University of Southern California Dissertations and Theses

LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

(USC Thesis Other)

LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Copyright 2023 Jonathan Castillo

LINC00261 ALTERS DNA REPAIR AND CONFERS RESISTANCE TO CISPLATIN
INDEPENDENT OF FOXA2 IN LUNG ADENOCARCINOMA

by

Jonathan Castillo

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(CANCER BIOLOGY & GENOMICS)

May 2023

ii

Dedication

To my grandfather, Modesto Castillo. Lung cancer took you away from us early, I hope work here and from
others will reduce the suffering from this terrible disease for future generations.

iii

Acknowledgements

I would like to thank Dr. Crystal N. Marconett for being a fantastic mentor throughout my time at
USC. I am grateful for her commitment in helping me grow as a scientist and for helping me become a
more confident and resilient person. I would like to thank all of the former and current members of the
Marconett lab. I am thankful for working with a supportive group of individuals throughout my time at
USC.
I would also like to thank Dr. Ite Offringa for providing support and guidance. I would like to
thank the members of the Offringa lab for their insights as well as for the use of their equipment. I would
also like to thank the members of my dissertation committee members, Dr. Frank Attenello, and Dr.
Michael Stallcup for their guidance.
Thank you to my wife Lisa Lugo for always being there when I needed you, you have been my
rock throughout this journey. Thank you to my mom, Maria Luisa Castillo for being the most supportive
mother possible. Since elementary school, you would support my interest in math and science, from
taking me to the library to practicing my multiplication tables on our walk to school. To my siblings,
Alexander, Christian, and Erika, thank you for the unconditional love and support.
This project would not have been possible without the funding provided by the American Cancer
Society [RSG-20-135-01], the US Department of Defense [W81XWH-21-1-0231], the Baxter
Foundation, STOP cancer, and the USC Department of Surgery.

iv

Table of Contents

Dedication …...……………………………………………………………………………………………..ii
Acknowledgements ………...…………………………………...………………………………...………iii
List of Figures …….……………………………………………………………………………………….vi
Abstract …...………………………………………………………………………………………...…....viii
Chapter 1: Overview and Introduction
1.1 Lung cancer
1.1.1 Lung cancer statistics ………..…………………………………………….……..1
1.1.2 Lung adenocarcinoma………..………………………………………….………..5
1.1.3 LUAD Clinical intervention .………..…………………………………………...6
1.2 Long non-coding RNA
1.2.1 Mechanism of action ..…….……………………………………………………...8
1.2.2 Long non-coding RNA and cancer ………….………………………………….11
1.3 LINC00261
1.3.1 LINC00261 as a candidate of interest in LUAD ……….……….………………14
1.3.2 LINC00261 and development ………………………….……….………………16
1.3.3 LINC00261 and cancer ………………………………...……….………………17
1.4 DNA Damage Response Pathway
1.4.1 Lung adenocarcinoma and mutational burden.…………………….……………20
1.4.2 ATM and G2/M cell cycle arrest.………………………………………..……...22
1.4.3 Nucleotide Excision Repair.…………………………….………………………22
1.4.4 Clinical implications and interventions ……………..….………………………24

Chapter 2: LINC00261 is a tumor suppressor involved with the DNA damage response pathway
2.1 Introduction.…………………..……………………………………….………….……...26
2.2 Materials and methods.……….……………………………………….………….……...28
2.3 Results
2.3.1 Knockdown of LINC00261 promotes cancer hallmarks.….…………..….……..32
2.3.2 LINC00261 regulates genes within the DNA damage response pathway.……....34
2.3.3 LINC00261 interacts with regulators of the DNA damage response pathway.…36
2.4 Discussion.…………………………………………………………….………….……...39
Chapter 3: LINC00261 alters the efficiency of DNA repair and confers resistance to cisplatin in lung
adenocarcinoma
3.1 Introduction …………………..……………………………………….………….….......41
3.2 Materials and methods………..……………………………………….………….….......43
3.3 Results
3.3.1 LINC00261 expression correlates with mutational burden …………….……….45
3.3.2 Molecular changes in LINC00261-deficient LUAD cells, when exposed to a
mutagen………………………………………………………………………….49
v

3.3.3 LUAD cells deficient of LINC00261 are more susceptible to cisplatin………...52
3.4 Discussion…………………………………………………………….………….………54

Chapter 4: Tumor suppressive role of FOXA2 in the context of LINC00261………………………….....57
4.1. Introduction……………………………………………………………………………………....57
4.2. Materials and methods ………..……………………………………….………….…..................60
4.3. Results
4.3.1. Regulation of LINC00261 by the pioneering transcription factor FOXA2………………...62
4.3.2. LINC00261 regulates a subset of FOXA2-associated transcriptional targets in lung
adenocarcinoma…………………………………………………………………………….64
4.4. Discussion…………………………………………………………………………………….….67

Chapter 5: Conclusions and Perspectives…………………………………………………………………69

BIBLIOGRAPHY …………………………………………………………..…………………………….72

vi

List of Figures
Figure 1.1: Classification of lung tumors by the Whole Health Organization …..……………….………4
Figure 1.2. The ten leading cancer types for the estimated new cancer cases and deaths
by sex in the United States, for 2021 …………………………………………………………….5
Figure 1.3: Molecular origins of LUAD ……….……...……………………………….…………………7
Figure 1.4: Exponential discovery of lncRNAs with the adoption of transcriptome-wide
gene expression technologies ...…………………..………………………………………………10
Figure 1.5: Differential expression analysis of lncRNAs in LUAD ……………..…………...…………..15
Figure 1.6: Structure of human LINC00261 ………………………...……………..……….…….………16
Figure 1.7: LINC00261 and FOXA2 expression across multiple tissue types. …………………………...17
Figure 1.8: Expression of LINC00261 across multiple cancer types …..………………….…….………..19
Figure 1.9: Mutational load among cancers profiled in TCGA ..………………………….…….………..21
Figure 1.10. Canonical Nucleotide Excision Repair Pathways…..……………………….……...……….23

Figure 2.1: Knockdown of LINC00261 promotes proliferation ………………………….………………32
Figure 2.2: Knockout of LINC00261 promotes migration and invasions…………………………………33
Figure 2.3: Knockdown of LINC00261 results in increased colony formation…………………………...33
Figure 2.4: Ectopic expression of LINC00261 in H522 cells ……………………………..…...…………34
Figure 2.5: RNA-seq analysis reveals a role for LINC00261 in DNA damage response pathways………35
Figure 2.6: LINC00261 interacts with ATM, a key regulator of the DNA Damage Response…………...37
Figure 2.7: RNA pulldown of in vitro transcribed LINC00261 …………………………………………..38

Figure 3.1: Low LINC00261 expression correlates with higher tumor mutational burden……………….46
Figure 3.2: Genes ranked by their correlation between gene expression and mutational burden…………47
Figure 3.3: Long term treatment of cisplatin in LINC00261 knockdown LUAD cells…………………...49
Figure 3.4: LINC00261 expression decreases after cisplatin treatment…………………………………...50
Figure 3.5: Gene expression changes before and after cisplatin treatment………………………………..51
vii

Figure 3.6 : Accumulation of somatic mutations when exposed to cisplatin between A549
shLINC00261 and shScrambled control cell lines ...……………………………………………..51
Figure 3.7 : Pathway enrichment analysis of gene differential expressed genes in
LINC00261-deficient cells, when exposed to cisplatin ...…….…………………………………..52
Figure 3.8: LINC00261 alters efficacy of chemotherapeutics on LUAD in vitro …….…………………..53
Figure 3.9: Chemical structure of platin based chemotherapies…………………………………………..56
Figure 3.10: Silenced LINC00261 expression confers to higher HIFIA Expression……………………..56

Figure 4.1: Lower expression of FOXA2 confers to poorer survival outcomes…………………………..58
Figure 4.2: FOXA2 is involved in LINC00261 expression ..…………..………………………….……...63
Figure 4.3: Knockdown of LINC00261 has no effect on FOXA2 expression. ………………….……….63
Figure 4.4: Differential expression analysis of H522 CMV-FOXA2 vs H522 CMV-NEO controls……..65
Figure 4.5: Ingenuity Pathway Analysis of genes differentially expressed with ectopic FOXA2………..66
Figure 4.6: SMAD2 expression in LUAD………………………………………………………………...68

viii

Abstract
Lung cancer is the leading cause of cancer related death in the United States, with lung
adenocarcinoma (LUAD) being among the most common histological subtypes. The current standard of
care for operable LUAD is surgical resection followed by chemotherapy, typically DNA damage-
inducing compounds such as platinum-derivatives. Studies on protein coding driver oncogenes, such as
EGFR and KRAS, have led to promising targeted therapeutics, namely gefitinib and erlotinib for EGFR
and the recently FDA-approved Sotorasib. However, approximately 30% of lung adenocarcinomas lack
known driver mutations. To circumvent this gap of knowledge, our lab studies the role of long non-
coding RNAs (lncRNAs) in the development of cancer. We previously identified LINC00261 as a tumor
suppressor in lung adenocarcinoma (LUAD), that when present predicts better overall patient survival,
decreased tumor cell proliferation and inhibited invasion.
Through transcriptional analysis of LUAD cells where LINC00261 was reintroduced, along with
identifying genes correlated to LINC00261 expression from TCGA-LUAD dataset, we identified that
LINC00261 is involved in the DNA damage response pathway. The loss of LINC00261 in LUAD results
in poorer survival outcome and decreased expression of DNA damage response genes. In addition, LUAD
cells where LINC00261 expression was lost are also more susceptible to the DNA damaging agent,
cisplatin. Collectively, these studies reveal LINC00261 as a novel biomarker for effective response to
DNA damaging therapeutic interventions in LUAD.

1

Chapter 1
Overview and Introduction

1.1 Lung cancer
1.1.1 Lung cancer statistics
Lung cancer is the leading cause of cancer related deaths worldwide, with an estimated 2.2
million new cases and 1.8 million deaths reported for 2020 (1). Compared to other cancers, lung cancer
accounts for about one in ten (11.4%) of all cancer diagnoses and about one in five (18.0%) of all cancer
related deaths (2). Although progress has been made in regard to 5-year survival outcomes in countries
such as Japan (33%), Israel (27%), and the Republic of Korea (25%), the 5-year survival outcome of
patients diagnosed with lung cancer still remains at 10 to 20% in most countries around the world (2).
In the United States, according to the most recent American Cancer Society Surveillance and
Health Services Research, deaths from lung and bronchus cancers are predicted to be ~69,000 in men and
~62,000 in women throughout 2021 (Figure 1.1) (3). Lung cancer rates third in new cancer cases, behind
breast cancer and prostate cancer, yet is the leading cause of cancer related deaths (3). With about one in
four cancer related deaths being attributed to lung cancer, it surpasses colon, breast, and prostate cancer
deaths, combined (3). While there have been modest improvements in outcomes over the past 10 years,
the five-year survival outcomes for lung cancer remains poor at ~21%. When broken down by stages,
metastatic disease reflects the majority of deaths, as 57% of patients are diagnosed with metastatic
disease, which has a survival five-year outcome of only 6%. Optimistically, trends in lung cancer deaths
have decreased in the United States over the years. As of 2018, death rates have dropped by 54% among
men and by 30% among women, compared to their peaks of 1990 and 2002, respectively. Overall cases of
lung cancer diagnosis have also dropped, where the decline has been twice as fast in men than in women
2

(3). This can be attributed to the differences in tobacco use, as overall cigarette smoking in the United
States has been in decline since the mid-20
th
century (4).
Advances in surgical procedures have also improved survival outcomes of patients with earlier
stages and more localized disease. Modern surgical techniques such as invasive video-assisted
thoracoscopic surgery (VATS) for lung resections have been shown to be better than open surgeries (5).
From a systematic review and meta-analysis, VATS lobectomy for early stage lung cancer was found to
result in a 5-year survival of 80.1%, compared to 65.5% for patients who underwent open lobectomy (5).
In addition, advances in targeted therapy such those against EGFR mutations are also noted for improving
survival outcomes in lung cancer patients (6). Immunotherapies are also emerging as a therapeutic option
for lung cancer. Programmed cell death protein-1/programmed death ligand-1 (PD-L1) inhibitors which
reactivates the immune response was recently approved in 2015 for non-small cell lung cancer treatment
(7). In addition, emerging biomarkers, such as total mutational burden (TMB) have become more
significant as they confer to better clinical response towards immunotherapies (8).
Early detection strategies such as low-dose computed tomography (CT) among high-risk
individuals, such as those who are current smokers or former heavy smokers, have helped in reducing
overall lung deaths (9). Annual low-dose CT screens of patients with 30+ pack-years saw a 20% reduction
in lung cancer mortality compared to previous standard of screening. However, CT screening among
young and/or non-smokers have shown little effect on overall survival (9). This raises the need for a more
comprehensive early detection strategy for young and non-smokers.
The development of early detection strategies is further complicated due to lung cancer consisting
of several distinct subtypes, each with their own etiology, molecular characterizations, and clinical
outcomes. Historically, lung cancer was broadly categorized into two major histological groups, non-
small cell lung cancer and small cell lung cancer. The case for targeted treatment based on histological
subtype became apparent when comparing with lung adenocarcinoma and squamous cell carcinoma, with
3

adenocarcinoma have much higher survival outcomes with cisplatin/pemetrexed, than those administered
with cisplatin/gemcitabine (10). However, cancer types such as large cell, failed to have defined
molecular characterizations and were often used as a ‘catch-all group’ for non-classified lung tumors.
In the case of lung cancer, in 2015, the World Health Organization Classification of Lung Tumors
made the effort to incorporate genetic and immunohistochemical aspects to the categorization of lung
tumors. The changes in guidelines made strides in more specific sub-classifications of tumors from small
biopsies and cytological samples, which were previously lacking (11). The new classifications addressed
issues regarding genetic and immunohistochemical aspects of different tumor subtypes, such as the use of
small cell variants of squamous cell carcinoma. The term small cell variant in a clinical practice was at
times confused with small cell carcinoma, so the term was discontinued in the 2015 recommendations
(11). The major changes include large cell carcinoma, which is no longer recommended as a catch-all
classification, and specified immunohistology is recommended for adenocarcinoma-like or squamous
carcinoma-like classification (Figure 1.2).
Lung cancers are broadly categorized by their histological subtypes, as either small cell lung
cancer (SCLC) or non-small cell lung cancer (NSCLC). NSCLC, which occurs in ~85% of lung cancer
cases, can further be broken down into lung adenocarcinoma (LUAD), squamous cell carcinoma (SCC),
and other less often-occurring NSCLC subtypes with heterogeneous categories and broad terminology,
including adenosquamous carcinoma, sarcomatoid carcinoma, and non-small cell neuroendocrine tumors.
Large cell carcinoma remains as a descriptor if no clear adenocarcinoma, squamous, or neuroendocrine
morphology or staining pattern is observed (4).
4

Figure 1.1 - The ten leading cancer types for the estimated new cancer cases and deaths by sex in the United
States, for 2021. Ranking is based on modeled projections and may differ from the most recent observed data. Note,
the 2021 projections are based on currently available incidence and mortality data, thus projections do not reflect the
impact of the COVID-19 pandemic on cancer cases and deaths. Figure from Siegel et al., 2021 (3).
5

Figure 1.2 - Classification of lung tumors by the World Health Organization. Inner circle represents the
traditional classification of lung cancer, broken into non-small cell lung cancer and small cell lung cancer. The outer
ring shows the current classifications from the WHO Classification of Lung Tumors of 2021 (12). Figure modified
from Travis et al., 2015 (13).

1.1.2 Lung adenocarcinoma
Lung adenocarcinoma (LUAD) is the most common histological subtype of lung cancer. It falls
under the category of non-small cell lung cancer (NSCLC), accounting for ~40% of such cases (14).
LUAD is defined as a malignant tumor of epithelial origin, specifically originating from alveolar
epithelial cells (11). LUAD can be broken down into specific histological patterns, such as lepidic, acinar,
papillary, micropapillary, and solid patterns. Although many LUAD tumors will present intermixed
patterns, the different patterns are associated with varying prognostic outcomes (11,15).
Although tobacco smoking accounts for more than 80% of lung adenocarcinoma cases, lung
adenocarcinoma is the most common subtype in never smokers. In the United States, overall cases of lung
6

cancer have been declining, however, the relative frequency of lung adenocarcinoma has been increasing
(5). This is in part due to the continual decrease of tobacco smoking seen in the United States since the
late 20th century. In addition, other non-smoking risk factors remain a point of concern, such as human
papillomavirus infections, both indoor and outdoor air pollution, and genetic susceptibility (16).
In spite of the drop in tobacco use, lung cancer still remains the leading cause of cancer related
death in the US. Due to the poor survival out for patients with metastatic LUAD, more comprehensive
therapies are necessary for meaningful improvement of clinical outcomes.
1.1.3 Lung adenocarcinoma clinical interventions
Treatment of lung adenocarcinoma depends on the stage of the tumor. For earlier staging of
disease, resection surgery is the treatment of choice. For more advanced stages of the disease, a
combination of surgery, radiation and chemotherapy is used to manage tumor growth. However, the high
mortality of LUAD is in part due to many patients having metastatic disease at the time of diagnosis.
Until the last decade, the 5-year overall survival rate for patients with metastatic non-small cell lung
cancer was less than 5% (3), emphasizing the need for more effective systemic therapies for improvement
in long term survival (17 –19).
Chemotherapies remain the standard of care for advanced stages of the disease. In general, they
are defined as any cytotoxic therapy that can disrupt cellular processes, such as proliferation, DNA
stability, angiogenesis, and metabolism. Although they come with excessive side effects, multiple studies
have demonstrated that chemotherapies provide improvements in survival (20,21).
The advent of large-scale molecular profiling has allowed for the targeted therapy that can aid in
prognostic and therapeutic outcomes. Several molecular alterations have been identified for lung
adenocarcinoma, such as EGFR mutations, ALK/ROS rearrangements, and Kras activating mutations.
Each of these have provided options for targeted therapies in cancer patients, notably, Erlotinib and
Gefintinib, both EGFR inhibitors, and the recently FDA-approved sotorasib for KrasG12C mutation
7

commonly found in lung cancer (22–24). Unfortunately, of LUAD cases screened, approximately 30%
harbor no known oncogenic driver mutations (17,18), emphasizing the need for a deeper understanding of
the molecular mechanisms underlying carcinogenesis (Figure 1.4).

Figure 1.3: Molecular origins of LUAD. Lung adenocarcinoma (LUAD) arises in the distal alveolar epithelium
from progenitor alveolar epithelial cells. LUAD develops from these precursor cells through oncogenic activation
(and deactivation of tumor suppressors) by induced mutations to the DNA, including amplification, fusion events,
and epigenomic alterations. Genes listed were taken from TCGA analysis of LUAD (25). Added to this is the newly
emergent appreciation for altered lncRNA regulation of cellular processes as an oncogenic event. Figure from
Castillo et al., 2017 (26).

8

Figure 1.4 – Large percentage of LUAD cases have no targetable mutations. Actionable oncogenic driver
alterations defined by OncoKB classifications (27). Cases with two or more mutations are represented only once
based on the mutation that primarily dictated clinical care, based on OncoKB. Figure from Skoulidis et al., 2019
(28).

9

1.2 Long non-coding RNAs
1.2.1 Mechanism of action
The conventional central dogma of molecular biology suggests genetic information transfer from
DNA to RNA to protein. Since the expansion of next generation sequencing of the past couple of decades,
it’s been revealed that most of the human genome is transcribed, as much as 70-90% is transcribed at
some point during development (29,30). However, little of this is translated into protein; in fact, only
1.5% of the transcribed human genome accounts for protein-coding genes. Included within the larger
class of non-protein coding RNAs are the translation related RNAs which include ribosomal RNA
(rRNA) and transfer RNA (tRNA), as well as the small non-coding RNAs, which include siRNA,
miRNA, and piRNAs involved in transcriptional gene silencing.
The remaining set of ncRNAs are categorized as long non-coding RNAs (lncRNA) which are
broadly categorized as non-coding RNAs greater than 200 nucleotides. These non-coding transcribed
regions of the genome were once considered “junk DNA”, simply leaky transcription or evolutionary
noise due to their lack of translational capability and poor sequence conservation. However, through
extensive annotation efforts, from ENCODE, LNCipedia and the HUGO Gene Nomenclature Committee,
many of these transcripts have been shown to have telltale signs of functional relevance (31). These
include epigenetic marks consistent with a transcribed gene, transcription vis RNA polymerase II, RNA
splicing, poly adenylation and 5’ capping (31,32). With the advent of sequencing technologies, pace of
discovery and functional validation of lncRNAs has increased exponentially (Figure 1.3).
In addition, it was quickly realized that the lack of evolutionary conservation did not rule out
conserved function. In fact, many lncRNAs show conserved secondary structure between species while
having poor sequence conservation (33). There are many instances of lncRNAs such as Air and Xist
which are poorly conserved across mammals yet maintain similar function (34). It is now accepted that
the human genome contains many thousands of lncRNA transcripts. Functional implications of this
10

discovery have yet to be fully elucidated. To date lncRNAs have been detected throughout development
and in every cell-type tested thus far.
Similar to mRNA genes, many lncRNA genes are transcribed by RNA polymerase II, are spliced,
and contain polyadenylation signals. In addition, many lncRNA undergo similar pre-mRNA processing
such as capping, splicing, cleavage/polyadenylation, and nuclear export. Mechanistically, lncRNAs can
broadly act in cis, where the transcriptional product influences the expression and epigenetic state of
nearby genes; and in trans, with functions throughout the cell. At the post-transcriptional level, lncRNAs
regulate splicing, microRNA targeting, and through RNA-protein interactions, can influence their binding
partner function, localization, and activity.

Figure 1.4: Exponential discovery of lncRNAs with the adoption of transcriptome-wide gene expression
technologies. Graph indicates the total number of publications per year for select lncRNAs with known involvement
in LUAD. With the advent of transcriptomic profiling, the pace of lncRNA discovery and papers characterizing their
function has increased exponentially over the last decade. Figure from Castillo et. al., 2017 (26).

11

With the exception of reported micro proteins, long non-coding RNAs have no translational
product, yet still demonstrate a functional biological role. One such example is the critical role the
lncRNA Xist plays in genomic organization by mediating X-chromosome condensation (35,36).
Another function of cis-regulatory lncRNA is the ability to alter nuclear structures such as the
formation of nuclear bodies, such as the nucleolus, paraspeckles, and Cajol bodies. Nuclear bodies are
membraneless, RNA-protein complexes which, in the case of the nucleolus, serve as the site for rRNA
transcription or other specialized functions within the nucleus. The nuclear paraspeckle assembly
transcript 1 (NEAT1), is one such RNA, which helps to maintain the shape of nuclear paraspeckles (37).
Consistent with its role in paraspeckle maintenance as sites of DNA repair, NEAT1 dysregulation has
been reported in multiple cancers, where loss of paraspeckle structure leads to accumulation of DNA
mutations and higher expression is correlated with worst survival outcomes in cancer patients (37).
Beyond loci-specific regulation in cis, lncRNA can operate in trans. This is possible due to
multiple mechanisms stabilizing the transcript, including the 5’ capping and polyA tail modifications
(38), as well as the formation of triple helices on lncRNA without polyadenylated 3’ends (39). These
modifications allow lncRNA to be transported to other locations including throughout the nuclear
compartment as well as exported to the cytoplasm. Coupled with secondary and tertiary structural folding,
lncRNA are also capable of functioning in a trans-regulatory manner. lncRNAs can serve as a protein
scaffold, and in turn facilitate interaction between protein complexes and specific DNA binding sites
(40,41), thus altering the three dimensional DNA chromatin structures (42).

1.2.2 Long non-coding RNA and cancer
One field that has been particularly active in lncRNA discovery is cancer biology. Due to the
pressing need for development of novel therapeutics and diagnostics, many newly emergent fields have
been focused on cancer research. These include the discovery of microRNAs, targeted immunotherapy,
12

and most recently circulating tumor cells. Added to this ever-growing list are lncRNAs. Their implication
in a diverse array of regulatory roles has heightened interest in these molecules as functional players in
the development and heterogeneity of cancer. In terms of biological processes, lncRNAs are involved in
regulation of the cell cycle, apoptosis, differentiation, and immunological response (43,44). Despite the
large repertoire of lncRNAs expressed in the lung, only a handful have been functionally linked to LUAD
development (26). Some exhibit hallmarks of tumor suppression, such as MEG3 (45,46), while others,
such as HOTAIR, behave as oncogenes through increased proliferation and reduced survival (47,48).
The discovery of tens of thousands of lncRNAs have provided new opportunities for cancer
diagnostics and treatment. One feature of lncRNAs that make it advantageous in cancer research is the
higher tissue and cell type expression specificity, compared to protein coding genes (49,50). This makes
lncRNAs an ideal candidate as biomarkers, as they can be used to classify different subclasses of tumors
and perhaps predict responses to treatment.
One example is the prostate cancer antigen 3 (PCA3), also known as DD3, which is a lncRNA
first recognized as an upregulated gene in prostate cancer in the late 1990s (51). PCA3 gained much
attention as a biomarker for prostate cancer as its expression is highly specific and sensitive. It is
overexpressed in prostate tumors by 30- to 100-fold, compared to prostatic tissue and is not expressed in
other tumor types (51 –53). PCA3 is even better than the serum prostate specific antigen (PSA) test for
detecting prostate cancer (54). PCA3 as a biomarker has been approved by the Food and Drug
Administration (FDA) and is now widely used for prostate cancer detection (55,56). With molecular and
medical tools such as RNA-FISH, qRT-PCR, and liquid biopsy, lncRNAs are emerging as convenient and
minimally invasive diagnostic markers.
Knowledge of the pathway the lncRNA is involved in can also open avenues for therapeutic
intervention. Although PCA3 is used as a biomarker, research in understanding the molecular mechanism
of PCA3 has opened avenues for therapeutic applications. PCA3 has been shown to promote survival of
13

prostate cancer cells through the modulation of androgen-receptor (AR) signaling, thus knockdown of
PCA3 has been proposed as a possible therapeutic intervention strategy (57). Although anti-androgens
have been developed for treatment of prostate cancer, many patients develop resistance to these classes of
drugs. In fact, knockdown of PCA3 in prostate cancer cell lines has been shown to enhance the efficacy of
anti-androgens, such as enzalutamide (58).

14

1.3 Long intergenic non-protein coding RNA 261 (LINC00261)
1.3.1 LINC00261 as a candidate of interest in LUAD
Prior work from the Marconett lab aimed to identify key lncRNA of interest in the context of
LUAD. To do so, the lab sequenced 16 different LUAD cell lines and primary human alveolar epithelial
cells (AECs) from three donors, the cell of origin for LUAD. Comparison between the LUAD cell lines
and AECs transcriptome revealed 649 lncRNA genes to be differentially expressed (Figure 1.5) (59). To
account for lncRNAs differentially expressed due to effects of in vitro culture, the list was compared to
lncRNAs differentially expressed in primary human LUAD tumors profiled by TCGA, narrowing the list
to 16 lncRNAs with relevance in both human tumors and cell lines. While previous transcriptome
analyses have determined that thousands of genes are differentially expressed in cancers when compared
with the adjacent normal tissues, few are "drivers'' of carcinogenesis. In order narrow the list of potential
candidate genes that are of interest in tumorigenesis, we focused on genes whose expression status
correlated with survival outcomes to determine which candidate lncRNAs had a high probability of
functionally affecting carcinogenesis. Six of the 16 candidate lncRNAs had significant effects on survival,
and LINC00261 emerged as the top candidate with a dramatic stage-dependent effect on expression and
survival (59).

15

Figure 1.5: Differential expression analysis of lncRNAs in LUAD. Volcano plot of differential expression
analysis for lncRNAs in 16 LUAD cell lines, compared to three primary alveolar epithelial cells. Black arrow points
to LINC00261. Data and figure from Shahabi et al., 2019 (59).

The lncRNA known as LINC00261 is an intergenic non-coding RNA that is located upstream of
the FOXA2 gene locus (Figure 1.6). The gene has other aliases, including but not limited to ALIEN,
LL35, C20orf56, DEANR1, FALCOR, HCCDR1, NCRNA00261, onco-lncRNA-17, and
TCONS_00027846 (60). The first published paper to discuss the lncRNA downstream to the FOXA2 loci
was by Herriges et al (61). Through transcriptional analysis, they identified lncRNAs located near
transcription factors, including NKX2.1, GATA6, FOXA2, and FOXF1, that are involved in mouse
foregut and lung development. The lncRNA gene, LL35 was found upstream of the Foxa2 loci, and this
gene was found to be highly correlated to Foxa2 (61). However, although the transcriptional start site of
LL35 is 2.5kb downstream of the Foxa2 gene, similar to the human homolog, both LL35 and LINC00261
transcripts have little sequence overlap (Figure 1.6). In fact, only exon 1 of the human homolog has
overlap over the mouse LL35 transcribed segment (Figure 1.6B). This brings to question whether the
mouse homolog is functionally similar to the human LINC00261 gene.
16

1.3.2 LINC00261 and development
The LINC00261 gene is located downstream of the Forkhead box transcription factor A2
(FOXA2) gene (Figure 1.6A). FOXA2 is a pioneering transcription factor that has critical regulatory
functions in prostate, lung, liver, and overall endoderm development. FOXA2 is essential for normal
differentiation of the alveolar epithelium, as FOXA2 ablation results in disrupted alveolarization (62). In
addition to its role in endoderm development, FOXA2 also plays a key role in the control of glucose
metabolism and lipid homeostasis (63,64).
Although FOXA2 is downregulated in cancer and has been implemented in tumor suppressive
properties, the exact mechanism of how FOXA2 functions as a tumor suppressor remains elusive. One
report finds FOXA2 to function as a tumor suppressor via inhibition of the epithelial-to-mesenchymal
transition (EMT) (65). However, it remains unknown how FOXA2 is regulated upstream of the observed
EMT in the context of lung cancer.

Figure 1.6: Structure of human LINC00261. (A) Diagram of RefGene annotated human LINC00261 gene.
Proximity to the pioneering transcription factor FOXA2 is shown along with sequence conservation with primates.
(B) Predicted orthologs of LINC00261 in mice. Sequence conservation does not align with known ncRNA
transcripts from the RIKEN mouse cDNA collection (66).
17

1.3.3 LINC00261 and cancer
Because lncRNAs have been shown to be involved in cis regulation of nearby genes (67), the
proximity of LINC00261 locus to this key differentiating factor for lung development makes it of interest
for further study in the context of lung cancer. In fact, the expression of FOXA2 and LINC00261 is highly
correlated in multiple human tissues (Figure 1.7). Others have also reported high correlation of the two
genes in mice (68,69).
At the start of this research, little was known about the functional role of LINC00261 in cancer
cells, although some papers suggested a corollary effect to its dysregulation and cancer (70 –72). One of
the first papers to discuss a functional role of LINC00261 in human cells, looked at LINC00261 role in
human endoderm differentiation (69). LINC00261 was shown to contribute to endoderm differentiation by
positively regulating expression of FOXA2, via recruitment of SMAD2/3 to the FOXA2 promoter.

Figure 1.7: LINC00261 and FOXA2 expression across multiple tissue types. LINC00261 expression levels from
multiple tissue types within the Genotype-Tissue Expression (GTEx) data set (73,74). Downloaded from GTEx,
using the R package TCGAbiolinks (75).
18

Work done by myself and colleagues in the Marconett lab suggest that in lung cancer LINC00261
is epigenetically silenced and FOXA2 is responsible for the activation of LINC00261 expression in
LUAD (See Chapter 4 and Shahabi et al., 2019 for more details) (59). However, in an endodermal
differentiation model, it was reported that LINC00261 regulated FOXA2 expression (69). LINC00261 was
shown to contribute to endoderm differentiation by positively regulating expression of FOXA2, via
recruitment of SMAD2/3 to the FOXA2 promoter. It might be the case that SMAD2/3 functions
differently in LUAD, compared to endodermal differentiation. At the moment, the role of SMAD2/3
remains elusive in LUAD (76), so how SMAD2/3 interact with LINC00261 in cancer remains unknown.
In addition to work done by my colleagues and I in the Marconett lab identifying LINC00261 as a
gene of interest in the development of lung adenocarcinoma, others have also reported LINC00261 as a
tumor suppressor in multiple other cancers. It has been reported to be downregulated in a variety of
human cancers, including lung, gastric, pancreatic, and colorectal, of which results in poorer survival
outcomes (77 –80).
In most instances, LINC00261 is observed to function as a tumor suppressor in these cancer
types, the exception being neuroendocrine prostate cancer (NEPC) (81). Interestingly, LINC00261
expression is upregulated in the highly aggressive NEPC, compared to other prostate cancer subtypes.
Upregulation of LINC00261 also predicts poor prognosis in cholangiocarcinoma (CHOL) (82). It remains
unclear how dysregulation of LINC00261 results in different survival outcomes in different tissues. In the
cases above, both NEPC and CHOL originate from different mechanisms. NEPC originate from
neuroendocrine cells and from prostate adenocarcinoma undergoing transdifferentiation following
androgen receptor inhibitor therapy, where adenocarcinoma features are lost, and neuroendocrine
phenotypes are gained (83). As for CHOL, the cancer originates from epithelial cells lining bile duct
within the liver and the cancer retains adenocarcinoma histological and molecular features (84). Further
work is needed to identify the unique role LINC00261 plays in different cancer types.
19

Mechanistically, there are reports LINC00261 can act as a sponge by binding to miRNA. One
such case shows LINC00261 functioning as a competitive endogenous RNA (ceRNA) for miR-522-3p
(85). In pancreatic cancer, LINC00261 RNA has been reported to bind to both miR-23a-3p and miR-222-
3p, where the downregulation of LINC00261 results in overactivation of the HIPK2/ERK pathway,
resulting in increased proliferation of pancreatic cancer cells (86,87). How LINC00261 is regulated seems
to differ depending on cancer type.

Figure 1.8: Expression of LINC00261 across multiple cancer types. Expression data of LINC00261 from TCGA
data sets [units in FPKM]. Only displaying tumor types who had a median LINC00261 expression of FPKM>1 in
either solid tissue normal or primary tumor. Salmon = solid tissue normal, teal = primary tumor. TCGA identifiers
indicate tumor type (https://gdc.cancer.gov/resources-tcga-users/tcga-code-tables/tcga-study-abbreviations).

20

1.4 DNA Damage Response and Lung Cancer
1.4.1 Lung Adenocarcinoma and Mutational burden
One of the major driving forces of carcinogenesis is the accumulation of DNA mutations. Rates
of mutation vary considerably among tumor types, with melanomas and lung cancers as having among the
highest rates of DNA mutation accumulation (8,88) (Figure 1.9). This in part is due to exposure to
exogenous factors, such as UV light or pollution. In lung cancers, this is due in part to exposure from
environmental mutagens, such as tobacco smoke and air particulate pollution, but accumulation of
mutations can also be attributed to loss of effective DNA damage response (DDR), resulting in high
accumulation of mutations (89,90) (Figure 1.9). In addition, mutations at key DNA repair genes can
compound the effect.
Because of the exposure to environmental factors, lung adenocarcinoma tends to have a high
somatic tumor mutational burden (TMB), which is defined as the number of nonsynonymous coding
mutations per megabase (91). The rationale for excluding synonymous mutations and mutations at non-
coding regions is due to not producing neoantigens, of which TMB is used as a proxy for the
immunogenicity the tumor produces. These neoantigens, which can be detected by tumor-infiltrating
cytotoxic T cells, result in an immune response.
TMB as a biomarker is used clinically, alongside PD-L1 and CTLA4 status, to determine which
patients may benefit from immunotherapy (92), as a high TMB load can give rise to neoantigens that
signal the immune system to effectively distinguish the tumor from surrounding normal tissue, provided
the inhibitory signal is blocked by checkpoint inhibitors. Understanding the key mechanisms causing
elevated TMB can give us a molecular understanding of the basis for the efficacy of immune checkpoint
therapies. This strategy has to date been highly successful in melanoma, lung cancers, and other solid
tumors, with moderate success seen in solid tumors of endodermal origin (8). Specifically, high TMB
non-small cell lung cancer tumors have shown moderate efficacy towards immune checkpoint inhibitors
21

(89). Understanding which patients will see clinical benefit is paramount to improving clinical outcomes.
Although deficiencies in expression and function of some DDR genes correlate with high TMB levels,
recent studies have suggested that DDR gene alterations themselves can serve as predictive biomarkers of
immunotherapy response (90). In addition to immunotherapies, platinum-based chemotherapeutics have
also shown efficacy towards patients with tumors containing high TMB (92). A major drawback of
platinum-based chemotherapeutics is the associated high levels of morbidity, where the response rate is
~27% with chemotherapy (89). Determining which patients are high-confidence responders prior to
chemotherapeutic administration could significantly improve patient outcomes.

Figure 1.9: Mutational load among cancers profiled in The Cancer Genome Atlas (TCGA) cohorts. Lung
adenocarcinoma is among the cancer types with the highest mutational burden. Data from TCGA and generated with
the R package “maftools” (93).

22

1.4.2 ATM and G2/M cell cycle arrest
Genomic instability is a key hallmark of all cancer types, especially in environmental mutagen
driven cancers such as lung cancer. Many of the common chemotherapy interventions are DNA damaging
agents which take advantage of cancer cell lack of proper DNA repair capabilities (94). Although the
silencing of key DNA damage repair pathways and thus the accumulation of mutations seen in lung
cancer are drivers of carcinogenesis, the resulting lack of functional repair components provide a key
opportunity to target cancer cells with DNA damaging agents. In addition, the rapidly dividing nature of
cancer cells, compared to normal cells makes the cell cycle a target for cancer intervention. Progression
through the cell cycle is driven by protein phosphorylation, with ataxia telangiectasia mutated (ATM) and
ATM and Rad3-related (ATR) as one of the many effector kinases. ATM and ATR respond to DNA
double strand breaks and replication stress (95). This signaling cascade culminates in activation of G2/M
cell cycle arrest, shutting down cell proliferation long enough for DNA repair to occur. In the absence of
efficient DNA repair, progression through mitosis will result in DNA tangling, tearing, and loss of
genomic integrity.

1.4.3 Nucleotide Excision Repair

Mutational accumulation in cancer is often recognized by specific detection pathways that are
able to initiate recruitment of ATM and downstream DDR signaling components. One such pathway,
Nucleotide Excision Repair (NER), specifically recognizes thymidine dimers and other bulky adducts and
targets them for excision and repair. NER is often associated with ultraviolet light damage and may be the
primary mechanism of repair that occurs at the replication fork to maintain DNA fidelity.
There are two distinct pathways that encompass NER, transcription-coupled (tc-NER) and global
genomic (gg-NER). These two pathways are differentiated by their genomic localization, as tc-NER
occurs at sites of active transcription whereas gg-NER occurs throughout the rest of the genome
23

independent of transcription. The two pathways can also be distinguished by the composition of factors
involved in recognition of the bulky adducts. Specifically, XPC participates in site recognition for gg-
NER, whereas tc-NER utilizes XPG coupled to CSB. Together, these interact with TFIIH, a known
binding component present at transcriptional start complexes. Once recognized, both pathways converge
with subsequent recruitment of XPA and additional factors to allow ERCC1 to induce nicks that allow
DNA polymerase to excise and fill the lesion with replaced nucleotides, effectively removing the bulky
adduct and restoring DNA fidelity.

Figure 1.10. Canonical Nucleotide Excision Repair Pathways. Transcription-coupled repair pathway is utilized
when DNA damage occurs at sites of active transcription, otherwise, global excision repair is used. Figure from Fuss
et al., 2006 (96).

24

1.4.4 Clinical implications and interventions
The DNA-damaging agents that are used in cancer treatment vary widely in their function and
produce a variety of toxic lesions (97). Ionizing radiation induces double-strand breaks (DSBs).
Alkylating agents induce DNA base modifications, which interfere with DNA synthesis. Such examples
include, but are not limited to, platinum-based compounds such as cisplatin, carboplatin, and oxaliplatin
(97). Lesions produced by some alkylators are processed into toxic lesions in a mismatch repair-
dependent manner (97,98). Platinum-based therapies have been the standard of care for patients with
advanced stage lung adenocarcinoma. Cisplatin forms intra-strand crosslinks in DNA, which disturbs
DNA replication and causes DNA damage, eventually inducing necrosis or apoptosis. Cisplatin-based
chemotherapy is widely used to treat NSCLC and has been shown to improve patient survival rates (17).
lncRNAs have recently been characterized as having a role in the DNA damage response, the
regulation of ATM, p53, and multiple other key regulators. Some of the first set of lncRNAs identified as
being involved in DNA damage were found via genome-wide screening of lncRNA expression profiles in
ATM knockout cells being treated with a mutagen (99). Double strand breaks were shown to induce
widespread changes in lncRNA expression, including an increase in 100 ATM-dependent lncRNAs and a
decrease in 70 ATM-dependent lncRNAs (99). From the ATM-dependent lncRNAs found, lncRNA-
JADE was shown to induce G1/S cell cycle arrest and cause inhibition of apoptosis in response to DNA
damage (99).
In addition, several screening studies have found lncRNAs both as key downstream targets and
regulators of p53 in the context of DNA repair (100,101). Multiple lncRNAs have been categorized as
p53 regulators, where they are capable of regulating p53 directly or indirectly, such as MALAT1, MEG3,
and WRAP53 (101). MALAT1 has previously been shown to be strongly linked to cancer progression,
where it represses p53 when upregulated (102). Due to the multiple cellular alterations in cancer cells that
can be mediated by lncRNA dysregulation, multiple mechanisms, from intracellular detoxification to
25

maintenance of DNA damage response pathways, have lncRNAs involved. The lncRNA HOTAIR, when
overexpressed, has shown cisplatin resistance by suppressing p21, a cyclin-dependent kinase inhibitor
which blocks cell proliferation (103).
Overall, precision medicine in the treatment of LUAD has mainly focused on tyrosine kinase
inhibitors and emerging biomarkers for immunotherapy (19). However, in terms of protein-coding
mutations, several patients still development cancer lacking targetable driver mutations (Figure 1.4). In
addition, DNA damaging agents are still a viable option in targeting tumors with DDR deficiencies
(21,104,105). As shown above, lncRNAs are emerging as a promising biomarker in targeting patients
with DNA damaging agents (106). In the next chapter, I will discuss the function of LINC00261 in acting
as a tumor suppressive and in regulating DNA damage response pathway in LUAD. By understanding the
molecular mechanisms by which this gene functions with LUAD, LINC00261 can serve as an additional
biomarker in guiding therapy to patients.

26

Chapter 2
LINC00261 is a tumor suppressor involved with the
DNA damage response pathway

2.1 Introduction
Lung cancer continues to be the leading cause of cancer-related death in the United States, with
approximately 130,000 deaths reported annually, accounting for a quarter of all cancer deaths (3). Lung
adenocarcinoma encompasses the most often occurring histologic subtype of lung cancer at about 40%
(107 –109). Progress in understanding the molecular mechanisms of LUAD has provided new treatment
options. Molecularly targeted therapies began seeing use in the late 1990s with the introduction of
gefitinib, a EGFR tyrosine kinase inhibitor (110). Unfortunately, approximately 30% of LUAD tumors
harbor no known oncogenic driver mutations (111), emphasizing the need for a deeper understanding of
the molecular mechanisms underlying carcinogenesis.
In the last decade, the role of lncRNAs as key regulators of cellular activity has become widely
apparent (43,44). RNAs play many roles in cellular physiology, regulating processes integral to cellular
survival. Long noncoding RNA transcripts are a largely uncharacterized subtype of RNA defined as
transcripts greater than 200 nucleotides in length with little to no protein-coding capacity. Their high
tissue specificity and temporal expression patterns suggest that they serve highly significant functions
throughout the development (30,112). In addition, lncRNAs exert a variety of functions throughout the
cell, acting in cis locally or in trans at different loci throughout the genome, playing critical roles in gene
regulation and the development of cancer (44).
Large-scale profiling studies, such as that performed by The Cancer Genome Atlas, have revealed
thousands of differentially expressed lncRNAs in multiple cancers (113), yet little is known of how these
candidates function at a molecular level to regulate cellular phenotypes. In addition, epigenetic alterations
27

to lncRNA expression have been suggested to contribute to the cancer phenotype (114). The mechanisms
of action for these lncRNAs are diverse, underscoring both the pivotal roles lncRNAs play in the
development of cancer and our current limited understanding of lncRNAs’ full role in the pathogenesis of
this disease.
To identify novel lncRNAs involved in LUAD, the Marconett lab previously sequenced the
transcriptome of 16 different LUAD cell lines and compared those to three primary alveolar epithelial
cells, the cell of origin for LUAD (Figure 1.5). LINC00261 was selected as a gene of further interest due
to its gene expression correlating to survival outcomes (59). In addition, its locus being adjacent to the
pioneering transcription factor FOXA2 gene, which has a known role in lung development (Figure 1.6)
(62,115). In the present study, I determined whether LINC00261 has a functional role in lung
adenocarcinoma cell lines. Using knockdown and re-expression constructs, LINC00261 expression was
altered in LUAD cell lines and key cancer hallmarks were measured. Here, I report that LINC00261
functions as a tumor suppressor and is a regulator of the DNA damage response pathway.

28

2.2 Materials and methods
Cell culture
Human lung cancer cell lines NCI-H522 and A549 were obtained from the laboratory of E. Haura
or American Type Culture Collection (ATCC), respectively. Cells were fingerprinted to verify their
identity prior to experimentation at the University of Arizona Genetics Core and were verified
mycoplasma-free every 6 months in the lab. Cells were cultured in RPMI-1640 medium (Corning, Cat#
45000-396) containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and
100 U/mL penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730).
Generating Stable Transfections
A549 cells were stable transfected with either the linearized shLINC00261 (Origene, pRFP-B-RS,
Cat# TF317893) or shScrambled (Origene, Scrambled shRNA control in pGFP-V-RS shRNA Vector,
Cat# TR30013) plasmid with Fugene HD (Promega, Cat# E2311). Both plasmids were linearized with
AgeI (New England Biolabs, Cat# R3552S) and cleaned using QIAquick PCR Purification kit (Qiagen,
Cat# 28104) prior to transfection. For the transfection, 200,000 A549 cells were plated onto 6-well plates.
The day after, 3.0 ug of DNA in a reagent:DNA ratio of 3:1 was used for the transfection (150 µL mixture
of 3 µg of DNA, 9 µL of Fugene HD, and topped off with OptiMEM (Gibco, Cat# 31985088) per each 6-
well). Two days after transfection, stable selection was done with 0.625 µg/mL puromycin (Santa Cruz
Biotech, Cat# sc-108071). After 2-3 weeks, monoclonal colonies were large enough to isolate by picking
with a 200 µL tip and transferred to a 96-well with complete medium containing 0.625 µg/mL puromycin.
In cases where individual colonies were too difficult to select, cells were trypsinized and cells in DPBS
were flow sorted at one cell per 96-well. Flow sorting was performed by the USC Flow Cytometry
Facility, with the BD SORP FACSAria IIu cell sorter.
The targeting sequence of the shLINC00261 plasmid used is CTGTGACATAGGTGGATAT,
targeting the middle of exon 4 of the LINC00261 RNA. The targeting sequence of the shScrambled
29

plasmid is GCACTACCAGAGCTAACTCAGATAGTACT. When performing a BLAT search with the
USCS genome browser, the Scrambled sequence has no similarity to the human hg38 reference genome.
H522 cells were stable transfected with linearized CMV-NEO (Origene, pCMV6-Entry
Mammalian Expression Vector, Cat# PS100001), CMV-LINC00261 (pCMV6-Entry backbone), or CMV-
FOXA2 (pCMV6-Entry backbone). Construction of CMV-LINC00261 is described in Shahabi et al.,
2019 (59). The CMV-FOXA2 plasmid was generated by subcloning the FOXA2 gene construct from the
pCMV6-XL5-FOXA2 (Origene, Cat# PCMV6XL5, with FOXA2 transcript variant 1) plasmid onto the
pCMV6-Entry plasmid. Briefly, both plasmids were cut with EcoRI and AgeI (New England Biolabs,
Cat# R3101, Cat# R3552), fragments were isolated via agarose gel, and the pCMV6 backbone and
FOXA2 gene were ligated. Plasmids were linearized with PvuI (New England Biolabs, Cat# R0150) and
cleaned with Qiagen QIAquick PCR Purification kit, prior to transfection. Note, the H522 CMV-
LINC00261 cells were generated by a former lab member, using a linearized plasmid that was cut with
AgeI. (59). Transfection procedure for H522 stable cell lines were similar to the procedure above, with
the exception of seeding 300,000 H522 cells per 6-well plate and using 166 µg/mL of G418 for selection.
H522 monoclonal colonies were large enough to pick at 3-4 weeks.
RNA isolation and qRT-PCR
Total RNA was isolated and purified using the Aurum Total RNA Mini kit (Bio-Rad, Cat# 7326820),
according to the manufacturer’s protocol. 1000 ng of RNA was then converted into cDNA using the
iScript cDNA Synthesis Kit (Bio-Rad, Cat# 1708891) according to the manufacturer's protocol. qRT was
set up using 5 µL of sample cDNA, 0.325 µL of forward primer, 0.325 µL of reverse primer, and 6.25 µL
of SYBR Green Supermix (Bio-Rad, Cat #1708886). Reaction steps consist of initiation step of 95 C for 3
minutes, followed by 50 cycles of denaturation for 30 seconds at 95° C, annealing for 30 seconds at 57°
C, elongation for 30 seconds at 72° C and plate reading. Relative expression was calculated using the
double delta Ct method, where GAPDH was used as the internal control gene. Three technical replicates
30

were done for each qPCR reaction and Ct were averaged. Number of biological replicates are mentioned
on the figure legend.
qPCR primers
• GAPDH Forward: GGTGAAGGTCGGAGTCAACG
• GAPDH Reverse: GTTGAGGTCAATGAAGGGGTC
• LINC00261 Forward: GGATAAAGACCAGCTCAACCA
• LINC00261 Reverse: CTCCAAGACAAAGAAGAGTAGG
Transwell migration and invasion assay
Cell migration was measured using transwell inserts (Corning, Cat# 07-200-150). In each well,
50,000 cells, suspended in 100 µL of serum-free medium (RPMI 1640, 100 U/mL
penicillin/streptomycin, and 0.1% BSA (Santa Cruz Biotechnology, Cat# sc-2323)) were added to the top
chamber. In the bottom chamber, 600 µL of the complete medium (RPMI 1640, 100 U/mL
penicillin/streptomycin, 10% FBS) was added. After 24-hours of incubation at 37° C, the top of the
membrane was dried with a cotton swab to remove any remaining non-migrated cells. Transwell inserts
were fixed with 70% ethanol for 10 minutes, dried, and submerged in a water solution of 0.2% crystal
violet (Santa Cruz Biotechnology, Cat# sc-207460) for staining. Using an inverted microscope with a
magnification of 100x, migrated cells were counted in three randomly selected fields and averaged. Cell
invasion was measured by coating wells with 50 µL of Matrigel (Corning, Cat# 47743-706) and drying
for 4 hours at 37° C prior to adding cells. Three biological and technical replicate experiments were
performed for each assay.
Soft-agar assay
Colony formation was measured by suspending 2,000 cells in agar-growth medium (0.3% agar
(EMD Millipore, Cat# 12177) in RPMI 1470 complete growth media (100 U/mL penicillin/streptomycin,
10% FBS) in 6-well plates precoated with a solidified 0.5% agar-growth medium base. Twice a week,
31

100 µL of the culture medium was added to the top of the agar layer. After three weeks, cells were stained
with 6.0% glutaraldehyde (Sigma, G7776) and 0.1% crystal violet and imaged using an Olympus IX51,
an inverted system microscope (40x magnification) with an Olympus Qcolor3 camera. Quantification was
performed using averages of three random fields. A colony is defined as the area >10,000 mm
2
. Three
biological replicates were performed for each assay.
RNA pulldown
In vitro RNA was synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (New
England Biolabs, Cat #: E2040). LINC00261 RNA was synthesized using the CMV-LINC00261 plasmid,
as the Origene pCMV6-Entry Mammalian Expression Vector (Cat #: PS100001) has a T7 promoter
upstream of CMV promoter. The RNA pulldown was performed with the Pierce™ Magnetic RNA-
Protein Pull-Down Kit (ThermoFisher, Cat #: 20164), following manufacturer's recommendations.

32

2.3 Results
2.3.1 Knockdown of LINC00261 promotes cancer hallmarks
LINC00261 expression is commonly silenced in LUAD tumors (Figure 1.8), and lower
expression correlates with poorer survival outcomes (Figure 1.8), suggesting that LINC000261 may play
a functional role in LUAD. To determine whether LINC00261 affected carcinogenesis, I utilized the A549
cell line, which is among the few LUAD cell lines that express LINC00261 (59), and knocked down the
expression of LINC00261 via stable integration of shRNA (Figure 2.1A). Ablation of LINC00261 in
A549 cells caused a significant increase in A549 cell proliferation (Figure 2.1B), and also significantly
increased colony formation (Figure 2.3) and migration (Figure 2.2). Invasion capability of A549 cells
was also affected by the knockdown of LINC00261; however, this result did not reach statistical
significance (Figure 2.2).

Figure 2.1: Knockdown of LINC00261 promotes proliferation. A) RT-qPCR validation of LINC00261
knockdown via short hairpin RNA (shRNA). Red = A549-shLINC00261, black = A549 shScrambled. B)
Proliferation assay of A549 shScrambled vs A549-shLINC00261. Performed in three separate stable cell lines and
triple technical replicates. Significance was measured by a paired t test between test conditions at each time point.
**, P ≤ 0.01.
33

Figure 2.2: Knockout of LINC00261 promotes migration and invasions. (A) Stable cells were seeded into the
upper chamber and were allowed to migrate for 24 h where they were then stained with crystal violet and 3 random
fields were counted. Migration was assessed without Matrigel coating whereas invasion was assessed with 300
ug/mL of Matrigel coating. (B) Quantification of transwell assay, N = 3.

Figure 2.3: Knockdown of LINC00261 results in increased colony formation (A) Representative field
(magnification, 40x) showing colony formation assay of A549-shScrambled and A549-shLINC00261 cells after 3
weeks of growth in 0.3% agar. (B) Three biological replicates representing isolated stable clones were quantified in
the technical replicates.

34

2.3.2 LINC00261 regulates genes within the DNA damage response pathway
Work done by colleagues in the Marconett lab demonstrated a similar relationship between
LINC00261 and cancer phenotypes using ectopic stable integration models. LINC00261 was ectopically
expressed from pCMV6 from Origene in the H522 LUAD cell line, which lacks endogenous expression
(Figure 2.4). By reintroducing expression of LINC00261 in a LUAD cell line, H522 CMV-LINC00261
demonstrated a decrease in cancer phenotypes, including a decrease in proliferation and decrease in
migration capability (48).

Figure 2.4: Ectopic expression of LINC00261 in H522 cells. Quantitation of ectopic LINC00261 reintroduction
H522 CMV-LINC00261 and H522 CMV NEO control (n=3).

Both knockdown and reintroduction cell line models suggest LINC00261 functions as a tumor
suppressor in LUAD cells. To identify genes that are differentially expressed in LUAD cell lines when
LINC00261 is reintroduced, I performed RNA sequencing on H522-CMV-NEO and H522 CMV-
LINC00261 stable cell lines (Figure 2.4). Using EdgeR for differential expression analysis, a total of 108
genes differed in expression in cell lines with reintroduced LINC00261, compared with the control cell
lines (Figure 2.5). Using Ingenuity Pathway Analysis, many of the differentially expressed genes are
involved in DNA damage response pathways, including G2/M DNA damage checkpoint, BRCA1 DNA
damage response, ATM signaling and many more (Figure 2.5).
35

To determine whether the changes in gene expression are unique to this one cell line, gene
expression data from TCGA-LUAD was used to determine genes and pathways that are significantly
correlated to LINC00261 expression. With a correlation significance cutoff of p < 10
-15
, a total of 342
genes were found to correlate with LINC00261 expression. Using Ingenuity Pathway Analysis, many
significant pathways were similar to those in the cell line model (Figure 2.5).

36

Figure 2.5: RNA-seq analysis reveals a role for LINC00261 in DNA damage response pathways. (A) Volcano
plot of the differentially expressed genes. Red, upregulated in H522 CMV-LINC00261; green, downregulated in
H522 CMV-LINC00261, relative to the H522 CMV-NEO control cell lines. (B) Ingenuity Pathway Analysis of
differentially expressed genes. Blue - differentially expressed genes between H522 CMV-NEO and CMV-
LINC00261. Purple - correlated and anti-correlated genes with LINC00261 expression in TCGA LUAD.

2.3.3 LINC00261 interacts with key regulator of the DNA damage response pathway
Because ectopic reintroduction of LINC00261 was shown to increase expression of multiple
genes involved in DNA damage response, it is likely that LINC00261 is further upstream of this
regulatory pathway. One mechanism by which lncRNAs mediate their function is through direct
interactions with proteins. Due to the significance of ATM in activating a host of proteins to initiate
multiple DNA damage response pathways, I investigated whether LINC00261 is interacting with the
ATM protein.
To investigate the molecular mechanism underlying LINC00261 function within the DNA
damage response pathway, an RNA-immunoprecipitation with anti-ATM antibody was performed.
Compared to the normal IgG antibody pulldown, LINC00261 was significantly enriched in the anti-ATM
pulldown, suggesting a physical interaction between LINC00261 RNA and ATM protein (Figure 2.6).
GAPDH specific primers were used for a non-specific pulldown control to confirm that interaction was
not due to non-specific binding.
Although the interaction between LINC00261 and ATM suggest a mechanism for which
LINC00261 activates the DNA damage response pathway, it remains unclear how the function is
mediated. To better understand the interaction, I performed an in vitro RNA-pulldown. This enrichment
protocol differs in that the RNA serves as the bait, rather than the protein-centric purification method
discussed above. Through an RNA-centric method of purification, all the interacting protein partners can
37

be enriched, as opposed to confirming interaction on an individual basis. Unfortunately, the in vitro
transcribed LINC00261 failed to pull down any protein. By staining the SDS-PAGE with Ponceau S stain,
no bands were observed in the LINC00261 pulldown lane (Figure 2.7A - lane 3). Immunoblotting for
ATM also yielded no observable enrichment for the protein (Figure 2.7C).

Figure 2.6: LINC00261 interacts with a key regulator of the DNA Damage Response Pathway, ATM. (A)
RNA-immunoprecipitation (RIP) utilizes antibodies to immunoprecipitated the RNA binding protein of interest,
along with its associated RNA to identify interactions. Transcripts are detected by reverse transcriptase-qPCR
(RTqPCR). (B) RNA-immunoprecipitation. LINC00261 interacts with ATM. (RNA immunoprecipitation figure
from former lab member Master Thesis, Gopika Nandagopal (116))

38

Figure 2.7: RNA pulldown of in vitro transcribed LINC00261. (A) Outline of the RNA-pulldown workflow. (B)
Ponceau S staining of SDS-PAGE. (L) AccuRuler RGB Protein Ladder (1) 10% input (20 ug A549 lysate) (3) polyA
RNA (3) LINC00261 RNA (4) androgen receptor's (AR) 3' untranslated region RNA. (C) Proteins retrieved from
polyA, LINC00261, and AR RNA, analyzed by immunoblotting.

39

2.4 Discussion
In this study, I used knockdown and re-introduction of LINC00261 to directly investigate the
functional role of this lncRNA in lung adenocarcinoma cell lines. Knockdown of LINC00261
demonstrated an increase in cancer phenotypes, such as proliferation, colony formation, cell migration
and invasion capabilities. In contrast, re-introduction of LINC00261 demonstrated a decrease in cancer
phenotypes, such as proliferation and migration. Although H522 cells failed to migrate through the
transwell, this has been previously reported elsewhere. This is consistent with published reports at the
time of this study, which demonstrated an increase in proliferation capability when LINC00261 was
knocked down (77). However, the exact mechanism of action of LINC00261 was unknown at the time of
this work. Many of the studies looking into LINC00261 performed association studies on the expression
and survival outcomes, its association towards clinical staging, and predictive miRNA interaction studies
(77,79,117).
Through transcriptional analysis of LUAD cells where LINC00261 was reintroduced, along with
identifying genes correlated to LINC00261 expression from TCGA-LUAD dataset, we identified that
LINC00261 is involved in the DNA damage response pathway. Additional work from colleagues in the
Marconett lab demonstrate that reintroduction of LINC00261 in LUAD cells results in slow down through
the G2/M phase of the cell cycle and changes the amount and activation of proteins involved in the DNA
damage response pathway (59). Proteins with an increase in phosphorylation status by LINC00261
reintroduction include ATM and several of its downstream targets such as CHK2, BRCA1, and BRCA2
(59). ATM is a key regulator of the G2/M DNA damage response pathway, where auto- phosphorylation
results in a further activation of proteins involved in DNA repair.
One mechanism by which lncRNA mediates their function within the cell includes the direct
interaction with other proteins. Because we see that reintroduction of LINC00261 results in both
transcriptional and protein level changes, it is likely that LINC00261 is upstream of ATM. Through an
40

RNA-immunoprecipitation, LINC00261 was shown to interact with ATM protein. Further approaches to
understand the interacting partners of LINC00261 include RNA-pulldown, where the RNA is used to
enrich interacting partners. Unfortunately, the in vitro RNA-pulldown was unsuccessful in identifying
enriched proteins from the elution (Figure 2.8). Alternative techniques would be necessary, such as
comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS). ChIRP-MS is
a more robust technique which utilizes a set of biotinylated antisense oligonucleotides against the RNA of
interest, allowing for studying in vivo RNA-protein interaction (118,119).
Here, I present a lncRNA, LINC00261, which behaves as a tumor suppressor by blocking cellular
proliferation through activation of the DNA damage signaling pathway to arrest cellular division. In
addition, this lncRNA demonstrates a role in regulating the kinase, ATM by interacting with the protein.
In addition, members of the DNA damage repair machinery have altered expression in the presence of
LINC00261. In identifying a critical regulatory component of the DNA damage response, we have
uncovered a new aspect of this critical pathway in carcinogenesis, one that opens up the possibility for the
development of novel chemotherapeutic agents targeting this lncRNA to treat this deadly disease.

41

Chapter 3
LINC00261 alters the efficiency of DNA repair and
confers resistance to cisplatin in lung adenocarcinoma

3.1 Introduction
One of the major driving forces of carcinogenesis is the accumulation of DNA mutations. Rates
of mutation vary considerably among tumor types, with melanomas and lung cancers as having among the
highest rates of DNA mutation accumulation (120,121). This is due in part to exposure from
environmental mutagens, such as tobacco smoking and air particulate pollution. Accumulation of
mutations can also be attributed to loss of effective DNA damage response and repair (DDR), resulting in
high levels of mutations within tumors (122,123).
Total mutational burden is used clinically, alongside PD-L1 and CTLA4 status, to determine
which patients may benefit from immunotherapy, as a high TMB load can give rise to neoantigens that
signal the immune system to effectively distinguish the tumor from surrounding normal tissue, provided
the inhibitory signal is blocked by checkpoint inhibitors. Understanding the key mechanisms causing
elevated TMB can give us a molecular understanding of the basis for the efficacy of immune checkpoint
therapies and provide additional criteria for evaluating which patients are likely to benefit. This strategy
has to date been highly successful in melanoma, lung cancers, and other solid tumors (8,124 –126).
Specifically, patients with high TMB non-small cell lung cancer (NSCLC) tumors showed significantly
longer progression-free survival with the immune checkpoint inhibitors nivolumab and ipilimumab (89).
Although alterations in expression and function of some DDR genes correlate with high TMB levels,
recent studies have suggested that DDR gene alterations themselves can serve as predictive biomarkers of
immunotherapy response (127). In addition to immunotherapies, platinum-based chemotherapeutics have
also shown efficacy towards patients with tumors containing altered DDR genes, where platinum
42

containing therapies resulted in an overall survival of 23.7 months compared to 13 months in patients
with no detectable DDR gene alteration (92). A major drawback of platinum-based chemotherapeutics is
the associated high levels of morbidity, where the response rate is about ~27% with platinum-based
chemotherapies such as carboplatin, cisplatin, and gemcitabine. Determining which patients are high-
confidence responders prior to chemotherapeutic administration could significantly improve patient
outcomes by eliminating morbidity-inducing treatments in non-responding tumors as well as targeting a
patient’s tumor with the most efficacious drugs.
Many attempts to tailor a patient's response through personalized medicine approaches are being
developed (128,129). One such approach that has emerged with the rapid onset of high precision
sequencing technologies is to exploit the vastly under characterized long non-coding RNA transcriptome,
which is highly cell and cancer-specific and are increasingly being recognized as key regulators of
signaling pathways (44,130). For instance, dysregulation of the lncRNAs HOTTIP (131), MALAT1 (132),
and ZXF1 (133) have all been recently characterized as drivers of cisplatin-resistance. These and other
lncRNAs with previously uncharacterized functions could provide an opportunity to understand the
molecular underpinnings of patient response to chemotherapeutics; however, to date no systematic study
has determined the extent of lncRNA-TMB relationship in cancer. Previous work has identified
LINC00261 as a tumor suppressor in lung adenocarcinoma that acts as a critical mediator of the DDR
(59).
In this study, I aimed to directly investigate the function of LINC00261 in the context of DNA
damage response in LUAD cells. Knockdown of LINC00261 in LUAD cell lines was used to measure
changes in gene expression and accumulation of mutational burden, when treated with cisplatin.
Simultaneously, expression status and mutational burden from TCGA data was used to further understand
the role of LINC00261 expression and mutational accumulation. The implications of LINC00261
knockdown in LUAD cells when exposed to cisplatin are discussed.
43

3.2 Materials and methods
Cell culture
Human lung cancer cell lines NCI-H522 and A549 were obtained from the laboratory of E. Haura
or American Type Culture Collection (ATCC), respectively. Cells were fingerprinted to verify their
identity prior to experimentation at the University of Arizona (Tucson, AZ) and were verified
mycoplasma-free every 6 months in the lab via established protocols. Cells were cultured in RPMI-1640
medium (Corning, Cat# 45000-396) containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-
500, Lot# 7B0302) and 100 U/mL penicillin/streptomycin (VWR Life Science s, Cat# 82026-730).
Cytotoxic assay
Cisplatin (Enzo Life Sciences, Cat # ALX-400-040-M050), carboplatin (Sigma, Cat# C2538),
and oxaliplatin (Sigma, Cat# O9512) were dissolved in dPBS (Corning, Cat# 45000-434). Paclitaxel
(Tocris Bioscience, Cat# 109710) was dissolved in DMSO (Sigma, Cat# D8418). A day prior to dosing
with chemotherapeutic, A549 cells were seeded at 3000 cells per well in a 96-well plate, respectively.
Treatment was done on a series of 2x dilutions with equal percent by volume of the respective vehicle.
Three days after incubation, cells tested for viability using a WST-8 assay (Abcam, Cat# ab228554),
following manufacturer protocol. Briefly, a mixture of WST-8 reagent (10 µL) and culture medium (100
µL) replaced the medium on the wells and incubated for 4 hours. Viability was measured using Multiskan
FC microplate photometer (ThermoFisher Scientific, Cat# 51119000) at absorbance of 460 nm. Percent
cell viability was normalized to the vehicle controls (either DPBS or DMSO). Each condition was the
average of three technical replicates. Results shown are of three biological replicates, consisting of three
different monoclonal stable transfections.
Long term cisplatin treatment
Stable transfected A549-shScramble and A549-shLINC00261 cells were treated for 28 days with
either 0.2 uM cisplatin or vehicle control (dPBS). Cells were passaged in a 1-to-2 ratio when they reached
44

80% confluence and media was changed every other day to ensure cisplatin concentration remained
constant.
Whole Exome Sequencing
DNA was extracted and purified using the DNeasy Blood & Tissue kit (Qiagen). DNA samples
were sequenced by the Keck Genomics Platform and underwent paired-end sequencing. DNA samples are
aligned to GRCh37 (hs37d5) by BWA (v0.7.8-r455), followed by GATK's Base Recalibrator (v3.5.0) to
detect quality score errors. Next, Picard Tools (v1.128) merges aligned bams and marks duplicate reads.
GATK’s IndelRealigner minimizes mismatches across local alignments, Picard Tools GC Bias
determines coverage bias, and Picard HS Metrics determines hybrid-selection metrics. Picard
MultiMetrics and Samtools Stats (v1.2) collect multiple classes of metrics, available in the final stats
folder. Vcf’s of bam SNPs and indels are obtained by GATK’s Haplotype Caller (intermediate gVCF),
Samtools MPileUp paired with BCFtools(v1.2), and Freebayes(v1.1.0-6-gf069ec6). Manta(v.1.1.1) and
Strelka(v2.7.1) call structural variants and indels, followed by Mutect(v1.1.4) and Seurat(v2.6) for
detection of somatic point mutations. The final tool, SnpEff (v3.6h) annotates and predicts gene variant
effects. Copy number analysis is completed using tCoNuT.

45

3.3 Results
3.3.1 LINC00261 expression correlates with mutational burden
LINC00261 is often downregulated in LUAD cancer cells, compared to the cell of origin, alveolar
epithelial cells (Figure 1.5) (59). In addition, LUAD tissue often demonstrates a decrease in LINC00261
expression, compared to adjacent normal lung tissue (Figure 1.8). As shown in Chapter 2 and in our
published work, LINC00261 is involved in maintaining active ATM-mediated DNA damage response
(Figure 2.3) (59). The loss of active repair mechanisms results in the accumulation of mutations, which is
a key mechanism in the development of cancer. To determine whether LINC00261 silencing contributes
to an increase in mutations, I first looked at clinical data from TCGA for an association between
LINC00261 expression and tumor mutational burden (TMB).
TMB was defined as the number of non-silent somatic mutations per megabase of genome
sequenced. To streamline data analysis, mutational burden values for LUAD samples was collected from
TCGA DDR Data Resources, where values have been previously generated by TCGA DNA Damage
Repair Analysis Working Group (DDR-AWG) (134). Silent LINC00261 expression was defined as
samples with LINC00261 expression of less than 1 FPKM. Samples with silenced LINC00261 (n=292)
demonstrated higher TMB when compared to samples defined as having some LINC00261 expression
(n=210) (Figure 3.1A). The LINC00261 Expressed group had a median TMB value of 3.43, whereas the
LINC00261 Silenced group had a median TMB value of 8.12.
In addition, plotting the 502 LUAD samples with both transcriptional and whole exome
sequencing data, demonstrates a significant negative correlation between LINC00261 expression and
TMB (Figure 3.1B). The correlation had a Spearman coefficient of -0.4, with a p-value < 2.2 x 10
-16
.
46

Figure 3.1: Low LINC00261 expression correlates with higher tumor mutational burden. (A) Bar plot and (B)
scatter plot was generated with LINC00261 expression data (FPKM) and number of mutations per tumor. Samples
with LINC00261 expression of FPKM less than 1 was considered silenced. TCGA LUAD sample with both RNA-
seq and whole-exome sequencing data was download using TCGAbiolinks R package and graphed using ggplot2
(75,135).

To identify genes whose expression correlates to mutational burden, whole exome sequencing
and transcriptional data was collected from TCGA-LUAD dataset and was used to correlate gene
expression with mutational burden for all genes. A linear regression was performed, regressing the
mutational burden of each sample onto the expression of each gene. LINC00261 expression was grouped
among genes which there was a significantly negative correlation with TMB (Figure 3.2). In addition,
when looking at only lncRNA genes, LINC00261 was the third highest negatively correlated to TMB,
among expressed lncRNA genes in LUAD (Table 3.1). Among the two highest significantly negative
correlated lncRNAs, both LINC01550 and UBXN10-AS1 have shown to be involved with cell cycle
control and immune microenvironment (136–138), two mechanisms that are altered by mutational burden
(139).
47

Figure 3.2: Genes ranked by their correlation between gene expression and mutational burden. Whole exome
sequencing and transcriptional data was collected from TCGA-LUAD dataset and was used to correlate gene
expression with mutational burden for all genes. A linear regression was performed, regressing the mutational
burden of each sample onto the expression of each gene. Genes are plotted from highest significance in correlation
(Red – positive correlation, blue – negative correlation, black - no significant correlation). Y-axis is the number of
genes present.

48

Table 3.1: Top lncRNA genes correlated with TMB. List of the top 20 lncRNA genes with the highest statistically
significant correlation to TMB, from correlation analysis shown in Figure 3.2. Upper table – lncRNA genes whose
expression positively correlates with TMB. Lower table – lncRNA genes whose expression negatively correlates
with TMB. Genes were classified as lncRNA according to lncipedia (version 5.2) (140). LINC000261 is bolded.

49

3.3.2 Molecular changes in LINC00261-deficient LUAD cells, when exposed to a mutagen
Although LINC00261 expression demonstrated significant correlation to mutational burden in the
TCGA-LUAD dataset, it is unclear whether the silencing of LINC00261 directly affects mutational
burden . In order to test whether LINC00261 directly affected TMB we set out to test mutation
accumulation in the presence or absence of LINC00261 (Figure 3.3). To artificially enhance the
mutational load, we utilized low dose long-term exposure to cisplatin (0.2 µM for 28 days), which has
been shown previously to increase the mutational rate without toxicity. This was done to ensure that the
cells accumulate mutations while not dying. Both RNA and DNA were collected prior to cisplatin
treatment to serve as a comparison.

Figure 3.3: Long term treatment of cisplatin in LINC00261 knockdown LUAD cells. Experimental strategy to
measure accumulation of mutations based on LINC00261 expression. RNA-seq and whole exome sequencing was
utilized to test whether LINC00261-depletion results in an accumulation of mutational burden.

Whole exome sequencing was performed on the initial A549-shLINC00261 and
A549shScrambled, as well as after 28 days of low-dose cisplatin treatment. To identify the number of
mutations in each sample, the Strelka variant caller was used to identify somatic mutations. All dbSNPs
50

and variant calls present in the day 0 sets were excluded from downstream analysis. Nonfiltered variants
included all significant somatic mutation calls, even if they were outside the capture library region.
Unfortunately, it remains unclear as to how LINC0261 is involved with the accumulation of mutations as
the expression of LINC00261 decreased over the course of the experiment (Figure 3.4). No significant
differences in LINC00261 expression is observed between the shScr-D28 and shLINC-D28 group,
suggesting that any LINC00261-dependent changes to DNA integrity would not be captured from these
results (Figure 3.6).

Figure 3.4: LINC00261 expression decreases after cisplatin treatment. Real-time qPCR analyses were
performed on the A549 shScrambled and shLINC00261 cells before and after 28 days of 0.2 μM cisplatin treatment.
Average of the three stable transfected clones for each experimental group were used as biological replicates. A
paired t-test was used to measure significance.
51

Figure 3.5: Gene expression changes before and after cisplatin treatment. (A) BRCA1 and (B) XPC gene
expression was measured through real-time qPCR. Average of the three stable transfected clones for each
experimental group were used as biological replicates. A paired t-test was used to measure significance.

Figure 3.6 : Accumulation of somatic mutations when exposed to cisplatin between A549 shLINC00261 and
shScrambled control cell lines. (A) Number of non-filtered variants identified with the Strelka variant caller.
Nonfiltered variants include those outside the capture library prep but can still be significantly called a variant,
compared to the Day 0 sample. (B) Tumor mutational burden was measured using only nonsynonymous mutations,
as those are the most expected to result in neoantigens. The number of nonsynonymous mutations is divided by the
size of the capture library used to generate the exome sequencing library. The effective exome size for the
SureSelect capture library is 33.3 Mbp.
52

Figure 3.7 : Pathway enrichment analysis of gene differential expressed genes in LINC00261-deficient cells,
when exposed to cisplatin. Comparison between the set of differentially expressed genes after cisplatin treatment of
A549-shLINC00261 and A549-shScrambled, both compared to A549-shScrabled prior to treatment. X-axis plots
Benjamini-Hochberg (B-H) multiple testing corrected p-values, -log10(B-H p-values).

3.3.3 LUAD cells deficient of LINC00261 are more susceptible to cisplatin
We previously observed that the loss of LINC00261 results in poorer survival outcome, and the
silencing of LINC00261 also confers lower expression of DNA damage response genes (Figure 2.5). To
determine whether the loss of DNA damage response gene expression was due to LIINC00261 silencing,
A549 shLINC00261 alongside A549 shScrambled cell lines were treated with 4 different chemotherapies
that are commonly used in treating NSCLC. Cells depleted of LINC00261 were found to be more
susceptible to cisplatin, whereas no significant differences in viability was observed from the other
chemotherapy agents (Figure 3.8).
53

Figure 3.8: LINC00261 alters efficacy of chemotherapeutics on LUAD in vitro. A-D) Cell viability assay of
A549 shLINC00261 compared to A549 shScrambled controls when exposed to the DNA damaging agent cisplatin,
paclitaxel, carboplatin, or oxaliplatin. Viability measured with WST-8 assay. Experiments were done with three
biological replicates (three different stable transfected monoclones). A paired t-test was performed on each dose,
between A549-shLINC00261 and A54-shScrambled. * p-value < 0.05, ** p-value < 0.01

54

3.4 Discussion
The accumulation of mutations is a key driving force in progressing cells into early stages of
tumorigenesis. Although human cells have multiple mechanisms by which to protect genomic DNA, often
exposure to environmental mutagens can render critical repair genes inactive, resulting in increasing
mutational accumulation. This mutational burden seen in cancer can be utilized as a biomarker for
immunotherapy, as the high number of mutations increases the probability of neoantigen formation and
T-cell response against the tumor cells (141,142). While progress has been made to combat tumors with
high mutational burden with immunotherapy, many patients with high mutational burden still have poorer
survival outcomes (143), due to innate or acquired resistance to immunotherapy (144). Multiple
mechanism of resistance towards PD-L1 inhibitors have been identified, ranging from silencing of MCH
class II genes, impaired INF-γ signaling, and insufficient neo-antigen presentation. Additional biomarkers
are necessary to determine if a tumor is suitable for candidate for immunotherapy.
In this study, LINC00261 was investigated for clinical relevance due to the observed role in
activating DNA damage response when reintroduced in LUAD cell lines. Interestingly, the silencing of
LINC00261 in LUAD was shown to correlate with an increase in mutational burden (Figure 3.1). The
utility of having surrogate biomarkers for TMB is crucial as measuring TMB often becomes difficult to
perform outside academic settings (145). In addition, the advancements in thoracic surgery in the recent
years has improved the ease by which small tumor biopsy and cytology specimens are collected, allowing
for the utility of new molecular biomarkers. The expression status of LINC00261 can be measured with
ease via qPCR or RNA-FISH, as other lncRNAs have previously been used in such manner in clinical
settings (56).
The use of a biomarker that correlates with DNA damage provides an opportunity to priorities
patients to immunotherapy and DNA damaging agents. In addition, lncRNA genes can serve as better
biomarkers as expression status is a direct signaler for activity, whereas protein-coding gene expression
often does not correlate with activity due to translational inhibition, silencing mutations, post-translation
55

modifications, and so forth (146,147). Further work is necessary to study whether LINC00261 expression
correlates with better patient response to immunotherapy. The strong correlation between LINC00261 and
TMB is a promising indicator, especially since LINC00261 is the top 3 ranked lncRNA in negative
correlation to TMB (Table 3.1).
Here, I tested whether the loss of LINC00261 results in a change in susceptibility to DNA
damaging agents. The idea being that cancer cells deficient of LINC00261 expression will be more
susceptible to DNA damage chemotherapeutics. A set of commonly used chemotherapeutics used for
treating NSCLC were tested on cells where LINC00261 was knocked down. Selective ablation of
LINC00261 demonstrated a significant susceptibility towards cisplatin, compared to control cells.
Although carboplatin and oxaliplatin are platinum based small molecule drugs, similar to cisplatin
(Figure 3.9), the two chemotherapeutics showed no difference in cell death in the LINC00261
knockdown cells and the controls (Figure 3.8). It remains unknown as to why this is the case. One
possible explanation is that cisplatin results in a higher number of reactive oxygen species (ROS)
compared to the former two drugs (148). In addition, when used at equitoxic concentrations, cisplatin was
found to induce more base substitution mutations, compared to carboplatin and oxaliplatin, suggesting
other mechanisms of action in causing cell death (149). How LINC00261 is involved with ROS remains
unknown, however, using data from TCGA, does suggest that LINC00261 expression correlates with
lower H1F1A (Figure 3.10), a key transcriptional regulator of ROS response (150). The increase amount
of HIF1A has been reported to enhance ROS-response pathways, often resulting in cell death. Further
work is necessary to determine if LINC00261 is involved in regulating HIF1A-mediated ROS response
and whether the susceptibility to cisplatin from low LINC00261 expression is due to the increase
responsiveness towards ROS.
56

Figure 3.9: Chemical structure of platin based chemotherapies. Cisplatin, carboplatin, oxaliplatin.

Figure 3.10: Silenced LINC00261 expression confers to higher HIF1A expression. Scatter plot and (B) boxplot
was generated with LINC00261 expression data (FPKM) and expression of HIF1A (FPKM). Samples with
LINC00261 expression of FPKM less than 3 was considered silenced. TCGA LUAD sample with both RNA-seq
and whole-exome sequencing data was download using TCGAbiolinks R package and graphed using ggplot2
(75,135).

57

Chapter 4
LINC00261 regulates a subset of FOXA2-associated
transcriptional targets in lung adenocarcinoma

4.2 Materials and methods
The LINC00261 gene is located ~2500 bp downstream of the FOXA2 gene. Because multiple
studies have demonstrated a functional relationship between lncRNAs neighboring mRNA genes in
genomic proximity to one another (67,151), we explored if there was a functional relationship between
LINC00261 and FOXA2 in LUAD. Indeed, our lab has shown that not only is FOXA2 and LINC00261
expression highly correlated in TCGA LUAD, but we also observed that FOXA2 regulates the expression
of LINC00261 (59). Although FOXA2 is downregulated in cancer and has been implemented as a tumor
suppressive (152,153), it remains unclear whether these properties are LINC00261-dependent or
independent, and vice versa.
Along with work presented above, multiple papers have showed that reduction of LINC00261
expression correlated with poorer lung adenocarcinoma patient survival (59,77,85). LINC00261 lies
adjacent to the pioneering transcription factor FOXA2 which has critical regulatory functions in lung
development and has been reported to be downregulated in lung cancer (154). Consistent with previous
work, decrease in FOXA2 expression correlates with poorer survival outcome (Figure 4.1). FOXA2 is
observed to have a high correlation to LINC00261 expression .Using the A549 LUAD cell lines (which
express both LINC00261 and FOXA2 endogenously) we observed that shRNA-mediated ablation of
FOXA2 decreased endogenous expression of LINC00261; however significant knockdown of LINC00261
did not affect FOXA2 levels, suggesting LINC00261 acts downstream of FOXA2.
58

Figure 4.1 - Lower expression of FOXA2 confers to poorer survival outcomes. Data from TCGA-LUAD of
FOXA2 expression was used to generate Kaplan-Meier plot. Plot generated using KM-Plotter (155).

Although previous work indicates that FOXA2 is a candidate tumor suppressor, the molecular
mechanism by which FOXA2 modulates cancer metastasis remains elusive. Here, I explore whether the
role of FOXA2 activating LINC00261 expression in LUAD cells contributes to FOXA2 tumor
suppressive capabilities. To independently control the expression of both FOXA2 and LINC00261 outside
of their shared genomic locus, I constructed stable H522 CMV-FOXA2 and H522 CMV-LINC00261 cell
lines which ectopically express their transgenes outside of the endogenous locus, thereby avoiding cis-
regulatory functions to focus specifically on trans-acting effects. In addition to H522 not having
endogenous expression of both FOXA2 and LINC00261, the FOXA2-LINC00261 locus is highly
methylated, preventing the endogenous activation of these genes.
Through comparison of differentially expressed genes between H522 CMV-FOXA2 and H522
CMV-LINC00261, I sought to identify unique pathways regulated by FOXA2, independent of
LINC00261. In the study here, I present that FOXA2 reintroduction activates a similar pathway as those
59

when LINC00261 is reintroduced, however the specific identities of the genes are non-overlapping.
Although the results do provide information as to the independent mechanism of action of FOXA2 in
lung cancer, the data suggest that FOXA2 and LINC00261 both serve an independent, synergistic role in
maintaining active DNA damage response pathways.

60

4.2 Materials and methods
Cell culture
Human lung cancer cell lines H522 and A549 were obtained from the laboratory of E. Haura or
American Type Culture Collection (ATCC), respectively. Cells were fingerprinted to verify their identity
prior to experimentation at the University of Arizona Genetics Core and were verified mycoplasma-free
every 6 months in the lab. Cells were cultured in RPMI-1640 medium (Corning, Cat# 45000-396)
containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and 100 U/mL
penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730).
Luciferase reporter assay
Cells were then transfected with Fugene-HD with a ratio of 3:1 DNA to Fugune-HD reagent.
Specifically, in a 24-well plate, 200 ng of total DNA per well was used for transfection, and of this, 50 ng
of Renilla plasmid (Promega, Cat# E2261), 150 ng of the designated promoter construct or empty-pGL3-
basic (Promega, Cat# E1751), and 200 ng of designated pCMV6 expression vector. For subcloning of
promoter regions, the pGL3-basic plasmid was cut with KpnI (New England Biolabs, Cat# R3142) and
NcoI (New England Biolabs, Cat# R3193) and promoter region was amplified with primers with KpnI
and NcoI overhangs using human genomic DNA (Promega, Cat# G1521). Construction of CMV-
LINC00261 is described in Shahabi et al., 2019 (59). The CMV-FOXA2 plasmid was generated by
subcloning the FOXA2 gene construct from the pCMV6-XL5-FOXA2 (Origene, Cat# PCMV6XL5, with
FOXA2 transcript variant 1) plasmid onto the pCMV6-Entry plasmid. Briefly, both plasmids were cut
with EcoRI and AgeI (New England Biolabs, Cat# R3101, Cat# R3552), fragments were isolated via
agarose gel, and the pCMV6 backbone and FOXA2 gene were ligated.
For H522, 100,000 cells per well were plated to 24-well dish 24 hours prior to transfection and
for A549, 80,000 cells per well were plated to 24-well dishes 24 hour prior. Following manufacture’s
61

protocol, Dual-Luciferase Reporter Assay kit (Promega, Cat# E1960) was used to measure promotor
activity. Technical replicates were averaged, and statistics performed on three biological replicates.
For subcloning of promoter regions, the pGL3-basic plasmid was cut with KpnI (New England
Biolabs, Cat# R3142) and NcoI (New England Biolabs, Cat# R3193) and promoter region was amplified
with primers with KpnI and NcoI overhangs using human genomic DNA (Promega, Cat# G1521).
RNA-Sequencing
Total RNA was isolated and purified using the Aurum Total RNA Mini kit (Bio-Rad, Cat#
7326820), according to the manufacturer’s protocol. RNA was set to Genewiz (Azenta Life Sciences) for
RNA-sequencing. Briefly, paired-end sequencing of PolyA selection of mRNA was done with 20-30
million reads per sample. FASTQ files were uploaded to the Galaxy web platform (156), where reads
were trimmed, cleaned, and aligned. Reads were trimmed and cleaned using Trimmomatic (157), where
adaptor (TruSeq3, paired-end) were removed and first 10 bases were removed from reads and reads with
less than an average of 30 quality were removed. Reads were then aligned with the STAR aligner (158),
using the hg38 reference genome. BAM files were downloaded and used to generate table of counts and
differential expression analysis was performed using EdgeR (159). Pathway analysis was performed,
using Ingenuity Pathway Analysis (Qiagen).

62

4.3 Results
4.3.1 Regulation of LINC00261 by the pioneering transcription factor FOXA2
Intergenic lncRNA are often found to be correlated with the gene expression of neighboring
protein-coding genes (29). One of the mechanisms of action for lncRNA is to serve as scaffold for
regulatory and/or repressive complexes that influence the expression of neighboring genes. However,
many of these lncRNA-neighboring gene patterns have evolved feedback loops to fine-tune expression of
these genes, especially in the case of development and differentiation. To study the regulatory interaction
between LINC00261 and FOXA2, reintroduction and knockdown studies were performed. Knockdown of
LINC00261 using shRNA resulted in no change in expression of FOXA2, compared to the shScrambled
control cell line (Figure 4.2). In addition, reintroduction of LINC00261 using a CMV driven construct,
also demonstrates no change of expression of FOXA2 (Figure 4.3).
To investigate whether FOXA2 is involved in regulating the expression of LINC00261, A549
cells were transfected with either shFOXA2 or shScrabled vector constructs. The silencing of FOXA2 via
shRNA resulted in a decrease in LINC00261 expression (Figure 4.1). Conversely, the reintroduction of
FOXA2 in H522 cells resulted in an increase in LINC00261 expression (Figure 4.1).

63

Figure 4.2: FOXA2 is involved in LINC00261 expression. (A) qRT-PCR of FOXA2 and LINC00261 expression in
H522 cells transiently transfected with CMV-FOXA2 or CMV-NEO control. Y-axis is log2-fold change in expression
between CMV-FOXA2 and CMV-NEO control. (B) qRT-PCR of FOXA2 and LINC00261 expression in A549-
shLINC00261 and A549-shScrambled controls.

Figure 4.3: Knockdown of LINC00261 has no effect on FOXA2 expression. qRT-PCR of FOXA2 and LINC00261
expression in transiently transfected A549-shFOXA2 and A549-shScrambled controls

64

4.3.2 LINC00261 regulates a subset of FOXA2-associated transcriptional targets in lung
adenocarcinoma.
To identify whether FOXA2 has a tumor suppressive role independent of LINC00261, stable cell
lines were generated in which only one of the two genes is transcribed. Figure 4.3A shows that H522 CMV-
FOXA2 does not result in expression of LINC00261 and the H522 CMV-LINC00261 stable cell lines do
not result in expression of FOXA2. RNA sequencing was performed on the three sets of cell lines and
differential expression analysis was performed against the H522 CMV-NEO, using EdgeR. A total of 2690
genes were significantly differentially expressed in the H522 CMV-FOXA2, compared to the H522 CMV-
NEO control lines (Figure 4.3). The high number of differentially expressed genes was to be expected as
FOXA2 is a pioneering transcription factor capable of activating multiple genes (64). Using Ingenuity
Pathway Analysis, the main pathways altered by FOXA2 re-expression are involved with DNA damage
response, including BRCA1 in DNA Damage Response, Kinetochore Metaphase Signaling, Cell Cycle
Control of Chromosomal Replication, and others (Figure 4.4). The pathways altered are similar to those
altered by LINC00261 re-expression in LUAD cells, suggesting similar mechanisms of actions.
65

66

Figure 4.4: Differential expression analysis of H522 CMV-FOXA2 vs H522 CMV-NEO controls. (A) Aligned
reads from RNA-sequenced H522 CMV-NEO/CMV-FOXA2/CMV-LINC00261 cell lines. Data viewed with
Integrative Genomics Viewer. (B) Volcano plot of differentially expressed genes in H522 CMV-FOXA2, compared
to H522 CMV-NEO. (C) Top five upregulated and downregulated genes in H522 CMV-FOXA2. (D) Starburst plot
of differentially expressed genes in H522 CMV-LINC00261 and H522 CMV-FOXA2, when compared to the control
line, H522 CMV-NEO. (E) Venn diagram of genes that overlap between the two sets of differentially expressed
gene lists.

Figure 4.5: Ingenuity Pathway Analysis of genes differentially expressed in cells reexpressing FOXA2. Top
pathways found to be altered by FOXA2 reexpression are involved in the DNA damage response.

67

4.4 Discussion
In this present study, I used a series of expression and shRNA-mediated knockdown constructs to
determine the regulators between LINC00261 and FOXA2. Here, we see that FOXA2 is involved in
activating the expression of LINC00261, via the direct binding of the LINC00261 promoter. In addition to
the work shown here, the strong positive correlation between LINC02261 and FOXA2 transcripts has been
observed in multiple cell lines and in multiple cancer types (59,61,69). However, at the time of this research,
little was known about the regulatory mechanism by which both FOXA2 and LINC00261 regulate each
other. One paper by Jiang et al., demonstrating that LICN00261 interacts with SMAD2/3 and thus regulates
FOXA2 expression in definitive endoderm differentiation (69).
The work from this study differs from what was observed in Jiang et. al. In their paper, FOXA2
expression is regulated by the recruitment of SMAD2/3 via the transcribing of LINC00261. This raises
questions as to whether these two genes are exposed to different regulatory factors between differentiation
and tumorigenesis, resulting in the observed regulatory pattern. In the epithelial differentiation model,
LINC00261 was able to recruit SMAD2/3 to the LINC00261-FOXA2 locus, resulting in the activation of
FOXA2 gene expression. Not a lot is known about the role of SMAD2/3 in lung adenocarcinoma, a
handful of papers suggest that the SMAD complex tends to be silenced in NSCLC cells (76). Further
work is needed to conclude whether this can explain the differences in regulatory activity.
In summary, this study revealed that although LINC00261 is downstream of FOXA2, LINC00261
itself is able to regulate a subset of FOXA2-associated genes in a FOXA2 independent manner. The re-
expression of both genes resulted in the activation of DNA damage response genes. The need for
activation of DNA damage response at multiple steps of the pathway is most likely is due to the fact that
human alveolar epithelium is among the tissue type most exposed to environmental mutagens. Future
studies would be necessary to determine whether this to be the case. However, it still remains unknown
whether lung adenocarcinoma cells lack or have a different set of transcriptional activators present that
68

would alter the LINC00261 activation of FOXA2, as seen with the SMAD2/3. Figure 4.5 shows a
decrease expression in SMAD2 in tumor samples, compared to adjacent normal tissue, but a more
comprehensive study would be needed to understand if this decrease contributes to the upstream
regulatory differences between LUAD and normal alveolar cells.

Figure 4.6 – SMAD2 expression in LUAD. Data from TCGA-LUAD data set of SMAD2 expression between solid
tissue normal and primary tumor. Transcription is plotted as log2(FPKM+1).

69

Chapter 5
Conclusions and Perspectives
Human cells retain multiple mechanisms of DNA repair, as the accumulation of mutations can
severely interfere with cellular function and cause the formation of cancer (160). Although genomic
instability through the silencing of repair genes is a key hallmark of cancer, the loss of active repair
mechanism causes cancer cells to be more susceptible to DNA damaging agents. Because a significant
proportion of LUAD patients lack targetable protein-coding mutations (Figure 1.4), further work is
necessary to identify novel non-coding genes that can serve as biomarkers for targeted therapies. In this
dissertation, I discuss findings demonstrating the lncRNA, LINC00261 as a novel tumor suppressor,
who’s role in the DNA damage response pathway provides a role as functioning as a biomarker for
therapeutic intervention in LUAD.
To identify lncRNAs that are relevant in the progression of LUAD, we looked into lncRNA genes
that are differentially expressed between LUAD and alveolar epithelia cells. In combination with
differential expression analysis from TCGA between LUAD and normal adject tissue, survival analysis
based on expression, and adjacency to protein-coding genes of interest, the lncRNA known as
LINC00261 was selected for further study. In Chapter 2, I demonstrate that LINC00261 has a functional
role in LUAD cells. Through a set of shRNA knockdown experiments, loss of LINC00261 resulted in
increased proliferation, migration, and invasion capabilities in LUAD cell lines. As a complement, I
reintroduced expression of LINC00261 in LUAD cells without endogenous expression of the gene. The
re-expression of LINC00261 resulted in a decrease in proliferation and migration. Both transcriptome
differential expression analysis from LINC00261 re-expression cell line models and correlation analysis
on LINC00261 expression with other genes from TCGA data, I show that LINC00261’s expression is
involved in regulating DNA damage response genes. One mechanism by which lncRNA mediate cellular
70

events without translation in proteins is through RNA-protein interactions. Here, LINC00261 RNA is
shown to interact with the ATM protein, a key regulator of the DNA damage response pathway. Overall,
with published work from myself and colleagues in the Marconett lab (59), LINC00261 is shown to
function as a tumor suppressor through its role in regulating the DNA damage response via ATM binding.
In Chapter 3, I explored the therapeutic potential of LINC00261 silencing in LUAD. With the role
in regulating the DNA damage response pathway, the loss of LINC00261 could serve as an opportunity to
target patients with DNA damaging agents, as tumors with inefficient DNA repair are susceptible to those
therapies (105,123). Platinum based chemotherapies such as cisplatin, carboplatin, and oxaliplatin take
advantage of the high proliferative rate and loss of genomic stability of cancers cells to selectively target
those cells. Here, I show that LUAD cells deficient of LINC00261 are more susceptible to cisplatin.
The significance of this finding is the LINC00261 gene has a unique role within the DNA damage
response pathway that alters LUAD cells to cisplatin. More interestingly, is that both carboplatin and
oxaliplatin, two derivatives of cisplatin, showed no difference in susceptible when LINC00261 was
knockdown. Although all three platinum based chemicals function in similar manner, in that they form
similar reaction products with DNA bases (161), differences in outcomes have been observed, both
cellularly and physiologically (148,162,163). Mechanistically, cisplatin differs from other platinum-based
chemotherapies in that it induces more mutations at equitoxic concentrations and it produces reactive
oxygen species (ROS) at a higher rates (148,149).
Further work is necessary to understand what cellular functions are being altered based on
LINC00261 expression to mediated cisplatin susceptibility. It is likely that the loss of LINC00261 and
increase HIF1-alpha, a key regulator of ROS-response (Figure 3.10) causes an enhanced ROS response to
cisplatin, leading to an increase in cell death. Previous work has shown that increase expression of HIF1-
alpha can induce apoptosis via inducing proapoptotic proteins such as BNIP3 and p53, as a protective
mechanism against ROS mediated mutagenesis (164,165).
71

In Chapter 4, I explored whether the function of LINC00261 is regulated by the adjacent protein
coding gene, FOXA2. One notable feature of intergenic lncRNAs is that their expression status is highly
correlated to nearby genes, due sharing the same chromatin state and both genes often functioning within
a positive feedback loop (166). In the case of LINC00261 and FOXA2, both genes are highly correlated,
throughout multiple tissue types (Figure 1.7). To determine the regulation between two genes, I used a
series of expression and shRNA-mediated knockdown constructs to determine if the activity of
LINC00261 is dependent or independent of FOXA2. Overall, LINC00261 was found to be activated by
FOXA2 in LUAD, as the LINC00261 promoter is active in the presence of FOXA2 and knockdown of
FOXA2 results in decrease expression of LINC00261. In addition, the overexpression of LINC00261
showed no change in FOXA2 expression, suggesting that LINC00261 tumor suppressive and DNA
damage response functions are FOXA2 independent.
One unanswered question is the difference in LINC00261 and FOXA2 regulation between cancer and
non-cancerous cells. In a report by Jiang et al., they demonstrate that LINC00261 activates expression of
FOXA2, through the recruitment of SMAD2/3 throughout endoderm differentiation. The dysregulated
nature of cancer is the likely explanation as for why the upstream mechanisms of LINC00261 and FOXA2
regulation differ from normal lung physiology. More work is necessary to investigate the upstream
mechanisms that change throughout tumorigenesis. One likely candidate is the expression statue of
SMAD2/3 in LUAD. Little work has been done in the study of SMAD2/3 in LUAD but the few reports
available suggest that these genes are silenced in LUAD (76).

72

Bibliography
1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer
Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185
Countries. CA: A Cancer Journal for Clinicians. 2021;71:209–49.
2. Global surveillance of trends in cancer survival 2000–14 (CONCORD-3): analysis of individual
records for 37 513 025 patients diagnosed with one of 18 cancers from 322 population-based
registries in 71 countries. The Lancet. Elsevier; 2018;391:1023–75.
3. Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics, 2021. CA: A Cancer Journal for
Clinicians. 2021;71:7–33.
4. de Koning HJ, van der Aalst CM, de Jong PA, Scholten ET, Nackaerts K, Heuvelmans MA, et al.
Reduced Lung-Cancer Mortality with Volume CT Screening in a Randomized Trial. N Engl J Med.
2020;382:503–13.
5. Whitson BA, Groth SS, Duval SJ, Swanson SJ, Maddaus MA. Surgery for early-stage non-small cell
lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy
approaches to lobectomy. Ann Thorac Surg. 2008;86:2008–16; discussion 2016-2018.
6. Metro G, Crinò L. Advances on EGFR mutation for lung cancer. Transl Lung Cancer Res. 2012;1:5–
13.
7. Gong J, Chehrazi-Raffle A, Reddi S, Salgia R. Development of PD-1 and PD-L1 inhibitors as a form
of cancer immunotherapy: a comprehensive review of registration trials and future considerations. J
Immunother Cancer. BMJ Specialist Journals; 2018;6:8.
8. Büttner R, Longshore JW, López-Ríos F, Merkelbach-Bruse S, Normanno N, Rouleau E, et al.
Implementing TMB measurement in clinical practice: considerations on assay requirements. ESMO
Open. 2019;4:e000442.
9. Reduced Lung-Cancer Mortality with Low-Dose Computed Tomographic Screening. New England
Journal of Medicine. Massachusetts Medical Society; 2011;365:395–409.
10. Scagliotti GV, Parikh P, von Pawel J, Biesma B, Vansteenkiste J, Manegold C, et al. Phase III Study
Comparing Cisplatin Plus Gemcitabine With Cisplatin Plus Pemetrexed in Chemotherapy-Naive
Patients With Advanced-Stage Non–Small-Cell Lung Cancer. JCO. Wolters Kluwer; 2008;26:3543–
51.
11. Travis WD, Brambilla E, Nicholson AG, Yatabe Y, Austin JHM, Beasley MB, et al. The 2015 World
Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic
Advances Since the 2004 Classification. Journal of Thoracic Oncology. 2015;10:1243–60.
12. Nicholson AG, Tsao MS, Beasley MB, Borczuk AC, Brambilla E, Cooper WA, et al. The 2021 WHO
Classification of Lung Tumors: Impact of Advances Since 2015. Journal of Thoracic Oncology.
Elsevier; 2022;17:362–87.
13. Šutić M, Vukić A, Baranašić J, Försti A, Džubur F, Samaržija M, et al. Diagnostic, Predictive, and
Prognostic Biomarkers in Non-Small Cell Lung Cancer (NSCLC) Management. Journal of
Personalized Medicine. Multidisciplinary Digital Publishing Institute; 2021;11:1102.
73

14. Dela Cruz CS, Tanoue LT, Matthay RA. Lung cancer: epidemiology, etiology, and prevention. Clin
Chest Med. 2011;32:605–44.
15. Travis WD. Lung Cancer Pathology. Clinics in Chest Medicine. 2020;41:67–85.
16. Thun MJ, Hannan LM, Adams-Campbell LL, Boffetta P, Buring JE, Feskanich D, et al. Lung cancer
occurrence in never-smokers: an analysis of 13 cohorts and 22 cancer registry studies. PLoS Med.
2008;5:e185.
17. Miller M, Hanna N. Advances in systemic therapy for non-small cell lung cancer. BMJ. British
Medical Journal Publishing Group; 2021;375:n2363.
18. Alexander M, Kim SY, Cheng H. Update 2020: Management of Non-Small Cell Lung Cancer. Lung.
2020;198:897–907.
19. Arbour KC, Riely GJ. Systemic Therapy for Locally Advanced and Metastatic Non–Small Cell Lung
Cancer: A Review. JAMA. 2019;322:764–74.
20. Marino P, Pampallona S, Preatoni A, Cantoni A, Invernizzi F. Chemotherapy vs supportive care in
advanced non-small-cell lung cancer. Results of a meta-analysis of the literature. Chest.
1994;106:861–5.
21. Kris MG, Hellmann MD, Chaft JE. Chemotherapy for lung cancers: here to stay. Am Soc Clin Oncol
Educ Book. 2014;e375-380.
22. Raymond E, Faivre S, Armand JP. Epidermal growth factor receptor tyrosine kinase as a target for
anticancer therapy. Drugs. 2000;60 Suppl 1:15–23; discussion 41-42.
23. Sordella R, Bell DW, Haber DA, Settleman J. Gefitinib-sensitizing EGFR mutations in lung cancer
activate anti-apoptotic pathways. Science. 2004;305:1163–7.
24. Hong DS, Fakih MG, Strickler JH, Desai J, Durm GA, Shapiro GI, et al. KRASG12C Inhibition with
Sotorasib in Advanced Solid Tumors. N Engl J Med. 2020;383:1207–17.
25. The Cancer Genome Atlas Research Network. Comprehensive molecular profiling of lung
adenocarcinoma. Nature. 2014;511:543–50.
26. Castillo J, Stueve TR, Marconett CN. Intersecting transcriptomic profiling technologies and long
non-coding RNA function in lung adenocarcinoma: discovery, mechanisms, and therapeutic
applications. Oncotarget. 2017;8:81538–57.
27. Chakravarty D, Gao J, Phillips S, Kundra R, Zhang H, Wang J, et al. OncoKB: A Precision Oncology
Knowledge Base. JCO Precision Oncology. Wolters Kluwer; 2017;1–16.
28. Skoulidis F, Heymach JV. Co-occurring genomic alterations in non-small-cell lung cancer biology
and therapy. Nat Rev Cancer. Nature Publishing Group; 2019;19:495–509.
29. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The Transcriptional
Landscape of the Mammalian Genome. Science. American Association for the Advancement of
Science; 2005;309:1559–63.
74

30. Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, et al. Landscape of
transcription in human cells. Nature. Nature Publishing Group; 2012;489:101–8.
31. Volders P-J, Helsens K, Wang X, Menten B, Martens L, Gevaert K, et al. LNCipedia: a database for
annotated human lncRNA transcript sequences and structures. Nucleic Acids Research.
2013;41:D246–51.
32. Prensner JR, Chinnaiyan AM. The Emergence of lncRNAs in Cancer Biology. Cancer Discovery.
2011;1:391–407.
33. Torarinsson E, Sawera M, Havgaard JH, Fredholm M, Gorodkin J. Thousands of corresponding
human and mouse genomic regions unalignable in primary sequence contain common RNA structure.
Genome Res. 2006;16:885–9.
34. Chureau C, Prissette M, Bourdet A, Barbe V, Cattolico L, Jones L, et al. Comparative Sequence
Analysis of the X-Inactivation Center Region in Mouse, Human, and Bovine. Genome Res.
2002;12:894–908.
35. Panning B. X-chromosome inactivation: the molecular basis of silencing. J Biol. BioMed Central;
2008;7:1–4.
36. Strehle M, Guttman M. Xist drives spatial compartmentalization of DNA and protein to orchestrate
initiation and maintenance of X inactivation. Current Opinion in Cell Biology. 2020;64:139–47.
37. Taiana E, Ronchetti D, Todoerti K, Nobili L, Tassone P, Amodio N, et al. LncRNA NEAT1 in
Paraspeckles: A Structural Scaffold for Cellular DNA Damage Response Systems? Non-Coding
RNA. Multidisciplinary Digital Publishing Institute; 2020;6:26.
38. Quinn JJ, Chang HY. Unique features of long non-coding RNA biogenesis and function. Nat Rev
Genet. Nature Publishing Group; 2016;17:47–62.
39. Zhang Y, Yang L, Chen L-L. Life without A tail: New formats of long noncoding RNAs. The
International Journal of Biochemistry & Cell Biology. 2014;54:338–49.
40. Kalwa M, Hänzelmann S, Otto S, Kuo C-C, Franzen J, Joussen S, et al. The lncRNA HOTAIR
impacts on mesenchymal stem cells via triple helix formation. Nucleic Acids Res. 2016;44:10631–
43.
41. O’Leary VB, Ovsepian SV, Carrascosa LG, Buske FA, Radulovic V, Niyazi M, et al. PARTICLE, a
Triplex-Forming Long ncRNA, Regulates Locus-Specific Methylation in Response to Low-Dose
Irradiation. Cell Reports. 2015;11:474–85.
42. Guh C-Y, Hsieh Y-H, Chu H-P. Functions and properties of nuclear lncRNAs—from systematically
mapping the interactomes of lncRNAs. J Biomed Sci. BioMed Central; 2020;27:1–14.
43. Anastasiadou E, Jacob LS, Slack FJ. Non-coding RNA networks in cancer. Nat Rev Cancer. Nature
Publishing Group; 2018;18:5–18.
44. Huarte M. The emerging role of lncRNAs in cancer. Nat Med. Nature Publishing Group;
2015;21:1253–61.
75

45. Lu K, Li W, Liu X, Sun M, Zhang M, Wu W, et al. Long non-coding RNA MEG3 inhibits NSCLC
cells proliferation and induces apoptosis by affecting p53 expression. BMC Cancer. 2013;13:461.
46. Zhao Y, Zhu Z, Shi S, Wang J, Li N. Long non-coding RNA MEG3 regulates migration and invasion
of lung cancer stem cells via miR-650/SLC34A2 axis. Biomedicine & Pharmacotherapy.
2019;120:109457.
47. Loewen G, Jayawickramarajah J, Zhuo Y, Shan B. Functions of lncRNA HOTAIR in lung cancer. J
Hematol Oncol. 2014;7:90.
48. Ren M, Xu S, Wei Y, Yang J, Yang Y, Sun S, et al. Roles of HOTAIR in lung cancer susceptibility
and prognosis. Mol Genet Genomic Med. 2020;8:e1299.
49. Cabili MN, Trapnell C, Goff L, Koziol M, Tazon-Vega B, Regev A, et al. Integrative annotation of
human large intergenic noncoding RNAs reveals global properties and specific subclasses. Genes
Dev. 2011;25:1915–27.
50. Iyer MK, Niknafs YS, Malik R, Singhal U, Sahu A, Hosono Y, et al. The landscape of long
noncoding RNAs in the human transcriptome. Nat Genet. Nature Publishing Group; 2015;47:199–
208.
51. Bussemakers MJG, van Bokhoven A, Verhaegh GW, Smit FP, Karthaus HFM, Schalken JA, et al.
DD3::A New Prostate-specific Gene, Highly Overexpressed in Prostate Cancer1. Cancer Research.
1999;59:5975–9.
52. de Kok JB, Verhaegh GW, Roelofs RW, Hessels D, Kiemeney LA, Aalders TW, et al. DD3PCA3, a
Very Sensitive and Specific Marker to Detect Prostate Tumors. Cancer Research. 2002;62:2695–8.
53. Hessels D, Klein Gunnewiek JMT, van Oort I, Karthaus HFM, van Leenders GJL, van Balken B, et
al. DD3(PCA3)-based molecular urine analysis for the diagnosis of prostate cancer. Eur Urol.
2003;44:8–15; discussion 15-16.
54. Ouyang B, Bracken B, Burke B, Chung E, Liang J, Ho S-M. A duplex quantitative polymerase chain
reaction assay based on quantification of alpha-methylacyl-CoA racemase transcripts and prostate
cancer antigen 3 in urine sediments improved diagnostic accuracy for prostate cancer. J Urol.
2009;181:2508–13; discussion 2513-2514.
55. Groskopf J, Aubin SMJ, Deras IL, Blase A, Bodrug S, Clark C, et al. APTIMA PCA3 molecular
urine test: development of a method to aid in the diagnosis of prostate cancer. Clin Chem.
2006;52:1089–95.
56. Durand X, Moutereau S, Xylinas E, de la Taille A. Progensa
TM
PCA3 test for prostate cancer. Expert
Review of Molecular Diagnostics. Taylor & Francis; 2011;11:137–44.
57. Ferreira LB, Palumbo A, de Mello KD, Sternberg C, Caetano MS, de Oliveira FL, et al. PCA3
noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen
receptor signaling. BMC Cancer. 2012;12:507.
58. Özgür E, Celik AI, Darendeliler E, Gezer U. PCA3 Silencing Sensitizes Prostate Cancer Cells to
Enzalutamide-mediated Androgen Receptor Blockade. Anticancer Research. International Institute of
Anticancer Research; 2017;37:3631–7.
76

59. Shahabi S, Kumaran V, Castillo J, Cong Z, Nandagopal G, Mullen DJ, et al. LINC00261 Is an
Epigenetically Regulated Tumor Suppressor Essential for Activation of the DNA Damage Response.
Cancer Res. American Association for Cancer Research; 2019;79:3050–62.
60. Tweedie S, Braschi B, Gray K, Jones TEM, Seal RL, Yates B, et al. Genenames.org: the HGNC and
VGNC resources in 2021. Nucleic Acids Research. 2021;49:D939–46.
61. Herriges MJ, Swarr DT, Morley MP, Rathi KS, Peng T, Stewart KM, et al. Long noncoding RNAs
are spatially correlated with transcription factors and regulate lung development. Genes &
Development. 2014;28:1363–79.
62. Friedman JR, Kaestner KH. The Foxa family of transcription factors in development and metabolism.
Cell Mol Life Sci. 2006;63:2317–28.
63. Wolfrum C, Stoffel M. Coactivation of Foxa2 through Pgc-1β promotes liver fatty acid oxidation and
triglyceride/VLDL secretion. Cell Metabolism. 2006;3:99–110.
64. Whirledge S, Kisanga EP, Taylor RN, Cidlowski JA. Pioneer Factors FOXA1 and FOXA2 Assist
Selective Glucocorticoid Receptor Signaling in Human Endometrial Cells. Endocrinology.
2017;158:4076–92.
65. Liang W-C, Ren J-L, Wong C-W, Chan S-O, Waye MM-Y, Fu W-M, et al. LncRNA-NEF
antagonized epithelial to mesenchymal transition and cancer metastasis via cis-regulating FOXA2
and inactivating Wnt/β-catenin signaling. Oncogene. 2018;37:1445–56.
66. Numata K, Kanai A, Saito R, Kondo S, Adachi J, Wilming LG, et al. Identification of Putative
Noncoding RNAs Among the RIKEN Mouse Full-Length cDNA Collection. Genome Res.
2003;13:1301–6.
67. Gil N, Ulitsky I. Regulation of gene expression by cis-acting long non-coding RNAs. Nat Rev Genet.
2020;21:102–17.
68. Kurian L, Aguirre A, Sancho-Martinez I, Benner C, Hishida T, Nguyen TB, et al. Identification of
Novel Long Noncoding RNAs Underlying Vertebrate Cardiovascular Development. Circulation.
2015;131:1278–90.
69. Jiang W, Liu Y, Liu R, Zhang K, Zhang Y. The lncRNA DEANR1 facilitates human endoderm
differentiation by activating FOXA2 expression. Cell Rep. 2015;11:137–48.
70. Cao W-J, Wu H-L, He B-S, Zhang Y-S, Zhang Z-Y. Analysis of long non-coding RNA expression
profiles in gastric cancer. World J Gastroenterol. 2013;19:3658–64.
71. Liu Y, Xiao N, Xu S-F. Decreased expression of long non-coding RNA LINC00261 is a prognostic
marker for patients with non-small cell lung cancer: a preliminary study. Eur Rev Med Pharmacol
Sci. 2017;21:5691–5.
72. Müller S, Raulefs S, Bruns P, Afonso-Grunz F, Plötner A, Thermann R, et al. Next-generation
sequencing reveals novel differentially regulated mRNAs, lncRNAs, miRNAs, sdRNAs and a piRNA
in pancreatic cancer. Mol Cancer. 2015;14:94.
73. GTEx Consortium. The Genotype-Tissue Expression (GTEx) project. Nat Genet. 2013;45:580–5.
77

74. THE GTEX CONSORTIUM. The GTEx Consortium atlas of genetic regulatory effects across human
tissues. Science. American Association for the Advancement of Science; 2020;369:1318–30.
75. Mounir M, Lucchetta M, Silva TC, Olsen C, Bontempi G, Chen X, et al. New functionalities in the
TCGAbiolinks package for the study and integration of cancer data from GDC and GTEx. PLOS
Computational Biology. Public Library of Science; 2019;15:e1006701.
76. Zeng Z, Yang Y, Qing C, Hu Z, Huang Y, Zhou C, et al. Distinct expression and prognostic value of
members of SMAD family in non-small cell lung cancer. Medicine (Baltimore). 2020;99:e19451.
77. Dhamija S, Becker AC, Sharma Y, Myacheva K, Seiler J, Diederichs S. LINC00261 and the
Adjacent Gene FOXA2 Are Epithelial Markers and Are Suppressed during Lung Cancer
Tumorigenesis and Progression. Noncoding RNA. 2018;5:E2.
78. Yu Y, Li L, Zheng Z, Chen S, Chen E, Hu Y. Long non-coding RNA linc00261 suppresses gastric
cancer progression via promoting Slug degradation. J Cell Mol Med. 2017;21:955–67.
79. Zhang B, Li C, Sun Z. Long non-coding RNA LINC00346, LINC00578, LINC00673, LINC00671,
LINC00261, and SNHG9 are novel prognostic markers for pancreatic cancer. Am J Transl Res.
2018;10:2648–58.
80. Yan D, Liu W, Liu Y, Luo M. LINC00261 suppresses human colon cancer progression via sponging
miR-324-3p and inactivating the Wnt/β-catenin pathway. J Cell Physiol. 2019;234:22648–56.
81. Mather RL, Parolia A, Carson SE, Venalainen E, Roig-Carles D, Jaber M, et al. The evolutionarily
conserved long non-coding RNA LINC00261 drives neuroendocrine prostate cancer proliferation and
metastasis via distinct nuclear and cytoplasmic mechanisms. Molecular Oncology. 2021;15:1921–41.
82. Gao J, Qin W, Kang P, Xu Y, Leng K, Li Z, et al. Up-regulated LINC00261 predicts a poor
prognosis and promotes a metastasis by EMT process in cholangiocarcinoma. Pathology - Research
and Practice. 2020;216:152733.
83. Wang Y, Wang Y, Ci X, Choi SYC, Crea F, Lin D, et al. Molecular events in neuroendocrine
prostate cancer development. Nat Rev Urol. Nature Publishing Group; 2021;18:581–96.
84. Rodrigues PM, Olaizola P, Paiva NA, Olaizola I, Agirre-Lizaso A, Landa A, et al. Pathogenesis of
Cholangiocarcinoma. Annual Review of Pathology: Mechanisms of Disease. 2021;16:433–63.
85. Shi J, Ma H, Wang H, Zhu W, Jiang S, Dou R, et al. Overexpression of LINC00261 inhibits non–
small cell lung cancer cells progression by interacting with miR-522-3p and suppressing Wnt
signaling. Journal of Cellular Biochemistry. John Wiley & Sons, Ltd; 2019;120:18378–87.
86. Zhai S, Xu Z, Xie J, Zhang J, Wang X, Peng C, et al. Epigenetic silencing of LncRNA LINC00261
promotes c-myc-mediated aerobic glycolysis by regulating miR-222-3p/HIPK2/ERK axis and
sequestering IGF2BP1. Oncogene. 2021;40:277–91.
87. Wang X, Gao X, Tian J, Zhang R, Qiao Y, Hua X, et al. LINC00261 inhibits progression of
pancreatic cancer by down-regulating miR-23a-3p. Arch Biochem Biophys. 2020;689:108469.
78

88. PCAWG Mutational Signatures Working Group, PCAWG Consortium, Alexandrov LB, Kim J,
Haradhvala NJ, Huang MN, et al. The repertoire of mutational signatures in human cancer. Nature.
2020;578:94–101.
89. Hellmann MD, Ciuleanu T-E, Pluzanski A, Lee JS, Otterson GA, Audigier-Valette C, et al.
Nivolumab plus Ipilimumab in Lung Cancer with a High Tumor Mutational Burden. N Engl J Med.
2018;378:2093–104.
90. Teo MY, Seier K, Ostrovnaya I, Regazzi AM, Kania BE, Moran MM, et al. Alterations in DNA
Damage Response and Repair Genes as Potential Marker of Clinical Benefit From PD-1/PD-L1
Blockade in Advanced Urothelial Cancers. JCO. 2018;36:1685–94.
91. Meléndez B, Van Campenhout C, Rorive S, Remmelink M, Salmon I, D’Haene N. Methods of
measurement for tumor mutational burden in tumor tissue. Transl Lung Cancer Res. 2018;7:661–7.
92. Teo MY, Bambury RM, Zabor EC, Jordan E, Al-Ahmadie H, Boyd ME, et al. DNA Damage
Response and Repair Gene Alterations Are Associated with Improved Survival in Patients with
Platinum-Treated Advanced Urothelial Carcinoma. Clin Cancer Res. 2017;23:3610–8.
93. Mayakonda A, Lin D-C, Assenov Y, Plass C, Koeffler HP. Maftools: efficient and comprehensive
analysis of somatic variants in cancer. Genome Res. 2018;28:1747–56.
94. Helleday T, Petermann E, Lundin C, Hodgson B, Sharma RA. DNA repair pathways as targets for
cancer therapy. Nat Rev Cancer. 2008;8:193–204.
95. Awasthi P, Foiani M, Kumar A. ATM and ATR signaling at a glance. Journal of Cell Science.
2015;128:4255–62.
96. Fuss JO, Cooper PK. DNA Repair: Dynamic Defenders against Cancer and Aging. PLOS Biology.
Public Library of Science; 2006;4:e203.
97. Cheung-Ong K, Giaever G, Nislow C. DNA-Damaging Agents in Cancer Chemotherapy: Serendipity
and Chemical Biology. Chemistry & Biology. 2013;20:648–59.
98. Dasari S, Tchounwou PB. Cisplatin in cancer therapy: molecular mechanisms of action. Eur J
Pharmacol. 2014;740:364–78.
99. Wan G, Hu X, Liu Y, Han C, Sood AK, Calin GA, et al. A novel non-coding RNA lncRNA-JADE
connects DNA damage signalling to histone H4 acetylation. EMBO J. 2013;32:2833–47.
100. Huarte M, Guttman M, Feldser D, Garber M, Koziol MJ, Kenzelmann-Broz D, et al. A Large
Intergenic Noncoding RNA Induced by p53 Mediates Global Gene Repression in the p53 Response.
Cell. 2010;142:409–19.
101. Zhang A, Xu M, Mo Y-Y. Role of the lncRNA-p53 regulatory network in cancer. J Mol Cell
Biol. 2014;6:181–91.
102. Tano K, Onoguchi-Mizutani R, Yeasmin F, Uchiumi F, Suzuki Y, Yada T, et al. Identification of
Minimal p53 Promoter Region Regulated by MALAT1 in Human Lung Adenocarcinoma Cells. Front
Genet. 2018;8:208.
79

103. Liu Z, Sun M, Lu K, Liu J, Zhang M, Wu W, et al. The long noncoding RNA HOTAIR
contributes to cisplatin resistance of human lung adenocarcinoma cells via downregualtion of
p21(WAF1/CIP1) expression. PLoS One. 2013;8:e77293.
104. Le DT, Durham JN, Smith KN, Wang H, Bartlett BR, Aulakh LK, et al. Mismatch repair
deficiency predicts response of solid tumors to PD-1 blockade. Science. 2017;357:409–13.
105. Burgess JT, Rose M, Boucher D, Plowman J, Molloy C, Fisher M, et al. The Therapeutic
Potential of DNA Damage Repair Pathways and Genomic Stability in Lung Cancer. Frontiers in
Oncology [Internet]. 2020 [cited 2022 Mar 10];10. Available from:
https://www.frontiersin.org/article/10.3389/fonc.2020.01256
106. Thapar R. Regulation of DNA Double-Strand Break Repair by Non-Coding RNAs. Molecules.
2018;23:2789.
107. Zheng M. Classification and Pathology of Lung Cancer. Surgical Oncology Clinics of North
America. 2016;25:447–68.
108. Myers DJ, Wallen JM. Lung Adenocarcinoma. StatPearls [Internet]. Treasure Island (FL):
StatPearls Publishing; 2022 [cited 2022 Sep 7]. Available from:
http://www.ncbi.nlm.nih.gov/books/NBK519578/
109. Lewis DR, Check DP, Caporaso NE, Travis WD, Devesa SS. US lung cancer trends by histologic
type. Cancer. 2014;120:2883–92.
110. Thomas A, Rajan A, Giaccone G. Tyrosine Kinase Inhibitors in Lung Cancer. Hematol Oncol
Clin North Am. 2012;26:589–605.
111. Skoulidis F. Co-occurring genomic alterations in non-small-cell lung cancer biology and therapy.
:15.
112. Ward M, McEwan C, Mills JD, Janitz M. Conservation and tissue-specific transcription patterns
of long noncoding RNAs. J Hum Transcr. 2015;1:2–9.
113. Yan X, Hu Z, Feng Y, Hu X, Yuan J, Zhao SD, et al. Comprehensive Genomic Characterization
of Long Non-Coding RNAs across Human Cancers. Cancer Cell. 2015;28:529–40.
114. Morlando M, Fatica A. Alteration of Epigenetic Regulation by Long Noncoding RNAs in Cancer.
Int J Mol Sci. 2018;19:570.
115. Kaestner KH. The FoxA factors in organogenesis and differentiation. Current Opinion in
Genetics & Development. 2010;20:527–32.
116. Nandagopal G. Defining the Functional Region of LINC00261 in Lung Adenocarcinoma. :51.
117. Fang Q, Sang L, Du S. Long noncoding RNA LINC00261 regulates endometrial carcinoma
progression by modulating miRNA/FOXO1 expression. Cell Biochem Funct. 2018;36:323–30.
118. Chu C, Zhang QC, da Rocha ST, Flynn RA, Bharadwaj M, Calabrese JM, et al. Systematic
Discovery of Xist RNA Binding Proteins. Cell. 2015;161:404–16.
80

119. Chu C, Chang HY. ChIRP-MS: RNA-Directed Proteomic Discovery. Methods Mol Biol.
2018;1861:37–45.
120. Vogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz LA, Kinzler KW. Cancer Genome
Landscapes. Science. 2013;339:1546–58.
121. Chalmers ZR, Connelly CF, Fabrizio D, Gay L, Ali SM, Ennis R, et al. Analysis of 100,000
human cancer genomes reveals the landscape of tumor mutational burden. Genome Med. 2017;9:34.
122. Jiang Z, Liao G, Yang Y, Lan Y, Xu L, Yan M, et al. Analysis of Mutations and Dysregulated
Pathways Unravels Carcinogenic Effect and Clinical Actionability of Mutational Processes. Frontiers
in Cell and Developmental Biology [Internet]. 2021 [cited 2022 May 4];9. Available from:
https://www.frontiersin.org/article/10.3389/fcell.2021.768981
123. Alhmoud JF, Woolley JF, Al Moustafa A-E, Malki MI. DNA Damage/Repair Management in
Cancers. Cancers (Basel). 2020;12:1050.
124. Hellmann MD, Nathanson T, Rizvi H, Creelan BC, Sanchez-Vega F, Ahuja A, et al. Genomic
Features of Response to Combination Immunotherapy in Patients with Advanced Non-Small-Cell
Lung Cancer. Cancer Cell. 2018;33:843-852.e4.
125. Cristescu R, Mogg R, Ayers M, Albright A, Murphy E, Yearley J, et al. Pan-tumor genomic
biomarkers for PD-1 checkpoint blockade–based immunotherapy. Science. American Association for
the Advancement of Science; 2018;362:eaar3593.
126. Snyder A, Makarov V, Merghoub T, Yuan J, Zaretsky JM, Desrichard A, et al. Genetic basis for
clinical response to CTLA-4 blockade in melanoma. N Engl J Med. 2014;371:2189–99.
127. Jia Q, Wu W, Wang Y, Alexander PB, Sun C, Gong Z, et al. Local mutational diversity drives
intratumoral immune heterogeneity in non-small cell lung cancer. Nat Commun. 2018;9:5361.
128. Gambardella V, Tarazona N, Cejalvo JM, Lombardi P, Huerta M, Roselló S, et al. Personalized
Medicine: Recent Progress in Cancer Therapy. Cancers (Basel). 2020;12:E1009.
129. Krzyszczyk P, Acevedo A, Davidoff EJ, Timmins LM, Marrero-Berrios I, Patel M, et al. The
growing role of precision and personalized medicine for cancer treatment. Technology (Singap World
Sci). 2018;6:79–100.
130. Yao R-W, Wang Y, Chen L-L. Cellular functions of long noncoding RNAs. Nat Cell Biol. Nature
Publishing Group; 2019;21:542–51.
131. Yin F, Zhang Q, Dong Z, Hu J, Ma Z. LncRNA HOTTIP Participates in Cisplatin Resistance of
Tumor Cells by Regulating miR-137 Expression in Pancreatic Cancer. Onco Targets Ther.
2020;13:2689–99.
132. Cui Y, Li G, Zhang X, Dai F, Zhang R. Increased MALAT1 expression contributes to cisplatin
resistance in non-small cell lung cancer. Oncol Lett. 2018;16:4821–8.
133. Yu T, Bai W, Su Y, Wang Y, Wang M, Ling C. Enhanced expression of lncRNA ZXF1 promotes
cisplatin resistance in lung cancer cell via MAPK axis. Exp Mol Pathol. 2020;116:104484.
81

134. Knijnenburg TA, Wang L, Zimmermann MT, Chambwe N, Gao GF, Cherniack AD, et al.
Genomic and Molecular Landscape of DNA Damage Repair Deficiency across The Cancer Genome
Atlas. Cell Reports. 2018;23:239-254.e6.
135. Weinstein JN, Collisson EA, Mills GB, Shaw KRM, Ozenberger BA, Ellrott K, et al. The Cancer
Genome Atlas Pan-Cancer analysis project. Nat Genet. Nature Publishing Group; 2013;45:1113–20.
136. Chen J, Li P, Chen Z, Wang S, Tang S, Chen X, et al. Elevated LINC01550 induces the apoptosis
and cell cycle arrest of melanoma. Med Oncol. 2021;38:32.
137. Zhou Z, Yang Z, Cui Y, Lu S, Huang Y, Che X, et al. Identification and Validation of a
Ferroptosis-Related Long Non-Coding RNA (FRlncRNA) Signature to Predict Survival Outcomes
and the Immune Microenvironment in Patients With Clear Cell Renal Cell Carcinoma. Front Genet.
2022;13:787884.
138. Wang Y, Zhang X, Dai X, He D. Applying immune-related lncRNA pairs to construct a
prognostic signature and predict the immune landscape of stomach adenocarcinoma. Expert Review
of Anticancer Therapy. Taylor & Francis; 2021;21:1161–70.
139. Pilger D, Seymour LW, Jackson SP. Interfaces between cellular responses to DNA damage and
cancer immunotherapy. Genes Dev. 2021;35:602–18.
140. Volders P-J, Anckaert J, Verheggen K, Nuytens J, Martens L, Mestdagh P, et al. LNCipedia 5:
towards a reference set of human long non-coding RNAs. Nucleic Acids Res. 2019;47:D135–9.
141. Rizvi NA, Hellmann MD, Snyder A, Kvistborg P, Makarov V, Havel JJ, et al. Mutational
landscape determines sensitivity to PD-1 blockade in non–small cell lung cancer. Science. American
Association for the Advancement of Science; 2015;348:124–8.
142. van Rooij N, van Buuren MM, Philips D, Velds A, Toebes M, Heemskerk B, et al. Tumor exome
analysis reveals neoantigen-specific T-cell reactivity in an ipilimumab-responsive melanoma. J Clin
Oncol. 2013;31:e439-442.
143. Wang C, Liang H, Lin C, Li F, Xie G, Qiao S, et al. Molecular Subtyping and Prognostic
Assessment Based on Tumor Mutation Burden in Patients with Lung Adenocarcinomas. International
Journal of Molecular Sciences. Multidisciplinary Digital Publishing Institute; 2019;20:4251.
144. Jenkins RW, Barbie DA, Flaherty KT. Mechanisms of resistance to immune checkpoint
inhibitors. Br J Cancer. Nature Publishing Group; 2018;118:9–16.
145. Jardim DL, Goodman A, Gagliato D de M, Kurzrock R. The Challenges of Tumor Mutational
Burden as an Immunotherapy Biomarker. Cancer Cell. 2021;39:154–73.
146. Evans JR, Feng FY, Chinnaiyan AM. The bright side of dark matter: lncRNAs in cancer. J Clin
Invest. 126:2775–82.
147. Skroblin P, Mayr M. “Going Long”: Long Non-Coding RNAs as Biomarkers. Circulation
Research. American Heart Association; 2014;115:607–9.
82

148. Kleih M, Böpple K, Dong M, Gaißler A, Heine S, Olayioye MA, et al. Direct impact of cisplatin
on mitochondria induces ROS production that dictates cell fate of ovarian cancer cells. Cell Death
Dis. 2019;10:851.
149. Szikriszt B, Póti Á, Németh E, Kanu N, Swanton C, Szüts D. A comparative analysis of the
mutagenicity of platinum-containing chemotherapeutic agents reveals direct and indirect mutagenic
mechanisms. Mutagenesis. 2021;36:75–86.
150. Lacher SE, Levings DC, Freeman S, Slattery M. Identification of a functional antioxidant
response element at the HIF1A locus. Redox Biol. 2018;19:401–11.
151. Engreitz JM, Haines JE, Perez EM, Munson G, Chen J, Kane M, et al. Local regulation of gene
expression by lncRNA promoters, transcription and splicing. Nature. 2016;539:452–5.
152. Li CM-C, Gocheva V, Oudin MJ, Bhutkar A, Wang SY, Date SR, et al. Foxa2 and Cdx2
cooperate with Nkx2-1 to inhibit lung adenocarcinoma metastasis. Genes Dev. 2015;29:1850–62.
153. Tang Y, Shu G, Yuan X, Jing N, Song J. FOXA2 functions as a suppressor of tumor metastasis
by inhibition of epithelial-to-mesenchymal transition in human lung cancers. Cell Res. 2011;21:316–
26.
154. Basseres DS, D’Alò F, Yeap BY, Löwenberg EC, Gonzalez DA, Yasuda H, et al. Frequent
downregulation of the transcription factor Foxa2 in lung cancer through epigenetic silencing. Lung
Cancer. 2012;77:31–7.
155. Nagy Á, Munkácsy G, Győrffy B. Pancancer survival analysis of cancer hallmark genes. Sci Rep.
Nature Publishing Group; 2021;11:6047.
156. Afgan E, Baker D, Batut B, van den Beek M, Bouvier D, Cech M, et al. The Galaxy platform for
accessible, reproducible and collaborative biomedical analyses: 2018 update. Nucleic Acids Res.
2018;46:W537–44.
157. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data.
Bioinformatics. 2014;30:2114–20.
158. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal
RNA-seq aligner. Bioinformatics. 2013;29:15–21.
159. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq
data with DESeq2. Genome Biol. 2014;15:550.
160. Lord CJ, Ashworth A. The DNA damage response and cancer therapy. Nature. Nature Publishing
Group; 2012;481:287–94.
161. Goodsell DS. The Molecular Perspective: Cisplatin. Stem Cells. 2006;24:514–5.
162. Szikriszt B, Póti Á, Németh E, Kanu N, Swanton C, Szüts D. Cisplatin is more mutagenic than
carboplatin or oxaliplatin at equitoxic concentrations [Internet]. bioRxiv; 2020 [cited 2022 Oct 17].
page 2020.08.11.245969. Available from:
https://www.biorxiv.org/content/10.1101/2020.08.11.245969v1
83

163. Chiorazzi A, Semperboni S, Marmiroli P. Current View in Platinum Drug Mechanisms of
Peripheral Neurotoxicity. Toxics. 2015;3:304–21.
164. Jin X, Dai L, Ma Y, Wang J, Liu Z. Implications of HIF-1α in the tumorigenesis and progression
of pancreatic cancer. Cancer Cell International. 2020;20:273.
165. Greijer AE, van der Wall E. The role of hypoxia inducible factor 1 (HIF-1) in hypoxia induced
apoptosis. J Clin Pathol. 2004;57:1009–14.
166. Ma L, Bajic VB, Zhang Z. On the classification of long non-coding RNAs. RNA Biol.
2013;10:924–33.

Abstract (if available)

Abstract Lung cancer is the leading cause of cancer related death in the United States, with lung adenocarcinoma (LUAD) being among the most common histological subtypes. The current standard of care for operable LUAD is surgical resection followed by chemotherapy, typically DNA damage-inducing compounds such as platinum-derivatives. Studies on protein coding driver oncogenes, such as EGFR and KRAS, have led to promising targeted therapeutics, namely gefitinib and erlotinib for EGFR and the recently FDA-approved Sotorasib. However, approximately 30% of lung adenocarcinomas lack known driver mutations. To circumvent this gap of knowledge, our lab studies the role of long non-coding RNAs (lncRNAs) in the development of cancer. We previously identified LINC00261 as a tumor suppressor in lung adenocarcinoma (LUAD), that when present predicts better overall patient survival, decreased tumor cell proliferation and inhibited invasion.
Through transcriptional analysis of LUAD cells where LINC00261 was reintroduced, along with identifying genes correlated to LINC00261 expression from TCGA-LUAD dataset, we identified that LINC00261 is involved in the DNA damage response pathway. The loss of LINC00261 in LUAD results in poorer survival outcome and decreased expression of DNA damage response genes. In addition, LUAD cells where LINC00261 expression was lost are also more susceptible to the DNA damaging agent, cisplatin. Collectively, these studies reveal LINC00261 as a novel biomarker for effective response to DNA damaging therapeutic interventions in LUAD.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Defining the functional region of LINC00261 in lung adenocarcinoma

PDF

LINC00261 induces a G2/M cell cycle arrest and activation of the DNA damage response in lung adenocarcinoma

PDF

Generation of an epigenetic toggle switch to test LINC00261 function on lung adenocarcinoma cellular response to the chemotherapeutics oxaliplatin and carboplatin

PDF

Establishing the non-coding RNA LINC00261 as a tumor suppressor in lung adenocarcinoma

PDF

Evaluating the impact of long non-coding RNAs on tumor mutational burden in cancer

PDF

DNA methylation changes in the development of lung adenocarcinoma

PDF

Modeling lung adenocarcinoma progression in vitro using immortalized human alveolar epithelial cells

PDF

Elucidating the cellular origins of lung adenocarcinoma

PDF

Optimizing an immortalized human alveolar epithelial cell line model system to recapitulate lung adenocarcinoma development in vitro

PDF

Application of tracing enhancer networks using epigenetic traits (TENET) to identify epigenetic deregulation in cancer

PDF

In vitro lineage tracing of immortalized human alveolar epithelial cells

PDF

Development of DNA methylation biomarkers as an early detection tool for human lung adenocarcinoma

PDF

Novel long non-coding RNA, LINC00824, contributes to stemness in hepatocytes

PDF

Tight junction protein CLDN18.1 attenuates malignant properties and related signaling pathways of human lung adenocarcinoma in vivo and in vitro

PDF

Development of DNA methylation based biomarkers for the early detection of squamous cell lung cancer

PDF

Molecular elucidation of nonhomologous DNA end-joining in the context of nucleosome core particles

PDF

Use of cell-free nucleic acids in associating PD-L1 gene expression with presence of driver mutations in DNA and demographics across different cancers

PDF

Genetics and the environment: evaluating the role of noncoding RNA in autism spectrum disorder

PDF

Developing a robust single cell whole genome bisulfite sequencing protocol to analyse circulating tumor cells

PDF

CpG methylation profiling in lung cancer cell lines, tumors and non-tumors

Asset Metadata

Creator Castillo, Jonathan (author)

Core Title LINC00261 alters DNA repair and confers resistance to cisplatin independent of FOXA2 in lung adenocarcinoma

School Keck School of Medicine

Degree Doctor of Philosophy

Degree Program Cancer Biology and Genomics

Degree Conferral Date 2023-05

Publication Date 01/26/2025

Defense Date 07/22/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag chemotherapy,DNA damage,lncRNA,lung adenocarcinoma,OAI-PMH Harvest

Format theses (aat)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Stallcup, Michael (committee chair), Attenello, Frank (committee member), Marconett, Crystal (committee member)

Creator Email cast033@usc.edu,castillo6433@gmail.com

Unique identifier UC112718988

Identifier etd-CastilloJo-11447.pdf (filename)

Legacy Identifier etd-CastilloJo-11447

Document Type Dissertation

Format theses (aat)

Rights Castillo, Jonathan

Internet Media Type application/pdf

Type texts

Source 20230126-usctheses-batch-1004 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu