antibody. (C) ChIP/re-
ChIP assays demonstrating the recruitment of RARα to Sp1 sites in the MAO B promoter
by Sp1 in vivo. BE(2)C cells were introduced with Sp1 siRNA, after 24 h, cells were
treated with or without RA (10 µM) for another 24 h. ChIP/re-ChIP assays were
performed with anti-Sp1 and anti-RARα antibodies sequentially used as descried above
(top and middle panels). A separate ChIP assay with anti-RARα antibody directly used
was performed as well (bottom panel). IgG was used as a negative control for IP in all
ChIP/re-ChIP assays. All PCR experiments were performed with primers targeting the
Sp1-binding region in the MAO B promoter. Distilled H
2
O was used as the template as a
negative control (NTC) for PCR. The intensity of DNA bands was quantified as indicated
by Labworks analysis software.

71

72
MAO A gene up-regulation by RA in human neuroblastoma BE(2)C cells
We also examined the RA effect on MAO A gene expression in BE(2)C cells. To
determine the effect of RA on MAO A catalytic activity, BE(2)C cells were treated with
10 µM RA for 48 h. As shown in Figure 22A, MAO A catalytic activity significantly
increased by 53% upon RA treatment. To examine whether this stimulating effect is also
mediated at the transcriptional level, we transfected MAO A 2-kb-promoter luciferase
reporter construct (MAO A 2-kb luc) into BE(2)C cells followed by RA treatment at
various concentrations for 24 h. As shown in Figure 22B, RA activated MAO A promoter
activity by 1.2-, 1.7- and 2.4-fold at 10
-7
, 10
-6
and 10
-5
M, respectively. Taken together,
these results demonstrate that RA activates both MAO A catalytic and promoter activities
in BE(2)C cells.

73
FIGURE 22. MAO A gene up-regulation by RA in BE(2)C cells. (A) Effect of RA on
MAO A catalytic activity. BE(2)C cells were treated with RA (10 µM) for 48 h followed
by MAO A catalytic activity determination. Activity of MAO A without RA treatment
was set as 100%. (B) Effect of RA on MAO A promoter activity. MAO A 2-kb-luc was
transfected into BE(2)C cells; 24 h after transfection, cells were treated with RA at
various concentrations for another 24 h followed by luciferase activity determination.
Acitivity of MAO A 2kb-luc without RA treatment was set as 1. (C) Effect of RA on
MAO A mRNA expression. BE(2)C cells were treated with RA (10 µM, DMSO used as a
vehicle) for different time. Cells treated with nothing were used as control. MAO A
mRNA level was determined by microarray analysis. MAO A mRNA level as compared
to control was set as 1. *, P<0.05; **, P<0.01.

74
Identification of co-regulated genes with MAO A by microarray analysis
Designed to elucidate co-regulated genes that may contribute to the identification of
potential regulators for the RA induction of MAO A gene, a microarray analysis was
conducted with BE(2)C cells treated with 10
-5
M RA for 3 h, 6 h (short term), 24 h and
48 h (long term). Complementary RNA prepared from the BE(2)C cells was hybridized
to human gene chips, and signals were analyzed using commercial software. Consistent
with the RA induction of MAO A promoter, as revealed from microarray data, MAO A
mRNA gradually increased by up to 2.5-fold with significance after 48-h RA treatment
(Figure 22C).
In response to RA signaling, of 36, 968 spots, 6, 776 showed either over 1-fold up-
regulation or <50% of down-regulation with significance, at least, at one of the four time
points. These genes were further clustered by gCLUTO clustering program (totally 60
clusters) on the basis of their temporal expression patterns (Figures 23A and B), and 27
genes ultimately showed similar pattern with MAO A upon RA treatment (Table 2). For
further analysis, we plotted the dynamic expression profiles of these co-regulated genes
with MAO A, which showed a high similarity in change tendency within the time course
(Figure 23C), and categorized them according to the predicted or established functions of
translated products acquired from Gene Ontology database. Interestingly, 64% of these
genes including MAO A are involved in cell metabolism, suggesting a potential role of
RA in maintaining the normal metabolic level in cells.

75
FIGURE 23. Identification and characterization of co-regulated genes with MAO A
by microarray study. (A, B) Clustering of co-regulated genes with similar temporal
expression patterns to MAO A in response to RA. Matrix visualization (A) of clustered
RA-responsive genes obtained from microarray on the basis of their temporal expression
patterns and clustered by gCLUTO software. There are totally 60 clusters, and 27 genes
showed similar patterns to MAO A. Mountain visualization (B) of gene clusters with
MAO A in cluster 6 (arrow in white). (C) Dynamic expression profiles of 27 co-regulated
genes with MAO A. (D) Categorization of these genes according to the predicted or
established functions of translated products acquired from Gene Ontology database.

76

!
77

TABLE 2. Summary of co-regulated genes with MAO A in BE(2)C cells treated with RA.

78
DISCUSSION
We provide evidence for the first time showing that RA activates MAO B promoter
activity and mRNA expression in human neuroblastoma cells. RA activates MAO B
transcription through RARα/RXRα via a functional RARE in the MAO B promoter
(Figures 15 and 16). RARα but not RXRα specifically binds to this RARE under both in
vitro and in vivo conditions (Figure 16). In the absence of RXRα, RARα may work with
other RXR isotypes and function as heterodimers at this RARE. This functional RARE
has been found to overlap with the fourth estrogen response element in the MAO B 2-kb
promoter (Zhang et al., 2006). A previous report showed that estrogen receptors (ERs)
compete with estrogen-related receptors at estrogen response element sites, although ERs
alone have no impact on the MAO B promoter (Zhang et al., 2006). Retinoids and
estrogens play similar roles in many biological processes such as vertebrate early
development and reproduction, which are mediated through their respective nuclear
receptors (Bastien and Rochette-Egly, 2004; van der Burg et al., 1999). In light of the
sequence identity shared by ER and RAR response elements, transcriptional crosstalk
between ER- and RAR-mediated pathways may provide clues for their similar functions
in certain biological processes.
We demonstrate that Sp1 enhances, but is not essentially required for, the RA
activation of MAO B promoter (Figures 17 and 18). Sp1 is a ubiquitous transcription
factor in mammals, in particular a key activator of MAO B, which directly binds to GC-
rich boxes in the promoter for maintaining the basal MAO B promoter activity (Desai-
Yajnik and Samuels, 1993; Li et al., 2004; Wong et al., 2001). Previous study showed

79
that Sp1 is RA-inducible and up-regulates downstream target genes, such as the cAMP
response-element binding protein in human tracheobronchial epithelial cells (Hong et al.,
2008), whereas Sp1 expression is not affected by RA in BE(2)C cells in the present study
(Figure 17C), which reflects this induction in a cell-specific manner. However, the
binding ability of Sp1 to Sp1 sites in the MAO B promoter is significantly enhanced in
response to RA (Figure 21A).
Recent studies have shown that RA receptors interact with other transcription factors
to mediate the transcription of target genes, and this crosstalk between nuclear receptors
and transcription factors is an important gene regulatory mechanism (Huggenvik et al.,
1993; Subramaniam et al., 2003; Yen et al., 1998). For example, RARα functionally
interacts with Sp1 to activate the transcription of interleukin-1β (Husmann et al., 2000)
and 17β-hydroxysteroid dehydrogenase type 2 (Cheng et al., 2008). Consistent with these
findings, we demonstrate that RARα physically interacts with Sp1 via zinc finger
domains in Sp1 (Figure 20). This interaction, to some extent, enhances the Sp1-binding
ability as suggested in previous studies (Cases et al., 1995; Suzuki et al., 1999; van
Wageningen et al., 2008). Mouse RXRα was reported to interact with human Sp1 as well,
whereas there is no obvious interaction observed between human RXRα and Sp1 in the
present study (Figure 20A), despite highly conserved sequence identity of human and
mouse RXRα. Moreover, RARα/RXRα are implicated to interact with Sp1 sites in the
MAO B promoter, as they significantly activate MAO B promoter activity when a
promoter deletion construct containing GC-rich sites only was used (Figure 19A). In
addition, RARα/RXRα also activate 3X Sp1-binding site-luc solely via Sp1 sites out of

80
the MAO B promoter context (Figure 19B), which further implies a possible interaction of
RA receptors with Sp1 sites. Previous studies have shown that RARα could not directly
bind to Sp1 sites by itself in both the absence (Desai-Yajnik and Samuels, 1993) and
presence (Suzuki et al., 1999) of Sp1 in vitro, to a large degree, due to the contrasting
nucleotide composition of RARE and Sp1 sites (GC-rich). However, here we show that
RARα is associated with the Sp1 sites in MAO B promoter in vivo (Figure 21A), which
was also observed in the regulation of the folate receptor type β promoter (Hao et al.,
2003). Furthermore, we raise and demonstrate the possibility that RARα is indirectly
associated with Sp1 sites in which RARα recruited by Sp1 interacts and forms a complex
with Sp1 at Sp1 sites in native chromatin to modulate MAO B transcription (Figures 20A,
21B and 21C).
In addition to BE(2)C cells, we also examined the stimulating effect of RA on the
MAO B promoter in another two human neuronal cell lines, the human glioblastoma
1242-MG and neuroblastoma SH-SY5Y cells. Both cell lines support the RA activation
of MAO B promoter by 50 and 70% with significance in 1242-MG and SH-SY5Y cells,
respectively, although not as robust as in BE(2)C cells (Figure 24A). With a further
dissection of the expression levels of RA receptors in all three neuronal cell lines, we
reveal that both RARα and RXRα are present in these cells with different expression
levels (Figure 24B). Both 1242-MG and SH-SY5Y cells express much lower levels of
RARα than BE(2)C cells, and SH-SY5Y cells express more RXRα than the other two cell
lines. These differences may partially explain the different MAO B promoter activation
by RA among three cell lines, in which RARα is suggested as an important mediator.

81
FIGURE 24. Comparison of RARα and RXRα expression levels and its consequences
in RA induction of MAO B promoter in three human neuronal cell lines. (A) MAO B
2-kb-luc was transfected into human neuroblastoma BE(2)C and SH-SY5Y, and human
glioblastoma 1242-MG cells, respectively; 24 h after transfection, cells were treated with
RA (10 µM) for another 24 h followed by luciferase activity determination. Activity of
MAO B 2-kb-luc without RA treatment was set as 1. (B) Western blot analysis of
endogenous RARα and RXRα expression levels in BE(2)C, 1242-MG and SH-SY5Y
cells. β-Actin was used as loading control. **, P<0.01

82
One possible mechanism by which RA activates MAO B transcription is through
epigenetic regulation of the MAO B promoter. There is a CpG island containing multiple
CpG methylation sites in the MAO B core promoter region, and MAO B gene expression
is up-regulated by DNA methylation inhibitors such as 5-aza-2’-deoxycytidine (Wong et
al., 2003). Emerging evidence has recently suggested that RA treatment induces
epigenetic modifications at its target loci and restores epigenetically silent genes to a
transcriptionally active state by triggering DNA demethylation and histone acetylation at
the promoter level (Ekici et al., 2008; Fazi et al., 2005; Ren et al., 2005). Because the
CpG island in the MAO B promoter encompasses several Sp1 sites (Wong et al., 2003),
we speculate that the RA activation of MAO B promoter is also correlated with RA-
induced epigenetic alterations. As a consequence of reducing DNA methylation and
decompacted chromatin structure, transcription factors are recruited to this region and
activate the MAO B promoter. This is consistent with the observation of higher Sp1
occupancy at the Sp1 sites of natural MAO B promoter in response to RA (Figure 21A).

83
Chapter V
Materials and Methods

Cell Lines and Reagents − The human nuroblastoma BE(2)C cell line was purchased
from the American Type Culture Collection (ATCC, Manassas, VA, USA). BE(2)C cells
were grown in a medium containing a 1:1 mixture of Eagle’s minimum essential medium
with Earle’s balanced salt solution (MEM) and Ham’s F-12 medium supplemented with
10% fetal bovine serum (FBS), 1 mM sodium pyruvate, 0.05 mM non-essential amino
acids, 100 units/ml penicillin and 100 µg/ml streptomycin. The human hepatoma HepG2
cell line was purchased from ATCC and grown in MEM supplemented with 10% FBS, 2
mM L-glutamine, 100 units/ml penicillin and 100 µg/ml streptomycin. The human
neuroblastoma SH-SY5Y cell line was purchased from ATCC. The human glioblastoma
1242-MG cell line was a gift from Dr. B. Westermark (Department of Pathology,
University of Hospital, Uppsala, Sweden). SH-SY5Y and 1242-MG cells were grown in
Dulbecco’s modification of Eagle’s medium (DMEM) supplemented with 10% FBS, 1
mM sodium pyruvate, 100 units/ml penicillin and 100 µg/ml streptomycin. All culture
materials were purchased from Mediatech (Manassas, VA, USA). Pten-knockout and
parental control mouse hepatocytes were a gift from Dr. Bangyan L. Stiles (Department
of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of
Southern California, Ca, USA), and grown in DMEM supplemented with 10% FBS, 100
units/ml penicillin, insulin and growth factors.

84
All-trans retinoic acid, mithramycin and t-butyl hydroquinone were purchased from
Sigma-Aldrich (St. Louis, MO, USA). LY 492002 was purchased from Cell Signaling
(Danvers, MA, USA). Monoclonal anti-RXRα (sc-46659), anti-Sp1 (sc-17824), anti-β-
actin (sc-47778), anti-GST (sc-138), anti-SRY (sc-69842), anti-cyclin D1 (A-12),
polyclonal anti-RARα (sc-773), anti-RARα (sc-551), anti-RXRα (sc-774) and anti-GFP
(sc-8334) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA,
USA). Monoclonal anti-HA (H3663) and anti-FLAG (F1804) antibodies were purchased
from Sigma-Aldrich. Polyclonal anti-Sp1 antibody (A300-133A) was purchased from
Bethyl Laboratories (Montgomery, TX, USA). Rabbit monoclonal anti-phospho-Akt
(Thr308) (2965) and anti-Akt (4691) antibodies were purchased from Cell Signaling.
Monoclonal anti-cyclin E (32-1600) and anti-COX IV (A21347) antibodies were
purchased from Invitrogen (Carlsbad, CA, USA). Rabbit polyclonal anti-MAO B
antibody was made in house. Mouse TrueBlot
TM
horseradish peroxidase (HRP) anti-
mouse IgG (13-8817) was purchased from eBioscience (San Diego, CA, USA). Human
SRY siRNA (sc-38443) and cyclin D1 siRNA (sc-29286) were purchased from Santa
Cruz Biotechnology. Human recombinant Sp1 protein was purchased from Promega
(Madison, WI, USA).

Plasmids − MAO A 2-, 1.6-, 1.3-, 0.3-, 0.24- and deleted 2-kb (without Sp1 sites)
promoter-luciferase (firefly) reporter constructs, and MAO B 2-, 0.15-, deleted 2-
(without Sp1 sites) and mutated 2- and 0.15-kb (with Sp1 sites mutated) promoter-luc
were generated as described previously (Chen et al., 2005; Ou et al., 2004, 2006a; Wong

85
et al., 2001, 2003). Human Sp1 expression construct was obtained as described
previously (Wong et al., 2001, 2003). Human RARα and RXRα expression constructs
were a gift from Dr. Henry M. Sucov (Department of Biochemistry and Molecular
biology, Keck School of Medicine, University of Southern California, Los Angeles, CA,
USA). GST-RARα expression construct was generated by inserting human RARα coding
region at BamHI/EcoRI sites of pGEX-2T vector, a gift from Dr. Ron T. Hay (Center for
Biomolecular Sciences, University of St. Andrews, St. Andrews, UK). GST-RXRα
expression construct was generated by inserting human RXRα coding region at
EcoRI/NotI sites of pGEX-4T1 vector (GE Healthcare, Piscataway, NJ, USA). EGFP-
RARα expression construct was generated by inserting human RARα coding region at
BamHI/BglII sites of pEGFP-C1 vector (Clontech, Mountain View, CA, USA). The 3X
Sp1-binding sites luciferase reporter construct was a gift from Dr. Harry P. Elsholtz
(Department of Laboratory Medicine and Pathobiology, Banting and Best Diabetes
Center, University of Toronto, Toronto, Ontario, Canada) (Lew et al., 1994). Wild-type
and truncated forms of HA-Sp1 expression constructs were a gift from Dr. Hans
Rotheneder (Department of Medical Biochemistry and Molecular Biology, Medical
University of Vienna, Vienna Austria) (Rotheneder et al., 1999). FLAG-SRY expression
construct was obtained from Dr. Chris Y-F. Lau (Department of Medicine, University of
California, San Francisco, San Francisco, CA, USA) (Oh et al., 2005). FLAG-SRY
expression construct carrying the neomycin-resistant gene was generated by inserting
SRY coding region at BglII/EcoRI sites of p3XFLAG-Myc-CMV-26 vector (Sigma-
Aldrich). Human cyclin D1-HA (T286A) expression construct was a gift from Dr. Bruce

86
R. Zetter (Department of Cell Biology and Surgery, Children’s Hospital, Harvard
Medical School, MA, USA) (Newman et al., 2004).

Stable Cell Line Establishment − FLAG-SRY expression construct or pCMV empty
vector carrying the neomycin-resistant gene was transfected into BE(2)C cells. After 24 h,
750 µg/ml of geneticin (G418) was added to the transfected cells. Resistant clones were
isolated after 14 days and cultured under G418 selection and maintained continuously
with 200 µg/ml of the selective agent.

Transient Transfection and Luciferase Reporter Assay − Transfections were
performed using Lipofectamine
TM
2000 (Invitrogen) transfecion reagent following the
manufacturer’s instructions. pRL-TK (expressing Renilla luciferase) was cotransfected as
an internal control (Promega). pcDNA was added to maintain an equivalent amount of
DNA in each transfection. After 24-48-h incubation, cells were harvested and assayed for
luciferase activity using the Dual-Luciferase Reporter 1000 Assay System (Promega).

RNA Isolation and Quantitative Real-time RT-PCR − Total DNA-free RNA was
purified with the RNeasy Mini Kit (Qiagen, Valencia, CA, USA), following the
manufacturer’s instructions. Two micrograms of total RNA was used for reverse
transcription by M-MLV reverse transcriptase (Promega), following the manufacturer’s
instructions. The RT products were used as the template for quantitative real-time PCR.
Quantitation of the PCR products was determined by SYBR Green reagent (Maxima

87
SYBR Green qPCR Master Mix 2X; Fermentas, Glen Burnie, MD, USA) using the
iCycler optical system (Bio-Rad, Hercules, CA, USA). The primers for MAO A were
forward 5’-CTGATCGACTTGCTAAGCTAC-3’ and reverse 5’-
ATGCACTGGATGTAAAGCTTC-3’ (fragment length, 102 bp). The primers for MAO
B were forward 5’-GCTCTCTGGTTCCTGTGGTATGTG-3’ and reverse 5’-
TCCGCTCACTCACTTGACCAGATC-3’ (fragment length, 118 bp). The primers for
GAPDH were forward 5’-GACAACAGCCTCAAGATCATCAG-3’ and reverse 5’-
ATGGCATGGACTGTGGTCATGAG-3’ (fragment length, 122 bp) (Jiang et al., 2006).
PCR conditions included an initial denaturation step of 3 min at 95
o
C, followed by 40
cycles of PCR consisting of 30 s at 94
o
C, 30 s at 60
o
C and 30 s at 72
o
C. The PCR data
were analyzed by 2
-ΔΔCT
method (Livak and Schmittgen, 2001).

Western Blotting Analysis − One hundred micrograms of total proteins from cells
lysed in radioimmune precipitation assay buffer (50 mM Tris-HCl, pH 8.0, 150 mM
sodium chloride, 1% Nonidet P-40, 0.5% sodium deoxycholate and 0.1% SDS)
supplemented with various 1X protease inhibitors and 1X phosphotase inhibitors (when
required) were separated by 8-12% SDS-PAGE and transferred to the nitrocellulose
membrane. After the transfer, the membrane was blocked at room temperature for 1 h
with 2% bovine serum albumin in PBST (10 mM sodium phosphate, pH 7.2, 150 mM
sodium chloride and 0.05% Tween 20). The membrane was incubated with primary
antibody in 1% bovine serum albumin in PBST at room temperature for 2 h or at 4
o
C
overnight. After incubating the membrane with HRP-conjugated secondary antibody

88
against appropriate species at room temperature for 1 h, bands were visualized with the
ECL Western Blotting Substrates (Pierce, Rockford, IL, USA).

Site-directed Mutagenesis − Site-directed mutagenesis was used to mutate each
putative retinoic acid response element as identified in MAO B 2-kb promoter, the
putative SRY-binding site as identified in MAO A 0.24-kb promoter. Wild-type MAO B
2-kb-luc and MAO A 0.24-kb-luc constructs were used as the template. Mutagenesis was
carried out using QuickChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla,
CA, USA) following the manufacturer’s instructions. The primers used for mutagenesis
(mutated nucleotides underlined) were as follows: 5’-GCTAGTACAGAATACCTAAG-
GGGTTTAATTTACATTGAAGAGAAA-3’ (m1), 5’-CGTTCCACATTTAACTTGGC-
TTGCTGC-3’ (m2), 5’-CTCTTTGAAGTCCTAAATGACCTCTCC-3’ (m3), 5’-GGGC-
TCCCGGGGCTTTTAATATAGCGGCTC-3’ (m4), 5’-GGCTCCCCCCGGGTACCCT-
GAGAAGGATCGGCTCC-3’ (SRY-binding site). Mutated nucleotides were verified by
DNA sequencing.

MAO Catalytic Activity Assay − One hundred micrograms of total proteins (~1X10
6

cells) were incubated with 1 mM
14
C-5-HT (MAO A) or 100 µM
14
C-PEA (MAO B) in
the assay buffer (50 mM sodium phosphate buffer, pH 7.4) at 37
o
C for 20 min, and the
reaction was terminated by the addition of 100 µl of 6 N HCl. The reaction products were
extracted with benzene/ethyl acetate (MAO A) or toluene (MAO B) and centrifuged at 4

89
o
C for 7 min. The organic phase containing the reaction products was extracted, and the
radioactivity was determined by liquid scintillation spectroscopy.

siRNA Interference − siRNA was introduced into cells with Lipofectamine
TM
2000
(Invitrogen) following the manufacturer’s instructions. The sequence to silence the
translation of Sp1, RARα or RXRα was 5’-GGUAGCUCUAAGUUUUGAUUU-3’ (sense)
(Jungert et al., 2007), 5’-GGUAUUAAUUCUCGCUGGUUU-3’ (sense) (Cheng et al.,
2008) and 5’-AAGCACUAUGGAGUGUACAUU-3’ (sense) (Cao et al., 2004),
respectively. A nonsilencing RNA with sense strand as 5’-
UUCUCCGAACGUGUCACGUUU’-3 was used as control (Salahpour et al., 2007).

In vitro Translation − In vitro translation was conducted with TNT Coupled
Reticulocyte Lysate System (Promega) following the manufacturer’s instructions. All
plasmids used as the DNA template carry T7 promoter. All in vitro translated products
were verified by Western blot.

Nuclear Protein Extraction and Electrophoretic Mobility Shift Analysis − BE(2)C
cells treated with 10 µM RA (DMSO used as a vehicle) for 48 h were washed with cold
PBS and harvested by scraping. The cell pellet was resuspended in a 5-pellet volume of
buffer A (10 mM KCl, 20 mM HEPES, 1 mM MgCl
2
, 0.5 mM DTT and 0.5 mM
phenylmethylsulfonyl fluoride), incubated on ice for 10 min, and centrifuged at 4
o
C for
10 min. The pellet was then resuspended in buffer B (10 mM HEPES, 400 mM NaCl, 0.1

90
mM EDTA, 1 mM MgCl
2
, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride and 15%
glycerol) and incubated on ice for 30 min with gentle shaking. Nuclear proteins were
centrifuged at 4
o
C for 30 min, dialyzed at 4
o
C for 4 h against 1 liter of buffer D (20 mM
HEPES, 200 mM KCl, 1mM MgCl
2
, 0.1 mM EDTA, 1 mM DTT, 0.5 mM
phenylmethylsulfonyl fluoride and 15% glycerol), and cleared by centrifugation at 4
o
C
for 15 min. Protein concentration was determined by BCA
TM
Protein Assay Kit (Pierce).
The RARE3 oligonucleotide (5’-GGTTTGAAGTCCTAGGTGACCTCT-3’, RARE3
underlined) was used as the probe and radioactively labeled by Klenow fill-in reaction. A
32
P-labeled probe was purified using the Nucleotide Removal Kit (Qiagen). For
determining the DNA-protein binding, 15 µg of nuclear extract were diluted in 1X
binding buffer [40 mM HEPES, pH 8.0, 50 mM KCl, 1 mM DTT, 0.1 mM EDTA, 10%
glycerol and 10 µg/ml of poly(dI-dC)] in a total volume of 20 µl. Excess unlabeled
probes (competitor) and 2 µg of anti-RARα or anti-RXRα antibody were added when
required, and the mixture was incubated at room temperature for 20 min. The
32
P-labeled
probe (~600, 000 cpm) was then added, and the mixture was incubated at room
temperature for another 20 min.
MAO A 0.24-kb promoter-derived oligonucleotide with wild-type SRY-binding site
was used as a probe and radioactively labeled by Klenow fill-in reaction.
32
P-labeled
probes were purified using Nucleotide Removal Kit. For determining the DNA-protein
binding, 2 µl of in vitro translated SRY was diluted with 5X binding buffer [20% glycerol,
5 mM MgCl
2
, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl, pH 7.5
and 0.25 mg/ml poly(dI-dC)] in a total volume of 20 µl. 100-fold excess unlabeled probes

91
(competitor) were added and the mixture was incubated at room temperature for 20 min.
32
P-labeled probe (~600, 000 cpm) was then added, and the mixture was incubated at
room temperature for another 20 min. Samples were analyzed on 5% non-denaturing
polyacrylamide gel in 1X Tris borate/EDTA buffer at 150 V at room temperature for 3 h.
Gel was dried and visualized by autoradiography.

Purification of Human RARα and RXRα − GST-RARα or GST-RXRα expression
construct was transformed into Escherichia coli BL21-competent cells (Sigma-Aldrich)
separately. Bacteria were cultured in LB supplemented with 100 µg/ml ampicillin at 37
o
C followed by isopropyl β-D-thiogalactopyranoside induction (0.4 mM) when A
600
was
above 0.6. Induction was performed at room temperature overnight with gentle shaking,
and bacteria were collected when the A
600
was above 2.0. Induction results were verified
by Coomassie Blue staining and Western blot with anti-GST, anti-RARα and anti-RXRα
antibodies. GST-RARα and GST-RXRα fusion proteins were purified using B-PER GST
Fusion Protein Purification Kit (Pierce) following the manufacturer’s instructions.

Co-immunoprecipitation (Co-IP) Assay − Two hundred nanograms of human
recombinant Sp1 protein was incubated with either 200 ng of pure GST-RARα protein or
200 ng of pure GST-RXRα protein in 50 µl of PBS on ice for 2 h. Samples were diluted
in 950 µl of PBS with 1X protease inhibitor, and immunoprecipitated with rabbit
polyclonal anti-RARα antibody (sc-773, Santa Cruz Biotechnology) or rabbit polyclonal
anti-RXRα antibody (sc-774, Santa Cruz Biotechnology) at the final concentration of 10

92
µg/ml at 4
o
C overnight on a rotating mixer. After 50 µl of Protein A-Sepharose beads
(GE Healthcare) was added into each IP reaction, samples were incubated at 4
o
C for
another 2 h on a rotating mixer. Beads were washed three times with cold PBS and boiled
in 2X SDS sample buffer for 5 min followed by Western blot with mouse monoclonal
anti-Sp1 (sc-17824, Santa Cruz Biotechnology). Incubations of 200 ng of Sp1 protein
with either anti-RARα antibody or anti-RXRα antibody only were used as a negative
control for IP. 200 ng of Sp1, GST-RARα and GST-RXRα were used as 100% input and
analyzed by Western blot with anti-Sp1, anti-RARα and anti-RXRα antibodies,
respectively.
To determine the specific RARα-binding region in Sp1, both in vitro translated RARα
(10 µl) and wt/truncated HA-Sp1 (10 µl) proteins were incubated in TNE buffer (250 mM
NaCl, 5 mM EDTA, 10 mM Tris-HCl, pH 7.4 and 1X protease inhibitor) in a total
volume of 250 µl on ice for 3 h, and immunoprecipitated with rabbit polyclonal anti-
RARα antibody (sc-551, Santa Cruz Biotechnology) at the final concentration of 10
µg/ml at 4
o
C for 4 h on a rotating mixer. After 40 µl of Protein A beads was added into
each IP reaction, samples were incubated at 4
o
C for another 1 h on a rotating mixer.
Beads were then washed once with cold TNE buffer and boiled in 2X SDS sample buffer
for 5 min followed by Western blot with mouse monoclonal anti-HA antibody and True-
Blot HRP-conjugated anti-mouse IgG (secondary antibody). The incubation of in vitro
translated wt HA-Sp1 (10 µl) with anti-RARα antibody only was used as a negative
control for IP. 2 µl of in vitro translated wt/truncated HA-Sp1 and RARα was used as

93
20% input and analyzed by Western blot with anti-HA and anti-RARα antibodies,
respectively.
To determine the physical interaction of SRY with Sp1 in vivo, confluent BE(2)C
cells in a 10-cm dish were lysed with 500 µl of lysis buffer (20 mM Tris-HCl, pH 7.5,
150 mM NaCl, 1 mM EDTA, 1 mM EGTA and 1% Triton X-100) containing various
protease inhibitors. Two hundred microliters of lysates was then incubated with
polyclonal anti-Sp1 antibody (2-4 µg, Bethyl Laboratories) at 4
o
C overnight and
incubated with 40 µl of Protein G sepharose (GE Healthcare) at 4
o
C for 3 h. The samples
were washed with lysis buffer 5 times and resuspended in 2X SDS sample buffer. Rabbit
normal IgG was used as control for IP. The samples were analyzed by Western blot using
a mouse anti-SRY antibody (Santa Cruz Biotechnology).

Chromatin-immunoprecipitation (ChIP) Assay and PCR − Confluent BE(2)C cells
in a 10-cm dish were treated with formaldehyde at a final concentration of 1% at room
temperature with gentle shaking for 10 min to cross-link nuclear proteins with genomic
DNA. Cross linking was quenched by incubating with glycine at the final concentration
of 2.5 M at room temperature with gentle shaking for another 5 min. Cells were quickly
washed by cold PBS twice, harvested by scraping, and centrifuged at 2000 rpm at 4
o
C
for 5 min. Cell pellets were lysed in 350 µl of SDS lysis buffer (1% SDS, 10 mM EDTA,
50 mM Tris-HCl, pH 8.0 and 2X protease inhibitor) on ice for 10 min, followed by
sonication using the Branson 450 Sonifier (Branson Ultrasonics, Danbury, CT, USA) to
shear genomic DNA into 500- to 1000-bp fragments. One to 10% of the supernatant was

94
saved as input. Supernatant was diluted (1:10) in dilution buffer (0.01% SDS, 1.1%
Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.0 and 167 mM NaCl), and
blocked with 60 µl of sheared salmon sperm DNA (Invitrogen)/Protein A/G agarose (GE
Healthcare) at 4
o
C for 2-4 h. The supernatant was immunoprecipitated with 2-5 µg of
specific antibody at 4
o
C overnight. IgG or no addition of antibody was used as a negative
control for IP. After incubating 40 µl of salmon sperm DNA/Protein A/G agarose with IP
samples at 4
o
C for another 2 h, beads were sequentially washed by low-salt buffer (0.1%
SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.0 and 150 mM NaCl), high-
salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.0 and 0.5
M NaCl), LiCl buffer (0.25 M LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mM
EDTA and 10 mM Tris-HCl, pH 8.0) and TE buffer (10 mM Tris-HCl, pH 8.0 and 1 mM
EDTA). The DNA-protein complex was eluted by elution buffer (1% SDS and 0.1 M
sodium bicarbonate) with gentle rotation at room temperature for 15 min twice, reverse-
cross-linked by incubating at 65
o
C for 5-8 h, and purified using QIAquick PCR
Purification Kit (Qiagen). Purified DNA was used as the template for the following PCR
analysis.
For the ChIP/re-ChIP assay to determine the simultaneous presence of RARα and Sp1
in the MAO B promoter, BE(2)C cells were performed with ChIP assay using anti-Sp1
antibody as described above. The remaining proteins bound within the beads in anti-Sp1
immunoprecipitates were recovered in 50 µl of DTT buffer (2% SDS, 10 mM DTT and
2X protease inhibitor in 1X TE buffer) at 37
o
C for 30 min twice and subjected to the
second ChIP assay (re-ChIP) using anti-RARα antibody as described above.

95
For the ChIP/re-ChIP assay to determine the simultaneous presence of Sp1 and SRY
in the MAO A promoter, BE(2)C cells transiently transfected with FLAG-SRY were
subjected to ChIP assay using anti-FLAG antibody, as described above. The remaining
chromatin bound within the beads in the anti-FLAG immunoprecipitates was recovered
in 50 µl of DTT buffer at 37
o
C for 30 min twice and subjected to the second ChIP assay
(re-ChIP) using anti-Sp1 antibody.
The primers used for the RARE3 were forward 5’-ATTTGCCCTACACCCAAGGA-
G-3’ and reverse 5’-GGAGAGGTCACCTAGGACTTC-3’ (fragment length, 176 bp).
The primers used for the Sp1 sites were forward 5’-TGAAGTCCTAGGTGACCTCTC-
3’ and reverse 5’-CACCACGACCACGTCGCATTTG-3’ (fragment length, 333 bp). The
primers used for the MAO A core promoter (-360/-17) were forward 5’-GTGCCTGACA-
CTCCGCGGGGTT-3’ and reverse 5’-TCCTGGGTCGTAGGCACAGGAG-3’ (fragme-
nt length, 344 bp) (Chen et al., 2005). PCR mix included 5% DMSO or/and 1 M betaine
when required. Distilled H
2
O was used as the template as a negative control for PCR.
PCR products were analyzed by agarose gel electrophoresis, and the intensity of DNA
bands was quantified by Labworks analysis software (UVP, Upland, CA, USA).

Microarray Analysis − BE(2)C cells were treated with 10
-5
M RA for different time
(0 h, 3 h, 6 h, 24 h and 48 h) with triplicates in each group, where DMSO was used as a
vehicle. Non-treated cells were used as a control. RNA prepared from cells was
processed with microarray analysis with triplicate measurement for each biological
sample performed by Phalanx Biotech Group (Palo Alto, CA, USA). All data obtained

96
from each group were normalized with the control group. Each microarray contains 30,
968 human genome probes for monitoring the expression level of corresponding protein-
coding genes described in the current public domain contents, and 1, 082 control probes
that monitor the sample quality and hybridization process. Raw intensity signals for each
microarray are captured using a Molecular Dynamics
TM
Axon 4100A scanner, measured
using GenePixPro
TM
Software, and stored in GPR format. Control and missing features
are removed, and the remaining signals are quantile normalized and transformed to log2
values. Testing is performed by combining technical replicates and performing a standard
student’s t-test to calculate raw P-values. Adjusted P-values are calculated using the
Benjamini and Hochberg methods with a false discover rate-value of 0.05. Fold changes
were calculated based on the mean values of the technical replicates for each probe.

97
BIBLIOGRAPHY

Albrecht, J.H., and Hansen, L.K. (1999). Cyclin D1 promotes mitogen-independent cell
cycle progression in hepatocytes. Cell Growth Differ 10, 397-404.

Altucci, L., and Gronemeyer, H. (2001). Nuclear receptors in cell life and death. Trends
Endocrinol Metab 12, 460-468.

Arai, Y., and Kinemuchi, H. (1988). Differences between monoamine oxidase
concentrations in striatum and forebrain of aged and young rats. J Neural Transm 72, 99-
105.

Arnold, A.P., Xu, J., Grisham, W., Chen, X., Kim, Y.H., and Itoh, Y. (2004). Minireview:
Sex chromosomes and brain sexual differentiation. Endocrinology 145, 1057-1062.

Bach, A.W., Lan, N.C., Johnson, D.L., Abell, C.W., Bembenek, M.E., Kwan, S.W.,
Seeburg, P.H., and Shih, J.C. (1988). cDNA cloning of human liver monoamine oxidase
A and B: molecular basis of differences in enzymatic properties. Proc Natl Acad Sci U S
A 85, 4934-4938.

Baker, S.J., Markowitz, S., Fearon, E.R., Willson, J.K., and Vogelstein, B. (1990).
Suppression of human colorectal carcinoma cell growth by wild-type p53. Science 249,
912-915.

Banning, A., Deubel, S., Kluth, D., Zhou, Z., and Brigelius-Flohe, R. (2005). The GI-
GPx gene is a target for Nrf2. Mol Cell Biol 25, 4914-4923.

Bastien, J., and Rochette-Egly, C. (2004). Nuclear retinoid receptors and the transcription
of retinoid-target genes. Gene 328, 1-16.

Bortolato, M., Chen, K., and Shih, J.C. (2008). Monoamine oxidase inactivation: from
pathophysiology to therapeutics. Adv Drug Deliv Rev 60, 1527-1533.

98
Briggs, M.R., Kadonaga, J.T., Bell, S.P., and Tjian, R. (1986). Purification and
biochemical characterization of the promoter-specific transcription factor, Sp1. Science
234, 47-52.

Brunner, H.G., Nelen, M., Breakefield, X.O., Ropers, H.H., and van Oost, B.A. (1993).
Abnormal behavior associated with a point mutation in the structural gene for
monoamine oxidase A. Science 262, 578-580.

Cao, T.T., Ma, L., Kandpal, G., Warren, L., Hess, J.F., and Seabrook, G.R. (2005).
Increased nuclear factor-erythroid 2 p45-related factor 2 activity protects SH-SY5Y cells
against oxidative damage. J Neurochem 95, 406-417.

Cao, X., Liu, W., Lin, F., Li, H., Kolluri, S.K., Lin, B., Han, Y.H., Dawson, M.I., and
Zhang, X.K. (2004). Retinoid X receptor regulates Nur77/TR3-dependent apoptosis
[corrected] by modulating its nuclear export and mitochondrial targeting. Mol Cell Biol
24, 9705-9725.

Cases, O., Seif, I., Grimsby, J., Gaspar, P., Chen, K., Pournin, S., Muller, U., Aguet, M.,
Babinet, C., Shih, J.C., et al. (1995). Aggressive behavior and altered amounts of brain
serotonin and norepinephrine in mice lacking MAOA. Science 268, 1763-1766.

Chan, W.Y., and Rennert, O.M. (2002). Molecular aspects of sex differentiation. Curr
Mol Med 2, 25-37.

Chen, K., Ou, X.M., Chen, G., Choi, S.H., and Shih, J.C. (2005). R1, a novel repressor of
the human monoamine oxidase A. J Biol Chem 280, 11552-11559.

Cheng, Y.H., Yin, P., Xue, Q., Yilmaz, B., Dawson, M.I., and Bulun, S.E. (2008).
Retinoic acid (RA) regulates 17beta-hydroxysteroid dehydrogenase type 2 expression in
endometrium: interaction of RA receptors with specificity protein (SP) 1/SP3 for
estradiol metabolism. J Clin Endocrinol Metab 93, 1915-1923.

Chugani, D.C., Muzik, O., Chakraborty, P., Mangner, T., and Chugani, H.T. (1998).
Human brain serotonin synthesis capacity measured in vivo with alpha-[C-11]methyl-L-
tryptophan. Synapse 28, 33-43.

99
Cohen, I.L., Liu, X., Schutz, C., White, B.N., Jenkins, E.C., Brown, W.T., and Holden,
J.J. (2003). Association of autism severity with a monoamine oxidase A functional
polymorphism. Clin Genet 64, 190-197.

Cosgrove, K.P., Mazure, C.M., and Staley, J.K. (2007). Evolving knowledge of sex
differences in brain structure, function, and chemistry. Biol Psychiatry 62, 847-855.

Davis, L.K., Hazlett, H.C., Librant, A.L., Nopoulos, P., Sheffield, V.C., Piven, J., and
Wassink, T.H. (2008). Cortical enlargement in autism is associated with a functional
VNTR in the monoamine oxidase A gene. Am J Med Genet B Neuropsychiatr Genet
147B, 1145-1151.

de Kloet, E.R., Reul, J.M., and Sutanto, W. (1990). Corticosteroids and the brain. J
Steroid Biochem Mol Biol 37, 387-394.

Dennis, C. (2004). Brain development: the most important sexual organ. Nature 427,
390-392.

Desai-Yajnik, V., and Samuels, H.H. (1993). The NF-kappa B and Sp1 motifs of the
human immunodeficiency virus type 1 long terminal repeat function as novel thyroid
hormone response elements. Mol Cell Biol 13, 5057-5069.

Devor, E.J., Cloninger, C.R., Hoffman, P.L., and Tabakoff, B. (1993). Association of
monoamine oxidase (MAO) activity with alcoholism and alcoholic subtypes. Am J Med
Genet 48, 209-213.

Dewing, P., Chiang, C.W., Sinchak, K., Sim, H., Fernagut, P.O., Kelly, S., Chesselet,
M.F., Micevych, P.E., Albrecht, K.H., Harley, V.R., et al. (2006). Direct regulation of
adult brain function by the male-specific factor SRY. Curr Biol 16, 415-420.

Dulcan, M. (1997). Practice parameters for the assessment and treatment of children,
adolescents, and adults with attention-deficit/hyperactivity disorder. American Academy
of Child and Adolescent Psychiatry. J Am Acad Child Adolesc Psychiatry 36, 85S-121S.

100

Ekici, M., Hohl, M., Schuit, F., Martinez-Serrano, A., and Thiel, G. (2008). Transcription
of genes encoding synaptic vesicle proteins in human neural stem cells: chromatin
accessibility, histone methylation pattern, and the essential role of rest. J Biol Chem 283,
9257-9268.

Emerit, J., Edeas, M., and Bricaire, F. (2004). Neurodegenerative diseases and oxidative
stress. Biomed Pharmacother 58, 39-46.

Faraj, B.A., Davis, D.C., Camp, V.M., Mooney, A.J., 3rd, Holloway, T., and Barika, G.
(1994). Platelet monoamine oxidase activity in alcoholics, alcoholics with drug
dependence, and cocaine addicts. Alcohol Clin Exp Res 18, 1114-1120.

Fazi, F., Travaglini, L., Carotti, D., Palitti, F., Diverio, D., Alcalay, M., McNamara, S.,
Miller, W.H., Jr., Lo Coco, F., Pelicci, P.G., et al. (2005). Retinoic acid targets DNA-
methyltransferases and histone deacetylases during APL blast differentiation in vitro and
in vivo. Oncogene 24, 1820-1830.

Fowler, J.S., Volkow, N.D., Wang, G.J., Logan, J., Pappas, N., Shea, C., and MacGregor,
R. (1997). Age-related increases in brain monoamine oxidase B in living healthy human
subjects. Neurobiol Aging 18, 431-435.

Godar, S., Ince, T.A., Bell, G.W., Feldser, D., Donaher, J.L., Bergh, J., Liu, A., Miu, K.,
Watnick, R.S., Reinhardt, F., et al. (2008). Growth-inhibitory and tumor- suppressive
functions of p53 depend on its repression of CD44 expression. Cell 134, 62-73.

Grimsby, J., Toth, M., Chen, K., Kumazawa, T., Klaidman, L., Adams, J.D., Karoum, F.,
Gal, J., and Shih, J.C. (1997). Increased stress response and beta-phenylethylamine in
MAOB-deficient mice. Nat Genet 17, 206-210.

Hao, H., Qi, H., and Ratnam, M. (2003). Modulation of the folate receptor type beta gene
by coordinate actions of retinoic acid receptors at activator Sp1/ets and repressor AP-1
sites. Blood 101, 4551-4560.

101
Harley, V.R., Clarkson, M.J., and Argentaro, A. (2003). The molecular action and
regulation of the testis-determining factors, SRY (sex-determining region on the Y
chromosome) and SOX9 [SRY-related high-mobility group (HMG) box 9]. Endocr Rev
24, 466-487.

Harley, V.R., Lovell-Badge, R., and Goodfellow, P.N. (1994). Definition of a consensus
DNA binding site for SRY. Nucleic Acids Res 22, 1500-1501.

Heikkila, R.E., Manzino, L., Cabbat, F.S., and Duvoisin, R.C. (1984). Protection against
the dopaminergic neurotoxicity of 1-methyl-4-phenyl-1,2,5,6-tetrahydropyridine by
monoamine oxidase inhibitors. Nature 311, 467-469.

Hong, J.S., Kim, S.W., and Koo, J.S. (2008). Sp1 up-regulates cAMP-response-element-
binding protein expression during retinoic acid-induced mucous differentiation of normal
human bronchial epithelial cells. Biochem J 410, 49-61.

Hranilovic, D., Novak, R., Babic, M., Novokmet, M., Bujas-Petkovic, Z., and Jernej, B.
(2008). Hyperserotonemia in autism: the potential role of 5HT-related gene variants. Coll
Antropol 32 Suppl 1, 75-80.

Huggenvik, J.I., Collard, M.W., Kim, Y.W., and Sharma, R.P. (1993). Modification of
the retinoic acid signaling pathway by the catalytic subunit of protein kinase-A. Mol
Endocrinol 7, 543-550.

Husmann, M., Dragneva, Y., Romahn, E., and Jehnichen, P. (2000). Nuclear receptors
modulate the interaction of Sp1 and GC-rich DNA via ternary complex formation.
Biochem J 352 Pt 3, 763-772.

Ischiropoulos, H., and Beckman, J.S. (2003). Oxidative stress and nitration in
neurodegeneration: cause, effect, or association? J Clin Invest 111, 163-169.

Jiang, H., Jiang, Q., Liu, W., and Feng, J. (2006). Parkin suppresses the expression of
monoamine oxidases. J Biol Chem 281, 8591-8599.

102
Jonsson, E.G., Norton, N., Forslund, K., Mattila-Evenden, M., Rylander, G., Asberg, M.,
Owen, M.J., and Sedvall, G.C. (2003). Association between a promoter variant in the
monoamine oxidase A gene and schizophrenia. Schizophr Res 61, 31-37.

Jungert, K., Buck, A., von Wichert, G., Adler, G., Konig, A., Buchholz, M., Gress, T.M.,
and Ellenrieder, V. (2007). Sp1 is required for transforming growth factor-beta-induced
mesenchymal transition and migration in pancreatic cancer cells. Cancer Res 67, 1563-
1570.

Kang, K.W., Cho, M.K., Lee, C.H., and Kim, S.G. (2001). Activation of
phosphatidylinositol 3-kinase and Akt by tert-butylhydroquinone is responsible for
antioxidant response element-mediated rGSTA2 induction in H4IIE cells. Mol Pharmacol
59, 1147-1156.

Kim, Y., and Capel, B. (2006). Balancing the bipotential gonad between alternative organ
fates: a new perspective on an old problem. Dev Dyn 235, 2292-2300.

Kiray, M., Ergur, B.U., Bagriyanik, A., Pekcetin, C., Aksu, I., and Buldan, Z. (2007).
Suppression of apoptosis and oxidative stress by deprenyl and estradiol in aged rat liver.
Acta Histochem 109, 480-485.

Klein, J.A., and Ackerman, S.L. (2003). Oxidative stress, cell cycle, and
neurodegeneration. J Clin Invest 111, 785-793.

Kraft, A.D., Johnson, D.A., and Johnson, J.A. (2004). Nuclear factor E2-related factor 2-
dependent antioxidant response element activation by tert-butylhydroquinone and
sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative
insult. J Neurosci 24, 1101-1112.

Lan, N.C., Heinzmann, C., Gal, A., Klisak, I., Orth, U., Lai, E., Grimsby, J., Sparkes,
R.S., Mohandas, T., and Shih, J.C. (1989). Human monoamine oxidase A and B genes
map to Xp 11.23 and are deleted in a patient with Norrie disease. Genomics 4, 552-559.

Langston, J.W., Forno, L.S., Rebert, C.S., and Irwin, I. (1984). Selective nigral toxicity
after systemic administration of 1-methyl-4-phenyl-1,2,5,6-tetrahydropyrine (MPTP) in
the squirrel monkey. Brain Res 292, 390-394.

103
Lau, Y.F., Li, Y., and Kido, T. (2009). Gonadoblastoma locus and the TSPY gene on the
human Y chromosome. Birth Defects Res C Embryo Today 87, 114-122.

Lee, T.L., Alba, D., Baxendale, V., Rennert, O.M., and Chan, W.Y. (2006). Application
of transcriptional and biological network analyses in mouse germ-cell transcriptomes.
Genomics 88, 18-33.

Lew, A.M., Yao, H., and Elsholtz, H.P. (1994). G(i) alpha 2- and G(o) alpha-mediated
signaling in the Pit-1-dependent inhibition of the prolactin gene promoter. Control of
transcription by dopamine D2 receptors. J Biol Chem 269, 12007-12013.

Li, J., Lee, J.M., and Johnson, J.A. (2002). Microarray analysis reveals an antioxidant
responsive element-driven gene set involved in conferring protection from an oxidative
stress-induced apoptosis in IMR-32 cells. J Biol Chem 277, 388-394.

Li, L., He, S., Sun, J.M., and Davie, J.R. (2004). Gene regulation by Sp1 and Sp3.
Biochem Cell Biol 82, 460-471.

Li, Y., Oh, H.J., and Lau, Y.F. (2006). The poly(ADP-ribose) polymerase 1 interacts with
Sry and modulates its biological functions. Mol Cell Endocrinol 257-258, 35-46.

Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.

Marin, M., Karis, A., Visser, P., Grosveld, F., and Philipsen, S. (1997). Transcription
factor Sp1 is essential for early embryonic development but dispensable for cell growth
and differentiation. Cell 89, 619-628.

Mayer, A., Lahr, G., Swaab, D.F., Pilgrim, C., and Reisert, I. (1998). The Y-
chromosomal genes SRY and ZFY are transcribed in adult human brain. Neurogenetics 1,
281-288.

Newman, R.M., Mobascher, A., Mangold, U., Koike, C., Diah, S., Schmidt, M., Finley,
D., and Zetter, B.R. (2004). Antizyme targets cyclin D1 for degradation. A novel
mechanism for cell growth repression. J Biol Chem 279, 41504-41511.

104
Nguyen, T., Sherratt, P.J., and Pickett, C.B. (2003). Regulatory mechanisms controlling
gene expression mediated by the antioxidant response element. Annu Rev Pharmacol
Toxicol 43, 233-260.

Nicotra, A., and Parvez, S.H. (2000). Cell death induced by MPTP, a substrate for
monoamine oxidase B. Toxicology 153, 157-166.

Nishizawa, S., Benkelfat, C., Young, S.N., Leyton, M., Mzengeza, S., de Montigny, C.,
Blier, P., and Diksic, M. (1997). Differences between males and females in rates of
serotonin synthesis in human brain. Proc Natl Acad Sci U S A 94, 5308-5313.

Nordquist, N., and Oreland, L. (2006). Monoallelic expression of MAOA in skin
fibroblasts. Biochem Biophys Res Commun 348, 763-767.

Oh, H.J., Li, Y., and Lau, Y.F. (2005). Sry associates with the heterochromatin protein 1
complex by interacting with a KRAB domain protein. Biol Reprod 72, 407-415.

Ou, X.M., Chen, K., and Shih, J.C. (2004). Dual functions of transcription factors,
transforming growth factor-beta-inducible early gene (TIEG)2 and Sp3, are mediated by
CACCC element and Sp1 sites of human monoamine oxidase (MAO) B gene. J Biol
Chem 279, 21021-21028.

Ou, X.M., Chen, K., and Shih, J.C. (2006a). Glucocorticoid and androgen activation of
monoamine oxidase A is regulated differently by R1 and Sp1. J Biol Chem 281, 21512-
21525.

Ou, X.M., Chen, K., and Shih, J.C. (2006b). Monoamine oxidase A and repressor R1 are
involved in apoptotic signaling pathway. Proc Natl Acad Sci U S A 103, 10923-10928.

Perkins, N.D., Edwards, N.L., Duckett, C.S., Agranoff, A.B., Schmid, R.M., and Nabel,
G.J. (1993). A cooperative interaction between NF-kappa B and Sp1 is required for HIV-
1 enhancer activation. EMBO J 12, 3551-3558.

105
Pontiggia, A., Rimini, R., Harley, V.R., Goodfellow, P.N., Lovell-Badge, R., and Bianchi,
M.E. (1994). Sex-reversing mutations affect the architecture of SRY-DNA complexes.
EMBO J 13, 6115-6124.

Poulat, F., Girard, F., Chevron, M.P., Goze, C., Rebillard, X., Calas, B., Lamb, N., and
Berta, P. (1995). Nuclear localization of the testis determining gene product SRY. J Cell
Biol 128, 737-748.

Prochazka, H., Anderberg, U.M., Oreland, L., Knorring, L.V., and Agren, H. (2003).
Self-rated aggression related to serum testosterone and platelet MAO activity in female
patients with the fibromyalgia syndrome. World J Biol Psychiatry 4, 35-41.

Quelle, D.E., Ashmun, R.A., Shurtleff, S.A., Kato, J.Y., Bar-Sagi, D., Roussel, M.F., and
Sherr, C.J. (1993). Overexpression of mouse D-type cyclins accelerates G1 phase in
rodent fibroblasts. Genes Dev 7, 1559-1571.

Ren, B., and Dynlacht, B.D. (2004). Use of chromatin immunoprecipitation assays in
genome-wide location analysis of mammalian transcription factors. Methods Enzymol
376, 304-315.

Ren, M., Pozzi, S., Bistulfi, G., Somenzi, G., Rossetti, S., and Sacchi, N. (2005).
Impaired retinoic acid (RA) signal leads to RARbeta2 epigenetic silencing and RA
resistance. Mol Cell Biol 25, 10591-10603.

Ross, S.A., McCaffery, P.J., Drager, U.C., and De Luca, L.M. (2000). Retinoids in
embryonal development. Physiol Rev 80, 1021-1054.

Rotheneder, H., Geymayer, S., and Haidweger, E. (1999). Transcription factors of the
Sp1 family: interaction with E2F and regulation of the murine thymidine kinase promoter.
J Mol Biol 293, 1005-1015.

Rushmore, T.H., and Kong, A.N. (2002). Pharmacogenomics, regulation and signaling
pathways of phase I and II drug metabolizing enzymes. Curr Drug Metab 3, 481-490.

106
Salahpour, A., Medvedev, I.O., Beaulieu, J.M., Gainetdinov, R.R., and Caron, M.G.
(2007). Local knockdown of genes in the brain using small interfering RNA: a
phenotypic comparison with knockout animals. Biol Psychiatry 61, 65-69.

Scott, A.L., Bortolato, M., Chen, K., and Shih, J.C. (2008). Novel monoamine oxidase A
knock out mice with human-like spontaneous mutation. Neuroreport 19, 739-743.

Shih, J.C. (1991). Molecular basis of human MAO A and B. Neuropsychopharmacology
4, 1-7.

Shih, J.C., Chen, K., and Ridd, M.J. (1999). Monoamine oxidase: from genes to behavior.
Annu Rev Neurosci 22, 197-217.

Shih, J.C., Zhu, Q.S., and Chen, K. (1995). Expression of human monoamine oxidase
(MAO) A gene controlled by transcription factor Sp1. Prog Brain Res 106, 49-56.

Sinclair, A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L., Smith, M.J., Foster,
J.W., Frischauf, A.M., Lovell-Badge, R., and Goodfellow, P.N. (1990). A gene from the
human sex-determining region encodes a protein with homology to a conserved DNA-
binding motif. Nature 346, 240-244.

Spring, S., Lerch, J.P., and Henkelman, R.M. (2007). Sexual dimorphism revealed in the
structure of the mouse brain using three-dimensional magnetic resonance imaging.
Neuroimage 35, 1424-1433.

Strom, A.C., Forsberg, M., Lillhager, P., and Westin, G. (1996). The transcription factors
Sp1 and Oct-1 interact physically to regulate human U2 snRNA gene expression. Nucleic
Acids Res 24, 1981-1986.

Subramaniam, N., Campion, J., Rafter, I., and Okret, S. (2003). Cross-talk between
glucocorticoid and retinoic acid signals involving glucocorticoid receptor interaction with
the homoeodomain protein Pbx1. Biochem J 370, 1087-1095.

Suske, G. (1999). The Sp-family of transcription factors. Gene 238, 291-300.

107
Suzuki, Y., Shimada, J., Shudo, K., Matsumura, M., Crippa, M.P., and Kojima, S. (1999).
Physical interaction between retinoic acid receptor and Sp1: mechanism for induction of
urokinase by retinoic acid. Blood 93, 4264-4276.

Tadic, A., Rujescu, D., Szegedi, A., Giegling, I., Singer, P., Moller, H.J., and Dahmen, N.
(2003). Association of a MAOA gene variant with generalized anxiety disorder, but not
with panic disorder or major depression. Am J Med Genet B Neuropsychiatr Genet 117B,
1-6.

Taketo, T., Lee, C.H., Zhang, J., Li, Y., Lee, C.Y., and Lau, Y.F. (2005). Expression of
SRY proteins in both normal and sex-reversed XY fetal mouse gonads. Dev Dyn 233,
612-622.

van der Burg, B., Sonneveld, E., Lemmen, J.G., and van der Saag, P.T. (1999).
Morphogenetic action of retinoids and estrogens. Int J Dev Biol 43, 735-743.

van Wageningen, S., Breems-de Ridder, M.C., Nigten, J., Nikoloski, G., Erpelinck-
Verschueren, C.A., Lowenberg, B., de Witte, T., Tenen, D.G., van der Reijden, B.A., and
Jansen, J.H. (2008). Gene transactivation without direct DNA binding defines a novel
gain-of-function for PML-RARalpha. Blood 111, 1634-1643.

Vansant, G., and Reynolds, W.F. (1995). The consensus sequence of a major Alu
subfamily contains a functional retinoic acid response element. Proc Natl Acad Sci U S A
92, 8229-8233.

Wang, X., Martindale, J.L., Liu, Y., and Holbrook, N.J. (1998). The cellular response to
oxidative stress: influences of mitogen-activated protein kinase signalling pathways on
cell survival. Biochem J 333 ( Pt 2), 291-300.

Werner, M.H., Huth, J.R., Gronenborn, A.M., and Clore, G.M. (1995). Molecular basis of
human 46X,Y sex reversal revealed from the three-dimensional solution structure of the
human SRY-DNA complex. Cell 81, 705-714.

Westlund, K.N., Denney, R.M., Rose, R.M., and Abell, C.W. (1988). Localization of
distinct monoamine oxidase A and monoamine oxidase B cell populations in human
brainstem. Neuroscience 25, 439-456.

108
Wilhelm, D., Palmer, S., and Koopman, P. (2007). Sex determination and gonadal
development in mammals. Physiol Rev 87, 1-28.

Williams, J.G., Allison, C., Scott, F.J., Bolton, P.F., Baron-Cohen, S., Matthews, F.E.,
and Brayne, C. (2008). The Childhood Autism Spectrum Test (CAST): sex differences. J
Autism Dev Disord 38, 1731-1739.

Wilson, C.A., and Davies, D.C. (2007). The control of sexual differentiation of the
reproductive system and brain. Reproduction 133, 331-359.

Wong, W.K., Chen, K., and Shih, J.C. (2001). Regulation of human monoamine oxidase
B gene by Sp1 and Sp3. Mol Pharmacol 59, 852-859.

Wong, W.K., Chen, K., and Shih, J.C. (2003). Decreased methylation and transcription
repressor Sp3 up-regulated human monoamine oxidase (MAO) B expression during
Caco-2 differentiation. J Biol Chem 278, 36227-36235.

Wong, W.K., Ou, X.M., Chen, K., and Shih, J.C. (2002). Activation of human
monoamine oxidase B gene expression by a protein kinase C MAPK signal transduction
pathway involves c-Jun and Egr-1. J Biol Chem 277, 22222-22230.

Yen, A., Roberson, M.S., Varvayanis, S., and Lee, A.T. (1998). Retinoic acid induced
mitogen-activated protein (MAP)/extracellular signal-regulated kinase (ERK) kinase-
dependent MAP kinase activation needed to elicit HL-60 cell differentiation and growth
arrest. Cancer Res 58, 3163-3172.

Yoo, H.J., Lee, S.K., Park, M., Cho, I.H., Hyun, S.H., Lee, J.C., Yang, S.Y., and Kim,
S.A. (2009). Family- and population-based association studies of monoamine oxidase A
and autism spectrum disorders in Korean. Neurosci Res 63, 172-176.

Zhang, Z., Chen, K., Shih, J.C., and Teng, C.T. (2006). Estrogen-related receptors-
stimulated monoamine oxidase B promoter activity is down-regulated by estrogen
receptors. Mol Endocrinol 20, 1547-1561.

109
Zhao, C., and Meng, A. (2005). Sp1-like transcription factors are regulators of embryonic
development in vertebrates. Dev Growth Differ 47, 201-211.

Zhu, Q.S., Chen, K., and Shih, J.C. (1994). Bidirectional promoter of human monoamine
oxidase A (MAO A) controlled by transcription factor Sp1. J Neurosci 14, 7393-7403.

Zhu, Q.S., Grimsby, J., Chen, K., and Shih, J.C. (1992). Promoter organization and
activity of human monoamine oxidase (MAO) A and B genes. J Neurosci 12, 4437-4446.

110
APPENDIX: Summary of MAO gene regulation

Abstract (if available)

Abstract This study has investigated the transcriptional regulation of MAO A and B genes. MAO A and B are a crucial pair of oxidative isoenzymes, which degrade biogenic and dietary amines, including monoamine neurotransmitters, and produce hydrogen peroxide. Abnormal MAO A or B activity has been implicated in numerous neurological and psychiatric disorders. These two isoenzymes have different but overlapping substrate and inhibitor selectivity. There is a 70% amino acid sequences identity and different tissue- and cell-specific expression between the two enzymes. MAO A and B promoters share approximately 60% sequence identity with distinct organization. Both MAO A and B are regulated by Sp-family proteins, such as Sp1 and Sp3. MAO B is uniquely regulated by protein kinase C and mitogen-activated protein kinase signaling pathways, whereas MAO A is involved in the c-Myc-induced proliferative signaling pathway.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Monoamine oxidase deficiency and emotional reactivity: neurochemical and developmental studies

PDF

Monoamine oxidase and cancer

PDF

Potential therapeutic effect of monoamine oxidase (MAO) inhibitor on human neuroblastoma

PDF

Pten regulates beta-cell regeneration intrinsically and independently of development

PDF

Regulation of mitochondrial bioenergetics via PTEN (phosphatase and tensin homolog deleted on chromosome 10)/estrogen-related receptor alpha (ERRα) signaling

PDF

Downregulation of osteopontin by PTEN in liver-specific Pten-null mouse model

PDF

Monoamine oxidase A inhibitors and androgen receptor antagonists regulate mitochondrial function in prostate cancer cells

PDF

Co-expression of monoamine oxidase A and prostate cancer stem cell markers in Pten knockout mice

PDF

Using genomics to understand the gene selectivity of steroid hormone receptors

PDF

MAO a deficient mice exhibit an altered immune system in the brain and prostate

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

Protein kinase Bα (AKT1) but not protein kinase Bβ (AKT2) controls pancreatic β cell growth and survival

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

Development of novel small molecules targeting mitochondrial and oxidative stress signaling pathways for pancreatic cancer therapy

PDF

Mechanistic studies of novel small molecule anti-cancer agents using next generation sequencing

PDF

The differential effects of genistein on cellular effects in T47D tumorigenic and MCF10A nontumorigenic breast epithelial cells: role of metabolism

PDF

Induction of hypersignaling as a therapeutic approach for treatment of BCR-ABL1 positive Acute Lymphoblastic Leukemia (ALL) cells

PDF

TREM2 and C1q signaling regulates immunoproteostasis in Alzheimer's disease

PDF

Investigating the function and epigenetic regulation of ABCA3, a novel LUAD tumor suppressor gene

PDF

The modulation of dynamin and receptor endocytosis machinery using elastin-like polypeptides

Asset Metadata

Creator Wu, Boyang (author)

Core Title Differential regulation of monoamine oxidase A and B genes

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology

Publication Date 12/02/2009

Defense Date 10/22/2009

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag antioxidant,monoamine oxidase,OAI-PMH Harvest,promoter regulation,retinoic acid,sex-determining region Y gene,Sp1

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Shih, Jean C. (committee chair), Duncan, Roger F. (committee member), Landolph, Joseph Jr. (committee member), Stiles, Bangyan L. (committee member)

Creator Email boyangwu@usc.edu,littletze@me.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m2781

Unique identifier UC1314638

Identifier etd-Wu-3365 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-280300 (legacy record id),usctheses-m2781 (legacy record id)

Legacy Identifier etd-Wu-3365.pdf

Dmrecord 280300

Document Type Dissertation

Rights Wu, Boyang

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu