University of Southern California Dissertations and Theses

Role of Notch and hyaluronan in modulating the expression of lymphatic vessel endothelial hyaluronan receptor1 (LYVE1)

(USC Thesis Other)

Role of Notch and hyaluronan in modulating the expression of lymphatic vessel endothelial hyaluronan receptor1 (LYVE1)

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ROLE OF NOTCH AND HYALURONAN IN MODULATING THE EXPRESSION
OF
LYMPHATIC VESSEL ENDOTHELIAL HYALURONAN RECEPTOR1 (LYVE1)

by

Sathish Kumar Ganesan

A Thesis Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
MASTER OF SCIENCE
(MOLECULAR MICROBIOLOGY AND IMMUNOLOGY)

August 2008

Copyright 2008 Sathish Kumar Ganesan
ii
Dedication

I dedicate my thesis work and my Master’s degree to my dearest Appa (naina) for
supporting and inspiring me all the way long. My dedication also goes to my sweet
Amma for all her insatiable love and delicious food, my best friends Milo, Tiger, my
brothers Divya kumar (alias) Ganesh Perumal, Chellam Mahesh, my sister in law(s)
Dolly, Kavitha and my best buddies Divi, Dubukku Arun, Kiruphagaran and Varun anna.

The dedication also goes to my dear friends Adithya, Abishek anna, Kadal
Vivekanandan, Deepak anna, Gauthaman, Tina, Preethi, Smitha, Nikhil, Praveen,
Vasanth and the whole bunch of Clonalfreaks.

I also dedicate the work to my research advisor, Dr. Young Kwon Hong and my labmates
Sunju Lee, Hyungnim Jae, Maple June, Jinjoo, Swapnika and Bernice for their love and
support.

iii
Acknowledgements
I would like to thank Dr. Young Kwon Hong, my research advisor, for his guidance and
support. I would also like to thank him for helping me learn the various techniques,
editing the thesis manuscript and for helping with my studies. I also thank him for
arranging the lab outings.
I would like to thank my academic advisor Dr. Axel Schonthal for his continuous support
over the two years of my masters, inspiring me in keeping up a good GPA, for providing
valuable suggestions regarding my student seminar presentation and for chairing my
master’s committee.
I would like to thank Dr. Joseph Landolph for his support for my thesis work, studies and
also for being a member of my thesis committee.
I thank Dr. Sunju Lee for teaching various lab techniques and, Jinjoo Kang for providing
me lymphatic endothelial cells, Swapnika Ramu for teaching me immunofluorescence
and immunohistochemistry, Jae for his inspiration and providing me timely help and
support, June for helping me with notch inhibitors and ordering various reagents, and
Bernice Aguilar for teaching me luciferase assays.
I am very grateful to my roommates-Divya, Adithya, Vivek and Varun-for driving me to
the laboratory at the weekends, for making good food, and for helping me write the
thesis.
Finally, I thank Naina, Amma, brothers, pets, and friends whose love and support has
kept me awake and working, always.

iv
Table of Contents
Dedication ii
Acknowledgements iii
List of Figures v
Abstract vi
Chapter 1: Introduction 1
1.1 Blood and Lymphatic endothelial cells 3
1.2 LYVE1 and HA 4
1.3 Notch signal 6
1.4 Notch activation of LYVE1 8

Chapter 2: Experimental Plan 10

Chapter 3: Material and Methods 11
3.1 Material 11
3.2 Antibodies 11
3.3 Cell lines ad culture conditions 11
3.4 Transfections 12
3.5 Luciferase assay 12
3.6 PCR and Real-time RT-PCR 12
3.7 Site directed mutagenesis 13
3.8 Immunofluorescence 14
3.9 WST-1 cell proliferation assay 15
3.10 Endothelial cell migration assay 15

Chapter 4: Results 16
4.1 Notch activates at transcriptional level and is cell specific 16
4.2 Notch activation of LYVE1 is mediated by Rbp-jk 20
4.3 Notch inhibitor DAPT and Jagged1 reduces LYVE1 mRNA levels 22
4.4 Effect of Notch inhibitors and HA on expression of LYE1 in LECs 23
4.5 Effect of Notch inhibitors on the binding of HA to LYVE1 25
4.6 Effect of Notch inhibitors and HA on LEC proliferation 26
4.7 Effect of Notch inhibitors and HA on LEC migration 27

Chapter 5: Discussion 29

Chapter 6: Conclusion 35

Bibliography 36

v
List of Figures

Figure 1: Current view of the development of lymphatic system 1

Figure 2: Binding of hyaluronan to CD44 5

Figure 3: Notch signaling pathway 7

Figure 4: Notch binds and activates LYVE1 promoter 8

Figure 5: Notch activation of LECs and BECs 17

Figure 6: Notch activation of LYVE1 in HEK293T, Hela, CV1 and COS7 18
cell lines

Figure 7: Notch activation of LYVE1 in PYV4-1, NIH3T3 and HMEC-1 19

Figure 8: PCR amplification of LYVE1 promoter region 20

Figure 9: Luciferase assay to check if LYVE1 is a direct of Notch and to check if 21
Rbp-jk can bind to LYVE1 promoter

Figure 10: Notch inhibitor DAPT and soluble ligand Jagged1 reduces LYVE1 22
mRNA levels

Figure 11: Effect of DAPT, Jagged1 and HA on LYVE1 expression in LECs 24

Figure 12: Effect of DAPT and Jagged1 on HA binding 25

Figure 13: Effect of notch inhibitor DAPT, soluble ligand Jagged1 and LYVE1 26
ligand HA on LEC proliferation

Figure 14: Endothelial cell migration assay for DAPT/Jagged1/HA treated LECs 28

vi
Abstract
Lymphatic Hyaluronan receptor (LYVE1) is a lymphatic endothelial cell marker and is
implicated in the embryonic development of the lymphatic system. Notch plays a major
role in development of the blood vascular system. Previous studies at our lab found that
Notch activates LYVE1. The aim of this project was to investigate this new finding. We
have studied activation of LYVE1 by Notch at transcriptional and translational levels by
overexpression of Notch and also by using Notch inhibitors. Hyaluronic acid (HA) is
ligand of LYVE1. We have studied the influence of HA with respect to Notch activation
of LYVE1. We show that Notch activates LYVE1, and the soluble form of Notch ligand
can inhibit Notch-mediated activation of LYVE1. We have analyzed the effect of Notch
inhibitors on the binding of HA to LYVE1 and also LEC proliferation. We also found
that HA influences cell migration when notch activity is inhibited.

Chapter 1: Introduction
Vertebrates have two highly organized vascular systems, the blood vessels and the
lymphatic vessels. The blood vasculature forms a closed circular system supplying
nutrients and oxygen through blood and removing it for recirculation. In contrast, the
lymphatic system is an open-ended linear system. It consists of lymphatic capillaries,
larger lymphatic vessels and various lymphoid organs such as the lymph nodes, tonsils,
Peyer’s patches, spleen and thymus (18). It acts as a drain for the protein-rich lymph from
the tissues. The lymphatic system plays a major role in the transport of immune cells to
lymphoid organs, absorption of lipids from the intestinal tract and maintenance of tissue
fluid homeostasis. Lymphatic vessels are present almost all throughout the body, except
for the avascular structures, such as cornea, hair, nails cartilage and epidermis. It is also
absent in some vascularized organs such as the brain and retina (8, 30).

Figure1: Current view of the development of lymphatic system (8). A step-wise commitment and
development of lymphatic system occurs through expression of various lymphatic markers. The specific
signal that induces Prox1 expression, thus committing the specific subset of vein endothelial cells to form
the initial lymphatics, remains yet unidentified.
1
2

While the blood vascular system has been extensively studied, the lymphatic system has
comparatively been neglected. However, interest in lymphatic research has increased in
the past few years, in part, due to the role of lymphatic vessels in tumor metastasis and
various other pathological conditions. In 1627, Gaspero Aselli first identified lymphatic
vessels in the mesentery of a well-fed dog. Later, in 1902, Florence Sabin proposed that
primary lymphatic sacs are formed from vein endothelial cells. These sacs give rise to
capillaries and larger vessels. The currently accepted model for embryonic development
of the mammalian lymphatic system involves a step-wise process of lymphatic
competence, commitment, differentiation, and maturation (8).
Some of the genes implicated in the development of the primary lymphatic system are
prospero-related homebox1 (Prox1), lymphatic vessel endothelial hyaluronan receptor1
(LYVE1), neuropilin2 (Nrp2), vascular endothelial growth factor receptor3 (VEGFR3),
vascular growth factor C (VEGFC) and podoplanin (19). Other molecular players in the
development and maintenance of lymphatic system include the tie family receptors Tie1
and Tie2, their ligands angiopoietin1 and 2, FOXC2 and neuropilins Nrp1 and Nrp2 (38).
Impairment or abnormal development of lymphatic vessels leads to accumulation of
proteins and associated water in the interstitium and causes lymphedema. Accumulation
of high-fat containing fluid (chyle) in the abdomen or thorax due to obstruction or
abnormal development of lymphatic vessels causes chylous ascites and chylothorax (3).
A chylothorax is a condition that results from lymphatic fluid accumulating in the pleural
cavity. Its cause is usually leakage from the thoracic duct or one of the main lymphatic
3
vessels that drain to it. The most common causes are lymphoma and trauma caused by
thoracic surgery. Recent clinical studies on cancer suggest that molecular interactions
between lymphatic endothelial cells and tumor cells might have a role in lymphatic
metastasis of human cancers (2).
1.1 Blood and lymphatic endothelial cells:
Morphologically, the blood and lymphatic capillaries are quite distinct from each other.
The blood capillaries are made up of a layer of endothelial cells surrounded by a
continuous basement membrane, followed by a layer of smooth-muscle cells/pericytes.
The lymphatic capillaries are also made up of a layer of endothelial cells, but they lack a
continuous basement membrane and pericyte coverage (18). The blood endothelial cells
(BECs) and lymphatic endothelial cells (LECs) express distinct sets of pro-inflammatory
cytokines, chemokines, and receptors, and also distinct cell adhesion molecules and
cytoskeletal proteins. The BECs express ICAM1, Integrin a5, MMP1, IL8 and others.
The LECs exclusively express Integrin a9, Desmoplakin I and II, IL7 and SDF 1b (33).
Endoglin, Neuropilin1 (NRP1), Collagen IV, L- selectin receptor CD34 are used as BEC
markers. Prox1, Podoplanin, LYVE1, VEGFR3, and the chemokine ligand, CCL21, are
used as LEC markers (1). These cell lineage specific markers also help in the
identification and in vitro isolation of BECs and LECs. LECs express Angiopoietin2
(Ang2) which destabilizes the adhesion of mural cells and thus contribute to the
characteristic lack of pericytes in the lymphatic vessels (34). The Prox1 knockout, the
Ang2 knockout and the VEGFR3 knockout defects are embryonic lethal. This
emphasizes the crucial role of these genes in development and maintenance of lymphatic
vessels (9, 12, 42). Prox1 is considered to be the master control gene in specifying the
4
lymphatic endothelial cell fate, as its expression gives the endothelial cells a lymphatic
bias(17). Differentiated BECs, upon infection by Kaposi sarcoma-associated Herpes virus
(KSHV), can undergo reprogramming to become LECs (16). A recent report identified
specific expression of the mesenchyme homeobox gene MEOX1, in BECs and MEOX2
in both BECs and LECs. In addition, expression of the homeobox gene, HOXD10, has
been found in both BECs and LECs. This gene could serve as a repressor of both
angiogenesis and lymphangiogenesis (4).
1.2 Lymphatic vessel Hyaluronan receptor1 (LYVE1) and Hyaluronan (HA):
LYVE1 was first identified based on its homology to CD44 and belongs to the Link
protein superfamily (6). LYVE1 is a transmembrane glycoprotein. It has a characteristic
extracellular HA-binding domain called the “Link” module followed by a membrane-
proximal domain which undergoes glycosylation. Although LYVE1 has a 43% homology
to CD44, the significant homology is highly restricted to the HA binding domain (23).
During embryonic development of the lymphatic system, some of the vein endothelial
cells specifically express LYVE1 and attain a lymphatic competence. Together with
expression of Prox1, the initial lymphatics are then established (30). Although all
embryonic LECs express LYVE1, postnatally, the expression is restricted to lymphatic
capillaries. Hence, it is used as an LEC marker. A recent report has identified the
expression of LYVE1 in normal pancreatic islet cells and suggests a possible role for
LYVE1 in hormone synthesis and secretion (39). This attributes a new possible
functional role for LYVE1. Recent studies on LYVE1 knockout mice reveal that LYVE1
may not be crucial for normal lymphatic development and function although microscopic
morphological and functional alterations are observed in the lymphatic capillaries in
certain tissues (11, 20).
Hyaluronan (HA) is a large mucopolysaccharide made up of N-acetyl D glucosamine and
D glucuronic acid. HA is a major component of the extracellular matrix and connective
tissue. It is also involved in cell migration during embryonic morphogenesis, adult wound
healing, and tumor metastasis. HA undergoes a constant turnover, where by it is initially
released from tissue matrix into afferent lymph and then carried onto lymph nodes for
degradation. The degraded products undergo final hydrolysis in the liver (23-25). HA
binds to both CD44 and LYVE1.

Figure 2: Binding of hyaluronan to CD44: Hyaluronan binds CD44 and activates many pathways that
affect cell growth and survival.

CD44 is the best characterized hyaluronan receptor. Binding of HA to the receptor CD44
leads to transduction of various signaling pathways. Experimental evidence from various
5
6
studies demonstrate that the signaling functions of HA are important in promoting cell
growth and survival in both cancer and non-cancer cells (Fig. 2). HA has also been
shown to be a chemoattractant source for directional migration of tumor cells and
infiltrating angiogenic endothelial cells. All these effects are cell type specific and also
dependent on hyaluronan size (35, 40).
1.3 Notch signaling:
First identified in Drosophila for its dominant mutant wing-Notching phenotype, the
Notch signaling pathway is highly conserved in a broad array of organisms from insects
and nematodes to mammals. Mammals have four Notch

proteins (Notch 1–4)

that are
membrane-bound type I receptors. They have a large extracellular domain

involved in
ligand binding, a single-pass

transmembrane domain, and a cytoplasmic domain involved

in signal transduction. There are two families of mammalian Notch

ligands, the Delta like
ligands (1, 3 and 4) and Jagged ligands (1 and 2). These ligands are also membrane-
bound and hence require direct cell-cell interactions. On interaction with its ligand, Notch
undergoes two steps of proteolytic cleavage.
The first cleavage is catalysed by ADAM-family metalloproteases, and then the γ-
secretase enzyme cleaves and releases the Notch intracellular domain (NICD) which then
translocates to the nucleus. Once inside the nucleus, NICD cooperates with the DNA-
binding protein CSL( called RBP-JK in mice) and its coactivator Mastermind (Mam) to
promote transcription(8). To date, only a few target genes have been identified. These
include members of the basic helix-loop-helix

(bHLH) hairy/enhancer of split (Hes)
family, Hes-related repressor protein transcription factor family (Hey), the cell cycle
regulator p21, the Notch pathway element

Notch-regulated ankyrin repeat protein
(Nrarp), deltex1,

and the pre-T cell receptor- gene.

Figure 3: Notch signaling pathway. Upon interaction with its ligand the Notch receptor undergoes
proteolytic cleavage, and the cleaved Notch (NICD) enters nucleus. NICD binds to DNA through RBP-JK
and activates its target genes. Figure modified from (21)

The notch pathway regulates diverse developmental and physiological processes. Some
key roles are in establishing arterial/venal identity, bone regeneration, pancreas
development, cardiac valve homeostasis and cancer (7). Notch1 and Notch4 expression
has been demonstrated in LECs. VEGFR3 has been identified as a direct target of Notch
in LECs, and Notch signaling may have a crucial role in physiological and tumor
lymphangiogenesis (37).
7
1.4 Notch activation of LYVE1:
In our recent study on the effects of Notch overexpression in LECs, we found that
LYVE1 protein levels were significantly upregulated. This is a significant finding, as
LYVE1 is an LEC marker, and it enables the establishment of lymphatic competence
during the development of embryonic lymphatics (30). In relation to our finding, a very
recent report has demonstrated that Notch activates VEGFR3, a lymphatic marker, and
suggests a role for Notch in tumor lymphangiogenesis (37). HA is a major component of
the extracellular matrix and forms a substratum for the movement of cells. Previous work
from various labs has shown that HA binds to CD44 and brings about change in cell
growth and survival. HA has been demonstrated to be chemotactic and angiogenic.
Studies have shown that HA plays role in tumor cell growth, survival and migration (40).
LYVE1, a homologue of CD44, is also a receptor for HA. Prevo et al demonstrated that
mouse LYVE1 binds and internalizes hyaluronan (36).

Figure 4: Notch binds and activates LYVE1 promoter: we hypothesize that notch binds to LYVE1
promoter. Hyaluronan, HA binds to LYVE1 and affects cell proliferation and migration
8
9
Studies on HA treated tumors show that HA promoted tumor lymphangiogenesis and
intralymphatic tumor growth (14). Based on all of the above findings, we hypothesized
that LYVE1 is a direct downstream target of Notch1 and the inhibition of Notch could
affect the expression pattern of LYVE1 and the responsiveness of LYVE1 to its ligand
Hyaluronan, HA (Fig. 4).
The specific aims of this study are:
1. To study Notch activation of LYVE1
• Notch activation of LYVE1 at transcriptional and translational level
• Cell specificity
• Effect of Notch inhibitors on LYVE1 expression
• Effect on cell proliferation and migration

2. To study the role of HA in LYVE1-Notch interaction
• Effect of HA on LYVE1 expression in LECs treated with Notch inhibitors
• Effect of HA on cell proliferation and migration

10
Chapter 2: Experimental Plan
To begin with, we performed a real-time RT-PCR assay to determine the effect of the
change in LYVE1 mRNA levels due to Notch overexpression. We found that Notch1
significantly upregulated LYVE1 mRNA levels. This effect was cell type-specific, as we
detected the activation only in LECs and BECs. In other cell lines, (293T, HeLa, Cos7,
CV1, PY4-1, HMECs and HDMVECs), we either did not detect LYVE1 expression or no
upregulation was seen. Next, to study the effect of Notch inhibitors, we treated LECs
with gamma-secretase inhibitor DAPT or soluble and found that LYVE1 mRNA levels
were significantly downregulated. On treating with the soluble Notch ligand Jagged1, we
observed a decrease in LYVE1 mRNA levels. We also tested the change in LYVE1
expression in LECs treated with Notch inhibitors and HA by immunostaining. We
performed immunostaining to detect the binding of HA to LYVE1 in LECs treated with
notch inhibitors. Next, we tested the effect of DAPT treatment and Notch overexpression
on the proliferation of LECs. Finally, we studied the effect of HA on the migration of
DAPT/Jagged treated LECs by scratch assay.

11
Chapter 3: Material and Methods
3.1 Materials:
The γ-secretase inhibitor DAPT was purchased from Sigma-Aldrich, St. Louis, MO and
was then dissolved in DMSO at 20mM (stock solution). The Notch ligand Jagged1 was
purchased from R&D systems, Minneapolis, MN. Jagged1 was dissolved in 1XPBS at
200μg/ml (stock solution). Biotin labeled HA and unlabeled HA was obtained from
Sigma-Aldrich, St. Louis, MO and were dissolved in PBS at a concentration of 1mg/ml.
The WST-1 cell proliferation assay reagent was purchased from Takara Bio USA,
Madison, WI.
3.2 Antibodies:
Rabbit polyclonal anti-LYVE1 was purchased from Abcam Inc, Cambridge, MA. Mouse
monoclonal mouse anti-human CD31 was purchased from DAKO, Denmark. The
Streptavidin-FITC conjugate was obtained from SouthernBiotech, Bridgeport, NJ.
3.3 Cell lines and culture conditions:
Primary human dermal lymphatic endothelial cells (LECs) were isolated from neonatal
human foreskins as previously described (15). LECs, HMEC, and HDMVEC were
cultured in Endothelial cell basal medium (EBM) supplemented with 10% fetal bovine
serum (FBS), 100U/ml penicillin G, 100ug/ml streptomycin and 0.25 μg/ml amphotericin
B, 2mM L-Glutamine (Invitrogen, Carlsbad, CA), 1mg/ml Hydrocortisone and 25mg/ml
cyclic AMP (Sigma-Aldrich, St. Louis, MO). BECs were cultured in the same medium as
LECs but with 20% FBS. HEK293, HeLa, Cos7, CV1,PY4-1 were cultured in Dulbeco’s
modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS),
100U/ml penicillin G, 100ug/ml streptomycin and 0.25 μg/ml amphotericin B (Invitrogen,
12
Carlsbad, CA). NIH3T3 cells were cultured in HEK293 medium with additional
500ng/ml Doxycycline (Sigma-Aldrich, St. Louis, MO).
3.4 Transfections:
HEK293, HeLa, Cos7, CV1, PY4-1, HMEC were transiently transfected using
Lipofectamine (Invitrogen, Carlsbad, CA). NIH3T3 cells were transfected using PEI
(Sigma-Aldrich, St. Louis, MO). The ratio of DNA to transfection reagent was in general
1:3 ( μg: μl). LECs, BECs, HDMVEC were transfected using nucleofection device
(Amaxa Biosystems, Koeln, Germany) as per the manufacturer’s instructions.
3.5 Luciferase assay:
Cells were plated in 48-well or 96-well plates at 70-80% confluency. The next day, cells
were transfected with either PEI or Lipofectamine. For either method, DNA and the
transfection reagent were incubated separately in cell culture medium for 5minutes and
then mixed together gently and incubated for 20minutes. The DNA: transfection reagent
solution was then added to wells. After 48hours, cells were washed with 1XPBS. The
cells were lysed by freezing the plate for 1hour at -80’C and then thawing at room
temperature. The freeze-thaw cycle was repeated again to ensure that cells were
completely lysed. Then, Bright-glo
TM
reagent (Promega Biosciences, San Luis Obispo,
CA) was added and luminescence was measured immediately by chameleon (Bioscan
Inc, WA)
3.6 PCR and Real- time RT-PCR:
Human BAC clones of LYVE1 promoter and gene were purchased from Invitrogen and
were used as the source to make luciferase constructs of LYVE1 promoter. Three sets of
specific primers were used. PCR reactions were performed for 40 cycles under the
13
following conditions: denaturation at 94’C for 15seconds; annealing at 50’C or 55’C for
15seconds; extension at 72’C for 3minutes. The PCR products were run in 1% agarose
gels and photodocumented.
Real-time RT-PCR assays were performed as previously described (17). The ABI prism
7000 sequence detection system was used to perform dual-labeled probe based real- time
RT-PCR reactions. Total RNAs were isolated using Tri-reagent (Sigma-Aldrich, St.
Louis, MO) and were treated with RNase-free RQ-DNAse (Promega, Madison, WI)
before analysis. Twenty to 100ng of total RNA were used for each reaction. Primers and
probes were purchased from Integrated DNA Technologies (Coralville, IA) and their
sequences are: LYVE1 (AGCTATGGCTGGGTTGGAGA,
CCCCATTTTTCCCACACTTG, FAM-TTCGTGGTCATCTCTAGGATTAGCCCAAA
CC-TAMRA), NOTCH1 (TCTGCCGACGCACAAGGT, CGTCGTGCCATCATGCAT,
FAM-CTGATCCGGAACCGAGCCACAGA-Blackhole),HEY (TGACCGTGGATCA
CCTGAAA, GCGTGCGCGTCAAAGTAAC,FAM-TGCTGCATACGGCAGGAGGGA
AA-TAMRA) Podoplanin (AGGCGGCGTTGCCAT, GTCTTCGCTGGTTCCTGGAG,
FAM-CCAGGTGCCGAAGATGATGTGGTG-TAMRA) and β-actin (TCACCGAGC
GCGGCT, TAATGTCACGCACGATTTCCC, JOE-CAGCTTCACCACCACGGCCG
AG-TAMRA). Probes labeled with FAM and TAMRA/Blackhole were multiplexed with
β-actin primers and probe labeled with JOE and TAMRA, as an internal control. TaqMan
EZ RT-PCR core reagent was used for dual-labeled probe based reactions.
3.7 Site directed mutagenesis:
The RBP-JK binding site TGGGAA in the luciferase construct was mutated to an
ECORV site by using the QuickchangeII site directed mutagenesis kit (Stratagene, La
14
Jolla, CA). For this, two mutation primers, 5’GGGGGAGGAGGAACAGCA
GGGAATAGATATCTTGGGAG AACCTTTAGCAG3’ and 3’CCCCCTCCTCCT
TGTCGTCCCTTATCTATAGAACCCTCTTGGAAATCGTC5’ were designed and
purchased from Integrated DNA technologies, Coralville, CA. Site directed mutagenesis
was performed as per the manufacturer’s protocol.
3.8 Immunofluorescence staining:
LECs were grown on fibronectin (10 μg/ml)- coated microscope cover slips. The cover
slips were then transferred to a 12-well plate to process them for staining. Cells were
treated with DMSO (0.01%) or DAPT (5 μM) or Jagged1 (2 μg/ml) for 24hours and then
replaced with complete medium with or without HA (10 μg/ml) for 24hours. The cover
slips were then washed with 1XPBS and fixed with 4% Paraformaldehyde for 20 minutes
at room temperature. They were then washed thrice with 1XPBS for 10 minutes. Cells
were permeabilized using 0.2% Triton-X in PBS for 10minutes at room temperature.
Then, cells were blocked with 0.5% BSA/goat serum in 1XPBS for 1 hour at room
temperature and followed by incubation with primary antibody overnight at 4’C. LYVE1,
CD31 were used at 1:1000 dilution in blocking solution. The next day, cover slips were
washed thrice with 1XPBS for 10minutes followed by incubation with secondary
antibodies for 1hour at room temperature. During this period, the plate was kept covered
in aluminum foil to prevent light exposure. All the secondary fluorescent antibodies
(donkey anti-rabbit, donkey anti-mouse) were used at 1:5000 dilution in blocking
solution. This was followed by a washing step with 1XPBS for 10minutes. The washing
step was repeated thrice. Then after washing with distilled water for 5seconds, the cover
slips were mounted on to glass slides using VectorShield fluorescence mounting medium
15
(Vector laboratories Inc, Burlingame, CA). This mounting medium has DAPI to stain
nuclei. Photographs were taken at 63X using ZEISS fluorescence microscope.
For the experiments with biotin labeled HA, the primary antibody rabbit polyclonal anti-
LYVE1 was used at 1:200 in blocking solution. Streptavidin-FITC (1:500) conjugate and
donkey anti-rabbit (1:1000) was used for detection.
3.9 WST-1 cell proliferation assay:
Proliferation of LECs was measured using the WST-1 cell proliferation assay (22, 26,
29). LECs were seeded at a density of 2 x10
4
cells/100 μl into 96-well plates. Cells were
treated with DMSO (0.01%) or DAPT (5 μM) or Jagged1(2 μg/ml) for 24hours and then
replaced with complete medium with or without HA(10 μg/ml) for 24hours. After 48
hours of incubation, cell proliferation was measured using the premix WST-1 cell assay
system. 10ul of the premix was added to wells and incubated at 37’C for 3 hours.
Absorbance was measured every hour using a microplate reader at 450nm using the
chameleon (Bioscan Inc, WA).
3.10 Endothelial cell Migration assay:
The endothelial cell migration activity was measured by scratch assay (27, 31, 32). LECs
were grown on 6-well plates. When the cells were 95% confluent, DMSO (0.01%) or
DAPT (5 μM) or Jagged1 (2 μg/ml) was added and allowed to remain in contact with cells
for 24hrs. After the treatment period, HA was added at (10ug/ml) to the medium. A 1mm
wide scratch was made with a 200ul tip across the width of the well. Photographs of the
well were taken with a phase contrast microscope (10X) at 0, 24, and 48 hours after
scraping.

16
Chapter 4: Results
4.1 Notch activates LYVE1 at transcriptional level and is cell specific

Adenoviral expression of the Notch1 intracellular domain (NICD) in LECs upregulated
LYVE1 mRNA levels by almost 7-folds (Fig.5A) and in BECs by almost 2.5- folds (Fig.
5B). On binding its ligand, the Notch receptor undergoes proteolytic cleavage and
releases the NICD, which then enters the nucleus and binds DNA through the DNA
binding protein RBP-JK. To show that Notch activates LYVE1 via RBP-JK, we used a
wild-type and a dominant negative form of RBP-JK together with Notch to check if there
is any modulation of LYVE1 mRNA levels (Fig. 5C). In this experiment, LECs were
nucleofected with NICD expression plasmid alone or together with the wild-type or
dominant negative RBP-JK. Nucleofection did not always result in upregulation of Notch
levels. However, high Notch expression produced a corresponding increase in LYVE1
levels. HEY1, a known target gene was used as a positive control. Notch overexpression
resulted in an increase in HEY1 expression levels, and this increase is comparable to the
effect of notch overexpression on LYVE1.

Figure 5: Notch activation of LYVE1 in LECs and BEC: A and B) Total RNA from Adenovirus-
control or Adenovirus-NICD infected LECs or BECs were treated with DNAse and then a real-time RT-
PCR was performed to check Notch1 and LYVE1 mRNA. C) LECs were nucleofected with Notch alone or
with wild-type /dominant negative mutant RBP-JK. Total RNA was isolated, treated with DNAse and real-
time RT-PCR was performed to check Notch1, LYVE1 and HEY1 mRNA.

We checked the endogenous Notch and LYVE1 expression of various commonly used
cell lines like HEK293T, HeLa, Cos7, CV1, NIH3T3, PY4-1, Human Microvascular
Endothelial cells (HMEC-1) and PY4-1. We found that while the HEK293T and HeLa
cell lines expressed very low levels of LYVE1, Cos7 and CV1 did not express LYVE1.
17
When we transfected these cell lines with NICD expression plasmid there was no change
in LYVE1 levels (Fig. 6).

Figure 6: Notch activation of LYVE1 in HEK293T, HeLa, CV1 and COS7 cell lines. A-D) Each cell
line was cultured in their appropriate growth medium and transfected with NICD expression plasmid or
control plasmid. Total RNA was isolated, DNAse treated and a real-time RT-PCR was performed to check
Notch1, LYVE1 mRNA.

18
The mouse endothelial cell line PY4-1 expressed LYVE1 but overexpression of NICD
did not increase LYVE1 mRNA levels (Fig. 7A). The mouse fibroblast cell line NIH3T3
did not express LYVE1 (Fig. 7B). The human microvascular endothelial cell line,
HMEC-1, was cultured on fibronectin (1 μg/ml) coated dishes. These cells expressed
LYVE1. When Notch was overexpressed, there was a significant upregulation of LYVE1
mRNA levels (Fig. 7C). To determine whether and that this activation is mediated by
RBP-JK, we transfected wild-type RBP-JK together with Notch but there was no effect
on LYVE1 levels. The dominant negative form decreased LYVE1 levels but this effect
was inconsistent in the subsequent experiments (Fig. 5D).

Figure 7: Notch activation of LYVE1 in PY4-1, NIH3T3 and HMEC-1. A-C) Each cell line was
cultured in their appropriate growth medium and transfected with NICD expression plasmid or control
plasmid. Total RNA was isolated, DNAse treated and a real-time RT-PCR was performed to check Notch1,
LYVE1 mRNA.

Moreover, LYVE1 activation by Notch alone was also not reproducible. The positive
control HEY1 showed only a 2 fold upregulation by Notch and RBP-JK did not affect
HEY1 levels.

19
4.2 Notch activation of LYVE1 is mediated by RBP-JK.
To determine whether LYVE1 is a direct target of Notch, we analyzed the LYVE1
promoter. We found that LYVE1 promoter has an RBP-JK binding site about 1.5kb
upstream of transcription start site.

Figure 8: PCR amplification of LYVE1 promoter region. Human BAC clones of LYVE1 promoter and
gene was used to PCR amplify 2-3kb region upstream of start site. Different sets of primers were used to
obtain different sizes of products. The PCR product was then subsequently used to make luciferase
constructs.

We used Human BAC clones of LYVE1 promoter and gene to amplify the required
region. We performed 36 reactions using 3 set of primers, 2 different BAC clones and
two different annealing temperatures (Fig. 8). The PCR products were subsequently used
to make the luciferase constructs SG2, SG3 and SG4. SG2 is the largest fragment of 2.8
kb and has an RBP-JK binding site. SG3 is the smallest fragment of 1.2 kb and lacks the
RBP-JK site. SG4 has a 1.8 kb fragment with the RBP-JK site.
20
The luciferase assay was carried out using the constructs SG2, SG3 and SG4. HEY1 was
used as positive control. Empty luciferase vector pGL3 was used as background control.
When NICD was transfected together with HEY1 or other LYVE1 constructs, there was a
significant increase in luciferase activity compared to the control (Fig 9A).

Figure 7: Luciferase assay to determine whether LYVE1 is direct target of Notch and if RBP-JK can
bind to LYVE1 promoter. A-B) 293T cells were grown in 96-well plate. Luciferase constructs SG2, SG3,
SG4, SG9 of LYVE1 promoter were transfected using Lipofectamine2000
TM
.

After 48hours, Bright glo
reagent was added and the luminescence was measured. In A, Notch upregulated luciferase activity. B, in
subsequent experiments we did not see upregulation. C-D) luciferase assay in Cos7 and CV1 cells. Notch
did not activate LYVE1.

SG3 also showed activity even without the RBP-JK site. Therefore, we examined the
sequence and found a second RBP-JK site that was not previously identified. We
designed mutation primers to mutate the RBP-JK site into an ECOR-V recognition site.
21
Site directed mutagenesis was performed as per Stratagene’s quick change II kit protocol.
The mutated plasmid was then used for luciferase assay. We did not get consistent
positive results with the luciferase assays (Fig. 9B). Therefore, we performed the
luciferase assay using two other cell lines, CV1 and Cos7 (Fig. 9C-D). We did not
observe any luciferase activity with the LYVE1 constructs although the HEY1 positive
control worked as expected.
4.3 Notch inhibitor DAPT and soluble ligand Jagged1 reduces LYVE1 mRNA

Notch inhibitor reduces LYVE1 mRNA levels in LEC
154
104
79
106
79 78
27
39
90
27
39
97
29
45
82
0
20
40
60
80
100
120
140
160
180
LYVE1 HEY1 PODOPLANIN
Relative gene expression
NO TREAT
DMSO
DAPT
JAGGED1 FC
DAPT + JAGGED1 FC

Figure 10: Notch inhibitor reduces LYVE1 mRNA levels. Gamma secretase inhibitor DAPT reduced
LYVE1 and HEY1 mRNA levels. Notch ligand Jagged1 in soluble form repressed LYVE1 and HEY1.
Podoplanin levels remained unaffected

Notch is a cell surface receptor. It undergoes proteolytic cleavage by gamma secretase,
releasing the NICD domain, which can now enter the nucleus. N-[N-(3,5-
difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester, DAPT inhibits gamma
secretase and is commonly used to inhibit Notch signaling (5, 13). LECs (Passage 5)
were grown in fibronectin-coated dishes. DMSO (0.01%) or DAPT (5 μM) or Jagged1
22
23
(2 μg/ml) or both were added and treated for 24hrs. Cells were then harvested and total
RNA was isolated. After DNAse treatment, a real-time RT-PCR was performed to
measure LYVE1, HEY1 and podoplanin (Fig. 10). HEY1 was used as positive control.
Podoplanin was used as negative control. DAPT reduced levels of both LYVE1 and
HEY1. The Notch ligand Jagged1 when added in soluble form did not activate LYVE1 or
the positive control HEY1; reduced it reduced both. When DAPT and Jagged1 were used
together we did not observe a synergistic repression of HEY1 or LYVE1.
4.4 Effect of Notch inhibitors and Hyaluronan on LYVE1 expression in LECs

Next, we investigated whether DAPT and Jagged1 affected LYVE1 protein expression
levels. LECs were grown on fibronectin-coated coverslips and treated with DAPT or
Jagged for 24hours followed by treatment with (Fig. 11E-H) or without HA (Fig. 11A-D)
for 24hours. The coverslips were then processed for immunofluorescence staining as
described. For this particular experiment, LYVE1 was stained in green and CD31 was
stained in red. CD31 or PECAM1 (Platelet-endothelial cell adhesion molecule1) is a pan
endothelial marker and so serves as a control. DAPT (Fig. 11C) and Jagged1 treatment
(Fig. 11D) resulted in a very small reduction in LYVE1 expression levels when compared
to the controls (Fig. 11A and B). Treatment with HA did not produce any change in
LYVE1 staining pattern. Figure 11G does not show the expected LYVE1 staining
pattern, possibly due to no-specific background effects.

Figure 11: Effect of DAPT, Jagged and HA on LYVE1 expression in LECs. LYVE1 is stained green
and CD31 red. A) Control cells. No treatment with DAPT/JAG/HA. B) DMSO treated cells, no HA
treatment. C) DAPT treated cells, no HA treatment. D) Soluble Jagged1 FC treated cells no HA treatment.
E) Control cells treated with HA alone. F) DMSO and HA treatment G) DAPT and HA treatment. H)
Jagged1 FC and HA treatment.

24
4.5 Effect of Notch inhibitors on the binding of Hyaluronan to LYVE1
We next asked whether treatment of LECs with DAPT/Jagged1 can affect the binding of
HA to LYVE1. To answer this question, we grew LECs on fibronectin coated coverslips.
After 24hour treatment with DAPT or Jagged, biotin labeled HA was added to the cells.
HA treatment was carried out for 24hours. We performed Immunofluorescence staining
on these cells to determine whether if LYVE1 protein expression was downregulated
upon treatment with DAPT or Jagged1.

Figure 12: Effect of DAPT and JAGGED1 on HA binding. HA is a ligand of LYVE1. To check if
DAPT and Jagged1 can reduce LYVE1 protein levels and hence HA binding, we treated LECs with
DMSO(B) or DAPT(C) or Jagged1 FC(D). LEC without any treatment was used as control (A). Green
staining is for Biotin labeled HA and Red staining is for LYVE1. Blue is DAPI for nucleus. Images were
taken at 63X oil ZEISS fluorescent microscope.

25
The streptavidin-FITC conjugate was used to stain for biotin labeled HA. HA was thus
labeled in green (Fig. 12) and LYVE1 stained in red. The results show that LYVE1
expression is significantly reduced in DAPT or Jagged treated cells but HA staining
remained unaffected.

4.6 Effect of Notch inhibitors and HA on LEC proliferation.

Next, we wished to determine whether the Notch inhibitor DAPT and soluble ligand
Jagged1 could affect the cell properties such as cell proliferation and migration. Also, we
wanted to determine whether HA can also influence these properties of LECs.
For the cell proliferation assay, cells were plated into a 96-well plate and treated with
DMSO (0.01%) or DAPT (5 μM) or Jagged1 (2 μg/ml) for 24 hours, and then HA was
added at 10 μg/ml and cells were treated with this for 24hrs.
EFFECT OF NOTCH INHIBITORS AND HYALURONAN ON LEC
PROLIFERATION
0.56
0.73
0.52
0.67
0.70
0.60
0.67
0.61
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
0.80
0.90
LEC TREATED WITH DAPT/JAGGED1 WITH/WO HA
ABSORBANCE A450nm
NO TREATMENT
NO TREATMENT + HA
DMSO
DMSO + HA
DAPT
DAPT + HA
JAGGED1
JAGGED1 + HA

Figure 13: Effect of Notch inhibitor DAPT, soluble ligand Jagged1 and LYVE1 ligand HA on LEC
proliferation. Cells were plated in a 96-well plate and treated with DAPT or Jagged1 for 24hours. Cells
were then treated with or without HA for another 24hours. Cell proliferation was evaluated using WST-1
reagent. Absorbance was measured at 450nm. Graph is representative of the absorbance after 2hour
incubation with WST-1 reagent. No significant difference in LEC proliferation on treatment with inhibitors
or with HA.
26
27

After the treatment period, cell proliferation was measured by the WST-1 cell
proliferation assay. The WST-1 premix reagent was added to wells and incubated for
3hours at 37’C. Absorbance was measured every hour at 450 nm. Graph was drawn of
the absorbance measured at 2 hours after the addition of the reagent (Fig. 13). The
inhibitor DAPT, the Notch ligand Jagged1 and the LYVE1 ligand, HA, did not affect
proliferation of LECs.
4.7 Effect of Notch Inhibitors and HA on LEC migration

To evaluate the effect of DAPT, Jagged1 and HA on migration of LECs, scratch assay
was performed. LECs were plated in 6-well plates at high density. On the next day, the
cells were treated with DMSO (0.01%) or DAPT (5 μM) or Jagged1 (2 μg/ml) for 24 hours
and then the cells were treated with HA (10μg/ml) for 24 hrs. The time point of addition
of HA was taken as “0 hours” and a scratch was made in each of the wells (Fig. 13A).
Photographs were taken at 0, 24 and 48 hours. At 24 hours after the scratch, the control
and DMSO treated cells had migrated across the scratch completely in the presence or
absence of HA (Fig. 13D). DAPT and Jagged1 treated cells completely migrated in the
absence of HA. In the presence of HA, at 24 hours the DAPT treated (Fig.13B) and
Jagged1 treated cells (Fig.13C) migrated slowly. At 48 hours they had also completely
migrated.

Figure 14: Endothelial cell migration assay for DAPT/JAGGED1/HA treated LECs. A) Scratch made
at zero hours in the 6-well plate. B) DAPT treated cells in the presence HA at 24hours. Migration was slow
compared to control or DMSO cells in the presence or absence of HA. C) Jagged1 treated cells migrated
slowly in the presence of HA. Picture was taken at 24hours. D) A closed scratch due to complete migration
of LECs at 48hours.

28
29
Chapter 5: Discussion:
The lymphatic system maintains tissue homeostasis, drains lymph fluid and transports
immune cells (18). Despite these functions, the lymphatic system has been long neglected
as a target for experimental study. However, the identification of new lymphatic-specific
molecular markers and emerging evidence implicating the lymphatic system in tumor
dissemination has resulted in an increased focus on lymphatic research. The current
accepted model for the development of the lymphatic system involves an array of genes
required for the step-wise development and maturation of initial lymphatics. Among
these is the cell surface receptor Lymphatic vessel hyaluronan receptor LYVE1, whose
expression in the embryonic vein endothelial cells confers lymphatic competency (18).
LYVE1 was first identified based on its homology to CD44. Hyaluronan (HA) is the
ligand for both LYVE1 and CD44 (24).
Notch signaling represents one of the fundamental signaling pathways and plays a variety
of roles from general metazoan development to pathological conditions such as cancer
(7). Notch is highly expressed in arteries but not veins. The role of Notch in the
lymphatic system is not yet clear. We are interested in determining the role of notch
signaling in the maintenance of the lymphatic phenotype. We have demonstrated that
Notch can activate LYVE1 expression. This finding is very interesting because notch is
specific to the blood vascular system and LYVE1 is specific to lymphatics. We therefore
would like to determine the effects of this activation on various aspects of cell behavior.
We hypothesized that LYVE1 is a direct downstream target of Notch1 and that the
inhibition of Notch could affect the expression pattern of LYVE1 and the responsiveness
to its ligand, Hyaluronan. We first identified the Notch activation of LYVE1 in LECs.
30
We also found that not only LECs, but also BECs, expressed LYVE1 but at low levels
and Notch activated LYVE1 in both of these primary cell lines (Fig. 5). We wished to
determine whether this effect was specific to LECs or could be observed in other
LYVE1-expressing cells. So, we tested endogenous LYVE1 activity in some commonly
used cell lines like HEK 293T, HeLa, COS7, CV1, NIH3T3, PY4-1, HMEC-1 (Fig. 6 and
7). We performed individual real-time RT-PCR analysis of all these cell lines and found
that, excepting HMEC1, they showed little or no LYVE1 expression. HMEC1 expressed
LYVE1 and on Ectopic expression of the Notch intracellular domain (NICD), LYVE1
levels were significantly upregulated. However, these results were not consistent in
subsequent experiments. This shows that Notch activation of LYVE1 is specific to the
blood vascular and the lymphatic endothelial cells.
The receptor Notch and its ligand are membrane bound. On interaction with its ligand,
Notch undergoes proteolytic cleavage to release NICD which enter nucleus and binds to
DNA through RBP-JK. To determine whether LYVE1 is a direct target of NOTCH, we
studied the LYVE1 promoter for putative RBP-JK binding sites. Initially we found an
RBP-JK binding site of about 1.5kb upstream of transcription start site. We then made
luciferase constructs by amplifying this specific region from human BAC clones of
LYVE1 gene and promoter using various specific primers and PCR conditions (Fig. 8).
We successfully made three clones SG2, SG3 and SG4. Of these, only SG3 does not have
the RBP-JK binding site. We performed luciferase assays with these constructs using
HEY1 as positive control and the empty luciferase vector pGL3 as negative control. We
found that Notch activated the constructs SG2, SG4 as well as SG3 (Fig. 9). Based on
these results, it appeared that SG3 may also contain an RBP-JK binding site. Further
31
analysis of the LYVE1 promoter revealed that this was indeed the case. We then
designed mutagenic primers and performed Stratagene’s quick change II method for site
directed mutagenesis of this new RBP-JK binding site. Subsequent experiments with
these constructs did not yield consistent positive results. We suggest that this may be due
to the interference of endogenous LYVE1 expression, though 293T cells that were used
for these luciferase assays expressed very low basal levels of LYVE1 (Fig. 6). From the
real-time RT-PCR experiments we could not detect any LYVE1 expression in cos7 and
cv-1 cells (Fig. 6), so we performed luciferase assay in these cell lines but we did not
observe any activation of the LYVE1 promoter although the HEY1 control showed
luciferase activity (Fig. 9). The constructs used for the luciferase assay all contain only 1-
2kb of the LYVE1 promoter. It is possible that this minimal region may lack upstream
enhancer or regulatory sequences required to recapitulate endogenous expression. In
addition, LYVE1 activation by Notch has been observed only in endothelial cells,
suggesting this activation is cell-type specific. In our future work we would like to
identify the regulatory mechanisms underlying this endothelial cell specificity.
Next, we wanted to determine whether LYVE1 is a target of Notch by using the Notch
inhibitor, DAPT, as well as the NOTCH ligand, JAGGED1 FC. We treated LECs with
either DAPT or Jagged or both and performed real-time RT PCR using RNA isolated
from these cells (Fig. 10). As expected, the gamma-secretase inhibitor, DAPT, reduced
LYVE1 mRNA levels. Unexpectedly, rather than resulting in an increase in LYVE1
mRNA levels, treatment with Jagged1-FC actually appeared to repress the expression of
LYVE1. This finding suggests that, in this case, Jagged1 appears to be inhibiting, rather
than activating Notch signaling. These results may be partially explained by the fact that
32
we made use of a soluble form of Jagged1 rather than the immobilized form. This idea
that soluble ligand may actually serve to inhibit Notch signaling is supported by
previously published work (28, 41) wherein the soluble ligand is thought to compete with
the membrane bound form for binding to the Notch receptor.
Next, we determined whether the inhibition of LYVE1 mRNA levels by DAPT or
Jagged1 was reflected in LYVE1 protein expression. To test this, we performed
immunofluorescence staining for LYVE1 and CD31 using LECs in the presence of
DMSO or DAPT or JAGGED1 (Fig. 11 A-D). LYVE1 was stained in green and CD31 in
red. DAPT or Jagged1 treated cells showed lesser LYVE1 staining compared to DMSO
treated or untreated cells. Therefore, inhibition of Notch by DAPT or soluble Jagged1
affects the LYVE1 expression at both the mRNA and protein levels.
Hyaluronan is a ligand of LYVE1. We wanted to examine the possibility that the
presence of the ligand could influence the expression of the receptor. Cells were grown
on coverslips and were first treated with inhibitors for 24 hrs followed by additional
incubation of 24 hours with HA. We found that presence of HA did not affect the
expression pattern of LYVE1 and it could not rescue the decreased expression of LYVE1
due to treatment with Notch inhibitors (Fig. 11 E-H).
To evaluate the possibility that treatment of LECs with Notch inhibitors can affect the
HA binding, we treated LECs with Notch inhibitors for 24 hours and then incubated them
with biotin labeled HA for another 24 hours. For visualization, we used streptavidin-
FITC conjugate to stain HA. LYVE1 was stained in red. Figure 12 shows binding of
labeled HA to cell and nuclear membranes. Moreover, the intensity of HA staining seems
to be the same in all conditions tested although DAPT/JAGGED treatment reduced
33
LYVE1 levels. In both control LECs and DMSO treated LECs (Fig. 12A&B), LYVE1 is
expressed at high levels and we expected to observe colocalization of HA and LYVE1.
However no colocalization was seen. We suggest that LECs may synthesize high levels
of HA and therefore the receptor is already completely bound to endogenous ligand. In
addition, a recent report by Banerji et al(6) indicates that the binding affinity of LYVE1
for biotin-HA reduced with increasing degrees pf biotinylation. This finding may also
account for the observed results. Therefore, at present it is not possible to conclude
whether treatment with notch inhibitors affects HA binding as no colocalization of
LYVE1 and HA was observed before and after treatment.
While the macromolecular hyaluronan promotes tumor cell growth and invasion, the
hyaluronidase generated hyaluronan oligosaccharides promote tumor angiogenesis.
Experimental evidence from other groups has shown that HA-CD44 interaction promotes
tumor cell growth, migration and metastasis (10). LECs express LYVE1, which is a
CD44 homologue and interacts with HA. So we asked if HA-LYVE1 interaction would
affect LEC proliferation and migration in the context of notch inhibition. For the
proliferation assay, cells were plated in 96-well plate and treated with inhibitors for
24hours and then HA was added and incubated for another 24hours. At the end of
48hours, the WST-1 premix reagent was added to the wells and incubated at 37’c for 3
hours. Absorbance was measured at 450nm at every hour. Graph was drawn with the
absorbance measured after 2hour incubation. In general the results show that neither the
inhibitors nor the ligand HA affected the LEC proliferation (Fig.13).
To determine whether the migration of LECs in the presence of notch inhibitors and
LYVE1 ligand, a scratch assay was performed as described in the materials and methods.
34
Pictures were taken at 0, 24 and 48 hours after scratch was made. At 24 hours, the DAPT
or Jagged treated LECs, in the presence of HA had migrated slowly (Fig.12 B-C). Under
all other treatment conditions, the cells exhibited complete migration. At 48 hours even
the DAPT or Jagged treated LECs with addition of HA had completely migrated (Fig 14
D). It is interesting to note that both HA and Notch inhibitors appear to decrease the
migration of LECs. This observed effect is not due to addition of notch inhibitors as the
cells showed complete migration when treated with DAPT or JAGGED1 in the absence
of HA. It is also not due to addition of HA as the control or DMSO treated cells, in the
presence or absence of HA had completely migrated in 24hours. Moreover the observed
effect is not due to change in cell proliferation as LECs treated with both HA and notch
inhibitor showed the same rate of proliferation as the untreated cells. These findings raise
several important questions. In particular, can the ligand exhibit an inhibitory function
when the LYVE1 receptor is downregulated due to inhibition of Notch signaling?
We would like to further investigate the interplay between Notch and LYVE1 using
several approaches. Firstly, we will generate LYVE1 promoter constructs incorporating
larger regions of the promoter that may be required for complete activation of the gene.
Secondly, we would like to optimize our LEC transfection methods to ensure optimal
delivery of genes. Thirdly, we will make use of transwell endothelial cell migration
assays to further assess the effect of Notch inhibitors and HA on LEC migration. Lastly,
we will determine the effect of Notch overexpression on LEC proliferation and migration
in the presence of HA.

35
Conclusion
By ectopically expressing Notch and by using Notch inhibitors we have provided
evidence that Notch activates LYVE1 at the transcriptional and translational levels. We
have evaluated the endogenous levels of LYVE1 in various cell lines. We have identified
potential RBP-JK binding sites in LYVE1 promoter. We have shown that the soluble
form of notch ligand Jagged1 appears to exert an inhibitory action on notch signaling. In
accordance with studies from other groups, we were not able to show the colocalization
of HA and LYVE1 in LECs. We found that Notch inhibitors and HA do not affect LEC
proliferation. Finally, we suggest that HA might exert an inhibitory action on cell
migration when LYVE1 is downregulated.

36
Bibliography

1. Adams, R. H., and K. Alitalo. 2007. Molecular regulation of angiogenesis and
lymphangiogenesis. Nat Rev Mol Cell Biol 8:464-78.
2. Alitalo, K. 2007. Lymphangiogenesis in development and human disease.
Experimental Dermatology 16:863-864.
3. Alitalo, K., T. Tammela, and T. V. Petrova. 2005. Lymphangiogenesis in
development and human disease. Nature 438:946-53.
4. Amatschek, S., E. Kriehuber, W. Bauer, B. Reininger, P. Meraner, A. Wolpl,
N. Schweifer, C. Haslinger, G. Stingl, and D. Maurer. 2007. Blood and
lymphatic endothelial cell-specific differentiation programs are stringently
controlled by the tissue environment. Blood 109:4777-85.
5. Androutsellis-Theotokis, A., R. R. Leker, F. Soldner, D. J. Hoeppner, R.
Ravin, S. W. Poser, M. A. Rueger, S. K. Bae, R. Kittappa, and R. D. McKay.
2006. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature
442:823-6.
6. Banerji, S., J. Ni, S. X. Wang, S. Clasper, J. Su, R. Tammi, M. Jones, and D.
G. Jackson. 1999. LYVE-1, a new homologue of the CD44 glycoprotein, is a
lymph-specific receptor for hyaluronan. J Cell Biol 144:789-801.
7. Bolos, V., J. Grego-Bessa, and J. L. de la Pompa. 2007. Notch signaling in
development and cancer. Endocr Rev:er.2006-0046.
8. Cueni, L. N., and M. Detmar. 2006. New insights into the molecular control of
the lymphatic vascular system and its role in disease. J Invest Dermatol 126:2167-
77.
9. Dumont, D. J., L. Jussila, J. Taipale, A. Lymboussaki, T. Mustonen, K.
Pajusola, M. Breitman, and K. Alitalo. 1998. Cardiovascular failure in mouse
embryos deficient in VEGF receptor-3. Science 282:946-9.
10. Edward, M., C. Gillan, D. Micha, and R. H. Tammi. 2005. Tumour regulation
of fibroblast hyaluronan expression: a mechanism to facilitate tumour growth and
invasion. Carcinogenesis 26:1215-1223.
37
11. Gale, N. W., R. Prevo, J. Espinosa, D. J. Ferguson, M. G. Dominguez, G. D.
Yancopoulos, G. Thurston, and D. G. Jackson. 2007. Normal lymphatic
development and function in mice deficient for the lymphatic hyaluronan receptor
LYVE-1. Mol Cell Biol 27:595-604.
12. Gale, N. W., G. Thurston, S. F. Hackett, R. Renard, Q. Wang, J. McClain, C.
Martin, C. Witte, M. H. Witte, D. Jackson, C. Suri, P. A. Campochiaro, S. J.
Wiegand, and G. D. Yancopoulos. 2002. Angiopoietin-2 is required for
postnatal angiogenesis and lymphatic patterning, and only the latter role is
rescued by Angiopoietin-1. Dev Cell 3:411-23.
13. Geling, A., H. Steiner, M. Willem, L. Bally-Cuif, and C. Haass. 2002. A
gamma-secretase inhibitor blocks Notch signaling in vivo and causes a severe
neurogenic phenotype in zebrafish. EMBO Rep 3:688-94.
14. Guo, L. X., K. Zou, J. H. Ju, and H. Xie. 2005. Hyaluronan promotes tumor
lymphangiogenesis and intralymphantic tumor growth in xenografts. Acta
Biochim Biophys Sin (Shanghai) 37:601-6.
15. Hirakawa, S., Y.-K. Hong, N. Harvey, V. Schacht, K. Matsuda, T.
Libermann, and M. Detmar. 2003. Identification of Vascular Lineage-Specific
Genes by Transcriptional Profiling of Isolated Blood Vascular and Lymphatic
Endothelial Cells. Am J Pathol 162:575-586.
16. Hong, Y. K., K. Foreman, J. W. Shin, S. Hirakawa, C. L. Curry, D. R. Sage,
T. Libermann, B. J. Dezube, J. D. Fingeroth, and M. Detmar. 2004.
Lymphatic reprogramming of blood vascular endothelium by Kaposi sarcoma-
associated herpesvirus. Nat Genet 36:683-5.
17. Hong, Y. K., N. Harvey, Y. H. Noh, V. Schacht, S. Hirakawa, M. Detmar,
and G. Oliver. 2002. Prox1 is a master control gene in the program specifying
lymphatic endothelial cell fate. Dev Dyn 225:351-7.
18. Hong, Y. K., J. W. Shin, and M. Detmar. 2004. Development of the lymphatic
vascular system: a mystery unravels. Dev Dyn 231:462-73.
19. Hosking, B., and T. Makinen. 2007. Lymphatic vasculature: a molecular
perspective. Bioessays 29:1192-202.
38
20. Huang, S. S., I. H. Liu, T. Smith, M. R. Shah, F. E. Johnson, and J. S. Huang.
2006. CRSBP-1/LYVE-l-null mice exhibit identifiable morphological and
functional alterations of lymphatic capillary vessels. FEBS Lett 580:6259-68.
21. Iso, T., L. Kedes, and Y. Hamamori. 2003. HES and HERP families: multiple
effectors of the Notch signaling pathway. J Cell Physiol 194:237-55.
22. Itoh, N., S. Semba, M. Ito, H. Takeda, S. Kawata, and M. Yamakawa. 2002.
Phosphorylation of Akt/PKB is required for suppression of cancer cell apoptosis
and tumor progression in human colorectal carcinoma. Cancer 94:3127-34.
23. Jackson, D. G. 2004. Biology of the lymphatic marker LYVE-1 and applications
in research into lymphatic trafficking and lymphangiogenesis. Apmis 112:526-38.
24. Jackson, D. G. 2003. The lymphatics revisited: new perspectives from the
hyaluronan receptor LYVE-1. Trends Cardiovasc Med 13:1-7.
25. Jackson, D. G., R. Prevo, S. Clasper, and S. Banerji. 2001. LYVE-1, the
lymphatic system and tumor lymphangiogenesis. Trends Immunol 22:317-21.
26. Kim, K. Y., J. Y. Seol, G. A. Jeon, and M. J. Nam. 2003. The combined
treatment of aspirin and radiation induces apoptosis by the regulation of bcl-2 and
caspase-3 in human cervical cancer cell. Cancer Lett 189:157-66.
27. Liang, C. C., A. Y. Park, and J. L. Guan. 2007. In vitro scratch assay: a
convenient and inexpensive method for analysis of cell migration in vitro. Nat
Protoc 2:329-33.
28. Nikopoulos, G. N., M. Duarte, C. J. Kubu, S. Bellum, R. Friesel, T. Maciag, I.
Prudovsky, and J. M. Verdi. 2007. Soluble Jagged1 Attenuates Lateral
Inhibition, Allowing for the Clonal Expansion of Neural Crest Stem Cells. Stem
Cells 25:3133-3142.
29. Ochi, N., Y. Matsuo, H. Sawai, A. Yasuda, H. Takahashi, M. Sato, H.
Funahashi, Y. Okada, and T. Manabe. 2007. Vascular endothelial growth
factor-C secreted by pancreatic cancer cell line promotes lymphatic endothelial
cell migration in an in vitro model of tumor lymphangiogenesis. Pancreas 34:444-
51.
39
30. Oliver, G. 2004. Lymphatic vasculature development. Nat Rev Immunol 4:35-45.
31. Osusky, K. L., D. E. Hallahan, A. Fu, F. Ye, Y. Shyr, and L. Geng. 2004. The
receptor tyrosine kinase inhibitor SU11248 impedes endothelial cell migration,
tubule formation, and blood vessel formation in vivo, but has little effect on
existing tumor vessels. Angiogenesis 7:225-33.
32. Ota, H., K. Katsube, J. Ogawa, and M. Yanagishita. 2007. Hypoxia/Notch
signaling in primary culture of rat lymphatic endothelial cells. FEBS Lett
581:5220-6.
33. Petrova, T. V., T. Makinen, T. P. Makela, J. Saarela, I. Virtanen, R. E.
Ferrell, D. N. Finegold, D. Kerjaschki, S. Yla-Herttuala, and K. Alitalo. 2002.
Lymphatic endothelial reprogramming of vascular endothelial cells by the Prox-1
homeobox transcription factor. Embo J 21:4593-9.
34. Podgrabinska, S., P. Braun, P. Velasco, B. Kloos, M. S. Pepper, and M.
Skobe. 2002. Molecular characterization of lymphatic endothelial cells. Proc Natl
Acad Sci U S A 99:16069-74.
35. Ponta, H., L. Sherman, and P. A. Herrlich. 2003. CD44: from adhesion
molecules to signalling regulators. Nat Rev Mol Cell Biol 4:33-45.
36. Prevo, R., S. Banerji, D. J. Ferguson, S. Clasper, and D. G. Jackson. 2001.
Mouse LYVE-1 is an endocytic receptor for hyaluronan in lymphatic
endothelium. J Biol Chem 276:19420-30.
37. Shawber, C. J., Y. Funahashi, E. Francisco, M. Vorontchikhina, Y.
Kitamura, S. A. Stowell, V. Borisenko, N. Feirt, S. Podgrabinska, K.
Shiraishi, K. Chawengsaksophak, J. Rossant, D. Accili, M. Skobe, and J.
Kitajewski. 2007. Notch alters VEGF responsiveness in human and murine
endothelial cells by direct regulation of VEGFR-3 expression. J Clin Invest
117:3369-82.
38. Tammela, T., T. V. Petrova, and K. Alitalo. 2005. Molecular
lymphangiogenesis: new players. Trends Cell Biol 15:434-41.
40
39. Tomita, T. 2007. Lymphatic vessel endothelial hyaluronan receptor 1
immunocytochemical staining for pancreatic islets and pancreatic endocrine
tumors. Pancreas 35:e18-22.
40. Tzircotis, G., R. F. Thorne, and C. M. Isacke. 2005. Chemotaxis towards
hyaluronan is dependent on CD44 expression and modulated by cell type
variation in CD44-hyaluronan binding. J Cell Sci 118:5119-5128.
41. Varnum-Finney, B., L. Wu, M. Yu, C. Brashem-Stein, S. Staats, D. Flowers,
J. D. Griffin, and I. D. Bernstein. 2000. Immobilization of Notch ligand, Delta-
1, is required for induction of notch signaling. J Cell Sci 113:4313-4318.
42. Wigle, J. T., and G. Oliver. 1999. Prox1 function is required for the
development of the murine lymphatic system. Cell 98:769-78.

Abstract (if available)

Abstract Lymphatic Hyaluronan receptor (LYVE1) is a lymphatic endothelial cell marker and is implicated in the embryonic development of the lymphatic system. Notch plays a major role in development of the blood vascular system. Previous studies at our lab found that Notch activates LYVE1. The aim of this project was to investigate this new finding. We have studied activation of LYVE1 by Notch at transcriptional and translational levels by overexpression of Notch and also by using Notch inhibitors. Hyaluronic acid (HA) is ligand of LYVE1. We have studied the influence of HA with respect to Notch activation of LYVE1. We show that Notch activates LYVE1, and the soluble form of Notch ligand can inhibit Notch-mediated activation of LYVE1. We have analyzed the effect of Notch inhibitors on the binding of HA to LYVE1 and also LEC proliferation. We also found that HA influences cell migration when notch activity is inhibited.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Lymphatic cell environment promotes sustained KSHV lytic replication and viral maintenance

PDF

Expression pattern analysis of coronary and lymphatic vessel genes in zebrafish and mice

PDF

Characterization of Cxcr7 in zebrafish cardiac lymphatic vessel development

PDF

Kaposi's sarcoma associated herpes-virus induces cellular proxi expression to modulate host gene expression that benefits viral infection and oncogenesis

PDF

Modulation of Runx proteins by steroid hormone receptors

PDF

Modulation of host antigen presentation by herpes simplex virus 1

PDF

Anti-cancer effects of novel glidobactin type proteasome inhibitors

PDF

The differential effects of selective COX-2 inhibitors on cell proliferation and induced ER stress in glioblastoma and pancreatic carcinoma cell lines

PDF

Roles of three domains of CCAR1 in transcription activation by nuclear receptors

PDF

Context-dependent role of androgen receptor (AR) in estrogen receptor-positive (ER+) breast cancer

PDF

Proliferation and maturation events in second heart field cells during cardiovascular development activated by the Delta like ligand-4 mediated notch signaling

PDF

Functional analyses of androgen receptor structure pertaining to prostate cancer

PDF

Spatially controlled tissue differentiation using the synthetic receptor SynNotch

PDF

Targeting mitochondrion-nucleus PDH1 transfer to suppress self-renewal and epigenetic NANOG reprogramming of tumor-initiating cells

PDF

Molecular targets for treatment of glioblastoma multiforme

PDF

Identification of molecular mechanism for cell-fate decision in liver; &, SARS-CoV replicon inhibitor high throughput drug screening

PDF

Differential role of two coactivators, CCAR1 and CARM1, for dysregulated beta-catenin activity in colorectal cancer cell growth and gene expression

PDF

Fibroblast growth factors and notch signaling in a diethoxycarbonyl dihydrocollidine-induced hepatic progenitor cell liver injury model

PDF

Enhanced Burkitt 's lymphoma cell killing by the combination treatments of bortezomib with celecoxib and 2,5-dimethyl-celecoxib (DMC)

PDF

Ethanol induced modulation of microglial P2X7 receptor expression and its role in neuroinflammation

Asset Metadata

Creator Ganesan, Sathish Kumar (author)

Core Title Role of Notch and hyaluronan in modulating the expression of lymphatic vessel endothelial hyaluronan receptor1 (LYVE1)

School Keck School of Medicine

Degree Master of Science

Degree Program Molecular Microbiology

Publication Date 08/04/2008

Defense Date 06/23/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag hyaluronan,LYVE1,Notch1,OAI-PMH Harvest

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Schönthal, Axel H. (committee chair), Hong, Young Kwon (committee member), Landolph, Joseph, Jr. (committee member)

Creator Email g.sathish.k@gmail.com,sathish158@yahoo.co.in

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1522

Unique identifier UC1297288

Identifier etd-Ganesan-2260 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-89693 (legacy record id),usctheses-m1522 (legacy record id)

Legacy Identifier etd-Ganesan-2260.pdf

Dmrecord 89693

Document Type Thesis

Rights Ganesan, Sathish Kumar

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu