University of Southern California Dissertations and Theses

Defining the circuits and mechanisms mediating a pacemaker-controlled behavior in C. elegans

(USC Thesis Other)

Defining the circuits and mechanisms mediating a pacemaker-controlled behavior in C. elegans

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Copyright 2022 Ukjin Choi

Defining the circuits and mechanisms mediating a pacemaker-controlled behavior in C. elegans

by

Ukjin Choi

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of
the Requirements for the Degree
DOCTOR OF PHILOSOPHY
(DEVELOPMENT, STEM CELLS AND REGENERATIVE MEDICINE)

December 2022
ii

Dedication

To my parents and younger brother for their full support
along the way to my Ph.D. degree

iii

Acknowledgements

My dissertation work would not be possible without my mentor Dr. Derek Sieburth. I would like
to thank him for his guidance, encouragement, and support during my Ph.D. program. I very much
appreciate his patience and trust when the projects did not go well. Also, I appreciate him for providing me
the resources whenever I needed to set up new experiments for my project.
I would also like to thank Mingxi Hu for the work and help on the experiments of my project. I
could not have accomplished this much without her help. I also want to thank Qi Jia for his help. He was
very thoughtful and supportive throughout my entire years in the Sieburth lab. I would also like to thank
the former lab members, Han Wang for his contribution to my project, and Sungjin Kim for his support and
help. I am also thankful to the members of the Sieburth lab: Qixin Zhang, Andrew Calof, and Drew Young,
and Dr. Karen Chang and her lab members: Yen-Ching Chang, Yuan Gao, Ying Wu, Yi-Jheng Peng, and
Mark Colt, for their helpful comments in our group meetings.
I am grateful to Dr. Karen Chang, who is the chair of my committee. She has been encouraging and
supportive throughout the 5 years of my Ph.D. training and gave me constructive comments and advice to
pursue my academic achievements. I would also like to thank my committee member, Dr. Alexandre
Bonnin, for his support and helpful comments in my dissertation. Also, I would like to thank my qualifying
exam committee, Dr. Robert Chow, for his helpful comments in the earlier stages of my project.
Lastly, I want to thank my parents and my younger brother in Korea for their support and trust. It
would not have been possible without their full support. Also, I want to thank my high school friends in
Korea for their support and my friends here for helping me whenever I needed support.
iv

Table of Contents
Dedication .................................................................................................................................................... ii
Acknowledgements .................................................................................................................................... iii
List of Figures ............................................................................................................................................. vi
List of Tables ............................................................................................................................................ viii
List of Movies ............................................................................................................................................. ix
List of Abbreviations .................................................................................................................................. x
Abstract ....................................................................................................................................................... xi
Chapter 1: Overview and Introduction .................................................................................................... 1
1.1 Rhythmic behavior .............................................................................................................................. 1
1.2 Neuropeptide signaling ....................................................................................................................... 1
1.3 Electrical synapses .............................................................................................................................. 2
1.4 C. elegans as a behavioral model ........................................................................................................ 3
1.5 Defecation motor program .................................................................................................................. 4
1.5.1 pBoc ............................................................................................................................................. 6
1.5.2 aBoc ............................................................................................................................................. 6
1.5.3 Exp ............................................................................................................................................... 8
Chapter 2: A novel peptidergic circuit controls a rhythmic muscle contraction ................................ 10
2.1 Summary ........................................................................................................................................... 10
2.2 Introduction ....................................................................................................................................... 10
2.3 Materials and Methods ...................................................................................................................... 12
2.4 Results ............................................................................................................................................... 16
2.4.1 The aBoc step is controlled by peptidergic signaling from the AVL neuron............................. 16
2.4.2 The FLP-22 FMRFamide-like neuropeptide is necessary for aBoc ........................................... 17
2.4.3 The FRPR-17 neuropeptide GPCR functions downstream of FLP-22 to promote aBoc ........... 19
2.4.4 FRPR-17 functions in hmc for aBoc .......................................................................................... 19
2.4.5 hmc controls aBoc ...................................................................................................................... 20
2.4.6 hmc is rhythmically activated by AVL ...................................................................................... 20
2.4.7 FLP-22-FRPR-17 signaling activates hmc ................................................................................. 24
2.4.8 PKA functions downstream of FRPR-17 to facilitate hmc activation ....................................... 25
2.4.9 The gap junction protein UNC-9 functionally couples hmc and neck muscles to promote aBoc
............................................................................................................................................................ 28
2.4.10 hmc activity is negatively regulated by FLP-9-FRPR-21 signaling in hmc............................. 31
2.4.11 NMUR-3 signaling shapes hmc calcium spike amplitude ....................................................... 33
2.5 Discussion ......................................................................................................................................... 34
2.5.1 A model for the circuit controlling aBoc ................................................................................... 34
2.5.2 aBoc is regulated by a network of peptidergic signaling ........................................................... 38
v

2.5.3 A function for hmc in coupling a pacemaker to muscle contraction ......................................... 40
Chapter 3: Presynaptic coupling by electrical synapses coordinates a rhythmic behavior by
synchronizing the activities of a neuron pair .......................................................................................... 54
3.1 Summary ........................................................................................................................................... 54
3.2 Introduction ....................................................................................................................................... 54
3.3 Materials and Methods ...................................................................................................................... 57
3.4 Results ............................................................................................................................................... 61
3.4.1 inx-1 regulates the timing of expulsion during the defecation motor program .......................... 61
3.4.2 inx-1 functions in mature AVL and DVB motor neurons to regulate expulsion ....................... 65
3.4.3 INX-1 is concentrated at AVL/DVB neuromuscular junctions, where it functions to regulate
expulsion frequency ............................................................................................................................ 65
3.4.4 INX-1 functions as a gap junction protein to couple AVL and DVB motor neurons ................ 66
3.4.5 INX-1 functionally couples AVL and DVB NMJs during the DMP ......................................... 68
3.4.6 INX-1 synchronizes the activation of AVL and DVB by NLP-40 ............................................ 69
3.4.7 Activation of AVL by NLP-40 can elicit calcium spikes in DVB through INX-1 .................... 71
3.4.8 INX-1 inhibits ectopic calcium spike generation at DVB NMJs ............................................... 71
3.4.9 Suppression of ectopic calcium influx by INX-1 occurs through inhibition of EGL-19 voltage
gated calcium channels ....................................................................................................................... 73
3.5 Discussion ......................................................................................................................................... 77
Chapter 4: Conclusions and Perspectives ............................................................................................... 93
4.1 Significance....................................................................................................................................... 93
4.2 How does AVL coordinate aBoc and Exp in phase? ........................................................................ 93
4.3 The necessity of hmc for regulating a rhythmic muscle contraction ................................................ 94
4.4 The mechanism underlying inhibition of ectopic DVB activation by INX-1 ................................... 97
4.5 Conclusion ........................................................................................................................................ 97
Bibliography .............................................................................................................................................. 98
Appendix .................................................................................................................................................. 109
A1 Publications ..................................................................................................................................... 109
A2 Legends of movies .......................................................................................................................... 110

vi

List of Figures
Figure 1.1 The defecation motor program in C. elegans .............................................................................. 5
Figure 1.2 Circuits of the defecation motor program .................................................................................... 7
Figure 2.1 AVL controls aBoc through peptidergic signaling to hmc ........................................................ 18
Figure 2.2 hmc is rhythmically activated by FLP-22-FRPR-17 signaling .................................................. 21
Figure 2.3 PKA functions downstream of FRPR-17 to facilitate hmc activation ....................................... 26
Figure 2.4 Gap junction UNC-9 mediates hmc signaling to anterior body-wall muscles .......................... 29
Figure 2.5 hmc activity is negatively regulated by FLP-9/FRPR-21 .......................................................... 32
Figure 2.6 NMUR-3 signaling shapes hmc calcium spike amplitude ......................................................... 35
Figure 2.7 Working model for the aBoc step .............................................................................................. 37
Figure S2.1 Identification of novel cell/tissue specific promoters from the nmur-3 promoter region ........ 43
Figure S2.2 flp-22 and frpr-17 mutants show decreased aBoc contraction frequency and extent .............. 44
Figure S2.3 flp-22 and frpr-17 mutants do not alter the calcium dynamics in AVL .................................. 46
Figure S2.4 FLP-22 secreted from AVL can reach hmc ............................................................................. 47
Figure S2.5 aBoc frequency of innexins expressed in hmc and muscles and calcium dynamics in unc-9
mutants ........................................................................................................................................................ 48
Figure S2.6 FRPR-21 and NMUR-3 signaling do not impact the calcium dynamics in AVL ................... 49
Figure S2.7 aBoc frequency and calcium dynamics of receptors highly expressed in hmc ....................... 50
Figure 3.1 inx-1 functions in AVL and DVB motor neurons to regulate the frequency and timing of
expulsion during the defecation motor program (DMP) ............................................................................. 62
Figure 3.2 INX-1 is a gap junction protein that functionally couples AVL and DVB motor neurons at
NMJs ........................................................................................................................................................... 67
Figure 3.3 INX-1 synchronizes the activation of AVL and DVB motor neurons ...................................... 70
Figure 3.4 INX-1 promotes expulsion and DVB activation by AVL in response to pacemaker ................ 72
Figure 3.5 INX-1 inhibits ectopic activation of the DVB motor neuron .................................................... 74
Figure 3.6 Ectopic activation of the DVB motor neuron in inx-1 mutants are suppressed in egl-19 or egl-
36(gf) mutants ............................................................................................................................................. 76
Figure 3.7 Working model for INX-1 in the expulsion step of the defecation motor program .................. 78
vii

Figure S3.1 inx-1 does not affect anterior body wall contraction frequency, cycle length, or synaptic
structure ...................................................................................................................................................... 83
Figure S3.2 INX-1 regulates Exp at NMJs ................................................................................................. 84
Figure S3.3 Localization of INX-1::GFP and AVL axon outgrowth defects in unc-33 mutants ................ 85
Figure S3.4 INX-1 negatively regulates Exp in the absence of nlp-40 ....................................................... 86
Figure S3.5 Calcium spike duration and intensity in inx-1 mutants ........................................................... 87

viii

List of Tables

Table S2.1 Strains, transgenic lines, and plasmids used in this study......................................................... 51
Table S3.1 Strains, transgenic lines, and plasmids used in this study......................................................... 88
Table S3.2 Oligos used in this study ........................................................................................................... 91

ix

List of Movies
#

Movie S2.1. Calcium imaging of freely moving wild-type day 1 adults co-expressing GCaMP6 in AVL and
hmc (under the nmur-3 promoter) and GCaMP3 in intestine (under the nlp-40 promoter).

Movie S2.2 Calcium imaging of freely moving frpr-17 mutant day 1 adults co-expressing GCaMP6 in AVL
and hmc (under the nmur-3 promoter) and GCaMP3 in intestine (under the nlp-40 promoter).

Movie S2.3 Calcium imaging of freely moving unc-9 mutant day 1 adults co-expressing GCaMP6 in AVL
and hmc (under the nmur-3 promoter) and GCaMP3 in intestine (under the nlp-40 promoter).

Movie S3.1. Calcium live imaging of wild-type day 1 adults co-expressing GCaMP6 in AVL (under the
nmur-3 promoter) and GCaMP3 in DVB (under the unc-47(mini) promoter).

Movie S3.2. Calcium live imaging of inx-1 mutant day 1 adults co-expressing GCaMP6 in AVL (under the
nmur-3 promoter) and GCaMP3 in DVB (under the unc-47(mini) promoter).

Movie S3.3. Calcium live imaging of day 1 aex-2 mutants co-expressing aex-2 cDNA in AVL (under the
flp-22 promoter) and GCaMP3 in DVB (under the flp-10 promoter).

Movie S3.4. Calcium live imaging of day 1 aex-2 inx-1 double mutants co-expressing aex-2 cDNA in AVL
(under the flp-22 promoter) and GCaMP3 in DVB (under the flp-10 promoter).

#
These movies are in the separate digital files accompanying this dissertation. Movie S3.1, 3.2, 3.3 and 3.4
can also be found in the supporting information in my paper (publication 1 in Appendix A1, Page 109).

x

List of Abbreviations

aBoc anterior body wall muscle contraction
cAMP cyclic adenosine monophosphate
DMP defecation motor program
Exp expulsion or enteric muscle contraction
GABA gamma-aminobutyric acid
GCaMP a genetically-encoded calcium indicator
GPCR G protein-coupled receptor
hmc head mesodermal cell
pBoc posterior body wall muscle contraction
PKA cAMP-dependent protein kinase or protein kinase A
PKA[CA] constitutively active PKA
PKA[DN] dominant negative PKA
VGCC voltage-gated calcium channel
xi

Abstract

Rhythmic behaviors, such as walking, breathing and sleeping are controlled by pacemakers, which
generate rhythmic firing patterns that regulate these behaviors. It is critical to convey temporal information
from the pacemaker to downstream effectors accurately and precisely as perturbation in this process can
lead to disruption in the execution of rhythmic behaviors. However, little is known about the circuits and
underlying molecular mechanisms by which pacemaker signaling conveys temporal information to target
tissues.
To address these questions, I utilize C. elegans as multicellular animal model and study its simple
rhythmic behavior, the defecation motor program. The rhythmicity of the defecation motor program is
encoded by calcium oscillations in the pacemaker, which is the intestine. The calcium oscillation occurs
every 50 seconds and triggers a neuropeptide, NLP-40 secretion. NLP-40 activates two GABAergic motor
neurons (AVL and DVB) to promote two discrete but related muscle contractions, anterior body wall
muscle contraction (aBoc) and enteric muscle contraction (Exp). Combining genetics, in vivo calcium
imaging, and behavioral assays, I identify a novel circuit regulated by neuropeptide signaling that promotes
muscle contraction in the aBoc step. In addition, I find that electrical synapses couple AVL and DVB to
synchronize their activities in response to NLP-40 in the Exp step.
Previous studies have suggested that aBoc is regulated by only AVL. However, the signal that is
released from AVL and the downstream circuits that mediate the signal to control aBoc are completely
unknown. Using RNAi knockdown and forward genetic screening, I find that a neuropeptide, FLP-22, as
the signal released in part from AVL and a GPCR, FRPR-17, as the receptor for FLP-22. In addition, by
tissue specific rescue experiments, I identify that FRPR-17 functions in the head mesodermal cell (hmc), a
cell with previously unknown function. Using calcium imaging, I show that activation of hmc results in
rhythmic calcium spikes in phase with the pacemaker and AVL, and show that the calcium spike frequency
of hmc is severely decreased when lacking flp-22 or frpr-17 signaling. I further demonstrate that PKA
xii

signaling mediates the calcium spike in hmc. By screening additional GPCRs that are enriched in hmc, I
identify two neuropeptide signaling pathways that inhibits and positively modulates hmc activation. Finally,
I demonstrate that the gap junction UNC-9 mediates the signaling from hmc to anterior body wall muscles.
While aBoc is only regulated by AVL, studies have shown Exp is regulated by both AVL and DVB.
NLP-40 activates both AVL and DVB through the AEX-2 GPCR on these neurons. The activation of two
neurons results in a conserved signaling cascade of PKA signaling which leads to the calcium influx in
AVL and DVB. Calcium influx triggers the release of the neurotransmitter, GABA, from both neurons and
GABA activates enteric muscles through an excitatory GABA receptor, EXP, resulting in the contraction
of enteric muscles. Although the circuit and molecular mechanisms underlying Exp is well understood, the
mechanism that coordinates synchronized activation of AVL and DVB remains unclear. Because NLP-40
is volume transmitter which diffuses through body cavity before binding to AEX-2, it is very likely that
NLP-40 may not activate AVL and DVB at the same time. Using genetic ablation and forward genetic
screen, I find that INX-1 is the component of electrical synapses that couple AVL and DVB. Combining
calcium imaging, cell specific rescue experiments, and behavioral assays, I demonstrate that INX-1
synchronizes the activation of AVL and DVB through a lateral excitation mechanism in response to NLP-
40. I find that the synchronized activation of AVL and DVB ensures precise timing and robustness for the
execution of Exp. Furthermore, I find that INX-1 inhibits ectopic activation of DVB during cycle intervals
when the input signal is low.
In conclusion, I present evidence to uncover a novel circuit composed of hmc that is regulated by
neuropeptide signaling and I identify roles for electrical synapses in coordinating rhythmic muscle
contractions. My findings provide a deeper understanding of how pacemaker driven signals are reliably and
precisely conveyed to downstream effectors to execute proper behavioral outputs.
1

Chapter 1: Overview and Introduction

1.1 Rhythmic behavior
Rhythmic behaviors are behaviors that exhibit regularity such as breathing, walking, and sleep.
These behaviors are controlled by complex neuronal networks composed of endogenous clocks called
central pattern generators or pacemakers, which convey temporal information to downstream effectors in
the absence of sensory input.
Previous studies have revealed the underlying molecular mechanisms that generate rhythmicity in
the pacemakers (Hastings et al., 2018; Patke et al., 2020). However, two important questions remain to be
answered: (1) What are the downstream circuits and molecular mechanisms that reliably convey pacemaker
signals to rhythmic behavioral outputs? (2) How does the circuit maintain temporal integrity to execute
precise rhythmic behaviors? Understanding how pacemaker driven signals are mediated to behavioral
outputs are crucial because perturbation in either downstream circuits or effectors would fail in delivering
precise temporal information, resulting in disruption of normal rhythmic behaviors.
1.2 Neuropeptide signaling
Neuropeptides are small bioactive molecules that play critical roles in regulating physiological
processes. Initially, neuropeptides are translated as large precursors that are packaged into immature dense
core vesicles (DCVs) with enzymes that process them into small active neuropeptides such as proprotein
convertases (PC). In DCVs, neuropeptide precursors undergo series of post-translational modifications to
become bioactive peptides (Husson et al., 2006). The mature neuropeptides are secreted through the
exocytosis of DCVs. The exocytosis requires SNARE (soluble Nethylmaleimide-sensitive factor
attachment protein receptor) complexes, consist of synaptobrevin, SNAP25, and syntaxin, to mediate
vesicle fusion (Sugita, 2008). Finally, calcium influx occurs upon stimulus which triggers vesicle fusion,
and synaptotagmins, the calcium sensors, on DCVs mediate this process (Kiessling et al., 2018).
2

After their secretion from neurons, neuropeptides bind to G protein-coupled receptors (GPCRs) on
target cells to mediate signaling. The seven transmembrane receptor is coupled with heterotrimeric G
proteins which are composed of α, β, and γ subunits. When the receptor is activated by a ligand, the Gα
subunit dissociates from the Gβγ subunits. Both the Gα and Gβγ can activate downstream effectors (Hamm,
1998). The C. elegans genome encodes 21 Gα, 2 Gβ, and 2 Gγ genes (Jansen et al., 1999). As with the
mammalian Gα subunits, the C. elegans Gα subunits are also classified into four families, which are Gs,
Gi/o, Gq, and G12. GSA-1 (Gs), GOA-1 (Gi/o), EGL-30 (Gq), and GPA-12 (G12) have been reported to
share high homology with mammalian Gα families (Cuppen et al., 2003). Previous studies have identified
downstream effectors of each Gα families, such as adenylate cyclase, Protein Kinase A (PKA),
diacylglycerol kinase (DGK), and phospholipase C (PLC) (Lackner et al., 1999; Nurrish et al., 1999;
Sunahara et al., 1996). The Gα signaling has been implicated in various physiological processes, including
embryo development, synaptic transmission, and locomotion (Lackner et al., 1999; Miller and Rand, 2000;
Wang and Sieburth, 2013). Although each Gα families utilize different downstream effectors, activation of
calcium channels has been involved in most of the Gα signaling pathways.
1.3 Electrical synapses
Electrical synapses are gap junction coupling between two neighboring neurons which are
important for neuronal communication. Electrical synapses allow bidirectional passage of small molecules,
such as ions, neurotransmitters, and signaling molecules. Electrical synapses are composed of two
hemichannels and each hemichannels are formed by six innexins (called connexins in vertebrates) (Pereda,
2014). The innexins, as well as connexins, are transmembrane proteins composed of four transmembrane
domains, two extracellular loops, and amino and carboxyl terminus in the cytoplasm (Simonsen et al., 2014).
In C. elegans, there are 25 genes that encode the innexin family members, while 21 connexin genes in the
human genome (Sohl and Willecke, 2004). The sequence between innexins and connexins show no
homology, but they share similar topology (Beyer and Berthoud, 2018).
In mammals, electrical coupling of neurons has been implicated in diverse neuronal functions
3

including sensory information processing, neuronal synchronization. In the retina, electrical synapses are
formed in amacrine, rod, and cone cells to transfer electrical currents in response to different light levels
for day and night vision (Söhl et al., 2005). Electrical synapses mediate synchronous firing of both
inhibitory and excitatory neuronal networks at all levels of the central nervous system, such as the cortex,
inferior olive, and thalamus (Connors, 2017). In C. elegans, locomotor circuits are regulated by electrical
synapses that couple interneurons and motor neurons (Kawano et al., 2011; Starich et al., 2009), and
electrical coupling is required in primary mechanosensory neurons to control behaviors in respond to nose-
touch (Chatzigeorgiou and Schafer, 2011). Neurons involved in hub and spoke circuits are connected by
electrical synapses to regulate aggregation and related behaviors (Jang et al., 2017).
1.4 C. elegans as a behavioral model
Caenorhabditis elegans (C. elegans) is a small non-parasitic nematode that can be easily handled
in the laboratory for its unique characteristics. C. elegans have two sexes that are hermaphrodites and males.
Hermaphrodites can reproduce by self-fertilization which generates around 300 progenies. The male allows
transfer of genetic information between different strains by mating with hermaphrodites. In the laboratory,
C. elegans can be cultured on agar plates seeded with E. coli as a food source. The life cycle of C. elegans
is around 3.5 days in 20°C. After hatched from the egg, the embryo undergoes four different larval stages,
from L1 to L4, before it becomes an adult. The adult hermaphrodite is about 1mm in length and is composed
of 959 somatic cells (Sulston and Horvitz, 1977; Sulston et al., 1983). Due to the transparency of the animal,
individual cells can be observed under the differential interference contrast (DIC) microscopy as well as in
vivo fluorescence imaging and calcium imaging. The genome sequencing of C. elegans revealed similarity
with human genome in which around 38% of C. elegans genes have orthologs in human (Shaye and
Greenwald, 2011).
The C. elegans hermaphrodite contains only 302 neurons which connectome has been completely
mapped through electron microscopy (Cook et al., 2019). In addition, the electron microscopy images have
identified that neurons communicate through approximately 6400 chemical synapses, 900 electrical
4

synapses, and 1500 neuromuscular junctions in C. elegans (White et al., 1986). The synaptic transmission
is mediated through classical neurotransmitters, such as acetylcholine, glutamate, GABA, serotonin, and
dopamine. Although C. elegans possess a compact nervous system, it displays complex behaviors,
including feeding, mating, locomotion, egg laying, social behavior, defecation, and learning and memory
(de Bono and Maricq, 2005). Furthermore, a recent study has revealed the complete transcriptome of all
302 neurons, which would facilitate the investigation of wireless neuropeptide signaling (Taylor et al.,
2021). The complete anatomically-defined synaptic connections, powerful genetics, and in vivo imaging
methods allow C. elegans as a remarkable animal model to examine how the nervous system functions at
different levels from molecular, cellular, to circuit.
1.5 Defecation motor program
The defecation motor program (DMP) is a rhythmic behavior in C. elegans that occurs every 50
seconds at 20°C in the presence of food to expel digested food from the gut. It consists of three sequential
muscle contractions, the posterior body wall muscle contraction (pBoc), anterior body wall muscle
contraction (aBoc), and enteric muscle contraction which leads to expulsion (Exp) (Figure 1.1A). Every 50
seconds, each cycle starts with pBoc which pushes the gut contents to the anterior region from the posterior
region. After about 3 seconds, aBoc occurs to push the gut contents to the pre-anal region of the posterior
intestine. Immediately after aBoc, enteric muscles contract to promote Exp which leads to the release of
gut contents out of the anus. In wild-type animals, all three contractions can be detected under the dissecting
microscope, although the simultaneous detection of aBoc and Exp is not easy. The circuit of DMP includes
the intestine (pacemaker), a pair of GABAergic motor neurons (AVL and DVB), anterior body wall muscles,
posterior body wall muscles, and enteric muscles (intestinal muscles, anal depressor muscles, and sphincter
muscle) (Figure 1.2B and (Branicky and Hekimi, 2006)). Due to the simple circuit, available behavioral
assays, and feasible in vivo calcium imaging, DMP has served as an outstanding model for studying
GABAergic synaptic transmission, neuropeptide signaling, and intracellular calcium signaling.
5

Figure 1.1 The defecation motor program in C. elegans. (A) Diagram showing the three rhythmic muscle
contractions of the defecation cycle (modified from (Beg et al., 2008)). Every 50 seconds, each cycle starts with the
posterior body wall muscle contraction (pBoc). After around 3 seconds, anterior body wall muscle contractions (aBoc)
immediately followed by enteric muscle contraction occurs which results in expulsion (Exp). (B) Diagram showing
the circuit of the defecation motor program. The intestine (pacemaker) releases signals to promote all three rhythmic
muscle contractions. AVL mediates both aBoc and Exp, while DVB only mediates Exp.
6

1.5.1 pBoc
pBoc is the first muscle contraction that marks the initiation of each cycle in DMP. Previous studies
demonstrated that the intestine directly regulates the contraction of posterior body wall muscles (Fig. 1.2).
The cycle starts with a calcium oscillation in the posterior intestine by calcium release from the IP3-gated
calcium channel, ITR-1, on the intestinal endoplasmic reticulum (ER) (Dal Santo et al., 1999; Nehrke et al.,
2008; Teramoto and Iwasaki, 2006). The increase cytoplasmic calcium in the intestine triggers a rhythmic
release of protons through the Na
+
/H
+
exchanger, PBO-4 on the basolateral membrane of the posterior
intestine (Pfeiffer et al., 2008). Protons are released to the pseudocoelom, the body cavity between the
intestine and posterior body wall muscles, and directly activates the proton-gated cation channel PBO-
5/PBO-6 (Beg et al., 2008). The activation of these channels leads to the contraction of posterior body wall
muscles.
1.5.2 aBoc
aBoc, anterior body wall muscle contraction, is the second rhythmic muscle contraction in the
defecation motor program. aBoc occurs around 3 seconds following pBoc. Prior neuronal ablation studies
by laser have shown that only AVL is required for promoting aBoc, but not DVB, as aBoc was completely
abolished in the absence of AVL, while normal in the absence of DVB (McLntire et al., 1993). In addition,
mutations in the GABA synthesis enzyme, glutamic acid decarboxylase (unc-25/GAD), exhibits normal
aBoc (McLntire et al., 1993), suggesting that AVL may release a different signal to execute aBoc. Mutations
in genes involved in neuropeptide processing or secretion have defects in aBoc (Nagy et al., 2015; Speese
et al., 2007), suggesting that neuropeptides may be the signal secreted from AVL. However, aBoc is also
regulated by the pacemaker (intestine) (Figure 1.2), as lacking the instructive signal, NLP-40, and its
receptor AEX-2, have defects in aBoc (Mahoney et al., 2008; Wang et al., 2013).
Evidence from previous studies suggest that aBoc might be regulated by only neuropeptides.
Neuropeptide signaling have mostly been shown to modulate target cell activities both positively and
negatively to control behavioral outputs, but it is largely unknown whether they can control behaviors as
7

Figure 1.2 Circuits of the defecation motor program. During the defecation motor program, intestinal calcium
oscillation occurs every 50 seconds. First, the calcium oscillation occurs in the posterior intestine and promote release
of protons from the intestine. The released proton activates the proton-gated ion channel PBO5/6, which leads to pBoc.
The calcium oscillation propagates to the anterior region and promotes the secretion of NLP-40. The secreted NLP-
40 activates both AVL and DVB. Activation of AVL and DVB results in the release of GABA which then activates
the ligan-gated cation channel EXP-1 to promote Exp. The signal that is release from AVL to regulate aBoc is
unknown.
8

classic neurotransmitters. Thus, investigating the circuit and molecular mechanisms underlying aBoc could
reveal new understandings of the neuropeptide signaling-induced rhythmic behaviors.
1.5.3 Exp
Exp is the last step in DMP which results in direct release of the gut contents from the anus. Exp
occurs by the contraction of enteric muscles which happens immediately following aBoc. The circuit of
Exp consists of the intestine, a pair of GABAergic neurons (AVL and DVB), and the enteric muscles. The
defects in Exp display as lack of enteric muscle contraction, resulting in constipation, an expansion of the
intestine. The constipation can easily be observed under the dissecting microscope due to accumulation of
the gut contents. Like aBoc, Exp is regulated by the pacemaker, intestine. Every 50 seconds, the propagation
of the calcium wave in the intestine triggers the secretion of NLP-40 from the dense core vesicles (DCVs)
through the calcium sensor SNT-2/synaptotagmin on DCVs (Wang et al., 2013). The release of NLP-40
binds to its receptor, AEX-2/GPCR on the plasma membrane of both AVL and DVB which leads to the
activation of the heterotrimeric G protein s (Gαs) (Mahoney et al., 2008; Wang et al., 2013). The activation
Gαs results in a signaling cascade of the downstream effectors, adenalyate cyclase and PKA, leading to
calcium influx through UNC-9 and EGL-19 voltage gated calcium channels (VGCCs) (Wang and Sieburth,
2013). The calcium influx drives the secretion of GABA from AVL and DVB, and the secreted GABA
binds to an excitatory GABA receptor, EXP-1, on the enteric muscles to promote contraction (Figure 1.2
and (Beg and Jorgensen, 2003)).
Laser ablation studies in AVL and DVB have shown that either AVL or DVB alone cannot promote
full Exp (McLntire et al., 1993), suggesting that GABA should be release from both AVL and DVB
simultaneously to ensure precise and robust contraction of enteric muscles. While neurotransmitters are
released locally at presynaptic terminals where they make chemical synapses with the target cell,
neuropeptides are volume transmitters that diffuse through a fluid-filled cavity. This mechanism enables
neuropeptides to travel relatively large distance to regulate target cell activities that are far apart. NLP-40
is also a volume transmitter that diffuse through the body cavity (pseudocoelom) following secretion from
9

the pacemaker. However, AVL and DVB are located in different regions relatively to the NLP-40 release
site. Thus, NLP-40 may lose temporal precision due to the distance it has to travel before binding to the
AEX-2 GPCR on AVL and DVB, which may result in an asynchronous activation of AVL and DVB. The
asynchronous activation of AVL and DVB may lead to a failure in an execution of robust and rhythmic
Exp, suggesting that a mechanism should exist to ensures precise activation of both AVL and DVB.
In my dissertation, by utilizing genetics, in vivo calcium imaging, and behavioral assays, I identify
a novel peptidergic circuit that controls aBoc. I demonstrate that the AVL GABAergic motor neuron
releases the neuropeptide FLP-22 to promote aBoc. FLP-22 does so by binding to its GPCR, FRPR-17. I
find that FRPR-17 is expressed in the head mesodermal cell (hmc), which function is previously unknown.
The activation of hmc results in a rhythmic calcium spike, which is mediated through gap junctions to the
anterior body wall muscles. In addition, I identify that the electrical synapses composed of INX-1 for
synchronizing the activities of AVL and DVB motor neurons to ensure robust and precise rhythmic Exp.
INX-1 synchronizes the calcium influx of AVL and DVB in response to NLP-40, and inhibits ectopic
calcium influx in DVB during cycle intervals of the Exp step. My dissertation work, in which I use the
rhythmic muscle contraction in the aBoc and Exp step as a model, provides mechanistic insights on how
neuropeptides could function as classic neurotransmitters and how electrical synapses coordinate neuronal
activities to control precise release of neurotransmitters during rhythmic behaviors.

10

Chapter 2: A novel peptidergic circuit controls a rhythmic muscle
contraction

2.1 Summary
Neuropeptides in the brain have both excitatory and inhibitory effects on neuronal activity through
paracrine signaling to local circuits. Here, we show that neuropeptides can activate and inhibit calcium
responses in a single target cell of previously unknown function, hmc, in C. elegans. We show that hmc
controls a discrete muscle contraction during a rhythmic behavior. Live imaging shows that hmc is activated
every 50 seconds in phase with the pacemaker and hmc is activated by the FLP-22 neuropeptide, which is
released from a bifunctional motor neuron AVL. FLP-22 functions through the frpr-17 G protein coupled
receptor (GPCR), which leads to the activation of a G alpha s-protein kinase A (PKA) signaling pathway
in hmc. PKA signaling is not required for hmc activation but instead potentiates hmc activation. hmc
activity is inhibited by signaling from the neuropeptide FLP-9, which functions through the GPCR frpr-21
in hmc. Behavioral, calcium imaging, and genetic studies suggest that hmc itself is not contractile but is
functionally coupled to muscles through gap junctions composed of UNC-9/innexin. These results suggest
that neuropeptides can function as neurotransmitters to control the activity state of a target cell and reveal
a function for hmc that has similarities to endothelial cells in mammals.
2.2 Introduction
Neuropeptide signaling plays critical roles in diverse behavioral processes, including feeding,
memory, and sleep (Melzer et al., 2021; Sohn et al., 2013; Tsujino and Sakurai, 2009). Disruption in
neuropeptide signaling is implicated in behavioral disorders, such as eating, epilepsy, and insomnia (Kovac
and Walker, 2013; Lutter et al., 2017; Winrow and Renger, 2014). Neuropeptides are small molecules that
bind to G protein-coupled receptors (GPCRs). Once secreted from neurons, neuropeptides activate GPCRs
on target cells to modulate their function. The effects of modulation can be both inducing activation and
inhibition of the target cell activity. Despite their various function for behavior, it is still largely unknown
11

how neuropeptides modulate target cell activities to shape behavioral outputs.
C. elegans has served as an exceptional animal model for understanding the impact of neuropeptide
signaling on behaviors due to its nearly defined connectome of 302 neurons, powerful genetics, in vivo
calcium imaging, mostly revealed transcriptomes, and various behavioral outputs. Previous studies have
revealed roles for neuropeptides in modulating target cell activities both positively and negatively to
regulate behaviors. For example, neuropeptides activate target neurons to regulate behaviors, such as local
search (Chalasani et al., 2010), foraging (Flavell et al., 2013), and aversive learning (Fadda et al., 2020).
The inhibition effects via neuropeptide signaling have been shown in circuits that regulate egg-laying
(Ringstad and Horvitz, 2008), locomotion quiescence (Choi et al., 2013), and reversal behavior (Bhardwaj
et al., 2018). These modulation effects, however, are mostly explored in the communication between
neurons with few exceptions directly on muscles (Florman and Alkema, 2022; Stawicki et al., 2013).
Here, we identify a simple behavioral circuit in which neuropeptides function as transmitters to
control the activation of target cells. The downstream target cell in the circuit is a cell with previously
unknown function: the head mesodermal cell (hmc). hmc is a large H shaped cell with a cell body on the
dorsal side of the neck, and four long processes that extend ventrally, anteriorly and posteriorly along the
length of dorsal and ventral neck muscles (Ghosh et al., 2017). Prior ultrastructural studies found that the
hmc cell body and processes are exposed to the pseudocoelom, a body cavity into which neurons secrete
neuropeptides (Altun and Hall, 2009), and are also connected to the neck muscles by numerous large gap
junctions (White John et al., 1976). Transcriptomic analysis of hmc reveals a complex gene expression
profile not characteristic of any of the major tissues (muscle, neuron, intestine or skin), but highly enriched
for a number of GPCRs, as well as genes associated with signal transduction and calcium-mediated
signaling (Mathies et al., 2019). The position, morphology, and transcriptional profile of hmc raises the
possibility that hmc may play a role in coupling intercellular signaling events to neck muscle contraction.
The anterior body wall muscle contraction (aBoc) is a discrete contraction of the neck muscles that
12

repeats every 50 seconds during the defecation motor program, which is a pacemaker-controlled rhythmic
behavior that functions to expel digested food from the intestine and to regulate nutrient uptake (Sheng et
al., 2015; Thomas, 1990). Prior laser ablation studies have shown that the motor neuron AVL is required
for aBoc (McLntire et al., 1993), and that disrupting neuropeptide processing or secretion results in missing
aBoc (Nagy et al., 2015; Speese et al., 2007), but the underlying cellular and molecular mechanisms
controlling aBoc had not been defined. Here, we show that AVL rhythmically activates hmc every 50
seconds in phase with AVL activation and neck muscle contraction. We find the secretion of the
neuropeptide-like protein FLP-22 from AVL is critical for hmc activation and neck muscle contraction.
FLP-22 activates the FRPR-17 GPCR in hmc, which in turn controls calcium spike generation through a
conserved PKA signaling pathway. We find that gap junctions composed of UNC-9/innexin subunits couple
hmc activation with neck muscles contraction. We find that the rhythmic activation of hmc is also directly
inhibited by a second neuropeptide signaling pathway. Our study identifies a novel behavioral circuit that
is controlled by both activating and inhibiting neuropeptide signaling to control a rhythmic behavior.
2.3 Materials and Methods
Strains and Transgenic lines
Strains were maintained at room temperature on nematode growth media (NGM) plates seeded
with OP50 Escherichia coli as a food source. The wild-type strain was N2 Bristol. Transgenic lines were
generated by injecting into adults with expression plasmids together with co-injection markers KP#708
(Pttx-3::RFP at 40 ng/μL) or KP#1338 (Pttx-3::GFP at 40 ng/μL) or KP#1106 (Pmyo-2::NLS::GFP at 5
ng/μL) or KP#1368 (Pmyo-2::NLS::mCherry at 5ng/μL) or pJQ70 (Pofm-1::mCherry at 25 ng/μL) or
pDS806 (Pmyo-3::mCherry at 20 ng/μL). Microinjection was conducted using standard procedures. In
general, three lines were analyzed, and one representative line was used for quantification. The strains and
transgenic lines used in this study are listed in Table S2.1.
Molecular Biology
All plasmids were constructed using the backbone of pPD49.26 or pPD95.75. Promoter regions
13

were amplified from C. elegans genomic DNA and coding regions were amplified from mixed stage cDNA.
PCR fragments were used to subclone into expression vectors using standard molecular biological
techniques. A detailed list of plasmids used in this study are described in Table S2.1.
flp-22(OE) suppressor screening and frpr-17 cloning
The parental strain carrying the Prab-3::flp-22 array (flp-22(OE)) was mutagenized with EMS for
a standard non-clonal F 2 screen. F2 progeny of ~10,000 mutagenized genomes were screened and one
mutant that suppressed the uncoordinated phenotype of flp-22(OE) was identified. The vj249 mutation was
mapped to LG I using three point mapping. The lesion of vj249 in the frpr-17 gene was identified by whole
genome sequencing (at the USC sequencing core) and the software MAQgene as previously described
(Bigelow et al., 2009).
CRISPR/Cas9-generated mutant strains
The deletion mutations in flp-22, frpr-17, nmur-3, and npr-23 were generated using a co-CRISPR
strategy (Arribere et al., 2014). A sgRNA targeting dpy-10 gene and a repair single-stranded
oligodeoxynucleotides (ssODN), to generate a gain of function DPY-10, were co-injected with two sgRNA
for gene of interest, one targeting around the first exon and other targeting around the last exon, and a
ssODN, to induce a non-homologous end joining (NHEJ). Fifteen adults were injected with the Cas9
enzyme containing mix of sgRNAs and ssODN. Twenty F1 animals were singled from five plates that
carried Dpy or Rol phenotype. F2 animals were genotyped to select the deletion mutants. The homozygous
mutants were outcrossed with wild-type at least four times before being used for experiments.
Behavioral assays
The defecation motor program was analyzed as previously described (Liu and Thomas, 1994;
Thomas, 1990). Briefly, twenty to thirty L4 animals were moved to a fresh NGM plate seeded with OP50
bacterial lawn and were stored in a 20°C incubator for 24 hours. After 24 hours, at least ten consecutive
defecation cycles were observed from each animal. The pBoc and aBoc steps were recorded using custom
14

Etho software (James Thomas Lab website:http://depts.washington.edu/jtlab/software/otherSoftware.html).
At least three animals were assayed, and the mean and the standard error was calculated for each genotype.
Feeding RNA interference
RNAi plates were made using established protocols. Seven gravid adult animals were bleached on
RNAi pales seeded with HT115 (DE3) bacteria that was transformed with the targeted gene insert in the
L4440 vector for knockdown. Three to four days later, adult animals were assayed for the defecation motor
program. RNAi clones were from the Ahringer or Vidal RNAi library.
Fluorescence imaging
Fluorescence imaging was done by using a Nikon eclipse 90i microscope equipped with a Nikon
Plan Apo 20x, 40x, 60x, and 100x oil objective (N.A.=1.40), and a Photometrics Coolsnap ES2 camera or
a Hamamatsu Orca Flash LT+ CMOS camera. L4 animals were transferred to a fresh NGM plate seeded
with OP50 bacterial lawn and were stored in a 20°C incubator for 24 hours prior to imaging. Adult animals
were paralyzed with 30 mg/ml 2, 3- Butanedione monoxime (BDM, Sigma) in M9 buffer, and then mounted
on 2% agarose imaging pad. Metamorph 7.0 software (Universal Imaging) was used to capture image stacks
and to obtain maximum intensity projections. All images were captured from left or right laterally
positioned animals facing up. Fluorescence imaging of AVL and hmc were captured from the neck region
where the terminal bulb of the pharynx is located. To analyze the ablation of hmc in N2 and hlh-8, GFP
was expressed in both AVL and hmc (Pnmur-3::gfp) and the neck region was imaged in adult animals.
Live calcium imaging
Calcium imaging was performed using freely moving adult animals. To limit the light stimulated
movement while recording, lite-3 gur-3 genetic background was introduced into wild-type and all the
mutants used in this study (Bhatla and Horvitz, 2015; Edwards et al., 2008). Calcium imaging plates were
prepared by making NGM plates with agarose instead of agar. OP50 bacteria were seeded on NGM-agarose
plates 5 days prior to imaging. For calcium imaging simultaneously in the cell body of AVL and hmc, we
15

used a transgenic line vjEx2548 (Pofm-1::mCherry, Pnmur-3::GCaMP6, Pnlp-40::GCaMP3) to express
GCaMP6 in AVL and hmc, and GCaMP3 in the intestine. Thirty to forty L4 stage animals were transferred
to a normal NGM plate and were stored in a 20°C incubator for 24 hours prior to imaging. Adult animals
were transferred to NGM-agarose plates seeded with OP50 and the plates were topped with a cover slide.
Live imaging was done using a Nikon eclipse 90i microscope equipped with a Nikon Plan Apo 20x oil
objective (N.A.=1.0), a standard GFP filter and a Hamamatsu Orca Flash LT+ CMOS camera. The animals
that were pumping and positioned laterally with the left or right side facing the objective were selected for
imaging. Metamorph 7.0 software (Universal Imaging) was used to obtain time lapse imaging. For each
animal, the cell body of AVL and hmc together was recorded at 4 frames per second (2x2 binning with 30
ms exposure time).
The GCaMP6 fluorescence intensity in the cell body of AVL and hmc was quantified using ImageJ.
The integrated fluorescence (F) of GCaMP6 was calculated by the integrated fluorescence density of a
region of interest (ROI) within a 20x20 circle that covers the cell body of AVL or hmc minus the
background integrated fluorescence density measured in the pharyngeal metacorpus. The baseline
fluorescence (F
0) was defined by the average GCaMP6 fluorescence in the first 10 frames before the
initiation of AVL or hmc activation. The fluorescent change of GCaMP6 for each frame was defined as
ΔF/F 0 = (F-F 0)/F 0.
aBoc was captured during calcium imaging by observing the movement of the terminal pharyngeal
bulb and measuring the area of the anterior intestinal lumen. In cycles with full aBoc, the terminal
pharyngeal bulb rapidly displaced toward the anterior intestine, which was referred to aBoc start, resulted
in a shrinkage of the anterior intestinal lumen. The complete shrunk of the anterior intestinal lumen was
considered aBoc max, and maintaining aBoc max for at least 500 ms was considered full aBoc. The partial
aBoc referred to cycles with aBoc max lasting less than 500 ms. The no aBoc referred to cycles with not
completely shrunk anterior intestinal lumen or no terminal pharyngeal bulb displacement.
16

Cell ablation by miniSOG
Transgenic lines were generated by expressing membrane-targeted miniSOG in hmc (Pnmur-
3(Δ)::PH domain::miniSOG). To ablate hmc, twenty to thirty L4 stage transgenic animals were transferred
to an OP50 seeded NGM plate. The plate was illuminated with blue light using an EXFO mercury light
source for 10 minutes with the cover off. Blue light illuminated animals were recovered at 20°C for 24
hours, and then assayed for the defecation motor program.
2.4 Results
2.4.1 The aBoc step is controlled by peptidergic signaling from the AVL neuron
The defecation motor program (DMP) is composed of three sequential muscle contractions
occurring every 50 s that starts with the posterior body wall muscle contraction (pBoc), followed by the
anterior body wall muscle contraction (aBoc), and lastly enteric muscle contraction which leads to
expulsion (Exp) (Thomas, 1990). aBoc begins about four seconds after pBoc starts, reaching full contraction
of the neck muscles about a second later followed by a slower relaxation (Jiang et al., 2022; Nagy et al.,
2015). The DMP starts with a calcium oscillation in the intestine (Nehrke et al., 2008; Teramoto and
Iwasaki, 2006), that leads to the release of protons, which promote pBoc (Beg et al., 2008; Pfeiffer et al.,
2008), and the release of the neuropeptide-like protein, NLP-40, which rhythmically activates two
GABAergic motor neurons, AVL and DVB (Wang et al., 2013). AVL and DVB activation leads to GABA
release from NMJs, causing contraction of the enteric muscles for expulsion (Beg and Jorgensen, 2003).
We found that ablation of AVL by expressing the Caspase-1/Interleukin-1 converting enzyme ICE
under an AVL-specific promoter fragment (((Pnmur-3(1k)), Fig. S2.1A and S2.1B), used hereafter for all
AVL-specific expression), led to the aBoc step being absent in nearly all cycles, reducing aBoc frequency
from 100% to less than 10% (Fig 2.1B), in agreement with laser ablation studies of AVL (McLntire et al.,
1993). AVL is rhythmically activated by the intestine through the calcium-dependent release of NLP-40
from the intestine (Wang et al., 2013). Mutants lacking either nlp-40 or its receptor, aex-2 exhibited a
significant decrease in aBoc frequency (Fig. 2.1B), albeit to a lesser extent compared to AVL ablation. The
17

aBoc frequency defects of nlp-40 mutants could be fully rescued by expressing nlp-40 cDNA selectively in
the intestine (using the ges-1 promoter, Fig. 2.1B). Similarly, the missing aBocs of aex-2 mutants could be
restored by expressing aex-2 cDNA selectively in AVL (Fig. 2.1B). Thus nlp-40-activated aex-2 signaling
in AVL provides the major (but not the entire) drive for aBoc.
AVL forms GABAergic synapses with the enteric muscles to promote the Exp step (Beg and
Jorgensen, 2003), but GABA is not required for aBoc because unc-25/glutamate decarboxylase null
mutants, which lack GABA, have normal aBoc frequencies (Fig. S2.2A and (McLntire et al., 1993; Thomas,
1990)). AVL expresses a number of neuropeptide-like proteins as well as neuropeptide processing and
release proteins (Taylor et al., 2021). Neuropeptides are secreted from dense core vesicles by SNARE-
mediated release (Sugita, 2008). Expression of tetanus toxin (TeTx) selectively in AVL, which blocks
SNARE-mediated exocytosis (Schiavo et al., 1992), reduced aBoc frequency to 24% (Fig 2.1B). egl-3
encodes the ortholog of prohormone convertase 2, which cleaves neuropeptide precursors in DCVs during
maturation (Husson et al., 2006). egl-3 mutants had significantly reduced aBoc frequencies, and these
defects could be fully rescued by expressing egl-3 cDNA selectively in AVL (Fig S2.2A). These results
indicate that neuropeptide signaling originating in AVL is critical for the execution of aBoc.
2.4.2 The FLP-22 FMRFamide-like neuropeptide is necessary for aBoc
To identify the neuropeptide(s) that control aBoc, we screened for genes encoding FMRFamides
(FLPs) or neuropeptide-like proteins (NLPs) that cause aBoc defects when knocked down by RNA
interference (RNAi). flp-22 encodes a FMRFamide neuropeptide protein that is cleaved by egl-3/PC2
(Husson et al., 2006), and is expressed in high levels in AVL but has no previously reported function.
Knockdown of flp-22 by RNAi or knockout of flp-22 using CRISPR/Cas9 significantly reduced aBoc
frequencies to 60% (Fig. 2.1C). flp-22 mutants had grossly normal locomotion and egg laying rates, and
had DMP cycle length and Exp frequency similar to wild type animals (Fig. S2.2C and D), suggesting a
specific defect in aBoc. flp-22 is the second most abundant gene expressed in AVL, and it is expressed in
a small number of additional neurons at lower levels (Taylor et al., 2021). The aBoc defects of flp-22
18

Figure 2.1 AVL controls aBoc through peptidergic signaling to hmc. (A) Diagram showing the circuit controlling
aBoc. (B) Quantification of the number of aBoc per defecation cycle in adult animals of the indicated genotypes.
“intestinal nlp-40” denotes nlp-40 cDNA expressed under the intestine-specific ges-1 promoter. “AVL aex-2”, “AVL
ICE”, and “AVL TeTx” denote aex-2 cDNA, ICE, or TeTx expressed in AVL using the nmur-3(1k) promoter. (C)
Quantification of the number of aBoc per defecation cycle in adult animals of the indicated genotypes. “GABAergic
flp-22” and “Cholinergic flp-22” denote flp-22 cDNA expressed under the GABAergic-specific unc-47 and
cholinergic-specific unc-129 promoter, respectively. “AVL flp-22” denotes flp-22 cDNA expressed in AVL using the
nmur-3(1k) promoter. “neuronal frpr-17” denotes frpr-17 cDNA expressed under the pan-neuronal rab-3 promoter.
“muscle frpr-17” denotes frpr-17 cDNA expressed under the muscle-specific myo-3 promoter. “hmc frpr-17” denotes
frpr-17 cDNA expressed in hmc using the nmur-3(Δ) promoter. (D) Left, schematic of the location of AVL and hmc
in the neck region and representative images showing GFP transcriptional reporters in wild-type and hlh-8 mutants.
“AVL + hmc GFP” denotes expressing gfp under the numr-3 promoter. GFP fluorescence is not detectable in hlh-8
mutants (0 out of 20 animals exhibited GFP fluorescence in hmc). Right, Quantification of the number of aBoc per
defecation cycle in adult animals of the indicated genotypes. “hmc miniSOG” and “hmc ICE” denote transgenes
expressing miniSOG or ICE in hmc under control of the nmur-3(Δ) promoter. Means and standard errors are shown.
*** P<0.001 and * P<0.05 in Student’s t test; n.s., not significant.
19

mutants could be fully rescued by expressing flp-22 cDNA in GABAergic motor neurons including AVL
(using the unc-47 promoter), whereas expression of flp-22 cDNA in in cholinergic neurons (using the unc-
129 promoter) failed to rescue (Fig. 2.1C). Expression of flp-22 cDNA selectively in AVL (using nmur-
3(1k) promoter) partially rescued the aBoc frequency defects of flp-22 mutants (Fig. 2.1C). Thus, the
neuronal sources of FLP-22 for aBoc are AVL as well as one or more additional GABAergic neurons.
Taken together, the control of aBoc by AVL is mediated in part by secretion of FLP-22 from AVL. Because
aBoc was not eliminated in flp-22 mutants, additional unidentified neuropeptides secreted from AVL are
likely to promote aBoc.
2.4.3 The FRPR-17 neuropeptide GPCR functions downstream of FLP-22 to promote aBoc
The FLP-22 pro-peptide is processed into three identical 9 amino acid long peptides that have been
isolated from worm lysates (Husson et al., 2006). To identify the receptor of FLP-22, we conducted a
genetic screen for suppressors of the uncoordinated phenotype caused by flp-22 cDNA overexpression
(FLP-22(OE)). One of the suppressors, vj249, carries a missense mutation that is predicted to alter an amino
acid in the extracellular domain of the orphan FMRFamide-like GPCR frpr-17 (Fig. S2.2B). vj249 mutants
as well as a frpr-17 null mutant that deletes the entire frpr-17 coding sequence (Fig. S2.2B) had aBoc
frequencies of 60% (Fig. 2.1C), and had superficially normal locomotion, egg laying, DMP cycle lengths
and Exp frequency (Fig. S2.2C and D). Double mutants lacking both frpr-17 and flp-22 exhibited aBoc
defects similar to those of either flp-22 or frpr-17 single mutants (Fig. 2.1C). Thus, flp-22 and frpr-17
function in a common genetic pathway to promote aBoc and frpr-17 function downstream of flp-22.
2.4.4 FRPR-17 functions in hmc for aBoc
To determine in which tissue frpr-17 functions for aBoc, we conducted tissue specific rescue
experiments of fpr-17 mutants. frpr-17 transcripts are detected in a subset of neurons, body wall muscle,
and hmc (Mathies et al., 2019; Taylor et al., 2021). frpr-17 expression in either neurons or muscles failed
to rescue the aBoc defects of frpr-17 mutants (Fig. 2.1C), whereas expression in hmc (under the arg-1
promoter (Zhao et al., 2007)) fully rescued (Fig. S2.2A). Expression of frpr-17 cDNA under a fragment of
20

the nmur-3 promoter (Pnmur-3(Δ)), which drives GFP expression selectively in hmc (Fig. S2.1A and
S2.1B), also fully restored wild type aBoc frequency to frpr-17 mutants (Fig. 2.1C). FRPR-17::GFP fusion
proteins expressed in hmc adopted a diffuse pattern of localization that could be seen throughout both the
dorsal and ventral processes of hmc and surrounding the cell body of hmc (Fig. 2.4C). This localization
pattern is consistent with FRPR-17 residing on the plasma membrane of hmc where it would be exposed to
signals released into the pseudocoelom cavity (Altun and Hall, 2009). Thus, flp-22 functions in AVL and
frpr-17 functions in hmc to promote aBoc.
2.4.5 hmc controls aBoc
Several experiments indicate that hmc is required for the execution of aBoc. First, hlh-8 encodes
the sole ortholog of the human basic helix-loop-helix domain containing mesodermal transcription factor
TWIST, and hlh-8 is expressed in hmc and is required for hmc differentiation ((Harfe et al., 1998; Meyers
and Corsi, 2010; Zhao et al., 2007) and O. Hobert, personal communication). We found that in hlh-8 null
mutants, gfp driven by the nmur-3 promoter was no longer detected (Fig. 2.1D), and aBoc occurred in just
~35% of cycles (Fig. 2.1D). Next, we ablated hmc by expressing ICE selectively in hmc, and found that
ICE expression reduced aBoc frequency to a similar extent as in hlh-8 mutations (Fig. 2.1D). Finally, we
expressed mini singlet oxygen generator (miniSOG), a photosensitizer that generates reactive oxygen
species after blue light illumination (Qi et al., 2012; Xu and Chisholm, 2016), selectively in hmc. miniSOG
activation at the L4 stage (after hmc is differentiated) led to aBoc defects one day later in adulthood similar
to ICE-ablated animals (Fig. 2.1D). Importantly, the aBoc frequency in hmc-ablated animals was not further
reduced by flp-22 or frpr-17 mutations (Fig. 2.1D), confirming that frpr-17 signaling exclusively in hmc
controls aBoc frequency. Thus, hmc has a post-developmental role in promoting aBoc downstream of AVL.
2.4.6 hmc is rhythmically activated by AVL
Since AVL is rhythmically activated by the pacemaker signal from the intestine every 50 seconds,
we reasoned that if hmc is a target of FLP-22 it may also be rhythmically activated in phase with AVL. To
determine whether hmc undergoes rhythmic activation, we captured time lapse videos of animals
21

Figure 2.2 hmc is rhythmically activated by FLP-22-FRPR-17 signaling. (A) Representative images from videos
showing GCaMP fluorescence in the intestine, AVL, and hmc before cycle start, at cycle start indicated by intestinal
oscillation, and at onset of AVL and hmc activation in animals expressing GCaMP3 in intestine (under the nlp-40
22

promoter) and GCaMP6 in AVL and hmc (under the nmur-3 promoter). (B) Representative traces showing the calcium
dynamics at the anterior region of intestine, AVL soma, and hmc cell body during the defecation cycle in adult animals.
Every 50 seconds, the cycle starts with the intestinal calcium oscillation followed by the AVL and hmc calcium spike
3 seconds after the cycle start. (C-E) Quantification of the number of calcium spikes observed in AVL and hmc during
DMP in adult animals of the indicated genotypes. Wild-type: 33 cycles in 8 animals, aex-2: 36 cycles in 7 animals,
aex-2; AVL aex-2: 20 cycles in 4 animals, AVL ICE: 43 cycles in 9 animals, flp-22: 49 cycles in 9 animals, frpr-17:
56 cycles in 13 animals, flp-22; frpr-17: 43 cycles in 9 animals, frpr-17; hmc frpr-17: 20 cycles in 7 animals, flp-22;
frpr-17; hmc frpr-17: 42 cycles in 9 animals. *** P<0.001 in Fisher’s exact test; n.s., not significant. (F) Violin plots
of calcium spike initiation time in hmc after the end of intestinal calcium oscillation. Dashed line refers median and
dotted lines refer quartiles. ** P<0.01 in Kruskal-Wallis test with Dunn's correction for multiple comparisons; n.s.,
not significant. (G) Traces of calcium dynamics in hmc aligned to the calcium spike initiation time. The solid lines
indicate average fold change in GCaMP intensity and the shades indicate SEM. Quantification of the average peak
amplitude, rise time, and half-decay time. Strains used for live calcium imaging contain lite-1 gur-3 background to
limit light-stimulated movement. Means and standard errors are shown. ** P<0.01 and * P<0.05 in ANOVA with
Bonferroni’s correction for multiple comparisons; n.s., not significant.
23

expressing the calcium indicator GCaMP simultaneously in the intestine, AVL, and hmc (Fig. 2.2A and
Movie S2.1), and analyzed the timing and extent of calcium responses in each of these tissues. In between
cycles, a constant low level of GCaMP fluorescence was detected in the intestine, the AVL soma, and the
hmc cell body. About every 50 seconds, GCaMP fluorescence increased in the intestine, marking the
beginning of each cycle. About three seconds later, GCaMP fluorescence intensity rapidly increased in the
AVL soma and its process, peaked after about 1 s and decayed slowly (average half-decay time =4.63 s)
(Fig 2.2B and S3C). Within 250ms of the calcium spike initiation in AVL, fluorescence intensity rapidly
increased in the hmc cell body and processes, peaked slightly after the peak in AVL, and decayed slowly
before returning to baseline (average half-decay time =9.55 s) (Fig. 2.2B and G). The calcium spikes in
both AVL and hmc were robust, with hmc showing a significantly larger peak amplitude (averaging 12 fold
increase from baseline) compared to AVL (averaging 2 fold increase from baseline, Fig. 2.2B, G, and
S2.3C).
By examining the timing and extent of neck contractions from the time lapse images, we found that
each calcium spike in hmc was accompanied by an aBoc, which consisted of a rapid posterior-directed
displacement of the terminal pharyngeal bulb into the anterior intestine that for at least 500ms followed by
a slower relaxation (Fig. S2.2E and F). Each aBoc initiated at the same time as the initiation of the hmc
calcium spike and reached maximal contraction at the peak of the hmc calcium spike. Thus, hmc is
rhythmically activated in phase with the intestine and AVL, and the maximal aBoc contraction occurs at
the peak of each calcium spike in hmc.
To determine whether AVL activates hmc, we examined calcium responses in hmc following
disruption of AVL activation. Genetic ablation of AVL (using ICE), resulted in a near elimination of hmc
activation, reducing calcium spike frequency from 100% to less than 10% per cycle (Fig. 2.2D). Silencing
AVL (in aex-2/GPCR mutants), nearly eliminated calcium spikes in both AVL and hmc (Fig. 2.2C and D),
and both AVL and hmc activation could be restored by expressing aex-2 cDNA selectively AVL (Fig. 2.2C
and D). Conversely, silencing hmc had no effect on kinetics or dynamics of AVL activation (Fig S2.3A-C,
24

see below). Together, these results indicate that AVL functions upstream of hmc, revealing a circuit for
aBoc in which the intestine rhythmically activates AVL every 50 seconds, which rhythmically activates
hmc, which leads to muscle contraction every 50 seconds.
2.4.7 FLP-22-FRPR-17 signaling activates hmc
AVL extends a process along the dorsal side of the ventral nerve cord bundle in the neck region,
where it is exposed to the pseudocoelom and is in close proximity to the ventral hmc process (Fig. 2.4A).
To determine whether FLP-22 secreted from AVL has access to hmc, we expressed FLP-22 tagged to the
GFP variant pHluorin (FLP-22::pHluorin) specifically in AVL and examined the fluorescence pattern in
animals expressing a GFP binding domain specifically on the surface of hmc (SAX-7::GBD, (Tao et al.,
2019)). Animals expressing FLP-22::pHluorin in AVL exhibited no fluorescence since pHluorin is
quenched in DCVs, which are acidic. However, in animals expressing both FLP-22::pHluorin in AVL and
SAX-7::GBD in hmc, fluorescence was seen along the hmc processes and on the surface of the cell body
(Fig. S2.4A and B). Thus, FLP-22 secreted into the pseudocoelom from AVL can bind to hmc processes.
To determine whether endogenous flp-22 signaling activates hmc, we conducted live calcium
imaging of flp-22 and frpr-17 mutants. flp-22 or frpr-17 mutants exhibited normal calcium spike frequency
and dynamics in AVL (Fig. S2.3A-C), whereas calcium spike frequency in hmc was reduced from 100%
to 20% (Fig. 2.2E and Movie S2.2). The remaining hmc calcium spikes were slightly delayed and larger in
amplitude compared to wild-type controls (Fig. 2.2F and G). flp-22; frpr-17 double mutants exhibited
reductions in calcium spike frequency that were similar to those of the single mutants (Fig. 2.2E). The
reduced calcium spike frequency of frpr-17 mutants could be fully rescued by expressing frpr-17 cDNA
selectively in hmc, and rescue by frpr-17 cDNA was abolished by flp-22 mutations (Fig. 2.2E). Taken
together, these results indicate that the rhythmic hmc activation derives predominantly from FLP-22-
activated FRPR-17 signaling in hmc.
Examination of aBoc in time lapse images revealed that full aBoc contractions were observed in
25

about 70% of cycles in flp-22 or fpr-17 mutants (Fig. S2.2F), corresponding well with the ~60% aBoc
frequency observed in the behavioral assays in these mutants. In cycles in which hmc was activated, there
was always an accompanying aBoc that occurred at the initiation of hmc calcium spike. In cycles lacking
hmc activation, normally-timed aBoc contractions were often observed: full aBoc occurred in 70% of cycles,
smaller “partial aBoc” occurred in about 20% of the cycles, and no aBoc occurred in the remaining 10% of
cycles (Fig. S2.2E and 2.2F). The partial aBocs were characterized by a smaller displacement of the pharynx
into the intestine or were shorter in duration (lasting less than 500ms) compared to full aBocs (Fig. S2.2F),
and are likely to be too small to be detected with the behavioral aBoc assay. Thus, full aBoc or partial can
occur even in the absence of hmc activation, in agreement with our hmc ablation studies revealing the
existence of an hmc-independent pathway that promotes aBoc.
2.4.8 PKA functions downstream of FRPR-17 to facilitate hmc activation
How does FRPR-17 activation lead to calcium spikes in hmc? GPCRs activate heterotrimeric G
proteins. To identify the signaling cascade downstream of frpr-17, we first examined the three Gα subunits
of the heterotrimeric G proteins, gsa-1/Gαs, goa-1/Gαi/o, and egl-30/Gαq that are the most highly expressed
in hmc (Mathies et al., 2019). RNAi-mediated knockdown of gsa-1/Gαs caused significant reductions in
aBoc frequency, whereas knockdown of goa-1/Gαi/o or loss of function mutations in egl-30/Gαq caused
no defects (Fig 2.3A). Gαs activates an evolutionarily conserved adenylyl cyclase – protein kinase A (PKA)
signaling cascade. RNAi-mediated knockdown of the PKA catalytic subunit, kin-1, reduced aBoc frequency
to 30% (Fig. 2.3A), and hmc-specific expression of dominant negative PKA[DN] transgenes (Skalhegg and
Tasken, 2000; Wang and Sieburth, 2013), reduced aBoc frequency to about 35%, similar to hmc ablation
(Fig. 2.3A). Together, these results suggest that FRPR-17 controls aBoc by activating PKA in hmc.
To determine how PKA signaling controls aBoc, we examined calcium dynamics and aBocs in
animals expressing PKA[DN] transgenes in hmc. Calcium spike frequency and initiation time in hmc were
similar in PKA[DN] transgenic animals and non-transgenic controls (Fig. 2.3B and D), but the average
calcium spike amplitude was reduced by 40%, and the average time to half-decay was significantly faster
26

Figure 2.3 PKA functions downstream of FRPR-17 to facilitate hmc activation. (A) Quantification of the number
of aBoc per defecation cycle in adult animals of the indicated genotypes and in adults treated with RNAi. “hmc
PKA[DN]” denotes expressing PKA dominant negative variants using the nmur-3(Δ) promoter. Means and standard
errors are shown. *** P<0.001 in Student’s t test. (B) Quantification of the number of calcium spikes observed in hmc
during DMP in adult animals of the indicated genotypes. “hmc PKA[DN]” and “hmc PKA[CA]” denote transgenes
expressing PKA dominant negative or PKA constitutively active variants under the control of the nmur-3(Δ) promoter.
Wilde type: 33 cycles in 8 animals, hmc PKA[DN]: 63 cycles in 21 animals, frpr-17: 56 cycles in 13 animals, frpr-17;
hmc PKA[CA]: 27 cycles in 6 animals. *** P<0.001 in Fisher’s exact test; n.s., not significant. (C) Quantification of
the number aBoc observed in the live calcium imaging records. *** P<0.001 in Fisher’s exact test; n.s., not significant.
(D) Violin plots of calcium spike initiation time in hmc after the end of intestinal calcium oscillation. Dashed line
refers median and dotted lines refer quartiles. *** P<0.001 and * P<0.05 in Kruskal-Wallis test with Dunn's correction
for multiple comparisons. (E) Traces of calcium dynamics in hmc aligned to the calcium spike initiation time. The
27

solid lines indicate average fold change in GCaMP intensity and the shades indicate SEM. Quantification of the
average peak amplitude and half-decay time. Strains used for live calcium imaging contain lite-1 gur-3 background
to limit light stimulated movement. Means and standard errors are shown. *** P<0.001 in ANOVA with Dunnett's
correction for multiple comparisons.
28

than controls (Fig. 2.3E). In PKA[DN] animals, each calcium spike was accompanied by an aBoc only 47%
of the time. The remaining calcium spikes were accompanied by either no aBoc or by partial aBocs (Fig.
2.3C). These results suggest that that PKA signaling in hmc controls aBoc by increasing calcium spike
amplitude and/or duration above a threshold needed for full aBoc.
To determine whether PKA activity in hmc is sufficient to activate hmc, we generated constitutively
active (PKA[CA]) transgenes (Orellana and McKnight, 1992; Wang and Sieburth, 2013). PKA[CA]
expression in hmc increased the frequency of calcium spikes of frpr-17 mutants from 20% to 70% (Fig.
2.3B). The calcium spikes did not occur at the normal time, but instead were “ectopic”, occurring at random
times during cycle intervals (Fig. 2.3D). The average amplitude of the ectopic calcium spikes was 20% of
that of wild type calcium spikes, and these spikes were never associated with aBoc (Fig. 2.3C and E). Thus,
unregulated PKA activation can lead to calcium spike generation in hmc at random times. Taken together,
these results suggest that the activation of hmc is not an all-or-none response, and that the PKA signaling
in hmc ensures that calcium spikes reach a threshold needed to trigger aBoc.
2.4.9 The gap junction protein UNC-9 functionally couples hmc and neck muscles to promote aBoc
How does hmc activation lead to neck muscle contraction? Prior ultrastructural studies show that
the hmc cell body and processes form extensive gap junctions with neck muscles (Fig. 2.4A). Gap junctions
are composed of multimers of subunits (termed connexins in vertebrates and innexins in invertebrates) that
form hemichannels. Hemichannels from coupled cells form gap junctions. C. elegans encodes 25 innexins,
four of which, unc-9, inx-7, inx-10, and inx-11 are expressed at high levels in hmc (Mathies et al., 2019).
Null mutations in unc-9/innexin, which is the most highly expressed innexin in hmc, caused significant
reductions in aBoc frequency (32%, Fig. 2.4B), while null mutations in the other innexins did not cause
aBoc defects (Fig. S2.5A). Expression of unc-9 cDNA selectively in hmc rescued the aBoc defects of unc-
9 mutants, whereas expression of unc-9 cDNA in muscles failed to rescue (Fig. 2.4B). Functional UNC-
9::mTurq2 fusion proteins adopted a highly punctate pattern of fluorescence in both dorsal and ventral
processes of hmc as well as the hmc cell body (Fig. 2.4C). These results indicate that UNC-9/innexin is a
29

Figure 2.4 Gap junction UNC-9 mediates hmc signaling to anterior body-wall muscles. (A) Above, schematic
showing the processes of hmc and the region of gap junction coupling with neck muscles. Below, transmission electron
micrograph images of AVL, with or without neck muscle arm, hmc, and pseudocoelom (PS) in cross section in the
ventral posterior region of hmc process, showing a large gap junction (arrow) between neck muscle arm and hmc. The
gap junction appears as an electron dense area where the plasma membranes of the neck muscle arm and hmc contact
each other. Adapted with permission from David Hall, Albert Einstein College of Medicine. (B) Quantification of the
number of aBoc per defecation cycle in adult animals of the indicated genotypes. “hmc unc-9” and “muscle unc-9”
denote expressing unc-9 cDNA under the nmur-3(Δ) and myo-3 promoter, respectively. Means and standard errors are
30

shown. *** P<0.001 in Student’s t test; n.s., not significant. (C) Representative images of NLS::mCherry (arrow),
FRPR-17::Venus (plasma membrane of hmc), UNC-9::mTurq2 (arrowheads) in hmc from an adult co-expressing
fusion proteins under the nmur-3(Δ) promoter. (D) Quantification of the number of calcium spikes observed in AVL
and hmc during DMP in adult animals of unc-9 mutants. unc-9: 27 cycles in 9 animals. Fisher’s exact test; n.s., not
significant. (E) Quantification of the number aBoc observed in the live calcium imaging records. *** P<0.001 in
Fisher’s exact test. (F) Traces of calcium dynamics in hmc aligned to the calcium spike initiation time. The solid lines
indicate average fold change in GCaMP intensity and the shades indicate SEM. Quantification of the average peak
amplitude, rise time, and half-decay time. unc-9 (no aBoc) refers to cycles with calcium spike followed by no aBoc
and unc-9 (aBoc) refers to cycles with calcium spike followed by aBoc. Strains used for live calcium imaging contain
lite-1 gur-3 background to limit light stimulated movement. Means and standard errors are shown. ** P<0.01 in
ANOVA with Bonferroni’s correction for multiple comparisons; n.s., not significant.

31

component of the hemichannel on the hmc side of the gap junctions that is critical for aBoc.
If gap junctions couple hmc activation to neck muscle contraction, we predict that unc-9 mutations
should eliminate aBoc without altering hmc calcium spike frequency or dynamics. We found that calcium
spike frequencies in AVL and hmc were normal in unc-9 mutants, and calcium spike amplitudes and decay
times in hmc were indistinguishable from wild type controls (Fig. 2.4D, F, and S2.5B), indicating that hmc
activation is not compromised in unc-9 mutants. However, in unc-9 mutants, aBocs were observed in 40%
of cycles (Fig. 2.4E), which corresponds well with the aBoc frequency of 32% observed in the behavioral
assays. In the remaining cycles aBocs were either partial or absent (Fig. 2.4E). Thus, unc-9 is critical for
normal aBoc frequency but not for hmc activation. These results are consistent with the idea that unc-9
functions as a gap junction protein in hmc to couple hmc activation with neck muscle contraction.
2.4.10 hmc activity is negatively regulated by FLP-9-FRPR-21 signaling in hmc
To identify additional GPCR signaling pathways that regulate hmc activity during aBoc, we
examined mutants corresponding to each of the most highly expressed GPCRs in hmc (after frpr-17). These
include five orphan neuropeptide GPCRs frpr-21, nmur-3, npr-23, T11F9.1, and frpr-4 as well as one
orphan class D GPCR srd-32 (Fig. S2.7A). Each of these genes is also highly enriched in hmc (Mathies et
al., 2019). Null mutants in four of these genes, npr-23, T11F9.1, frpr-4, or srd-32 exhibited aBoc
frequencies and calcium spike frequencies in hmc that were similar to wild type controls, nor did they
significantly alter the aBoc or the hmc calcium spike frequency defects caused by frpr-17 mutations (Fig
S2.7B and C). Mutants in these genes did not significantly alter rise time, peak amplitude, or half decay
time of hmc calcium spikes, with the exception of npr-23 mutants, which increased the half decay time of
hmc calcium spikes (Fig. S2.7D). Thus, npr-23, T11F9.1, frpr-4, or srd-32 are likely to have minor effects
on calcium dynamics in hmc.
frpr-21 is the second most highly expressed receptor in hmc after frpr-17 (Fig. S2.7A). frpr-21 null
mutants exhibited aBoc frequencies and calcium spike frequencies in both AVL and hmc that were similar
32

Figure 2.5 hmc activity is negatively regulated by FLP-9/FRPR-21. (A) Quantification of the number of aBoc per
defecation cycle in adult animals of the indicated genotypes. Means and standard errors are shown. Student’s t test;
n.s., not significant. (B) Quantification of the number of calcium spikes observed in hmc during DMP in adult animals
of the indicated genotypes. *** P<0.001 and ** P<0.01 in Fisher’s exact test; n.s., not significant. “hmc frpr-17”
denotes expressing frpr-21 cDNA under the nmur-3(Δ) promoter. (C) Traces of calcium dynamics in hmc aligned to
the calcium spike initiation time. Solid lines indicate average fold change in GCaMP intensity and shades indicate
standard errors. Quantification of the average peak amplitude, rise time, and half-decay time. Student’s t test; n.s., not
significant. (D) Quantification of the number of aBoc per defecation cycle in adult animals of the indicated genotypes.
“flp-9 (OE)” denotes expression of flp-9 cDNA under the GABAergic-specific unc-47 promoter. Means and standard
errors are shown. *** P<0.001 in Student’s t test. (E) Quantification of the number of calcium spikes observed in hmc
during DMP in adult animals of the indicated genotypes. “frpr-21 (OE)” denotes expressing frpr-21 cDNA in hmc
using the nmur-3(Δ) promoter. *** P<0.001 in Fisher’s exact test. (F) Representative image of hmc cell body (arrow)
and processes from adults expressing FRPR-21::GFP in hmc under the nmur-3(Δ) promoter.

33

to wild type controls (Fig. 2.5B and S2.6A), and frpr-21 mutations did not significantly alter rise time, peak
amplitude, or half decay time of calcium spikes in either AVL or hmc (Fig. 2.5C and S2.6B). However,
frpr-21 mutations significantly increased the calcium spike frequency in frpr-17 mutants from 20% to 50%
(Fig. 2.5B). Expression of frpr-21 cDNA in hmc fully reverted calcium spike frequency of frpr-21; frpr-17
double mutants (Fig. 2.5B), suggesting that frpr-21 functions in hmc to inhibit hmc activation.
frpr-21 encodes a FMRFamide neuropeptide GPCR with no reported ligand. flp-9 encodes a
FMFR-like peptide that is predicted to be processed into two identical peptides that have been isolated
from C. elegans lysates (Husson et al., 2006). Synthetic FLP-9 peptides relax muscles and reduce cAMP
levels when injected into the nematode Ascaris suum (Reinitz et al., 2000). We found that like frpr-21
mutations, flp-9 null mutations did not alter aBoc frequencies or calcium dynamics on their own (Fig. 2.5B
and D), but they restored calcium spike frequency to frpr-17 mutants from 20% to 50% (Fig. 2.5B).
FLP-9 is likely to be the ligand for FPRP-21 in regulating aBoc. First flp-9; frpr-21; frpr-17 triple
mutants had a similar calcium spike phenotype as flp-9; frpr-17 or frpr-21; frpr-17 double mutants (Fig.
2.5B). Second, overexpressing frpr-21 cDNA in hmc (frpr-21(OE)) resulted in missing aBocs and hmc
calcium spikes in about 50% of cycles (Fig 2.5E). Similarly, overexpression of flp-9 cDNA in the nervous
system (flp-9(OE)) led to missing aBocs and hmc calcium spikes in about 50% of cycles (Fig. 2.5D and E).
Finally, flp-9(OE); frpr-21 double mutants had wild type aBoc and hmc calcium spike frequency (Fig. 2.5D
and E), indicating that the defects caused by FLP-9 overexpression were mediated by frpr-21. Thus, flp-9
and frpr-21 function in a common genetic pathway, and frpr-21 functions downstream of flp-9 to inhibit
aBoc by negatively regulating hmc activation. Because frpr-21 or flp-9 mutations restore calcium transients
at the proper time in the cycle (albeit slightly delayed) in the absence of frpr-17 signaling, frpr-21 can
inhibit rhythmic hmc activation by a mechanism that is independent of frpr-17 signaling.
2.4.11 NMUR-3 signaling shapes hmc calcium spike amplitude
nmur-3 is the third most highly expressed neuropeptide GPCR in hmc (Mathies et al., 2019), and
34

nmur-3 encodes an ortholog of the neuromedin receptor, which have a number of biological functions
including to regulate calcium dynamics in smooth muscle cells (Martinez and O'Driscoll, 2015). nmur-3
null mutants exhibited calcium spike frequencies, average timing, rise time, amplitude and decay times in
AVL were similar to wild type controls (Fig S2.6A and B), and nmur-3 mutations did not alter calcium
spike frequencies in hmc in wild-type backgrounds or in frpr-17 mutants (Fig. 2.6B). hmc calcium spike
rise and half-decay times in nmur-3 mutants were normal, however, the average calcium spike peak
amplitude in hmc was significantly lower in nmur-3 mutants compared to wild-type controls (Fig. 2.6C).
numr-3 is expression is restricted to hmc, as well as a few neurons including AVL, vulval muscles and the
enteric muscles (Mathies et al., 2019; Taylor et al., 2021). Expressing nmur-3 gDNA in either AVL or in
hmc, fully rescued the decreased peak amplitude of nmur-3 mutants to wild-type (Fig. 2.6D). When
expressed in hmc, NMUR-3::GFP fusion proteins adopted a diffuse localization pattern consistent with
plasma membrane localization (Fig. 2.6E). Thus, nmur-3 positively regulates the amplitude of calcium
spikes without affecting the frequency or timing of calcium spike initiation, and functions either in AVL or
in hmc to regulate calcium spike amplitude.
nmur-3 mutations significantly reduced the aBoc frequency of flp-22 mutants from 60% to 20%
per cycle (Fig. 2.6A). The enhanced aBoc defects in flp-22; nmur-3 double mutants were fully rescued by
expressing numr-3 gDNA in AVL, but not by expressing nmur-3 gDNA in hmc (Fig. 2.6A). We conclude
that nmur-3 has a secondary function in AVL to promote aBoc frequency by regulating a signal from AVL
that controls aBoc independently of hmc.
2.5 Discussion
2.5.1 A model for the circuit controlling aBoc
Here we identified a simple circuit activated by peptidergic signaling that links pacemaker activity
to muscle contraction during a rhythmic behavior. Based on our findings, we suggest the following model
for how this circuit controls aBoc (Fig. 2.7). The calcium wave in the intestine every 50 seconds leads to
the secretion of the pacemaker signal NLP-40 and the subsequent activation of the AEX-2/GPCR on AVL
35

Figure 2.6 NMUR-3 signaling shapes hmc calcium spike amplitude. (A) Quantification of the number of aBoc per
defecation cycle in adult animals of the indicated genotypes. “AVL nmur-3” and “hmc nmur-3” denote expressing
nmur-3 gDNA under the nmur-3(1k) and nmur-3(Δ) promoter, respectively. Means and standard errors are shown.
*** P<0.001 in Student’s t test; n.s., not significant. (B) Quantification of the number of calcium spikes observed in
hmc during DMP in adult animals of the indicated genotypes. Fisher’s exact test; n.s., not significant. (C-D) Traces
of calcium dynamics in hmc aligned to the calcium spike initiation time. The solid lines indicate average fold change
in GCaMP intensity and the shades indicate SEM. Quantification of the average peak amplitude, rise time, and half-
decay time. Strains used for live calcium imaging contain lite-1 gur-3 background to limit light stimulated movement.
Means and standard errors are shown. ** P<0.01 in Student’s t test; n.s., not significant. * P<0.05 in ANOVA with
Dunnett's correction for multiple comparisons. (E) Representative image of hmc cell body (arrow) and processes from
adults expressing NMUR-3::GFP in hmc under the nmur-3(Δ) promoter.
36

leading to the generation of a calcium transient in AVL. AVL activation leads to the calcium dependent
secretion of FLP-22 from the AVL axon, and FLP-22 subsequently binds to the FRPR-17/GPCR on hmc.
FRPR-17 activates the gsa-1/Gas, acy-1/adenylate cyclase, kin-1/PKA signaling pathway in hmc that
results in the generation of a calcium transient in hmc. Gap junctions composed of UNC-9/innexin in hmc
couple the calcium transient in hmc with neck muscle contraction. Two additional GPCR pathways function
in hmc to impact hmc activation and calcium dynamics: FRPR-21 signaling, activated by FLP-
9/neuropeptide negatively regulates the generation of calcium transients in hmc and NMUR-3 signaling
positively regulates calcium transient amplitude.
Because the intestine, AVL, and hmc are not in direct contact with each other, each of the
neuropeptides in this circuit function as volume transmitters following their release into the pseudocoelom.
Once released they diffuse to their targets where they activate GPCR signaling cascades in target cells. We
demonstrated that FLP-22 has access to hmc once it is released from AVL (Fig. S2.4), and functions
upstream of frpr-17 to promote hmc activation (Fig. 2.2E). Since AVL and hmc activate at about the same
(within 250 ms of each other), it is likely that FLP-22 diffuses rapidly to hmc, where it can activate FRPR-
17 signaling. We speculate that FLP-22 is released from non-synaptic sites in the proximal axon since this
is where AVL directly contacts the pseudocoelom in close proximity (<5uM) to the ventral hmc process
(Fig. 2.4A). FLP-22 is likely to function as an excitatory neurotransmitter, since FLP-22 is necessary for
the activation of hmc and activation of the putative FLP-22 effector PKA in hmc is sufficient for hmc
activation. This represents a unique function for neuropeptides since they more often function in a
modulatory capacity (Bargmann, 2012). This makes them more like classical neurotransmitters.
Neuropeptides functioning as classical neurotransmitters has been shown in the neuropeptide-like protein,
NLP-40, which regulates both aBoc and Exp in DMP. Both the AVL and DVB motor neurons are solely
depolarized by NLP-40 (Wang et al., 2013). AVL has a well characterized function as a motor neuron that
controls the Exp step of the DMP through the release of GABA from NMJs in the axon tip (Beg and
Jorgensen, 2003; McLntire et al., 1993).
37

Figure 2.7 Working model for the aBoc step. During the defecation cycle, calcium oscillation occurs in the intestine
every 50 s which leads to NLP-40 release from the intestine. NLP-40 activates its receptor, AEX-2, on AVL which
results in calcium spike. The calcium spike triggers secretion of the neuropeptide FLP-22 from AVL. FLP-22 activates
its receptor, FRPR-17, on hmc. Activation of FRPR-17 leads to a signaling cascade of its downstream targets, GSA-
1 and PKA-1, which leads to a calcium spike in hmc. Activation of hmc is transmitted to muscles through the gap
junction protein UNC-9, resulting in a contraction of anterior body-wall muscles which is aBoc. Additional
GABAergic neuron(s) may also secrete FLP-22 to activate hmc. FLP-9 activates its receptor, FRPR-21, on hmc which
leads to inhibition of hmc. NMUR-3 receptor acts both on AVL and hmc to promote calcium spike in hmc. AVL may
secrete additional neuropeptides and NMUR-3 signaling on AVL may regulate the secretion.
38

Here, we have uncovered a second function for AVL as a peptidergic neuron controlling aBoc.
Each calcium transient in AVL, which occurs throughout the cell (Fig 2.2A and (Choi et al., 2021)), is
likely to trigger the release of both FLP-22 and GABA. Thus, AVL is a bifunctional motor neuron in which
a single input (a calcium transient triggered by AEX-2/GPCR signaling) leads to divergent output signals
to regulate two independent (but coordinated) behaviors. Multifunctional neurons are common in C. elegans
given its compact nervous system. For example, the ASH sensory neuron secretes both neurotransmitters
and neuropeptides to regulate multiple circuits for avoidance behaviors (Guo et al., 2009; Harris et al., 2010;
Lee et al., 1999). By examining the timing of aBoc and Exp relative to the calcium transient in AVL, we
found that aBoc initiates at the beginning of each calcium transient, whereas Exp initiates at the peak of the
calcium transient about one second later (Fig. 2.2B and (Wang et al., 2013)). One explanation for this
observation is that FLP-22 secretion is evoked by lower calcium levels than GABA release. This could
occur if exocytosis of FLP-22 containing DCVs is more sensitive to calcium than the exocytosis of GABA
from SVs. Indeed, DCV and SV release have been reported to occur with different calcium sensitivities
(Tandon et al., 1998). We further speculate that FLP-22 may be secreted from AVL in a rhythmic manner
in response to each calcium transient. Rhythmic release of neuropeptides has been observed in regulating
the circadian locomotor activity in Drosophila (Hermann-Luibl et al., 2014; Klose et al., 2021; Park et al.,
2000).
2.5.2 aBoc is regulated by a network of peptidergic signaling
While our results reveal a primary aBoc circuit composed of the intestine, AVL, hmc, and neck
muscles, we also uncovered evidence for additional cellular and molecular signaling components in this
circuit (Fig. 2.7). First, although AVL is the primary source of FLP-22 for aBoc, expression of flp-22 in
AVL does not fully rescue the aBoc defects of flp-22 mutants, whereas flp-22 expression under a pan-
GABAergic neuron promoter fully rescues the aBoc defects of flp-22 mutants (Fig. 2.1C), indicating that
FLP-22 secretion from at least one additional GABAergic neuron is necessary for aBoc. Second, our
calcium imaging indicates that FLP-22 may not be the only neuropeptide that activates hmc since in the
39

absence of flp-22 or frpr-17, hmc calcium spikes that trigger aBoc are still observed in 20% of cycles (Fig.
2.2E). Interestingly, the remaining hmc calcium spikes and aBoc contractions in flp-22 or frpr-17 mutants
are slightly delayed by about one second compared to wild-type controls (Fig. 2.2F), implying that the
additional signal(s) may activate hmc slightly later than FLP-22. The use of multiple signals to activate
hmc may function to ensure that a full aBoc occurs in every cycle by increasing the amplitude and/or
duration of the calcium spike in hmc. The remaining hmc calcium spikes in flp-22 or frpr-17 mutants are
also larger in amplitude compared to wild-type controls (Fig. 2.2G), suggesting the existence of
compensatory mechanisms that may either increase the strength of non-FLP-22 signaling or increase hmc
excitability in the absence of FLP-22. Third, we found that AVL ablation nearly eliminates aBoc (Fig. 2.1B),
whereas elimination of hmc or flp-22 signaling leads to absent aBoc in just about half of the cycles (Fig
2.1D), indicating that AVL can control aBoc in an hmc- and flp-22-independent manner. One possibility is
that the secretion of one or more non-FLP-22 peptides from AVL can bypass the requirement for hmc to
promote aBoc. This signal is likely to be a neuropeptide since impairing neuropeptide processing (in egl-3
mutants) leads to more severe aBoc defects than flp-22 mutations (Fig. 2.1B). AVL expresses a number of
neuropeptide-like proteins (Taylor et al., 2021), that may be candidates for additional signals that control
aBoc. Finally, we identified a modulatory pathway controlled by nmur-3 that can function in either hmc or
AVL to increase calcium responses in hmc. nmur-3 encodes one of three orthologs of the mammalian
neuromedin U receptor family (Brighton et al., 2004; Mirabeau and Joly, 2013). Neuromedin U receptor
signaling regulates intracellular calcium signaling in other organisms (Wang et al., 2011; Zhang et al., 2021),
but a function of nmur-3 has not been reported. Rescue of either nmur-3 in AVL or hmc fully restores the
hmc calcium spike amplitude defects of nmur-3 mutants. Thus, nmur-3 signaling may act on both hmc-
dependent and -independent circuits.
We uncovered an inhibitory input to hmc from the FLP-9 neuropeptide and the FRPR-21 GPCR.
The overexpression of FLP-9 or FRPR-21 leads to decrease in hmc activation, and eliminating FLP-9
signaling has no effect on hmc activation but restores activation to hmc in mutants lacking frpr-17 (Fig.
40

2.5). FLP-9 signaling may inhibit both FRPR-17 signaling and a yet unidentified activating pathway in hmc
that functions in parallel to frpr-17. Alternatively, FLP-9 signaling may negatively regulate the excitability
of hmc by less direct mechanisms such as increasing hyperpolarization of the hmc (eg. by activating K
channels), reducing hmc activation (e.g by inhibiting VGCCs), or by hmc activation more generally (eg. by
regulating gene expression). GPCR signaling has been shown to influence cell activity by all three of these
mechanisms (Currie, 2010; Emtage et al., 2012; Kang et al., 2005). flp-9 has been reported to express in
GABAergic motor neurons, including RME, RIS, and AVL (Taylor et al., 2021). Identifying the source of
FLP-9 will be important in understanding how this circuit is controlled by FLP-9 signaling.
2.5.3 A function for hmc in coupling a pacemaker to muscle contraction
We found that hmc is not essential for viability (Fig. 2.2D), but plays a critical role in the mature
aBoc circuit to couple FLP-22 signaling with neck muscle contraction. hmc expresses a number of muscle
specific genes (eg. unc-54 and myo-3 (Mathies et al., 2019)), and has contractile fibers in the vicinity of the
pharyngeal bulb (Altun and Hall, 2009), however, we found that its activation by FLP-22 signaling does
not lead to its contraction (Fig. 2.4D and E and Movie S2.3), indicating that it is non contractile for aBoc.
Instead, hmc controls neck muscle contraction through the gap junctions that connect its dorsal and ventral
processes to the dorsal and ventral neck muscles. We speculate that FLP-22 likely activates FRPR-17
locally on the ventral hmc process nearest AVL axon, and the calcium wave is rapidly amplified and
propagated throughout hmc, thereby ensuring the coordinated contraction of the dorsal and ventral neck
muscles needed for aBoc. The dorsal and ventral neck muscles are also used for locomotion whereby they
are activated out-of-phase with each other by motor neurons about once per second for sinusoidal movement.
Thus, hmc provides a direct input to neck muscles that is dedicated to aBoc and that is independent of the
motor input that controls the locomotion. A previous study found that locomotion and defecation are
coordinated but this seems to occur upstream of AVL at the level of the intestine (Nagy et al., 2015).
We found that PKA, which is activated by cAMP, functions downstream of FRPR-17 signaling in
hmc to control aBoc frequency (Fig. 2.3). Calcium spikes are nearly eliminated by frpr-17 mutations,
41

whereas calcium spikes are still observed (albeit at significantly lower amplitudes) by PKA dominant
negative transgenes expressed in hmc, raising the possibility that PKA is not the only effector of FRPR-17
in hmc. cAMP has multiple targets in addition to PKA including epac-1/EPAC or the cyclic nucleotide
gated channels (tax-2, tax-4, cng-1, cng-2, and cng-3). We do not believe that these effectors are involved
in hmc activation since they are not expressed at detectable levels in hmc (Mathies et al., 2019; Taylor et
al., 2021). We speculate that FRPR-17 activates hmc primarily through PKA activation and that the calcium
spikes observed in animals expressing PKA dominant negative transgene reflect an incomplete knockout
of PKA activity by the transgene. None the less, the ability of PKA[DN] transgenes to eliminate aBoc and
reduce amplitude reveals that calcium spikes in hmc must rise above a threshold to trigger aBoc. How does
PKA activation lead to the generation of calcium transients? cAMP-PKA signaling has well established
roles in controlling cell excitability. In the heart, PKA phosphorylates ryanodine receptors to release
calcium from the sarcoplasmic reticulum (SR) (Marx et al., 2000), and PKA-mediated phosphorylation of
L-type calcium channels leads to calcium influx (Kamp and Hell, 2000). In C. elegans motor neurons, PKA
signaling regulates voltage-gated calcium channels to induce calcium influx (Wang and Sieburth, 2013).
hmc expresses all three VGCCs calcium channels (unc-2, egl-19, and cca-1) as well as itr-1/IP3 receptor
and unc-68/ryanodine receptor at high levels (Mathies et al., 2019). These channels are also expressed in
other tissues in the circuit so addressing their role in hmc will require hmc-specific knock out strategies.
hmc is likely to activate the neck muscles exclusively through gap-junctions since eliminating unc-
9/innexin causes similar reductions in aBoc frequency as ablating hmc (Fig. 2.1D and 4B). The
hemichannels in hmc could be composed of either UNC-9/innexin homomers or heteromultimers in which
UNC-9/innexin is an essential component. The identity of the innexins forming hemichannels on the muscle
side of the gap junctions remains unknown, but they may function redundantly since our screens did not
identify additional single innexins beyond unc-9 that are required for aBoc. Redundancy in innexin function
has been postulated to occur in gap junctions that electrically couple in C. elegans body wall muscles (Liu
et al., 2013b). A recent study found that frpr-17 signaling regulates gap junction assembly in motor neurons
42

during development (Palumbos et al., 2021). We do not believe that frpr-17 signaling functions to regulate
gap junction formation in hmc since the hmc calcium spikes in frpr-17 mutants are always accompanied by
aBoc, implying that gap junctions are functional in these mutants. Gap junctions have been reported to open
and close and opening can be regulated by PKA (Pidoux et al., 2014). Whether gap junctions between hmc
and neck muscles open and close is unclear. One observation making this idea favorable is that during live
imaging we did not observe calcium transients in hmc when neck muscles bent during locomotion
suggesting that calcium generated in neck muscles for locomotion does not enter hmc.
The structure and functional characteristics of hmc resemble those of endothelial cells in vertebrates
in some important respects. Both cells are derived from mesoderm, are non-contractile, and are exposed to
internal body cavities. Endothelial cells are exposed to the circulation and like hmc, the activation of GPCR
signaling pathways by peptides in endothelial cells can induce changes in intracellular calcium levels
(Maguire and Davenport, 2005). Endothelial cells can form gap junctions with underlying smooth muscle
and the communication between endothelial cells and smooth muscle cells via gap junction can regulate
the contraction state of smooth muscle cells (Figueroa and Duling, 2009). However, terminal differentiation
markers of endothelial cells are largely absent in C. elegans, and although both hmc and endothelial cells
form a lining of the cavities they associate with, hmc does not form an epithelium. Given their long
processes, hmc may be more similar to the amoebocytes postulated to be ancestral endothelial cells in
vertebrates and coelomic epithelia in invertebrates (Muñoz-Chápuli et al., 2005). Interestingly, the hlh-
8/TWIST transcription factor, which is important for the differentiation of hmc (Fig. 2.1D and (Meyers and
Corsi, 2010)), is also expressed in endothelial cells, where it regulates endothelial cell proliferation and
migration (Mahmoud et al., 2016), consistent with a common origin of these cell types.
43

Figure S2.1 Identification of novel cell/tissue specific promoters from the nmur-3 promoter region. (A)
Schematic of the nmur-3 promoter. The 3kb nmur-3 promoter extends from -1bp to -2956bp relative to the ATG codon
of nmur-3, and drives expression of GFP in both AVL and hmc. The Pnmur-3(1k) promoter fragment extends from -
1bp to -1000 bp relative to the ATG codon of nmur-3, and drives GFP expression in AVL but not in hmc. The Pnmur-
3(Δ) promoter fragment extends from -2000 bp to -2956 bp and drives GFP expression in hmc but not in AVL. +++
indicates that 80-100% of animals exhibited fluorescence in the indicated cell, and – indicates that 0% of animals
exhibited fluorescence in the indicated cell. (B) Representative images showing fluorescence of AVL or hmc in adults
expressing transcriptional gfp reporters under control of either the Pnmur-3, Pnmur-3(1k), and Pnmur-3(Δ) promoter
fragments.
44

Figure S2.2 flp-22 and frpr-17 mutants show decreased aBoc contraction frequency and extent. (A)
Quantification of the number of aBoc per defecation cycle in adult animals of the indicated genotypes. “AVL egl-3”
denotes egl-3 cDNA expressed in AVL using the nmur-3(1k) promoter. “hmc (Parg-1) frpr-17” denotes frpr-17 cDNA
expressed in hmc using arg-1 promoter. Means and standard errors are shown. *** P<0.001 and * P<0.05 in Student’s
t test; n.s., not significant. (B) Top, genomic organization of the frpr-17 locus showing the locations and the lesions
of the vj249 and vj265 alleles. vj249 is a glycine to glutamic acid substitution in exon 3. Bottom, diagram showing
structure of FRPR-17 protein and the position of the amino acid substitution in vj249 allele. (C and D) Quantification
of the DMP cycle length and expulsion (Exp) frequency in adult animals with the indicated genotypes. (E
Representative images from the live calcium imaging showing contraction states of the neck muscle. The lumen of
the anterior intestine is outlined with a white dotted line. The lumen of the intestine begins to displace posteriorly at
the initiation of aBoc and reaches maximum displacement after about one second before beginning to relax. In wild
45

type animals the duration of the maximal aBoc is at least 500ms. In the indicated mutants, the maximal displacement
is not reached or it is less than 500 ms in about 40% of cycles. Posterior is up and dorsal is to the left in these images.
(F) Quantification of the number aBoc observed in the live calcium imaging records. *** P<0.001 in Fisher’s exact
test; n.s., not significant.

46

Figure S2.3 flp-22 and frpr-17 mutants do not alter the calcium dynamics in AVL. (A) Violin plots of calcium
spike initiation time in AVL after the end of intestinal calcium oscillation. Dashed line refers median and dotted lines
refer quartiles. Kruskal-Wallis test with Dunn's correction for multiple comparisons; n.s., not significant. (B)
Quantification of the number of calcium spikes observed in AVL during DMP in adult animals of the indicated
genotypes. “hmc frpr-17” denotes expressing frpr-17 cDNA under the nmur-3(Δ) promoter. Wild-type: 33 cycles in 8
animals, flp-22: 49 cycles in 9 animals, frpr-17: 56 cycles in 13 animals, flp-22; frpr-17: 43 cycles in 9 animals, frpr-
17; hmc frpr-17: 20 cycles in 7 animals, flp-22; frpr-17; hmc frpr-17: 42 cycles in 9 animals. (C) Traces of calcium
dynamics in AVL aligned to the calcium spike initiation time. Solid lines indicate average fold change in GCaMP
intensity and shades indicate SEM. Quantification of the average peak amplitude, rise time, and half-decay time.
Strains used for live calcium imaging contain lite-1 gur-3 background to limit light stimulated movement. Means and
standard errors are shown. ANOVA with Dunnett's correction for multiple comparisons; n.s., not significant.

47

Figure S2.4 FLP-22 secreted from AVL can reach hmc. (A) Representative image showing FLP-22::pHluorin
trapped to GBP::SAX-7 on hmc. (B) Representative image showing an adult expressing only GBP::SAX-7 in hmc.

48

Figure S2.5 aBoc frequency of innexins expressed in hmc and muscles and calcium dynamics in unc-9 mutants.
(A) Quantification of the number of aBoc per defecation cycle in adult animals of the indicated genotypes. (B) Traces
of calcium dynamics in AVL aligned to the calcium spike initiation time. Solid lines indicate average fold change in
GCaMP intensity and shades indicate SEM. Quantification of the average peak amplitude, rise time, and half-decay
time. unc-9 (no aBoc) refers to cycles with calcium spike followed by no aBoc and unc-9 (aBoc) refers to cycles with
calcium spike followed by aBoc. Strains used for live calcium imaging contain lite-1 gur-3 background to limit light
stimulated movement.

49

Figure S2.6 FRPR-21 and NMUR-3 signaling do not impact the calcium dynamics in AVL. (A) Quantification
of the number of calcium spikes observed in AVL during DMP in adult animals of the indicated genotypes. “flp-9
(OE)” denotes expressing flp-9 cDNA under GABAergic-specific unc-47 promoter. Wild-type: 33 cycles in 8 animals,
frpr-21: 23 cycles in 9 animals, nmur-3: 21 cycles in 7 animals, flp-9: 28 cycles in 8 animals, flp-9 (OE): 27 cycles in
5 animals. (B) Traces of calcium dynamics in AVL aligned to the calcium spike initiation time. Solid lines indicate
average fold change in GCaMP intensity and shades indicate SEM. Quantification of the average peak amplitude, rise
time, and half-decay time. Strains used for live calcium imaging contain lite-1 gur-3 background to limit light
stimulated movement.

50

Figure S2.7 aBoc frequency and calcium dynamics of receptors highly expressed in hmc. (A) Table of the GPCRs
highly expressed in hmc (adapted from (Mathies et al., 2019)). (B) Quantification of the number of calcium spikes
observed in hmc during DMP in adult animals of the indicated genotypes. Wilde type: 33 cycles in 8 animals, srd-32:
25 cycles in 9 animals, npr-23: 23 cycles in 6 animals, T11F9.1: 20 cycles in 9 animals, frpr-17: 56 cycles in 13
animals, srd-32; frpr-17: 47 cycles in 10 animals, npr-32; frpr-17: 27 cycles in 7 animals, T11F9.1; frpr-17: 49 cycles
in 9 animals, frpr-4; frpr-17: 43 cycles in 9 animals. Fisher’s exact test; n.s., not significant. (C) Quantification of the
number aBoc observed in the live calcium imaging records. Fisher’s exact test; n.s., not significant. (D) Traces of
calcium dynamics in hmc aligned to the calcium spike initiation time. Solid lines indicate average fold change in
GCaMP intensity and shades indicate standard errors. Quantification of the average peak amplitude, rise time, and
half-decay time. Strains used for live calcium imaging contain lite-1 gur-3 background to limit light stimulated
movement. Means and standard errors are shown. Asterisks indicate significant differences: * P<0.05 in ANOVA with
Dunnett's correction for multiple comparisons.
51

Table S2.1 Strains, transgenic lines, and plasmids used in this study
Strain Genotype
N2 Wild-type Bristol strain
OJ794 nlp-40(tm4085) I
OJ6846 aex-2(vj304) X
OJ3271 flp-22(vj229) I
OJ6057 frpr-17(vj265) X
OJ6754 hlh-8(nr2061) X
OJ7173 flp-22(vj229) I; hlh-8(nr2061) X
OJ1218 unc-25(e156) III
OJ2424 egl-3(nr2090) V
OJ5308 frpr-17(vj249) X
OJ3584 egl-30(ad806) I
OJ8203 unc-9(e101) X
OJ2451 inx-10(ok2714) V
OJ4154 inx-11(ok2783) V
OJ9407 inx-7(ok2319) IV
OJ2446 inx-1(tm3524) X
OJ3650 unc-7(e5) X
OJ7399 frpr-21(tm4669) II
OJ3844 flp-9(yn36) IV
OJ6524 flp-22(vj229) I; frpr-21(tm4669) II
OJ6660 nmur-3(ok2295) X
OJ6437 flp-22(vj229) I; nmur-3(ok2295) X
OJ1626 nlp-40(tm4085) I; vjEx368 [pHW61 (Pges-1::nlp-40 cDNA), 25 ng/μL]
OJ9177 aex-2(vj304) X; vjEx3004 [pDS728 (Pnmur-3(1k)::aex-2 cDNA), 10 ng/μL]
OJ7009 vjEx2445 [pMH569 (Pnmur-3(1k)::ICE), 10 ng/μL]
OJ7011 vjEx2447 [pDS729 (Pnmur-3(1k)::TeTx), 10 ng/μL]
OJ9314 flp-22(vj229) I; vjEx1837 [pHM363 (Punc-47::flp-22 gDNA), 25 ng/μL]
OJ5082 flp-22(vj229) I; vjEx1534 [pHM184 (Punc-129::flp-22 gDNA), 25 ng/μL]
OJ7439 flp-22(vj229) I; vjEx2466 [pDS747 (Pnmur-3(1k)::flp-22 gDNA), 10 ng/μL]
OJ9395 frpr-17(vj249) X; vjEx1596 [pDS573 (Prab-3::frpr-17 cDNA), 5 ng/μL]
OJ5372 frpr-17(vj249) X; vjEx1580 [pDS567 (Pmyo-3::frpr-17) 10 ng/μL]
OJ9396 frpr-17(vj265) X; vjEx2830 [pUC259 (Pnmur-3(Δ)::frpr-17 cDNA) 25 ng/μL]
OJ6607 vjEx2174 [pUC168 (Pnmur-3::gfp) 50 ng/μL]
OJ7656 vjEx2651 [pUC246 (Pnmur-3(Δ)::PH domain::miniSOG::SL2::mCherry), 25 ng/μL]
OJ7659 vjEx2653 [pUC249 (Pnmur-3(Δ)::ICE), 25 ng/μL]
OJ7716 frpr-17(vj265) X; vjEx2653 [pUC249 (Pnmur-3(Δ)::ICE), 25 ng/μL]
OJ6889 otIs348; vjEx2349 [pUC214 (Pnmur-3(1k)::gfp) 2 ng/μL]
OJ7018 vjEx2454 [pUC218 (Pnmur-3(Δ)::gfp) 50 ng/μL]
OJ7149 egl-3(nr2090) V; vjEx2535 [pMH576 (Pnmur-3(1k)::egl-3::Venus) 5 ng/μL]
OJ6220 frpr-17(vj265); vjEx1926 [pUC163 (Parg-1::Pegl-18::frpr-17 cDNA::mCherry) 50 ng/μL]
OJ8149 lite-1(ce314) gur-3(ok2245) X; vjEx2548 [pUC191 (Pnmur-3::GCaMP6) 12 ng/μL + pHW107
(Pnlp-40::GCaMP3) 10 ng/μL]
52

Table S2.1 Cont.
Strain Genotype
OJ9397 lite-1(ce314) gur-3(ok2245) aex-2(vj302) X; vjEx2548
OJ9398 lite-1(ce314) gur-3(ok2245) aex-2(vj302) X; vjEx2548; vjEx2985 [pDS728 (Pnmur-3(1k)::aex-2
cDNA) 7 ng/μL]
OJ9089 lite-1(ce314) gur-3(ok2245) X; vjEx2548; vjEx2957 [pMH569 (Pnmur-3(1k)::ICE) 10 ng/μL]
OJ8231 flp-22(vj229) I; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ8229 lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ9399 flp-22(vj229) I; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ8725 lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548; vjEx2830 [pUC259 (Pnmur-3(Δ)::frpr-
17 cDNA) 25 ng/μL]
OJ8783 flp-22(vj229) I; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548; vjEx2830 [pUC259
(Pnmur-3(Δ)::frpr-17 cDNA) 25 ng/μL]
OJ9320 vjEx2589 [pDS788 (Pnmur-3(1kb)::flp-22::pHluorin::flp-22) 5 ng/μL]; vjEx3038 [pDS834
(Pnmur-3(Δ)::GBP::sax-7) 20 ng/μL]
OJ9150 lite-1(ce314) gur-3(ok2245) X; vjEx2548; vjEx2987 [pUC247 (Pnmur-3(Δ)::kin-2a(G310D)) 50
ng/μL]
OJ8824 lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548; vjEx2871 [pUC273 (Pnmur-3(Δ)::kin-
1a(H96Q,W205R)) 25 ng/μL]
OJ8442 unc-9(e101) X; vjEx2796 [pUC290 (Pnmur-3(Δ)::unc-9 cDNA) 25 ng/μL]
OJ9148 unc-9(e101) X; vjEx3000 [pUC258 (Pmyo-3::unc-9 cDNA) 10 ng/μL]
OJ9356 vjEx3049 [pUC265 (Pnmur-3(Δ)::frpr-17 cDNA::Venus) 20 ng/μL + pUC291 (Pnmur-3(Δ)::unc-
9 cDNA::mTurquoise2) 20 ng/μL + pDS833 (Pnmur-3(Δ)::wdr-23b NLS::mCherry) 20 ng/μL]
OJ8578 lite-1(ce314) gur-3(ok2245) unc-9(e101) X; vjEx2548
OJ8615 frpr-21(tm4669) II; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ8635 frpr-21(tm4669) II; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ8740 frpr-21(tm4669) II; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548; vjEx2838 [pUC276
(Pnmur-3(Δ)::frpr-21 cDNA) 25 ng/μL]
OJ8976 flp-9(yn36) IV; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ8977 frpr-21(tm4669) II; flp-9(yn36) IV; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ5929 vjEx1785 [pMH351 (Punc-47::flp-9 gDNA) 25 ng/μL]
OJ6572 frpr-21(tm4669) II; vjEx1785 [pMH351 (Punc-47::flp-9 gDNA) 25 ng/μL]
OJ8975 flp-9(yn36) IV; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ8856 lite-1(ce314) gur-3(ok2245) X; vjEx2548; vjEx2867 [pMH351 (Punc-47::flp-9 gDNA) 25 ng/μL]
OJ8857 frpr-21(tm4669) II; lite-1(ce314) gur-3(ok2245) X; vjEx2548; vjEx2867 [pMH351 (Punc-47::flp-
9 gDNA) 25 ng/μL]
OJ9400 lite-1(ce314) gur-3(ok2245) X; vjEx2548; vjEx2838 [pUC276 (Pnmur-3(Δ)::frpr-21 cDNA) 25
ng/μL]
OJ9017 frpr-21(tm4669) II; lite-1(ce314) gur-3(ok2245) X; vjEx2548; vjEx2838 [pUC276 (Pnmur-
3(Δ)::frpr-21 cDNA) 25 ng/μL]
OJ8875 vjEx2899 [pUC281 (Pnmur-3(Δ)::frpr-21 cDNA::gfp) 25 ng/μL]
OJ9392 flp-22(vj229) I; nmur-3(ok2295) X; vjEx2847 [pDS742 (Pnmur-3(1k)::nmur-3 gDNA) 10 ng/μL]
OJ9393 flp-22(vj229) I; nmur-3(ok2295) X; vjEx2851 [pUC225 (Pnmur-3(Δ)::nmur-3 gDNA) 10 ng/μL]
OJ8202 lite-1(ce314) gur-3(ok2245) nmur-3(vj353) X; vjEx2548
OJ8579 lite-1(ce314) gur-3(ok2245) nmur-3(vj353) frpr-17(vj265) X; vjEx2548
OJ9401 lite-1(ce314) gur-3(ok2245) nmur-3(vj353) X; vjEx2548; vjEx2847 [pDS742 (Pnmur-
3(1k)::nmur-3 gDNA) 10 ng/μL]
OJ9402 lite-1(ce314) gur-3(ok2245) nmur-3(vj353) X; vjEx2548; vjEx2851 [pUC225 (Pnmur-
3(Δ)::nmur-3 gDNA) 10 ng/μL]
53

Table S2.1 Cont.
Strain Genotype
OJ8873 vjEx2897 [pUC280 (Pnmur-3(Δ)::nmur-3 gDNA::gfp) 25 ng/μL]
OJ8617 srd-32(vj308) V; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ9403 srd-32(vj308) V; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ8618 npr-23(vj298) I; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ8637 npr-23(vj298) I; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ8616 T11F9.1(ok2284) V; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ8636 T11F9.1(ok2284) V; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548
OJ8638 frpr-4(ok2376) II; lite-1(ce314) gur-3(ok2245) X; vjEx2548
OJ8639 frpr-4(ok2376) II; lite-1(ce314) gur-3(ok2245) frpr-17(vj265) X; vjEx2548

54

Chapter 3: Presynaptic coupling by electrical synapses coordinates a
rhythmic behavior by synchronizing the activities of a neuron pair

3.1 Summary
Electrical synapses are specialized structures that mediate the flow of electrical currents between
neurons and have well known roles in synchronizing the activities of neuronal populations, both by
mediating the current transfer from more active to less active neurons and by shunting currents from active
neurons to their less active neighbors. However, how these positive and negative functions of electrical
synapses are coordinated to shape rhythmic synaptic outputs and behavior is not well understood. Here,
using a combination of genetics, behavioral analysis, and live calcium imaging in Caenorhabditis elegans,
we show that electrical synapses formed by the gap junction protein INX-1/innexin couple the presynaptic
terminals of a pair of motor neurons (AVL and DVB) to synchronize their activation in response to a
pacemaker signal. Live calcium imaging reveals that inx-1/innexin mutations lead to asynchronous
activation of AVL and DVB, due, in part, to loss of AVL-mediated activation of DVB by the pacemaker.
In addition, loss of inx-1 leads to the ectopic activation of DVB at inappropriate times during the cycle
through the activation of the L-type voltage-gated calcium channel EGL-19. We propose that electrical
synapses between AVL and DVB presynaptic terminals function to ensure the precise and robust execution
of a specific step in a rhythmic behavior by both synchronizing the activities of presynaptic terminals in
response to pacemaker signaling and by inhibiting their activation in between cycles when pacemaker
signaling is low.
3.2 Introduction
Electrical synapses mediate the synchronized firing between neurons that are connected by them
(Connors, 2017), and consequently play an important role in modulating the strength and timing of synaptic
output at chemical synapses (Pereda, 2014). Neuronal synchronization by electrical coupling has been
widely observed throughout the mammalian central nervous system (CNS) including in the cortex (Dugué
55

et al., 2009; Mann-Metzer and Yarom, 1999), inferior olive (Long et al., 2002; Van Der Giessen et al.,
2008), and retina (Veruki and Hartveit, 2002). In addition, the interaction of electrical synapses and
chemical synapses can drive neuronal activities more effectively. In cerebellar Golgi cells, electrical
synapses between interneurons enhance synchronous activities in response to chemical synaptic inputs
(Vervaeke et al., 2012), and electrically coupled dendrites of the retinal ganglion cells show spike
synchrony when chemical synaptic input is integrated (Trenholm et al., 2014). Lastly, electrical coupling
can enhance downstream chemical synaptic outputs. In the mouse retina electrical synapses between bipolar
cells promotes glutamate release on retinal ganglion cells (Kuo et al., 2016).
Electrical synapses are composed of multimeric clusters of connexin hemichannels (or innexin
channels in invertebrates) that dock with connexin hemichannels on the other cell thereby connecting the
cytosols of adjoining neurons, allowing passage of ions and small molecules. One mechanism by which
electrical synapses activate coupled neurons is by mediating lateral excitation, whereby an excited neuron
drives depolarization of its neighboring neurons through the passage of depolarizing currents through the
channel. Lateral excitation mediated by electrical synapses is thought to underlie the ability of electrical
synapses to synchronize the activity of neuronal populations and to enhance network activity (Pereda, 2014;
Rabinowitch and Schafer, 2017). In mammals, lateral excitation between ON bipolar cells improves
sensitivity to motion (Kuo et al., 2016), and between mitral cells in the olfactory bulb amplifies sensory
signals (Christie and Westbrook, 2006). In C. elegans, electrical coupling between mechanosensory
neurons enhances the activities between them through lateral excitation in response to nose touch
(Chatzigeorgiou and Schafer, 2011). However, electrical synapses can also inhibit the neuronal activities
of coupled neurons as they introduce resistance to the circuit. The inhibition occurs when current leaks from
a more depolarized neuron to a less depolarized neuron resulting in the attenuation of the voltage change
of the more depolarized neuron. This shunting inhibition can result in a subthreshold depolarization and
thereby locally silence neuronal activity at the electrical synapse (Alcami and Pereda, 2019; Bennett and
Zukin, 2004; Rabinowitch and Schafer, 2017). Shunting inhibition by electrical synapses has been reported
56

in both vertebrate and invertebrate studies. In the retina, simultaneous injection of a subthreshold current
pulse into two electrically coupled All amacrine cells elicits a response but injection into just one fails to
elicit depolarization (Veruki and Hartveit, 2002). Striatal interneurons show reduction in firing frequency
in response to synaptic inputs with less correlation due to shunting of currents through electrical synapses
(Hjorth et al., 2009). In C. elegans, the network activity of the hub-and-spoke circuit is suppressed by
shunting from an active neuron to an inactive neuron (Rabinowitch et al., 2013), and electrical coupling
reduces the activity of a motor neuron that regulates the backward motion through shunting (Kawano et al.,
2011). How the excitatory and inhibitory functions of electrical synapses are coordinated to shape the
synchronized activity of neurons and how this coordination impacts rhythmic behaviors not well
understood.
The expulsion (Exp) step of the defecation motor program (DMP) in C. elegans is a rhythmic and
precisely timed contraction of the enteric muscles that repeats every 50 seconds and functions to expel
contents from the gut (Dal Santo et al., 1999; Liu and Thomas, 1994; Thomas, 1990). The circuit that
controls the expulsion step consists of the intestine, which functions as the pacemaker, a pair of GABAergic
motor neurons, AVL and DVB, and the enteric muscles (Beg and Jorgensen, 2003; McLntire et al., 1993;
Nehrke et al., 2008; Teramoto and Iwasaki, 2006). The expulsion step starts with a calcium oscillation in
the intestine, which triggers the calcium-dependent secretion of the neuropeptide like protein NLP-40 from
dense core vesicles (DCVs) (Nehrke et al., 2008; Teramoto and Iwasaki, 2006; Wang et al., 2013). Once
secreted, NLP-40 binds to AEX-2/GPCR on AVL and DVB motor neurons, leading to their activation by
the generation of an all-or-none calcium transient that originates at their neuromuscular junctions (NMJs)
(Mahoney et al., 2008; Wang et al., 2013). Each calcium transient leads to the release of GABA, which
functions as an excitatory neurotransmitter to promote contraction of the enteric muscles (Beg and
Jorgensen, 2003). This excitatory function of GABA, which differs from its classical inhibitory function
(Farrant and Nusser, 2005), promotes enteric muscle contraction by activating the GABA-gated cationic
channel EXP-1 (Beg and Jorgensen, 2003). The expulsion step is highly robust and its timing is precise,
57

always once 3 seconds after the start of each cycle (Liu and Thomas, 1994). It has been proposed that the
rhythmic release of NLP-40 from the pacemaker is the instructive signal controlling the timing of AVL and
DVB activation. However, NLP-40 is a volume transmitter, diffusing from the intestine to AVL and DVB
through a fluid-filled cavity, suggesting that additional mechanisms must exist in AVL/DVB to ensure the
robustness and precise timing of their activation.
Here, we demonstrate a role for electrical synapses composed of the gap junction protein INX-1,
in functionally coupling the AVL and DVB motor neuron NMJs and in coordinating their activation to
control the timing of the enteric muscle contraction. We found that INX-1 synchronizes calcium influx into
AVL and DVB by promoting the activation of DVB by AVL in response to pacemaker signaling. In
addition, we found that INX-1 inhibits inappropriate activation of the DVB motor neuron during cycle
intervals. We propose that the electrical synapses synchronize and amplify synaptic output by promoting
lateral excitation in response to pacemaker signaling and inhibit inappropriately timed synaptic activation
by shunting inhibition when pacemaker signaling is low.
3.3 Materials and Methods
Strains and transgenic lines
Strains were maintained at room temperature on NGM plates with OP50 E.coli as a food source.
The wild-type strain was N2 Bristol. Transgenic lines were generated by injecting into N2 or corresponding
mutants with expression plasmids together with co-injection markers KP#708(Pttx-3::RFP at 40ng/μl) or
KP#1338(Pttx-3::GFP at 40ng/μl) or KP#1106 (Pmyo-2::NLS::GFP at 5ng/μl) or KP#1368 (Pmyo-
2::NLS::mCherry at 5ng/μl) or pJQ70 (Pofm-1::mCherry at 25ng/μl). Microinjection was performed using
standard procedures (Mello et al., 1991). Generally, three lines were analyzed and one representative line
was used for quantification. Integration of arrays was performed using UV irradiation as described (Mariol
et al., 2013). The strains and transgenic lines used in this study are listed in Table S3.1

58

Molecular Biology
Plasmids were constructed using the backbone pPD49.26 or pPD117.01 (A. Fire). Promoter regions
were amplified from genomic DNA of C. elegans and cDNA were used to clone genes using standard
molecular biological techniques. A detailed list of plasmids and oligos are described in Table S3.1 and S3.2.
nlp-40 suppressor screening and inx-1 cloning
The parental strain nlp-40(tm4085) was mutagenized with EMS for a standard non-clonal F 2 screen
(Jorgensen and Mango, 2002). F 2 progenies of ~ 8,400 mutagenized genomes were screened and three
mutants that suppressed the constipated phenotype of nlp-40(tm4085) were identified. The vj46 was
mapped to LG X using SNP mapping (Davis et al., 2005). The lesion of vj46 in the inx-1 gene was identified
by whole genome sequencing and the software MAQgene as previously described (Bigelow et al., 2009).
Behavioral assays
The defecation motor program was analyzed as previously described (Liu and Thomas, 1994;
Thomas, 1990). Ten to fifteen worms were moved to fresh NGM plate seeded with OP50 bacterial lawn
and allowed to settle for at least ten minutes for recovery. At least ten constitutive defecation cycles were
observed from each worm. The pBoc and Exp steps were recorded using custom Etho software (James
Thomas Lab website: http://depts.washington.edu/jtlab/software/otherSoftware.html) (Liu and Thomas,
1994; Mahoney et al., 2008). Five to ten worms were assayed, and the mean and the standard error of the
mean (SEM) was calculated for each genotype.
RNA Interference
RNAi plates were made using established protocols (Kamath and Ahringer, 2003). Ten gravid adult
animals were bleached on RNAi plates seeded with HT115 (DE3) bacteria that was transformed with the
targeted gene insert in the L4440 vector for knockdown or empty L4440 vector as a control. Three to four
days later, adult animals were assayed for the defecation motor program. RNAi clones were from the
Ahringer or Vidal RNAi library.
59

Fluorescence imaging
Fluorescence imaging was done by using a Nikon eclipse 90i microscope equipped with a Nikon
Plan Apo 40x, 60x, and 100x oil objective (N.A.=1.40), and a Photometrics Coolsnap ES
2
camera or a
Hamamatsu Orca Flash LT+ CMOS camera. Adult worms were paralyzed with 30 mg/ml 2, 3-Butanedione
monoxime (BDM, Sigma) in M9 buffer, and then mounted on 2% agarose imaging pad. Metamorph 7.0
software (Universal Imaging) was used to capture image stacks and to obtain maximum intensity
projections. All images were captured from left laterally positioned animals facing up. Fluorescence
imaging in the GABAergic motor neurons were captured from the neuromuscular junction (NMJ) region
of the AVL and DVB at the preanal ganglion. To analyze the synaptic structure in N2 and inx-1 mutants,
GFP::RAB-3 fusion protein was expressed in AVL (Punc-25(Δ)::GFP::rab-3) and the synaptic region of
AVL was imaged in adult animals. For analyzing AVL axon process in N2, unc-33, and inx-1 mutants,
EBP-1::GFP fusion protein was expressed in AVL (Punc-25(Δ)::ebp-1::GFP) and adult animals were
imaged from head to tail.
In vivo calcium live imaging
Calcium imaging was performed as previously described (Wang et al., 2013; Wang and Sieburth,
2013). For calcium imaging simultaneously in AVL NMJ and DVB soma, we used a transgenic line vjIs58
(Pmyo-2::NLS::mCherry, Punc-47(mini)::GCaMP3); vjEx2554 (Pofm-1::mCherry, Pnmur-3::Pegl-
18::GCaMP6) to express GCaMP3 in DVB and GCaMP6 in AVL. For calcium imaging only in DVB NMJ,
we used three transgenic lines, vjIs58, vjIs64 (Pmyo-2::NLS::mCherry, Punc-47(mini)::GCaMP3), and
vjIs183 (Pofm-1::mCherry, Pflp-10::GCaMP3) which expresses GCaMP3 in DVB neurons to perform in
vivo calcium imaging at the synaptic region. All four transgenic lines were imaged in the unc-13(s69)
mutant background to immobilize animals for live imaging, and unc-13 mutants carrying these transgenes
had normal Exp frequency. Adult worms were transferred to NGM-agarose plates seeded with OP50 and
the plates were topped with a cover slide. Live imaging was done using a Nikon eclipse 90i microscope
equipped with a Nikon Plan Apo 40x oil objective (N.A.=1.0), a standard GFP filter and a Hamamatsu Orca
60

Flash LT+ CMOS camera. The worms that were pumping and positioned laterally with the left side or right
side facing the objective were selected for imaging. Metamorph 7.0 software (Universal Imaging) was used
to obtain time lapse imaging. For each worm, the neuromuscular junction (NMJ) of AVL and DVB soma
together or DVB NMJ was recorded for 250 s at 4 frames per second (2x2 or 3x3 binning with 30-90 ms
exposure time depending on the baseline of GCaMP3 or GCaMP6 fluorescence in the NMJ region and
DVB soma in each worm).
The GCaMP3 and GCaMP6 fluorescence intensity in the NMJ region of AVL/DVB or DVB soma
was quantified using Metamorph 7.0 software (Universal Imaging). The average fluorescence (F) of
GCaMP3 or GCaMP6 was calculated by the average fluorescence of a region of interest (ROI) in the NMJ
region of the AVL/DVB or DVB soma minus the background fluorescence of a similar region near the tail.
The baseline fluorescence (F 0) was defined by the average GCaMP3 or GCaMP6 fluorescence in the first
10 frames before the initiation of pBoc. The fluorescent change of the GCaMP3 or GCaMP6 for each frame
was defined as ΔF/F 0 = (F-F 0)/F 0.
Cell ablation by miniSOG
Transgenic lines were generated by expressing membrane-targeted miniSOG in AVL (Pflp-22::PH
domain::miniSOG) and in DVB (Pflp-10::PH domain::miniSOG), separately or together. To ablate AVL
or DVB, 20 to 30 L4 stage transgenic animals were transferred to an OP50 seeded NGM plate. The plate
was illuminated with blue light using an EXFO mercury light source for 10 minutes with the cover off.
Blue light illuminated animals were recovered at 20°C for 24 hours, and then assayed for the defecation
motor program.
Histamine chloride inhibition
One day before the defecation motor program assay, histamine containing plates were made by
adding histamine dihydrochloride (TCI) into standard NGM agar to a final concentration of 10mM. OP50
was seeded to the plates and was grown for overnight. Next day, transgenic animals expressing HisCl
61

channels in DVB (Pflp-10::HisCl1) were transferred to histamine-containing NGM plates. After 30
minutes, behavioral assay was performed for the defecation motor program.
3.4 Results
3.4.1 inx-1 regulates the timing of expulsion during the defecation motor program
The defecation motor program consists of three sequential muscle contractions that occur every 50
seconds beginning with the posterior body-wall muscles (pBoc), followed by the anterior body-wall
muscles (aBoc), and ending with the enteric muscles (EMC), which leads to expulsion (Exp) (Beg et al.,
2008; Thomas, 1990). In wild-type animals, expulsion occurs once in every cycle about three seconds after
the start of each cycle (as measured by pBoc). Disruption of nlp-40 signaling does not impact cycle length
or pBoc frequency, but expulsion is nearly eliminated, resulting in a reduction of expulsion frequency from
100% to < 5% [Fig. 3.1B, (McLntire et al., 1993; Wang et al., 2013)]. Prior laser ablation studies have
shown that AVL or DVB ablation results in an expulsion frequency of 53% or 71%, respectively (McLntire
et al., 1993). Prior live calcium imaging studies reveal that a single calcium transient is generated by NLP-
40 at the AVL and DVB NMJs every 50 seconds and expulsion occurs at the peak of each calcium transient
(Wang et al., 2013). Together these results suggest a model whereby the rhythmic secretion of NLP-40
from the intestine activates both AVL and DVB, which function in parallel to promote expulsion by
calcium-dependent GABA release (Fig. 3.1A).
To investigate the contributions of AVL and DVB on expulsion in more detail, we first genetically
ablated AVL or DVB after the expulsion circuit is formed (in the L4 stage), using miniSOG (mini singlet
oxygen generator), a genetically encoded photosensitizer that kills neurons by generating reactive oxygen
species (ROS) after blue light illumination (Qi et al., 2012; Xu and Chisholm, 2016). To selectively ablate
AVL or DVB, we expressed miniSOG under control of a flp-22 promoter or flp-10 promoter fragment
(Kim and Li, 2004), respectively, and assayed expulsion frequency 24 hours after exposure of animals to
blue light. As expected, genetic ablation of both AVL and DVB dramatically reduced expulsion frequency
to less than 5% (Fig 3.1B). Genetic ablation of either AVL or DVB reduced the expulsion frequency to
62

Figure 3.1 inx-1 functions in AVL and DVB motor neurons to regulate the frequency and timing of expulsion
during the defecation motor program (DMP). (A) Model for the circuit regulating expulsion (Exp). Calcium
oscillations in the intestine (pacemaker) every 50 seconds lead to SNT-2/synaptotagmin-dependent secretion of NLP-
40 from dense core vesicles (DCVs). NLP-40 activates the G protein coupled receptor (GPCR), AEX-2, in AVL and
DVB, leading to calcium spike generation through voltage gated calcium channels (VGCCs) and GABA release from
neuromuscular junctions (NMJs), which leads to the enteric muscle contraction. AVL and DVB NMJs are functionally
coupled by INX-1/innexin, which coordinates AVL/DVB activities by suppressing ectopic calcium influx and
promoting NLP-40-dependent AVL/DVB activation. (B) Quantification of the number of Exp per DMP cycle in adult
worms with the indicated genotypes. “Exp per cycle” denotes the ratio of Exp per pBoc, which defines the start of the
DMP. “Normal” denotes Exp occurring less than 5 seconds after pBoc, and “Ectopic” denotes Exp occurring more
than 5 seconds after pBoc. DVB-miniSOG and AVL-miniSOG denote transgenes expressing miniSOG under control
of a flp-10 and flp-22 promoter fragment, respectively. (C) Histograms showing the time when each Exp occurred
after pBoc in the indicated strains. The average Exp time after pBoc with standard errors is shown for wild-type, DVB
miniSOG, AVL miniSOG, and inx-1 mutant. (D) Quantification of the number of Exp per DMP cycle in adult nlp-40
mutants, nlp-40; inx-1 mutants or nlp-40; inx-1 mutants expressing the indicated transgenes. “Intestinal inx-1” denotes
full length inx-1a cDNA expressed under the intestine-specific nlp-40 promoter. “Neuronal inx-1” denotes inx-1a
cDNA expressed in GABAergic neurons using the unc-47 promoter. “Muscle inx-1” denotes inx-1a cDNA expressed
in body wall muscles using the myo-3 promoter. “Heat shock inx-1” denotes inx-1a cDNA expressed using the heat
shock promoter (Phsp-16.2) either without or with heat shock (HS) for 1 hour at 34°C. DVB inx-1 and AVL inx-1
denote transgenes expressing inx-1a cDNA under control of the flp-10 and flp-22 promoter, respectively. (E) Above,
Diagram showing the cell bodies and axons of AVL/DVB and the neuromuscular junction (NMJ) region of AVL/DVB
in the preanal ganglia. Below, Transmission electron micrograph (TEM) image of AVL and DVB axons in cross
section in the preanal ganglion region (image JSE_207 a.k.a. JSE_122116), showing a large gap junction (arrowhead)
between AVL and DVB axons. The gap junction appears as electron dense areas within the plasma membranes of
AVL and DVB where they contact each other. DD6 refers to the soma of the DD6 motor neuron. The electron dense
63

regions of AVL and DVB plasma membranes are present in 8 serial sections (JSE_205-JSE_213). Adapted with
permission from David Hall. Means and standard errors are shown. Student’s t-test: ## P<0.001 compared to wild-
type; # P<0.01 compared to wild-type; & P<0.001 compared to DVB miniSOG; ^ P<0.01 compared to AVL miniSOG;
$$ P<0.001 compared to nlp-40; $ P<0.01 compared to nlp-40; @ P<0.001 compared to wild-type; n.s., not significant.

64

68% and 63%, respectively (Fig. 3.1B), in agreement with the laser ablation studies (McLntire et al., 1993).
These results indicate that AVL and DVB contribute roughly equally to contraction of the enteric muscle,
but the activation of both neurons is critical for enteric muscle contraction to occur in every cycle.
We next examined the timing of expulsion, and we found that in both wild-type and DVB-ablated
animals, expulsion was precisely timed, occurring on average three seconds after the start of each cycle
(pBoc, Fig. 3.1C). However, AVL-ablated animals exhibited a significant delay in the average time of
expulsion compared to controls. The majority of expulsions (62%) in AVL-ablated animals occurred at the
normal time of 3 sec following pBoc (hereafter referred to as normal expulsion), but 38% of expulsion
occurred more than 5 sec following pBoc (hereafter referred to as ectopic expulsion, Fig. 3.1B and 3.1C).
As expected, all normally-timed expulsions in AVL- or DVB- ablated animals were eliminated by nlp-40
mutations. However, the ectopic expulsion of AVL-ablated animals were not eliminated by nlp-40
mutations (Fig. 3.1B and 3.1C). These results suggest that in the absence of AVL, DVB can become
activated at random times independently of pacemaker signaling.
To determine the molecular mechanism by which ectopic DVB activation occurs, we conducted a
forward genetic screen for suppressors that could restore expulsion to nlp-40 mutants. We identified three
suppressors each defining a different gene (Fig. S3.1A). One of the suppressors contained a putative null
mutation in inx-1, which encodes one of 25 innexin family members in C. elegans. Two independently
isolated inx-1 null mutations (vj46 and tm3524, Fig. S3.1B) significantly increased the expulsion frequency
of nlp-40 mutants from <5% to about 40% without altering pBoc frequency or cycle length (Fig. 3.1B,
S3.1A, S3.1C, and S3.1D). Similarly, RNA interference (RNAi)-mediated knockdown of inx-1 increased
the expulsion frequency of nlp-40 mutants to 37% (Fig. 3.1B). Notably, most of the restored expulsions in
nlp-40; inx-1 double mutants were ectopic, occurring more than 5 seconds after the start of each cycle (Fig.
3.1B and 3.1C). inx-1 single mutants had normal cycle lengths but exhibited a mild reduction in overall
expulsion frequency due to both a reduction in normally-timed expulsion as well as the occurrence of
ectopic expulsion (Fig. 3.1B, 3.1C, and S3.1C). NLP-40 also controls the second (aBoc) step of the DMP,
65

and nlp-40 mutants have significantly reduced aBoc frequency [Fig. S3.1D, (Wang et al., 2013)]. inx-1
mutations did not suppress the aBoc frequency defects of nlp-40 mutants (Fig. S3.1D). Thus, inx-1 has a
specific role in negatively regulating the ectopic contraction of the enteric muscles.
3.4.2 inx-1 functions in mature AVL and DVB motor neurons to regulate expulsion
To determine in which tissue inx-1 functions to regulate expulsion, we conducted tissue-specific
rescue experiments. Expression of inx-1 cDNA in the GABAergic motor neurons (using the unc-47
promoter), which includes AVL and DVB, fully reverted the expulsion frequency of nlp-40; inx-1 mutants
from ~50% to 4%. In contrast, expression of inx-1 cDNA in either the intestine (using the nlp-40 promoter)
or in muscles (using the myo-3 promoter) failed to revert the expulsion frequency of nlp-40; inx-1 mutants
(Fig. 3.1D). inx-1 cDNA expression in AVL but not DVB or in DVB but not AVL failed to revert the
expulsion frequency of nlp-40; inx-1 mutants. However, co-expression of inx-1 cDNA in both AVL and
DVB fully reverted the expulsion frequency of nlp-40; inx-1 to 8% (Fig. 3.1D). Thus, inx-1 is required
simultaneously in AVL and DVB to negatively regulate ectopic expulsion.
AVL and DVB are integrated into the motor circuit post-embryonically following the first larval
stage (Sulston, 1976; Thomas, 1990). To determine whether inx-1 regulates AVL and DVB development
or function, we expressed inx-1 cDNA in adults using a heat shock promoter fragment (from hsp-16.2 (Rea
et al., 2005)). Heat shock of transgenic nlp-40; inx-1 adults for one hour reverted their expulsion frequency
to 10% (Fig. 3.1D), indicating that inx-1 expression after development of the circuit is sufficient to rescue
inx-1 mutants. In support of a post-developmental role for INX-1, inx-1 adults did not exhibit obvious
differences in AVL or DVB morphology or in presynaptic vesicle pools sizes at NMJs compared to wild-
type controls (Fig. S3.1E). Together, these results indicate that inx-1 regulates the function of mature AVL
and DVB NMJs.
3.4.3 INX-1 is concentrated at AVL/DVB neuromuscular junctions, where it functions to regulate
expulsion frequency
AVL and DVB each extend a single process along the ventral nerve cord to the pre-anal ganglion,
66

where they form en passant NMJs with the enteric muscles [Fig. 3.1E and (White et al., 1986)].
Examination of serial electron micrographs used to determine the wiring diagram of the nervous system
reveal that AVL and DVB processes are often opposed to each other in the pre-anal ganglion and that they
are connected by at least one large gap junction that extends for several sections and lies in close proximity
to their NMJs [Fig. 3.1E and (White et al., 1986)]. To determine whether INX-1 might be a component of
this gap junction, we examined the localization pattern of fluorescent INX-1 fusion proteins in AVL and
DVB. inx-1 encodes two isoforms, INX-1A and INX-1B, which have unique C-terminal intracellular tails
that arise by alternative splicing (Fig. S3.2A). Expression of either INX-1a::GFP or INX-1b::GFP fusion
proteins in GABAergic motor neurons fully reverted the expulsion frequency of nlp-40; inx-1 mutants to
5% (Fig. S3.2A), indicating that both isoforms are functional and that their localization pattern should
reflect that of endogenous INX-1. Both INX-1a::GFP and INX-1b::GFP localized to AVL and DVB somas,
as well as to one or two puncta located in the pre-anal ganglion that co-localized with the presynaptic active
zone marker UNC-10/RIM1a::mCherry [Fig. 3.2A, S3.2D, and (Weimer et al., 2006)]. We identified a
sixteen amino acid region (from aa 356 to 372) in the INX-1 intracellular C-terminal domain, that is
necessary for both INX-1::GFP’s localization to NMJs and for reversion of the expulsion phenotype of nlp-
40; inx-1 mutants (Fig. S3.2B-D). Thus, INX-1 is highly concentrated at AVL and DVB NMJs, and its
localization to NMJs, which is mediated by its cytoplasmic tail, strictly correlates with its ability to regulate
expulsion.
3.4.4 INX-1 functions as a gap junction protein to couple AVL and DVB motor neurons
Several lines of evidence point to a role for INX-1 as a gap junction protein that functionally
couples AVL and DVB NMJs during expulsion. First, INX-1::GFP fusion proteins expressed selectively
in AVL accumulated at one or two puncta at the pre-anal ganglion which co-localized with puncta of INX-
1::mCherry expressed in DVB (Fig. 3.2B and S3.3A). Second, genetic manipulations that disrupt the
association of AVL and DVB NMJs suppressed the expulsion defects of nlp-40 mutants to a similar extent
as inx-1 mutations. unc-33 encodes a collapsin response mediator protein ortholog essential for axon
67

Figure 3.2 INX-1 is a gap junction protein that functionally couples AVL and DVB motor neurons at NMJs.
(A) Representative images of AVL/DVB NMJs (arrowhead) and DVB somas (arrow) from young adults co-expressing
INX-1::GFP and UNC-10/RIM1::mCherry fusion proteins in GABAergic motor neurons (AVL and DVB) under the
unc-47 promoter. (B) Representative images of AVL/DVB NMJs (arrowhead) and DVB somas (arrow) from young
adults co-expressing INX-1::GFP in AVL (under the unc-25(Δ) promoter) and INX-1::mCherry in DVB (under the
flp-10 promoter). (C) Representative images of AVL/DVB NMJs (arrowhead) and DVB somas (arrow) from young
adults co-expressing INX-1::GFP and mouse Cx36::mCherry fusion proteins under the unc-47 promoter. (D)
Quantification of the number of Exp per defecation cycle in adults with the indicated genotypes. unc-33c cDNA was
expressed under the GABAergic neuron-specific (Punc-47) promoter. “DVB HisCl1” denotes expressing HisCl1
under the flp-10 promotor. (E) Quantification of the number of Exp per defecation cycle in adults with the indicated
genotypes. Human PANX1 cDNA and synthetic/mouse Cx36 gene were expressed under the GABAergic neuron-
specific (Punc-47) promoter. Scale bar represents 10 μm. Asterisks indicate significant differences: *** P<0.001 and
* P<0.05 in Student’s t-test; n.s., not significant.
68

outgrowth (Goshima et al., 1995; Maniar et al., 2012). In unc-33 mutants, the AVL process terminated
prematurely before reaching the pre-anal ganglion (Fig. S3.3B), and the expulsion frequency was 44%,
similar to the expulsion frequency in animals in which AVL is ablated (Fig. 3.1B and (McLntire et al.,
1993)), suggesting a failure of AVL to form NMJs with enteric muscle. Importantly, unc-33 mutations
suppressed the expulsion defects of nlp-40 mutants to 47%, and the suppression was reverted by expressing
unc-33c cDNA in GABAergic motor neurons (Fig. 3.2D). Finally, in mammals, connexins can form gap
junctions, whereas pannexins only form channels (Beckmann et al., 2016; Simonsen et al., 2014; Sosinsky
et al., 2011). Expression of the mammalian pannexin, PANX1, in GABAergic neurons failed to revert the
expulsion frequency of nlp-40; inx-1 mutants (Fig. 3.2E), whereas expression of mammalian connexin,
Cx36 (Rabinowitch et al., 2014), which co-localized with INX-1 at AVL and DVB NMJs (Fig. 3.2C),
completely reverted the expulsion frequency of nlp-40; inx-1 mutants to 5% (Fig. 3.2E). Although we
cannot rule out that the failure of PANX1 to rescue may be due to lack of efficient expression, altogether
these results suggest that INX-1 functions as a gap junction protein at AVL and DVB NMJs to regulate
expulsion.
Gap junctions can assemble into heteromeric, heterotypic, and homotypic complexes (Hall, 2017).
To determine whether inx-1 might function with other innexins to regulate expulsion, we knocked down
(by mutation or by RNAi) each of the other 24 innexins encoded by C. elegans in nlp-40 mutants. Only
knockdown of inx-1, but not any of the other innexins, significantly increased expulsion frequency in nlp-
40 mutants (Fig. S3.4), suggesting that INX-1 may function as a homotypic gap junction at AVL and DVB
NMJs.
3.4.5 INX-1 functionally couples AVL and DVB NMJs during the DMP
To further test the importance of INX-1 in coupling AVL and DVB NMJs, we used the histamine
activated chloride channel, HisCl1, whose activation by acute histamine exposure silences neurons by
promoting chloride influx through the channel and neuronal hyperpolarization (Pokala et al., 2014). We
reasoned that if AVL and DVB are coupled by gap junctions, then silencing one neuron using HisCl1 should
69

also silence the other neuron, since chloride ions should pass between them, leading to the elimination of
expulsion. On the other hand, if AVL and DVB are not coupled by gap junctions, then inactivation of one
neuron by HisCl1 should mimic the effects of ablation of that neuron, and reduce expulsion frequency to
about 60% (Fig. 3.1B and (McLntire et al., 1993)). We found that 30-minute histamine treatment of animals
expressing HisCl1 in DVB nearly eliminated expulsion in wild-type animals. However, HisCl1 activation
failed to eliminate expulsion in inx-1 mutants. Instead, expulsion frequency was reduced to 60% (Fig.
3.2D). Thus, HisCl1 activation in DVB can silence both AVL and DVB by passing chloride ions through
INX-1. Together these results indicate that AVL and DVB NMJs are functionally coupled by INX-1.
3.4.6 INX-1 synchronizes the activation of AVL and DVB by NLP-40
To determine whether inx-1 functions to synchronize the activation of AVL and DVB, we
conducted live fluorescence imaging of animals expressing the calcium sensor GCaMP in AVL and DVB
during the defecation motor program. Since the AVL and DVB NMJs overlap, we distinguished between
AVL and DVB activation by quantifying GCaMP fluorescence at the AVL axon tip and the DVB soma,
which occupy distinct areas just posterior to the NMJs (Fig. 3.3A). The calcium spikes in AVL activate the
entire neuron, whereas the calcium spikes in DVB originate at the NMJ and spread along the axon, reaching
the DVB soma within 500ms [Movie S1, S2, and (Wang and Sieburth, 2013)]. In wild-type animals, both
AVL and DVB were inactive in between expulsions, and each neuron exhibited a single calcium spike
within 500ms of the other neuron after the start of each cycle (measured by pBoc, n = 29 cycles, Fig. 3.3A-
3D and Movie S1). In inx-1 mutants, AVL and DVB activation was largely asynchronous, with calcium
spikes occurring within 500 ms of each other in just 33% of the cycles (n = 12 cycles), with DVB activation
occurring greater than 500 ms after AVL in 55% of the cycles (n = 20 cycles), and AVL activation occurring
more than 500 ms after DVB activation in 11% of the cycles (n = 4 cycles). When AVL activated first, the
delay in DVB activation ranged from more than 500 ms to 15 s after AVL activation, and when DVB
activated first, the delay in AVL activation ranged from more than 500ms to 4 seconds (Fig. 3.3C, 3.3D
and Movie S2). In inx-1 mutants, during cycles with synchronized firing, expulsion was always observed
70

Figure 3.3 INX-1 synchronizes the activation of AVL and DVB motor neurons. (A) Representative images from
videos showing GCaMP fluorescence in the AVL NMJ (arrowhead) and the DVB cell body (arrow) right before pBoc,
at AVL activation, and at DVB activation in animals expressing GCaMP3 in DVB (under the unc-47(mini) promoter)
and GCaMP6 in AVL (under the nmur-3 promoter). Scale bar represents 20 μm. (B) Representative normalized traces
showing the calcium dynamics at the AVL axon tip and DVB cell body during the defecation cycle in adult animals
with the indicated genotypes. “same” denotes where the calcium spike in DVB cell body initiates within 500ms after
the calcium spike in AVL NMJ initiates, “AVL first” denotes where the calcium spike in DVB cell body initiates
more than 500ms after the calcium spike in AVL NMJ initiates, and “DVB first” denotes where the start of the calcium
spike in DVB cell body precedes the start of calcium spike in AVL NMJ. (C) Calcium spike initiation time is quantified
with the indicated genotypes. (D) Histogram showing the initiation time of each calcium spike in DVB cell body
relative to the initiation of calcium spike in AVL NMJ with the indicated genotypes. (E) The frequency with which
Exp occurs at the first or second spike is quantified for the indicated genotypes.

71

at the peak of the AVL/DVB calcium spikes as seen in wild-type (Fig. 3.3E). However, during cycles with
asynchronous firing, expulsion was observed either at the peak of the calcium spike of the first neuron or
second neuron with equal frequency, and in about 10% of cycles, expulsion was all together absent (Fig.
3.3E). Together, these results reveal that the coupling of AVL and DVB NMJs by INX-1 is critical for
synchronizing AVL and DVB activation. Moreover, the observation that asynchronous AVL and DVB
activation is occasionally associated with missing expulsion suggests that activation of both neurons is
necessary to ensure sufficient GABA is released to trigger enteric muscle contraction.
3.4.7 Activation of AVL by NLP-40 can elicit calcium spikes in DVB through INX-1
To determine whether INX-1 promotes synchronization of AVL and DVB activation by a lateral
excitation mechanism, we examined whether AVL could activate DVB. AEX-2 is the NLP-40 GPCR that
functions in AVL and DVB to promote expulsion, and aex-2 mutants have <5% expulsion frequency
(Mahoney et al., 2008). We generated transgenic animals in which only AVL but not DVB could respond
to endogenous NLP-40 by expressing aex-2 cDNA selectively in AVL in aex-2 mutants (Fig. 3.4A). As
expected, the expulsion frequency in these animals was 48% (Fig. 3.4B), which is similar to the expulsion
frequency of DVB-ablated animals (Fig. 3.1B). Live imaging of GCaMP in DVB of these animals revealed
that each expulsion was invariably accompanied by a calcium spike at the DVB NMJ (Fig. 3.4C and Movie
S3). These results show that in the absence of pacemaker input to DVB, DVB can nevertheless be activated
in response to pacemaker signaling. Because AVL is activated in every cycle (Fig. 3.3), these results
indicate that DVB is laterally excited by depolarizing currents generated at AVL NMJs by NLP-40.
inx-1 mutations further reduced the expulsion frequency of the DVB-silenced animals from 48%
to 22% (Fig. 3.4B), and eliminated calcium spikes in DVB in 50% of the cycles (n = 22 cycles) in which
expulsion occurred (Fig. 3.4C and Movie S3.4). Thus, the activation of AVL by the pacemaker signal leads
to activation of DVB that depends, in part, on INX-1. These results suggest that INX-1 synchronizes AVL
and DVB activity and GABA release in response to NLP-40 through a lateral excitation mechanism.
72

Figure 3.4 INX-1 promotes expulsion and DVB activation by AVL in response to pacemaker. (A) Schematic
showing the strategy used to monitor DVB activation in the absence of pacemaker signaling. The NLP-40 receptor
aex-2 was expressed only in the AVL motor neuron (under the flp-22 promoter), and the calcium indicator GCaMP3
was expressed in DVB motor neuron (under the flp-10 promoter) in aex-2 mutants. Scale bar represents 20 μm. (B)
Quantification of the number of Exp per defecation cycle in adults with the indicated genotypes. “aex-2; AVL aex-2”
denotes aex-2 cDNA expressed in AVL in aex-2 mutants. (C) Left, representative images from a real time video
showing GCaMP3 fluorescence in the NMJ (arrowhead) either right before the pBoc or the Exp step. Scale bar
represents 20 μm. Right, quantification of the number of calcium spikes observed during normal Exp. Means and
standard errors are shown. Asterisks indicate significant differences: * P<0.05 in Student’s t-test.

73

3.4.8 INX-1 inhibits ectopic calcium spike generation at DVB NMJ
Since inx-1 mutants exhibit ectopic enteric muscle contractions, we reasoned that electrical
synapses composed of INX-1 may also function to inhibit AVL and DVB activity in between cycles via a
shunting mechanism. To test this idea, we conducted live calcium imaging of wild-type or inx-1 mutants
expressing GCaMP selectively in DVB. Both wild-type and inx-1 mutants exhibited a single calcium spike
after each pBoc that were similar in amplitude and duration (Fig. S3.5A and B) and were eliminated in nlp-
40 mutants (Fig. 3.5C and D). However, inx-1 mutants exhibited at least one additional ectopic calcium
spike in 50% of the cycles that occurred at random times during the 50 second interval in between cycles
(Fig. 3.5A and 5B) that on average was similar in duration but decreased in amplitude, compared to wild-
type calcium spikes (Fig. S3.5A). nlp-40 mutants exhibit no calcium spikes in DVB in any cycle (Fig. 3.5C,
5D, and (Wang et al., 2013)). nlp-40; inx-1 double mutants lacked normally-timed calcium spikes, but still
exhibited at least one ectopic calcium spike in each cycle that occurred at random times (Fig. 3.5C and 5D),
that was similar in average amplitude and duration to the calcium spikes of wild-type controls (Fig. S3.5B).
These results indicate that INX-1 functions to inhibit muscle contractions in between cycles by preventing
the generation of ectopic calcium spikes at DVB (and likely also AVL) NMJs. We conclude that DVB is
spontaneously active in between cycles and this activity is inhibited via the shunting of current generated
in DVB to AVL through INX-1.
3.4.9 Suppression of ectopic calcium influx by INX-1 occurs through inhibition of EGL-19 voltage-
gated calcium channels
To determine the molecular mechanism by which INX-1 inhibits the ectopic activation of AVL
and DVB, we examined genetic interactions between inx-1 and components of the signaling cascade that
activates AVL and DVB. snt-2 encodes a synaptotagmin family member that positively regulates NLP-40
secretion from the intestine, and snt-2 mutants exhibit reduced expulsion frequency compared to wild-type
controls (Fig. 3.1A, 3.1B, and (Wang et al., 2013)). inx-1 mutations increased the expulsion frequency of
snt-2 mutants from 55% to nearly 80% (Fig. 3.6B). AEX-2/GPCR binding by NLP-40 activates AVL/DVB
through a signaling cascade composed of the heterotrimeric G protein GSA-1/Gas, adenylate cyclase, and
74

Figure 3.5 INX-1 inhibits ectopic activation of the DVB motor neuron. (A and C) Representative traces showing
change of GCaMP3 fluorescence at the AVL/DVB NMJs during the defecation cycle in adult animals of the indicated
genotypes expressing GCaMP3 under the unc-47(mini) promoter. (B and D) Left: histograms showing the time when
each calcium spike occurred after pBoc in wild-type and inx-1 mutants. Right: average frequency of calcium spikes
per cycle grouped by normal and ectopic spikes in wild-type and inx-1 mutants. Means and standard errors are shown.
Asterisks indicate significant differences: *** P<0.001 in Student’s t-test.

75

KIN-1/Protein kinase A (Fig. 3.6A). Knockout or knock down of any of these signaling components nearly
eliminates expulsion (Mahoney et al., 2008; Wang et al., 2013; Wang and Sieburth, 2013). inx-1 mutations
significantly increased expulsion frequency (to about 40%) in animals compromised in any of these
signaling components, and the restored expulsions were nearly exclusively ectopic (Fig. 3.6B). Thus, INX-
1 functions independently of the NLP-40 - PKA signaling pathway in AVL and DVB to suppress their
activation in between cycles.
Calcium influx into the DVB NMJ in response to NLP-40 - PKA signaling is mediated primarily
through egl-19, an L-type voltage-gated calcium channel (VGCC), and unc-2, a non-L-type VGCC (Wang
and Sieburth, 2013). We found that egl-19/VGCC mutations completely abolished the ectopic expulsions
associated with inx-1 aex-2 double mutants (Fig. 3.6B). In addition, egl-19/VGCC mutations significantly
reduced the ectopic calcium spikes in DVB of inx-1 mutants (Fig. 3.6C). In contrast, unc-2/VGCC
mutations had no significant effect on ectopic expulsion frequency of nlp-40; inx-1 double mutants or
ectopic calcium spike frequency of inx-1 mutants (Fig. 3.6B and 3.6C). Together, these results indicate that
the activity of the egl-19 voltage gated calcium channel drives ectopic calcium spike generation in the
absence of pacemaker signaling.
To determine whether the ectopic calcium spike generation through EGL-19 is voltage regulated,
we examined egl-36 mutants. egl-36 encodes a shaw-type voltage-gated potassium channel that is expressed
in AVL and DVB (Johnstone et al., 1997). egl-36(n2332) loss-of-function mutants exhibited normal
expulsion frequency (Fig. 3.6D), whereas egl-36(n728) gain-of-function mutants, which have
hyperpolarized neuronal membranes (Johnstone et al., 1997), exhibited 35% expulsion frequency (Fig.
3.6D). Transgenic animals over-expressing egl-36(gf) cDNA selectively in GABAergic neurons, exhibited
more severe expulsion frequency defects compared to the egl-36(gf) mutants (Fig. 3.6D and E), indicating
that the egl-36 potassium channel functions cell-autonomously to decrease AVL and DVB excitability in a
dose-dependent manner. Expression of constitutively active PKA (PKA[CA]) in AVL and DVB restores
enteric muscle contractions to nlp-40 mutants (Wang and Sieburth, 2013), but failed to restore expulsion
76

Figure 3.6 Ectopic activation of the DVB motor neuron in inx-1 mutants are suppressed in egl-19 or egl-36(gf)
mutants. (A) Diagram of the pacemaker controlled signaling pathway that leads to calcium influx at AVL/DVB NMJs
and contraction of the enteric muscle (Exp). NP = neuropeptide; GPCR = G protein coupled receptor; ACY = adenylate
cyclase; PKA = protein kinase A; VGCC = voltage gated calcium channel. (B) Quantification of the number of Exp
per defecation cycle in adults of the indicated genotypes. PKA[DN] denotes a dominant negative PKA transgene
expressed in GABAergic neurons (under the unc-47 promoter). (C) Average frequency of normally timed and ectopic
(greater than 5 seconds) calcium spike per cycle in the indicated mutants. (D and E) Quantification of the number of
Exp per defecation cycle in adults of the indicated genotypes. PKA[CA] denotes a constitutively active PKA transgene
expressed in GABAergic neurons (under the unc-47 promoter). Neuronal egl-36(gf) denotes egl-36 (gain-of-function)
transgene expressed under the GABAergic unc-47 promoter. (F) Average frequency of normally timed and ectopic
(greater than 5 seconds) calcium spike per cycle in the indicated mutants. Means and standard errors are shown.
Asterisks indicate significant differences: *** P<0.001, ** P<0.01 in Student’s t-test; n.s, not significant.

77

to egl-36(gf) mutants (Fig. 3.6D), indicating that egl-36 functions downstream of PKA to inhibit AVL and
DVB activation in response to pacemaker. We found that inx-1 mutations significantly suppressed the
expulsion defects of egl-36(gf) mutants (Fig. 3.6D) but failed to suppress the expulsion defects caused by
egl-36(gf) overexpression (Fig. 3.6E), suggesting that inx-1 mutations suppress the expulsion defects
caused by weak but not strong AVL/DVB hyperpolarization. Finally, egl-36(gf) mutations completely
blocked the ectopic calcium spikes of inx-1 mutants (Fig. 3.6F). Thus, INX-1 suppresses DVB activation
by a mechanism that likely involves membrane hyperpolarization by potassium channels.
3.5 Discussion
Here using a simple circuit that controls a minute-timescale rhythm, we show that electrical
synapses coupling a pair of motor neurons coordinates the chemical synaptic output of NMJs to ensure the
robust and precise execution of a rhythmic behavior. INX-1/innexin functions in the mature circuit to
synchronize the pacemaker-induced activation of AVL and DVB, and to also inhibit ectopic activation of
DVB during cycle intervals. We propose that by functionally coupling AVL and DVB NMJs, INX-1
promotes synchronized activation of the neurons by mediating lateral excitation of one neuron to the other
in response to pacemaker signaling and silences each neuron in between cycles by mediating shunting
inhibition when pacemaker signaling is low (Fig. 3.7). Our results provide a mechanistic understanding of
how electrical synapses may fine-tune synaptic output in rhythmic circuits in other organisms.
Prior studies suggest that NLP-40 is rhythmically secreted from the intestine, since the intestine
generates calcium waves required for enteric muscle contraction, and NLP-40 secretion is partially
dependent upon SNT-2/synaptotagmin, an intestinal calcium sensor for exocytosis. However, NLP-40 is
likely to be predominately secreted from the anterior region of the intestine, whereas AVL and DVB NMJs
are located in the posterior of the animal (Peters et al., 2007; Wang et al., 2013). Thus, NLP-40 must diffuse
through the body cavity (pseudocoelom) following its secretion over a distance of hundreds of microns.
Because NLP-40 likely functions as a volume transmitter, it is likely to lose temporal precision due to the
distance it has to travel before AEX-2/GPCR binding on AVL and DVB. We propose that electrical
78

Figure 3.7 Working model for INX-1 in the expulsion step of the defecation motor program. Left: During the
defecation cycle, calcium oscillation occurs in the intestine around every 50 seconds. SNT-2 on the dense core vesicles
(DCVs) senses the calcium and leads to NLP-40 release from the intestine. NLP-40 activates its receptor, AEX-2
which leads activation of ACY-1 to generate cAMP. Increased cAMP activates PKA which results in calcium influx
to GABAergic motor neurons (AVL and DVB), triggering GABA release. The released GABA activates its receptor,
EXP-1 which leads to contraction of enteric muscles for expulsion (Exp). During NLP-40-induced signaling, INX-1
promotes calcium influx in one neuron in response to activation of the other neuron, leading to synchronized GABA
release from both NMJs. Right: During cycle intervals, INX-1 suppresses ectopic activation of the motor neurons by
inhibiting ectopic calcium transients. INX-1 sharpens NMJ output by mediating lateral excitation in the presence of
signal and shunting inhibition in between cycles when signal is low. Dotted lines are experimentally not shown.
79

coupling between the two neurons that respond to NLP-40 has evolved as an effective way of turning an
imprecisely-timed analog input (NLP-40) into a precisely timed all-or-none response (calcium transient and
GABA release) at NMJs. The role of electrical synapses in synchronizing neuronal activities have been
well supported by in vitro studies of mammalian connexins. Spinal motor neurons lacking connexin 40
show temporally uncorrelated firing (Personius et al., 2007). Connexin 36 knockout leads to asynchronous
rhythmic activities between the excitatory neurons of inferior olive (Long et al., 2002), and inhibitory
neurons of the neocortex (Blatow et al., 2003; Deans et al., 2001). A more recent in vivo study of connexin
36 knockout mice showed lack of precise correlated activities in cerebellar Golgi cells (van Welie et al.,
2016).
Our results support the idea that a major mechanism by which INX-1 tunes the synchronization of
AVL and DVB activity is through mediating lateral excitation from AVL to DVB. We found that under
conditions where only AVL was capable of being activated by the pacemaker, AVL can lead to the
generation of calcium transients in DVB that are dependent on inx-1 (Fig. 3.4). In addition, the timing of
AVL activation was largely unaffected in animals lacking inx-1, whereas DVB activation was late and
asynchronous, suggesting that electrical coupling is required for proper timing of DVB activation (Fig. 3.3).
Our results show that synchronized firing of both AVL and DVB also promotes enteric muscle contraction
reliably in every cycle. First, ablation of either AVL or DVB reduced expulsion frequency to half (Fig.
3.1B). Second, calcium imaging of inx-1 mutants revealed that in cycles in which AVL and DVB activation
was asynchronous, expulsion was observed only 42% of the time after the firing of the first or second
neuron, and 17% did not show any expulsion either after firing of the first or the second neuron (Fig 3.3E).
In contrast, during the synchronous cycles in inx-1 mutants, expulsion was always followed by the
AVL/DVB calcium spike. Third, the expulsion frequency of aex-2 mutants in which aex-2 cDNA was
rescued in only AVL was reduced by about half by inx-1 mutations (from 48% to 22%, Fig. 3.4), suggesting
that activation of AVL alone (in the absence of INX-1) elicits expulsion only half as well as activating AVL
and DVB (in the presence of INX-1). Together these results suggest that the activation and subsequent
80

GABA release from just one neuron has about a 50% probability of promoting enteric muscle contraction,
and they underscore the importance of electrical synapse-mediated lateral excitation in increasing reliability
of synaptic output. In mammals, the release of glutamate is shaped by connexin 36-mediated lateral
excitation in bipolar cells of the retina (Kuo et al., 2016), and mitral cells of the olfactory bulb (Christie and
Westbrook, 2006).
We found that not all lateral excitation between AVL and DVB is mediated by INX-1 since inx-1
mutations did not eliminate DVB activation by AVL (Fig. 3.4). The remaining lateral excitation could be
explained by two other mechanisms. First, AVL and DVB could be coupled by other innexin proteins.
Studies in C. elegans using fluorescent reporters for gap junction proteins have shown that AVL and DVB
express a number of innexins, including inx-2, inx-10, inx-14, unc-7, unc-9, inx-7, inx-11, and inx-13. (Altun
et al., 2009; Bhattacharya et al., 2019). Surprisingly, inx-1 was not reported to be expressed in either AVL
or DVB in these studies, suggesting the cis-regulatory elements for expressing inx-1 may not have been
fully covered. The CeNGEN project, which conducted single cell RNA-sequencing to identify the
transcriptional profiles of individual neurons, however, detected inx-1 expression in both AVL and DVB
(Hammarlund et al., 2018). A prior study reported that INX-1 may form heterotypic gap junctions with
INX-10, INX-11, and INX-16 in the C. elegans body wall muscle to promote electrical coupling of muscle
cells (Liu et al., 2013a). Although we did not identify any other innexins that function as nlp-40 suppressors,
we note that our screening strategy may not have identified innexins that function redundantly with inx-1
or that were not efficiently knocked down by RNAi, leaving open the possibility that other innexins may
function together with INX-1 to regulate expulsion. A second mechanism by which AVL could activate
DVB independently of INX-1 could be by ephaptic interaction, which is a non-synaptic mechanism of
activation whereby depolarization of a neuron changes the electrical properties of its surrounding
extracellular environments, which in turn affects the excitability of other neurons at the same synaptic
region. In vertebrates, ephaptic coupling synchronizes the activity of cortical neurons (Anastassiou et al.,
2011), and mediates the communication between cone and bipolar cells in the retina (Vroman et al., 2013).
81

Once AVL is depolarized at the NMJ by NLP-40 signaling, the local field potential could induce excitability
to DVB.
We analyzed two different strains in which only AVL but not DVB could be activated by
pacemaker signaling, we and found that each strain exhibited very different expulsion frequencies. DVB
ablated animals exhibited normally-timed expulsions in 63% of cycles (Fig. 3.1B), whereas aex-2 inx-
1 mutants expressing aex-2 specifically in AVL exhibited a normally-timed expulsions in just 22% of cycles
(Fig. 3.4). What accounts for such an apparent discrepancy in expulsion phenotypes in these strains? Prior
studies support the idea that the pacemaker controls a GABA-independent signaling pathway since mutants
lacking the GABA biosynthetic enzyme, UNC-25 or the GABA receptor, EXP-1 exhibit less severe
expulsion frequency defects than aex-2 or nlp-40 mutants (Beg and Jorgensen, 2003; Mcintire et al., 1993).
Since our rescued aex-2 mutant strains lack aex-2 in all neurons except in AVL (and neurons that are
expressed by the flp-22 promoter), we speculate that the more severe expulsion defects may arise from the
disruption of the GABA-independent signaling pathway in these strains. Under normal conditions, GABA
provides nearly all of the drive for expulsion, but the importance of the GABA-independent pathway is
revealed in animals with compromised GABA signaling (e.g. upon DVB ablation).
Our study also revealed that INX-1 inhibits the activation of DVB during the 50 second interval
between cycles when NLP-40 is presumably not released. Our live calcium imaging showed that ectopic
calcium spikes occurred in DVB at random times in both inx-1 mutants and nlp-40; inx-1 double mutants,
suggesting that these neurons can be randomly activated even in the absence of pacemaker signaling. The
ectopic calcium spikes in inx-1 mutants were not accompanied by expulsion, whereas the ectopic calcium
spikes in nlp-40; inx-1 mutants were generally accompanied by expulsion. Prior studies have suggested the
existence of a refractory period during which expulsion cannot take place within a certain time after the
preceding expulsion (Mahoney et al., 2008; Wang et al., 2013), which would explain why the ectopic
calcium spikes in inx-1 mutants did not elicit enteric muscle contraction. We speculate that DVB and AVL
may have different electrophysiological properties at rest: DVB is noisier perhaps due to a more depolarized
82

resting potential arising from background leak currents, resulting in an ectopic activation in the absence of
INX-1. However, in the presence of INX-1, the ectopic activation is suppressed in DVB by shunting of the
background leak currents into AVL. In the backward motor circuit of C. elegans, absence of electrical
coupling leads to an increase in spontaneous excitatory activity in the premotor interneuron (Kawano et al.,
2011). Coupling to AVL could also help to reduce excitability of DVB by decreasing input resistance
(Deans et al., 2001; Kawano et al., 2011; Zolnik and Connors, 2016), and/or increasing membrane
capacitance (Roerig and Feller, 2000).
Because the ectopic calcium spikes and enteric muscle contractions in the absence of INX-1 were
dependent upon the EGL-19 L-type VGCCs, but not the UNC-2 non-L-type VGCCs, we speculate that the
leak currents in DVB may selectively open EGL-19 voltage gated calcium channels. Indeed, mammalian
L-type channels open at lower potentials compared to non-L-type calcium channels (Helton et al., 2005).
Thus, the background leak currents in DVB may induce sufficient voltage change to open EGL-19 channels
but not enough to open UNC-2 channels. We found that hyperpolarization of AVL and DVB induced by
constitutively active EGL-36 potassium channel mutants also abolished the ectopic calcium spikes in inx-
1 mutants, but failed to suppress the pacemaker signaling induced calcium transients (Fig. 3.6F), suggesting
that the leak currents are no longer able to trigger ectopic calcium transients, but pacemaker signaling can
promote opening of the calcium channels under these conditions. Thus, during a normal cycle, the large
depolarizing currents generated by NLP-40-mediated activation likely override the currents being
dampened by shunting, enabling both neurons to become simultaneously active. Further analysis by
electrophysiology will provide a deeper understanding of how electrical synapses coordinate the activities
of this neuron pair during this motor program.

83

Figure S3.1 inx-1 does not affect anterior body wall contraction frequency, cycle length, or synaptic structure.
(A) Table of the alleles identified in forward genetic screens for suppressors of the Exp defects of nlp-40 mutants. (B)
Genomic organization of the inx-1 locus showing the locations and the lesions of the tm3524 and vj46 alleles. tm3524
is a 238bp deletion that deletes all of exon 8 in inx-1. vj46 is a guanine to adenosine (G to A) substitution in a splice
donor site following exon 5 at position 8112 (from the 5’ UTR of the unspliced inx-1a transcript) that leads to a
truncated INX-1 that includes 1-250 amino acids with additional 30 amnio acids arising from the frameshift. (C-D)
Quantification of the DMP cycle length and anterior body wall contraction (aBoc) frequency in adult worms with the
indicated genotypes. One way ANOVA with Bonferroni's correction for multiple comparisons. (E) Left: representative
images of GFP::RAB-3 fusion protein expressed at the NMJ of AVL in wild-type and inx-1 mutants. Scale bar
represents 10 μm. Right: quantification of average GFP::RAB-3 fluorescence at the NMJ of AVL in wild-type (20
animals) and inx-1 mutants (16 animals). Means and standard errors are shown. Asterisks indicate significant
differences: *** P<0.001 and ** P<0.01 in Student’s t-test; n.s., not significant.

84

Figure S3.2 INX-1 regulates Exp at NMJs. (A) The gene structure of inx-1a and b isoforms and location of GFP
tags used for rescue experiments. +++ denotes full rescue (5% Exp frequency) of nlp-40; inx-1 double mutants
expressing the indicated inx-1 transgenes under the GABAergic neuron-specific (Punc-47) promoter. (B) Diagram
showing the structure of INX-1 protein and sequences of the INX-1 truncations generated and tested. The positions of
the various truncated proteins (red arrow) are indicated. Blue box indicates the motif necessary for the localization of
INX-1 at the NMJ of AVL/DVB. Green box indicates where the sequence is different between inx-1a and inx-1b. (C)
Quantification of the Exp frequency in adults expressing the indicated truncated INX-1 proteins. (D) Representative
images of the AVL/DVB NMJs (arrowhead) and DVB soma (arrow) in young adults expressing the indicated INX-
1::GFP fusion proteins under the unc-47 promoter. Scale bar represents 10 μm. Means and standard errors are shown.
Asterisks indicate significant differences: *** P<0.001 in Student’s t-test; n.s., not significant.

85

Figure S3.3 Localization of INX-1::GFP and AVL axon outgrowth defects in unc-33 mutants. (A) Representative
images of the AVL/DVB NMJs (arrowhead) and DVB soma (arrow) in young adults expressing the indicated INX-
1::GFP fusion proteins. “AVL INX-1::GFP” denotes INX-1::GFP fusion protein expressed under the unc-25(Δ)
promoter, “DVB INX-1::GFP” denotes INX-1::GFP expressed under the flp-10 promoter, and “GABAergic mCherry”
denotes expressing mCherry under the unc-47 promoter. Both INX-1::GFP fusion proteins localized to the bend of
DVB where the NMJ is located (white arrow head). Scale bar represents 10 μm. (B) Left, representative images of
adult animals showing the position of the AVL axon tip with the indicated genotypes. AVL axon tip was labeled with
GFP tagged EBP-1, a microtubule plus-end binding protein, under the unc-25(Δ) promoter. Wide-type: 26 animals
(exposure time of 10 ms), unc-33: 25 animals (exposure time of 200 ms), and inx-1: 22 animals (exposure time of 30
ms). Scale bar represents 20 μm. “AVL EBP-1::GFP” denotes EBP-1::GFP expressed under AVL neuron-specific
((Punc-25(Δ)) promoter. Right, top, diagram showing the position of the AVL axon tip. “1” denotes tip ending around
the vulva, “2” denotes tip ending around half way between the vulva and the NMJ, “3” denotes tip ending one third
of the way between 2 and 4 from 4, and “4” denotes tip ending around the NMJ. Right, bottom, the frequency of the
position of the AVL axon tip is quantified for the indicated genotypes.

86

Figure S3.4 INX-1 negatively regulates Exp in the absence of nlp-40. Quantification of the number of Exp per
defecation cycle in nlp-40 adults with knockout or knockdown of the in indicated innexins. Innexins were knocked
down by feeding of nlp-40; eri-1; lin-15 mutants, to enhance neuronal RNAi. eat-5, unc-7, and unc-9 were tested as
mutants. Means and standard errors are shown. Asterisks indicate significant differences: ** P<0.01 in Student’s t-
test.

87

Figure S3.5 Calcium spike duration and intensity in inx-1 mutants. (A and B) Left, average GCaMP3 fluorescence
peak amplitude in DVB NMJs in the indicated genotypes expressing GCaMP3 under the unc-47(mini) promoter.
Right, average GCaMP3 fluorescence duration in DVB NMJs in the indicated genotypes. “inx-1 normal” denotes
calcium spikes at the right time followed by Exp and “inx-1 ectopic” denotes ectopic calcium spikes followed by no
Exp in inx-1 mutants. “nlp-40; inx-1 Exp” denotes ectopic calcium spikes followed by Exp and “nlp-40; inx-1” denotes
ectopic calcium spikes with no Exp nlp-40; inx-1 double mutants. Means and standard errors are shown. Asterisks
indicate significant differences: * P<0.05 in one way ANOVA with Bonferroni's correction for multiple comparisons;
n.s., not significant.

88

Table S3.1 Strains, transgenic lines, and plasmids used in this study
Genotype Strain Plasmid
Wild-type Bristol strain N2

nlp-40(tm4085) I OJ794

vjEx1530 OJ7346 pUC96 (Pflp-10::PH domain::miniSOG),
50 ng/μL
vjEx1578 OJ5350 pUC94 (Pflp-22::PH domain::miniSOG),
50 ng/μL
vjEx2701 OJ7888 pUC94 (Pflp-22::PH domain::miniSOG),
50 ng/μL + pUC96 (Pflp-10::PH
domain::miniSOG), 50 ng/μL
nlp-40(tm4085) I; vjEx1530 OJ5030 pUC96 (Pflp-10::PH domain::miniSOG),
50 ng/μL
nlp-40(tm4085) I; vjEx1578 OJ7391 pUC94 (Pflp-22::PH domain::miniSOG),
50 ng/μL
inx-1(tm3524) X OJ2446

nlp-40(tm4085) I; inx-1(tm3524) X OJ2323

nlp-40(tm4085) I; wpSi1 II; eri-1(mg366) IV;
rde-1(ne219) V; lin-15B(n744) X
OJ2156

nlp-40(tm4085) I; inx-1(tm3524) X; vjEx917 OJ2343 pUC08 (Pnlp-40::inx-1a), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx912 OJ2331 pHW175 (Punc-47(FL)::inx-1a), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx915 OJ2337 pUC07 (Pmyo-3::inx-1a), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx916 OJ2342 pUC09 (Phsp-16.2::inx-1a), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1064 OJ2805 pUC30 (Pflp-22::inx-1a::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1193 OJ7566 pUC34 (Pflp-10::inx-1a::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1080 OJ2846 pUC30 (Pflp-22::inx-1a::GFP), 25 ng/μL
+ pUC34 (Pflp-10::inx-1a::GFP), 25
ng/μL
nlp-40(tm4085) I; inx-1(vj46) X OJ1664

nlp-40(tm4085) I; snta(vj48) IV OJ1665

nlp-40(tm4085) I; snta(vj49) V OJ1667

vjIs123 II OJ3005 pMH52 (Punc-25(Δ)::GFP::rab-3),
5ng/μL
vjIs123 II; inx-1(tm2534) X OJ3651 pMH52 (Punc-25(Δ)::GFP::rab-3),
5ng/μL
inx-1(tm3524) X; vjEx955; vjEx1187 OJ7359 vjEx955 [pUC06 (Punc-47(FL)::inx-
1a::GFP(TFV)), 25 ng/μL], vjEx1187
[pUC55 (Punc-47(FL)::unc-10::mCherry),
25 ng/μL]
vjEx1260; vjEx1984 OJ7555 vjEx1260 [pUC57 (Punc-25(Δ)::inx-
1a::GFP), 50 ng/μL], vjEx1984 [pUC93
(Pflp-10::inx-1a::mCherry), 50 ng/μL]
inx-1(tm3524) X; vjEx955; vjEx1188 OJ3289 vjEx955 [pUC06 (Punc-47(FL)::inx-
1a::GFP(TFV)), 25 ng/μL], vjEx1188
[pUC56 (Punc-47(FL)::Cx36::mCherry),
25 ng/μL]
nlp-40(tm4085) I; unc-33(e204) IV OJ6236
nlp-40(tm4085) I; unc-33(e204) IV; vjEx1828 OJ6418 pUC77 (Punc-47(FL)::unc-33c), 25 ng/μL

89

Table S3.1 Cont.
Genotype Strain Plasmid
unc-33(e204) IV CB204
vjEx1478 OJ4594 pUC63 (Pflp-10::HisCl1), 50 ng/μL
inx-1(tm3524) X; vjEx1478 OJ4595 pUC63 (Pflp-10::HisCl1), 50 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1060 OJ2801 pUC18 (Punc-47(FL)::PANX1), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1188 OJ3182 pUC56 (Punc-47(FL)::Cx36*::mCherry),
25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1067 OJ2819 pUC19 (Punc-47(FL)::inx-1b::GFP), 25
ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1068 OJ2820 pUC20 (Punc-47(FL)::inx-
1(1~307)::linker::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1069 OJ2821 pUC21 (Punc-47(FL)::inx-
1(1~338)::linker::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1062 OJ2803 pUC26 (Punc-47(FL)::inx-
1(1~356)::linker::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1066 OJ2818 pUC25 (Punc-47(FL)::inx-
1(1~372)::linker::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1070 OJ2822 pUC31 (Punc-47(FL)::inx-1(1~307)::inx-
1a(339~428)::GFP), 25 ng/μL
nlp-40(tm4085) I; inx-1(tm3524) X; vjEx1071 OJ2823 pUC32 (Punc-47(FL)::inx-1(1~307)::inx-
1a(357~428)::GFP), 25 ng/μL
otIs348 IV; vjEx1260 OJ7555 pUC57 (Punc-25(Δ)::inx-1a::GFP), 50
ng/μL
otIs348 IV; inx-1(tm3524) X; vjEx1193 OJ3820 pUC34 (Pflp-10::inx-1a::GFP), 25 ng/μL
vjIs192 V OJ4395 pMH212 (Punc-25(Δ)::ebp-1::GFP), 25
ng/μL
unc-33(e204) IV; vjIs192 V OJ4459 pMH212 (Punc-25(Δ)::ebp-1::GFP), 25
ng/μL
vjIs192 V; inx-1(tm3524) X OJ5160 pMH212 (Punc-25(Δ)::ebp-1::GFP), 25
ng/μL
nlp-40(tm4085) I; inx-7(ok2319) IV OJ3679
nlp-40(tm4085) I; inx-10(ok2714) V OJ2326
nlp-40(tm4085) I; inx-11(ok2783) V OJ4155
nlp-40(tm4085) I; unc-7(e5) X OJ3713
nlp-40(tm4085) I; unc-9(e101) X OJ3714
unc-13(s69) I; vjIs58 IV; vjEx2554 OJ7242 vjIs58 [pHW100 (Punc-
47(mini)::GCaMP3), 125ng/μl],
vjEx2554 [pUC224 (Pnmur-3::Pegl-
18::GCaMP6), 25 ng/μL]
unc-13(s69) I; vjIs58 IV; inx-1(tm3524) X;
vjEx2554
OJ7243 vjIs58 [pHW100 (Punc-
47(mini)::GCaMP3), 125ng/μl],
vjEx2554 [pUC224 (Pnmur-3::Pegl-
18::GCaMP6), 25 ng/μL]
vjIs187 V; aex-2(sa3) X OJ7528 vjIs187 [pMH44 (Pflp-22::aex-2), 25
ng/μL]
vjIs187 V; aex-2(sa3) inx-1(tm3524) X OJ7529 vjIs187 [pMH44 (Pflp-22::aex-2), 25
ng/μL]
unc-13(s69) I; vjIs186 II; vjIs183 V; aex-
2(sa3) X
OJ4167 vjIs186 [pMH44 (Pflp-22::aex-2), 25
ng/μL], vjIs183 [pUC61 (Pflp-
10::GCaMP3), 50 ng/μL]

90

Table S3.1 Cont.
Genotype Strain Plasmid
unc-13(s69) I; vjIs186 II; vjIs183 V; aex-
2(sa3) inx-1(tm3524) X
OJ4679 vjIs186 [pMH44 (Pflp-22::aex-2), 25
ng/μL], vjIs183 [pUC61 (Pflp-
10::GCaMP3), 50 ng/μL]
unc-13(s69) I; vjIs58 IV OJ1443 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
unc-13(s69) I; vjIs58 IV; inx-1(tm3524) X OJ2161 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
nlp-40(tm4085) unc-13(s69) I; vjIs58 IV OJ1467 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
nlp-40(tm4085) unc-13(s69) I; vjIs58 IV; inx-
1(tm3524) X
OJ7567 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
snt-2(tm1711) III OJ1352
snt-2(tm1711) III; inx-1(tm3524) X OJ2291
aex-2(sa3) X OJ2834
aex-2(sa3) inx-1(tm3524) X OJ2327
vjIs76(PKA[DN]) V OJ1603 pHW154 (Punc-47(FL)::kin-2a(G310D)),
50 ng/µl
vjIs76(PKA[DN]) V; inx-1(tm3524) X OJ3382 pHW154 (Punc-47(FL)::kin-2a(G310D)),
50 ng/µl
egl-19(n582) IV OJ1911
egl-19(n582) IV; inx-1(tm3524) X OJ3488
egl-19(n582) IV; aex-2(sa3) inx-1(tm3524) X OJ6341
unc-2(lj1) X OJ1526
unc-2(lj1) inx-1(tm3524) X OJ2290
nlp-40(tm4085) I; unc-2(lj1) inx-1(tm3524) X OJ3682
unc-13(s69) I; vjIs64 II; egl-19(n582) IV OJ1916 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
unc-13(s69) I; vjIs64 II; egl-19(n582) IV; inx-
1(tm3524) X
OJ3428 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
unc-13(s69) I; vjIs58 IV; unc-2(lj1) X OJ1919 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
unc-13(s69) I; vjIs58 IV; unc-2(lj1) inx-
1(tm3524) X
OJ3464 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
egl-36(n2332 sa577) X JT577
egl-36(n728) X OJ1897
vjIs103 I OJ1858 pHW173 (Punc-47(FL)::kin-1a(H96R,
W205Q), 50ng/μl
vjIs103 I; egl-36(n728) X OJ1898 pHW173 (Punc-47(FL)::kin-1a(H96R,
W205Q), 50ng/μl
egl-36(n728) I; inx-1(tm3524) X OJ3709
vjEx1272 OJ3735 pUC58 (Punc-47(FL)::egl-36(gf)::GFP),
25 ng/μL
inx-1(tm3524) X; vjEx1272 OJ3751 pUC58 (Punc-47(FL)::egl-36(gf)::GFP),
25 ng/μL
unc-13(s69) I; vjIs58 IV; egl-36(n728) X OJ1906 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl
unc-13(s69) I; vjIs58 IV; inx-1(tm3524) egl-
36(n728) X
OJ3332 pHW100 (Punc-47(mini)::GCaMP3),
125ng/μl

91

Table S3.2 Oligos used in this study
Sequence Oligos
flp-10 promoter forward ccccccGCATGCtactcggctaatgactagtg
reverse ccccccGGATCCcctttgctgtatgagttgattg
flp-22 promoter forward ccccccGCATGCgagcataagctcttcttgaattc
reverse ccccccCCCGGGttttgtgtatatcctgaaataaaac
unc-25(Δ) promoter forward ccccccGCATGCCTCATTTCGCCCTCGGGGC
reverse CCCCCCgctagcCTCCAAGGGTCCTCctgaaaatg
nmur-3 promoter forward ccccccGCATGCaacacacgttcaactcgttg
reverse ccccccCCCGGGATCCggcttcaattagttgtgtca
egl-18 basal promoter forward ccccccGGATCCctccatagtagtacattttaaggt
reverse ccccccCCCGGGatagactgtgtggagacac
inx-1a cDNA forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse CCCCCCggtaccTTAGACGAACGTGAAGTAAC
PANX1 cDNA forward ccccccGCTAGCaaaaatggccatcgctcaactgg
reverse ccccccCCATGGtcagcaagaagaatccagaagtctc
HisCl1 forward ccccccGCGATCGCaaaaatgcaaagcccaactagcaaattg
reverse ccccccGGTACCtcataggaacgttgtccaatagac
unc-33c cDNA forward ccccccGCGATCGCaaaaATGGCAGTCGTATGGGAAC
reverse CCCCCCgcggccgcCTACCAAAACCCTGTAGTCCG
For 3’ terminal fusion
with GFP, mCherry, or
linker::GFP

inx-1a cDNA forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse ccccccACCGGTGACGAACGTGAAGTAACC
inx-1b cDNA forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse ccccccACCGGTGTGGTTGAGGGATTCCGTTG
unc-10 cDNA forward ccccccGCGATCGCaaaaATGGACGATCCGTCGATGATG
reverse ccccccgcggccgcCTGCTGAGCACCTCCAACTG
Cx36 forward ccccccGCTAGCaaaaATGGGAGAGTGGACCATCC
reverse CCCCCCaccggtGACGTAGGCGGAGTCGGAG
inx-1(1~307) forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse CCCCCCaccggtGTGCTGTCCTGGTAAGAAAG
inx-1(1~338) forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse CCCCCCaccggtATCATATCCGAGGAACTTGTG
inx-1(1~356) forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse ccccccACCGGTTGTAGCAAGAATATCTCCAGC
inx-1(1~372) forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse ccccccACCGGTCTTCCTGACACGATCATTGAAG
ebp-1 cDNA forward CCCCCCgctagcAAAAATGGGCTATCAAGTAGTTAATG
reverse ccccccACCGGTGAATTCTTCGGCTTCTGCTC
egl-36(gf) forward ccccGCTAGCaaaaATGCTCGACGCGTGCTCGTTC
reverse GCAAGGGTCTTTTGTGTGTCTTTAGCATGAAG
forward AGACACACAAAAGACCCTTGCTGTTTTGGATC
reverse ccccccaccggtGGAAATTATTGTGGTGGTAATGGC
For internal deletion of
inx-1 cDNA

inx-1(1~307) forward ccccccgctagcAAAAATGCTTCTATATTATCTGGCG
reverse CCCCCCaccggttctagaGTGCTGTCCTGGTAAGAAAG
inx-1a(339~428)::GFP forward CCCCCCtctagaGGAGTGTTTTGTATGAGAATGATTTCG
reverse ggggggggtaccttaTTTGTATAGTTCATCCATGCC
inx-1a(357~428)::GFP forward cccccctctagaGAACTAATTGTTGCTCTGTGGC
reverse ggggggggtaccttaTTTGTATAGTTCATCCATGCC

92

Table S3.2 Cont.
Sequence Oligos
For internal GFP fusion
to inx-1a cDNA

GFP(TFV) forward ccccccacgcgtAGTAAAGGAGAAGAACTT
reverse ccccccacgcgtTTTGTATAGTTCATCCATGCC
Notes: egl-36(gf) was generated by overlapping PCR to introduce a point mutation.

93

Chapter 4: Conclusions and Perspectives

4.1 Significance
Rhythmic signals secreted from pacemakers need to be precisely and reliably transmitted to
downstream effectors to ensure robust and rhythmic execution of behavioral outputs. However, the circuits
and mechanisms that mediate pacemaker signals to behavior remain largely unknown. In my dissertation,
I first identifed a novel peptidergic circuit that controls a rhythmic muscle contraction during the defecation
motor program in C. elegans. The AVL motor neuron releases a neuropeptide (FLP-22) in response to NLP-
40 secretion from the intestine. FLP-22 then binds to its receptor, FRPR-17, on hmc which activates hmc
through a signaling cascade composed of heterotrimeric G protein GSA-1/Gαs and Protein kinase A. The
activation of hmc results in a rhythmic calcium spike in phase with the calcium influx in AVL. hmc
signaling is mediated to neck muscles through gap junctions composed of UNC-9 to promote contraction
of anterior body wall muscles.
Second, I showed that electrical synapses composed of the gap junction protein INX-1/innexin are
necessary for the precise and accurate timing of the behavioral outputs that are controlled by a biological
clock. Electrical synapses do so by both promoting synchronized activation of a pair of coupled neurons in
response to the signals from the clock and by inhibiting their inappropriate activation when clock signaling
is low. My findings represent one of the first examples of how the execution of a rhythmic behavior is
shaped by electrical synapses through coordinating the activities of coupled neurons.
4.2 How does AVL coordinate aBoc and Exp in phase?
I have shown that AVL secretes a neuropeptide, FLP-22, to control aBoc. Previous studies have
shown that AVL also regulates the enteric muscle contraction by releasing a neurotransmitter, GABA, in
response to NLP-40 (Wang et al., 2013). These results indicate that AVL is a bifunctional neuron that
secrets both neuropeptides and neurotransmitters to regulate two discrete muscle contractions. However, it
94

remains unclear how AVL rhythmically initiates the contraction of anterior body wall muscles first before
enteric muscles. The calcium imaging in AVL shows a single calcium transient during each cycle of the
defecation motor program (Fig. 2.4 and (Choi et al., 2021), suggesting that the same calcium spike promotes
the release of both FLP-22 containing DCVs and GABA containing SVs. Therefore, a mechanism should
exist downstream of calcium spike in AVL to control the timing of DCV and SV secretion.
Although DCVs and SVs share similar machinery to regulate exocytosis such as SNARE
complexes, they differ transport and regulation of release. One possible mechanism that can control the
release time differently is by utilizing different synaptotagmins on DCVs and SVs. The release kinetics and
calcium sensitivity are different between synaptotagmins (Xu et al., 2007), suggesting that the
synaptotagmin on DCVs may have a faster release kinetics and a higher calcium sensitivity than the
synaptotagmin on SVs. Consistent with this idea, while aBoc initiated as the calcium spike initiated, Exp
initiated at the peak of the calcium spike. AVL expresses only three synaptotagmins which are snt-1, snt-3,
and snt-4 (Taylor et al., 2021). snt-1 has been reported to function as a calcium sensor on SVs to regulate
GABA release (Miller et al., 1996). Further examination of snt-3 and snt-4 by behavioral analysis and
calcium imaging may reveal the synaptotagmin that functions on DCVs in AVL.
4.3 The necessity of hmc for regulating a rhythmic muscle contraction
The primary function of body-wall muscles in C. elegans is to control locomotion. The locomotion
is regulated by the balance between cholinergic excitatory and GABAergic inhibitory motor neurons (Zhen
and Samuel, 2015). These motor neurons make neuromuscular junctions (NMJs) on the body wall muscles
where they secrete neurotransmitters to regulate contraction and relaxation of muscles (McLntire et al.,
1993; Richmond and Jorgensen, 1999). Motor neurons are regulated by interneurons through both chemical
synapses and electrical synapses (White et al., 1976).
As the aBoc step and pBoc step of defecation motor program also have to utilize body wall muscles
for their contraction, the need for a discrete circuit is reasonable to prevent interference with locomotion.
95

In the pBoc step, the contraction of posterior body wall muscles is regulated by proton gated-cation
channels. The protons are released from the basolateral membrane of the intestine and its release are linked
to the intestinal calcium oscillation which occurs once every cycle of the DMP (Beg et al., 2008; Kaulich
et al., 2022). On the other hand, the aBoc step is regulated by the AVL motor neuron that is activated by
NLP-40 secreted from the intestine (McLntire et al., 1993; Wang et al., 2013). The soma of AVL lies on
the ventral side of the terminal bulb and its axon runs through the ventral nerve cord to the tail (Eastman et
al., 1999; Jin et al., 1999; McLntire et al., 1993). If anterior body wall muscles directly receive
neuropeptides from AVL, the neuropeptides may not reach the ventral and dorsal side of the body wall
muscles at a same time because FLP-22 has to travel longer distance to reach the dorsal side once secreted
from AVL. This condition makes hmc as an ideal solution for mediating FLP-22 signaling equally to
muscles. The unique H shape of hmc which contains four processes that covers both dorsal and ventral side
of muscles enables muscles to receive signals simultaneously after hmc is activated. In addition, hmc and
muscles are coupled with UNC-9 gap junctions which may provide less latency than for hmc instead
secreting signal cues to muscles as gap junction-mediated signaling is faster than ligand-activated receptor
signaling. Thus, the cellular and molecular mechanisms facilitated by hmc provides a reliable and robust
circuitry for controlling a muscle contraction during a rhythmic behavior.
4.4 What are the calcium sources in hmc that leads to rhythmic activation of hmc?
My results demonstrate that flp-22/frpr-17 signaling promotes calcium spike in hmc presumably
through PKA signaling in hmc. However, the calcium sources in which PKA signaling activates are still
lacking. Previous studies have shown that PKA can promote release of calcium from the endoplasmic
reticulum (ER) by IP3 receptors or ryanodine receptors, and calcium influx via voltage gated calcium
channels (VGCCs). The C. elegans genome encodes both IP3 and ryanodine receptors which are ITR-3 and
UNC-68, and hmc expresses both, although the expression levels are low. On the other hand, the VGCCs
which are encoded by three genes, unc-2, egl-19, and cca-1, are highly expressed hmc, suggesting that PKA
may activate VGCCs to promote calcium spike in hmc. However, it is challenging to test the mutants of
96

VGCCs because of the following reasons. First, the calcium influx in AVL is regulated by UNC-2 and
EGL-19 channels (Wang and Sieburth, 2013). To test the impact of lacking UNC-2 and/or EGL-19 in hmc,
these channels must be rescued in AVL. Second, the genes that encode calcium channels generate many
different isoforms which makes it difficult to clone the isoform that is being used in AVL for phenotypic
rescue experiments. One possible approach is to conduct conditional CRISPR-Cas9 gene knockout for the
calcium channels. Both spatial and temporal gene editing by CRISPR-Cas9 mediated conditional knockout
has been validated under variety of promoters (Li and Ou, 2016). By generating a plasmid that expresses
Cas9 and sgRNA specifically in hmc would knockout the calcium channels only in hmc but not in AVL.
Another approach could be conducting electrophysiological experiments on hmc. AVL has successfully
been recorded in a recent electrophysiology study (Jiang et al., 2022). The cell body of hmc should be more
accessible as it is located near the dorsal side of the animal. If electrophysiological recordings can be
conducted in hmc, whether voltage gated calcium channels contribute to the calcium spike in hmc could be
revealed without rescuing the calcium channels in AVL. In addition, the results from electrophysiological
recordings would confirm whether the activation of hmc is an all-or-none response.
4.5 What gap junction subunit on neck muscles couple with UNC-9?
I have shown that hmc regulates the contraction of anterior body wall muscle via UNC-9 gap
junctions. The fluorescence tagged fusion proteins showed similar localization patterns as seen in the
electron micrograms and calcium imaging of unc-9 mutants exhibited cycles in which lacking aBoc
following calcium spike in hmc. These results suggest that UNC-9 is the gap junction that couples hmc to
neck muscles. However, the defects of aBoc in unc-9 mutants were fully rescued by expressing unc-9 cDNA
in hmc but did not rescue when expressed in muscles. Thus, UNC-9 may couple with a different gap
junction subunit that expresses in the muscle. The muscle expresses several innexins and inx-1, inx-7, and
inx-18 have been reported to express in high levels (Taylor et al., 2021). Examination of these mutants
could reveal the innexin that couples with UNC-9.
97

4.4 The mechanism underlying inhibition of ectopic DVB activation by INX-1
I have identified that INX-1 inhibits ectopic activation of DVB during cycle intervals of the
defecation motor program. Calcium imaging of DVB showed ectopic calcium spikes followed by ectopic
Exp, suggesting that the ectopic activation arises from the depolarization of DVB. I further showed that the
EGL-19 voltage gated calcium channel (VGCC) promotes calcium influx in DVB in the absence of INX-
1. Based on these results, I have proposed that DVB is a noisy neuron and INX-1 may shunt the subthreshold
depolarizations from DVB to AVL during cycle intervals. However, my results do not provide direct
evidence for the shunting inhibition mechanism. A recent electrophysiology study has recorded AVL and
showed a long-lasting afterhyperpolarization which lasted about 40 seconds (Jiang et al., 2022). This
afterhyperpolarization could pass through INX-1 to suppress ectopic activation of DVB during cycle
intervals. Further examination by dual whole cell recordings may reveal whether INX-1 shunts subthreshold
depolarizations from DVB or mediates the long-lasting afterhyperpolarization from AVL.
4.5 Conclusion
My work demonstrates how pacemaker driven signals are coupled to behavioral outputs.
Specifically, I show how behavioral circuits are regulated by neuropeptides and thier GPCR receptors. In
humans, G protein-coupled receptor (GPCR) signaling is one of the most abundantly used cellular signaling
mechanisms and has been implicated in numerous diseases ranging from neurological diseases to cancer
(Dorsam and Gutkind, 2007; Thathiah and De Strooper, 2011). Therefore, investigating new GPCRs and
their underlying signaling pathways in C. elegans could provide strategies for developing new drugs in
humans.

98

Bibliography

Alcami, P., and Pereda, A.E. (2019). Beyond plasticity: the dynamic impact of electrical synapses on neural
circuits. Nat Rev Neurosci 20, 253-271.
Altun, Z.F., Chen, B., Wang, Z.-W., and Hall, D.H. (2009). High resolution map of Caenorhabditis elegans
gap junction proteins. Developmental Dynamics 238, 1936-1950.
Altun, Z.F., and Hall, D.H. (2009). Muscle system, head mesodermal cell. In WormAtlas.
Anastassiou, C.A., Perin, R., Markram, H., and Koch, C. (2011). Ephaptic coupling of cortical neurons. Nat
Neurosci 14, 217-U304.
Arribere, J.A., Bell, R.T., Fu, B.X.H., Artiles, K.L., Hartman, P.S., and Fire, A.Z. (2014). Efficient Marker-
Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics
198, 837-U842.
Bargmann, C.I. (2012). Beyond the connectome: How neuromodulators shape neural circuits. BioEssays
34, 458-465.
Beckmann, A., Grissmer, A., Krause, E., Tschernig, T., and Meier, C. (2016). Pannexin-1 channels show
distinct morphology and no gap junction characteristics in mammalian cells. Cell and Tissue Research 363,
751-763.
Beg, A.A., Ernstrom, G.G., Nix, P., Davis, M.W., and Jorgensen, E.M. (2008). Protons Act as a Transmitter
for Muscle Contraction in C. elegans. Cell 132, 149-160.
Beg, A.A., and Jorgensen, E.M. (2003). EXP-1 is an excitatory GABA-gated cation channel. Nat Neurosci
6, 1145.
Bennett, M.V.L., and Zukin, R.S. (2004). Electrical Coupling and Neuronal Synchronization in the
Mammalian Brain. Neuron 41, 495-511.
Beyer, E.C., and Berthoud, V.M. (2018). Gap junction gene and protein families: Connexins, innexins, and
pannexins. Bba-Biomembranes 1860, 5-8.
Bhardwaj, A., Thapliyal, S., Dahiya, Y., and Babu, K. (2018). FLP-18 Functions through the G-Protein-
Coupled Receptors NPR-1 and NPR-4 to Modulate Reversal Length in Caenorhabditis elegans. J Neurosci
38, 4641-4654.
Bhatla, N., and Horvitz, H.R. (2015). Light and Hydrogen Peroxide Inhibit C. elegans Feeding through
Gustatory Receptor Orthologs and Pharyngeal Neurons. Neuron 85, 804-818.
Bhattacharya, A., Aghayeva, U., Berghoff, E.G., and Hobert, O. (2019). Plasticity of the Electrical
Connectome of C. elegans. Cell 176, 1174-1189.e1116.
Bigelow, H., Doitsidou, M., Sarin, S., and Hobert, O. (2009). MAQGene: software to facilitate C. elegans
mutant genome sequence analysis. Nature methods 6, 549-549.
Blatow, M., Rozov, A., Katona, I., Hormuzdi, S.G., Meyer, A.H., Whittington, M.A., Caputi, A., and
99

Monyer, H. (2003). A novel network of multipolar bursting interneurons generates theta frequency
oscillations in neocortex. Neuron 38, 805-817.
Branicky, R., and Hekimi, S. (2006). What keeps C-elegans regular: the genetics of defecation. Trends
Genet 22, 571-579.
Brighton, P.J., Szekeres, P.G., and Willars, G.B. (2004). Neuromedin U and its receptors: structure,
function, and physiological roles. Pharmacol Rev 56, 231-248.
Chalasani, S.H., Kato, S., Albrecht, D.R., Nakagawa, T., Abbott, L.F., and Bargmann, C.I. (2010).
Neuropeptide feedback modifies odor-evoked dynamics in Caenorhabditis elegans olfactory neurons. Nat
Neurosci 13, 615-621.
Chatzigeorgiou, M., and Schafer, William R. (2011). Lateral Facilitation between Primary Mechanosensory
Neurons Controls Nose Touch Perception in C. elegans. Neuron 70, 299-309.
Choi, S., Chatzigeorgiou, M., Taylor, K.P., Schafer, W.R., and Kaplan, J.M. (2013). Analysis of NPR-1
reveals a circuit mechanism for behavioral quiescence in C. elegans. Neuron 78, 869-880.
Choi, U., Wang, H., Hu, M., Kim, S., and Sieburth, D. (2021). Presynaptic coupling by electrical synapses
coordinates a rhythmic behavior by synchronizing the activities of a neuron pair. Proc Natl Acad Sci U S
A 118.
Christie, J.M., and Westbrook, G.L. (2006). Lateral Excitation within the Olfactory Bulb. The Journal of
Neuroscience 26, 2269-2277.
Connors, B.W. (2017). Synchrony and so much more: Diverse roles for electrical synapses in neural
circuits. Developmental Neurobiology 77, 610-624.
Cook, S.J., Jarrell, T.A., Brittin, C.A., Wang, Y., Bloniarz, A.E., Yakovlev, M.A., Nguyen, K.C.Q., Tang,
L.T.H., Bayer, E.A., Duerr, J.S., et al. (2019). Whole-animal connectomes of both Caenorhabditis elegans
sexes. Nature 571, 63-+.
Cuppen, E., van der Linden, A.M., Jansen, G., and Plasterk, R.H.A. (2003). Proteins Interacting with
Caenorhabditis elegans Gα Subunits. Comparative and Functional Genomics 4.
Currie, K.P.M. (2010). G protein inhibition of CaV2 calcium channels. Channels 4, 497-509.
Dal Santo, P., Logan, M.A., Chisholm, A.D., and Jorgensen, E.M. (1999). The inositol trisphosphate
receptor regulates a 50-second behavioral rhythm in C-elegans. Cell 98, 757-767.
Davis, M.W., Hammarlund, M., Harrach, T., Hullett, P., Olsen, S., and Jorgensen, E.M. (2005). Rapid
single nucleotide polymorphism mapping in C. elegans. BMC genomics 6, 118-118.
de Bono, M., and Maricq, A.V. (2005). Neuronal substrates of complex behaviors in C-elegans. Annu Rev
Neurosci 28, 451-501.
Deans, M.R., Gibson, J.R., Sellitto, C., Connors, B.W., and Paul, D.L. (2001). Synchronous Activity of
Inhibitory Networks in Neocortex Requires Electrical Synapses Containing Connexin36. Neuron 31, 477-
485.
Dorsam, R.T., and Gutkind, J.S. (2007). G-protein-coupled receptors and cancer. Nature Reviews Cancer
100

7, 79.
Dugué, G.P., Brunel, N., Hakim, V., Schwartz, E., Chat, M., Lévesque, M., Courtemanche, R., Léna, C.,
and Dieudonné, S. (2009). Electrical Coupling Mediates Tunable Low-Frequency Oscillations and
Resonance in the Cerebellar Golgi Cell Network. Neuron 61, 126-139.
Eastman, C., Horvitz, H.R., and Jin, Y. (1999). Coordinated Transcriptional Regulation of the unc-
25Glutamic Acid Decarboxylase and the unc-47 GABA Vesicular Transporter by the
Caenorhabditis elegans UNC-30 Homeodomain Protein. The Journal of Neuroscience 19,
6225-6234.
Edwards, S.L., Charlie, N.K., Milfort, M.C., Brown, B.S., Gravlin, C.N., Knecht, J.E., and Miller, K.G.
(2008). A Novel Molecular Solution for Ultraviolet Light Detection in Caenorhabditis elegans. PLOS
Biology 6, e198.
Emtage, L., Aziz-Zaman, S., Padovan-Merhar, O., Horvitz, H.R., Fang-Yen, C., and Ringstad, N. (2012).
IRK-1 Potassium Channels Mediate Peptidergic Inhibition of Caenorhabditis elegans
Serotonin Neurons via a Go Signaling Pathway. The Journal of Neuroscience 32, 16285-
16295.
Fadda, M., De Fruyt, N., Borghgraef, C., Watteyne, J., Peymen, K., Vandewyer, E., Naranjo Galindo, F.J.,
Kieswetter, A., Mirabeau, O., Chew, Y.L., et al. (2020). NPY/NPF-Related Neuropeptide FLP-34 Signals
from Serotonergic Neurons to Modulate Aversive Olfactory Learning in Caenorhabditis elegans. J Neurosci
40, 6018-6034.
Farrant, M., and Nusser, Z. (2005). Variations on an inhibitory theme: phasic and tonic activation of
GABAA receptors. Nat Rev Neurosci 6, 215-229.
Figueroa, X.F., and Duling, B.R. (2009). Gap junctions in the control of vascular function. Antioxid Redox
Signal 11, 251-266.
Flavell, S.W., Pokala, N., Macosko, E.Z., Albrecht, D.R., Larsch, J., and Bargmann, C.I. (2013). Serotonin
and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans. Cell 154, 1023-
1035.
Florman, J.T., and Alkema, M.J. (2022). Co-transmission of neuropeptides and monoamines choreograph
the C. elegans escape response. PLOS Genetics 18, e1010091.
Ghosh, S., Vetrone, S.A., and Sternberg, P.W. (2017). Non-neuronal cell outgrowth in C. elegans. Worm
6, e1405212.
Goshima, Y., Nakamura, F., Strittmatter, P., and Strittmatter, S.M. (1995). Collapsin-induced growth cone
collapse mediated by an intracellular protein related to UNC-33. Nature 376, 509.
Guo, Z.V., Hart, A.C., and Ramanathan, S. (2009). Optical interrogation of neural circuits in Caenorhabditis
elegans. Nature Methods 6, 891-U847.
Hall, D.H. (2017). Gap junctions in C. elegans: Their roles in behavior and development. Developmental
Neurobiology 77, 587-596.
Hamm, H.E. (1998). The Many Faces of G Protein Signaling. Journal of Biological Chemistry 273, 669-
101

672.
Hammarlund, M., Hobert, O., Miller, D.M., and Sestan, N. (2018). The CeNGEN Project: The Complete
Gene Expression Map of an Entire Nervous System. Neuron 99, 430-433.
Harfe, B.D., Vaz Gomes, A., Kenyon, C., Liu, J., Krause, M., and Fire, A. (1998). Analysis of a
Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal
patterning. Genes Dev 12, 2623-2635.
Harris, G., Mills, H., Wragg, R., Hapiak, V., Castelletto, M., Korchnak, A., and Komuniecki, R.W. (2010).
The Monoaminergic Modulation of Sensory-Mediated Aversive Responses in Caenorhabditis elegans
Requires Glutamatergic/Peptidergic Cotransmission. J Neurosci 30, 7889-7899.
Hastings, M.H., Maywood, E.S., and Brancaccio, M. (2018). Generation of circadian rhythms in the
suprachiasmatic nucleus. Nat Rev Neurosci 19, 453-469.
Helton, T.D., Xu, W., and Lipscombe, D. (2005). Neuronal L-Type Calcium Channels Open Quickly and
Are Inhibited Slowly. The Journal of Neuroscience 25, 10247-10251.
Hermann-Luibl, C., Yoshii, T., Senthilan, P.R., Dircksen, H., and Helfrich-Forster, C. (2014). The Ion
Transport Peptide Is a New Functional Clock Neuropeptide in the Fruit Fly Drosophila melanogaster. J
Neurosci 34, 9522-9536.
Hjorth, J., Blackwell, K.T., and Hellgren Kotaleski, J. (2009). Gap Junctions between Striatal Fast-Spiking
Interneurons Regulate Spiking Activity and Synchronization as a Function of Cortical Activity. The Journal
of Neuroscience 29, 5276-5286.
Husson, S.J., Clynen, E., Baggerman, G., Janssen, T., and Schoofs, L. (2006). Defective processing of
neuropeptide precursors in Caenorhabditis elegans lacking proprotein convertase 2 (KPC-2/EGL-3):
mutant analysis by mass spectrometry. Journal of Neurochemistry 98, 1999-2012.
Jang, H., Levy, S., Flavell, S.W., Mende, F., Latham, R., Zimmer, M., and Bargmann, C.I. (2017).
Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis
elegans. Proceedings of the National Academy of Sciences 114, E1263-E1272.
Jansen, G., Thijssen, K.L., Werner, P., van derHorst, M., Hazendonk, E., and Plasterk, R.H.A. (1999). The
complete family of genes encoding G proteins of Caenorhabditis elegans. Nature Genetics 21, 414.
Jiang, J., Su, Y., Zhang, R., Li, H., Tao, L., and Liu, Q. (2022). C. elegans enteric motor neurons fire
synchronized action potentials underlying the defecation motor program. Nat Commun 13, 2783.
Jin, Y., Jorgensen, E., Hartwieg, E., and Horvitz, H.R. (1999). The Caenorhabditis elegans gene unc-25
encodes glutamic acid decarboxylase and is required for synaptic transmission but not synaptic
development. J Neurosci 19, 539-548.
Johnstone, D.B., Wei, A., Butler, A., Salkoff, L., and Thomas, J.H. (1997). Behavioral defects in C. elegans
egl-36 mutants result from potassium channels shifted in voltage-dependence of activation. Neuron 19,
151-164.
Jorgensen, E.M., and Mango, S.E. (2002). The art and design of genetic screens: Caenorhabditis elegans.
Nature Reviews Genetics 3, 356-369.
102

Kamath, R.S., and Ahringer, J. (2003). Genome-wide RNAi screening in Caenorhabditis elegans. Methods
30, 313-321.
Kamp, T.J., and Hell, J.W. (2000). Regulation of Cardiac L-Type Calcium Channels by Protein Kinase A
and Protein Kinase C. Circulation Research 87, 1095-1102.
Kang, J.H., Shi, Y.F., Xiang, B., Qu, B., Su, W.J., Zhu, M., Zhang, M., Bao, G.B., Wang, F.F., Zhang,
X.Q., et al. (2005). A nuclear function of beta-arrestin1 in GPCR signaling: Regulation of histone
acetylation and gene transcription. Cell 123, 833-847.
Kaulich, E., Carroll, T., Ackley, B., Tang, Y.-Q., Hardege, I., Nehrke, K., Schafer, W.R., and Walker, D.S.
(2022). Distinct roles for two Caenorhabditis elegans acid-sensing ion channels in an ultradian clock. eLife
11, e75837.
Kawano, T., Po, Michelle D., Gao, S., Leung, G., Ryu, William S., and Zhen, M. (2011). An Imbalancing
Act: Gap Junctions Reduce the Backward Motor Circuit Activity to Bias C. elegans for Forward
Locomotion. Neuron 72, 572-586.
Kiessling, V., Kreutzberger, A.B., Liang, B.Y., Nyenhuis, S.B., Seelheim, P., Castle, J.D., Cafiso, D.S.,
and Tamm, L.K. (2018). A molecular mechanism for calcium-mediated synaptotagmin-triggered
exocytosis. Nat Struct Mol Biol 25, 911-+.
Kim, K., and Li, C. (2004). Expression and regulation of an FMRFamide-related neuropeptide gene family
in Caenorhabditis elegans. Journal of Comparative Neurology 475, 540-550.
Klose, M.K., Bruchez, M.P., Deitcher, D.L., and Levitan, E.S. (2021). Temporally and spatially partitioned
neuropeptide release from individual clock neurons. P Natl Acad Sci USA 118.
Kovac, S., and Walker, M.C. (2013). Neuropeptides in epilepsy. Neuropeptides 47, 467-475.
Kuo, Sidney P., Schwartz, Gregory W., and Rieke, F. (2016). Nonlinear Spatiotemporal Integration by
Electrical and Chemical Synapses in the Retina. Neuron 90, 320-332.
Lackner, M.R., Nurrish, S.J., and Kaplan, J.M. (1999). Facilitation of Synaptic Transmission by EGL-30
Gqα and EGL-8 PLCβ: DAG Binding to UNC-13 Is Required to Stimulate Acetylcholine Release. Neuron
24, 335-346.
Lee, R.Y.N., Sawin, E.R., Chalfie, M., Horvitz, H.R., and Avery, L. (1999). EAT-4, a homolog of a
mammalian sodium-dependent inorganic phosphate cotransporter, is necessary for glutamatergic
neurotransmission in Caenorhabditis elegans. J Neurosci 19, 159-167.
Li, W., and Ou, G. (2016). The application of somatic CRISPR-Cas9 to conditional genome editing in
Caenorhabditis elegans. Genesis 54, 170-181.
Liu, D.W.C., and Thomas, J.H. (1994). Regulation of a Periodic Motor Program in C-Elegans. J Neurosci
14, 1953-1962.
Liu, P., Chen, B., Altun, Z.F., Gross, M.J., Shan, A., Schuman, B., Hall, D.H., and Wang, Z.-W. (2013a).
Six Innexins Contribute to Electrical Coupling of C. elegans Body-Wall Muscle. PLOS ONE 8, e76877.
Liu, P., Chen, B., Altun, Z.F., Gross, M.J., Shan, A., Schuman, B., Hall, D.H., and Wang, Z.W. (2013b).
103

Six innexins contribute to electrical coupling of C. elegans body-wall muscle. PLoS One 8, e76877.
Long, M.A., Deans, M.R., Paul, D.L., and Connors, B.W. (2002). Rhythmicity without Synchrony in the
Electrically Uncoupled Inferior Olive. The Journal of Neuroscience 22, 10898-10905.
Lutter, M., Bahl, E., Hannah, C., Hofammann, D., Acevedo, S., Cui, H., McAdams, C.J., and Michaelson,
J.J. (2017). Novel and ultra-rare damaging variants in neuropeptide signaling are associated with disordered
eating behaviors. PLOS ONE 12, e0181556.
Maguire, J.J., and Davenport, A.P. (2005). Regulation of vascular reactivity by established and emerging
GPCRs. Trends in Pharmacological Sciences 26, 448-454.
Mahmoud, M.M., Kim, H.R., Xing, R., Hsiao, S., Mammoto, A., Chen, J., Serbanovic-Canic, J., Feng, S.,
Bowden, N.P., Maguire, R., et al. (2016). TWIST1 Integrates Endothelial Responses to Flow in Vascular
Dysfunction and Atherosclerosis. Circulation Research 119, 450-462.
Mahoney, T.R., Luo, S., Round, E.K., Brauner, M., Gottschalk, A., Thomas, J.H., and Nonet, M.L. (2008).
Intestinal signaling to GABAergic neurons regulates a rhythmic behavior in Caenorhabditis elegans. Proc
Natl Acad Sci U S A 105, 16350-16355.
Maniar, T.A., Kaplan, M., Wang, G.J., Shen, K., Wei, L., Shaw, J.E., Koushika, S.P., and Bargmann, C.I.
(2012). UNC-33 (CRMP) and ankyrin organize microtubules and localize kinesin to polarize axon-dendrite
sorting. Nat Neurosci 15, 48-56.
Mann-Metzer, P., and Yarom, Y. (1999). Electrotonic Coupling Interacts with Intrinsic Properties to
Generate Synchronized Activity in Cerebellar Networks of Inhibitory Interneurons. The Journal of
Neuroscience 19, 3298-3306.
Mariol, M.C., Walter, L., Bellemin, S., and Gieseler, K. (2013). A Rapid Protocol for Integrating
Extrachromosomal Arrays With High Transmission Rate into the C. elegans Genome. Jove-J Vis Exp.
Martinez, V.G., and O'Driscoll, L. (2015). Neuromedin U: a multifunctional neuropeptide with pleiotropic
roles. Clin Chem 61, 471-482.
Marx, S.O., Reiken, S., Hisamatsu, Y., Jayaraman, T., Burkhoff, D., Rosemblit, N., and Marks, A.R. (2000).
PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor):
defective regulation in failing hearts. Cell 101, 365-376.
Mathies, L.D., Ray, S., Lopez-Alvillar, K., Arbeitman, M.N., Davies, A.G., and Bettinger, J.C. (2019).
mRNA profiling reveals significant transcriptional differences between a multipotent progenitor and its
differentiated sister. BMC Genomics 20, 427.
Mcintire, S.L., Jorgensen, E., and Horvitz, H.R. (1993). Genes Required for Gaba Function in
Caenorhabditis-Elegans. Nature 364, 334-337.
McLntire, S.L., Jorgensen, E., Kaplan, J., and Horvitz, H.R. (1993). The GABAergic nervous system of
Caenorhabditis elegans. Nature 364, 337.
Mello, C.C., Kramer, J.M., Stinchcomb, D., and Ambros, V. (1991). Efficient gene transfer in C.elegans:
extrachromosomal maintenance and integration of transforming sequences. The EMBO Journal 10, 3959-
3970.
104

Melzer, S., Newmark, E.R., Mizuno, G.O., Hyun, M., Philson, A.C., Quiroli, E., Righetti, B., Gregory,
M.R., Huang, K.W., Levasseur, J., et al. (2021). Bombesin-like peptide recruits disinhibitory cortical
circuits and enhances fear memories. Cell 184, 5622-5634.e5625.
Meyers, S.G., and Corsi, A.K. (2010). C. elegans twist gene expression in differentiated cell types is
controlled by autoregulation through intron elements. Developmental Biology 346, 224-236.
Miller, K.G., Alfonso, A., Nguyen, M., Crowell, J.A., Johnson, C.D., and Rand, J.B. (1996). A genetic
selection for Caenorhabditis elegans synaptic transmission mutants. P Natl Acad Sci USA 93, 12593-12598.
Miller, K.G., and Rand, J.B. (2000). A Role for RIC-8 (Synembryn) and GOA-1 (Goα) in
Regulating a Subset of Centrosome Movements During Early Embryogenesis in Caenorhabditis
elegans. Genetics 156, 1649-1660.
Mirabeau, O., and Joly, J.S. (2013). Molecular evolution of peptidergic signaling systems in bilaterians.
Proc Natl Acad Sci U S A 110, E2028-2037.
Muñoz-Chápuli, R., Carmona, R., Guadix, J.A., Macías, D., and Pérez-Pomares, J.M. (2005). The origin of
the endothelial cells: an evo-devo approach for the invertebrate/vertebrate transition of the circulatory
system. Evolution & Development 7, 351-358.
Nagy, S., Huang, Y.-C., Alkema, M.J., and Biron, D. (2015). Caenorhabditis elegans exhibit a coupling
between the defecation motor program and directed locomotion. Scientific Reports 5, 17174.
Nehrke, K., Denton, J., and Mowrey, W. (2008). Intestinal Ca2+ wave dynamics in freely moving C elegans
coordinate execution of a rhythmic motor program. Am J Physiol-Cell Ph 294, C333-C344.
Nurrish, S., Ségalat, L., and Kaplan, J.M. (1999). Serotonin Inhibition of Synaptic Transmission: Gαo
Decreases the Abundance of UNC-13 at Release Sites. Neuron 24, 231-242.
Orellana, S.A., and McKnight, G.S. (1992). Mutations in the catalytic subunit of cAMP-dependent protein
kinase result in unregulated biological activity. Proc Natl Acad Sci U S A 89, 4726-4730.
Palumbos, S.D., Skelton, R., McWhirter, R., Mitchell, A., Swann, I., Heifner, S., Von Stetina, S., and
Miller, D.M. (2021). cAMP controls a trafficking mechanism that maintains the neuron specificity and
subcellular placement of electrical synapses. Dev Cell 56, 3235-3249.e3234.
Park, J.H., Helfrich-Forster, C., Lee, G., Liu, L., Rosbash, M., and Hall, J.C. (2000). Differential regulation
of circadian pacemaker output by separate clock genes in Drosophila. P Natl Acad Sci USA 97, 3608-3613.
Patke, A., Young, M.W., and Axelrod, S. (2020). Molecular mechanisms and physiological importance of
circadian rhythms. Nature Reviews Molecular Cell Biology 21, 67-84.
Pereda, A.E. (2014). Electrical synapses and their functional interactions with chemical synapses. Nat Rev
Neurosci 15, 250.
Personius, K.E., Chang, Q., Mentis, G.Z., O'Donovan, M.J., and Balice-Gordon, R.J. (2007). Reduced gap
junctional coupling leads to uncorrelated motor neuron firing and precocious neuromuscular synapse
elimination. Proceedings of the National Academy of Sciences 104, 11808-11813.
Peters, M.A., Teramoto, T., White, J.Q., Iwasaki, K., and Jorgensen, E.M. (2007). A Calcium Wave
105

Mediated by Gap Junctions Coordinates a Rhythmic Behavior in C. elegans. Current Biology 17, 1601-
1608.
Pfeiffer, J., Johnson, D., and Nehrke, K. (2008). Oscillatory Transepithelial H+ Flux Regulates a Rhythmic
Behavior in C. elegans. Current Biology 18, 297-302.
Pidoux, G., Gerbaud, P., Dompierre, J., Lygren, B., Solstad, T., Evain-Brion, D., and Taskén, K. (2014). A
PKA–ezrin–Cx43 signaling complex controls gap junction communication and thereby trophoblast cell
fusion. Journal of Cell Science 127, 4172-4185.
Pokala, N., Liu, Q., Gordus, A., and Bargmann, C.I. (2014). Inducible and titratable silencing of
Caenorhabditis elegans neurons in vivo with histamine-gated chloride channels. Proceedings
of the National Academy of Sciences 111, 2770-2775.
Qi, Y.B., Garren, E.J., Shu, X., Tsien, R.Y., and Jin, Y. (2012). Photo-inducible cell ablation in
Caenorhabditis elegans using the genetically encoded singlet oxygen generating protein
miniSOG. Proceedings of the National Academy of Sciences.
Rabinowitch, I., Chatzigeorgiou, M., and Schafer, William R. (2013). A Gap Junction Circuit Enhances
Processing of Coincident Mechanosensory Inputs. Current Biology 23, 963-967.
Rabinowitch, I., Chatzigeorgiou, M., Zhao, B., Treinin, M., and Schafer, W.R. (2014). Rewiring neural
circuits by the insertion of ectopic electrical synapses in transgenic C. elegans. Nature Communications 5,
4442.
Rabinowitch, I., and Schafer, W.R. (2017). Chapter 1 - Electrical Coupling in Caenorhabditis elegans
Mechanosensory Circuits. In Network Functions and Plasticity, J. Jing, ed. (Academic Press), pp. 1-11.
Rea, S.L., Wu, D.Q., Cypser, J.R., Vaupel, J.W., and Johnson, T.E. (2005). A stress-sensitive reporter
predicts longevity in isogenic populations of Caenorhabditis elegans. Nature Genetics 37, 894-898.
Reinitz, C.A., Herfel, H.G., Messinger, L.A., and Stretton, A.O.W. (2000). Changes in locomotory behavior
and cAMP produced in Ascaris suum by neuropeptides from Ascaris suum or Caenorhabditis elegans.
Molecular and Biochemical Parasitology 111, 185-197.
Richmond, J.E., and Jorgensen, E.M. (1999). One GABA and two acetylcholine receptors function at the
C. elegans neuromuscular junction. Nat Neurosci 2, 791-797.
Ringstad, N., and Horvitz, H.R. (2008). FMRFamide neuropeptides and acetylcholine synergistically
inhibit egg-laying by C. elegans. Nat Neurosci 11, 1168-1176.
Roerig, B., and Feller, M.B. (2000). Neurotransmitters and gap junctions in developing neural circuits.
Brain Res Brain Res Rev 32, 86-114.
Schiavo, G.G., Benfenati, F., Poulain, B., Rossetto, O., de Laureto, P.P., DasGupta, B.R., and Montecucco,
C. (1992). Tetanus and botulinum-B neurotoxins block neurotransmitter release by proteolytic cleavage of
synaptobrevin. Nature 359, 832-835.
Shaye, D.D., and Greenwald, I. (2011). OrthoList: A Compendium of C. elegans Genes with Human
Orthologs. Plos One 6.
106

Sheng, M., Hosseinzadeh, A., Muralidharan, S.V., Gaur, R., Selstam, E., and Tuck, S. (2015). Aberrant fat
metabolism in Caenorhabditis elegans mutants with defects in the defecation motor program. PLoS One
10, e0124515.
Simonsen, K., Moerman, D., and Naus, C. (2014). Gap junctions in C. elegans. Frontiers in Physiology 5.
Skalhegg, B.S., and Tasken, K. (2000). Specificity in the cAMP/PKA signaling pathway. Differential
expression,regulation, and subcellular localization of subunits of PKA. Front Biosci 5, D678-693.
Söhl, G., Maxeiner, S., and Willecke, K. (2005). Expression and functions of neuronal gap junctions. Nat
Rev Neurosci 6, 191.
Sohl, G., and Willecke, K. (2004). Gap junctions and the connexin protein family. Cardiovascular Research
62, 228-232.
Sohn, J.-W., Elmquist, J.K., and Williams, K.W. (2013). Neuronal circuits that regulate feeding behavior
and metabolism. Trends Neurosci 36, 504-512.
Sosinsky, G.E., Boassa, D., Dermietzel, R., Duffy, H.S., Laird, D.W., MacVicar, B., Naus, C.C., Penuela,
S., Scemes, E., Spray, D.C., et al. (2011). Pannexin channels are not gap junction hemichannels. Channels
5, 193-197.
Speese, S., Petrie, M., Schuske, K., Ailion, M., Ann, K., Iwasaki, K., Jorgensen, E.M., and Martin, T.F.J.
(2007). UNC-31 (CAPS) Is Required for Dense-Core Vesicle But Not Synaptic Vesicle Exocytosis in
Caenorhabditis elegans. The Journal of Neuroscience 27, 6150-6162.
Starich, T.A., Xu, J., Skerrett, I.M., Nicholson, B.J., and Shaw, J.E. (2009). Interactions between innexins
UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory
nervous system. Neural Development 4, 16.
Stawicki, T.M., Takayanagi-Kiya, S., Zhou, K., and Jin, Y. (2013). Neuropeptides Function in a
Homeostatic Manner to Modulate Excitation-Inhibition Imbalance in C. elegans. PLOS Genetics 9,
e1003472.
Sugita, S. (2008). Mechanisms of exocytosis. Acta Physiol 192, 185-193.
Sulston, J.E. (1976). Post-embryonic development in the ventral cord of Caenorhabditis elegans.
Philosophical transactions of the Royal Society of London Series B, Biological sciences 275, 287-297.
Sulston, J.E., and Horvitz, H.R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis
elegans. Dev Biol 56, 110-156.
Sulston, J.E., Schierenberg, E., White, J.G., and Thomson, J.N. (1983). The embryonic cell lineage of the
nematode Caenorhabditis elegans. Developmental Biology 100, 64-119.
Sunahara, R.K., Dessauer, C.W., and Gilman, A.G. (1996). Complexity and diversity of mammalian
adenylyl cyclases. Annu Rev Pharmacol Toxicol 36, 461-480.
Tandon, A., Bannykh, S., Kowalchyk, J.A., Banerjee, A., Martin, T.F.J., and Balch, W.E. (1998).
Differential regulation of exocytosis by calcium and CAPS in semi-intact synaptosomes. Neuron 21, 147-
154.
107

Tao, L., Porto, D., Li, Z.Y., Fechner, S., Lee, S.A., Goodman, M.B., Xu, X.Z.S., Lu, H., and Shen, K.
(2019). Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans. Dev Cell
51, 617-+.
Taylor, S.R., Santpere, G., Weinreb, A., Barrett, A., Reilly, M.B., Xu, C., Varol, E., Oikonomou, P.,
Glenwinkel, L., McWhirter, R., et al. (2021). Molecular topography of an entire nervous system. Cell 184,
4329-4347.e4323.
Teramoto, T., and Iwasaki, K. (2006). Intestinal calcium waves coordinate a behavioral motor program in
C-elegans. Cell Calcium 40, 319-327.
Thathiah, A., and De Strooper, B. (2011). The role of G protein-coupled receptors in the pathology of
Alzheimer's disease. Nat Rev Neurosci 12, 73.
Thomas, J.H. (1990). Genetic analysis of defecation in Caenorhabditis elegans. Genetics 124, 855-872.
Trenholm, S., McLaughlin, A.J., Schwab, D.J., Turner, M.H., Smith, R.G., Rieke, F., and Awatramani,
G.B. (2014). Nonlinear dendritic integration of electrical and chemical synaptic inputs drives fine-scale
correlations. Nat Neurosci 17, 1759-1766.
Tsujino, N., and Sakurai, T. (2009). Orexin/Hypocretin: A Neuropeptide at the Interface of Sleep, Energy
Homeostasis, and Reward System. Pharmacological Reviews 61, 162-176.
Van Der Giessen, R.S., Koekkoek, S.K., van Dorp, S., De Gruijl, J.R., Cupido, A., Khosrovani, S.,
Dortland, B., Wellershaus, K., Degen, J., Deuchars, J., et al. (2008). Role of Olivary Electrical Coupling in
Cerebellar Motor Learning. Neuron 58, 599-612.
van Welie, I., Roth, A., Ho, S.S.N., Komai, S., and Hausser, M. (2016). Conditional Spike Transmission
Mediated by Electrical Coupling Ensures Millisecond Precision-Correlated Activity among Interneurons
In Vivo. Neuron 90, 810-823.
Veruki, M.L., and Hartveit, E. (2002). AII (Rod) Amacrine Cells Form a Network of Electrically Coupled
Interneurons in the Mammalian Retina. Neuron 33, 935-946.
Vervaeke, K., Lőrincz, A., Nusser, Z., and Silver, R.A. (2012). Gap Junctions Compensate for Sublinear
Dendritic Integration in an Inhibitory Network. Science 335, 1624-1628.
Vroman, R., Klaassen, L., and Kamermans, M. (2013). Ephaptic communication in the vertebrate retina.
Frontiers in Human Neuroscience 7.
Wang, F., Zhang, Y., Jiang, X., Zhang, Y., Zhang, L., Gong, S., Liu, C., Zhou, L., and Tao, J. (2011).
Neuromedin U inhibits T-type Ca2+ channel currents and decreases membrane excitability in small dorsal
root ganglia neurons in mice. Cell Calcium 49, 12-22.
Wang, H., Girskis, K., Janssen, T., Chan, J.P., Dasgupta, K., Knowles, J.A., Schoofs, L., and Sieburth, D.
(2013). Neuropeptide secreted from a pacemaker activates neurons to control a rhythmic behavior. Curr
Biol 23, 746-754.
Wang, H., and Sieburth, D. (2013). PKA Controls Calcium Influx into Motor Neurons during a Rhythmic
Behavior. PLOS Genetics 9, e1003831.
108

Weimer, R.M., Gracheva, E.O., Meyrignac, O., Miller, K.G., Richmond, J.E., and Bessereau, J.-L. (2006).
UNC-13 and UNC-10/Rim Localize Synaptic Vesicles to Specific Membrane Domains. The Journal of
Neuroscience 26, 8040-8047.
White, J.G., Southgate, E., Thomson, J.N., and Brenner, S. (1976). The structure of the ventral nerve cord
of Caenorhabditis elegans. Philosophical Transactions of the Royal Society of London B, Biological
Sciences 275, 327-348.
White, J.G., Southgate, E., Thomson, J.N., and Brenner, S. (1986). The structure of the nervous system of
the nematode Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 314, 1-340.
White John, G., Southgate, E., Thomson, J.N., and Brenner, S. (1976). The structure of the ventral nerve
cord of Caenorhabditis elegans. Philosophical Transactions of the Royal Society of London B, Biological
Sciences 275, 327-348.
Winrow, C.J., and Renger, J.J. (2014). Discovery and development of orexin receptor antagonists as
therapeutics for insomnia. British Journal of Pharmacology 171, 283-293.
Xu, J., Mashimo, T., and Südhof, T.C. (2007). Synaptotagmin-1, -2, and -9: Ca2+ Sensors for Fast Release
that Specify Distinct Presynaptic Properties in Subsets of Neurons. Neuron 54, 567-581.
Xu, S., and Chisholm, A.D. (2016). Highly efficient optogenetic cell ablation in C. elegans using
membrane-targeted miniSOG. Scientific Reports 6, 21271.
Zhang, W., Sakoda, H., Nakazato, Y., Islam, M.N., Pattou, F., Kerr-Conte, J., and Nakazato, M. (2021).
Neuromedin U uses Gαi2 and Gαo to suppress glucose-stimulated Ca2+ signaling and insulin secretion in
pancreatic β cells. PLOS ONE 16, e0250232.
Zhao, J., Wang, P., and Corsi, A.K. (2007). The C. elegans Twist target gene, arg-1, is regulated by distinct
E box promoter elements. Mechanisms of Development 124, 377-389.
Zhen, M., and Samuel, A.D.T. (2015). C. elegans locomotion: small circuits, complex functions. Current
Opinion in Neurobiology 33, 117-126.
Zolnik, T.A., and Connors, B.W. (2016). Electrical synapses and the development of inhibitory circuits in
the thalamus. The Journal of Physiology 594, 2579-2592.

109

Appendix
A1 Publications
1. Choi, U., Wang, H., Hu, M., Kim, S., and Sieburth, D. (2021). Presynaptic coupling by electrical
synapses coordinates a rhythmic behavior by synchronizing the activities of a neuron pair. Proceedings
of the National Academy of Sciences, 118(20).

110

A2 Legends of movies
Movie S2.1 Calcium imaging of freely moving wild-type day 1 adults co-expressing GCaMP6 in AVL and
hmc (under the nmur-3 promoter) and GCaMP3 in intestine (under the nlp-40 promoter). Movie shows one
cycle of the DMP in which a calcium spike in the AVL cell body (including the axon) and in the hmc cell
body (including the processes) were observed at the same time (within 250ms of the calcium spike initiation
in AVL) about 3 seconds after the intestinal calcium oscillation.

Movie S2.2 Calcium imaging of freely moving frpr-17 mutant day 1 adults co-expressing GCaMP6 in AVL
and hmc (under the nmur-3 promoter) and GCaMP3 in intestine (under the nlp-40 promoter). Movie shows
one cycle of the DMP in which a calcium spike only occurred in the AVL cell body (including the axon)
but not in hmc about 3 seconds after the intestinal calcium oscillation.

Movie S2.3 Calcium imaging of freely moving unc-9 mutant day 1 adults co-expressing GCaMP6 in AVL
and hmc (under the nmur-3 promoter) and GCaMP3 in intestine (under the nlp-40 promoter). Movie shows
one cycle of the DMP in which a calcium spike occurred in the AVL cell body (including the axon) and in
the hmc cell body (including the processes) were observed at the same time (within 250ms of the calcium
spike initiation in AVL) about 3 seconds after the intestinal calcium oscillation but not followed by aBoc.

Movie S3.1 Calcium live imaging of wild-type day 1 adults co-expressing GCaMP6 in AVL (under the
nmur-3 promoter) and GCaMP3 in DVB (under the unc-47(mini) promoter). Movie shows one cycle of the
DMP in which a calcium spike in AVL (including the NMJ) and in the DVB cell body were observed at
the same time (within 250ms of each other) about 3 seconds after pBoc and right before Exp.

Movie S3.2 Calcium live imaging of inx-1 mutant day 1 adults co-expressing GCaMP6 in AVL (under the
nmur-3 promoter) and GCaMP3 in DVB (under the unc-47(mini) promoter). Movie shows one cycle of the
DMP in which the calcium spike occurred at the normal time at the AVL NMJ, and occurred in the DVB
cell body 2 seconds later. The Exp occurred during the calcium spike in DVB.

Movie S3.3 Calcium live imaging of day 1 aex-2 mutants co-expressing aex-2 cDNA in AVL (under the
flp-22 promoter) and GCaMP3 in DVB (under the flp-10 promoter). Movie shows one cycle of the DMP in
which a calcium spike was observed at the DVB NMJ right before Exp.
Movie S3.4 Calcium live imaging of day 1 aex-2 inx-1 double mutants co-expressing aex-2 cDNA in AVL
(under the flp-22 promoter) and GCaMP3 in DVB (under the flp-10 promoter). Movie shows one cycle of
the DMP in which no calcium spike was observed at the DVB NMJ right before Exp.

#
These movies are in the separate digital files accompanying this dissertation. Movie S3.1, 3.2, 3.3 and 3.4
can also be found in the supporting information in my paper (publication 1 in Appendix A1, Page 109).

Abstract (if available)

Abstract Rhythmic behaviors, such as walking, breathing and sleeping are controlled by pacemakers, which generate rhythmic firing patterns that regulate these behaviors. It is critical to convey temporal information from the pacemaker to downstream effectors accurately and precisely as perturbation in this process can lead to disruption in the execution of rhythmic behaviors. However, little is known about the circuits and underlying molecular mechanisms by which pacemaker signaling conveys temporal information to target tissues.
To address these questions, I utilize C. elegans as multicellular animal model and study its simple rhythmic behavior, the defecation motor program. The rhythmicity of the defecation motor program is encoded by calcium oscillations in the pacemaker, which is the intestine. The calcium oscillation occurs every 50 seconds and triggers a neuropeptide, NLP-40 secretion. NLP-40 activates two GABAergic motor neurons (AVL and DVB) to promote two discrete but related muscle contractions, anterior body wall muscle contraction (aBoc) and enteric muscle contraction (Exp). Combining genetics, in vivo calcium imaging, and behavioral assays, I identify a novel circuit regulated by neuropeptide signaling that promotes muscle contraction in the aBoc step. In addition, I find that electrical synapses couple AVL and DVB to synchronize their activities in response to NLP-40 in the Exp step.
Previous studies have suggested that aBoc is regulated by only AVL. However, the signal that is released from AVL and the downstream circuits that mediate the signal to control aBoc are completely unknown. Using RNAi knockdown and forward genetic screening, I find that a neuropeptide, FLP-22, as the signal released in part from AVL and a GPCR, FRPR-17, as the receptor for FLP-22. In addition, by tissue specific rescue experiments, I identify that FRPR-17 functions in the head mesodermal cell (hmc), a cell with previously unknown function. Using calcium imaging, I show that activation of hmc results in rhythmic calcium spikes in phase with the pacemaker and AVL, and show that the calcium spike frequency of hmc is severely decreased when lacking flp-22 or frpr-17 signaling. I further demonstrate that PKA signaling mediates the calcium spike in hmc. By screening additional GPCRs that are enriched in hmc, I identify two neuropeptide signaling pathways that inhibits and positively modulates hmc activation. Finally, I demonstrate that the gap junction UNC-9 mediates the signaling from hmc to anterior body wall muscles.
While aBoc is only regulated by AVL, studies have shown Exp is regulated by both AVL and DVB. NLP-40 activates both AVL and DVB through the AEX-2 GPCR on these neurons. The activation of two neurons results in a conserved signaling cascade of PKA signaling which leads to the calcium influx in AVL and DVB. Calcium influx triggers the release of the neurotransmitter, GABA, from both neurons and GABA activates enteric muscles through an excitatory GABA receptor, EXP, resulting in the contraction of enteric muscles. Although the circuit and molecular mechanisms underlying Exp is well understood, the mechanism that coordinates synchronized activation of AVL and DVB remains unclear. Because NLP-40 is volume transmitter which diffuses through body cavity before binding to AEX-2, it is very likely that NLP-40 may not activate AVL and DVB at the same time. Using genetic ablation and forward genetic screen, I find that INX-1 is the component of electrical synapses that couple AVL and DVB. Combining calcium imaging, cell specific rescue experiments, and behavioral assays, I demonstrate that INX-1 synchronizes the activation of AVL and DVB through a lateral excitation mechanism in response to NLP-40. I find that the synchronized activation of AVL and DVB ensures precise timing and robustness for the execution of Exp. Furthermore, I find that INX-1 inhibits ectopic activation of DVB during cycle intervals when the input signal is low.
In conclusion, I present evidence to uncover a novel circuit composed of hmc that is regulated by neuropeptide signaling and I identify roles for electrical synapses in coordinating rhythmic muscle contractions. My findings provide a deeper understanding of how pacemaker driven signals are reliably and precisely conveyed to downstream effectors to execute proper behavioral outputs.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Genetic and molecular analysis of a rhythmic behavior in C. elegans: how neuropeptide signaling conveys temporal information

PDF

inx-1 is a negative regulator of the expulsion step of the defecation motor program in C. elegans

PDF

Endogenous H2O2 signaling positively regulates the release of neuropeptides during a neuron-gut axis mediated oxidative stress response in caenorhabditis elegans

PDF

Neuroendocrine regulation of the transcription factor SKN-1/Nrf2 in oxidative stress response

PDF

A pantothenate (vitamin B5) metabolite promotes intestinal neuropeptide secretion as part of the gut-neural axis-mediated stress response

PDF

Neural circuits underlying the modulation and impact of defensive behaviors

PDF

Defining the functional roles of neurotransmitters and neuropeptides in neural circuits

PDF

The calcium-sensing receptor in the specification of normal and malignant hematopoietic cell localization in the bone marrow microenvironment

PDF

Role of purinergic P2X4 receptors in regulation of dopamine homeostasis in the basal ganglia and associated behaviors

Asset Metadata

Creator Choi, Ukjin (filename)

Core Title Defining the circuits and mechanisms mediating a pacemaker-controlled behavior in C. elegans

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Development, Stem Cells and Regenerative Medicine

Degree Conferral Date 2022-12

Publication Date 11/04/2022

Defense Date 10/12/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag C. elegans,electrical synapse,G protein-coupled receptor (GPCR),head mesodermal cell (hmc),innexin,lateral excitation,neuropeptide signaling,OAI-PMH Harvest,shunting inhibition

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Chang, Karen (committee chair), Bonnin, Alexandre (committee member), Sieburth, Derek (committee member)

Creator Email exnbac@gmail.com,ukjincho@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC112305183

Unique identifier UC112305183

Identifier etd-ChoiUkjin-11303.pdf (filename)

Legacy Identifier etd-ChoiUkjin-11303

Document Type Dissertation

Format theses (aat)

Rights Choi, Ukjin

Internet Media Type application/pdf

Type texts

Source 20221107-usctheses-batch-990 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu