University of Southern California Dissertations and Theses

Estrogen and progesterone interactions in neurons: implications for Alzheimer's disease-related pathways

(USC Thesis Other)

Estrogen and progesterone interactions in neurons: implications for Alzheimer's disease-related pathways

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content ESTROGEN AND PROGESTERONE INTERACTIONS IN NEURONS:
IMPLICATIONS FOR ALZHEIMER’S DISEASE-RELATED PATHWAYS

By

Anusha Jayaraman

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(NEUROSCIENCE)

August 2010

Copyright 2010 Anusha Jayaraman

ii
DEDICATION

To my loving and supportive husband who has always been there for me through this
long and hard journey
iii
ACKNOWLEDGEMENTS

I would like to thank my advisor, Dr. Christian Pike, for his mentorship and guidance
throughout my doctoral studies. I thank him in particular for preparing me for the
scientific challenges in the next step of my career well in advance. He has been extremely
supportive with my projects giving me valuable input and motivation all along. He also
never doubted in my ability to handle my thesis work while managing the responsibilities
of a new mother.

Nothing would have been possible if it were not for the huge support of my family. I
thank my dear parents for standing behind my every decision my entire life, be it personal
or career-related. Their blessings and their faith in me have kept me going through ups
and downs. No words could possibly express how thankful I am for having such a
wonderful husband who shares my passion for science among many other things. He has
been there every single day of this memorable journey, many a times bearing the brunt of
those bad days in lab, but always encouraging me and helping me put things in
perspective. I also thank my very supportive extended family, my in-laws, who have
always believed in me. A special mention to our little girl, Aanika, who has been such an
amazing baby sleeping through nights and adjusting well to her daycare so that mommy
could work towards her degree without much of a problem.

I also would like to thank past and present Pike Lab members - Emily Rosario, Anna
Barron, and Mingzhong Yao. I specifically want to thank Emily for being a good friend
iv
and colleague from the very beginning and Anna for patiently hearing my ideas and
frustrations alike over the last year. You both made the good times in the lab memorable
and the bad ones bearable.

I would like to thank my committee members, Dr. Roberta Diaz Brinton, Dr. Michel
Baudry, and Dr. Rayudu Gopalakrishna, for giving me their valuable time and guidance
in shaping my dissertation work.

Huge thanks to all my friends in the Finch lab and Longo lab, especially Jason, Eduardo,
Priya, and David Davies, for sharing reagents and helping me with my experiments and
animal work. I also want to thank Thuy-Vi Nguyen, a past Pike lab member, and Claudia
Aguirre, a past Baudry lab member, for letting me be a part of their projects and
manuscripts.

I would like to thank my collaborators from the Analytical Core and Animal Core of the
Progesterone Program project. Specifically, I would like to thank Dr. Todd Morgan, Dr.
Sharon Lee, and David Berg for helping me with the in vivo experiments and Dr. Liqin
Zhao and Dr. Jennifer Mao for their help in RNA and protein isolation from tissue
samples.

v
I would like to thank the USC WiSE program and its program manager, Nicole Hawkes,
for choosing me for the WiSE Fellowship as well as the WiSE Childcare Subsidy, which
made things easy financially when the need arose.

Finally, I would like to thank the Journal of Neuroendocrinology for copyright
permission.
vi
TABLE OF CONTENTS

DEDICATION ii

ACKNOWLEDGEMENTS iii

LIST OF TABLES viii

LIST OF FIGURES ix

ABSTRACT xi

CHAPTER ONE Introduction 1
1. Female sex-steroid hormones and Alzheimer’s disease 1
Age-related risk for Alzheimer’s disease in women 1
Hormone therapy and Alzheimer’s disease 3
2. Estrogen and progesterone biosynthesis and receptor-mediated
signaling 6
Estrogen and progesterone during estrus cycle
Estrogen biosynthesis 9
Progesterone biosynthesis 13
Receptor-mediated signaling 20
Estrogen and progesterone receptors in the brain 28
Regulation of receptor expression by estrogen and progesterone 32
3. Estrogen and progesterone interaction 35
Estrogen and progesterone interaction in the brain 37
Estrogen and progesterone interaction in other tissues 47
4. Estrogen and progesterone regulation of β-amyloid 53
APP processing and AD 55
Aβ clearance 56
Estrogen and Aβ 59
Progesterone and Aβ 61
Role of estrogen and progesterone in regulating tau
phosphorylation 62
5. Estrogen and progesterone neuroprotection 64
Estrogen neuroprotection 64
Progesterone neuroprotection 67
6. Hypothesis and experimental paradigms 70

CHAPTER TWO Progesterone down regulates the expression of
estrogen receptors, ERα and ERβ in neurons 72
Chapter Two Abstract 72
Chapter Two Introduction 73
vii
Methods 75
Results 77
Chapter Two Discussion 84
CHAPTER THREE Progesterone affects estrogen receptor transcription
and estrogen-mediated neuroprotection down-
regulating the estrogen receptors 86
Chapter Three Abstract 86
Chapter Three Introduction 87
Methods 88
Results 90
Chapter Three Discussion 96

CHAPTER FOUR Role of synthetic progestins on the expression
and function of estrogen receptors. 98
Chapter Four Abstract 98
Chapter Four Introduction 99
Methods 100
Results 103
Chapter Four Discussion 110

CHAPTER FIVE Estradiol and progesterone regulation of
β-amyloid degrading enzymes 114
Chapter Five Abstract 114
Chapter Five Introduction 115
Methods 117
Results 122
Chapter Five Discussion 133

CHAPTER SIX Conclusions and future directions 139

BIBLIOGRAPHY 164

viii
LIST OF TABLES

1. Estrogen and progesterone interactions in the brain. 38
2. Acute in vivo hormonal treatment paradigm. 80
3. Effect of progesterone and synthetic progestin on various paradigms. 152
4. Putative ERE sites on the promoter region of Aβ-degrading enzymes. 161
ix
LIST OF FIGURES

1. Estrogen and progesterone levels during estrous cycle. 7
2. Steroid biosynthesis pathway. 11
3. Steroidogenesis of progesterone. 16
4. Simplified model of estrogen receptor structures. 22
5. Different types of hormonal signaling. 24
6. Genomic and non-genomic signaling pathways of progesterone. 26
7. Simplified model of progesterone receptor structures. 27
8. ERα and ERβ distribution in the rat brain. 29
9. PR distribution in the rat brain. 31
10. Schematic diagram of amyloid precursor protein (APP) processing
and Aβ clearance. 54

11. Estrogen-induced neuroprotective pathways. 65
12. Progesterone mediated neuroprotective pathways. 67
13. Progesterone (P
4
) decreases the expression of estrogen receptor ERa
and ERb mRNA in a concentration- and time-dependent manner. 78

14. ERα and ERβ levels in the frontal cortex and hippocampus after
acute hormonal treatment. 81

15. Effect of P4 on ERα and ERβ expression in hippocampal slices. 83

16. Progesterone (P4) reduces estrogen-induced increases in estrogen
receptor (ER) activity and neuron survival. 93

17. Effect of progesterone treatment on bdnf mRNA levels. 95
18. Effect of synthetic progestins on ERα mRNA expression in primary
neurons. 104
x

19. Effect of synthetic progestins on ERβ mRNA expression in primary
neurons. 106

20. Neuroprotective effect of synthetic progestins against apoptotic insult. 108
21. Effect of synthetic progestins on bdnf mRNA expression. 109
22. E
2
affects Aβ-degrading enzymes in a dose- and time-dependent
manner. 124

23. P
4
affects Aβ-degrading enzymes in a dose- and time-dependent
manner. 125

24. Effect of ER agonist and ER and PR antagonists on the mRNA
levels of different Aβ-degrading enzymes. 127

25. Effect of short-term hormonal treatment on in vivo levels of Aβ-
degrading enzymes. 129

26. Effect of long-term hormonal treatment on in vivo levels of Aβ-
degrading enzymes. 131

27. Effect of long-term hormonal treatment on soluble Aβ levels in vivo. 132
28. Effect of E
2
and P
4
on IDE expression levels. 134
29. Comparative analysis of soluble Aβ levels vs. Ide mRNA levels in
vivo. 158

xi
ABSTRACT

The depletion of estrogen and progesterone in postmenopausal women is
associated with increased risk for several disorders in the cardiovascular, skeletal and
nervous system. To reduce this risk, hormone therapy containing estrogens and a
synthetic progestagen has been used but with little success. For example, the Women’s
Health Initiative clinical trial showed that hormone therapy was associated with reduced
incidence of hip fractures associated with osteoporosis but unexpectedly increased
incidences of both stroke and dementia. The disparities between basic research studies
that demonstrate neuroprotective effects of estrogen and progesterone and recent clinical
findings that report adverse neural effects of hormone therapy indicate the need for a
more complete understanding of estrogens and progesterone interactions in brain and
other tissues. One important issue that is not well understood is how neural effects of
estrogens are affected by progestagens. Recent experimental evidence shows that
prolonged progesterone exposure often represses estradiol function. The mechanism by
which progesterone inhibits estrogen action in the brain is unclear. We hypothesize that
progesterone might oppose estrogen activity by regulating the expression and or function
of estrogen receptors, ERα and ERβ, thereby affecting ER-dependent transcriptional
activity and E2-mediated neuroprotection. My thesis work involved testing these
hypotheses and in the following chapters, I provide the experimental evidence for the
same. Chapter 1 is a comprehensive introduction to a number of topics that are relevant to
my research area. Chapter 2 describes the effects of progesterone on the expression of
estrogen receptors both in primary neuron cultures as well as in rat brains. Chapter 3
xii
describes the effect of progesterone regulation of estrogen receptors on estrogen-
mediated transcriptional activity and neuroprotection against apoptotic factors primarily
in cell-culture and to some extent in organotypic cultures. Chapter 4 describes the effects
of estradiol and progesterone individually as well as combined on the expression of β-
amyloid degrading enzymes and the accumulation of amyloid both in vitro and in vivo. In
Chapter 5 we look at the effects of progesterone on apoptotic pathways by itself and in
the presence of estradiol mainly in primary neurons. In Chapter 6 I discuss the relevance
of my research findings in the context of neurobiology and translational research and
predict the potential outcomes of incorporating these findings in hormone therapy against
risk for neurodegenerative diseases such as Alzheimer’s disease.

1
CHAPTER ONE : INTRODUCTION

Alzheimer’s disease (AD) is one of the major neurodegenerative diseases which is
characterized by the accumulation of β-amyloid (Aβ) plaques and extracellular tangles in
the brain. Many studies have shown age to be a major risk-factor in the development of
AD (Rocca et al., 1986; Jorm et al., 1987; Evans et al., 1989). Another important risk
factor for the development of AD is the decline of male and female sex hormones with
advancing age (Paganini-Hill A, 1994; Solerte et al., 1999; Gandy and Duff, 2000). This
is more pronounced in females where there is a sharp decline in female sex steroid
hormones, estrogens and progesterone, with menopause. Basic research and
epidemiological studies have suggested the use of hormones as a therapeutic approach in
the treatment of AD especially in females. This led to several clinical trials with hormone
replacement therapy in postmenopausal women, although with mixed results. The
disparities between the basic research studies that show several beneficial roles of the
hormones and the less successful clinical trials showcased the need for better
understanding of the interaction between these hormones in the neuronal cells.

1. Female sex-steroid hormones and Alzheimer’s disease

Age-related risk for Alzheimer’s disease in women
Studies have shown that women are at a higher risk for AD than men (Molsa et al.,
1982; Rocca et al., 1986; Jorm et al., 1987; Bachman et al., 1992; Gao et al., 1998;
2
Ruitenberg et al., 2001). During menopause, the loss of estrogen and progesterone, the
key female sex steroid hormones seem to contribute to this increased risk (for review, see
Brinton, 2004). The effect of this decline is seen in various hormone responsive tissues
throughout the body such as the reproductive organs and bones leading to several
disorders like osteoporosis and heart disease (Kleerekoper and Sullivan, 1995). The brain
is one such important hormone responsive tissue. Both estrogens and progesterone have
several beneficial actions in the brain which will be discussed in detail later in this
chapter. Hence, the precipitous decline of these hormones during menopause also affects
several neuronal functions. In severe cases such as in AD, this may contribute to neuron
loss and dementia. Men too undergo an age-related decline of androgens, although there
is never a complete loss as in the case of women. Several evidence including some of the
studies from our laboratory indicate that the gradual loss of androgens in males have a
correlation to increased risk for AD (Pike et al., 2006; Rosario ER, 2006).
Over the years growing evidence from observational and epidemiological studies has
suggested that decrease in estrogens can contribute to the development of AD and that
estrogens replacement would decrease the incidence of AD significantly. For example,
the Leisure World Cohort of Aging showed that the risk of AD in older women was less
in estrogen users as compared to non-users and this risk was inversely correlated to the
increasing dose and duration of estrogen use (Paganini-Hill A, 1994, 1996). Another
longitudinal study done on elderly women showed that the use of estrogens after
menopause significantly delayed the onset of AD (Tang et al., 1996). The Baltimore
Longitudinal Study of Aging (BLSA) also showed that the use of estrogens reduced the
3
risk for AD in postmenopausal and perimenopausal women (Kawas C, 1997). The Cache
County study suggested that the risk of developing AD in women under hormone-
replacement therapy (HT) for over 10 years was almost negligible as compared to the
non-users (Zandi et al., 2002).

Hormone therapy and Alzheimer’s disease
As mentioned earlier, the decline of sex steroid hormones after menopause has
been implicated to be a risk factor for AD. On the other hand, the plasma levels of 17β-
estradiol (E2) are shown to be lower in women with AD as compared to the control
group, strengthening the correlation between hormone loss and AD in women (Manly et
al., 2000). Estrogens and progesterone have many important functions throughout the
body including the nervous system. Basic research has shown estradiol to protect against
several neuronal insults (Goodman et al., 1996; Brinton et al., 2000), modulate synaptic
plasticity by increasing dendritic spines and synapses (McEwen et al., 1994), and
increase anti-apoptotic factors such as Bcl-2 and Bcl-x . Estradiol has also been shown to
be protective against β-amyloid (Aβ) toxicity both in vitro and in rodent models
(Petanceska et al., 2000; Levin-Allerhand et al., 2002; Goodman et al., 1996). Similarly,
progesterone and synthetic progestins have been shown to be neuroprotective against
neuronal injury in some rodent models (Roof et al., 1994; Hoffman et al., 2003; De
Nicola AF, 2006). Moreover, epidemiological studies have shown that estradiol and
progesterone have beneficial effects on several disorders (Brass, 2004; Henderson, 2006).
4
The wealth of data from both basic research and epidemiological studies led to the
use of estrogens and progestagens in hormone replacement therapies (HT) in
postmenopausal women to decrease the risk of AD and other disorders (Paganini-Hill A,
1994, 1996; Tang et al., 1996; Kawas C, 1997; Zandi et al., 2002). Several studies have
been done with conjugated equine estrogen (CEE) treatment and CEE/MPA
(medroxyprogesterone acetate) combination treatments using variable paradigms. One
such study done to determine the effect of these hormones on dementia in women with
AD suggested that estradiol treatment for 7 weeks caused an improvement in the tests
performed by these women whereas addition of MPA from the 4
th
week along with
estradiol worsened the performance as compared to estradiol alone for 7 weeks (Honjo H,
2005). A recent major randomized clinical trial, the Women’s Health Initiative (WHI)
was undertaken and the effect of the combination of CEE and MPA were evaluated for
multiple endpoints such as cardiovascular health, bone density, stroke, breast cancer, and
endometrial cancer.
One limb of the WHI was the Women’s Health Initiative Memory Study
(WHIMS) which evaluated the effects of these hormones on memory and AD and non-
AD related dementia. In this study, postmenopausal women were given CEE + MPA or
placebo for about 6 years at the end of which they were tested for incidence for probable
dementia and mild cognitive impairment. The cotreatment with estradiol and progestin
increased the risk for dementia and did not prevent mild cognitive impairment (Shumaker
et al., 2003). As these studies progressed, emerging data suggested more risks and fewer
benefits of HT which led to a premature termination of the whole trial (Honjo H, 2005;
5
Klaiber et al., 2005; LaCroix, 2005; Gleason et al., 2005). Many possible reasons have
been suggested for the failure of the clinical trial. One important factor was the lack of
right formulation of the hormones and or the right doses. This has led to the investigation
of the beneficial actions of several other progestagens as well as estrogen compounds.
The other important issue that was raised regarding this trial was the fact that the age of
the postmenopausal women recruited into the study was between 65 and 80 years which
means that even the younger women in the group were at least 10 years post-menopause.
The treatment age during HT could be an important factor since several of the hormone
responsive tissues might lose their hormone responsiveness after prolonged absence of
hormones. Therefore starting the HT just before or just after menopause might result in
more positive results. The third reason was that the combination of estrogens with
continuous progestagens was worse than estrogen alone treatment, suggesting that
progestagens antagonize estrogen action (Honjo H, 2005; MacLennan AH, 2007).
However, addition of progestagens are important in order to counteract some of the
negative effects of unopposed estrogen exposure on endometrial and breast tissues
(Persson et al., 1989; Grady et al., 1995; Dai et al., 2002; Davies et al., 2004b; Davies et
al., 2004a). Therefore the need for better understanding of the interaction between
estrogens and progesterone in different cell-types becomes important. My research work
addresses aspects of this problem. Chapter 2 and 3 shows one of the ways by which
progesterone might be antagonizing estrogen actions in neurons. The understanding of
estrogen-progesterone interaction will potentially lead to better design of the treatment
regimen. To this effect, Chapter 5 gives a glimpse of the benefits of having a cyclic
6
progesterone regimen over continuous progesterone along with estradiol. This
observation is also supported by several previous studies both from our laboratory and
others (Gibbs, 2000; Carroll et al., 2007). Some of the newer ongoing clinical trials such
as Kronos Early Estrogen Prevention Study (KEEPS) have also incorporated the cyclic
progesterone regimen and only time will tell us of its success.

2. Estrogen and progesterone biosynthesis and receptor-mediated signaling

Estrogen and progesterone during the estrous cycle
The estrous cycle can be divided into the following periods – estrous, metestrus,
diestrus, and proestrus (Butcher and Kirkpatrick-Keller, 1984). The levels of estrogens
and progesterone, along with other important non-steroidal hormones such as follicular
stimulating hormone (FSH) and luteinizing hormone (LH), are regulated throughout the
estrous cycle in a specific pattern in order to maintain normal functioning of the female
reproductive system. This regulation is quite similar across different mammalian species.
Corpus luteum is formed during the metestrus period. Once the corpus luteum is
functional, diestrus period starts with an increase in the level of plasma progesterone.
This is also known as the luteal phase of the ovarian cycle. The progesterone levels are
high during the luteal phase as well as during pregnancy. The level of progesterone
continues to increase till proestrus period begins with the regression of corpus luteum
(reviewed in (McCracken et al., 1999). A drop in the progesterone levels coincides with
an increase in estrogen levels which continues through the late proestrus phase of the
7
Fig 1: Estrogen and progesterone levels during estrous cycle.

Estrogen and progesterone levels during estrous cycle. (a) This is the representative schematic diagram
showing the relative concentrations of estradiol, progesterone, luteinizing hormone (LH) and follicular
stimulating hormone (FSH) across the estrous cycle. The LH surge during late follicular phase stimulates
progesterone secretion. The level of progesterone is high during the luteal phase and decreases by the
beginning of the follicular phase. This decline corresponds to increase in estrogen levels. FSH levels
increase twice during the course of the estrous cycle.
Luteal Phase Follicular phase
Progesterone
Estrogen
FSH
LH
a.
Luteal Phase Follicular phase
Progesterone
Estrogen
FSH
LH
a.
Relat
ive
conc
. of
horm
ones
8
cycle. This period is also known as the follicular phase (Erb et al., 1971; Owen, 1975;
Graham JD, 1997) (Fig.1).
The production and secretion of estrogen and progesterone is regulated by various
signaling pathways (reviewed in Niswender GD, 2002). The decrease in estrogen levels
coincides with LH and FSH surges which are preceded by increase in Gonadotropin-
releasing hormones (GnRH). LH and FSH stimulate progesterone secretion (Owen,
1975). Gonadotropins such as LH and FSH play a vital role in the steroidogenesis of
progesterone. The LH surge before the luteal phase of the estrous cycle acts as a signal
that prepares the corpus luteum cells for progesterone production and secretion from
(Mason et al., 1962). This effect of LH on progesterone biosynthesis is thought to be
through cyclic AMP, which accumulates in the presence of LH (Marsh and Savard, 1966;
Marsh et al., 1966). FSH not only stimulates the secretion of progesterone initially, but
also activates another hormone, activin, which later inhibits progesterone secretion (Xiao
et al., 1990). In order to maintain progesterone secretion and activity, progesterone
activates follistatin, which binds to activin and inhibits FSH (Nakamura et al., 1990;
Mercado et al., 1993). Prostaglandins also play a regulatory role in progesterone
secretion. There is a correlation between the prostaglandin F
2α
surge during the proestrus
period and the sharp decrease in the progesterone levels around the same time (Blatchley
FR, 1972). It has been shown that prostaglandin F
2α
causes a decrease in progesterone
production by activating the PKC pathway (Wiltbank et al., 1989). Increase in estrogen
levels coincide with decrease in progesterone levels which might suggest a regulatory
control between the two hormones. Given that progesterone is a repressor of several
9
estrogen actions, it is not surprising that many of the mechanisms mentioned above are
aimed at restoring estrogen action during the follicular phase by repressing progesterone
production and activity.
Progesterone also controls the activity of the other hormones either by inhibiting or
stimulating their secretion depending on the period of the estrous cycle (Everett and
Tyrey, 1982). It has been shown that during early estrous period, progesterone can
stimulate the secondary surge of FSH (Knox et al., 1993). During the metestrus period
and through the luteal phase, progesterone is capable of reducing the levels of the
gonadotropins (Lustig et al., 1988; Bellido C, 1999) by inhibiting their hypothalamic
secretion (Skinner et al., 1998; Skinner et al., 1999) to promote its secretion. Thus
various hormones expressed during the different periods of the estrous cycle control the
expression of each other in order to maintain a phase-dependent release of the required
hormones.
The level of progesterone in the brain also fluctuates during the estrous cycle. It
has been reported in rats that the relative concentration of brain progesterone follows a
similar pattern as that of serum progesterone (Morissette et al., 1992) (Fig 1).

Estrogen biosynthesis
Estradiol is a key steroid hormone involved in many regulatory functions in
reproductive system, cardiovascular system, skeletal system, and nervous system.
Estradiol is synthesized from the precursor, androstenedione which is derived from
cholesterol after several intermediate steps. The conversion of testosterone to estradiol by
10
aromatase activity is the rate-limiting step in the biosynthesis of estradiol. There have
been reports that the biosynthesis of estradiol occurs primarily in the peripheral tissues
such as the ovaries and placenta, and to a much lesser extent in the liver, adrenal glands,
breasts and adipose cells (for review see Olson et al., 2007). Studies have also
demonstrated that estradiol can be synthesized de novo in the brain (Naftolin et al., 1971;
Zwain and Yen, 1999; Hojo et al., 2004). Many studies have confirmed the presence of
all the enzymes required for estradiol synthesis in glial cells and neurons. During the
estrous cycle, the levels of estradiol fluctuate in the serum as well as in the brain in a
specific pattern depending on the period of the cycle (Zwain and Yen, 1999; Hojo et al.,
2004). This is closely regulated by feedback mechanisms involving several steroidal and
non-steroidal factors.

Steroidogenesis of estradiol in the peripheral tissue
Among the peripheral tissues, the ovary is the primary sites of estradiol
biosynthesis followed by placenta. Cholesterol is required as a substrate for the synthesis
of pregnenolone, the precursor of for all steroidogenesis including that of estradiol (Fig.
2). Conversion of cholesterol to pregnenolone is done by the action of cytochrome P450.
Pregnenolone is then converted to 17α-pregnenolone by 17α-hydroxylase and to 17α-
progesterone via progesterone. These 17α-intermediates serve as precursors for
dihydroxyepiandrosterone and androstenedione respectively, both of which can be
converted to testosterone. The conversion of androstenedione to estrone and testosterone
to estradiol occurs by the activity of aromatase.
11
Cholesterol
Pregnenolone
17-OH pregnenolone
Dehydroepiandrosterone
Progesterone
17-OH progesterone
Androstenedione
Estrone
Testosterone
Estradiol

3β β β β-HSD
3β β β β-HSD
3β β β β-HSD 17β β β β-HSD
17β β β β-HSD
P-450 aromatase P-450 aromatase
Fig 2: Steroid biosynthetic pathway.

Steroid biosynthetic pathway. The steroid biosynthesis pathway for the conversion of substrate
cholesterol to the progestagens, androgens, and estrogens. (Adapted from: Encyclopedia of Reproduction,
Vol 3, pp 889–898. Boston, Academic Press, 1998)
12
Estrone and estradiol are interconvertible by the enzyme 3β-hydroxysteroid
dehydrogenase (for review see Olson et al., 2007).

Neurosteroidogenesis of estradiol
Estradiol has been shown to be synthesized de novo in the nervous system and has
important functions in the brain. The steps involved in the production of estradiol from
cholesterol are essentially the same as those discussed above (Naftolin et al., 1971; Zwain
and Yen, 1999; Hojo et al., 2004; Tsutsui, 2008). Neurons and astrocytes have all the
enzymes required for neosynthesis of estradiol (Zwain and Yen, 1999).

Estradiol metabolism and clearance
Estradiol and its less biologically active counterpart, estrone, can be inter-
converted by the action of 17β-hydroxysteroid dehydrogenase 1 and 2 (Labrie et al.,
2000). Most of the metabolism of estradiol occurs in the liver and a significant amount
occurs in skin and adipose tissue (for review see (Grow, 2002). The MCR of estradiol in
women is 615±17 L/day and that of estrone is 980±94 L/day. In men, MCR for estradiol
is 830±30 L/day and that of estrone is 1170±95 L/day (Hembree et al., 1969). There is a
significance decline in the estrogens during perimenopause and immediately after
menopause (Longcope et al., 1986).

13

Progesterone biosynthesis
Progesterone is an important ovarian hormone that plays a significant role in the
normal reproductive functions including ovulation and maintenance of pregnancy. It also
has its influence on non-reproductive tissues such as the brain (for review see Graham
JD, 1997). Progesterone is synthesized from its precursor, pregnenolone which is derived
from cholesterol. The transport of cholesterol into the mitochondria for synthesis of
pregnenolone is the rate-limiting step in the biosynthesis of progesterone. There have
been reports that the biosynthesis of progesterone not only occurs in the peripheral
tissues, but also in the nervous system (Koenig et al., 1995; Inoue et al., 2002). Many
studies have confirmed the presence of all the enzymes required for progesterone
synthesis in glial cells and neurons. During the estrous cycle, the levels of progesterone
fluctuate in the serum as well as in the brain in a specific pattern depending on the period
of the cycle (Morissette et al., 1992). This is closely regulated by feedback mechanisms
involving several steroidal and non-steroidal factors.
Progesterone can be further converted to several metabolites through a variety of
enzymatic reactions. Most of the metabolism of progesterone occurs in the liver.
Progesterone and its metabolites have several important physiological roles in various
target tissues such as the uterus, ovary, breast, brain, and bone. In the uterus and ovary,
progesterone facilitates ovulation and maintenance of pregnancy. In the breast, it helps in
lactation and regulation of cell cycle and growth factors. Aspects of sexual behavior are
controlled by progesterone action in the brain. It is also involved in regulation of bone
14
tissue and prevention of bone loss (reviewed in (Graham JD, 1997; Peluso JJ, 2006).
Progesterone synthesized in the brain is involved in dendritic outgrowth and
synaptogenesis in Purkinje cells (Sakamoto H, 2001). Allopregnanolone (3α, 5α-THP), a
metabolite of progesterone, can modulate GABA
A
receptor mediated plasticity (Concas et
al., 1998). Experiments done with mice that lack functional PR clearly illustrate the
importance of progesterone and its receptors in all its physiological roles (some aspects
reviewed in Conneely OM, 2000).

Steroidogenesis of progesterone in the peripheral tissues
Among the peripheral tissues, the ovary is one of the primary sites of
progesterone biosynthesis. Cholesterol is required as a substrate for the synthesis of
pregnenolone, the precursor of progesterone (Fig. 2). Cholesterol should be in the free-
form and is obtained from either low density lipoproteins (LDL), high-density
lipoproteins (HDL) or by the hydrolysis of cholesterol esters by cholesterol esterase
(Brannian and Stouffer, 1993; Azhar et al., 1998). Free cholesterol is taken into the
mitochondria from the cytoplasm by the action of steroidogenic acute regulatory protein
(StAR) which requires phosphorylation by protein kinase A (reviewed in Stocco, 2001)
and peripheral-type benzodiazepine receptors (PBR). Here it is converted to
pregnenolone by cytochrome P450scc by a side-chain cleavage. The movement of
cholesterol into the mitochondria is the most critical step in the synthesis of progesterone.
Pregnenolone is then transported to the smooth endoplasmic reticulum where it
is converted to progesterone by the enzyme 3β-hydrosteroid dehydrogenase, Δ
5
, Δ
4

15
isomerase (3β-HSD) (reviewed in (Christenson and Devoto, 2003). Progesterone can be
further converted to 5α-dihydroprogesterone (5α-DHP) by the enzymes 5α-reductase and
further reduced to 3α, 5α-tetrahydroprogesterone (3α, 5α-THP or allopregnanolone) by
the action of 3α-hydrosteroid oxidoreductase (Fig 3).
Progesterone is also synthesized by the adrenal glands and is under the control
of adrenocorticotropic hormone (ACTH) (Feder and Ruf, 1969). In women, only a part
of plasma progesterone synthesis occurs in the adrenal gland where as in men, most of
the plasma progesterone comes from the adrenal glands (Eldar-Geva et al., 1998;
Schumacher M, 2007a, b).
16
PBR, StAR
Cholesterol
PREG
Cyt P450scc
Smooth ER
Mitochondrion
3a,5a-THP
5a-DHP
Progesterone
PREG
3a-HSD
5a-reductase
3beta-HSD
PBR, StAR
Cholesterol
PREG
Cyt P450scc
Smooth ER
Mitochondrion
3a,5a-THP
5a-DHP
Progesterone
PREG
3a-HSD
5a-reductase
3beta-HSD
Fig 3: Steroidogenesis of progesterone.

Steroidogenesis of progesterone. Cholesterol is transported into the mitochondria by proteins such as
StAR and PBR, where it is converted into pregnenolone (PREG) by the enzyme cytochrome P450scc.
PREG translocates to the smooth endoplasmic reticulum (ER) and sequentially converted to progesterone,
5α-DHP, and 3α, 5α-THP by the actions of 3β-HSD, 5α-reductase, and 3α-HSD.

17
Neurosteroidogenesis of progesterone
Progesterone is not just synthesized in the reproductive tissues, but it has been
shown that it can also be synthesized in the nervous system and has functions in the brain
(Koenig HL, 1995; Inoue T, 2002). The steps involved in the production of progesterone
from cholesterol are essentially the same as those discussed above (Guennoun et al.,
1995). (Fig. 2, 3)
Apart from being oxidized to progesterone, pregnenolone can also be converted to
17α-hydroxypregnenolone by a microsomal enzyme in the brain (Akwa et al., 1992).
Progesterone is synthesized in Schwann cells in the peripheral nervous system and
oligodendrocytes in the central nervous system (Koenig HL, 1995; Inoue T, 2002). All
the enzymes required for the synthesis of progesterone from cholesterol and few of its
metabolites are present in the glial cells. The progesterone receptors, PR-A and PR-B, are
also expressed in different regions of the brain suggesting that progesterone actions in the
nervous system can be mediated through the PRs (Kato J, 1994). In vitro cerebellar
granule cells treated with progesterone is capable of synthesizing allopregnanolone which
is an indication that neurons may also be involved in biosynthesis of progesterone and its
metabolites and not just glial cells (Follesa P, 2000). It has been shown that cortical and
hippocampal neurons express 20α-hydrosteroid dehydrogenase that is capable of
converting progesterone into an inactive form, 20α-hydroxyprogesterone (20α-DHP) and
allopregnanolone to 20α-hydroxyallopregnanolone (Pelletier et al., 2004).
The production of pregnenolone and its derivatives in the brain is said to be de
novo i.e. synthesized locally and independent of the reproductive biosynthesis. Hence
18
these hormones are also classified as neurosteroids. It is shown that levels of some
steroids such as pregnenolone are generally higher in the brain than in the plasma
(Corpechot et al., 1983). Not much is known about the exact mechanism of stimulation of
progesterone biosynthesis in the brain but is believed to coincide with the LH surge-
induced progesterone production in the ovary. It has been shown that estradiol simulates
the biosynthesis of progesterone from cholesterol in the hypothalamus, perhaps by
increasing the transcription of enzymes such as 3β-HSD (Soma KK, 2005). Progesterone
can also be converted to allopregnanolone in the brain by the enzymes 5α-reductase and
3α-hydrosteroid oxidoreductase, same as in the ovaries (Wilson et al., 1993; Cheney et
al., 1995).
Thus steroidogenesis of progesterone occurs both in the reproductive tissues as
well as in the central and peripheral nervous system.

Progesterone clearance
Several studies have suggested that metabolism of progesterone is continuous and
rapid. Majority of progesterone metabolism and clearance occurs in the liver. Other sites
include brain and uterus (Little et al., 1975). The metabolites form water-soluble
conjugates with glucuronic and sulfuric acid in the liver. They are then removed via bile
and eventually excreted in the urine (reviewed in Berliner and Wiest, 1956). The
metabolic clearance rate (MCR) of a steroid compound is defined as the volume of blood
completely and irreversibly cleared of the steroid in unit time. It is estimated that the
MCR of progesterone is around 2300 L/day in normal women. Of this, about 50% occurs
19
in the liver. Progesterone is primarily converted to 5β-pregnanolones by 5β-reductase in
the liver. The MCR of 5α-DHP in the liver is around 4100 L/day in both men and women
(Dombroski et al., 1993). Progesterone is also metabolized in extra-hepatic tissues as
indicated by studies done in animals that lack liver. However, progesterone metabolites in
these animals do not form conjugates with glucuronic or sulfuric acid and hence are of
low water solubility. They accumulate in the peripheral tissues other than kidney and
adrenal without getting excreted via urine (Berliner and Wiest, 1956). Metabolism of
plasma progesterone to 5α-pregnanolones occurs outside the liver and accounts for about
40% of progesterone clearance. The rest 10% of the plasma progesterone is converted to
20α-DHP in the brain (Bedford et al., 1972). The MCR of 20α-DHP is shown to be 20-
25% lower than that of progesterone as seen in rats, sheep and humans (Billiar et al.,
1973; Waddell and Bruce, 1989). 17-hydroxypregnenolone is metabolized and excreted
as pregnenetriol in the urine (Strott CA, 1970). The levels of progesterone and its
metabolites in the brain were higher than in peripheral blood when radioactive
progesterone and two of its metabolites, 20α-DHP and 5α-DHP, were administered in
female monkeys (Billiar RB, 1975). In an interesting study done in monkeys, it was
observed that the fetus had a higher plasma concentration of progesterone as compared to
the mother due to reduced MCR in the fetus (Ducsay et al., 1985). Factors such as food
intake and body fat increase the MCR of progesterone (Miller et al., 1999).
20
Receptor mediated signaling
Estradiol brings about its physiological effects mainly by signaling through its
receptors – estrogen receptor alpha (ERα) and estrogen receptor beta (ERβ) (Fig 4). ERα
and ERβ are classical nuclear receptors that bind to the ligand through their ligand
binding domain. Following ligand-binding, the receptors attach to estrogen response
element (ERE) on the promoter region of target genes through the DNA binding domain
(reviewed in Matthews and Gustafsson, 2003). ERE typically contain either a complete
palindrome sequence “GGTCAnnnTGACC” or half of the sequence in the case of half-
ERE (Klein-Hitpass et al., 1986). After binding to the target genes either directly or
through cofactors, ERs can regulate the transcription of the genes. This is the classical
genomic estrogen signaling (Fig.5a).
Estradiol has also been shown to induce rapid signaling which are not through
transcriptional activation of target genes. There have been contradicting reports regarding
the presence of a membrane estrogen receptor which could participate in these non-
genomic signaling. Some studies report a novel ER-X membrane receptor (Toran-
Allerand et al., 2002), while others suggest splice variants of ERα and ERβ to be the
membrane receptors (Razandi et al., 1999; Campbell et al., 2002; Watson et al., 2002) or
translocation of classical ERs to the membrane to become membrane receptors (Pedram
A, 2007). This novel receptor, known as ER-X, is reported to be functionally different
from both ERα and ERβ and plays a role in several rapid signaling pathways. Another
candidate for the membrane ER is an orphan G-protein coupled receptor, GPR30
21
(Revankar et al., 2005; Thomas et al., 2005). GPR30 is said to activate rapid estrogen
signaling via ERK (Filardo et al., 2002).
Many rapid signaling pathways such as the mitogen-activated protein kinase
(MAPK) pathway (Migliaccio et al., 1996), phosphotidyl-inositol -3 kinase (PI-3K) /Akt
pathway (Honda et al., 2001), and the protein kinase C (PKC) pathway (Maizels et al.,
1992) have been reported to be activated by estradiol in various target tissues via the non-
genomic mechanism (Fig. 5b).
Similar to estradiol, progesterone also plays several important roles in
maintaining the physiological functions in the reproductive system and neuroendocrine
system. Progesterone has two receptors, progesterone receptor A and B (PR-A, PR-B)
which are isoforms arising from two distinct promoters on a single gene (Fig. 7). PR-B is
said to be the stronger transcriptional activator of the two isoforms (Kumar et al., 1998)
and PR-A can act as a repressor of PR-B-induced gene transcription (Vegeto E, 1993).
PR-A not only represses PR-B but also other steroid receptors such as glucocorticoid
receptor, androgen receptor, mineralocorticoid receptor and ER-induced transcription
(Vegeto E, 1993; McDonnell and Goldman, 1994; Wen DX, 1994). As in the case of
estrogen signaling, majority of progesterone signaling occurs through the binding of
progesterone to PRs via their ligand binding domain, followed by binding of the ligand-
receptor complex to the progesterone response element (PRE) on the promoter region of
the target genes through the DNA binding domain leading to the regulation their
transcription (Fig. 5a).
22
A/B
A/B
C
C
D
D
E
E
F
F
hERα α α α
hERβ β β β
1
F
1
595
530
Fig. 4: Simplified model of estrogen receptor structures.

Simplified model of estrogen receptor structures. The above model shows the various domains (A-F) in
estrogen receptors, ERα and ERβ. C contains the DNA-binding domain and E contains the ligand-binding
domain. There also 2 activating factors (AF-1 and AF-2). AF-1 is present in the A/B domain and AF-2 is
present in E along with the ligand-binding domain.
23
Progesterone also signals through rapid non-genomic pathways such as Src/Ras/Erk
signaling pathway (Migliaccio et al., 1998). A class of membrane progestin receptors
have been identified which are structurally distinct from the PRs and similar to seven-
transmembrane G protein-coupled receptors (Zhu et al., 2003a; Zhu et al., 2003b). These
receptors are not inhibited by the classical antiprogestins such as RU486 (reviewed in
Peluso JJ, 2006). Scientists have also suggested membrane translocation of nuclear PRs
(Pedram A, 2007) as well as binding of progestagens to other membrane receptors such
as GABA
A
receptors (reviewed in Schumacher M, 1999) as other means for initiating
rapid signaling (Fig. 6). It has been shown that 3α-tetrahydroprogesterone facilitates the
release of gonadotropin-releasing hormone via the GABA
A
receptor binding (el-Etr et al.,
1995). The sulfate ester form of pregnenolone acts as an inhibitor of GABA activity
(Majewska et al., 1988).
A third type of signaling known as “ligand-independent signaling” is also
responsible for certain functions of the hormone receptors. In this case, the ERs and PRs
bind to factors other than estrogens and progesterone, respectively. ERs can be activated
by growth factors such as epidermal growth factor (EGF) and insulin-like growth factor
(IGF) in the absence of estrogens (reviewed in (Smith and Hughes, 1998; Hall et al.,
2001). Similarly, PRs can be activated by growth factors, cAMP, and dopamine (Aronica
and Katzenellenbogen, 1991; Power et al., 1991a; Power et al., 1991b) (Fig. 5c).
24
R
R
TARGET GENE HRE
R
Hormone
Cell
Nucleus
R
TARGET GENE HRE
X
R
R
TARGET GENE HRE
R
Hormone
Cell
Nucleus
R
TARGET GENE HRE
X
GENE
Hormone
Cell
Nucleus
GENE
R R
R
mRNA
Protein
Rapid signaling
Cellular responses
GENE
Hormone
Cell
Nucleus
GENE
R R
R
mRNA
Protein
Rapid signaling
Cellular responses
Fig 5: Different types of hormone signaling

25
GENE
IGF-1, EGF, cAMP etc.
Cell
Nucleus
GENE
R R
R
P
R
P
R
P
HRE
HRE
X
GENE
IGF-1, EGF, cAMP etc.
Cell
Nucleus
GENE
R R
R
P
R
P
R
P
HRE
HRE
X
Fig 5: Different types of hormone signaling - Continued

Different types of hormone signaling. a) Classical genomic pathway of steroid hormone signaling.
R=hormone receptor; HRE= hormone response element. b) Non-genomic signaling pathway for steroid
hormones. R=membrane hormone receptors. c) Ligand-independent signaling of hormone receptors.
R=membrane hormone receptor; P=phosphorylation; HRE= hormone response element.

26
GENE
Cell
Nucleus
GENE
R G
R
P
R
R
PRE
PRE
X
R
R
IGF-1, cAMP etc.
Rapid signaling
Cellular responses
R
R
Progesterone
a
b
c
R
R
G
Nuclear PR
Membrane PR
Non-PR receptors like GABA-R
GENE
Cell
Nucleus
GENE
R G
R
P
R
R
PRE
PRE
X
R
R
IGF-1, cAMP etc.
Rapid signaling
Cellular responses
R
R
Progesterone
a
b
c
R
R
G
Nuclear PR
Membrane PR
Non-PR receptors like GABA-R
R
R
G
Nuclear PR
Membrane PR
Non-PR receptors like GABA-R
Fig 6: Genomic and non-genomic signaling pathways of progesterone.

Genomic and non-genomic signaling pathways of progesterone. (a) Progesterone binds to classical
nuclear PR to regulate transcription of target genes – genomic pathway. (b) Progesterone and its
metabolites bind to membrane PRs or other receptors such as GABA receptor and activate rapid signaling
mechanisms – Non-genomic pathway. (c) Factors such as growth hormones, cAMP bind to membrane PRs
to activate signaling in the absence of the regular ligand, progesterone – ligand-independent pathway.

27
A/B
A/B
C
C
D
D
E
E
PR-B
PR-A
1 923
Fig. 7: Simplified model of progesterone receptor structures.

Simplified model of progesterone receptor structures. The above model shows the various domains (A-
E) in progesterone receptors, PR-A and PR-B. C contains the DNA-binding domain and E contains the
ligand-binding domain. There also 3 activating factors (AF-1 and AF-2). AF-1 and AF-3 are present in the
A/B domain and AF-2 is present in E along with the ligand-binding domain. An inhibition factor (IF) is
also present in the A/B domain between the two activating factors. (Adapted from (Brinton et al., 2008)
28
Estrogen and progesterone receptors in the brain

Estrogen receptors
Estrogen signaling occurs through two main classical nuclear estrogen receptors,
alpha and beta (ERα, ERβ). Both these receptors are found in the estrogen target tissues
such as the uterus, placenta, bone, breast and the brain. In the brain, ERs are found in
regions controlling the reproductive behaviors such as the hypothalamus as well as
regions involved in cognition and memory such as the hippocampus, amygdale and
cortex (Fig. 8) (Pettersson et al., 1997; Gustafsson, 1999; Shughrue et al., 1997a).
There is a differential pattern of expression of ERα and ERβ in the brain regions.
For example, ERβ is shown to be more abundant than ERα in the hippocampus whereas
ERα is more abundant in ventromedial hypothalamus (Shughrue et al., 1997a). Both the
receptors are shown to decline with age in the brain (Mehra et al., 2005; Adams et al.,
1997) but most studies have shown no gender differences (Li et al., 1997; Azcoitia et al.,
1999; Solum and Handa, 2001; Kalita et al., 2005).

29
Dentate Gyrus
CA1 CA3
Cortex
Hypothalamus Amygdala
CA3

Fig. 8: ERα α α α and ERβ β β β distribution in the rat brain.

ERα α α α and ERβ β β β distribution in the rat brain. The diagram summarizes the distribution of ERα (closed
circles) and ERβ (open circles) as determined by immunoreactivity studies (Perez et al., 2003; Hert et al.,
2001; Solum et al., 2001; Butler et al., 1999; Cintra et al., 1986; Shughrue et al., 2001; (Li et al., 1997;
Azcoitia et al., 1999).

30
Progesterone receptors
The classical progesterone receptors (PR) exist in two isoforms, PR-A and PR-B, arising
from a single gene (Fig. 7). Of these, PR-B is the full-length isoform and PR-A lacks the
N-terminal sequences (Conneely et al., 1987b; Conneely et al., 1987a). Similar to the
ERs, there are several splice variants of the classical PRs too (Hirata et al., 2002;
Hisatomi et al., 2003).
Studies done in the PR-knockout mice suggest that progesterone signaling in the
brain occurs through pathways that involve factors other than the classical PRs (Krebs et
al., 2000). These could via membrane progesterone receptors or through other receptors
such as GABA-R. Recently, a seven-transmembrane protein, known as 7TMPR, that is
capable of binding to progesterone has been identified (Zhu et al., 2003a).
Classical PRs have been identified in the hippocampus and the frontal cortex
among other regions (Fig. 9) (Guerra-Araiza et al., 2000; Guerra-Araiza et al., 2003).
There are reports of sex differences in the PR expression in certain brain regions such as
the cerebellum and not in others like the bed nucleus of the stria terminalis and amygdala
(Auger and De Vries, 2002; Guerra-Araiza et al., 2003). Estradiol also induces PR-A
expression in hippocampus and cerebellum (Guerra-Araiza et al., 2003). The 7TMPR is
also found in several brain regions including the cortex (Zhu et al., 2003a).
31
Dentate Gyrus
CA1 CA3
Cortex
Hypothalamus Amygdala
CA3
Fig. 9: PR distribution in the rat brain.

PR distribution in the rat brain. The diagram summarizes the distribution of PR-A and PR-B in the rat
brain as determined by immunoreactivity, RT-PCR and in situ studies (Kato J, 1994; Guerra-Araiza et al.,
2000; Guerra-Araiza et al., 2003) Adapted from: (Brinton et al., 2008)

32
Regulation of receptor expression by estradiol and progesterone

Effect of estradiol on progesterone receptor expression
PRs have estrogen-response elements (ERE) in their promoter region and their
mRNA levels are increased by estrogens in various target tissues (Romano GJ, 1989;
Chauchereau A, 1992; Prange-Kiel J, 2001; Scott RE, 2002; Clarke RB, 2003). Since ER-
antagonists such as ICI 182,780 block the increase of PR expression (Kumar et al., 1998),
the estrogen-induced PR expression might be through the classical genomic ERs that bind
to ERE and regulate transcription. Both the human PR isoforms lack a complete ERE
sequence, but have a half-ERE and adjacent cofactor binding sites which help in
estrogen-induced transcription of human PRs (Petz and Nardulli, 2000; Petz et al., 2002;
Schultz et al., 2003). The increase of PR by estradiol is not affected by age in female rat
hypothalamus (Funabashi et al., 2000). Estradiol is shown to bring about sexual
dimorphism by differential activation of PRs in certain regions of the male and female
brain (Lauber et al., 1991). Testosterone also contributes to this sex-specific difference in
PR expression after aromatization to estradiol (Quadros et al., 2002). Progesterone
receptor activation in vivo is shown in response to PPT (a ERα agonist) but not DPN (a
ERβ agonist), suggesting that estradiol signals through ERα to increase the expression of
PR (Harrington et al., 2003; Chung et al., 2006). But data from ERα knockout mice do
not show a significant difference in PR expression as compared to the control mice when
treated with estradiol, suggesting that the mechanism for PR transcriptional activation
endogenously may be through a combination of both ERα and ERβ. Experiments have
33
shown that the progestins activate Src/p21ras/ERK-rapid signaling pathway via estradiol
through the binding of PR-B with ERα (Migliaccio et al., 1998; Ballare C, 2003). This
demonstrates a non-genomic cross-talk between estrogens and progesterone.

Effect of progesterone on estrogen receptor expression
Progesterone was first shown to antagonize estrogen action in the uterus where
treatment of progesterone decreased the ER expression in estrogen-treated rats (Hsueh
AJ, 1975; Graham JD, 1997). Treatment of cultured hamster endometrial cells with
progestins also resulted in a decrease in ER protein levels and suggested that progestins
could be inhibiting the synthesis of ERs as well as destabilizing the ER protein (Takeda
A, 1986). In several studies done in breast cancer cells, progesterone has been shown to
decrease ER at the mRNA level by inhibiting their transcription rather than affecting the
mRNA stability (Read LD, 1989; Alexander IE, 1990). A contradicting study shows that
treatment with certain synthetic progestins show an increase in ERα mRNA expression in
liver and muscle (Pfaffl et al., 2002).
Progesterone has also been reported to antagonize estrogen action without
affecting ER expression levels, even though the exact molecular mechanism behind this
effect is not clear. One such example of progesterone antagonism is on the expression of
PR itself. Several reports suggest that progesterone is capable of inhibiting the
transcription of PRs and other estrogen target genes although this is not by the down-
regulation of ER expression or by competitive target DNA binding (Bradshaw et al.,
1991; Chalbos and Galtier, 1994; Savouret et al., 1994; Wen DX, 1994), suggesting
34
either down-regulation or sequestration of cofactors involved in the transcriptional
activation by estrogens.
In order to function in receptor regulation and signaling interactions as
mentioned above, the receptors of estrogen and progesterone need to be expressed in
close proximity. Several studies have demonstrated co-expression of ERs and PRs in the
target tissues (Gahr, 2001; Greco et al., 2001). The coexpression in certain brain areas
also coincided with crucial periods of hormone action during development such as sexual
differentiation (Roselli et al., 2006).

35
3. Estradiol and progesterone interaction
Estradiol and progesterone have been shown to interact in several tissues. Soma et
al., (2005) have demonstrated that estradiol is capable of increasing the mRNA
expression and activity of 3β-hydroxysteroid dehydrogenase (3β-HSD) in the
hypothalamus which is required for synthesis of progesterone from pregnenolone, thus
indirectly increasing the local synthesis of progesterone in the brain (Soma KK, 2005).
On the other hand, progesterone is known to increase the expression of the enzyme, 17β-
hydroxysteroid dehydrogenase (17β-HSD) which converts biologically active estradiol to
an inactive estrone in the human endometrial tissue (Yang S, 2001). During the estrous
cycle, levels of estradiol and progesterone fluctuate corresponding with effects on
estrogen-mediated and progesterone-mediated processes. During the luteal phase of the
estrous cycle, the corpus luteum is fully functional and the progesterone levels are high
and estradiol levels are low. By the end of the luteal phase, progesterone activity goes
down due to the down-regulation of its own receptors and ultimately progesterone levels
drop. This results in the restoration of estrogen receptor activity coincided with
increasing estradiol levels, known as the follicular phase. Thus, even during the estrous
cycle, there is evidence of interaction between these two hormones.
As mentioned in the previous section, progesterone receptors (PR) have
estrogen-response elements (ERE) in their promoter region and their mRNA levels are
increased by estradiol in various target tissues (Romano GJ, 1989; Chauchereau A, 1992;
Prange-Kiel J, 2001; Scott RE, 2002; Clarke RB, 2003). Estradiol is shown to bring about
sexual dimorphism by the differential activation of PRs in certain regions of the male and
36
female brain (Lauber et al., 1991). Progesterone interacts with estradiol to increase
expression of several genes such as choline acetyltransferase and oxytocin receptor
(Schumacher et al., 1989; Gibbs and McNabb, 1996) and in controlling lordosis (Yanase
and Gorski, 1976) and LH surge (Everett and Tyrey, 1982).
Clinical studies and basic research studies have shown that progesterone is
capable of blocking several functions of estradiol in various tissues, including the brain.
Progesterone has also been shown to antagonize estrogen action in the uterus (Hsueh AJ,
1975), endometrial cells (Takeda A, 1986) and breast cancer cells (Read LD, 1989;
Alexander IE, 1990) by decreasing the ER expression. In the brain, P
4
treatment can
inhibit several beneficial E
2
-induced effects, including regulation of neurotrophins such
as NGF, NT3, and BDNF in entorhinal cortex (Bimonte-Nelson HA, 2004), Bcl-2
expression in hypothalamus (Garcia-Segura LM, 1998), choline acetyltransferase
activity in nasal forebrain cholinergic neurons (Gibbs, 2000), hippocampal spine density
(Woolley and McEwen, 1993; Murphy and Segal, 2000), neuroprotection against kainate
lesion (Rosario ER, 2006), and β-amyloid accumulation in hippocampus and frontal
cortex (Carroll et al., 2007). The exact mechanism of this inhibitory action is not clear.
One of the ways by which the ligand-receptor-mediated function can be controlled, is by
altering the availability of the receptors. Accordingly, the activity of estradiol could
possibly be controlled by altering the levels of ER. In chapter 2, we investigate this
aspect of progesterone-estrogen interaction using primary neurons as well as in vivo
animal model. This study is important in designing HT regimens that have maximum
clinical benefits while minimizing the risks.
37
Estradiol and progesterone interaction in the brain
Estradiol and progesterone act as neuroendocrine hormones that regulate several aspects
of the nervous system such as synaptic plasticity, expression of neuronal factors, and
behavior. In vivo and in vitro studies have been conducted to elucidate the interactive
mechanism of these hormones in the brain by treating animals with estradiol, progestins
and a combination of both under different paradigms. The ease of manipulation of the in
vitro cell culture system has lead to the use of several neural cell lines and primary cell
culture models to study aspects of hormone signaling. These studies are aimed at
providing more mechanistic details of the effects elicited by the hormones.

38
Table 1: Estrogen and progesterone interactions in the brain.

Cell Type Parameter Duration
of E 2
Duration
of P 4/
MPA
Duration
of E 2+P 4/
MPA
Interval
between
E 2 & P 4
Effect of
E 2+P 4/ MPA
Interaction
Genomic (G)
vs. non-
genomic (NG)

Basal
Forebrain
neurons
ChAT
mRNA
Up to 72
hrs
5 hr &
24 hr
- 48 hrs Additive;
↑ ChAT
mRNA
G & NG In vivo
2 weeks - 2 weeks
Cyclic
Continuous
- Cyclic - ↑
Continuous -
↓
G & NG In vivo
Hypothalamic
neurons
Bcl-2 24hrs 24 hrs 24hrs - Antagonistic;
↓ Bcl-2
G In vivo
(Ovx)
Lordosis
Behavior
5 days @
POA; 21
hrs
@MRF
30 min to
3 hrs –
for 2
days
? 21hrs Positive;
↑lordosis
facilitation
G & NG via
OTR
In vivo
(Ovx)
Pituitary cells LH surge 1 day 1 day - 24hrs Positive;
↑ LH surge
to normal
levels
G via GnRH
release
In vivo
FSH release 96 hrs 48hrs 48hrs - Positive;
↑ FSH
release
G via activin In vitro
Hippocampal
neurons
Neuro-
protection
2 weeks 2 weeks 2 weeks - Antagonistic;
↓ neuro-
Protection
G via ↓ER In vivo
(Ovx)
BDNF,
NGF, NT3
mRNA
Approx.
1 month
Approx.
1 month
Approx1
month
- Antagonistic;
↓ mRNA
G via ↓ER In vivo
(Ovx)
Dementia 7 weeks 4 weeks 4 weeks - Antagonistic;
↑dementia
related
symptoms
G via ↓
synaptogenesis
Clinical
Memory - - 6 yrs - Antagonistic;
↑dementia
related
symptoms
G via ↓
synaptogenesis
Clinical
Water Maze 1 week 1 week 1 week - Positive;
↑
performance
NG via 3α,5α-
THP
In vivo
(Ovx)
pCREB 20hrs 20 hrs 20 hrs - Antagonistic; NG via 3α,5α- In vitro
39
Spine
density

48 hrs

48 hrs

48hrs
↓ pCREB
↓ spine
density
THP, ↓ PKA
Neuro-
protection
48hrs 48hrs 48hrs - ↑protection
(P 4);
↓protection
(MPA)
G via Bcl-2 In vitro
Uterine
endometrium
Cells
PGF 2α
secretion
5-15 days 5-15 days 5- 15 days - Positive;
↑PGF2α α α α
secretion
G In vivo
(Ovx)
EGF
receptor
6 days 6 days 6 days - Additive;
↑ EGFR
G via ER &
PR
In vitro
VEGF
release
48hrs +
48hrs
48hrs 48hrs - Positive;
↑ VEGF
release
G In vitro
Breast cells Proliferation 1-3
weeks
1-3
weeks
1-3 weeks - No effect on
proliferation
- In vitro
(graft)
Proliferation 2-3
weeks
2-3
weeks
2-3 weeks - Positive;
↑
proliferation
G via ER &
PR
In vitro
Bone cells BMD - - 5-7 yrs - Positive;
↑ BMD
? Clinical
Cardiac
myocytes
Neuron-
protection
- - - - Antagonistic;
↓ neuron-
Protection
NG via MR In vivo
(Ovx)
Smooth
muscle cells
Proliferation 2-6 days 2-6 days 2-6 days - Additive;
↑
proliferation
G In vitro

Table 1: Estrogen and progesterone interactions in the brain - Continued

40
Basal Forebrain neurons:
Estradiol and progesterone have shown to affect the expression level of choline
acetyltransferase (ChAT) mRNA in the basal forebrain of female rats during the course
of the estrous cycle. According to the study reported by Gibbs 1996, in normal female
rats, the ChAT mRNA levels were highest in nucleus basalis magnocellularis (NBM)
during diestrus 2 when estradiol levels are also high. In ovarectomized rats that received
a single dose of estradiol, ChAT mRNA levels increased in a time-dependent manner
being highest at 24hrs in the medial septum (MS), at 72 hrs at the NBM, and at 5hrs at
the striatum. This expression level was further increased by progesterone treatment for 5
hr (in NBM and striatum) or 24 hrs (in all three regions) 2 days after estradiol treatment
(Gibbs and McNabb, 1996). There are many ways by which these hormones could be
functioning to regulate ChAT expression. One possibility is that estradiol stabilizes the
ChAT mRNA in striatum and up-regulates both synthesis and stability in the other two
regions. Progesterone could act rapidly through GABA receptors in NBM and striatum to
further increase or stabilize the ChAT mRNA within a short period of time where as
genomic pathways may play a role in the MS. Another similar study was done over a
longer time period of two weeks, in which the hormones were either given continuously
for the whole time period, or were injected every third day (cyclic). For estradiol and
progesterone combination treatment, both hormones were given together continuously
through out the period of experiment or in case of cyclic treatment, progesterone was
given 2 days after estradiol treatment and this was repeated every 3 days. The animals
were sacrificed 24 hrs after the last injection. This study showed that estradiol given
41
continuously and estradiol + progesterone in a cyclic manner also caused ChAT
expression to increase significantly, whereas estradiol + progesterone given continuously
caused a decrease in ChAT expression (Gibbs, 2000). This study suggests that hormonal
interactions during the continuous hormone treatment might activate negative feedback
mechanism after a certain time period greater than 24 hrs through which the ChAT
mRNA levels are decreased as compared to the cyclic treatment. Hence the timing of
progesterone treatment with respect to estradiol treatment seems to be important in
determining the type of interaction between the two hormones.

Hypothalamic, pituitary and brain stem neurons:
Estradiol and progesterone regulate the female sexual behaviors such as lordosis
by functioning at specific brain regions (Molenda-Figueira et al., 2006). Ovarectomized
rats were implanted with progesterone at the progesterone sites of lordosis behavior in the
brain (mesencephalic reticular formation – MRF and caudate-putamen-CPU). The
behavioral tests were conducted 30 min to 3 hrs post-treatment on two consecutive days.
The progesterone cannulae were replaced with blank cannulae between the two
treatments. In another set of animals, a similar procedure was carried out, except that
instead of using blank cannulae between the progesterone treatments, cannulae
containing estradiol benzoate were inserted. In both sets of animals, estradiol benzoate
was also inserted in the pre-optic-diagonal band area (POA) three days prior to the first
progesterone treatment and was left undisturbed until the end of the experiments. The
results showed that the first progesterone treatment facilitated lordosis behavior while the
42
second treatment on the next day had no effect. In the experiment with the intermediate
estradiol benzoate exposure to MRF, even the second treatment of progesterone
facilitated lordosis behavior, suggesting a possible interaction between estradiol and
progesterone signaling in regulation of lordosis behavior (Yanase and Gorski, 1976). This
indicates that there is a critical window of time after the estradiol treatment within which
progesterone can induce lordosis behavior. After the critical period has passed
progesterone addition has no effect and requires subsequent estradiol application to be
able to regulate the behavior. The regulation of lordosis behavior by estradiol and
progesterone seems to be a combination of both genomic and non-genomic pathways.
Estradiol treatment transcriptionally activates the receptor for oxytocin (OTR), a
neuropeptide important for the facilitation of lordosis behavior. The consequent
progesterone treatment increases the OTR activity in a rapid manner without the
synthesis of new OTR, suggesting that this is through a non-genomic pathway
(Schumacher et al., 1989). The turnover rate of OTR and the need for synthesis of new
OTR may be some of the factors that dictate the critical time period for progesterone to
be effective following estradiol treatment.
Progesterone and estradiol also control other non-steroidal hormones involved
in the estrous cycle. During the estrous cycle, the level of luteinizing hormone (LH)
which is secreted by the pituitary gland spikes in response to estradiol and progesterone.
In studies done in cyclic middle-age rats, it was observed that the LH surge was smaller
than normal when estradiol benzoate was given on day 2 of the 5-day cycle or
progesterone on day 3. However, when estradiol benzoate was given on day 2 followed
43
by progesterone on day 3, the LH surge returned to the normal level. The LH levels were
determined one day after the individual injections and on day 4 for combination
injections (Everett and Tyrey, 1982).
In experiments done using primary cells from anterior pituitary of rats, it was
seen that 48 hr progesterone treatment increased the basal and activin-stimulated FSH
(Follicular stimulating hormone) release and also increased intracellular FSH in the
presence of estradiol, as compared to the absence of estradiol. This effect of progesterone
on FSH was completely abolished by antiprogestins (Szabo et al., 1998).
As in the above cases, progesterone does not always have a co-operative role
with estradiol. In most studies, progesterone acts as a repressor or antagonist of estradiol
action. This kind of counteracting function of progesterone as seen in the experimental
paradigms suggests that such mechanism might be required to maintain the balance of
estradiol functions within the cells.
Progesterone inhibits estrogen-induced neuroprotection by down-regulating
estrogen target genes that are anti-apoptotic and neurotrophic. In ovarectomized Wistar
albino female rats, injections of estradiol, progesterone, combination of the two hormones
or vehicle control were given and the animals were sacrificed 24 hrs post-injection.
Estradiol treatment resulted in a dose-dependent increase in the number of neurons
expressing Bcl-2, an anti-apoptotic factor, in the hypothalamus as compared to the
control. Progesterone by itself had no effect on Bcl-2 expression, but when given in
combination with estradiol, it counteracted the increase of Bcl-2 expression by estradiol
(Garcia-Segura LM, 1998).
44
Hippocampal and cortical neurons:
Progesterone has been shown to inhibit the beneficial neuroprotective effects of
estradiol even in hippocampus as seen in ovarectomized adult female rats implanted with
silastic capsules with no hormone, estradiol, progesterone, medroxyprogesterone acetate
(MPA), or estradiol + progesterone/MPA. After two weeks of hormone treatment, the rats
were subjected to kainite lesions at the hippocampal region and sacrificed three days after
the lesion. Upon analysis, it was found that with estradiol alone, there was an increase in
neuron survival in the lesion area. But when progesterone or MPA were given by
themselves there was no significant neuronal viability as compared to the controls. When
estradiol was given simultaneously with either progesterone or MPA, the neuroprotective
effect of estradiol was completely lost (Rosario ER, 2006). This suggests that
progesterone is able to block estradiol induced pathways for neuroprotection. Exactly
how progesterone is able to inhibit estradiol action in the brain is still not clear.
Preliminary data from our lab indicates that one of the ways by which progesterone can
repress estradiol neuroprotective function is by down-regulating the ER expression as
seen in the primary hippocampal and cortical cultures (Jayaraman and Pike, 2009).
Progesterone also inhibits the up-regulation of different neurotrophins by
estradiol as seen in ovarectomized aged rats which were given estradiol, estradiol +
progesterone, or vehicle control pellets for about a month. When analyzed, estradiol
seemed to have increased the mRNA expression of several neurotrophins such as BDNF
(brain-derived neurotrophic factor), NGF (nerve-growth factor), and NT3 (neurotrophin
3) as compared to the control animals. A combination treatment of estradiol and
45
progesterone did not increase the mRNA levels as compared to the controls in the regions
such as hippocampus, entorhinal cortex and frontal cortex (Bimonte-Nelson HA, 2004).
Rat hippocampal primary neuron cultures were treated with estradiol or
progesterone or combination of the two hormones for 18-20 hrs to measure BDNF and
phosphorylated CREB and for 48 hrs to measure spine density. It was seen that
progesterone in combination with estradiol did not block the decrease in BDNF
expression caused by estradiol. However, progesterone blocked the increase in pCREB
and the increase in spine density caused by estradiol when co-administered. Since there is
no evidence of hippocampal expression of PRs, progesterone might be acting thought
non-classical mechanisms to inhibit estradiol action. It has been shown that progesterone
can be converted to 3α, 5α-tetrahydroprogesterone (THP) in the hippocampal culture
which is an enhancer of GABAergic signal. An increase in GABAergic signal leads to
the inhibition of cAMP-dependent PKA pathway necessary for phosphorylation of CREB
and increase in spine density (Murphy and Segal, 1996, 2000).
The interactions between progesterone and estradiol also have clinical
relevance. The decline of sex steroid hormones after menopause has been implicated to
be a risk factor for Alzheimer’s disease (AD). As a consequence, hormone replacement
therapies (HRT) have been suggested as a treatment option for postmenopausal women.
Several studies have been done with conjugated equine estrogen (CEE) treatment and
CEE/progestin (MPA) combination treatments using variable paradigms. One such study
done to determine the effect of these hormones on dementia in women with AD
suggested that estradiol treatment for 7 weeks caused an improvement in the tests
46
performed by these women whereas addition of MPA from the 4
th
week along with
estradiol worsened the performance as compared to estradiol alone for 7 weeks (Honjo H,
2005). In the Women’s Health Initiative Memory study, postmenopausal women (65
years and older) were given CEE + MPA or placebo for about 6 years at the end of which
they were tested for incidence for probable dementia and mild cognitive impairment. The
cotreatment with estradiol and progestin increased the risk for dementia and did not
prevent mild cognitive impairment (Shumaker et al., 2003). This is in accordance with
several experimental reports which indicate that progesterone antagonizes estradiol
action.
On the contrary, there are reports of progesterone being beneficial in
combination with estradiol treatment in the hippocampus resulting in improved cognitive
behavior. Vongher and Frye reported that when ovarectomized rats were given estradiol,
progesterone or estradiol + progesterone pellets for one week, they found that the rats
with estradiol + progesterone, improved in the water maze performance and showed
increased neuroprotection compared to the controls. The authors speculate the
mechanism in this case is by the conversion of progesterone to its metabolite, 3α, 5α-
THP, and activation of GABAergic signaling (Frye and Vongher, 1999a, b). Comparing
this study to the reports by Murphy and Segal (Murphy and Segal, 1996, 2000)
mentioned before, the difference seems to be again in he duration of treatment leading to
opposite results (Murphy and Segal, 1996, 2000).
In contrast to the previously mentioned in vivo study by Rosario et al. (2006), in
primary rat hippocampal neuronal culture conditions, pretreatment of 48hrs with
47
progesterone and 19-norprogesterone showed neuroprotection against glutamate toxicity
when analyzed 24 hrs after the 5 min glutamate exposure either when treated alone or
when co-administered with estradiol. However, MPA showed no neuroprotection and
blocked estrogen-mediated neuroprotection (Nilsen and Brinton, 2002; Rosario ER,
2006). This study also showed that the mechanism of this differential effect of different
progestins on neuroprotection is because of the activation of Bcl-2 by progesterone
(which is also in contrast to the in vivo data by Garcia-Segura et al., 1998 (Garcia-Segura
LM, 1998) and 19-norprogesterone and not by MPA either alone or with estradiol.
All these studies again suggest that the timing and duration of progesterone
treatment with respect to estradiol are very significant in determining the type of outcome
in different cell types.

Estradiol and progesterone interaction in other tissues
a. Interaction in reproductive tissue:
Estradiol and progesterone were first recognized as the major female ovarian
hormones, before being known to be neurosteroids. The levels of progesterone and
estradiol, along with other important gonadotropin hormones such as FSH and LH, are
regulated throughout the estrous cycle in a specific pattern in order to bring about normal
functioning of the female reproductive system. This regulation is more or less similar
across different mammalian species. Progesterone also plays a role in the maintenance of
pregnancy. The progesterone levels are high during this luteal phase of the estrous cycle
48
as well as during pregnancy. Interestingly, a drop in the progesterone levels coincides
with an increase in estradiol levels during estrous cycle.

Uterine Endometrial cells:
In ovarectomized ewes, the treatment with progesterone either by itself or in
combination with estradiol seemed to increase the secretion of prostaglandin F
2α
from the
uterus in response to oxytocin. The ovarectomized ewes were treated with estradiol
capsules, progesterone injections (every 12 hrs) or a combination of estradiol capsules
and progesterone injections. After 5, 10, and 15 days, oxytocin was injected into the
animals and blood samples were analyzed for secreted prostaglandin F
2α
. Only on day 15,
oxytocin injection stimulated uterine secretion of prostaglandin F
2α
and that too with
progesterone treatment and the combination treatment, but not with estradiol alone
treatment (Homanics and Silvia, 1988). This suggests that long-term progesterone
treatment increases the ability of uterus to respond to oxytocin in ovarectomized ewes.
Since the effect of combination of hormones was greater than progesterone alone, it
suggests that an interaction between the two hormones is required for optimal secretion
of prostaglandin F
2α
in the uterus. As the effect is seen only after prolonged treatment
with the hormones, it suggests genomic transcription and accumulation of factors such as
oxytocin receptor over time that leads to the secretion, rather than a rapid signaling effect.
In endometrial cell culture, estradiol and progesterone have been shown to
affect the epidermal growth factor (EGF) binding by altering the expression levels of the
EGF receptor in these cells. According to a study done by Watson et al. (1996), the cells
49
treated with either estradiol or progestin caused an increase in EGF receptor expression in
a dose dependent manner (Watson et al., 1996). A combination of estradiol and progestin
treatment increased the EGF receptor expression higher than the individual hormone
treatments. This hormonal effect was inhibited by both ER and PR inhibitors, suggesting
that this effect might be through classical genomic pathways involving ERs and PRs. In
epithelial culture from the endometrium, the cells were primed with estradiol for 48hrs
before treating for an additional 48hrs with estradiol, MPA or estradiol + MPA. On
measuring the vascular epidermal growth factor (VEGF) release from the epidermal cells,
MPA showed an increasing effect on VEGF release either alone or in combination with
estradiol (Shifren et al., 1996; Classen-Linke et al., 2000). In fibroblasts, this effect of
MPA on VEGF was reversed in accordance with other previous study done in endothelial
stromal cells. MPA did not cause a increase in VEGF release in fibroblasts as it did in the
epithelial cells suggesting a cell-specific regulation by sex hormones (Classen-Linke et
al., 2000).
Using human endometrial long term cultures, it was shown that estradiol
treatment up-regulated the mRNA expression of ERα, PR-A and PR-B, whereas estradiol
treatment along with progesterone decreased the effect of estradiol alone on these
receptor mRNA levels (Prange-Kiel J, 2001).

Breast cells:
Breast cells undergo increased proliferation during high hormone levels in
estrous cycle. To determine the contributions of estradiol and progesterone to this
50
increased proliferation, studies were conducted in female athymic nude mice with
subcutaneous implants of human breast tissues where the breast tissue grafts were
removed 1,2, and 3 weeks after hormone treatments. In the mice treated with vehicle,
progesterone or low estradiol concentration, the tissue from the graft showed low
proliferation of epithelial cells. High estradiol concentration showed significantly higher
proliferation rate. Progesterone added along with high estradiol did not affect the rate of
proliferation, suggesting that the increased cell proliferation seen during the estrous cycle
was mainly due to estradiol (reviewed in (Clarke RB, 2003)).
In another study done to look at the effect of estradiol and MPA on breast cell
morphology, proliferation, and apoptosis, breast tissue explants were cultured and treated
with either estradiol or MPA or both for either 2 or 3 weeks. The authors demonstrate
that all of the treatment conditions lead to an increase in the rate of proliferation of the
epithelia and also down-regulation of ER and PRs though with varying degree (Eigeliene
et al., 2006). This report is in contrast with other reports regarding receptor expression
that show that in cultured breast tissues treated for two weeks, addition of estradiol
increases both ERs and PRs, but MPA down-regulates PR either by itself or in
combination with estradiol (Zhuang et al., 2003).

b. Interaction in other tissues:
Bone cells:
The Women’s Health Initiative conducted a study to look at the effect of
estrogen and progestin combination treatment on bone mineral density and the risk for
51
osteoporosis and fractures. Postmenopausal women were given either placebo tablets or
CEE + MPA tablets for about 5 to 7 years. The follow-up study done after this time
period suggested that the women taking the CEE+MPA tablets showed higher bone
mineral density and lower risk for fractures as compared to the placebo group (Cauley et
al., 2003).

Cardiac myocytes:
Western blot analysis has shown the presence of both ER and PR in the myocytes.
In primary cardiac myocyte cultures, treatment with either estradiol or progesterone for
10 hrs caused the activation of unbound Heat-Shock factor 1 (HSF-1) and an increase in
the levels of heat shock protein 72 (HSP72). Even though this is shown to occur by the
binding of the hormones to their receptors it does not lead to transcriptional activation of
HSF-1, but rather frees it from a bound inactive form and enables it to up-regulate HSP72
(Knowlton and Sun, 2001).
The above study did not focus on the interaction of progesterone and estradiol
when administered together in cardiac myocytes. The following study done in
aldosterone-treated rats, a model for looking as cardiovascular function, addresses this
issue. Uncontrolled activation of mineralocorticoid receptors (MR) by aldosterone are
seen in cardiac hypertrophy, hypertension, and leads to cardiac failure. Estradiol has been
shown to be protective against MR activation in ovarectomized rats co-treated with
aldosterone and estradiol. When MPA is added along with estradiol, the protective effect
of estradiol is reduced, suggesting that MPA antagonizes estradiol-induced pathways in
52
myocardial tissue (Arias-Loza et al., 2006). The reason for this could be the fact that
progesterone can bind to mineralocorticoids and activate them. The additional activation
of MR by MPA along with aldosterone may be hard for estradiol to overcome at the
concentration used against aldosterone-induced activity alone.

Smooth muscle cells:
Smooth muscle cells collected from the uterine myometrium of premenopausal
women were treated for 2, 4, and 6 days with GnRH (Gonadotropin releasing hormone)
agonists and antagonists either alone or along with estradiol, MPA or estradiol and MPA
to determine the rate of proliferation of the smooth muscle cells. The cells were also
incubated similarly for 24 hrs to determine the level of transforming growth factor-β1
(TGFβ1) in the culture medium. In this case, all conditions of the hormones resulted in
increased rate of proliferation and TGFβ1 expression. However, the combination of both
estradiol and MPA resulted in a more significant increase than when the hormones acted
alone suggesting an additive effect (Chegini et al., 1996).
53
4. Estradiol and progesterone regulation of β β β β-amyloid
The accumulation of amyloid-β (Aβ), a neurotoxic peptide, is a key feature in
the development of Alzheimer’s disease (AD). Aβ is derived from a larger single-
transmembrane protein, the amyloid precursor protein (APP). APP undergoes proteolytic
cleavage by the activity of secretases through the non-amyloidogenic and the
amyloidogenic pathways. In the non-amyloidogenic pathway, APP is sequentially
cleaved by α- and γ-secretases. In the amyloidogenic pathway, APP is cleaved by β- and
γ-secretase resulting in Aβ fragments (reviewed in De Strooper, 2000; De Strooper and
Annaert, 2000). Normally, Aβ is degraded by several enzymes which help to maintain a
balance between production and clearance of Aβ. However, under certain circumstances
including mutations in APP as seen in AD, the amyloidogenic pathway becomes more
prominent leading to the excess production and/or accumulation of Aβ. The accumulation
of Aβ results in the formation of extracellular plaques in the brain of AD.
Several factors are involved in regulating APP processing including secretases,
degrading enzymes, hormones etc. In the following section we will discuss in detail the
pathways involved in APP processing, the factors that affect APP processing, and Aβ
production and clearance, and the role of estradiol and progesterone in regulating Aβ
production and degradation.
54
α-secretase; Calpain; PKC;
Seladin-1; Pin1
Furin
β-secretase; Cathepsin B,D,E; Caspace
3,6,8; Calpain; AchE; PPIL; ACAT
γ-secretase
γ-secretase
APP
KPI domain
β α γ
sAPP α sAPP β
P3
A β
NEP, IDE, ECE. ACE, HrtA
Degraded Aβ
Non-amyloigogenic
Amyloidogenic
( PSEN, Aph1, Nicastrin, PEN2)
α-secretase; Calpain; PKC;
Seladin-1; Pin1
Furin
β-secretase; Cathepsin B,D,E; Caspace
3,6,8; Calpain; AchE; PPIL; ACAT
γ-secretase
γ-secretase
APP
KPI domain
β α γ
sAPP α sAPP β
P3
A β
NEP, IDE, ECE. ACE, HrtA
Degraded Aβ
Non-amyloigogenic
Amyloidogenic
( PSEN, Aph1, Nicastrin, PEN2)
Fig 10. Schematic diagram of amyloid precursor protein (APP) processing and Aβ β β β
clearance.

Schematic diagram of amyloid precursor protein (APP) processing and Aβ β β β clearance. The above
schematic shows the two pathways by which APP processing takes place – non-amyloidogenic pathway
and amyloidogenic pathway.
55
APP processing and AD
Amyloid precursor protein or APP is a type I transmembrane protein. The
largest splice form of APP is 770 amino acids long. The 770 and 751- amino acid splice
forms of APP are found in non-neuronal cells whereas the 695- amino acid isoform is
found in the neurons (for review see Selkoe, 1998). APP is further cleaved by the action
of several secretases either via the non-amyloidogenic pathway or the amyloidogenic
pathway. In the case of non-amyloidogenic pathway, APP is first cleaved by the action of
α-secretase into two fragments, the soluble APPα (sAPPα) and a C-terminal fragment
(C83). C83 further acts as a substrate to γ-secretase activity resulting in smaller fragments
that are not known to be toxic to the cells. In the amyloidogenic pathway, APP is first
cleaved by β-secretase resulting in a soluble APPβ (sAPPβ) and a C-terminal (C99)
fragments. C99 is further cleaved by the γ-secretase giving rise to Aβ peptide (Fig. 10).
Normally the level of Aβ is maintained at a non-toxic level by several clearance
mechanisms. However, due to certain factors including mutations in APP as seen in
familial AD, this balance is perturbed leading to the accumulation and aggregation of Aβ
and formation of extracellular plaques (for review see Selkoe, 1998; Hardy and Selkoe,
2002; Lundkvist and Naslund, 2007).
α-secretases cleave APP at amino acid 17 of the Aβ domain which leads to the
formation of the non-amyloidogenic soluble APP fragment (sAPPα) and a C-terminal
fragment of 83 amino acids (C-83) (reviewed in (Nunan and Small, 2000)). There are
several α-secretases that have been known to cleave APP such as ADAM-10/KUZ,
ADAM-17/TACE, ADAM 19 and ADAM-9. Furin is a calcium-dependent serine
56
protease, which has been recently shown to be a negative regulator of α-secretase activity
both in vivo and in vitro (Hwang et al., 2005). Several candidates have been suggested to
be β-secretases such as BACE1 and BACE2. BACE1 (β-site APP cleaving enzyme 1) is
also referred to memapsin2 or Asp2 (Vassar et al., 1999) and is a type I membrane
protein. BACE 2 is a highly similar aspartic protease to BACE1 and is also known as Asp
1. This β-secretase has also been implicated in APP processing in vitro (Hussain et al.,
2000) and is expressed in the brain. Presenilin 1 and Presenilin 2 (PSEN1 and PSEN2)
are membrane proteins. Mutations in these genes occur in the early-onset AD (Clark et
al., 1995). Several transgenic models of AD have mutations in Presenilins. PSEN have
been shown to be required to form the γ-secretase complex along with Aph-1 (Anterior
pharynx defective 1 homolog), nicastrin, and Pen2 (presenilin enhancer-2) that cleaves
the C-terminal fragments of both α- and β-secretase pathways, C83 and C99, to give P3
fragment and Aβ respectively (reviewed in (Selkoe, 1998; Vassar et al., 1999; Selkoe,
2001a, b).

Aβ β β β clearance
Role of degrading enzymes:
Enzyme-mediated degradation of Aβ is an important step in APP processing in
order to maintain a homeostasis between different products derived from APP. Some of
the key enzymes that are implicated in Aβ degradation are insulin-degrading enzyme
(IDE) (Qiu et al., 1998; Mukherjee et al., 2000; Vekrellis et al., 2000; Edbauer et al.,
2002; Farris W, 2003; Wang et al., 2006), neprilysin (NEP) (Shirotani et al., 2001;
57
Carson and Turner, 2002; Kanemitsu et al., 2003; Leissring et al., 2003; Marr et al., 2003;
Marr et al., 2004), endothelin-converting enzymes 1 and 2 (ECE-1, ECE-2) (Eckman et
al., 2001; Eckman et al., 2003), angiotensin-converting enzyme (ACE) (Elkins and Rajab,
2004; Hemming and Selkoe, 2005; Zuo et al., 2007) and transthyretin (TTR) (Tsuzuki et
al., 2000; Choi et al., 2007; Buxbaum et al., 2008). All of these enzymes are expressed in
the neurons and are present in the hippocampal and cortical regions of the brain (for
review see Choi et al., 2007; Miners et al., 2008).
IDE has been shown to have genetic linkage to both late-onset AD as well as type
II diabetes. It has been shown to decrease Aβ accumulation and plaque formation both in
transgenic animal models as well as in cell culture (reviewed in (Wang et al., 2006)).
Neprilysin is reported to be the rate-limiting enzyme in the Aβ degradation as
demonstrated both in vivo and in vitro (Kanemitsu et al., 2003; Marr et al., 2003). ECE1
and ECE2 have been shown to be important for the degradation of Aβ both in vitro and in
the brain of mice lacking ECE (Eckman et al., 2001; Eckman et al., 2003). A genetic
analysis shows a correlation between risk for AD and genetic variance in ACE alleles
(Elkins and Rajab, 2004). Cell culture studies have indicated that ACE can degrade Aβ
(Hemming and Selkoe, 2005). But experiments done using ACE inhibitors show no
correlation between ACE levels and Aβ accumulation in vivo suggesting that ACE might
not act on Aβ endogenously (Hemming et al., 2007). Transthyretin which is primarily
synthesized in the choroid plexus also plays a role in Aβ degradation (Giunta et al., 2005;
Li et al., 2006; Buxbaum et al., 2008). The other enzyme that is implicated in Aβ
degradation is HtrA belonging to the ‘high temperature requirement’ family of
58
mitochondrial serine proteases. Studies suggest that HtrA is involved in the degradation
of various APP products and a HtrA inhibitor leads to accumulation of Aβ (Grau et al.,
2005). There have also been reports of HtrA being a binding partner of Aβ (Liu et al.,
2005) suggesting that it could change the conformation of Aβ to become more vulnerable
to other degrading enzymes.

Aβ transport across blood-brain barrier:
Recent studies have suggested that the transport of Aβ across the blood-brain-
barrier into the vascular system might be another way by which Aβ clearance is achieved
and its accumulation in the brain prevented (Shibata et al., 2000; Bading et al., 2002;
Monro et al., 2002; Deane and Zlokovic, 2007); (Kandimalla et al., 2005). This process is
shown to be dependent on the peripheral levels of Aβ (Marques et al., 2009). Aβ has
been shown to bind to a variety of cell-surface receptors such as receptor for advanced
glycation end product (RAGE) and LDL-receptor related protein-1 and -2 (LRP-1, LRP-
2) (Yan et al., 1996; Zlokovic et al., 1996; Narita et al., 1997; Mackic et al., 1998; Qiu et
al., 1999; Deane et al., 2004) either as a free peptide or after forming a complex with
transport binding proteins such as apolipoprotein J (apoJ), apolipoprotein E (apoE), and
α
2
-macroglobulin (α
2
-M) (Ghiso et al., 1993; Matsubara et al., 1995; Du et al., 1997;
Yang et al., 1997; Bell et al., 2007; Wilhelmus et al., 2007); Fan et al., 2009; Jaeger and
Pietrzik, 2008). This type of clearance especially by LRP-1 is more robust in younger
animals and decreases with age since the levels of LRP-1 also decreases with advancing
age (Shibata et al., 2000). Inhibitors of LRP as well as self-aggregation of LRP-1 have
59
been shown to reduce the efflux of Aβ across the blood-brain-barrier (Ito et al., 2006; Ito
et al., 2007). Once in the plasma, almost 90% of the circulating Aβ peptide is sequestered
by the liver which acts as a major organ in Aβ clearance (Ghiso et al., 2004). Most of the
Aβ that gets into the liver gets cleared via the bile while a small portion gets degraded.
Hepatocyte LRP-1 plays a critical role in the uptake of Aβ by the liver (Tamaki et al.,
2007). However, in AD patients, the liver has very low amount of Aβ as compared to the
controls perhaps because of liver damage or impaired vascular function due to advanced
age (Roher et al., 2009). A small amount of Aβ is also cleared by the kidneys and
excreted in the urine (Ghiso et al., 1997).

Estradiol and Aβ β β β

Apart from direct regulators of APP processing, several factors affect this mechanism
indirectly. One such factor is the female sex-steroid hormone estradiol (Goodenough S,
2003). Estradiol plays several important roles as a neurosteroid to regulate cellular,
cognitive and behavioral functions. The decline of estrogens during menopause is
implicated to be a major risk factor for late-onset AD. Estradiol treatment has shown to
be neuroprotective against Aβ toxicity (Brinton et al., 2000). Several reports have
suggested that estradiol regulates APP processing towards the non-amyloidogenic
pathway (Gandy and Petanceska, 2001). Estradiol has been shown to reduce Aβ levels
both in vivo and in vitro (Chang et al., 1997; Xu et al., 1998; Petanceska et al., 2000),
induce secretion of sAPPα (Manthey et al., 2001; Zhang S, 2005), and regulate alternate
APP mRNA splicing (Thakur MK, 2005). In AD patient brains, the level of estradiol in
60
cerebrospinal fluid is lower and is inversely correlated to the amount of soluble Aβ
(Lewczuk et al., 2008). In post-menopausal women, estradiol treatment has shown to
reduce Aβ levels in the plasma (Baker et al., 2003). Similarly, in female rodent models,
the decrease in estradiol levels due to ovariectomy correlates with increased levels of
soluble Aβ in the brain while estradiol replacement has shown to decrease soluble Aβ
levels and the amount of extracellular plaque depositions (Petanceska et al., 2000; Levin-
Allerhand et al., 2002; Zheng et al., 2002; Yue et al., 2005; Xu et al., 2006). Estradiol has
been shown to regulate APP trafficking through the trans-Golgi network. The accelerated
trafficking of APP along the trans-Golgi network by estradiol leads to less production of
Aβ (Greenfield et al., 2002; Xu et al., 2006).
Estradiol has been shown to regulate the expression and functions of several Aβ
degrading enzymes in various tissues. In the uterus, ovariectomy decreases IDE levels
which increase by E
2
treatment (Udrisar et al., 2005). A recent independent study using
triple transgenic mice model of AD shows E
2
regulation of IDE in hippocampal neurons
(Zhao et al., 2010). Several studies done in animals have compared the effect of
ovariectomy and E
2
replacement on ACE levels in various tissues such as the cardiac
tissues, lung, kidney, and anterior pituitary and their results show a decrease in ACE
levels with E
2
treatment (Seltzer et al., 1992; Tanaka et al., 1997; Gallagher et al., 1999;
Dean et al., 2005; Shenoy et al., 2009). Similar results have been obtained in studies
involving post-menopausal women too where estrogen replacement therapy has shown a
decrease in ACE activity (Proudler et al., 1995; Sanada et al., 2001; Proudler et al.,
2003). The up-regulation of neprilysin expression has been shown in ovariectomized rat
61
brains as well as cell culture following E
2
treatment (Huang et al., 2004; Xiao et al.,
2009; Liang et al., 2010). E
2
also increases neprilysin expression in the uterus as shown
in normotensive and hypertensive rats (Neves et al., 2006). Among the endothelin-
converting enzymes, vascular ECE-1 is downregulated by E
2
and phytoestrogens and
upregulated by anti-estrogen, ICI 182,780 in ovariectomized rats (Rodrigo et al., 2003).
Transthyretin is known to be synthesized in the liver as well as the choroid plexus. E
2

increases the expression of transthyretin in both liver and choroid plexus via ER-
dependent pathways (Goncalves et al., 2008; Quintela et al., 2009). In Chapter 4, we
provide further evidence that estradiol in capable of regulating the expression of several
Aβ degrading enzymes at the mRNA level both in neuronal cultures as well as in rat
brain.
Although many rapid signaling mechanisms are induced by estradiol leading to
increased secretion of sAPPα and decreased production and/or accumulation of Aβ, it is
not clear whether genomic transcriptional regulation by estrogen receptors have a role in
APP processing.

Progesterone and Aβ β β β
The role of progesterone as a regulator of Aβ is largely unclear. Only recently,
studies have suggested that progesterone also plays a role in regulating Aβ level along
with estradiol (Carroll et al., 2007). Depending on the treatment paradigm of
progesterone, the outcome seems to vary. For example, a continuous exposure to
estradiol and progesterone does not have any protective effect on Aβ accumulation. On
62
the other hand, a cyclic regimen of progesterone along with estradiol seems to be
beneficial in reducing levels of Aβ in AD mouse model (Carroll et al., 2007).
Understanding the regulation of Aβ by progesterone is of clinical relevance since
hormone therapies in post-menopausal women contain both estradiol and progesterone
component.
The role of progesterone in regulation of APP processing or Aβ accumulation by
itself has not yet been determined. One study shows a hint of such a regulation in human
endometrium where progesterone increases Aβ-degrading enzyme neprilysin expression
(Casey et al., 1991). In Chapter 4, we demonstrate for the first time that progesterone is
capable of modulating the neuronal expression of Ide and Ace expression in vitro and in
vivo and Ttr expression in vitro. This study suggests a possible role for progesterone in
APP processing and or Aβ clearance. Additional studies need to be conducted in order to
understand the potential role of progesterone in AD-related neuropathology.

Role of estradiol and progesterone in regulating tau phosphorylation
Another important hallmark of AD is the presence of hyperphosphorylated tau
and formation of neurofibrillary tangles (Yen et al., 1995; Iqbal and Grundke-Iqbal,
1996). Similar to neuroprotection against β-amyloid, estradiol has been shown to be
neuroprotective against hyperphosphorylated tau. Estradiol has been shown to regulate
some of the kinases and phosphatases that play a role in phosphorylation of tau (Alvarez-
de-la-Rosa et al., 2005; Goodenough et al., 2005). There are several ways by which
estradiol reduces hyperphosphorylation of tau such as decreasing glycogen synthase
63
kinase-3β (GSK3β) activity (Goodenough et al., 2005), via wnt signaling molecule
dickkopf-1 (Zhang et al., 2008), by activating serine/threonine phosphatases such as PP1,
PP2A and calcineurin (Yi et al., 2008; Yi and Simpkins, 2008), and by the protein kinase
A pathway (Liu et al., 2008). In AD patients, the level of nuclear ERα inversely
correlated with hyperphosphorylated tau in the hippocampal neurons (Hu et al., 2003).
Progesterone has also been shown to play a role in regulating tau
hyperphosphorylation (Carroll et al., 2007). Recent studies from our laboratory have
shown that progesterone is capable of reducing tau hyperphosphorylation in the triple
transgenic mouse model of AD when administered by itself or in combination with
estradiol (Carroll et al., 2007). Progesterone can decrease the expression of both tau and
GSK3β in neurons (Guerra-Araiza et al., 2007). Further studies are required to
completely understand whether progesterone can be neuroprotective against tau-related
pathology in AD.
64
5. Effect of estradiol and progesterone on neuron viability

Estradiol mediated cell survival:
Estradiol has been shown to be neuroprotective against several insults both in
vitro and in vivo. One of the primary neuroprotective roles of estradiol is to increase cell
viability i.e. increasing the number of neurons that survive against a particular insult. For
example, estradiol causes significant increase in the number of live neurons against Aβ
toxicity or oxidative stress in cultures cells (Behl et al., 1995; Goodman et al., 1996;
Green et al., 1996; Gridley et al., 1997; Pike CJ, 1999). Similarly, estradiol is
neuroprotective against apoptotic factors and excitotoxicity in neurons (Jayaraman and
Pike, 2009; Regan and Guo, 1997; Singer et al., 1999; Nilsen and Diaz Brinton, 2003).
There are several mechanisms by which estradiol is able to protect neurons
against these insults (Fig. 11). Studies show that estradiol is able to regulate apoptosis by
affecting anti-apoptotic genes and pro-apoptotic genes in the Bcl-2 family (Garcia-Segura
LM, 1998; Pike CJ, 1999; Singer et al., 1998; Patrone et al., 1999; Nilsen and Diaz
Brinton, 2003; Yao et al., 2007). Previous work from our laboratory has demonstrated
that E
2
activates the expression and function of anti-apoptotic genes such as Bcl-w and
Bcl-xL and suppresses the pro-apoptotic genes such as Bim (Pike CJ, 1999; Yao et al.,
2007). The pathway involved in this process is ER-dependent since ER-antagonists such
as ICI 182,780 is able to reverse the effect of E
2
. This is consistent with the finding of
ERE in the

65
R
R
TARGET
GENE
HR
E
R
E
2
Cel
Nucleu

R
TARGET
GENE
HRE
X
Bcl-2,Bcl-w,Bcl-x,IDE ERE
Cell
Nucleu

Bim ERE
X
ER
ER
ER
ER
CRE
PKC
Src
ERK
pCREB
Increased
Neuron
survival
Nongenomic
signaling
Fig 11. Estradiol-induced neuroprotective pathways.

Estradiol-induced neuroprotective pathways. This is a schematic showing the different pathways
involved in E
2
-mediated neuroprotection. E2 signals through both genomic and non-genomic pathways to
promote neuron survival.

66
promoter regions of Bcl-xL as well as Bcl-2 (Dong et al., 1999; Pike CJ, 1999; Perillo et
al., 2000).
The mechanism of neuroprotection of E
2
via regulation of Bcl-2 family is not only seen
against Aβ toxicity but also against glutamate excitotoxicity (Goodman et al., 1996;
Nilsen et al., 2002; Riederer and Hoyer, 2006) and is shown to involve ERs (Singer et al.,
1996; Zhao and Brinton, 2007). In animal models, E
2
protects against kainate-lesion in
ovariectomized animals (Azcoitia et al., 1999; Rosario ER, 2006).
Apart from regulating the Bcl-2 family, estradiol has been shown to regulate
inflammation and oxidative stress (Behl et al., 1995; Behl et al., 1997; Goodman et al.,
1996). But the antioxidant property of estradiol is seen only when supraphysiological
concentrations of E
2
are used in treating the cells (Liehr and Roy, 1990; Behl et al.,
1997). It has also been shown that the antioxidant function is mediated via ER-
independent pathways where as the anti-inflammatory actions are ER-dependent
(Sugioka et al., 1987).

67
Progesterone and neuron viability:
Similar to estradiol, progesterone has also been shown to be neuroprotective in
both cell culture as well as animal models (Fig.12). For example, progesterone is
protective against glutamate excitotoxicity in neurons (Nilsen and Brinton, 2002). In
certain animal models, progesterone is neuroprotective against cortical and hippocampal
injuries (Roof et al., 1994; Alkayed et al., 2000; Brinton et al., 2008); (De Nicola AF,
2006). Extensive studies done in traumatic brain injury models demonstrate that
progesterone can reduce neuronal injury and increase neuron viability in the treated
animals (Roof et al., 1994; Stein, 2008). Similar effects of progesterone are seen in spinal
cord injury models as well as seizure models (Labombarda et al., 2003; Rhodes and Frye,
2004). Progesterone plays an important therapeutic role in myelin repair (for review see
Schumacher M, 2007b; Schumacher et al., 2008). As compared to estradiol, not many
studies have been conducted to evaluate the effects of progesterone against Aβ toxicity or
apoptotic factors.
As opposed to progesterone, synthetic progestin such as the medroxyprogesterone
acetate or MPA, which has been used in hormone therapy, does not show much promise
as a neuroprotective agent. For example, in the studies done by Nilsen and Brinton which
compared progesterone and MPA against glutamate toxicity, MPA was not protective in
cultured primary neurons (Nilsen and Brinton, 2002).
Although most of the signaling of progesterone is done through the classical and
membrane PRs which might be one of the primary pathways involved in most of the
progesterone functions, the anxiolytic or anti-seizure property of progesterone seems
68
R
R
TARGET

HR
E
R
P4
Nucleus
R
TARGET

HR
E
X
Bcl-2 PRE
Nucleus
PR
PR
PR
CRE
Src
ERK
pCREB
Bcl-2
Ca++
JNK
Neuroprotection
Fig 12: Progesterone-mediated neuroprotective pathways.

Progesterone-mediated neuroprotective pathways. This schematic represents some of the major
pathways involved in progesterone-induced neuroprotection. Porgesterone signals through genomic and
non-genomic signaling pathways to promote neuron survival. Adapted from (Brinton et al., 2008).
69
to be mediated through GABA
A
receptors (Kokate et al., 1994). In this case, progesterone
might be acting through its metabolite allopregnanolone.
In combination with E
2
, progesterone seems to block E
2
action in the neurons
when given continuously. On the other hand, the cyclic regimen of progesterone
treatment seems to be neuroprotective along with E
2
(Carroll et al., 2007). Further studies
need to be conducted to fully elucidate the neuroprotective potential of progesterone,
especially when administered along with E
2
.
70
6. Hypothesis and experimental paradigms

Estradiol and progesterone play several important roles in various tissues of the
body including the brain. The decline of estradiol and progesterone, as a consequence of
menopause, results in disease and dysfunction in hormone responsive tissues throughout
the body. It has been shown that such a loss of these hormones can put the brain at an
increased risk for neurodegenerative disease such as AD. Observations from several
clinical studies have shown that hormone replacement does not completely provide the
neuroprotection that the basic research demonstrates. This discrepancy seen between
basic research data and clinical studies has brought to light the importance of
understanding the dynamics between estradiol and progesterone in neuronal cells. In my
thesis, I investigated the interactions of estradiol and progesterone and its implications for
pathways involved in neuroprotection and Alzheimer’s disease pathology. Specifically, I
focused on the regulation of expression and function of estradiol receptors (ERα and
ERβ) by progesterone and progestins using several different experimental paradigms. I
also investigated the role of estradiol and progesterone in the regulation of several Aβ
degrading enzymes.
Several studies have indicated that progesterone antagonizes estradiol action in
the brain. But the exact mechanism of progesterone’s action is not clear. One of the ways
by which the function of a ligand can be controlled is by regulating the availability and or
function of its receptor. In accordance with this, regulation of estrogen receptors (ERα
and ERβ) can affect estradiol activity. Based on this, one would predict that progesterone
71
would affect estradiol action in the neurons by reducing the expression levels of one or
both ERs. In Chapter 2, I investigated whether progesterone is capable of regulating the
expression of ERα and ERβ in primary neuronal cultures as well as in wild-type rat
brains. In Chapter 3, I examined whether the regulation of ER expression by progesterone
leads to the regulation of ER-dependent functions, specifically ER-mediated transcription
and E
2
-mediated neuroprotection against apoptosis. In both these Chapters, I also briefly
discuss the collaborative work done along with the Baudry laboratory in looking at the
effect of progesterone on ER-dependent regulation of BDNF expression. In Chapter 4, I
used primary neuronal cultures to investigate the role of synthetic progestins on
expression and function of ER. In Chapter 5, I determined the individual and combined
effects of estradiol and progesterone on Aβ-degrading enzymes. This was done using
both primary neuronal cultures as well as wild-type rat brain. In addition to looking at
some of the Aβ degrading enzymes in the rat brain, I also show a correlation between the
levels of these Aβ degrading enzymes with the levels of soluble Aβ in the same animals.
Taken together, results from these studies will provide useful insight into the
interactions between female sex steroid hormones in neuronal cells and their effects on
AD-related pathways.
In Chapter 6, I discuss the relevance of my experimental results in advancing the
existing knowledge of the field. I also predict the various translational outcomes as well
as future directions based on my research data.
72
CHAPTER TWO: Progesterone down regulates the expression of estrogen receptors,
ERα and ERβ in neurons

Chapter two Abstract

Recent findings indicate that progesterone can attenuate beneficial neural effects
of estrogen. Here, we investigate the hypothesis that progesterone can modulate estrogen
actions by regulating expression of estrogen receptors, ERα and ERβ. Our studies
demonstrate that progesterone decreases the expression of both ERα and ERβ in cultured
neurons as well as in wild type rat brain. These results identify a potential mechanism by
which progesterone antagonizes neural estrogen actions, a finding that may have
important implications for hormone therapy in postmenopausal women.

Adapted from: Jayaraman A and Pike CJ. Progesterone attenuates oestrogen
neuroprotection via downregulation of estrogen receptor expression in cultured neurons.
J Neuroendocrinology (2009). 21(1): 77-81.
73
Chapter two Introduction
The depletion of estrogen and progesterone in postmenopausal women is
associated with increased risk for several disorders in the cardiovascular, skeletal and
nervous systems (LaCroix, 2005). For example, the Women’s Health Initiative clinical
trial showed that HT use was associated with reduced incidence of hip fractures but,
unexpectedly, increased incidences of both stroke and dementia (Schumacher M, 2007a,
b). The disparities between basic research studies that demonstrate neuroprotective
effects of estrogen and recent clinical findings that report adverse neural effects of HT
indicate the need for a more complete understanding of estrogen and progesterone
interactions in brain and other tissues. To gain some mechanistic insight into this issue,
we studied the effects of progesterone on estrogen actions in cultured neurons.
One important issue that is not well understood is how neural effects of estrogen
are affected by progestagens. Recent experimental evidence in rodent models shows that
prolonged progesterone (P
4
) exposure often represses beneficial 17β-estradiol (E
2
)
function in the brain (Murphy and Segal, 1996; Garcia-Segura LM, 1998; Murphy and
Segal, 2000; Bimonte-Nelson HA, 2004; Rosario ER, 2006; Carroll et al., 2007). The
mechanism(s) by which P
4
inhibits E
2
action in the brain is unclear. Estrogen binds to
estrogen receptors to function in several signaling pathways in neuronal cells. Hence one
of the ways by which estrogen action can be controlled is by regulating the expression of
its receptors. Progesterone is known to decrease ER expression in reproductive tissues
(Hsueh AJ, 1975; Read LD, 1989; Alexander IE, 1990). Here, we investigate the
possibility that P
4
modulates E
2
action by regulating expression of estrogen receptors
74
(ERs) in neurons. We demonstrate that P
4
treatment reduces the expression of both ERα
and ERβ in cultured neurons in a concentration- and time-dependent manner.
In rodent models, P
4
treatment can inhibit several beneficial E
2
effects, including
regulation of neurotrophins, Bcl-2 expression, choline acetyltransferase activity,
hippocampal spine density, neuroprotection, and β-amyloid accumulation (Woolley and
McEwen, 1993; Murphy and Segal, 1996; Garcia-Segura LM, 1998; Gibbs, 2000;
Murphy and Segal, 2000; Bimonte-Nelson HA, 2004; Rosario ER, 2006; Carroll et al.,
2007). Several clinical studies involving HT for disorders of cardiovascular system and
nervous system also show antagonism of estrogen action by progesterone and synthetic
progestins (Shumaker et al., 2003; Shumaker et al., 2004; Honjo H, 2005; LaCroix,
2005). In this study, we also investigate whether P
4
is able to decrease the expression of
ERs in vivo using wild type rats and if so, what the dynamics of the effect in terms of
time would be.
Some studies suggest that using P
4
in a cyclic manner that parallels natural
fluctuations during ovarian cycle to be a more optimal treatment regimen both in vivo
and in clinical trials (Adams et al., 1997; Gibbs, 2000; Klaiber et al., 2005). Hence, we
investigate whether the effects of continuous versus cyclic P
4
regimen. We hypothesize
that continuous administration of P
4
along with E
2
might keep the levels of ER low
resulting in blocking not only the harmful effects but also the beneficial effects of E
2
. On
the other hand, cyclic P
4
might help in reducing and restoring the ER levels
corresponding to the levels of P
4
.

75
Materials and methods

Primary neuron culture
Experimental animal procedures were conducted in accordance with the
University of Southern California guidelines based on National Institute of Health
standards. Primary rat cerebrocortical cultures (~95% neuronal) were generated from
gestational day 16-17 rat pups using a previously described protocol (Cordey et al., 2003)
with some modifications. Cultures were seeded in multiwell plates at final densities of
approximately 2.5 x 10
4
cells/cm
2
(cell viability and luciferase assays) or 8 x 10
5

cells/cm
2
(RNA isolation) and experiments were started 1-2 days after plating.

RNA isolation and RT-PCR
In all experiments, both E
2
(Steraloids Inc.; Newport, RI) and P
4
(Acros
Organics USA; Morris Plains, NJ) were dissolved in ethanol and diluted to required
concentrations in culture medium. Cells were harvested for RNA isolation using TRIzol
reagent (Invitrogen Corporation; Carlsbad, CA) according to manufacturer’s protocol. ER
mRNA levels were analyzed using qualitative and quantitative PCR. Following real-time
PCR, the relative quantification of mRNA levels from various treated samples was
determined by the comparative Ct method (also known as ∆∆Ct method) (Livak and
Schmittgen, 2001). The following primer pairs were used - ERα α α α: F -
5’CATCGATAAGAACCGGAG3’, R- 5’AAGGTTGGCAGCTCTCAT3’; ERβ β β β: F -
5’AAAGTAGCCGGAAGCTGA3’, R - 5’CTCCAGCAGCAGGTCATA3’; β β β β-actin: F –
5’AGCCATGTACGTAGCCATCC3’; R – 5’CTCTCAGCTGTGGTGGTGAA3’.
76

Animal procedures
The in vivo experiments were done under the guidance and collaboration of the
Progesterone Program Project Animal Core at USC. The doses used and the timing of
hormone treatments were according to those determined by the Progesterone Program
Project pilot experiments and would be maintained across all experiments done under the
Program Project using this paradigm.

Short term E
2
and P
4
treatment in OVX rats
Female Sprague-Dawley rats were randomly divided into X groups: sham-
operated + vehicle (Sham); ovariectomised + vehicle (OVX); ovariectomised + 17β-
estradiol (OVX+ E
2
); and ovariectomised + progesterone (OVX+ P
4
). (N=2/group). After
5-days post-ovariectomy, the OVX and the OVX+ E
2
group animals were replaced with
either placebo or E
2
capsule. Two days after E
2
replacement, an acute injection of
progesterone (500µg/100µl/animal) was given and animals were sacrificed for tissue
collection at 10 h post-injection.

Long-term E
2
and P
4
treatment in OVX rats
Rats were either sham-operated (Sham; n=8) or ovariectomised. Ovariectomised
rats were randomly divided into six groups to receive the following treatments: placebo
(OVX); 17β-estradiol (OVX+ E
2
); (continuous P
4
(ovx+ P
4cont
); cyclic P
4
(ovx+ P
4cyc
),
17β-estradiol with continuous P
4
(ovx+ E
2
+ P
4cont
), or E
2
with cyclic P
4
(ovx+ E
2
+ P
4cyc
)
77
(n=8/group). Rats were treated with two cycles of 30 day hormone treatment (60 days
total) administered 7 days post-OVX via slow release subcutaneous implants (Innovative
Research America, ). Sham and OVX groups were implanted with placebo pellets; E
2

treated rats were implanted with a 0.72mg E
2
, 90 day release pellet while continuous P
4

treated rats were implanted with a 200mg P
4
, 90 day release pellet. Rats treated with
cyclic P
4
were implanted with a 50mg P
4
, 10 day release pellet at day 20 and 50.

Tissue collection and processing
At the time of sacrifice trunk blood was collected and separated into the serum fraction
for determining hormone levels. The brains were rapidly dissected and the hippocampi
and frontal cortex from one hemisphere was snap-frozen for RNA extractions.

Statistical analysis
One-way analyses of variance (ANOVA) followed by Tukey’s multiple
comparison post-hoc tests were used for pair-wise comparisons between experimental
treatments. Data were analyzed using GraphPad Prism 4 software (San Diego, CA) and
significance level was set at 0.05. Results are expressed as means ± S.E.M. for the
indicated number of experiments.

Results

P
4
attenuates ERα and ERβ expression in a dose- and time-dependent manner

78
Fig. 13. Progesterone (P
4
) decreases the expression of estrogen receptor ERa and
ERb mRNA in a concentration- and time-dependent manner.
Progesterone (P
4
) decreases the expression of estrogen receptor ERa and ERb mRNA in a
concentration- and time-dependent manner. Representative agarose gels of reverse transcriptase-
polymerase chain reaction (PCR) products qualitatively show relative changes in mRNA levels of ERa and
ERb induced by 24 h exposure to 0–100 ng ⁄ ml (approximately 0–300 nM) progesterone (P
4
) (A) and 0–24
h exposure to 10 ng ⁄ ml (approximately 30 nM) P
4
(D); β-actin was used as an internal control. The relative
levels of ERa and ERb mRNA after treatment with various P
4
concentrations (B, C; n = 5) and for various
time points (E, F; n = 3) were determined quantitatively using real-time PCR. Data show the mean _ SEM
expression levels, relative to vehicle-treated controls, as determined by Ct values (cycle number at which
the logarithmic fluorescence crosses the threshold) of ERa and ERb normalized with corresponding Ct
values of b-actin. *P≤ 0.01 relative to corresponding vehicle-treated control group.

79
To investigate the effect of P
4
on ER expression, cultures were treated with increasing
concentrations of P
4
(0-100 ng/ml) for 24 h. The cells were harvested for RNA isolation,
followed by qualitative and quantitative RT-PCR. Our results show that mRNA
expression of both ERα and ERβ was decreased by P
4
at 0.01-100 ng/mL (p < 0.0001)
(Fig. 13a-c; n=5). The 10 ng/mL (~30 nM) P
4
concentration was chosen for subsequent
experiments as it was maximally effective and within the normal physiological range (8 -
50 ng/ml). Next, cultures were treated with 10ng/mL P
4
for increasing durations ranging
from 5 min to 24 h after which RNA was isolated and quantitatively assessed for ER
expression. We found that P
4
treatment significantly decreased expression of ERα
mRNA by 2 h (p < 0.001) and ERβ mRNA within 1 h (p < 0.0001) (Fig. 13d-f; n=3).
These data show that P
4
decreases expression of both ERα and ERβ in a concentration-
and time-dependent manner.

Progesterone decreases ERα α α α and ERβ β β β mRNA expression in acute in vivo treatment.
To investigate whether P
4
decreased ERα and ERβ expression in vivo, rats were
subjected to hormone manipulations as described in the Materials and Methods section
(Table 2). The hippocampi and frontal cortex tissues were processed for RNA isolation
by standard protocol and analyzed by RT-PCR using specific primers. Our results suggest
that at 10 h post-injection, both ERα and ERβ mRNA are reduced in frontal cortices and
hippocampi of the P
4
-treated animals as compared to the vehicle-injected controls (Fig
14a-d).

80
Table 2: Acute in vivo hormonal treatment paradigm.

Condition
OVX
Status
Hormone treatment
Control Sham Vehicle
OVX + placebo OVX Placebo caps
OVX + E
2
+ veh OVX
E
2
cap & Vehicle
injection
OVX + E
2
+ P
4
(10
h)
OVX
E
2
cap & 500µg P
4

injection

81
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
0
50
100
Sham Ovx Ovx+ Ovx+
E2 E2+P4
ER beta mRNA
0
50
100
ER alpha mRNA
% mRNA expression
ER beta mRNA
% mRNA expression
Sham Ovx Ovx+ Ovx+
E2 E2+P4
0
50
100
150
200
Sham Ovx Ovx+ Ovx+
E2 E2+P4
ER alpha mRNA
Sham Ovx Ovx+ Ovx+
E2 E2+P4
Fig 14: ERα α α α and ERβ β β β levels in the frontal cortex and hippocampus after acute
hormonal treatment.

ERα α α α and ERβ β β β levels in the frontal cortex and hippocampus after acute hormonal treatment. The top
panels show the levels of ERα and ERβ in the frontal cortex after different hormone manipulations. The
bottom panels show the levels of ERα and ERβ in the hippocampus after similar hormone treatments.
82
Study 2 (in collaboration with Dr.Claudia Aguirre - Baudry lab) -Progesterone
reverses estrogen-mediated increases in ERβ β β β but not ERα α α α mRNA
P
4
reversed the E
2
-mediated neuroprotection against NMDA neurotoxicity. To
further investigate the molecular mechanisms underlying the antagonistic effect of P
4

following E
2
treatment, we investigated whether ER mRNA levels were differentially
affected. Cultured hippocampal slices were treated with 10 nM E
2
for 24 h and
concomitant treatment with 10 nM P
4
during the final 4 h of E
2
treatment period. E
2

treatment resulted in a significant increase in levels of ERβ mRNA but not ERα mRNA
as compared to vehicle controls (Fig. 15a). P
4
alone (4 h) did not significantly alter ERβ
mRNA or ERα mRNA levels. Interestingly, the addition of P
4
to E
2
-treated slices
reversed E
2
-mediated increase in ERβ mRNA levels (Fig. 15a). Quantification of PCR
data indicates that the combination of P
4
+ E
2
(EP) reversed ERβ mRNA levels to those
observed with P
4
or vehicle (Fig. 15b).

83
Fig. 15: Effect of P4 on ERα α α α and ERβ β β β mRNA levels in hippocampal slices.

A

B

Effect of P4 on ERα α α α and ERβ β β β mRNA levels in hippocampal slices. (A) Representative gel showing that
P4 doesn’t affect ERα mRNA but reduced ERβ mRNA and E2-mediated increase in the ERβ mRNA. (B)
Quantitative data showing the levels of ERβ mRNA with different hormonal treatments.

84
Chapter two Discussion
In this study, we investigated P
4
regulation of ER expression and E
2

neuroprotection. Our results in neuron-enriched cultures demonstrate that physiologically
relevant concentrations of P
4
induce a profound and prolonged decrease in expression of
both ERα and ERβ transcripts, both in vitro and in vivo. The potential role of classical
PR in mediating this effect is unclear. Although the lowest effective P
4
concentration
0.01 ng/mL (~ 0.03 nM) is below the K
d
value of P
4
-PR interaction (~1x10
-9
M),
similarly low P
4
concentrations can exert progestagenic actions (Vallejo et al., 2005;
Teves et al., 2006) and high affinity P
4
binding sites have been described (Luconi et al.,
1998; Helguero et al., 2003). Our data demonstrate that one neural consequence of P
4

exposure is modulation of E
2
activity via regulation of ER levels.
In the in vivo experiments, our results showed that physiological levels of P
4
is
capable of downregulating ER expression consistent with the cell culture data. In case of
continuous P
4
treatment this reduction of ER expression is seen as long as P
4
is present.
In the case of cyclic P
4
treatment, ER expression is affected when P
4
is present and the
mRNA levels start increasing to normal levels once the P
4
is off. This shows that ER
mRNA levels are inversely correlated with the amount of P
4
present.
Our data show that P
4
decreases ER expression within hours, suggesting that even
relatively short term P
4
exposure may attenuate E
2
actions in vivo. In agreement with this
prediction, acute P
4
blocks E
2
-induced upregulation of the anti-apoptotic protein Bcl-2 in
ovariectomised female rats (Garcia-Segura LM, 1998). Interestingly, E
2
-induced increase
in hippocampal spine density in female rats is potentiated 4 h following P
4
treatment but
85
blocked after 18 h P
4
treatment (Woolley and McEwen, 1993). Thus, P
4
may exert
independent protective effects and or initially potentiate protective E
2
actions but with
prolonged exposure P
4
can attenuate E
2
action via ER downregulation. This interpretation
is consistent with observations that although P
4
can be neuroprotective, both P
4
and
synthetic progestagens (Nilsen and Brinton, 2002; Rosario ER, 2006) can also block E
2

neuroprotection. The comparison between the cyclic and continuous regimens has
demonstrated that ER levels are down as long as P
4
levels are up. It also demonstrates for
the first time that ER levels are able to bounce back once P
4
is removed and again goes
down when P
4
levels rise. This is similar to natural estrous cycle, where ER levels are
shown to fluctuate depending on the levels of hormones at a particular stage of the cycle
(Pack et al., 1978). This provides a possible mechanism why cyclic P
4
has been shown to
be beneficial as compared to the continuous exposure of P
4
along with E
2
. The decrease
in ER levels and perhaps ER function when the P
4
is “on” may work to keep the
detrimental effects of E
2
on endometrial cells in check. On the other hand, the ability of
ER expression to recover when P
4
is “off” might help to make sure E
2
beneficial effects
are not continuously suppressed. Thus, further studies have to be conducted to determine
the full potential of the cyclic P
4
effect on E
2
-mediated neuronal functions.

86
CHAPTER THREE: Progesterone affects estrogen receptor transcription and estrogen-
mediated neuroprotection downregulating the estrogen receptors

Chapter three Abstract

Recent findings indicate that progesterone can attenuate beneficial neural effects
of estrogen. Here, we investigate the hypothesis that progesterone can modulate estrogen
actions by regulating activity of estrogen receptors, ERα and ERβ. Our studies in
cultured neurons and hippocampal slices demonstrate that progesterone decreases both
ER-dependent transcriptional activity and neuroprotection. These results identify a
potential mechanism by which progesterone blocks beneficial estrogen actions, a finding
that may have important implications for hormone therapy in postmenopausal women.

Adapted from: Jayaraman A and Pike CJ. Progesterone attenuates oestrogen
neuroprotection via downregulation of estrogen receptor expression in cultured neurons.
J Neuroendocrinology (2009). 21(1): 77-81.
87

Chapter three Introduction

As mentioned in the previous chapter, one important issue that is not well
understood is how neural effects of estrogen are affected by progestagens. Recent
experimental evidence in rodent models shows that prolonged progesterone (P
4
) exposure
often represses beneficial 17β-estradiol (E
2
) function in the brain (Bimonte-Nelson HA,
2004; Carroll et al., 2007). In the previous chapter, we demonstrated that P
4
treatment
reduces the expression of both ERα and ERβ in cultured neurons and in rat brain in a
concentration- and time-dependent manner. In this study, we show that this decrease in
ER expression leads to attenuation of E
2
activity in the neurons.
Continuous P
4
exposure maintained over weeks to months in ovariectomized
female rodents has been observed to attenuate several E
2
-induced actions, including
neuroprotection following kainate lesion (Rosario ER, 2006), reduction of the
Alzheimer’s disease-related protein, β-amyloid (Carroll et al., 2007), and increased
expression of the neurotrophins brain-derived neurotrophic factor, nerve-growth factor,
and neurotrophin 3 (Bimonte-Nelson HA, 2004). Acute P
4
blocks E
2
-induced
upregulation of the anti-apoptotic protein Bcl-2 in ovariectomized female rats (Garcia-
Segura LM, 1998). Interestingly, E
2
-induced increase in hippocampal spine density in
female rats is potentiated 4 h following P
4
treatment but blocked after 18 h P
4
treatment
(Woolley and McEwen, 1993).
In this study, we hypothesize that progesterone regulation of ER expression leads
to a decrease in ER-dependent functions and thus results in antagonizing E
2
-mediated
neuroprotection in primary neuron cultures. ERs are nuclear receptors which are involved
88
in activating or repressing the transcriptional activity of a variety of target genes by
binding to estrogen response elements (ERE) on their promoter regions (Matthews and
Gustafsson, 2003). Target genes of E
2
/ER consist of several candidates including anti-
apoptotic and neurotrophic factors which are important for cell survival (Toran-Allerand,
1996; Safe, 2001). If progesterone down-regulates ER function along with their
expression, transcription of several of these genes could in turn be down-regulated. In
this study, we will first investigate whether P
4
treatment decreases ER-dependent
transcriptional activation of a reporter plasmid. Since E
2
treatment is protective against a
variety of neuronal insults and ER antagonists such as ICI 182,780 can block this
neuroprotective effect of E
2
(Cordey and Pike, 2005), we know that ERs are required for
E
2
-mediated neuroprotection. We hypothesize that P
4
will block E
2
-induced protection
against apoptotic insult in primary neurons by decreasing the ER expression and thus its
function.
In Study 2, done in collaboration with Dr. Claudia Aguirre (former student from
Dr. Michel Baudry’s laboratory), we also look at the effect of P
4
mediated decrease of
ERβ expression on BDNF expression in hippocampal slice cultures.

Materials and methods
Luciferase Assay
To assess E transcriptional activity, cultures were co-transfected with a luciferase
reporter plasmid containing an upstream estrogen response element (ERE-luc) in the
promoter region (Hall and Korach, 2002) (kind gift from Dr. Donald McDonnell, Duke
89
University) and an internal control renilla luciferase expression plasmid (pRL) (Promega;
Madison, WI) using Amaxa Nucleofector system (Amaxa; Gaithersburg, MD) and treated
with different hormone conditions starting at 4-6 h post-transfection. To assess E
2

neuroprotection, cultures were pretreated with different hormone conditions and then
exposed to Apoptosis Activator II (AAII), a cell-permeable cytochrome c-dependent
caspase activator (Nguyen JT, 2003) (Calbiochem; San Diego, CA). Cell viability was
determined by counts of viable cells stained with the vital dye calcein AM (Invitrogen) as
previously described (Cordey et al., 2003). Raw data were statistically assessed by
ANOVA followed by between group comparisons using the Fisher LSD test.

RNA extraction and RT-PCR/QPCR
Following protein determination, hippocampal tissues were processed for RT-
PCR quantification of ERα, ERβ and BDNF mRNA. For RNA extraction, treated cells
were lysed using TRIzol reagent (Invitrogen Corporation; Carlsbad, CA, USA) and
processed for total RNA extraction as per manufacturer’s protocol. 1-2 μg of RNA was
used for reverse transcription using the Superscript
TM
First strand synthesis system
(Invitrogen) and the resulting cDNA was used for both standard PCR and real-time
quantitative PCR amplifications. The primer sets used were: ERα α α α: F -
5’CATCGATAAGAACCGGAG3’, R- 5’AAGGTTGGCAGCTCTCAT3’; ERβ β β β: F -
5’AAAGTAGCCGGAAGCTGA3’, R - 5’CTCCAGCAGCAGGTCATA3’. β β β β-actin – F: 5’-
AGCCATGTACGTAGCCATCC-3’ and R: 5’-CTCTCAGCTGTGGTGGTGAA-3’.
Quantitative PCR was carried out using DNA Engine Opticon 2 continuous fluorescence
90
detector (MJ Research Inc; Waltham, MA, USA). SYBR Green I (Molecular Probes,
Invitrogen, USA) was added to the PCR mix along with cDNA and appropriate primers.
The cycle of threshold (Ct) was determined for each of the primers used. A standard
curve was generated for each primer set such that the Ct values obtained for different
samples were included within the corresponding standard curve. Relative quantification
of mRNA levels from various treated samples was done by the comparative Ct method as
follows (Livak and Schmittgen, 2001). The standard-curve fitted Ct values for ERα and
ERβ from different samples were normalized using the corresponding β-actin values to
get ∆Ct values. The ∆Ct values for different treatment conditions were then subtracted by
the ∆Ct value of the control to get ∆∆Ct values. The relative levels of mRNA in treatment
samples compared to that of the control were obtained using the formula 2
-∆∆Ct
and are
plotted in the graphs as percent of control values. The experiments were repeated with at
least 3 independent culture preparations.

Statistical analysis
One-way analyses of variance (ANOVA) followed by Tukey’s multiple
comparison post-hoc tests were used for pair-wise comparisons between experimental
treatments. Data were analyzed using GraphPad Prism 4 software (San Diego, CA) and
significance level was set at 0.05. Results are expressed as means ± S.E.M. for the
indicated number of experiments.

Results
Progesterone decreases E
2
-dependent transcriptional activity
91
To determine whether the P
4
-induced decrease in ER expression reduces ER
activity, we examined the ability of E
2
to activate ERE-dependent transcription, a
measure of classic E
2
genomic activity, by transfecting cultures with an ERE-reporter
construct (ERE-luc) and measuring how P
4
treatment affected E
2
-induced expression of
luciferase. P
4
alone treatment was for 15 h followed by 8 h of vehicle treatment and did
not have any effect on the luciferase activity. We observed that 8 h exposure to 10 nM E
2

resulted in an approximately two-fold increase in luciferase levels (p < 0.0001). This E
2
-
induced increase in luciferase was modestly reduced by short-term 15 min pretreatment
with 10 ng/mL P
4
and completely blocked by long-term 15 h P
4
pretreatment (p <
0.0001) (Fig. 16a; n=3).

Progesterone attenuates E
2
-mediated neuroprotection
To investigate whether P
4
also attenuates E
2
-mediated neuroprotection, cultures
were pretreated with 10 ng/mL P
4
for either 15 min or 15 h, followed by 10 nM E
2
for 1
h, and finally 24 h exposure to a toxic concentration (3 μM) of the apoptosis-inducing
peptide AAII. For the P
4
alone condition, cells were treated with 10 ng/ml P
4
for 15 h
followed by 1 h vehicle treatment before administering AAII. We observed that E
2
alone
but not P
4
alone significantly reduced neuron loss induced by AAII (p < 0.0001). E
2

neuroprotection was not significantly affected by 15 min P
4
pretreatment (p = 0.67) but
was completely blocked by 15 h P
4
pretreatment (p < 0.0001) (Fig. 16b; n=5). Finally,
because these experiments were conducted with both P
4
and E
2
, we also considered how
P
4
affects ER expression in the presence of E
2
. Thus, we measured mRNA levels of ERα
92
and ERβ under the same treatment parameters used in the E
2
genomic activity experiment
(Fig. 16a). We found that 8 h treatment with E
2
alone significantly increased expression
of both ERα (p < 0.0001) and ERβ (p < 0.0001) relative to vehicle control, effects that
were reduced by 15 min P
4
pretreatment (ERα p < 0.0001; ERβ p < 0.0001) and to a
significantly greater extent by 15 h P
4
pretreatment (ERα p < 0.001; ERβ p < 0.0001)
(Fig. 16c, d; n=3).
93
Fig. 16. Progesterone (P
4
) reduces estrogen-induced increases in estrogen receptor
(ER) activity and neuron survival.

Progesterone (P
4
) reduces estrogen-induced increases in estrogen receptor (ER) activity and neuron
survival. (A) ER activity was determined by luciferase assay of neuronal cultures. Data show the mean _
SEM luciferase activity represented as relative luminescence unit and expressed as a percentage of vehicle-
treated control condition. *P < 0.01 relative to vehicle-treated control (C, open bar) and (#) P < 0.01
relative to E
2
group (n = 3). (B) Neuron survival was measured in cultures pretreated with 0 or 10 ng ⁄ ml
P
4
for 15 min or 15 h. Cell viability data show the mean _ SEM cell counts of viable cells expressed as
percentage of vehicle-treated control group. *P < 0.01 relative to vehicle + AAII condition (veh, solid bar)
(n = 5). (C, D) Levels of ERα and ERβ mRNA were determined under the same treatment conditions used
in the luciferase assay. Data show representative agarose gels of reverse transcriptase-polymerase chain
reaction (RT-PCR) products (upper panels) and the mean _ SEM mRNA levels determined by quantitative
RT-PCR (lower panels). *Increased expression (P < 0.0001) compared to the vehicle control (C); (#)
decreased expression (P < 0.0001) compared to the E
2
condition (E
2
); (w) decreased expression (P <
0.001) compared to the 15-min P
4
pretreatment group [P
4
+ E
2
(15 m)] (n = 3).
94
Study 2 (in collaboration with Dr.Claudia Aguirre - Baudry lab) - Progesterone
inhibits estrogen-mediated neuroprotection against excitotoxicity by down-
regulating estrogen receptor-β β β β

Progesterone reverses E
2
-induced increase in BDNF mRNA
In this study, we evaluated whether the effect we observed previously (Aguirre
and Baudry, 2009) on BDNF protein levels could be observed at the mRNA level.
Indeed, P
4
treatment also reversed E
2
-induced increase in BDNF mRNA levels in parallel
with its effects on ERβ mRNA levels (Fig. 17a, b, c). Quantification of PCR data
revealed a significant reduction in BDNF mRNA levels when comparing E
2
+ P
4
– treated
(EP) and E
2
-treated hippocampal slices (Fig. 17 b; one way ANOVA, F
3,4
= 12.10, P =
0.0178).
95
Fig 17: P4 decreases bdnf mRNA via ERβ β β β.

P4 decreases bdnf mRNA via ERβ β β β. (top panel) Representative gel showing a decrease in bdnf levels with
progesterone corresponding to reduced ERβ levels. (bottom panel) quantitation of ERβ and bdnf levels
under different hormonal treatments.

96
Chapter three Discussion

In this study, we investigated P
4
regulation of ER-mediated transcription and E
2

neuroprotection. Our results in neuron-enriched cultures demonstrate that physiologically
relevant concentrations of P
4
induce a decrease in ER mediated functions. The potential
role of classical PR in mediating this effect is unclear.. The observed P
4
-induced
downregulation of ER expression is associated with corresponding decreases in E
2
-
induced transcriptional activity and neuroprotection against apoptosis. In hippocampal
slices, we see that the decrease in ERβ expression by P
4
leads to a corresponding
decrease in bdnf mRNA levels which might affect E
2
-mediated neuroprotection against
glutamate excitotoxicity. Our data demonstrate that one neural consequence of P
4

exposure is modulation of E
2
activity via regulation of ER levels.
Our findings are consistent with an accumulating set of observations that P
4
can
inhibit beneficial E
2
actions in brain. Continuous P
4
exposure maintained over weeks to
months in ovariectomised female rodents has been observed to attenuate several E
2
-
induced actions, including neuroprotection from kainate lesion (Rosario et al., 2004),
reduction in the Alzheimer’s disease-related protein β-amyloid (Carroll et al., 2007), and
increased expression of the neurotrophins brain-derived neurotrophic factor, nerve-
growth factor, and neurotrophin 3 (Bimonte-Nelson HA, 2004). Although P
4
was not
neuroprotective in our paradigm, we suggest that P
4
has neural benefits both directly and
interactively with E
2
(Brinton et al., 2008) that may be optimised by delivery in a cyclic
manner (which parallels natural fluctuations) rather than continuously. In one of the few
studies to investigate this important issue, Gibbs found that activity of choline
97
acetyltransferase – the enzyme catalyzing biosynthesis of the neurotransmitter
acetylcholine – in ovariectomized female rats is modestly increased by E
2
, significantly
elevated by E
2
paired with a cyclic P
4
regimen but reduced by E
2
with continuous P
4

exposure (Gibbs, 2000).
Additional research is needed not only to further define this progestagen-estrogen
interaction, but also to evaluate its potential involvement in regulating neural hormone
actions in intact brain. Should these findings extrapolate to humans, they would have
significant implications for the design of hormone therapy in postmenopausal women.
98
CHAPTER FOUR: Role of synthetic progestins on the expression and function of
estrogen receptors

Chapter four Abstract

Our previous studies indicated that progesterone (P
4
) decreased the expression levels of
estrogen receptor (ER) mRNA and this decrease correlated with the reduction in ER-
dependent transcription and estradiol (E
2
)-mediated neuroprotection against apoptotic
factor II (AAII) (Jayaraman and Pike, 2009). In this study, we investigate the effects of
seven clinically relevant synthetic progestins on ER expression and E
2
-induced
neuroprotection against AAII. Our results show that some but not all synthetic progestins
regulate ER expression and function. Specifically, we found that medroxyprogesterone
acetate (MPA) decreased both estrogen receptors alpha and beta (ERα and ERβ) in a
dose- and time-dependent manner and blocked E
2
-mediated neuroprotection against
AAII. Conversely, levonorgestrel caused an increase in ERα and ERβ mRNA expression
and was protective against AAII with or without E
2
. Of the other progestins tested,
norethindrone and nestorone increased ERα expression, although only nestorone was
protective against AAII. These results provide an insight into the mechanism of action of
these seven synthetic progestins in neurons which may have potential implications in
hormone therapy against Alzheimer’s disease (AD).

99
Chapter four Introduction

The use of unopposed estrogen in hormone replacement therapy (HT) has
detrimental effects on the endometrial tissue. Hence progesterone or synthetic progestins
are given along with estrogen to block estrogen-induced cell proliferation and prevent
endometrial hyperplasia (Sitruk-Ware, 2002a, b). Many of these synthetic progestins
have been used extensively as oral contraceptives and progestational drugs and their
functions in the reproductive system are well known (Gonzalez Deniselle et al., 2007;
Schumacher M, 2007a, b; Brinton et al., 2008). However, not enough is known about the
neuronal effects of synthetic progestins, especially in the context of neurodegenerative
diseases such as Alzheimer’s disease (AD) for which HT has become a viable treatment
option.
In several basic research studies, progesterone (P
4)
has been shown to block not
only the detrimental effects of E
2
in endometrial cells but also its beneficial neuronal
actions. For example, P
4
treatment antagonizes E
2
-induced increase in anti-apoptotic
factors and neurotrophins (Garcia-Segura LM, 1998; Bimonte-Nelson HA, 2004) as well
as E
2
-mediated neuroprotection against excitotoxicity and Aβ accumulation (Rosario ER,
2006; Carroll et al., 2007). These observations suggest the requirement to come up with
alternate approaches that could be incorporated in clinical trials for a better HT regimen.
One of the ways in which this can be achieved is by using synthetic progestins which
have some but not all the properties of P
4
. Some studies have already been conducted to
determine the role of certain synthetic progestins such as medroxyprogesterone acetate
(MPA) in HT, however, with not much success (Shumaker et al., 1998; Shumaker et al.,
100
2003; Resnick SM, 2004; Resnick SM, 2006). Further investigation of the interactions of
the synthetic progestins with E
2
in different cell types is required to completely evaluate
their potential in HT.
Previously, we have shown that P
4
is able to antagonize E
2
action in cultured
neurons by decreasing the expression and function of estrogen receptors, ERα and ERβ.
We also showed that this decrease in the receptor expression and function affects E
2
-
mediated neuroprotection against AAII (Jayaraman and Pike, 2009). In this study, we
investigate the effects of seven different clinically relevant synthetic progestins on ER
expression and E
2
-mediated neuroprotection against apoptosis in primary neuron cultures.
We use the following synthetic progestins - medroxyprogesterone acetate (MPA),
norethindrone (NET), norethindrone acetate (NETA), norethynodrel, levonorgestrel
(LNG), norgestimate (NGM), and nestorone. We also determine the effect of these
progestins in regulating E
2
-induced brain-derived neurotrophic factor (bdnf) expression.

Materials and methods

Reagents
Progesterone (P
4
), medroxyprogesterone acetate (MPA), norethindrone (NET),
norethindrone acetate (NETA), norethynodrel, levonorgestrel (LNG), and norgestimate
(NGM) were kind gift of Dr. Brinton and Dr. Zhao (University of Southern California,
CA, USA). Nestorone was a kind gift from Dr. Sitruk-Ware (Rockefeller University and
Population Council, NY, USA). All hormones, including 17β-estradiol (E
2
) (Steraloids
Inc., Newport, RI, USA) were dissolved in ethanol and diluted to the required
101
concentrations using culture medium. Apoptosis Activator II, a cell-permeable
cytochrome-c-dependent caspase activator, was purchased from Calbiochem (San Diego,
CA, USA).

Primary neuron culture
All experimental animal procedures were conducted in accordance with the University of
Southern California guidelines as per the National Institute of Health standards. Primary
rat cerebrocortical cultures (approximately 95% neuronal) were prepared from E18-19
day Sprague-Dawley rat pups (n>6 pups per preparation) with some modifications to the
previously described protocol (Cordey et al., 2003). In brief, cells were enzymatically
dissociated using 0.25% trypsin at 37°C for 5 min. The reaction was then quenched using
2 volumes of phenol-red free Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC).
The cells were centrifuged, resuspended and mechanically dissociated using flame-
polished glass Pasteur pipettes, then filtered through 40μm cell strainer (Falcon; Franklin
Lakes, NJ). The single cell suspension was diluted using phenol-red free DMEM
containing N2 supplement (without progesterone) to a final density of 2.5 x 10
4
cells/cm
2

(for cell viability assays) and 8 x 10
5
cells/cm
2
(for RNA isolations). Cultures were
maintained at 37°C in a humidified incubator supplemented with 5% CO
2
. All
experiments were started after 1-2 days in vitro and were repeated with three to five
independent culture preparations.

RNA isolation and RTPCR
102
Cells were treated with different synthetic progestins at different doses and time points.
For RNA extractions in all experiments, treated cells and tissues were lysed using TRIzol
reagent (Invitrogen Corporation; Carlsbad, CA) and processed for total RNA extraction
as per manufacturer’s protocol. 1-2μg of RNA was used for reverse transcription using
the Superscript
TM
First strand synthesis system (Invitrogen) as described before
(Jayaraman and Pike, 2009) and the resulting cDNA was used for both standard PCR and
real-time quantitative PCR amplifications. Quantitative PCR was carried out using DNA
Engine Opticon 2 continuous fluorescence detector (MJ Research Inc; Waltham, MA).
The amplification efficiency was estimated from the standard curve for each gene.
Relative quantification of mRNA levels from various treated samples was determined by
the comparative Ct method (also known as ∆∆Ct method) (Livak and Schmittgen, 2001).
The following primer pairs were used - ERα α α α: F - 5’CATCGATAAGAACCGGAG3’, R-
5’AAGGTTGGCAGCTCTCAT3’; ERβ β β β: F - 5’AAAGTAGCCGGAAGCTGA3’, R -
5’CTCCAGCAGCAGGTCATA3’; β β β β-actin: F – 5’AGCCATGTACGTAGCCATCC3’; R –
5’CTCTCAGCTGTGGTGGTGAA3’.

Cell viability assay
Cultures were pretreated with different hormones followed by 3 μM AAII treatment for
24 h. At the end of the treatment period, cell viability was assessed using the live-dead
vital-dye kit (Invitrogen, Carlsbad, CA, USA). The viable cells that were stained green by
the vital-dye calcein AM were counted under fluorescent microscope. Raw data were
103
statistically assessed using ANOVA followed by between group comparisons using
Fisher’s LSD test.

Results

P
4
and MPA down-regulate ERα α α α mRNA expression in a dose- and time- dependent
manner
To investigate the effects of synthetic progestins on ERα mRNA expression, the neuronal
cultures were treated with an increasing concentration (0 – 100 nM) of P
4
or each
synthetic progestin for 24 h. The cells were then harvested for RNA isolation and
analyzed further by RT-PCR and QPCR using ERα-specific primers. Our results show
that P
4
and MPA decrease ERα mRNA expression in a dose-dependent manner. On the
other hand, NET, LNG, and nestorone treatment increase ERα transcript levels with
increasing concentrations (Fig 18A). The results obtained were also quantitatively
significant (Fig 18B).
To determine the effect of P
4
, MPA, NET, LNG, and nestorone on ERα mRNA over
time, neurons were treated with either 10 nM P
4
or each of these synthetic progestins (10
nM) for different time periods between 0 and 24 h and processed as mentioned before.
Our results show that P
4
and MPA decrease, and NET, LNG, and nestorone increase ERα
mRNA in a time-dependent manner both qualitatively and quantitatively (Fig 18 C, D).

104
Fig 18. Effect of synthetic progestins on ERα α α α mRNA expression in primary neurons

Effect of synthetic progestins on ERα α α α mRNA expression in primary neurons. A) Representative gel
showing the different levels of ERα mRNA after treating with increasing concentrations of P4 and
synthetic progestins. B) Quantitative graph of the regulation of ERα mRNA levels by P4 and synthetic
progestins. C, D) Representative gel and quantitative graph showing the levels of ERα mRNA across the
different time treatments of selected synthetic progestins.

105
P
4
and MPA decrease ERβ β β β mRNA expression in a dose- and time-dependent
manner
To assess the regulation of ERβ mRNA by the seven synthetic progestins, primary
neurons were treated with increasing concentrations (0 – 100 nM) of each progestagen
for 24 h, followed by RNA isolation and analysis by RTPCR and QPCR. Our data shows
that P
4
and MPA reduce and LNG increases ERβ mRNA levels in the treated cells (Fig
19 A, B). To investigate the changes of ERβ mRNA levels by MPA and LNG with time,
cells were treated with 10 nM of P
4
, MPA or LNG from 0 – 24 h. The resulting RNA was
analyzed further with ERβ specific primers. Our data shows that all the three
progestagens regulate ERβ transcription in a time-dependent manner as seen by both
regular and real-time PCR (Fig 19 C, D).

Neuroprotective effect of synthetic progestins against AAII
To determine the effect of the various synthetic progestins on apoptosis as well as E
2
-
mediated neuroprotection against apoptosis, cultures neurons were divided into several
treatment groups – vehicle-treated control (C), AAII treated (AAII), 10 nM E
2
for 1 h
followed by AAII (E
2
), 10 nM synthetic progestin/P
4
for 1 h followed by AAII (X
denoting any synthetic progestin), synthetic progestin pretreatment for 15 h + E
2
for 1 h
+AAII (X + E
2
). Accordingly, after the respective hormone treatment periods, the cells
were treated with 3 μM AAII for 24 h. At the end of 24 h, the vital-dye calcein AM were
added to the cells and incubated for 15 m at 37 C. On analysis of the cells for viability,
106
Fig 19: Effect of synthetic progestins on ERβ β β β mRNA expression in primary neurons.

Effect of synthetic progestins on ERβ β β β mRNA expression in primary neurons. A) Representative gel
showing the different levels of ERβ mRNA after treating with increasing concentrations of P4 and
synthetic progestins. B) Quantitative graph of the regulation of ERβ mRNA levels by P4 and synthetic
progestins. C, D) Representative gel and quantitative graph showing the levels of ERβ mRNA across the
different time treatments of selected synthetic progestins.

107
we found that AAII by itself decreased the number of viable neurons as compared to the
control cells. E
2
treatment protected the neurons from AAII insult and thus, increased the
number of live neurons. P
4
showed a decrease in E2-mediated neuroprotection against
AAII consistent with our previous observations (Jayaraman and Pike, 2009). Among the
synthetic progestins, MPA, NET, norethynodrel, and NGM did not protect the neurons
from apoptosis by themselves (Fig 20 A, B, D, F). This was similar to the previously
observed effect of P
4
(Fig 20 H and Jayaraman and Pike, 2009). On the other hand,
NETA, LNG, and nestorone were all protective against AAII by themselves (Fig 20 C, E,
G). For determining the combined effect of E
2
and synthetic progestin on neuroprotection
against AAII, cells were pretreated with each synthetic progestin for 15 h followed by 1 h
treatment with 10 nM E
2
and then 3 μM AAII for 24 h. On analyzing cell viability, we
found that MPA blocked E
2
-mediated protection against AAII similar to P
4
(Fig 20 A, H).
None of the other six synthetic progestins tested blocked E
2
action (Fig 20 B-G).

P
4
, MPA, LNG, and nestorone regulate brain-derived neurotrophic factor (BDNF)
In order to understand the mechanism behind the neuroprotective effects of some but not
all synthetic progestins, neuronal cultures were treated with the different progestins with
increasing concentrations. The isolated RNA from the treated cells was analyzed for bdnf
levels as it has been implicated in neuron survival. Our results show that P
4
and MPA
decrease bdnf mRNA levels and LNG and nestorone increase bdnf mRNA expression in
a quantitative manner (Fig 21 A, B).

108
Fig 20: Neuroprotective effects of synthetic progestins against apoptotic insults.

Neuroprotective effects of synthetic progestins against apoptotic insults. Quantitative graphs showing
% cell viability of neurons pretreated with different hormone conditions and AAII.
109
Fig 21. Effect of synthetic progestins on bdnf mRNA expression.

Effect of synthetic progestins on bdnf mRNA expression. A,B) Representative gel and quantitative
graph of bdnf mRNA levels after treatment with increasing doses of synthetic progestins and P4. C,D)
Representative gel and quantitative graph of effect of synthetic progestins on E2-mediated increase of bdnf
mRNA.

110
In order to investigate the effect of P
4
and all seven synthetic progestins on E
2
-mediated
increase of bdnf mRNA expression, we pretreated the neurons with 10 nM of each
progestagen for 15 h followed by 8 h of E
2
treatment. At the end of the treatment time,
cells were harvested and processed for RNA isolation and analyzed by RT-PCR and
quantitative PCR using primers specific to bdnf. Our results showed that both P
4
and
MPA not only decreased bdnf expression by themselves but also reduced the E
2
-induced
increase seen by E
2
treatment alone. Conversely, LNG and nestorone increased bdnf
levels with and without E
2
. Of the other progestins, none of them significantly changed
bdnf expression or suppressed the increase mediated by E
2
(Fig. 21 C, D).

Chapter four Discussion

In the current study, we investigated the effect of seven synthetic progestins on
the expression levels of estrogen receptors, ERα and ERβ. We also determined the role
of these clinically relevant progestins in neuroprotection against apoptosis and on E
2
-
mediated neuroprotection. Our results show that MPA decreases both ERα and ERβ
mRNA levels in a dose- and time-dependent manner. MPA does not protect the neurons
against AAII and also blocks the protective effect of E
2
. All the observed effects of MPA
were very similar to that of P
4
. On the other hand, LNG increased the mRNA levels of
both the estrogen receptors and was protective against AAII either alone or in
combination with E
2
. NET and nestorone increased ERα and not ERβ levels but only
nestorone showed neuroprotection against AAII. None of the other synthetic progestins
except for MPA blocked E
2
-mediated neuroprotection. NETA was protective by itself
111
even though it had not effect on the ERs. Further, MPA decreased the expression of bdnf
mRNA where as LNG and nestorone increased it.
Our findings suggest that all the seven synthetic progestins have varied effects on
ER expression and on blocking E
2
action. MPA seems to be the closest to P
4
in
decreasing ERα and ERβ mRNA levels as well as not being neuroprotective alone and in
the presence of E
2
. This is in agreement with previous reported effects of MPA on ER
expression and function in various cell types (Miyagawa et al., 1997; Nilsen and Brinton,
2002; Nilsen and Diaz Brinton, 2003; Vereide et al., 2006). MPA also has been shown to
decrease the activation of ERE-reporter plasmid and prevent E
2
-dependent cell
proliferation (Catherino et al., 1993). This is also in agreement with the data from the
WHI trails which suggested the combination of MPA with conjugated equine estrogens
(CEE) increased the risk for dementia rather than improve it (Shumaker et al., 2003;
Resnick SM, 2006). Therefore, the reduction in ER expression and perhaps ER function
might be the mechanism by which MPA blocks E
2
action similar to P
4
. On the other
hand, several studies have also shown that MPA has outcomes opposite to P
4
(Rosano et
al., 2000; Nilsen and Brinton, 2002).
Of the other progestins, LNG shows most promise as a potential candidate for HT
as it increases the expression levels of both ERα and ERβ mRNA, is protective against
an apoptotic factor, and does not antagonize E
2
-induced neuroprotection in primary
neurons. This is in contrast to the published effect of LNG in endometrial cells where it is
said to decrease ERα and ERβ expression (Vereide et al., 2006). Also, LNG increases
proliferation in breast cancer cells (Catherino et al., 1993). This means that LNG is able
112
to have cell-type specific effect on ERs and could possibly help retain the beneficial
neuronal E
2
functions while decreasing its detrimental effects in endometrial cells, which
is the desired effect expected in HT. Further in vivo studies have to be conducted to
determine whether the beneficial effects of LNG are conserved on the systemic level.
The role of BDNF as a neurotrophin which is protective against many insults is
well known (Alberch et al., 2002; Marini et al., 2004; Mocchetti and Bachis, 2004;
Harper et al., 2009). Estrogen is a known up-regulator of BDNF in several paradigms
(Sato K, 2007; Takuma K, 2007; Sohrabji and Lewis, 2006; Bimonte-Nelson HA, 2004).
Progesterone on the other hand has shown to block the estrogen-induced increase in
BDNF (Bimonte-Nelson HA, 2004; Aguirre and Baudry, 2009). This is consistent with
our observations that P
4
reduced bdnf mRNA levels and blocks the E
2
-mediated increase
in bdnf levels. MPA behaves in a similar manner by decreasing bdnf with and without E
2
.
LNG and nestorone increase bdnf levels and do not block E
2
effect on its expression. The
effect of these progestins on bdnf gives a potential mechanism by which they are able to
regulate AAII-induced apoptosis and influence neuroprotection.
The difference among the seven synthetic progestins may be attributed to the
difference in their structures. MPA is derived from the pregnane-structure; NET, NETA,
and norethynodrel are derived from the estrane structure; LNG and NGM are derived
from the gonane-structure; and nestorone is derived from 19-norprogesterone structure
(Schindler et al., 2008). NETA and norethynodrel have to be converted to NET to
function as a progestin (Sitruk-Ware, 2002b). Similarly, NGM has to be converted to
113
LVG to have an effect (Sitruk-Ware, 2002b). This might also be another reason why
norethynodrel and NGM had not effect on any of the endpoints tested.
According to our data, the gonane-structure seems to be the most favorable in
terms of interaction with E
2
. Since E
2
and progestagen components are required for a
successful HT regimen and to reduce the risk of uncontrolled E
2
exposure, determining
the interaction of synthetic progestins with estrogen in different cell-types is important.
This will provide an alternative approach for designing a combination of drugs that
would have more benefits than risks in clinical trials.
114
CHAPTER FIVE

Estradiol and progesterone regulation of β-amyloid degrading enzymes

Chapter five Abstract
The accumulation of amyloid β (Aβ) is a key risk factor in the development of
Alzheimer’s disease. Female sex steroid hormones, estrogen and progesterone have been
shown to regulate Aβ accumulation both in vitro and in vivo although the exact
mechanism(s) involved is unclear. In this study we investigate the effect of E
2
and P
4

treatment on the expression Aβ degrading enzymes such as insulin degrading enzyme,
neprilysin, angiotensin-converting enzyme, endothelin-converting enzyme 1 and 2, and
transthyretin both in primary neuron cultures as well as in female rat brains. Our results
show the E
2
and P
4
are able to regulate the expression of one or more of these enzymes.
In particular, E
2
and P
4
increase the expression of Ide mRNA and protein and this
inversely correlates with the soluble Aβ levels in vivo. Our findings provide a potential
mechanism by which female sex steroid hormones are able to regulate Aβ accumulation.

115
Chapter five Introduction
Alzheimer’s disease (AD) is characterized by extracellular plaque formation due
to the accumulation of β-amyloid (Aβ), a neurotoxic peptide. Aβ is derived from a larger
single-transmembrane protein, the amyloid precursor protein (APP), when it undergoes
proteolytic cleavage by the activity of secretases through the amyloidogenic pathway (De
Strooper and Annaert, 2000). Normally, amount of Aβ is maintained at a non-toxic level
by a balance between its production and clearance. Several factors regulate the various
steps involved in the production as well as clearance of Aβ. One such key regulator is the
female sex steroid hormones, estrogen and progesterone.
The decline of estrogen and progesterone during menopause is implicated to be a
major risk factor for late-onset AD. Estrogen treatment has shown to be neuroprotective
against Aβ toxicity (Brinton et al., 2000). Several reports have suggested that estrogen
regulates APP processing towards the non-amyloidogenic pathway (Gandy and
Petanceska, 2001). Estrogen has been shown to reduce Aβ levels both in vivo and in vitro
(Chang et al., 1997; Petanceska et al., 2000, Xu et al., 1998), induce secretion of sAPPα
(Manthey et al., 2001, Zhang et. al., 2005), and regulate alternate APP mRNA splicing
(Thakur MK, 2005). In AD patient brains, the level of estrogen in cerebrospinal fluid is
lower and is inversely correlated to the amount of soluble Aβ (Lewczuk et al., 2008). In
post-menopausal women, estrogen treatment has shown to reduce Aβ levels in the plasma
(Baker et al., 2003). Similarly, in female rodent models, the decrease in estrogen levels
due to ovariectomy correlates with increased levels of soluble Aβ in the brain while
estrogen replacement has shown to decrease soluble Aβ levels and the amount of
116
extracellular plaque depositions (Petanceska et al., 2000; Levin-Allerhand et al., 2002;
Zheng et al., 2002; Yue et al., 2005; Xu et al., 2006). The role of progesterone as a
regulator of Aβ is largely unclear. Only recently, studies have suggested that
progesterone also plays a role in regulating Aβ level along with estrogen (Carroll et al.,
2007).
An important clearance mechanism of Aβ is the enzyme-mediated degradation of
Aβ. Some of the key enzymes that are implicated in Aβ degradation are insulin-
degrading enzyme (IDE) (Mukherjee et al., 2000; Vekrellis et al., 2000; Edbauer et al.,
2002; Farris et al., 2003; Qiu and Folstein, 2006; Wang et al., 2006), neprilysin (NEP)
(Shirotani et al., 2001; Carson and Turner, 2002; Kanemitsu et al., 2003; Leissring et al.,
2003; Marr et al., 2003; Marr et al., 2004), endothelin-converting enzymes 1 and 2 (ECE-
1, ECE-2) (Eckman et al., 2001; Eckman et al., 2003), angiotensin-converting enzyme
(ACE) (Elkins and Rajab, 2004; Hemming and Selkoe, 2005; Zuo et al., 2007) and
transthyretin (TTR) (Tsuzuki et al., 2000; Choi et al., 2007; Buxbaum et al., 2008). IDE
or insulysin has been shown to degrade Aβ in cultured cells as well as in animal models
(Chesneau et al., 2000; Mukherjee et al., 2000; Vekrellis et al., 2000; Farris et al., 2003;
Leissring et al., 2003; Qiu and Folstein, 2006). Similarly neprilysin has been shown to
play an important role in the clearance of Aβ both in vitro and in vivo (Hama et al., 2001;
Iwata et al., 2001; Shirotani et al., 2001; Marr et al., 2003; Marr et al., 2004). Blocking
the endogenous expression of endothelin-converting enzymes 1 and 2 either by using
metalloprotease inhibitor such as phosphoramidon or in mice deficient in both the ECEs
causes an elevation in Aβ levels (Eckman et al., 2001; Eckman et al., 2003). ACE has
117
been shown to degrade secreted Aβ 40 and 42 in vitro and in vivo and mutations in ACE
catalytic domains as well as a pharmacological inhibitor of ACE, catopril, lead to Aβ
accumulation (Hemming and Selkoe, 2005; Zuo et al., 2007).Transthyretin reduces Aβ
aggregation and cytotoxicity in neuroblastoma cells as well as in transgenic mouse model
of AD (Giunta et al., 2005; Buxbaum et al., 2008). All of these enzymes are expressed in
the neurons and are present in the hippocampal and cortical regions of the brain (for
review see (Choi et al., 2007; Miners et al., 2008).
Determining the combined effect of E
2
and P
4
on the Aβ degrading enzymes is
key to understanding the role of hormonal interactions on the expression and activity of
these enzymes. This combined treatment paradigm is also of clinical relevance since
hormone therapies in post-menopausal women use the combination of E
2
and
progestagens. In this study, we investigate the individual and combined regulation of
several Aβ degrading enzymes by E
2
and P
4
both in primary neuron cultures as well as in
the rat brain. This is one of the first studies that determine the role of E
2
and P
4

interactions in regulating some of the key enzymes involved in Aβ clearance.

Materials and methods
Reagents
Estradiol (E
2
) (Steraloids Inc., Newport, RI) and progesterone (P
4
) (Acros
Organics USA, Morris Plains, NJ) were dissolved in 100% ethanol and were diluted to
the required concentrations using CMF solution. The ER antagonist ICI 182,780 (Tocris,
Ellisville, MO), the ERα agonist propylpyrazole triol (PPT: Tocris), the ERβ agonist 2,3-
118
bis(4-hydroxyphenyl) propionitrile (DPN: Tocris), and PR antagonists RU486 (Sigma-
Aldrich, St.Louis, MO) and ORG31710 (gift..) were all dissolved in 100% ethanol to
prepare the stock solutions.

Primary neuronal culture
Primary rat cerebrocortical neuron cultures were ~95% neuronal and were
prepared with some modifications of a previously described protocol (Pike CJ, 1999).
Briefly, cerebral cortices were dissected from gestational day 17-18 Sprague-Dawley rat
pups (n>6 pups per preparation). Cortices were enzymatically dissociated using 0.25%
trypsin at 37°C for 5 min. The reaction was quenched using 2 volumes of Dulbecco’s
Modified Eagle’s Medium (DMEM) (ATCC; Manassas, VA). The cells were centrifuged,
resuspended and mechanically dissociated using flame-polished glass Pasteur pipettes,
then filtered through 40μm cell strainer (Falcon; Franklin Lakes, NJ). The single cell
suspension was diluted using DMEM containing N2 supplement (without progesterone)
to a final density of 2.5 x 10
4
cells/cm
2
(for cell viability assays) and 8 x 10
5
cells/cm
2

(for RNA isolations). Cultures were maintained at 37°C in a humidified incubator
supplemented with 5% CO
2
. All experiments were started after 1-2 days in vitro and were
repeated with three to five independent culture preparations.

Animals and surgical procedures
For in vitro studies, timed pregnant female Sprague Dawley rats (Harlan Laboratories
Inc., Livermore, CA) were purchased from Harlan Laboratories, at gestational day 17-18
119
rats were euthanized via CO2 inhalation and pups harvested for preparation of neuronal
cultures. For in vivo studies, female Sprague Dawley rats were purchased either sham-
operated or bilaterally ovariectomised at 3 months of age (Harlan Laboratories Inc.). All
animals were housed individually with access to food and water under a 12 h on: 12 h off
light cycle. Experimental animal procedures were conducted in accordance with the
University of Southern California guidelines based on National Institute of Health
standards.

Hormone treatments in animals
In the short-term experiment, rats were randomly assigned to 4 groups: sham-ovx
+ vehicle (Sham); ovariectomised + vehicle (OVX); ovariectomised + 17β-estradiol
(OVX+ E
2
); and ovariectomised + progesterone (OVX+ P
4
). (N=7/group). Treatments
were administered via two injections, the first injection 7 days post-sham or -OVX (time
0 hr), then the second injection 24 hrs later (time 24 hrs). Tissues collected 24 h after the
last injection (at time 48 hr). Vehicle treated animals were injected with 100uL canola oil
per injection. E
2
treated rats received 100μg/100μL E
2
per injection (1mg/mL E
2
in
canola oil, % ETOH) ( and P
4
treated rats received 500μg/100μL P
4
per injection
(5mg/mL P
4
in canola oil).
For the long-term experiment, rats were either sham-ovx (Sham; n=8) or ovx.
Ovariectomised rats were randomly assigned to six groups to receive the following
treatments: placebo (OVX); 17β-estradiol (OVX+ E
2
); (continuous P
4
(ovx+ P
4cont
);
cyclic P
4
(ovx+ P
4cyc
), 17β-estradiol with continuous P
4
(ovx+ E
2
+ P
4cont
), or E
2
with
120
cyclic P
4
(ovx+ E
2
+ P
4cyc
) (n=8/group). Rats were treated with two cycles of 30 day
hormone treatment (60 days total) administered 7 days post-OVX via slow release
subcutaneous implants (Innovative Research America, ). Sham and OVX groups were
implanted with placebo pellets; E
2
treated rats were implanted with a 0.72mg E
2
, 90 day
release pellet while continuous P
4
treated rats were implanted with a 200mg P
4
, 90 day
release pellet. Rats treated with cyclic P
4
were implanted with a 50mg P
4
, 10 day release
pellet at day 20 and 50.
At the time of sacrifice trunk blood was collected and separated into the serum
fraction for determining hormone levels. Uterus were collected from all the animals and
weighed as a positive control for hormone manipulations. The brains were rapidly
dissected and the hippocampi and frontal cortex from one hemisphere was snap-frozen
for RNA and protein extractions, while the other hemisphere was snap frozen to be
processed for Aβ ELISA.

RTPCR and quantitative PCR
For RNA extractions in all experiments, treated cells and tissues were lysed using
TRIzol reagent (Invitrogen Corporation; Carlsbad, CA) and processed for total RNA
extraction as per manufacturer’s protocol. 1-2μg of RNA was used for reverse
transcription using the Superscript
TM
First strand synthesis system (Invitrogen) as
described before (Jayaraman and Pike, 2009) and the resulting cDNA was used for both
standard PCR and real-time quantitative PCR amplifications. Quantitative PCR was
carried out using DNA Engine Opticon 2 continuous fluorescence detector (MJ Research
121
Inc; Waltham, MA). The amplification efficiency was estimated from the standard curve
for each gene. Relative quantification of mRNA levels from various treated samples was
determined by the comparative Ct method (also known as ∆∆Ct method) (Livak and
Schmittgen, 2001). The following primer pairs were used - Ide: F –
GGAAGCGTTCGCCGAGATCGCA; R- TCTGAATCGACAGCGTTCAC. Nep: F –
CATTGAACTATGGGGGCATC; R – CCTGAAATTGCCAGGACTGT. Ece1: F –
GAGCTGACTCATGCTTTC; R – CAGCTCCGTTCTTCTTTA. Ece2: F –
AGAAAGTTCTCGCTGCCT; R – AGTGGCGACAACAAGAAA. Ace: F –
GAGCCATCCTTCCCTTTT; R – GGCTGCAGCTCCTGGTAT. Ttr: F –
GGCTCACCACAGATGAGA; R – ACAAATGGGAGCTACTGC. β β β β-actin: F –
AGCCATGTACGTAGCCATCC; R – CTCTCAGCTGTGGTGGTGAA.

Western Blotting
For all experiments involving protein analysis by immunoblotting, appropriately
treated cells and tissues were lysed using a reducing sample buffer (62.5mM Tris-HCl,
1% sodium dodecyl sulfate (SDS), 2.5% glycerol, 0.5% 2-β-mercaptoethanol), boiled for
5 min at 100°C and centrifuged at 13000g for 10 min in a microcentrifuge. The resultant
supernatant was used for western blot analysis using a standard protocol previously
described (Pike CJ, 1999). Briefly, samples were electrophoresed in 10% polyacrylamide
gels and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore,
Medford, MA, USA) at constant 100V for 1 h. The membranes were blocked using 5%
bovine serum albumin (BSA) solution (10mM Tris, 100mM NaCl, 0.1% Tween) for 1 h
at room temperature (RT), followed by incubation with the primary antibodies (α-IDE –
122
Abcam) in blocking solution for 1h at RT. The membranes were then incubated with
corresponding horseradish peroxidase-conjugated secondary antibody for 1 h at RT and
detected using ECL (Amersham, Arlington Heights, IL, USA).

β β β β-amyloid ELISA
Brain levels of soluble Aβ1-40 were determined by ELISA as previously
described (Haugabook et al., 2001). In brief, hemi-brains were processed for Aβ ELISA
after extracting soluble protein by homogenization in buffer (0.2% diethylamine, 50mM
NaCl; 1ml/100mg tissue) using a polytron for 1 min on ice. Homogenates were
centrifuged at 100,000 x g at 4°C for 1 h and the supernatants collected and neutralized
(1/10th volume of 0.5 M Tris-HCl pH 6.8). This soluble protein fraction was used to
measure Aβ with a sandwich capture ELISA using the rodent-specific Aβ40 antibody
13.1.1. Raw data (expressed as pmol Aβ/g protein) were statistically analyzed by
ANOVA followed by between group comparisons using the Fisher LSD test.

Results
17β β β β-estradiol and progesterone both regulate Ide and Ace mRNA levels in primary
neuron cultures.
To investigate the effect of E
2
and P
4
on various Aβ-degrading enzymes, primary
neuron cultures were treated with increasing concentrations of E
2
(0 – 100nM) or P
4
(0 –
300nM). The cells were then harvested for RNA isolation and cDNA synthesis.
Following the RT reaction, the samples were analyzed by qualitative and quantitative
123
PCR using specific primers. Our results qualitatively and quantitatively show that Ide
mRNA levels increased in a dose-dependent manner while Ace and Ece2 mRNA levels
decreased in a dose-dependent manner with E
2
treatment (Fig. 22 A, B). Ece1, Nep and
Ttr mRNA levels remained unchanged with increasing E
2
doses (Fig. 22 A, B). We also
show that Ide, Ace and Ttr mRNA levels increased in a dose-dependent manner with P
4

treatment (Fig. 23 A, B). Ece1, Ece2 and Nep mRNA levels remained unchanged with
increasing P
4
doses (Fig. 23 A, B). We then investigated the effect of 10nM E
2
on Ide,
Ace, and Ece2 and similarly the effect of 30nM P
4
on Ide, Ace, and Ttr over time (0 – 24
h). Our results show that Ide mRNA increased steadily whereas both Ace and Ece2
mRNA levels decreased after about 8 h of E
2
treatment (Fig. 22 C, D). We also show that
Ide, Ace and Ttr mRNA levels increased both qualitatively (Fig. 23 C) and quantitatively
(Fig. 23 D) with P
4
treatment.

124
Fig 22. E
2
affects Aβ β β β-degrading enzymes in a dose- and time-dependent manner.

E
2
affects Aβ β β β-degrading enzymes in a dose- and time-dependent manner. A,B) Representative gel and
quantitative graph showing the levels of different Aβ-degrading enzymes after E2 treatment. C,D)
Representative gel and quantitative graph showing levels of Ide, Ace and Ece2 mRNA after various times
of E2 treatment.
125
Fig 23. P4 affects Aβ β β β-degrading enzymes in a dose- and time-dependent manner.

P4 affects Aβ β β β-degrading enzymes in a dose- and time-dependent manner. A,B) Representative gel and
quantitative graph showing the levels of different Aβ-degrading enzymes after P4 treatment. C,D)
Representative gel and quantitative graph showing levels of Ide, Ace and Ttr mRNA after various times of
P4 treatment.

126
Effect of receptor agonists and antagonists on expression of Ide, Ace, Ece2, and Ttr.
To investigate the mechanism behind the regulation of Ide, Ace, and Ece2 mRNA
by E
2
, cultures were pretreated with estrogen receptor (ER) antagonist, ICI 182780 for 1
h followed by 10 nM E
2
or vehicle treatments for 24 h. Cells were harvested for RNA
isolation followed by qualitative and quantitative PCR. Our results suggest that in the
presence of ICI, E
2
-mediated increase in Ide mRNA was blocked suggesting that the
increase in Ide mRNA by E
2
may be through classical genomic pathways (Fig. 24 A,B).
However, the effect of E
2
on Ace and Ece2 mRNA levels remained unchanged even in
the presence of ICI suggesting that these effects may be occurring via non-genomic
mechanisms (Fig 24 A, B). To determine whether ERα, ERβ, or both ERs might be
important in E
2
-mediated increase of Ide mRNA, cells were treated with increasing
concentrations (0 – 100 nM) of ERα and ERβ agonists, PPT and DPN, respectively.
After the 24 h treatment cells were isolated for RNA extraction for RT-PCR. Our results
indicate that while Ace and Ece2 mRNA levels remained unchanged with different
concentrations of PPT and DPN, both PPT and DPN treatments showed a dose-dependent
increase of Ide mRNA (Fig. 24 C-F). Upon quantitative PCR, our results suggest that the
increase in Ide mRNA is more robust in case of PPT than DPN suggesting a role of ERα
over ERβ in E
2
-regulation of Ide.

127
Fig 24. Effect of ER agonist and ER and PR antagonists on the mRNA levels of
different Aβ β β β-degrading enzymes.

Effect of ER agonist and ER and PR antagonists on the mRNA levels of different Aβ β β β-degrading
enzymes. A,B) Representative gel and graph showing the effect of ICI 182,770, an ER-antagonist, on E2-
mediated changes in the levels of Aβ-degrading enzymes. C,D) Representative gel and graph showing the
effect of PPT, an ERα-agonist, on the levels of Aβ-degrading enzymes. E,F) Representative gel and graph
showing the effect of DPN, an ERβ-agonist, on the levels of Aβ-degrading enzymes. G,H) Representative
gel and graph showing the effect of RU486 and Org31710, PR-antagonists, on the levels of Aβ-degrading
enzymes.
128
followed by 30nM P
4
treatment for 16 h and harvested for RNA isolation. Our results
show that the increase in Ide and Ace mRNA levels by P
4
remained unchanged in the
presence of the antagonists, where as the mRNA levels of Ttr did not increase by P
4

treatment in the presence of the PR antagonists (24 G-J). This suggests that P
4
effect on
Ttr alone may be through classic genomic signaling.

Short-term regulation of Ide, Ace, Ece2, and Ttr in vivo by E
2
and P
4
.
To investigate the effect of E
2
and P
4
on the different Aβ-degrading enzymes in
vivo, ovariectomised (ovx) female Sprague-Dawley rats were used. The rats in the ovx+E
and ovx+P groups were injected with 100ug/100ul E2 or 500ug/100ul P
4
each
respectively at time 0 h and time 24 h and were sacrificed at time 48 h (24 h after the last
injection). The rats in the Sham and ovx groups were injected with vehicle at the same
time points and sacrificed at time 48 h. The brains were immediately dissected and
hippocampi and frontal cortices were isolated for RNA extractions. The uterine weights
and hormone levels from the various treatment groups indicate that the hormone
manipulations were as expected. Our results demonstrate that E
2
increases Ide mRNA
levels and decreases both Ace and Ece2 mRNA levels in vivo in the treated animals (Fig.
25 A, C). These results are similar to the observations in the primary neuron cultures. P
4

injected animals showed an increase in Ide and Ace mRNA levels but no change in the
Ttr mRNA levels (Fig. 25 A, C). Quantitative PCRs were conducted to confirm the
qualitative data (Fig. 25 B, D).
129
Fig 25. Effect of short-term hormone treatment on in vivo levels of Aβ β β β-degrading
enzymes.

Effect of short-term hormone treatment on in vivo levels of Aβ β β β-degrading enzymes. A) Representative
gel showing the in vivo levels of different Aβ-degrading enzymes after hormone manipulations. B-E)
Graphical representation of the quantitation of Aβ-degrading enzyme levels after short-term in vivo
hormone manipulations.
130
Long-term regulation of Ide, Ace, Ece2, and Ttr in vivo by E
2
and P
4

In order to investigate the effect of E
2
and P
4
combined together in vivo, we
designed a study using female Sprague-Dawley rats as described in the Materials and
methods section. The uterine weights and hormone levels from the various treatment
groups indicate that the hormone manipulations were as expected. Our results show that
E
2
and cyclic P
4
increase IDE mRNA levels both individually and in combination. Ace
mRNA levels increase with ovariectomy and decrease with E
2
treatment consistent with
the cell culture findings. P
4
increases Ace mRNA levels with and without E
2
. We did not
see any significant changes in Ece2 and Ttr mRNA levels in this treatment regimen (Fig.
26 A). These data were corroborated quantitatively by real time PCR (Fig. 26 B - E).

Long-term regulation of soluble Aβ β β β levels by E
2
and P
4

To investigate the effects of the above mentioned in vivo regimen on Aβ
accumulation, we used one hemibrain from the animals from different treatment groups
to analyze soluble Aβ levels by ELISA. Our results show that the quantitative levels of
soluble Aβ are lowest in the group treated with E
2
and cyclic P
4
(fig 27). Our data also
suggests an inverse correlation between the soluble Aβ levels and levels of IDE mRNA
suggesting a possible mechanism by which the hormones could be regulating Aβ
accumulation in the brains of the treated animals. Other Aβ-degrading enzymes such as
Ace may be contributing to Aβ clearance in animals treated with P
4
alone or in
combination with E
2
.

131
Fig 26. Effect of long-term hormonal treatment on the in vivo levels of Aβ β β β-degrading
enzymes.

Effect of long-term hormonal treatment on the in vivo levels of Aβ β β β-degrading enzymes. A)
Representative gel showing the in vivo levels of different Aβ-degrading enzymes after hormone
manipulations. B-E) Graphical representation of the quantitation of Aβ-degrading enzyme levels after long-
term in vivo hormone manipulations.

132
Fig 27. Effect of long-term hormonal treatments on soluble Aβ β β β levels in vivo.

Effect of long-term hormonal treatments on soluble Aβ β β β levels in vivo. This is the quantitation of soluble
Aβ levels in the hemibrain of rats treated with different hormone conditions.
133
E
2
ad P
4
regulate expression of IDE protein
Since IDE was the only Aβ degrading enzyme that was regulated positively by
both E
2
and P
4
across in vitro and in vivo treatment paradigms, we investigated whether
IDE expression was affected at the protein level. To do this, we used similar dose-
response treatments with both E
2
and P
4
in primary neuron cultures. For time-course, we
extended the time range to 48 h in order to detect changes in the protein. Similarly, we
used the hippocampal tissues from the short-term in vivo animals for determining IDE
changes at the protein level. The isolated protein samples from all the experiments were
analyzed by immunoblotting using antibody specific to IDE. Our results suggest that both
E
2
and P
4
are able to increase the expression of IDE in a dose- and time-dependent
manner (Fig. 28 A-F). We also see a decrease in IDE expression with ovariectomy which
is restored by both E
2
and P
4
treatments in rat hippocampus (Fig. 28G, H).

Chapter five Discussion
In the present study, we investigated the effects of E
2
and P
4
on the expression
levels of Aβ degrading enzymes both in vitro and in vivo. Our results suggest that
physiological concentrations of E
2
and P
4
are able to affect mRNA expression of some
but not all Aβ degrading enzymes. We show that E
2
affects Ide, Ace and Ece2 mRNA in
a dose- and time-dependent manner in primary neuron cultures. Similarly, P
4
regulates
the expression levels of Ide, Ace and Ttr mRNA. These effects are largely replicated in
both short-term and long-term in vivo hormone treatments.
134
Fig 28. Effect of E2 and P4 on IDE expression levels.

Effect of E2 and P4 on IDE expression levels. A-D) Effect of E2 dose and time course on IDE protein
levels. E-H) Effect of P4 dose and time course on IDE levels. I,J) Effect of short-term hormone
manipulations of IDE levels in vivo.
135
Moreover, we show the role of E
2
- and P
4
-mediated classic genomic signaling in the
regulation of Ide and Ttr mRNA respectively. We also demonstrate an inverse correlation
between the levels of Ide and Aβ accumulation in rat brain and the regulation of IDE
activity by the hormones suggesting a possible mechanism for Aβ regulation by E
2
and P
4

treatments.
Gonadal hormone depletion and E
2
supplementation has been implicated in the
regulation of key Aβ degrading enzymes including IDE, neprilysin, ACE, ECE and
transthyretin in a diverse range of tissues including the brain, although not in the context
of Aβ degradation. For example, uterine IDE level and activity decreases during low
estrogen level and increases during high estrogen level during estrous cycle (Udrisar et
al., 2005). Ovariectomized rats show decreased levels of NEP in their brain which is
upregulated by estrogen replacement (Pinto et al., 1999; Huang et al., 2004; Neves et al.,
2006; Xiao et al., 2009). ECE-1 mRNA has been previously shown to be down-regulated
by estrogen in vascular tissues (Rodrigo et al., 2003). Conjugated estrogen and
phytoestrogen treatments decrease ACE expression in animals as well as post-
menopausal women (Seltzer et al., 1992; Gallagher et al., 1999; Seely et al., 2004;
Brosnihan et al., 2008). Estrogen increases TTR expression in various tissues including
the brain (Tang et al., 2004; Goncalves et al., 2008; Quintela et al., 2009). Very few
studies have looked into the effects of P
4
on the different Aβ degrading enzymes. One
such study shows that P
4
treatment increases NEP mRNA levels in the rat uterus (Casey
et al., 1991; Pinto et al., 1999).
136
E
2
has been shown to regulate the expression and functions of several Aβ
degrading enzymes in various tissues, although not in the context of Aβ degradation. In
the uterus, ovariectomy decreases IDE levels which increase by E
2
treatment (Udrisar et
al., 2005). A recent independent study done by our group using triple transgenic mice
model of AD shows E
2
regulation of IDE in hippocampal neurons (Zhao et al., 2010).
Several studies done in animals have compared the effect of ovariectomy and E
2

replacement on ACE levels in various tissues such as the cardiac tissues, lung, kidney,
and anterior pituitary and their results show a decrease in ACE levels with E
2
treatment
(Seltzer et al., 1992; Tanaka et al., 1997; Gallagher et al., 1999). Similar results have
been obtained in studies involving post-menopausal women too where estrogen
replacement therapy has shown a decrease in ACE activity (Proudler et al., 1995; Sanada
et al., 2001; Proudler et al., 2003). The up-regulation of neprilysin expression has been
shown in ovariectomised rat brains as well as cell culture following E
2
treatment (Huang
et al., 2004; Xiao et al., 2009; Liang et al., 2010). E
2
also increases neprilysin expression
in the uterus as shown in normotensive and hypertensive rats (Neves et al., 2006). Among
the endothelin-converting enzymes, vascular ECE-1 is downregulated by E
2
and
phytoestrogens and upregulated by anti-estrogen, ICI 182,780 in ovariectomised rats
(Rodrigo et al., 2003). Transthyretin is known to be synthesized in the liver as well as the
choroid plexus. E
2
increases the expression of transthyretin in both liver and choroid
plexus via ER-dependent pathways (Goncalves et al., 2008; Quintela et al., 2009).
Progesterone regulation of the Aβ degrading enzymes is not very well-
documented. One study shows such a regulation in human endometrium where
137
progesterone increases neprilysin expression (Casey et al., 1991). Our results further
demonstrate that progesterone is capable of modulating the neuronal expression of Ide
and Ace expression in vitro and in vivo and Ttr expression in vitro. The modulatory
effects of the gonadal sex hormones on Aβ degrading enzymes may explain, at least in
part underlying mechanisms by which estrogen and progesterone regulate Aβ
accumulation both in vitro and in vivo (Gandy and Petanceska, 2000, 2001; Carroll et al.,
2007)
The mechanism behind the regulation of Aβ degrading enzymes by estrogen and
progesterone is also largely unknown. A few evidences suggest the role of estrogen
receptors, ERα and ERβ, in E
2
-mediated changes (Zhao L, 2007; Goncalves et al., 2008;
Quintela et al., 2009; Liang et al., 2010). We show that the regulation of Ide by E
2
is
blocked in the presence of anti-estrogen, ICI 182,780. We further demonstrate that both
ERα and ERβ might be important in the E
2
-mediated regulation of Ide. The P
4
effect on
Ttr is blocked by anti-progestins like Ru486 and Org31710 suggesting that this regulation
might be due to classic genomic signaling by PRs. Further investigation of the roles of
ERs and PRs is required to completely understand the mechanism behind the hormone
regulation of these Aβ degrading enzymes.
Determining the combined effect of E
2
and P
4
on the Aβ degrading enzymes is
key to understanding the role of hormonal interactions on the expression and activity of
these enzymes. This combined treatment paradigm is also of clinical relevance since
hormone therapies in post-menopausal women use the combination of E
2
and
progestagens. Our data show that the effect of E
2
with cyclic P
4
treatment is the most
138
optimal condition for the expression of Ide as well as for lowering Aβ accumulation in rat
hippocampus. The effect of continuous P
4
exposure either alone or with E
2
on Ide
expression and Aβ accumulation is minimal. This is in accordance with some of the
previous studies from our laboratory and others that suggest that cyclic P
4
treatment is
more beneficial than continuous P
4
treatment either alone or in combination with E
2

(Gibbs, 2000; Carroll et al., 2007). Ongoing clinical trials such as the Kronos Early
Estrogen Prevention Study (KEEPS) have also incorporated the cyclic or pulsed P
4
in the
treatment paradigm (Miller, 2009).

139
Chapter 6

Conclusions and future directions

The work presented in my thesis is designed to understand the role of estrogens
and progesterone interactions in neurons and their impact on pathways related to
Alzheimer’s disease (AD). Female sex hormones estrogens and progesterone have
multiple functions in a variety of tissues. One of the most prominent neurodegenerative
diseases that have a higher risk with the decline of estrogens and progesterone during
menopause is AD (Manly et al., 2000; Shumaker et al., 2003). Because basic research
work and observational studies have established the importance of estradiol and
progesterone in maintaining cognitive functions and neuroprotection, hormone
replacement therapies (HT) were designed to use a combination of estrogens and
progestagens for long-term treatments in AD patients. However, the results from a recent
large-scale randomized clinical trial, the Women’s Health Initiative, did not corroborate
the beneficial aspects of these hormones seen in basic research studies. This discrepancy
between basic research and clinical data suggests that a better understanding of hormonal
interactions with the different cell types as well as their interaction with each other is
critically important in order to come up with a successful design for future HT.
Some of the important questions in the field of “Hormone treatment and
Alzheimer’s disease” that my thesis work focuses on answering are: What is the
mechanism(s) by which progesterone is able to oppose not only the detrimental effects of
estradiol but also its beneficial effects especially in neuronal cells? Which of the
progestagens are ideal candidates for use in HT in combination with estrogens? Is a
140
cyclic regimen of progesterone better than a continuous regiment of treatment with or
without estradiol? What is the mechanism(s) by which estradiol and progesterone
interactions are able to regulate β-amyloid accumulation? I have utilized a combination
of in vitro and in vivo paradigms and techniques to address these key issues.
The experiments in Chapter 2 investigated the mechanism(s) by which
progesterone could antagonize estradiol’s beneficial action in neurons. We show that
progesterone is able to downregulate both the estrogen receptors, ERα and ERβ, at the
mRNA level in a dose- and time-dependent manner (Jayaraman and Pike, 2009); Chapter
2). We further investigated the impact of progesterone on E
2
function and found that the
decrease in ER expression by progesterone also affected ER-dependent transcription and
E
2
-mediated neuroprotection against an apoptotic factor (Jayaraman and Pike, 2009);
Chapter 3). Our data suggests that progesterone is capable of opposing estradiol signaling
by reducing its receptor expression and function.
The property of opposing estradiol action is not isolated to progesterone alone
as seen from the WHI trials. The progestagen used in the WHI trials was
medroxyprogesterone acetate (MPA) which is a synthetic progestin along with combined
equine estrogens (CEE). In certain endpoints of the WHI trial, the combination of MPA
and CEE seemed to be worse than CEE alone suggesting that MPA may also antagonize
estradiol action. Therefore, in Chapter 4, we did a comparative analysis of seven different
synthetic progestins including MPA on ER expression and E
2
-mediated neuroprotection.
Our data showed that these synthetic progestins have varying properties with regard to
their interactions with estradiol.
141
In Chapter 5, we investigated a possible mechanism by which estradiol and
progesterone may regulate β-amyloid accumulation, either individually or in
combination. We also determined whether cyclic progesterone was better than continuous
progesterone treatment with or without estradiol. We show that estradiol and
progesterone may be able to regulate β-amyloid accumulation by regulating the
expression of one or more β-amyloid degrading enzymes and thus affecting its clearance.
Specifically, the expression of insulin-degrading enzyme (IDE) is increased by both
estradiol and progesterone individually and in combination, both in vitro and in vivo. We
also found that cyclic progesterone is better than continuous progesterone for elevating
IDE levels and decreasing Aβ accumulation in treated animals.
Take together, the experimental results from this thesis work addresses some of
the important issues in the AD field and suggests a few novel mechanisms by which
female sex steroid hormones interact in neurons, thus laying a foundation for improved
HT against risk of AD.

Estradiol and progesterone interactions: from basic research to clinical trials

Estrogens and progesterone have been shown to interact in various tissues. Any
imbalance in the relationship of estrogens and progesterone caused either by decrease in
their amount or by absence of one or both these hormones often results in abnormalities.
As mentioned earlier, the sharp decline of these hormones during menopause increases
the risk for conditions such as dementia, neurodegenerative diseases and osteoporosis
142
(Bonomo et al., 2009). If progesterone is not present in sufficient quantities to counteract
the effects of estrogens or if estrogen levels increase artificially due to hormonal
treatments in the absence of progesterone, it gives rise to tumor growths and seizures
(Scharfman and MacLusky, 2006). Lack of progesterone in postmenopausal women who
are obese may lead to aromatization of excess androgen precursors to estradiol in adipose
tissues (reviewed in Kaaks et al., 2002). On the other hand, excessive progestins induce
mood disorders, depression and loss of memory (Honjo H, 2005). Progestins such as
depot medroxyprogesterone acetate (DMPA) that is used in contraceptives have been
reported to suppress estradiol production in the ovary and have serious impairment of
bone mass and bone mineral density especially in young women (Albertazzi et al., 2006).
Both estradiol and progesterone in excess increases the risk for breast cancer (Million
Women Study, 2003). In case of hormone-replacement therapies, several studies use a
combination of CEE and progesterone/progestins. Such HT were conducted to
ameliorate pathology and cognitive impairment in case of dementia and AD. Since
progesterone also represses the estradiol-induced neuronal excitability, it is commonly
used as an anti-convulsant in high-estradiol related seizures (reviewed in (Scharfman and
MacLusky, 2006).
Estrogens and progesterone classically signal through their nuclear receptors –
estrogen receptors and progesterone receptors, respectively. During genomic signaling,
these hormones need to bind to their specific nuclear receptors, which in turn bind to the
promoter regions of the target genes and either activate or repress their transcription. This
makes the availability of the receptors as one of the limiting factors for classical hormone
143
signaling. Some of the functions of these hormones can also occur very rapidly and are
insensitive to inhibitors of mRNA and protein synthesis. These signaling events come
under the non-genomic pathways. Estradiol and progesterone interact with each other
either directly through the regulation of the receptors or indirectly by the regulation of
other cellular targets. In most studies done to determine the effects of estradiol-
progesterone interactions, progesterone acts as a repressor of estradiol function. On the
other hand, progesterone receptors have estrogen-response elements (ERE) in their
promoter region and estradiol is required for their expression. Hence, a delicate interplay
exists between the two hormones which s necessary to tightly regulates several cellular
functions.
One of the important questions that are critical in further understanding how
estrogens and progesterone interact in disease-related pathways is how progesterone
antagonizes estradiol action. In Chapter 2, we investigate this aspect of estradiol-
progesterone interaction in primary neuron cultures. Our results show that progesterone is
capable of decreasing the mRNA expression of both ERα and ERβ in a dose- and time-
dependent manner. This is also observed in vivo where an acute progesterone treatment in
ovariectomized animals shows a decrease in ERα and ERβ in hippocampal and cortical
neurons. This is the first study that shows a downregulation of ERs by progesterone in
neurons thereby suggesting a novel mechanism for progesterone antagonism of neuronal
estradiol action. The next step was to determine whether this decrease of ER by
progesterone also leads to a decrease in ER function. This was tested in Chapter 3 by
using a ERE-luciferase plasmid and we found that progesterone treatment reduced ER-
144
mediated transcription of the reporter plasmid and hence a reduction in luciferase
expression and activity. Further, the effect of progesterone on E
2
-mediated
neuroprotection against apoptotic factor II (AAII) was determined. We show that
decrease of ERβ by progesterone corresponds to the blocking of E
2
-mediated
neuroprotection with progesterone pretreatment. Hence the studies presented in Chapters
2 and 3, show that downregulation of ER by progesterone leads to a decrease in ER-
dependent activity and this is a possible mechanism for progesterone blocking estradiol
action.
From the data obtained in the above studies, we predict that progesterone, if given
along with estrogens in hormone therapy in a continuous combined manner, would
decrease ER expression and function. Assuming that this action of progesterone is via the
progesterone receptor, the decrease in ER activity would eventually lead to a decrease in
PR expression and activity. This cycle will repeat itself for as long as the two hormones
are administered, thereby not allowing either hormones to function for sufficient amount
of time to bring about their beneficial actions. Therefore, progesterone might not be
beneficial in combination with estradiol without certain modifications. Several different
strategies can be suggested to overcome this issue. For example, several recent studies
from our laboratory and others suggest that progesterone when used in a cyclic regimen
as opposed to a continuous regimen is beneficial in combination with estradiol. In the
cyclic regimen, progesterone will be administered for a short period of time intermittently
with estradiol being present for the entire treatment period. This way, the decrease in ER
expression which might occur due to the presence of progesterone will have a chance to
145
recover when the progesterone is off. This might be a good way to make sure that both
the detrimental and beneficial estradiol actions are kept in balance. Cyclic progesterone
by itself also has been shown to be neuroprotective as compared to the continuous
progesterone. Hence the cyclic regimen might preserve the neuroprotective effects of
both estradiol and progesterone. The other strategy would be to use one the synthetic
progestins, which selectively block the detrimental effects of estradiol in endometrial
cells and be neuroprotective. Among the candidates that we screened in our study as
described in chapter 5, levonorgestrel, NETA, and nestorone seem to be potential
candidates for hormone therapy. The third strategy would be to modify progesterone at
the molecular level such that it binds to estrogen receptors in a cell-type specific manner.
This would prevent progesterone from blocking the neuroprotective actions of estradiol
while blocking its endometrial signaling.
To go a step further and determine the possible ways by which progesterone could
reduce ER expression, we tested the basic possibilities of progesterone affecting ER
transcription and or mRNA and protein stability. The half-life of ERα and ERβ mRNA
are 9 h and > 6 h, respectively. So if we blocked any further mRNA production by using
a compound that blocks all cellular transcription such as Actinomycin D, then the already
synthesized remaining mRNA will be degraded in about 6 – 9 h under normal
circumstances. On the other hand, if any factor affects the mRNA stability either by
increasing or decreasing the rate of degradation, then the half-life of that particular
mRNA will also increase or decrease respectively. So when we added Actinomycin D to
the primary neurons for different time periods from 0 to 8 h, we found that both ERα and
146
ERβ mRNA to be unchanged as expected. However, progesterone treatment decreased
ERα mRNA from about 2 h and ERβ mRNA from about 30 min. This shows that
progesterone might affect ER mRNA stability. This could be either by increasing RNA
degrading enzymes such as the exo and endonucleases at the 3’ end leading to poly A
shortening or by removing the cap binding and stabilizing proteins on the 5’ and 3’
untranslated regions (UTR). This could be done by progesterone directly or indirectly by
affecting intermediate factor(s). Can progesterone affect mRNA stability as quickly as 30
min as seen in the case of ERβ? It has been shown that some compounds affect mRNA
stability that quickly. For example, iron is one such compound which changes the mRNA
stability of transferrin receptor mRNA within 30 min thereby reducing the half-life of
transferrin receptor mRNA from 30 h to 1.5 h (Mullner et al., 1989). Since the time taken
to reduce both ERα and ERβ are relatively quick, we presume that direct transcription
may not be affected by progesterone.
Although our in vitro and in vivo results suggest that progesterone might block
estradiol-induced neural actions via downregulation of estrogen receptor mRNA, the
limitations of our experimental paradigm make the data only correlative. There are other
possible ways by which progesterone can affect estradiol function. For example,
progesterone can affect estrogen receptor protein function by changing its conformation
so it no longer binds to estradiol. Since hormones and hormone receptors are known for
promiscuous binding, especially in the absence of their receptor or ligand respectively,
progesterone may be able to bind to estrogen receptor in the absence of estradiol and
mask or change its estrogen binding site. On the other hand, the presence of progesterone
147
could activate alternate pathway which make other factors sequester estrogen receptor
and block their estradiol binding. Similar pathways could be acting to prevent estrogen
receptor dimerization rather than estradiol binding, which would also result in reducing
estradiol signaling. One other way is also to cause conformational changes such that the
nuclear translocation of E
2
-ER complex is blocked due to masking of the nuclear
localization sequence.
Progesterone could also affect estradiol signaling by acting downstream of the E
2
-
ER complex and nuclear localization, by competitive target DNA binding such that E
2
-
ER no longer are able to bind to the ERE on the promoter region of the target genes.
Progesterone could also lead to sequestration of cofactors required for E
2
-ER signaling
such that it leads to a decrease in the transcriptional activation/ repression of the target
genes. In some cases, it is shown that estrogen receptors have to be phosphorylated in
order to be active. In those cases, progesterone might affect the phosphorylation of the
receptors by regulating the required kinases and phosphatases. Thus, although our data
suggests that decrease in ER mRNA levels correspond to a decrease in E
2
-mediated
activity, we have to still consider these other possible mechanisms in order to determine
the mechanism of action of progesterone conclusively.
Given the data that progesterone blocks estradiol action in the brain by decreasing
the expression and function of its receptors, the question now was how the synthetic
progestins compare to progesterone in their interaction with estrogen receptors. In chapter
4, we did comparative analyses of seven different clinically relevant synthetic progestins
and their effects on ER expression and E
2
-mediated neuroprotection against AAII and
148
Aβ. The seven synthetic progestins used were medroxyprogesterone acetate (MPA),
norethindrone (NET), norethindrone acetate (NETA), norethynodrel, levonorgestrel
(LNG), norgestimate (NGM), and nestorone. All of these synthetic progestins have been
used in hormone replacement therapies and contraceptive therapies for several years
since they share a similar property of preventing estradiol-induced endometrial cell
proliferation like progesterone. Therefore, it is important to evaluate their neuronal
actions on estradiol-mediated functions to see if they can replace progesterone as a better
candidate for hormone replacement therapies against risk of AD.
Our results show that MPA decreases ERα and ERβ mRNA expression in
a dose and time-dependent manner similar to progesterone. On evaluating its effect on
AAII-induced apoptosis either alone or in combination with E
2
, we found that MPA was
not neuroprotective by itself and also blocked E
2
-mediated neuroprotection. Further,
MPA also downregulated the expression of brain-derived neurotrophic factor (bdnf)
which is shown to be important for neuron-viability. Thus, MPA seems to be unsuitable
for use in hormone therapy against neurodegenerative diseases like AD. This result
confirms the findings from the WHIMS study where MPA used along with CEE did not
improve the risk for dementia in the post-menopausal women. On the other hand, our
data demonstrates that LNG increased the expressions of ERα, ERβ, and bdnf mRNA. It
also was neuroprotective against AAII insult. In combination with E
2
, it did not block E
2
-
induced neuroprotection against apoptosis, even though no additive effect was seen with
the addition of LNG. Two other candidates that showed an increase in ERα expression
were NET and nestorone. Both these progestins had no effect on ERβ expression.
149
Nestorone also showed an increase in bdnf expression and was protective against AAII.
NETA, norethynodrel, and NGM did not change the expressions of ERα, ERβ, and bdnf
in cultured neurons. However, NETA was seen to be protective against AAII. Thus, the
seven clinically relevant progestins tested here had varying effects upon ER expression
and E
2
-mediated neuroprotection.
Results from the above study suggest that LNG, NETA and Nestorone
could be good candidates to use in place of progesterone in hormone therapies in
combination with estradiol. Another important feature of LNG as seen from previous
work shows that it decreases ER expression in endometrial cells (Vereide et al., 2006).
This makes it an ideal candidate for hormone therapy as it could prevent the detrimental
effects of estradiol in the endometrium while still preserving ER expression and E
2
-
mediated beneficial action in the neurons. NETA does not seem to affect ER expression
in the neurons while being neuroprotective either by itself or in combination with E
2

making it another potential hormone for treatment against AD. Nestorone too would be
an interesting candidate for further investigation since it increases the expression of ERα
while having no effect on ERβ and at the same time is neuroprotective without and with
E
2
. The next step would be to validate the data obtained from our cell culture experiments
in vivo. This is important because some of the synthetic progestins are prodrugs and get
converted to others inside the body to be fully functional. For example, NETA and
norethynodrel get converted to NET and NGM gets converted to LNG. Therefore, NETA
which shows promise in our in vitro experiments may or may not have the same result in
vivo. It might get converted to NET which was only partially beneficial in vitro. One way
150
to overcome this would be to manipulate the compound structurally so that it no longer
gets converted to another form. On the other hand, norethynodrel and NGM which did
not show any effect in vitro, might get converted to NET and LNG respectively and have
beneficial results in vivo. Another important point to consider is the rate of metabolism of
these compounds within the body. This is difficult to deduce from in vitro experiments
since the primary neuron cultures may not have the complete machinery required for the
metabolism of progesterone or synthetic progestins. But once in the context of a live
animal model, the physiology of the animal comes into play and this might affect the
outcome of the results. In this regard, the role of glial cells and the effect of synthetic
progestins on the glial cells need to be determined. If LNG or NETA get metabolized
quickly in vivo, then they need to be altered to slow their metabolism when administered.
If none of the seven progestins show promising results in vivo, a new set of synthetic
progestins which are derived from a novel structure or novel variations of the known
pregnane, gonane, estrane, or 19-norprogesterone structures have to be designed and
tested. Hence, more studies have to be conducted to determine the optimal combination
of natural and or synthetic hormones that have the maximum benefit and minimum
disadvantage in all tissue types before trying them in clinical trials.
As discussed previously in the case of progesterone, synthetic progestins
may also affect estradiol signaling by other mechanisms other than decreasing estrogen
receptor mRNA levels such as ER conformational change, ER sequestration and
degradation, blocking E
2
-ER nuclear translocation, competitive DNA binding and or
cofactor sequestration. Synthetic progestins could also be acting by blocking indirect
151
genomic or rapid signaling of estrogens rather than or along with genomic signaling
especially in the case if neuroprotection.
The summary of the effects of progesterone and synthetic progestins on
various end points that we investigated is summarized in Table 3. From our results, we do
not see any obvious correlation between the effects seen on ER expression and E
2
-
mediated function and the structural classification of the synthetic progestins or their
receptor binding affinities. For example, not all the compounds tested that were derived
from estrane-group (NET, NETA, norethynodrel) behaved similarly. In the same way,
both the gonane-derived molecules (LNG and NGM) did not have the same effect on ER
expression, bdnf expression, or in being neuroprotective. On the other hand, we must
keep in mind
152
Table 3: Effect of progesterone and synthetic progestin on various paradigms.

153
that NETA, norethynodrel, and NGM are pro-drugs and need to be converted, at least in
vivo, to NET and LNG respectively to be active. Hence, as mentioned before, these may
behave very differently in vivo or even clinically from what we have seen in our studies.
With regards to receptor-affinity, except for nestorone which binds mostly to
progesterone receptors (PR) only, all the other synthetic progestins tested have binding
affinities to PR, androgen receptors (AR), and glucocorticoid receptors (GR). Here again,
the receptor-affinity and the observed effects do not seem to correlate, at least with the 8
molecules tested.
One thing to test would be to see which of the molecules signal via
membrane vs. genomic PR. This could be a potential difference between the synthetic
progestins and the effects observed. There might also be a difference in the cofactors
employed in each of the progestin signaling that makes their effect on ER expression and
function to be varied. These paradigms need to be investigated in the future to better
understand the mechanism of action of these progestins as well as to design new
molecules when required.
Although in most treatment paradigms progesterone is shown to oppose
estradiol action, recent studies have shown that progesterone can be beneficial with
estradiol when the treatment regimen is changed. Progesterone and estrogens have been
classically administered in a “continuous combined” regimen in hormone replacement
therapy. This “continuous combined” regimen where both the hormones are given on a
continuous basis throughout the duration of treatment in combination with each other has
been shown to have little beneficial effect clinically which is in contrast to the wealth of
154
basic research and epidemiological data on the individual benefits of estrogens and
progesterone. This prompted for a consideration of alternate treatment regimens. One of
the new ways of administering progesterone with estrogens is the “cyclic” regimen which
is more in parallel to the natural hormone cycle within our body. During estrous cycle,
estradiol increases during the follicular phase. With the formation of corpus luteum,
progesterone is released and continues to increase during the luteal phase. This increase
in progesterone coincides with the decrease in estradiol and vice versa keeping the
hormones out of phase with each other. This facilitates both the hormones to function
effectively while keeping a check on each others unopposed action. This is the rationale
behind designing the cyclic regimen. In this type of treatment, progesterone is given only
intermittently while estradiol is kept continuous. This way, when the progesterone is
“off”, estradiol is able to function without any hindrance throughout the body. When the
progesterone is “on”, it not only facilitates beneficial neuronal signaling but also limits
ER expression and estradiol action so that the detrimental endometrial effects of estradiol
are kept to the minimum. It also facilitates the beneficial neuronal actions of progesterone
by itself. But since PR expression is dependent on estradiol, after progesterone has been
active for a while, the decrease in estradiol action ultimately leads to reducing PR levels
and a decrease in progesterone action, thus activating a feedback loop. This, combined
with the limited exposure to progesterone in the first place, helps the beneficial neuronal
actions of estradiol to not be continuously suppressed as would be the case in the
“continuous combined” paradigm. In several recent studies, this paradigm has been
incorporated and has shown promising results as being neuroprotective. For example,
155
studies in the ovariectomized triple transgenic mouse model of AD in our laboratory have
shown that individually cyclic progesterone and estradiol reduced Aβ accumulation in the
brain as compared to continuous progesterone alone. In combination with each other,
cyclic progesterone and estradiol decreased Aβ accumulation whereas continuous
progesterone blocked the beneficial action of estradiol (Carroll et al., 2007). Hence the
“cyclic” way of progesterone treatment might be more beneficial than the continuous
exposure. Future studies will determine the complete potential as well as pitfalls of cyclic
progesterone plus estradiol regimen in clinical trials.
Although estradiol and progesterone are able to regulate Aβ accumulation
and extracellular plaque formation, the exact mechanism behind this is unclear. Some
studies have suggested that estradiol is capable of regulating several aspects of APP
processing and thus, able to keep the amount of Aβ in check (Chang et al., 1997;
Petanceska et al., 2000; Manthey et al., 2001; Thakur MK, 2005). Others have suggested
that estradiol is able to regulate APP trafficking such that it favors the non-amyloidogenic
pathway over the amyloidogenic pathway (Gandy and Petanceska, 2001). The regulation
of Aβ by progesterone is not very well characterized. Aβ accumulation can be modulated
by either controlling its production from APP or by regulating its clearance in the brain.
Most of the studies showing the regulation of Aβ by hormones have shown them to play
a role in Aβ production. However, the role of estradiol and progesterone in Aβ clearance
is not investigated enough. Aβ clearance can be by its transport across the blood-brain
barrier into the liver via the circulating blood where it is eliminated through bile. The
other mechanism of Aβ clearance is more localized in the brain where different Aβ-
156
degrading enzymes are able to bind to Aβ and degrade it, thus keeping its level in
balance. Any disturbance in the production and or clearance of Aβ can lead to its
increased accumulation and extracellular plaque formation, a hallmark of AD.
There are several Aβ-degrading enzymes that have been shown to degrade
Aβ both in vitro and in vivo. Among them, the most prominent are the insulin-degrading
enzyme (IDE) and neprilysin (NEP). The other enzymes are endothelin-converting
enzymes 1 and 2 (ECE1, ECE2), Angiotensin-converting enzyme (ACE), plasmin,
transthyretin (TTR) etc. Very little is known regarding the effect of estradiol and
progesterone on these enzymes with regards to Aβ degradation. In chapter 5, we look at
the role of estradiol and progesterone on the expression levels of several Aβ-degrading
enzymes both in vitro and in vivo. We also inversely correlate the changes in these
enzymes, especially IDE, with the soluble Aβ levels in the treated WT female animals.
The following Aβ-degrading enzymes were screened – IDE, NEP, ECE-1, ECE-2, ACE
and TTR.
Our results show that estradiol and progesterone are able to affect the
expression levels of some but not all the Aβ-degrading enzymes tested. Estradiol
increases Ide mRNA in a dose- and time-dependent manner in primary neuron cultures.
This effect is conserved in both acute and long-term in vivo treatments. Estradiol also
reduces mRNA levels of both Ace and Ece2 mRNA, although only its effect on Ace
seems to be conserved in the animals. Nep, Ece1 and Ttr mRNA seem to be unaffected
by estradiol, contradicting some of the previous reports (Huang et al., 2004; Quintela et
al., 2009). Progesterone also increases Ide mRNA expression which was a novel and
157
unexpected finding. It also increases the mRNA levels of Ace and Ttr in a time- and
dose-dependent manner in the cultured neurons. The effect of progesterone on Ide and
Ace are conserved in vivo where as Ttr mRNA remains unchanged. Progesterone had no
effect on Nep, Ece1 and Ece2 mRNAs either in vitro or in the animal brain. Estradiol and
progesterone also increased IDE protein in a dose-and time dependent manner in cultures
as well as in the acute hormone treated animals. Given all the data, we found Ide to be the
best candidate for regulation by both the hormones individually. In combination with
each other, estradiol and either acute progesterone or cyclic progesterone increased Ide
mRNA in short-term and long-term experiments, respectively. The continuous
progesterone regimen not only failed to increase Ide mRNA expression as compared to
the ovariectomized animal samples but also blocked the increase mediated by estradiol in
the treated animals. This emphasized the previously mentioned observation that cyclic
progesterone is more beneficial than continuous progesterone treatment either alone or in
combination with estradiol. When the soluble Aβ levels were analyzed in the long-term
treated animal brains, the animals treated with estradiol and cyclic progesterone showed
Aβ levels comparable to the Sham animals. Here again, the continuous progesterone
regimen failed to reduce Aβ accumulation with or without estradiol. After analyzing the
data from the above experiment on a
158
Fig. 29: Comparative analysis of soluble Aβ β β β levels with Ide mRNA levels in vivo.

Comparative analysis of soluble Aβ β β β levels with Ide mRNA levels in vivo. The above graph shows the
comparative levels of soluble Aβ across the Ide mRNA levels in the same animals. There is a high
correlation between the two parameters in a given set of animals.

159
scatter-plot, the soluble Aβ ELISA somewhat inversely correlated with the Ide expression
levels in these animals suggesting that the regulation of Ide could be one of the
mechanisms by which the hormones regulate Aβ levels (R≤ -1.00) (Fig.29). Further
studies have to be conducted to conclusively establish the inverse relationship between
Ide levels and soluble Aβ levels.
The other set of interesting observations from this study shed some light
into the mechanism behind the regulation of Aβ-degrading enzymes by estradiol and
progesterone. We found that when an ER-antagonist such as ICI 182,780 is used in the
presence of estradiol, the effect of estradiol on Ide mRNA, but not Ace and Ece2 mRNA
expressions, are reversed suggesting the role of classical ER signaling in the
transcriptional regulation of Ide by estradiol. We also tested the effect of specific ER
agonists such as PPT (ERα agonist) and DPN (ERβ agonist) on the expression levels of
these enzymes and found that both PPT and DPN are able to increase Ide mRNA in a
dose-dependent manner. Again, Ace and Ece2 mRNA levels were not significantly
affected by either of the agonists. In the case of progesterone, PR antagonists such as
Ru486 and Org31710 blocked the effect of progesterone on Ttr mRNA but not Ide and
Ace mRNA levels. This suggests that the regulation of Ttr could be through classical PR
signaling.
The above study gave some novel insights into the mechanism(s) behind the
regulation of Aβ by estradiol and progesterone. Our data showed that Ide could be a good
target through which both the hormones could regulate Aβ levels.
160
The effect on Ide seems to be conserved in primary neuronal cultures as well as in the
brains of treated animals which makes it more promising. The other candidate of interest
is Ace which was increased by progesterone in both in vitro and in vivo irrespective of
the presence of estradiol, although estradiol reduced Ace levels in cultured neurons. The
effect of estradiol on Ace expression has been reported previously in cardiovascular
tissue where the decrease of Ace by estradiol has been shown to be beneficial for
reducing blood pressure and improving cardiovascular health of patients (Seltzer et al.,
1992; Tanaka et al., 1997; Shenoy et al., 2009). Therefore, even though the increase in
Ace levels in the neurons may be of benefit for Aβ degradation, a system-wide increase
in Ace by progesterone, which seems to take place even in the presence of estradiol,
might be detrimental to cardio-vascular health of the treated patients. This makes Ace to
be less favorable as a drug target. The effect of progesterone on the levels of Ttr is
unfortunately not conserved in vivo which suggests that other regulatory pathways come
into picture when it comes to animal brain as opposed to cultured neurons in a dish. The
decrease in Ece2 mRNA by estradiol also does not seem to be significant as it is not
observed in vivo. Given the above findings, activation of Ide could be a potential target
for future hormone therapy in the treatment of AD.
Regarding the mechanism(s) by which estradiol and progesterone are able to
regulate some of these enzymes, increase of Ide by estradiol and Ttr by progesterone
seems to be through classic genomic signaling whereas the other effects seem to be either
via rapid signaling or by some indirect transcriptional regulation of the transcripts.
Estradiol mediates its transcriptional regulation via
161
Table 4: Putative ERE sites on the promoter region of Aβ β β β-degrading enzymes.

Enzymes Gene ID ERE Half-ERE ERR AP1
NEP 4311 X -4117, 80 -6595 -8234, -
3430, -
2279
IDE 3416 -9275, -6192,
-3865, -1558
-2028 X -3787, -
2463
ECE1 1889 X -8921, -
6601,
-241
-6158 -4822, -
4690,
-4296
ECE 2 9718 -6695, 1832 7147 -6758, -
5801,
-4348, 4758
-6057, -
4640,
5264, 8021
ACE 1636 -8531, -1304 X -4679, -3420 -2759
TTR 5654 X -5969, -
5076,
-2621
X -3248

162
the binding of ERs to ERE on the promoter region target genes which have a canonical
sequence “GGTCAnnnTGACC”. Some of the target genes contain half-EREs which are
either half the sequence or imperfect EREs with some base changes. On some
preliminary analyses of the promoter regions of the above Aβ-degrading enzymes, we
found the following putative ERE and half ERE along with other relevant regulatory sites
(Table 4). From the above table, we see that Nep, Ece1 and Ttr do not contain canonical
EREs although they might contain half-EREs. This might be the reason estradiol does not
seem to affect their transcription. Ide seems to have several putative ERE sequences in its
promoter region which could be where ERs bind and increase its transcription. Although
Ece2 and Ace have canonical EREs, ICI 182,780 was unable to reverse estradiol effect
suggesting that classical ER signaling might not play a role in their regulation. Estradiol
could be reducing their expression via estradiol related receptors (ERR) or via other
transcription factors such as activating protein-1 (AP-1) and Sp-1 binding to the promoter
region. On the other hand, estradiol could be activating other factors through rapid
signaling which ultimately affect either the transcription or mRNA stability of Ace and
Ece2 mRNA indirectly.
Progesterone also signals via its classical receptors that bind to progesterone
response elements (PRE) on the promoter region of the target genes for genomic
signaling which may be the case with Ttr expression. However, it is very difficult to
analyze promoter regions of genes for PRE as there is no defined canonical sequence for
PRE that can be used in any bioinformatics software. Binding assay have to be conducted
to determine this kind of interaction. In the case of Ide and Ace, progesterone could
163
signal via rapid non-genomic signaling pathways through non-classical receptors such as
GABA-R, glucocorticoid and mineralocorticoid receptors etc., to increase their
transcription or mRNA stability indirectly.
Although regulation of Aβ-degrading enzymes could be a potential mechanism by
which estradiol and progesterone modulate Aβ clearance, there are other pathways that
could be affected by these hormones while still having the same end result on Aβ levels.
For example, estradiol and progesterone could act on other Aβ clearance mechanisms
such as increased transport of Aβ across the blood-brain-barrier (BBB), decrease in the
influx of Aβ through the BBB, and microglial phagocytosis.
In conclusion, my thesis work has demonstrated novel mechanisms for regulation
of estradiol activity by progesterone as well as regulation of Aβ by estradiol and
progesterone. In addition, the evaluation of several synthetic progestins has helped to
determine some promising candidates for use in hormone therapy. Also, comparing
cyclic versus continuous progesterone regimens on several outcomes has clearly shown
that mimicking the natural cycle by using the cyclic method of progesterone treatment is
more beneficial than the continuous combined mode. Taken together, these observations
have led to an increased understanding of estradiol and progesterone interactions in
neurons and have opened up new possibilities for the future in designing a better
hormone therapy against AD.

164
BIBLIOGRAPHY
Adams MR, Register TC, Golden DL, Wagner JD, Williams JK (1997)
Medroxyprogesterone acetate antagonizes inhibitory effects of conjugated equine
estrogens on coronary artery atherosclerosis. Arterioscler Thromb Vasc Biol
17:217-221.
Aguirre CC, Baudry M (2009) Progesterone reverses 17beta-estradiol-mediated
neuroprotection and BDNF induction in cultured hippocampal slices. Eur J
Neurosci 29:447-454.
Akwa Y, Morfin RF, Robel P, Baulieu EE (1992) Neurosteroid metabolism. 7 alpha-
Hydroxylation of dehydroepiandrosterone and pregnenolone by rat brain
microsomes. Biochem J 288 ( Pt 3):959-964.
Alberch J, Perez-Navarro E, Canals JM (2002) Neuroprotection by neurotrophins and
GDNF family members in the excitotoxic model of Huntington's disease. Brain
Res Bull 57:817-822.
Albertazzi P, Bottazzi M, Steel SA (2006) Bone mineral density and depot
medroxyprogesterone acetate. Contraception 73:577-583.
Alexander IE SJ, Sutherland RL. (1990) Progestin regulation of estrogen receptor
messenger RNA in human breast cancer cells. Mol Endocrinol 4:821-828.
Alkayed NJ, Murphy SJ, Traystman RJ, Hurn PD, Miller VM (2000) Neuroprotective
effects of female gonadal steroids in reproductively senescent female rats. Stroke
31:161-168.
Alvarez-de-la-Rosa M, Silva I, Nilsen J, Perez MM, Garcia-Segura LM, Avila J, Naftolin
F (2005) Estradiol prevents neural tau hyperphosphorylation characteristic of
Alzheimer's disease. Ann N Y Acad Sci 1052:210-224.
Arias-Loza PA, Hu K, Schafer A, Bauersachs J, Quaschning T, Galle J, Jazbutyte V,
Neyses L, Ertl G, Fritzemeier KH, Hegele-Hartung C, Pelzer T (2006)
Medroxyprogesterone acetate but not drospirenone ablates the protective function
of 17 beta-estradiol in aldosterone salt-treated rats. Hypertension 48:994-1001.
Aronica SM, Katzenellenbogen BS (1991) Progesterone receptor regulation in uterine
cells: stimulation by estrogen, cyclic adenosine 3',5'-monophosphate, and insulin-
like growth factor I and suppression by antiestrogens and protein kinase
inhibitors. Endocrinology 128:2045-2052.
165
Auger CJ, De Vries GJ (2002) Progestin receptor immunoreactivity within steroid-
responsive vasopressin-immunoreactive cells in the male and female rat brain. J
Neuroendocrinol 14:561-567.
Azcoitia I, Sierra A, Garcia-Segura LM (1999) Localization of estrogen receptor beta-
immunoreactivity in astrocytes of the adult rat brain. Glia 26:260-267.
Azhar S, Tsai L, Medicherla S, Chandrasekher Y, Giudice L, Reaven E (1998) Human
granulosa cells use high density lipoprotein cholesterol for steroidogenesis. J Clin
Endocrinol Metab 83:983-991.
Bachman DL, Wolf PA, Linn R, Knoefel JE, Cobb J, Belanger A, D'Agostino RB, White
LR (1992) Prevalence of dementia and probable senile dementia of the Alzheimer
type in the Framingham Study. Neurology 42:115-119.
Bading JR, Yamada S, Mackic JB, Kirkman L, Miller C, Calero M, Ghiso J, Frangione
B, Zlokovic BV (2002) Brain clearance of Alzheimer's amyloid-beta40 in the
squirrel monkey: a SPECT study in a primate model of cerebral amyloid
angiopathy. J Drug Target 10:359-368.
Baker LD, Sambamurti K, Craft S, Cherrier M, Raskind MA, Stanczyk FZ, Plymate SR,
Asthana S (2003) 17beta-estradiol reduces plasma Abeta40 for HRT-naive
postmenopausal women with Alzheimer disease: a preliminary study. Am J
Geriatr Psychiatry 11:239-244.
Ballare C UM, Bechtold T, Sancho E, Di Domenico M, Migliaccio A, Auricchio F, Beato
M (2003) Two domains of the progesterone receptor interact with the estrogen
receptor and are required for progesterone activation of the c-Src/Erk pathway in
mammalian cells. Mol Cell Biol 23:1994-2008.
Bedford CA, Harrison FA, Heap RB (1972) The metabolic clearance rate and production
rate of progesterone and the conversion of progesterone to 20 -hydroxypregn-4-
en-3-one in the sheep. J Endocrinol 55:105-118.
Behl C, Widmann M, Trapp T, Holsboer F (1995) 17-beta estradiol protects neurons from
oxidative stress-induced cell death in vitro. Biochem Biophys Res Commun
216:473-482.
Behl C, Skutella T, Lezoualc'h F, Post A, Widmann M, Newton CJ, Holsboer F (1997)
Neuroprotection against oxidative stress by estrogens: structure-activity
relationship. Mol Pharmacol 51:535-541.
Bell RD, Sagare AP, Friedman AE, Bedi GS, Holtzman DM, Deane R, Zlokovic BV
(2007) Transport pathways for clearance of human Alzheimer's amyloid beta-
166
peptide and apolipoproteins E and J in the mouse central nervous system. J Cereb
Blood Flow Metab 27:909-918.
Bellido C GD, Aguilar R, Sanchez-Criado JE (1999) Antiprogestins RU486 and ZK299
suppress basal and LHRH-stimulated FSH and LH secretion at pituitary level in
the rat in an oestrous cycle stage-dependent manner. J Endocrinol 163:79-85.
Berliner DL, Wiest WG (1956) The extra-hepatic metabolism of progesterone in rats. J
Biol Chem 221:449-459.
Billiar RB, Lin TJ, Little B (1973) Metabolic clearance rate and production rate of 20
alpha-hydroxypregn-4-en-3-one in the menstrual cycle. Gynecol Invest 4:148-
154.
Billiar RB LB, Kline I, Reier P, Takaoka Y, White RJ (1975) The metabolic clearance
rate, head and brain extractions, and brain distribution and metabolism of
progesterone in the anesthesized, female monkey (Macaca Mulatta). Brain Res
94:99-113.
Bimonte-Nelson HA NM, Granholm AC. (2004) Progesterone counteracts estrogen-
induced increases in neurotrophins in the aged female rat brain. Neuroreport
15:2659-2663.
Blatchley FR DB, Horton EW, Poyser NL (1972) The release of prostaglandins and
progestin into the utero-ovarian venous blood of guinea-pigs during the oestrus
cycle and following oestrogen treatment. J Physiol 223:69-88.
Bonomo SM, Rigamonti AE, Giunta M, Galimberti D, Guaita A, Gagliano MG, Muller
EE, Cella SG (2009) Menopausal transition: a possible risk factor for brain
pathologic events. Neurobiol Aging 30:71-80.
Bradshaw MS, Tsai SY, Leng XH, Dobson AD, Conneely OM, O'Malley BW, Tsai MJ
(1991) Studies on the mechanism of functional cooperativity between
progesterone and estrogen receptors. J Biol Chem 266:16684-16690.
Brannian JD, Stouffer RL (1993) Native and modified (acetylated) low density
lipoprotein-supported steroidogenesis by macaque granulosa cells collected
before and after the ovulatory stimulus: correlation with fluorescent lipoprotein
uptake. Endocrinology 132:591-597.
Brass LM (2004) Hormone replacement therapy and stroke: clinical trials review. Stroke
35:2644-2647.
167
Brinton RD (2004) Impact of estrogen therapy on Alzheimer's disease: a fork in the road?
CNS Drugs 18:405-422.

Brinton RD, Chen S, Montoya M, Hsieh D, Minaya J (2000) The estrogen replacement
therapy of the Women's Health Initiative promotes the cellular mechanisms of
memory and neuronal survival in neurons vulnerable to Alzheimer's disease.
Maturitas 34 Suppl 2:S35-52.
Brinton RD, Thompson RF, Foy MR, Baudry M, Wang J, Finch CE, Morgan TE, Pike
CJ, Mack WJ, Stanczyk FZ, Nilsen J (2008) Progesterone receptors: form and
function in brain. Front Neuroendocrinol 29:313-339.
Brosnihan KB, Hodgin JB, Smithies O, Maeda N, Gallagher P (2008) Tissue-specific
regulation of ACE/ACE2 and AT1/AT2 receptor gene expression by oestrogen in
apolipoprotein E/oestrogen receptor-alpha knock-out mice. Exp Physiol 93:658-
664.
Butcher RL, Kirkpatrick-Keller D (1984) Patterns of follicular growth during the four-
day estrous cycle of the rat. Biol Reprod 31:280-286.
Buxbaum JN, Ye Z, Reixach N, Friske L, Levy C, Das P, Golde T, Masliah E, Roberts
AR, Bartfai T (2008) Transthyretin protects Alzheimer's mice from the behavioral
and biochemical effects of Abeta toxicity. Proc Natl Acad Sci U S A 105:2681-
2686.
Campbell CH, Bulayeva N, Brown DB, Gametchu B, Watson CS (2002) Regulation of
the membrane estrogen receptor-alpha: role of cell density, serum, cell passage
number, and estradiol. Faseb J 16:1917-1927.
Carroll JC, Rosario ER, Chang L, Stanczyk FZ, Oddo S, LaFerla FM, Pike CJ (2007)
Progesterone and estrogen regulate Alzheimer-like neuropathology in female
3xTg-AD mice. J Neurosci 27:13357-13365.
Carson JA, Turner AJ (2002) Beta-amyloid catabolism: roles for neprilysin (NEP) and
other metallopeptidases? J Neurochem 81:1-8.
Casey ML, Smith JW, Nagai K, Hersh LB, MacDonald PC (1991) Progesterone-
regulated cyclic modulation of membrane metalloendopeptidase (enkephalinase)
in human endometrium. J Biol Chem 266:23041-23047.
168
Catherino WH, Jeng MH, Jordan VC (1993) Norgestrel and gestodene stimulate breast
cancer cell growth through an oestrogen receptor mediated mechanism. Br J
Cancer 67:945-952.
Cauley JA, Robbins J, Chen Z, Cummings SR, Jackson RD, LaCroix AZ, LeBoff M,
Lewis CE, McGowan J, Neuner J, Pettinger M, Stefanick ML, Wactawski-Wende
J, Watts NB (2003) Effects of estrogen plus progestin on risk of fracture and bone
mineral density: the Women's Health Initiative randomized trial. Jama 290:1729-
1738.
Chalbos D, Galtier F (1994) Differential effect of forms A and B of human progesterone
receptor on estradiol-dependent transcription. J Biol Chem 269:23007-23012.
Chang D, Kwan J, Timiras PS (1997) Estrogens influence growth, maturation, and
amyloid beta-peptide production in neuroblastoma cells and in a beta-APP
transfected kidney 293 cell line. Adv Exp Med Biol 429:261-271.
Chauchereau A SJ, Milgrom E. (1992) Control of biosynthesis and post-transcriptional
modification of the progesterone receptor. Biol Reprod 46:174-177.
Chegini N, Rong H, Dou Q, Kipersztok S, Williams RS (1996) Gonadotropin-releasing
hormone (GnRH) and GnRH receptor gene expression in human myometrium and
leiomyomata and the direct action of GnRH analogs on myometrial smooth
muscle cells and interaction with ovarian steroids in vitro. J Clin Endocrinol
Metab 81:3215-3221.
Cheney DL, Uzunov D, Costa E, Guidotti A (1995) Gas chromatographic-mass
fragmentographic quantitation of 3 alpha-hydroxy-5 alpha-pregnan-20-one
(allopregnanolone) and its precursors in blood and brain of adrenalectomized and
castrated rats. J Neurosci 15:4641-4650.
Chesneau V, Vekrellis K, Rosner MR, Selkoe DJ (2000) Purified recombinant insulin-
degrading enzyme degrades amyloid beta-protein but does not promote its
oligomerization. Biochem J 351 Pt 2:509-516.
Choi SH, Leight SN, Lee VM, Li T, Wong PC, Johnson JA, Saraiva MJ, Sisodia SS
(2007) Accelerated Abeta deposition in APPswe/PS1deltaE9 mice with
hemizygous deletions of TTR (transthyretin). J Neurosci 27:7006-7010.
Christenson LK, Devoto L (2003) Cholesterol transport and steroidogenesis by the corpus
luteum. Reprod Biol Endocrinol 1:90.
169
Chung WC, Pak TR, Weiser MJ, Hinds LR, Andersen ME, Handa RJ (2006) Progestin
receptor expression in the developing rat brain depends upon activation of
estrogen receptor alpha and not estrogen receptor beta. Brain Res 1082:50-60.
Clark RF, Cruts M, Korenblat KM, He C, Talbot C, Van Broeckhoven C, Goate AM
(1995) A yeast artificial chromosome contig from human chromosome 14q24
spanning the Alzheimer's disease locus AD3. Hum Mol Genet 4:1347-1354.
Clarke RB (2003) Steroid receptors and proliferation in the human breast. Steroids
68:789-794.
Classen-Linke I, Alfer J, Krusche CA, Chwalisz K, Rath W, Beier HM (2000) Progestins,
progesterone receptor modulators, and progesterone antagonists change VEGF
release of endometrial cells in culture. Steroids 65:763-771.
Collaboration MWS (2003) Breast cancer and hormone replacement therapy in the
million women study. Lancet 362:419-427.
Concas A, Mostallino MC, Porcu P, Follesa P, Barbaccia ML, Trabucchi M, Purdy RH,
Grisenti P, Biggio G (1998) Role of brain allopregnanolone in the plasticity of
gamma-aminobutyric acid type A receptor in rat brain during pregnancy and after
delivery. Proc Natl Acad Sci U S A 95:13284-13289.
Conneely OM, Maxwell BL, Toft DO, Schrader WT, O'Malley BW (1987a) The A and B
forms of the chicken progesterone receptor arise by alternate initiation of
translation of a unique mRNA. Biochem Biophys Res Commun 149:493-501.
Conneely OM, Dobson AD, Tsai MJ, Beattie WG, Toft DO, Huckaby CS, Zarucki T,
Schrader WT, O'Malley BW (1987b) Sequence and expression of a functional
chicken progesterone receptor. Mol Endocrinol 1:517-525.
Conneely OM LJ (2000) Progesterone receptors in reproduction: functional impact of the
A and B isoforms. Steroids 65:571-577.
Cordey M, Pike CJ (2005) Neuroprotective properties of selective estrogen receptor
agonists in cultured neurons. Brain Res 1045:217-223.
Cordey M, Gundimeda U, Gopalakrishna R, Pike CJ (2003) Estrogen activates protein
kinase C in neurons: role in neuroprotection. J Neurochem 84:1340-1348.
Corpechot C, Synguelakis M, Talha S, Axelson M, Sjovall J, Vihko R, Baulieu EE,
Robel P (1983) Pregnenolone and its sulfate ester in the rat brain. Brain Res
270:119-125.
170
Dai D, Wolf DM, Litman ES, White MJ, Leslie KK (2002) Progesterone inhibits human
endometrial cancer cell growth and invasiveness: down-regulation of cellular
adhesion molecules through progesterone B receptors. Cancer Res 62:881-886.
Davies S, Dai D, Wolf DM, Leslie KK (2004a) Immunomodulatory and transcriptional
effects of progesterone through progesterone A and B receptors in Hec50co
poorly differentiated endometrial cancer cells. J Soc Gynecol Investig 11:494-
499.
Davies S, Dai D, Feldman I, Pickett G, Leslie KK (2004b) Identification of a novel
mechanism of NF-kappaB inactivation by progesterone through progesterone
receptors in Hec50co poorly differentiated endometrial cancer cells: induction of
A20 and ABIN-2. Gynecol Oncol 94:463-470.
De Nicola AF GS, Labombarda F, Gonzalez-Deniselle MC, Garay L, Geunnoun R,
Schumaker M (2006) Progesterone treatment of spinal cord injury. J Mol
Neurosci 28:3-16.
De Strooper B (2000) Alzheimer's disease. Closing in on gamma-secretase. Nature
405:627, 629.
De Strooper B, Annaert W (2000) Proteolytic processing and cell biological functions of
the amyloid precursor protein. J Cell Sci 113 ( Pt 11):1857-1870.
Dean SA, Tan J, O'Brien ER, Leenen FH (2005) 17beta-estradiol downregulates tissue
angiotensin-converting enzyme and ANG II type 1 receptor in female rats. Am J
Physiol Regul Integr Comp Physiol 288:R759-766.
Deane R, Zlokovic BV (2007) Role of the blood-brain barrier in the pathogenesis of
Alzheimer's disease. Curr Alzheimer Res 4:191-197.
Deane R, Wu Z, Zlokovic BV (2004) RAGE (yin) versus LRP (yang) balance regulates
alzheimer amyloid beta-peptide clearance through transport across the blood-brain
barrier. Stroke 35:2628-2631.
Dombroski RA, Casey ML, MacDonald PC (1993) The metabolic disposition of plasma 5
alpha-dihydroprogesterone (5 alpha-pregnane-3,20-dione) in women and men. J
Clin Endocrinol Metab 77:944-948.
Dong L, Wang W, Wang F, Stoner M, Reed JC, Harigai M, Samudio I, Kladde MP,
Vyhlidal C, Safe S (1999) Mechanisms of transcriptional activation of bcl-2 gene
expression by 17beta-estradiol in breast cancer cells. J Biol Chem 274:32099-
32107.
171
Du Y, Ni B, Glinn M, Dodel RC, Bales KR, Zhang Z, Hyslop PA, Paul SM (1997)
alpha2-Macroglobulin as a beta-amyloid peptide-binding plasma protein. J
Neurochem 69:299-305.
Ducsay CA, Stanczyk FZ, Novy MJ (1985) Maternal and fetal production rates of
progesterone in rhesus macaques: placental transfer and conversion to cortisol.
Endocrinology 117:1253-1258.
Eckman EA, Reed DK, Eckman CB (2001) Degradation of the Alzheimer's amyloid beta
peptide by endothelin-converting enzyme. J Biol Chem 276:24540-24548.
Eckman EA, Watson M, Marlow L, Sambamurti K, Eckman CB (2003) Alzheimer's
disease beta-amyloid peptide is increased in mice deficient in endothelin-
converting enzyme. J Biol Chem 278:2081-2084.
Edbauer D, Willem M, Lammich S, Steiner H, Haass C (2002) Insulin-degrading enzyme
rapidly removes the beta-amyloid precursor protein intracellular domain (AICD).
J Biol Chem 277:13389-13393.
Eigeliene N, Harkonen P, Erkkola R (2006) Effects of estradiol and
medroxyprogesterone acetate on morphology, proliferation and apoptosis of
human breast tissue in organ cultures. BMC Cancer 6:246.
Eldar-Geva T, Margalioth EJ, Brooks B, Algur N, Zylber-Haran E, Diamant YZ (1998)
The origin of serum progesterone during the follicular phase of menotropin-
stimulated cycles. Hum Reprod 13:9-14.
el-Etr M, Akwa Y, Fiddes RJ, Robel P, Baulieu EE (1995) A progesterone metabolite
stimulates the release of gonadotropin-releasing hormone from GT1-1
hypothalamic neurons via the gamma-aminobutyric acid type A receptor. Proc
Natl Acad Sci U S A 92:3769-3773.
Elkins GR, Rajab MH (2004) Clinical hypnosis for smoking cessation: preliminary
results of a three-session intervention. Int J Clin Exp Hypn 52:73-81.
Erb RE, Randel RD, Callahan CJ (1971) Female sex steroid changes during the
reproductive cycle. J Anim Sci 32 Suppl 1:80-106.
Evans DA, Funkenstein HH, Albert MS, Scherr PA, Cook NR, Chown MJ, Hebert LE,
Hennekens CH, Taylor JO (1989) Prevalence of Alzheimer's disease in a
community population of older persons. Higher than previously reported. Jama
262:2551-2556.
172
Everett JW, Tyrey L (1982) Comparison of luteinizing hormone surge responses to
ovarian steroids in cyclic and spontaneously persistent estrous rats of middle age.
Biol Reprod 26:663-672.
Fan J, Donkin J, Wellington C (2009) Greasing the wheels of Abeta clearance in
Alzheimer's disease: the role of lipids and apolipoprotein E. Biofactors 35:239-
248.
Farris W, Mansourian S, Chang Y, Lindsley L, Eckman EA, Frosch MP, Eckman CB,
Tanzi RE, Selkoe DJ, Guenette S (2003) Insulin-degrading enzyme regulates the
levels of insulin, amyloid beta-protein, and the beta0amyloid precursor protein
intacellular domain in vivo. Proc Natl Acad Sci 100:4162-4167.
Farris W MS, Chang Y, Lindsley L, Eckman EA, Frosch MP, Eckman CB, Tanzi RE,
Selkoe DJ, Guenette S (2003) Insulin-degrading emzyme regulates the levels of
insulin, amyloid b-protein, and the b-amyloid precursor protein intracellular
domain in vivo. Proc Natl Acad Sci 100:4162-4167.
Feder HH, Ruf KB (1969) Stimulation of progesterone release and estrous behavior by
ACTH in ovariectomized rodents. Endocrinology 84:171-174.
Filardo EJ, Quinn JA, Frackelton AR, Jr., Bland KI (2002) Estrogen action via the G
protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP-
mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling
axis. Mol Endocrinol 16:70-84.
Follesa P SM, Cagetti E, Pisu MG, Porta S, Floris S, Massa F, Sanna E, Biggio G (2000)
Allopregnanolone synthesis in cerebellar granule cells: roles in regulation of
GABA A receptor expression and function during progesterone treatment and
withdrawal. Mol Pharmacol 57:1262-1270.
Frye CA, Vongher JM (1999a) GABA(A), D1, and D5, but not progestin receptor,
antagonist and anti-sense oligonucleotide infusions to the ventral tegmental area
of cycling rats and hamsters attenuate lordosis. Behav Brain Res 103:23-34.
Frye CA, Vongher JM (1999b) Progestins' rapid facilitation of lordosis when applied to
the ventral tegmentum corresponds to efficacy at enhancing GABA(A)receptor
activity. J Neuroendocrinol 11:829-837.
Funabashi T, Kleopoulos SP, Brooks PJ, Kimura F, Pfaff DW, Shinohara K, Mobbs CV
(2000) Changes in estrogenic regulation of estrogen receptor alpha mRNA and
progesterone receptor mRNA in the female rat hypothalamus during aging: an in
situ hybridization study. Neurosci Res 38:85-92.
173
Gahr M (2001) Distribution of sex steroid hormone receptors in the avian brain:
functional implications for neural sex differences and sexual behaviors. Microsc
Res Tech 55:1-11.
Gallagher PE, Li P, Lenhart JR, Chappell MC, Brosnihan KB (1999) Estrogen regulation
of angiotensin-converting enzyme mRNA. Hypertension 33:323-328.
Gandy S, Petanceska S (2000) Neurohormonal signalling pathways and the regulation of
Alzheimer beta-amyloid metabolism. Novartis Found Symp 230:239-251;
discussion 251-233.
Gandy S, Duff K (2000) Post-menopausal estrogen deprivation and Alzheimer's disease.
Exp Gerontol 35:503-511.
Gandy S, Petanceska S (2001) Regulation of alzheimer beta-amyloid precursor
trafficking and metabolism. Adv Exp Med Biol 487:85-100.
Gao S, Hendrie HC, Hall KS, Hui S (1998) The relationships between age, sex, and the
incidence of dementia and Alzheimer disease: a meta-analysis. Arch Gen
Psychiatry 55:809-815.
Garcia-Segura LM C-GP, Naftolin F, Chowen JA. (1998) Estradiol upregulates Bcl-2
expression in adult brain neurons. Neuroreport 9:593-597.
Ghiso J, Matsubara E, Koudinov A, Choi-Miura NH, Tomita M, Wisniewski T,
Frangione B (1993) The cerebrospinal-fluid soluble form of Alzheimer's amyloid
beta is complexed to SP-40,40 (apolipoprotein J), an inhibitor of the complement
membrane-attack complex. Biochem J 293 ( Pt 1):27-30.
Ghiso J, Calero M, Matsubara E, Governale S, Chuba J, Beavis R, Wisniewski T,
Frangione B (1997) Alzheimer's soluble amyloid beta is a normal component of
human urine. FEBS Lett 408:105-108.
Ghiso J, Shayo M, Calero M, Ng D, Tomidokoro Y, Gandy S, Rostagno A, Frangione B
(2004) Systemic catabolism of Alzheimer's Abeta40 and Abeta42. J Biol Chem
279:45897-45908.
Gibbs RB (1996) Fluctuations in relative levels of choline acetyltransferase mRNA in
different regions of the rat basal forebrain across the estrous cycle: effects of
estrogen and progesterone. J Neurosci 16:1049-1055.
Gibbs RB (2000) Effects of gonadal hormone replacement on measures of basal forebrain
cholinergic function. Neuroscience 101:931-938.
174
Gibbs RS, McNabb F (1996) Randomized clinical trial of intrapartum clindamycin cream
for reduction of group B streptococcal maternal and neonatal colonization. Infect
Dis Obstet Gynecol 4:25-27.
Giunta S, Valli MB, Galeazzi R, Fattoretti P, Corder EH, Galeazzi L (2005) Transthyretin
inhibition of amyloid beta aggregation and toxicity. Clin Biochem 38:1112-1119.
Gleason CE, Cholerton B, Carlsson CM, Johnson SC, Asthana S (2005) Neuroprotective
effects of female sex steroids in humans: current controversies and future
directions. Cell Mol Life Sci 62:299-312.
Goncalves I, Alves CH, Quintela T, Baltazar G, Socorro S, Saraiva MJ, Abreu R, Santos
CR (2008) Transthyretin is up-regulated by sex hormones in mice liver. Mol Cell
Biochem 317:137-142.
Gonzalez Deniselle MC, Garay L, Gonzalez S, Saravia F, Labombarda F, Guennoun R,
Schumacher M, De Nicola AF (2007) Progesterone modulates brain-derived
neurotrophic factor and choline acetyltransferase in degenerating Wobbler
motoneurons. Exp Neurol 203:406-414.
Goodenough S, Schleusner D, Pietrzik C, Skutella T, Behl C (2005) Glycogen synthase
kinase 3beta links neuroprotection by 17beta-estradiol to key Alzheimer
processes. Neuroscience 132:581-589.
Goodenough S SM, Behl C (2003) Estrogen-induced cell signaling in a cellular model of
Alzheimer's disease. J Steroid Biochem & Mol Biol 84:301-305.
Goodman Y, Bruce AJ, Cheng B, Mattson MP (1996) Estrogens attenuate and
corticosterone exacerbates excitotoxicity, oxidative injury, and amyloid beta-
peptide toxicity in hippocampal neurons. J Neurochem 66:1836-1844.
Grady D, Gebretsadik T, Kerlikowske K, Ernster V, Petitti D (1995) Hormone
replacement therapy and endometrial cancer risk: a meta-analysis. Obstet Gynecol
85:304-313.
Graham JD CC (1997) Physiological action of progesterone in target tissues. Endocrine
Reviews 18:502-519.
Grau S, Baldi A, Bussani R, Tian X, Stefanescu R, Przybylski M, Richards P, Jones SA,
Shridhar V, Clausen T, Ehrmann M (2005) Implications of the serine protease
HtrA1 in amyloid precursor protein processing. Proc Natl Acad Sci U S A
102:6021-6026.
175
Greco B, Allegretto EA, Tetel MJ, Blaustein JD (2001) Coexpression of ER beta with ER
alpha and progestin receptor proteins in the female rat forebrain: effects of
estradiol treatment. Endocrinology 142:5172-5181.
Green PS, Gridley KE, Simpkins JW (1996) Estradiol protects against beta-amyloid (25-
35)-induced toxicity in SK-N-SH human neuroblastoma cells. Neurosci Lett
218:165-168.
Greenfield JP, Leung LW, Cai D, Kaasik K, Gross RS, Rodriguez-Boulan E, Greengard
P, Xu H (2002) Estrogen lowers Alzheimer beta-amyloid generation by
stimulating trans-Golgi network vesicle biogenesis. J Biol Chem 277:12128-
12136.
Gridley KE, Green PS, Simpkins JW (1997) Low concentrations of estradiol reduce beta-
amyloid (25-35)-induced toxicity, lipid peroxidation and glucose utilization in
human SK-N-SH neuroblastoma cells. Brain Res 778:158-165.
Grow DR (2002) Metabolism of endogenous and exogenous reproductive hormones.
Obstet Gynecol Clin North Am 29:425-436.
Guennoun R, Fiddes RJ, Gouezou M, Lombes M, Baulieu EE (1995) A key enzyme in
the biosynthesis of neurosteroids, 3 beta-hydroxysteroid dehydrogenase/delta 5-
delta 4-isomerase (3 beta-HSD), is expressed in rat brain. Brain Res Mol Brain
Res 30:287-300.
Guerra-Araiza C, Cerbon MA, Morimoto S, Camacho-Arroyo I (2000) Progesterone
receptor isoforms expression pattern in the rat brain during the estrous cycle. Life
Sci 66:1743-1752.
Guerra-Araiza C, Amorim MA, Camacho-Arroyo I, Garcia-Segura LM (2007) Effects of
progesterone and its reduced metabolites, dihydroprogesterone and
tetrahydroprogesterone, on the expression and phosphorylation of glycogen
synthase kinase-3 and the microtubule-associated protein tau in the rat
cerebellum. Dev Neurobiol 67:510-520.
Guerra-Araiza C, Villamar-Cruz O, Gonzalez-Arenas A, Chavira R, Camacho-Arroyo I
(2003) Changes in progesterone receptor isoforms content in the rat brain during
the oestrous cycle and after oestradiol and progesterone treatments. J
Neuroendocrinol 15:984-990.
Gustafsson JA (1999) Estrogen receptor beta--a new dimension in estrogen mechanism of
action. J Endocrinol 163:379-383.
176
Hall JM, Korach KS (2002) Analysis of the molecular mechanisms of human estrogen
receptors alpha and beta reveals differential specificity in target promoter
regulation by xenoestrogens. J Biol Chem 277:44455-44461.
Hall JM, Couse JF, Korach KS (2001) The multifaceted mechanisms of estradiol and
estrogen receptor signaling. J Biol Chem 276:36869-36872.
Hama E, Shirotani K, Masumoto H, Sekine-Aizawa Y, Aizawa H, Saido TC (2001)
Clearance of extracellular and cell-associated amyloid beta peptide through viral
expression of neprilysin in primary neurons. J Biochem 130:721-726.
Hardy J, Selkoe DJ (2002) The amyloid hypothesis of Alzheimer's disease: progress and
problems on the road to therapeutics. Science 297:353-356.
Harper MM, Adamson L, Blits B, Bunge MB, Grozdanic SD, Sakaguchi DS (2009)
Brain-derived neurotrophic factor released from engineered mesenchymal stem
cells attenuates glutamate- and hydrogen peroxide-mediated death of
staurosporine-differentiated RGC-5 cells. Exp Eye Res 89:538-548.
Harrington WR, Sheng S, Barnett DH, Petz LN, Katzenellenbogen JA, Katzenellenbogen
BS (2003) Activities of estrogen receptor alpha- and beta-selective ligands at
diverse estrogen responsive gene sites mediating transactivation or
transrepression. Mol Cell Endocrinol 206:13-22.
Haugabook SJ, Le T, Yager D, Zenk B, Healy BM, Eckman EA, Prada C, Younkin L,
Murphy P, Pinnix I, Onstead L, Sambamurti K, Golde TE, Dickson D, Younkin
SG, Eckman CB (2001) Reduction of Abeta accumulation in the Tg2576 animal
model of Alzheimer's disease after oral administration of the phosphatidyl-inositol
kinase inhibitor wortmannin. Faseb J 15:16-18.
Helguero LA, Lamb C, Molinolo AA, Lanari C (2003) Evidence for two progesterone
receptor binding sites in murine mammary carcinomas. J Steroid Biochem Mol
Biol 84:9-14.
Hembree WC, Bardin CW, Lipsett MB (1969) A study of estrogen metabolic clearance
rates and transfer factors. J Clin Invest 48:1809-1819.
Hemming ML, Selkoe DJ (2005) Amyloid beta-protein is degraded by cellular
angiotensin-converting enzyme (ACE) and elevated by an ACE inhibitor. J Biol
Chem 280:37644-37650.
Hemming ML, Selkoe DJ, Farris W (2007) Effects of prolonged angiotensin-converting
enzyme inhibitor treatment on amyloid beta-protein metabolism in mouse models
of Alzheimer disease. Neurobiol Dis 26:273-281.
177
Henderson VW (2006) Estrogen-containing hormone therapy and Alzheimer's disease
risk: understanding discrepant inferences from observational and experimental
research. Neuroscience 138:1031-1039.
Hirata S, Shoda T, Kato J, Hoshi K (2002) Novel isoforms of the mRNA for human
female sex steroid hormone receptors. J Steroid Biochem Mol Biol 83:25-30.
Hisatomi H, Kohno N, Wakita K, Nagao K, Hirata H, Hikiji K, Harada S (2003) Novel
alternatively spliced variant with a deletion of 52 BP in exon 6 of the
progesterone receptor gene is observed frequently in breast cancer tissues. Int J
Cancer 105:182-185.
Hoffman GE, Moore N, Fiskum G, Murphy AZ (2003) Ovarian steroid modulation of
seizure severity and hippocampal cell death after kainic acid treatment. Exp
Neurol 182:124-134.
Hojo Y, Hattori TA, Enami T, Furukawa A, Suzuki K, Ishii HT, Mukai H, Morrison JH,
Janssen WG, Kominami S, Harada N, Kimoto T, Kawato S (2004) Adult male rat
hippocampus synthesizes estradiol from pregnenolone by cytochromes
P45017alpha and P450 aromatase localized in neurons. Proc Natl Acad Sci U S A
101:865-870.
Homanics GE, Silvia WJ (1988) Effects of progesterone and estradiol-17 beta on uterine
secretion of prostaglandin F2 alpha in response to oxytocin in ovariectomized
ewes. Biol Reprod 38:804-811.
Honda K, Shimohama S, Sawada H, Kihara T, Nakamizo T, Shibasaki H, Akaike A
(2001) Nongenomic antiapoptotic signal transduction by estrogen in cultured
cortical neurons. J Neurosci Res 64:466-475.
Honjo H IK, Kawata M, Fushiki S, Hosoda T, Tatsumi H, Oida N, Mihara M, Hirasugi
Y, Yamamoto H, Kikuchi N, Kitawaki J. (2005) Progestins and estrogens and
Alzheimer's disease. J Steroid Biochem Mol Biol 93:305-308.
Hsueh AJ PEJ, Clark JH. (1975) Progesterone antagonism of the oestrogen receptor and
oestrogen-induced uterine growth. Nature 254:337-339.
Hu XY, Qin S, Lu YP, Ravid R, Swaab DF, Zhou JN (2003) Decreased estrogen
receptor-alpha expression in hippocampal neurons in relation to
hyperphosphorylated tau in Alzheimer patients. Acta Neuropathol 106:213-220.
Huang J, Guan H, Booze RM, Eckman CB, Hersh LB (2004) Estrogen regulates
neprilysin activity in rat brain. Neurosci Lett 367:85-87.
178
Hussain I, Powell DJ, Howlett DR, Chapman GA, Gilmour L, Murdock PR, Tew DG,
Meek TD, Chapman C, Schneider K, Ratcliffe SJ, Tattersall D, Testa TT, Southan
C, Ryan DM, Simmons DL, Walsh FS, Dingwall C, Christie G (2000) ASP1
(BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol
Cell Neurosci 16:609-619.
Hwang DY, Cho JS, Kim CK, Shim SB, Jee SW, Lee SH, Seo SJ, Cho JY, Lee SH, Kim
YK (2005) Aging-related correlation of insulin-degrading enzyme with gamma-
secretase-generated products involving insulin and glucose levels in transgenic
mice. Neurochem Res 30:1171-1177.
Inoue T AJ, Suzuki T, Darnel AD, Kaneko C, Takahashi K, Hatori M, Shirane R,
Kumabe T, Kurokawa Y, Satomi S, Sasano H. (2002) Progesterone production
and actions in the human central nervous system and neurogenic tumors. J Clin
Endocrinol Metab 87:5325-5331.
Iqbal K, Grundke-Iqbal I (1996) Molecular mechanism of Alzheimer's neurofibrillary
degeneration and therapeutic intervention. Ann N Y Acad Sci 777:132-138.
Ito S, Ohtsuki S, Terasaki T (2006) Functional characterization of the brain-to-blood
efflux clearance of human amyloid-beta peptide (1-40) across the rat blood-brain
barrier. Neurosci Res 56:246-252.
Ito S, Ohtsuki S, Kamiie J, Nezu Y, Terasaki T (2007) Cerebral clearance of human
amyloid-beta peptide (1-40) across the blood-brain barrier is reduced by self-
aggregation and formation of low-density lipoprotein receptor-related protein-1
ligand complexes. J Neurochem 103:2482-2490.
Iwata N, Tsubuki S, Takaki Y, Shirotani K, Lu B, Gerard NP, Gerard C, Hama E, Lee
HJ, Saido TC (2001) Metabolic regulation of brain Abeta by neprilysin. Science
292:1550-1552.
Jaeger S, Pietrzik CU (2008) Functional role of lipoprotein receptors in Alzheimer's
disease. Curr Alzheimer Res 5:15-25.
Jayaraman A, Pike CJ (2009) Progesterone attenuates oestrogen neuroprotection via
downregulation of oestrogen receptor expression in cultured neurones. J
Neuroendocrinol 21:77-81.
Jorm AF, Korten AE, Henderson AS (1987) The prevalence of dementia: a quantitative
integration of the literature. Acta Psychiatr Scand 76:465-479.
179
Kaaks R, Lukanova A, Kurzer MS (2002) Obesity, endogenous hormones, and
endometrial cancer risk: a synthetic review. Cancer Epidemiol Biomarkers Prev
11:1531-1543.
Kalita K, Szymczak S, Kaczmarek L (2005) Non-nuclear estrogen receptor beta and
alpha in the hippocampus of male and female rats. Hippocampus 15:404-412.
Kandimalla KK, Curran GL, Holasek SS, Gilles EJ, Wengenack TM, Poduslo JF (2005)
Pharmacokinetic analysis of the blood-brain barrier transport of 125I-amyloid
beta protein 40 in wild-type and Alzheimer's disease transgenic mice (APP,PS1)
and its implications for amyloid plaque formation. J Pharmacol Exp Ther
313:1370-1378.
Kanemitsu H, Tomiyama T, Mori H (2003) Human neprilysin is capable of degrading
amyloid beta peptide not only in the monomeric form but also the pathological
oligomeric form. Neurosci Lett 350:113-116.
Kato J HS, Nozawa A, Yamada-Mouri N. (1994) Gene expression of progesterone
receptor isoforms in the rat brain. Horm Behav 28:454-463.
Kawas C RS, Morrison A, Brookmeyer R, Corrada M, Zonderman A, Bacal C, Donnell
Lingle D, Metter E (1997) A prospective study of estrogen replacement therapy
and the risk of developing Alzheimer's disease: The Baltimore longitudinal study
of aging. Neurology 48.
Klaiber EL, Vogel W, Rako S (2005) A critique of the Women's Health Initiative
hormone therapy study. Fertil Steril 84:1589-1601.
Kleerekoper M, Sullivan JM (1995) Osteoporosis as a model for the long-term clinical
consequences of the menopause. Prog Cardiovasc Dis 38:181-188.
Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU (1986) An estrogen-responsive
element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene
functions in transfected human cells. Cell 46:1053-1061.
Knowlton AA, Sun L (2001) Heat-shock factor-1, steroid hormones, and regulation of
heat-shock protein expression in the heart. Am J Physiol Heart Circ Physiol
280:H455-464.
Knox KL, Ringstrom SJ, Schwartz NB (1993) RU486 blocks the effects of inhibin
antiserum or luteinizing hormone on the secondary follicle-stimulating hormone
surge. Endocrinology 133:277-283.
180
Koenig HL SM, Ferzaz B, Thi AN, Ressouches A, Guennoun R, Jung-Testas I, Robel P,
Akwa Y, Baulieu EE. (1995) Progesterone synthesis and myelin formation by
Schwann cells. Science 268:1500-1503.
Kokate TG, Svensson BE, Rogawski MA (1994) Anticonvulsant activity of
neurosteroids: correlation with gamma-aminobutyric acid-evoked chloride current
potentiation. J Pharmacol Exp Ther 270:1223-1229.
Krebs CJ, Jarvis ED, Chan J, Lydon JP, Ogawa S, Pfaff DW (2000) A membrane-
associated progesterone-binding protein, 25-Dx, is regulated by progesterone in
brain regions involved in female reproductive behaviors. Proc Natl Acad Sci U S
A 97:12816-12821.
Kumar NS, Richer J, Owen G, Litman E, Horwitz KB, Leslie KK (1998) Selective down-
regulation of progesterone receptor isoform B in poorly differentiated human
endometrial cancer cells: implications for unopposed estrogen action. Cancer Res
58:1860-1865.
Labombarda F, Gonzalez SL, Deniselle MC, Vinson GP, Schumacher M, De Nicola AF,
Guennoun R (2003) Effects of injury and progesterone treatment on progesterone
receptor and progesterone binding protein 25-Dx expression in the rat spinal cord.
J Neurochem 87:902-913.
Labrie F, Luu-The V, Lin SX, Simard J, Labrie C, El-Alfy M, Pelletier G, Belanger A
(2000) Intracrinology: role of the family of 17 beta-hydroxysteroid
dehydrogenases in human physiology and disease. J Mol Endocrinol 25:1-16.
LaCroix AZ (2005) Estrogen with and without progestin: benefits and risks of short-term
use. Am J Med 118 Suppl 12B:79-87.
Lauber AH, Romano GJ, Pfaff DW (1991) Sex difference in estradiol regulation of
progestin receptor mRNA in rat mediobasal hypothalamus as demonstrated by in
situ hybridization. Neuroendocrinology 53:608-613.
Leissring MA, Farris W, Chang AY, Walsh DM, Wu X, Sun X, Frosch MP, Selkoe DJ
(2003) Endoplasmic reticulum-localized amyloid beta-peptide is degraded in the
cytosol by two distinct degradation pathways. Neuron 40:1087-1093.
Levin-Allerhand JA, Lominska CE, Wang J, Smith JD (2002) 17Alpha-estradiol and
17beta-estradiol treatments are effective in lowering cerebral amyloid-beta levels
in AbetaPPSWE transgenic mice. J Alzheimers Dis 4:449-457.
Lewczuk P, Kornhuber J, Vanderstichele H, Vanmechelen E, Esselmann H, Bibl M, Wolf
S, Otto M, Reulbach U, Kolsch H, Jessen F, Schroder J, Schonknecht P, Hampel
181
H, Peters O, Weimer E, Perneczky R, Jahn H, Luckhaus C, Lamla U, Supprian T,
Maler JM, Wiltfang J (2008) Multiplexed quantification of dementia biomarkers
in the CSF of patients with early dementias and MCI: a multicenter study.
Neurobiol Aging 29:812-818.
Li Q, Ali MA, Cohen JI (2006) Insulin Degrading Enzyme Is a Cellular Receptor
Mediating Varicella-Zoster Virus Infection and Cell-to-Cell Spread. Cell
127:305-316.
Li X, Schwartz PE, Rissman EF (1997) Distribution of estrogen receptor-beta-like
immunoreactivity in rat forebrain. Neuroendocrinology 66:63-67.
Liang K, Yang L, Yin C, Xiao Z, Zhang J, Liu Y, Huang J (2010) Estrogen stimulates
degradation of beta-amyloid peptide by up-regulating neprilysin. J Biol Chem
285:935-942.
Liehr JG, Roy D (1990) Free radical generation by redox cycling of estrogens. Free Radic
Biol Med 8:415-423.
Little B, Billiar RB, Rahman SS, Johnson WA, Takaoka Y, White RJ (1975) In vivo
aspects of progesterone distribution and metabolism. Am J Obstet Gynecol
123:527-534.
Liu F, Gong X, Zhang G, Marquis K, Reinhart P, Andree TH (2005) The inhibition of
glycogen synthase kinase 3beta by a metabotropic glutamate receptor 5 mediated
pathway confers neuroprotection to Abeta peptides. J Neurochem 95:1363-1372.
Liu XA, Zhu LQ, Zhang Q, Shi HR, Wang SH, Wang Q, Wang JZ (2008) Estradiol
attenuates tau hyperphosphorylation induced by upregulation of protein kinase-A.
Neurochem Res 33:1811-1820.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-
408.
Longcope C, Franz C, Morello C, Baker R, Johnston CC, Jr. (1986) Steroid and
gonadotropin levels in women during the peri-menopausal years. Maturitas 8:189-
196.
Luconi M, Bonaccorsi L, Maggi M, Pecchioli P, Krausz C, Forti G, Baldi E (1998)
Identification and characterization of functional nongenomic progesterone
receptors on human sperm membrane. J Clin Endocrinol Metab 83:877-885.
182
Lundkvist J, Naslund J (2007) Gamma-secretase: a complex target for Alzheimer's
disease. Curr Opin Pharmacol 7:112-118.
Lustig RH, Pfaff DW, Fishman J (1988) Induction of LH hypersecretion in cyclic rats
during the afternoon of oestrus by oestrogen in conjunction with progesterone
antagonism or opioidergic blockade. J Endocrinol 117:229-235.
Mackic JB, Stins M, McComb JG, Calero M, Ghiso J, Kim KS, Yan SD, Stern D,
Schmidt AM, Frangione B, Zlokovic BV (1998) Human blood-brain barrier
receptors for Alzheimer's amyloid-beta 1- 40. Asymmetrical binding, endocytosis,
and transcytosis at the apical side of brain microvascular endothelial cell
monolayer. J Clin Invest 102:734-743.
MacLennan AH (2007) HRT: a reappraisal of the risks and benefits. MJA 186:643-646.
Maizels ET, Miller JB, Cutler RE, Jr., Jackiw V, Carney EM, Mizuno K, Ohno S,
Hunzicker-Dunn M (1992) Estrogen modulates Ca(2+)-independent lipid-
stimulated kinase in the rabbit corpus luteum of pseudopregnancy. Identification
of luteal estrogen-modulated lipid-stimulated kinase as protein kinase C delta. J
Biol Chem 267:17061-17068.
Majewska MD, Mienville JM, Vicini S (1988) Neurosteroid pregnenolone sulfate
antagonizes electrophysiological responses to GABA in neurons. Neurosci Lett
90:279-284.
Manly JJ, Merchant CA, Jacobs DM, Small SA, Bell K, Ferin M, Mayeux R (2000)
Endogenous estrogen levels and Alzheimer's disease among postmenopausal
women. Neurology 54:833-837.
Manthey D, Heck S, Engert S, Behl C (2001) Estrogen induces a rapid secretion of
amyloid beta precursor protein via the mitogen-activated protein kinase pathway.
Eur J Biochem 268:4285-4291.
Marini AM, Jiang X, Wu X, Tian F, Zhu D, Okagaki P, Lipsky RH (2004) Role of brain-
derived neurotrophic factor and NF-kappaB in neuronal plasticity and survival:
From genes to phenotype. Restor Neurol Neurosci 22:121-130.
Marques MA, Kulstad JJ, Savard CE, Green PS, Lee SP, Craft S, Watson GS, Cook DG
(2009) Peripheral amyloid-beta levels regulate amyloid-beta clearance from the
central nervous system. J Alzheimers Dis 16:325-329.
Marr RA, Rockenstein E, Mukherjee A, Kindy MS, Hersh LB, Gage FH, Verma IM,
Masliah E (2003) Neprilysin gene transfer reduces human amyloid pathology in
transgenic mice. J Neurosci 23:1992-1996.
183
Marr RA, Guan H, Rockenstein E, Kindy M, Gage FH, Verma I, Masliah E, Hersh LB
(2004) Neprilysin regulates amyloid Beta peptide levels. J Mol Neurosci 22:5-11.
Marsh JM, Savard K (1966) The stimulation of progesterone synthesis in bovine corpora
lutea by adenosine 3',5'-monophosphate. Steroids 8:133-148.
Marsh JM, Telegdy G, Savard K (1966) Effect of gonadotropins on steroidogenesis in rat
ovaries at dioestrus. Nature 212:950-952.
Mason NR, Marsh JM, Savard K (1962) An action of gonadotropin in vitro. J Biol Chem
237:1801-1806.
Matsubara E, Frangione B, Ghiso J (1995) Characterization of apolipoprotein J-
Alzheimer's A beta interaction. J Biol Chem 270:7563-7567.
Matthews J, Gustafsson JA (2003) Estrogen signaling: a subtle balance between ER alpha
and ER beta. Mol Interv 3:281-292.
McCracken SA, Grant KE, MacKenzie IZ, Redman CW, Mardon HJ (1999) Gestational
regulation of granulocyte-colony stimulating factor receptor expression in the
human placenta. Biol Reprod 60:790-796.
McDonnell DP, Goldman ME (1994) RU486 exerts antiestrogenic activities through a
novel progesterone receptor A form-mediated mechanism. J Biol Chem
269:11945-11949.
Mehra RD, Sharma K, Nyakas C, Vij U (2005) Estrogen receptor alpha and beta
immunoreactive neurons in normal adult and aged female rat hippocampus: a
qualitative and quantitative study. Brain Res 1056:22-35.
Mercado M, Shimasaki S, Ling N, DePaolo L (1993) Effects of estrous cycle stage and
pregnancy on follistatin gene expression and immunoreactivity in rat reproductive
tissues: progesterone is implicated in regulating uterine gene expression.
Endocrinology 132:1774-1781.
Migliaccio A, Di Domenico M, Castoria G, de Falco A, Bontempo P, Nola E, Auricchio
F (1996) Tyrosine kinase/p21ras/MAP-kinase pathway activation by estradiol-
receptor complex in MCF-7 cells. Embo J 15:1292-1300.

Migliaccio A, Piccolo D, Castoria G, Di Domenico M, Bilancio A, Lombardi M, Gong
W, Beato M, Auricchio F (1998) Activation of the Src/p21ras/Erk pathway by
184
progesterone receptor via cross-talk with estrogen receptor. Embo J 17:2008-
2018.
Miller AD (2009) Is hormone replacement therapy for me? Jaapa 22:57.
Miller HM, Foxcroft GR, Squires J, Aherne FX (1999) The effects of feed intake and
body fatness on progesterone metabolism in ovariectomized gilts. J Anim Sci
77:3253-3261.
Miners JS, Baig S, Palmer J, Palmer LE, Kehoe PG, Love S (2008) Abeta-degrading
enzymes in Alzheimer's disease. Brain Pathol 18:240-252.
Miyagawa K, Vidgoff J, Hermsmeyer K (1997) Ca2+ release mechanism of primate
drug-induced coronary vasospasm. Am J Physiol 272:H2645-2654.
Mocchetti I, Bachis A (2004) Brain-derived neurotrophic factor activation of TrkB
protects neurons from HIV-1/gp120-induced cell death. Crit Rev Neurobiol
16:51-57.
Molenda-Figueira HA, Williams CA, Griffin AL, Rutledge EM, Blaustein JD, Tetel MJ
(2006) Nuclear receptor coactivators function in estrogen receptor- and progestin
receptor-dependent aspects of sexual behavior in female rats. Horm Behav
50:383-392.
Molsa PK, Marttila RJ, Rinne UK (1982) Epidemiology of dementia in a Finnish
population. Acta Neurol Scand 65:541-552.
Monro OR, Mackic JB, Yamada S, Segal MB, Ghiso J, Maurer C, Calero M, Frangione
B, Zlokovic BV (2002) Substitution at codon 22 reduces clearance of Alzheimer's
amyloid-beta peptide from the cerebrospinal fluid and prevents its transport from
the central nervous system into blood. Neurobiol Aging 23:405-412.
Morissette M, Garcia-Segura LM, Belanger A, Di Paolo T (1992) Changes of rat striatal
neuronal membrane morphology and steroid content during the estrous cycle.
Neuroscience 49:893-902.
Mukherjee A, Song E, Kihiko-Ehmann M, Goodman JP, Jr., Pyrek JS, Estus S, Hersh LB
(2000) Insulysin hydrolyzes amyloid beta peptides to products that are neither
neurotoxic nor deposit on amyloid plaques. J Neurosci 20:8745-8749.
Mullner EW, Neupert B, Kuhn LC (1989) A specific mRNA binding factor regulates the
iron-dependent stability of cytoplasmic transferrin receptor mRNA. Cell 58:373-
382.
185
Murphy DD, Segal M (1996) Regulation of dendritic spine density in cultured rat
hippocampal neurons by steroid hormones. J Neurosci 16:4059-4068.
Murphy DD, Segal M (2000) Progesterone prevents estradiol-induced dendritic spine
formation in cultured hippocampal neurons. Neuroendocrinology 72:133-143.
Naftolin F, Ryan KJ, Petro Z (1971) Aromatization of androstenedione by the
diencephalon. J Clin Endocrinol Metab 33:368-370.
Nakamura Y, Kato H, Terranova PF (1990) Interleukin-1 alpha increases thecal
progesterone production of preovulatory follicles in cyclic hamsters. Biol Reprod
43:169-173.
Narita M, Holtzman DM, Schwartz AL, Bu G (1997) Alpha2-macroglobulin complexes
with and mediates the endocytosis of beta-amyloid peptide via cell surface low-
density lipoprotein receptor-related protein. J Neurochem 69:1904-1911.
Neves LA, Chappell MC, Ferrario CM, Gallagher PE, Ganten D, Brosnihan KB (2006)
Effect of estrogen on neprilysin expression in uterus and kidney of Sprague-
Dawley normotensive and heterozygous (mRen2)27-transgenic hypertensive rats.
Peptides 27:2912-2918.
Nguyen JT WJ (2003) Direct activation of the apoptosis machinery as a mechanism to
target cancer cells. Proc Natl Acad Sci 100:7533-7538.
Nilsen J, Brinton RD (2002) Impact of progestins on estrogen-induced neuroprotection:
synergy by progesterone and 19-norprogesterone and antagonism by
medroxyprogesterone acetate. Endocrinology 143:205-212.
Nilsen J, Diaz Brinton R (2003) Mechanism of estrogen-mediated neuroprotection:
regulation of mitochondrial calcium and Bcl-2 expression. Proc Natl Acad Sci U
S A 100:2842-2847.
Nilsen J, Chen S, Brinton RD (2002) Dual action of estrogen on glutamate-induced
calcium signaling: mechanisms requiring interaction between estrogen receptors
and src/mitogen activated protein kinase pathway. Brain Res 930:216-234.
Niswender GD (2002) Molecular control of luteal secretion of progesterone.
Reproduction 123:333-339.
Nunan J, Small DH (2000) Regulation of APP cleavage by alpha-, beta- and gamma-
secretases. FEBS Lett 483:6-10.
186
Olson SH, Bandera EV, Orlow I (2007) Variants in estrogen biosynthesis genes, sex
steroid hormone levels, and endometrial cancer: a HuGE review. Am J Epidemiol
165:235-245.
Owen JA, Jr. (1975) Physiology of the menstrual cycle. Am J Clin Nutr 28:333-338.
Pack BA, Christensen C, Douraghy M, Brooks SC (1978) Nuclear and cytosolic estrogen
receptor in gilt endometrium throughout the estrous cycle. Endocrinology
103:2129-2136.
Paganini-Hill A HV (1994) Estrogen deficiency and risk of Alzheimer's disease in
women. Am J Epidemiol 140:256-260.
Paganini-Hill A HV (1996) Estrogen replacement therapy and risk of Alxheimer's
disease. Arch Intern Med 156:2213-2217.
Patrone C, Andersson S, Korhonen L, Lindholm D (1999) Estrogen receptor-dependent
regulation of sensory neuron survival in developing dorsal root ganglion. Proc
Natl Acad Sci U S A 96:10905-10910.
Pedram A RM, Sainson RCA, Kim JK, Hughes CC, Levin ER (2007) A conserved
mechanism for steroid receptor translocation to the plasma membrane. J Biol
Chem.
Pelletier G, Luu-The V, Li S, Labrie F (2004) Localization of 20alpha-hydroxysteroid
dehydrogenase mRNA in mouse brain by in situ hybridization. Brain Res Mol
Brain Res 125:143-146.
Peluso JJ (2006) Multiplicity of progesterone's actions and receptors in the mammalian
ovary. Biol Reprod 75:2-8.
Perillo B, Sasso A, Abbondanza C, Palumbo G (2000) 17beta-estradiol inhibits apoptosis
in MCF-7 cells, inducing bcl-2 expression via two estrogen-responsive elements
present in the coding sequence. Mol Cell Biol 20:2890-2901.
Persson I, Adami HO, Bergkvist L, Lindgren A, Pettersson B, Hoover R, Schairer C
(1989) Risk of endometrial cancer after treatment with oestrogens alone or in
conjunction with progestogens: results of a prospective study. Bmj 298:147-151.
Petanceska SS, Nagy V, Frail D, Gandy S (2000) Ovariectomy and 17beta-estradiol
modulate the levels of Alzheimer's amyloid beta peptides in brain. Exp Gerontol
35:1317-1325.
187
Pettersson K, Grandien K, Kuiper GG, Gustafsson JA (1997) Mouse estrogen receptor
beta forms estrogen response element-binding heterodimers with estrogen
receptor alpha. Mol Endocrinol 11:1486-1496.
Petz LN, Nardulli AM (2000) Sp1 binding sites and an estrogen response element half-
site are involved in regulation of the human progesterone receptor A promoter.
Mol Endocrinol 14:972-985.
Petz LN, Ziegler YS, Loven MA, Nardulli AM (2002) Estrogen receptor alpha and
activating protein-1 mediate estrogen responsiveness of the progesterone receptor
gene in MCF-7 breast cancer cells. Endocrinology 143:4583-4591.
Pfaffl MW, Daxenberger A, Hageleit M, Meyer HH (2002) Effects of synthetic
progestagens on the mRNA expression of androgen receptor, progesterone
receptor, oestrogen receptor alpha and beta, insulin-like growth factor-1 (IGF-1)
and IGF-1 receptor in heifer tissues. J Vet Med A Physiol Pathol Clin Med 49:57-
64.
Pike CJ, Rosario ER, Nguyen TV (2006) Androgens, aging, and Alzheimer's disease.
Endocrine 29:233-241.
Pike CJ (1999) Estrogen modulates neuronal Bcl-xL expression and beta-amyloid-
induced apoptosis: relevance to Alzheimer's disease. J Neurochem 72:1552-1563.
Pinto FM, Armesto CP, Magraner J, Trujillo M, Martin JD, Candenas ML (1999)
Tachykinin receptor and neutral endopeptidase gene expression in the rat uterus:
characterization and regulation in response to ovarian steroid treatment.
Endocrinology 140:2526-2532.
Power RF, Lydon JP, Conneely OM, O'Malley BW (1991a) Dopamine activation of an
orphan of the steroid receptor superfamily. Science 252:1546-1548.
Power RF, Mani SK, Codina J, Conneely OM, O'Malley BW (1991b) Dopaminergic and
ligand-independent activation of steroid hormone receptors. Science 254:1636-
1639.
Prange-Kiel J RG, Zwirner M, Wallwiener D, Kiesel L. (2001) Regulation of estrogen
receptor alpha and progesterone receptor (isoform A and B) expression in
cultured human endometrial cells. Exp Clin Endocrinol Diabetes 109:231-237.
Proudler AJ, Cooper A, Whitehead M, Stevenson JC (2003) Effects of oestrogen-only
and oestrogen-progestogen replacement therapy upon circulating angiotensin I-
converting enzyme activity in postmenopausal women. Clin Endocrinol (Oxf)
58:30-35.
188
Proudler AJ, Ahmed AI, Crook D, Fogelman I, Rymer JM, Stevenson JC (1995)
Hormone replacement therapy and serum angiotensin-converting-enzyme activity
in postmenopausal women. Lancet 346:89-90.
Qiu WQ, Folstein MF (2006) Insulin, insulin-degrading enzyme and amyloid-beta
peptide in Alzheimer's disease: review and hypothesis. Neurobiol Aging 27:190-
198.
Qiu WQ, Walsh DM, Ye Z, Vekrellis K, Zhang J, Podlisny MB, Rosner MR, Safavi A,
Hersh LB, Selkoe DJ (1998) Insulin-degrading enzyme regulates extracellular
levels of amyloid beta-protein by degradation. J Biol Chem 273:32730-32738.
Qiu Z, Strickland DK, Hyman BT, Rebeck GW (1999) Alpha2-macroglobulin enhances
the clearance of endogenous soluble beta-amyloid peptide via low-density
lipoprotein receptor-related protein in cortical neurons. J Neurochem 73:1393-
1398.
Quadros PS, Pfau JL, Goldstein AY, De Vries GJ, Wagner CK (2002) Sex differences in
progesterone receptor expression: a potential mechanism for estradiol-mediated
sexual differentiation. Endocrinology 143:3727-3739.
Quintela T, Goncalves I, Baltazar G, Alves CH, Saraiva MJ, Santos CR (2009) 17beta-
estradiol induces transthyretin expression in murine choroid plexus via an
oestrogen receptor dependent pathway. Cell Mol Neurobiol 29:475-483.
Razandi M, Pedram A, Greene GL, Levin ER (1999) Cell membrane and nuclear
estrogen receptors (ERs) originate from a single transcript: studies of ERalpha
and ERbeta expressed in Chinese hamster ovary cells. Mol Endocrinol 13:307-
319.
Read LD GG, Katzenellenbogen BS. (1989) Regulation of estrogen receptor messenger
ribonucleic acid and protein levels in human breast cancer cell lines by sex steroid
hormones, their antagonists, and growth factors. Mol Endocrinol 3:295-304.
Regan RF, Guo Y (1997) Estrogens attenuate neuronal injury due to hemoglobin,
chemical hypoxia, and excitatory amino acids in murine cortical cultures. Brain
Res 764:133-140.
Resnick SM CL, Maki PM, Rapp SR, Espeland MA, Shumaker SA. (2004) The Women's
Health Initiative Study of Cognitive Aging (WHISCA): a randomized clinical trial
of the effects of hormone therapy on age-associated cognitive decline. Clin Trials
1:440-450.
189
Resnick SM MP, Rapp SR, Espeland MA, Brunner R, Coker LH, Granek IA, Hogan P,
Ockene JK, Shumaker SA; Women's Health Initiative Study of Cognitive Aging
Investigators. (2006) Effects of combination estrogen plus progestin hormone
treatment on cognition and affect. J Clin Endocrinol Metab 91:1802-1810.
Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER (2005) A
transmembrane intracellular estrogen receptor mediates rapid cell signaling.
Science 307:1625-1630.
Rhodes ME, Frye CA (2004) Progestins in the hippocampus of female rats have
antiseizure effects in a pentylenetetrazole seizure model. Epilepsia 45:1531-1538.
Riederer P, Hoyer S (2006) From benefit to damage. Glutamate and advanced glycation
end products in Alzheimer brain. J Neural Transm 113:1671-1677.
Rocca WA, Amaducci LA, Schoenberg BS (1986) Epidemiology of clinically diagnosed
Alzheimer's disease. Ann Neurol 19:415-424.
Rodrigo MC, Martin DS, Eyster KM (2003) Vascular ECE-1 mRNA expression
decreases in response to estrogens. Life Sci 73:2973-2983.
Roher AE, Esh CL, Kokjohn TA, Castano EM, Van Vickle GD, Kalback WM, Patton
RL, Luehrs DC, Daugs ID, Kuo YM, Emmerling MR, Soares H, Quinn JF, Kaye
J, Connor DJ, Silverberg NB, Adler CH, Seward JD, Beach TG, Sabbagh MN
(2009) Amyloid beta peptides in human plasma and tissues and their significance
for Alzheimer's disease. Alzheimers Dement 5:18-29.
Romano GJ KA, Pfaff DW. (1989) Expression and estrogen regulation of progesterone
receptor mRNA in neurons of the mediobasal hypothalamus: an in situ
hybridization study. Mol Endocrinol 3:1295-1300.
Roof RL, Duvdevani R, Braswell L, Stein DG (1994) Progesterone facilitates cognitive
recovery and reduces secondary neuronal loss caused by cortical contusion injury
in male rats. Exp Neurol 129:64-69.
Rosano GM, Webb CM, Chierchia S, Morgani GL, Gabraele M, Sarrel PM, de Ziegler D,
Collins P (2000) Natural progesterone, but not medroxyprogesterone acetate,
enhances the beneficial effect of estrogen on exercise-induced myocardial
ischemia in postmenopausal women. J Am Coll Cardiol 36:2154-2159.
Rosario ER, Chang L, Stanczyk FZ, Pike CJ (2004) Age-related testosterone depletion
and the development of Alzheimer disease. Jama 292:1431-1432.
190
Rosario ER RM, Pike CJ. (2006) Progestins inhibit the neuroprotective effects of
estrogen in rat hippocampus. Brain Res 1099:206-210.
Roselli CE, Resko JA, Stormshak F (2006) Expression of steroid hormone receptors in
the fetal sheep brain during the critical period for sexual differentiation. Brain Res
1110:76-80.
Ruitenberg A, Ott A, van Swieten JC, Hofman A, Breteler MM (2001) Incidence of
dementia: does gender make a difference? Neurobiol Aging 22:575-580.
Safe S (2001) Transcriptional activation of genes by 17 beta-estradiol through estrogen
receptor-Sp1 interactions. Vitam Horm 62:231-252.
Sakamoto H UK, Tsutsui K (2001) Effects of progesterone synthesized de novo in the
developing Purkinje Cell on its dendritic growth and synaptogenesis. J Neurosci
21:6221-6232.
Sanada M, Higashi Y, Nakagawa K, Sasaki S, Kodama I, Sakashita T, Tsuda M, Ohama
K (2001) Estrogen replacement therapy in postmenopausal women augments
reactive hyperemia in the forearm by reducing angiotensin converting enzyme
activity. Atherosclerosis 158:391-397.
Savouret JF, Rauch M, Redeuilh G, Sar S, Chauchereau A, Woodruff K, Parker MG,
Milgrom E (1994) Interplay between estrogens, progestins, retinoic acid and AP-1
on a single regulatory site in the progesterone receptor gene. J Biol Chem
269:28955-28962.
Scharfman HE, MacLusky NJ (2006) The influence of gonadal hormones on neuronal
excitability, seizures, and epilepsy in the female. Epilepsia 47:1423-1440.
Schindler AE, Campagnoli C, Druckmann R, Huber J, Pasqualini JR, Schweppe KW,
Thijssen JH (2008) Classification and pharmacology of progestins. Maturitas
61:171-180.
Schultz JR, Petz LN, Nardulli AM (2003) Estrogen receptor alpha and Sp1 regulate
progesterone receptor gene expression. Mol Cell Endocrinol 201:165-175.
Schumacher M, Sitruk-Ware R, De Nicola AF (2008) Progesterone and progestins:
neuroprotection and myelin repair. Curr Opin Pharmacol 8:740-746.
Schumacher M, Coirini H, Frankfurt M, McEwen BS (1989) Localized actions of
progesterone in hypothalamus involve oxytocin. Proc Natl Acad Sci U S A
86:6798-6801.
191
Schumacher M CH, Robert F, Guennoun R, El-Etr M (1999) Genomic and membrane
actions of progesterone: implications for reproductive physiology and behavior.
Behav Brain Res 105:37-52.
Schumacher M GR, Ghoumari A, Massaad C, Robert F, El-Etr M, Akwa Y, Rajkowski
K, and Baulieu EE (2007a) Novel Perspectives for progesterone in Hormone
Replacement Therapy, with special reference to the nervous system. Endocrine
Reviews 28:387-439.
Schumacher M GR, Stein DG, De Nicola AF (2007b) Progesterone: Therapeutic
opportunities for neuroprotection and myelin repair. Pharmacology &
Therapeutics.
Scott RE W-PX, Pfaff DW. (2002) Regulation and expression of progesterone receptor
mRNA isoforms A and B in the male and female rat hypothalamus and pituitary
following oestrogen treatment. J Neuroendocrinol 14:175-183.
Seely EW, Brosnihan KB, Jeunemaitre X, Okamura K, Williams GH, Hollenberg NK,
Herrington DM (2004) Effects of conjugated oestrogen and droloxifene on the
renin-angiotensin system, blood pressure and renal blood flow in postmenopausal
women. Clin Endocrinol (Oxf) 60:315-321.
Selkoe DJ (1998) The cell biology of beta-amyloid precursor protein and presenilin in
Alzheimer's disease. Trends Cell Biol 8:447-453.
Selkoe DJ (2001a) Alzheimer's disease results from the cerebral accumulation and
cytotoxicity of amyloid beta-protein. J Alzheimers Dis 3:75-80.
Selkoe DJ (2001b) Clearing the brain's amyloid cobwebs. Neuron 32:177-180.
Seltzer A, Pinto JE, Viglione PN, Correa FM, Libertun C, Tsutsumi K, Steele MK,
Saavedra JM (1992) Estrogens regulate angiotensin-converting enzyme and
angiotensin receptors in female rat anterior pituitary. Neuroendocrinology 55:460-
467.
Shenoy V, Grobe JL, Qi Y, Ferreira AJ, Fraga-Silva RA, Collamat G, Bruce E, Katovich
MJ (2009) 17beta-Estradiol modulates local cardiac renin-angiotensin system to
prevent cardiac remodeling in the DOCA-salt model of hypertension in rats.
Peptides 30:2309-2315.
Shibata M, Yamada S, Kumar SR, Calero M, Bading J, Frangione B, Holtzman DM,
Miller CA, Strickland DK, Ghiso J, Zlokovic BV (2000) Clearance of
Alzheimer's amyloid-ss(1-40) peptide from brain by LDL receptor-related
protein-1 at the blood-brain barrier. J Clin Invest 106:1489-1499.
192
Shifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, Jaffe RB, Taylor RN
(1996) Ovarian steroid regulation of vascular endothelial growth factor in the
human endometrium: implications for angiogenesis during the menstrual cycle
and in the pathogenesis of endometriosis. J Clin Endocrinol Metab 81:3112-3118.
Shirotani K, Tsubuki S, Iwata N, Takaki Y, Harigaya W, Maruyama K, Kiryu-Seo S,
Kiyama H, Iwata H, Tomita T, Iwatsubo T, Saido TC (2001) Neprilysin degrades
both amyloid beta peptides 1-40 and 1-42 most rapidly and efficiently among
thiorphan- and phosphoramidon-sensitive endopeptidases. J Biol Chem
276:21895-21901.
Shughrue PJ, Lane MV, Merchenthaler I (1997a) Comparative distribution of estrogen
receptor-alpha and -beta mRNA in the rat central nervous system. J Comp Neurol
388:507-525.
Shughrue PJ, Lane MV, Merchenthaler I (1997b) Regulation of progesterone receptor
messenger ribonucleic acid in the rat medial preoptic nucleus by estrogenic and
antiestrogenic compounds: an in situ hybridization study. Endocrinology
138:5476-5484.
Shumaker SA, Reboussin BA, Espeland MA, Rapp SR, McBee WL, Dailey M, Bowen
D, Terrell T, Jones BN (1998) The Women's Health Initiative Memory Study
(WHIMS): a trial of the effect of estrogen therapy in preventing and slowing the
progression of dementia. Control Clin Trials 19:604-621.
Shumaker SA, Legault C, Kuller L, Rapp SR, Thal L, Lane DS, Fillit H, Stefanick ML,
Hendrix SL, Lewis CE, Masaki K, Coker LH (2004) Conjugated equine estrogens
and incidence of probable dementia and mild cognitive impairment in
postmenopausal women: Women's Health Initiative Memory Study. Jama
291:2947-2958.
Shumaker SA, Legault C, Rapp SR, Thal L, Wallace RB, Ockene JK, Hendrix SL, Jones
BN, 3rd, Assaf AR, Jackson RD, Kotchen JM, Wassertheil-Smoller S,
Wactawski-Wende J (2003) Estrogen plus progestin and the incidence of
dementia and mild cognitive impairment in postmenopausal women: the Women's
Health Initiative Memory Study: a randomized controlled trial. Jama 289:2651-
2662.
Singer CA, Rogers KL, Dorsa DM (1998) Modulation of Bcl-2 expression: a potential
component of estrogen protection in NT2 neurons. Neuroreport 9:2565-2568.
Singer CA, Rogers KL, Strickland TM, Dorsa DM (1996) Estrogen protects primary
cortical neurons from glutamate toxicity. Neurosci Lett 212:13-16.
193
Singer CA, Figueroa-Masot XA, Batchelor RH, Dorsa DM (1999) The mitogen-activated
protein kinase pathway mediates estrogen neuroprotection after glutamate toxicity
in primary cortical neurons. J Neurosci 19:2455-2463.
Sitruk-Ware R (2002a) Hormonal replacement therapy. Rev Endocr Metab Disord 3:243-
256.
Sitruk-Ware R (2002b) Progestogens in hormonal replacement therapy: new molecules,
risks, and benefits. Menopause 9:6-15.
Skinner DC, Bouchard P, Caraty A (1999) The progesterone blockade of the luteinizing
hormone surge is overcome by RU486. J Neuroendocrinol 11:637-641.
Skinner DC, Evans NP, Delaleu B, Goodman RL, Bouchard P, Caraty A (1998) The
negative feedback actions of progesterone on gonadotropin-releasing hormone
secretion are transduced by the classical progesterone receptor. Proc Natl Acad
Sci U S A 95:10978-10983.
Smith A, Hughes PL (1998) The estrogen dilemma. Am J Nurs 98:17-20.
Smith CL (1998) Cross-talk between peptide growth factor and estrogen receptor
signaling pathways. Biol Reprod 58:627-632.
Solerte SB, Fioravanti M, Racchi M, Trabucchi M, Zanetti O, Govoni S (1999)
Menopause and estrogen deficiency as a risk factor in dementing illness:
hypothesis on the biological basis. Maturitas 31:95-101.
Solum DT, Handa RJ (2001) Localization of estrogen receptor alpha (ER alpha) in
pyramidal neurons of the developing rat hippocampus. Brain Res Dev Brain Res
128:165-175.
Soma KK SK, Lakhter A, Schlinger BA, Micevych PE. (2005) Neurosteroids and female
reproduction: estrogen increases 3beta-HSD mRNA and activity in rat
hypothalamus. Endocrinology 146:4386-4390.
Stein DG (2008) Progesterone exerts neuroprotective effects after brain injury. Brain Res
Rev 57:386-397.
Stocco DM (2001) StAR protein and the regulation of steroid hormone biosynthesis.
Annu Rev Physiol 63:193-213.
Strott CA BJ, Lipsett MB. (1970) Blood levels and production rate of 17-
hydroxypregnenolone in man. J Clin Invest 49:1999-2007.
194
Sugioka K, Shimosegawa Y, Nakano M (1987) Estrogens as natural antioxidants of
membrane phospholipid peroxidation. FEBS Lett 210:37-39.
Szabo M, Kilen SM, Saberi S, Ringstrom SJ, Schwartz NB (1998) Antiprogestins
suppress basal and activin-stimulated follicle-stimulating hormone secretion in an
estrogen-dependent manner. Endocrinology 139:2223-2228.
Takeda A LW (1986) Progestin-induced down regulation of nuclear estrogen receptor in
uterine decidual cells: analysis of receptor synthesis and turnover by the density-
shift method. Biochem Biophys Res Commun 135:98-104.
Tamaki C, Ohtsuki S, Terasaki T (2007) Insulin facilitates the hepatic clearance of
plasma amyloid beta-peptide (1 40) by intracellular translocation of low-density
lipoprotein receptor-related protein 1 (LRP-1) to the plasma membrane in
hepatocytes. Mol Pharmacol 72:850-855.
Tanaka M, Nakaya S, Watanabe M, Kumai T, Tateishi T, Kobayashi S (1997) Effects of
ovariectomy and estrogen replacement on aorta angiotensin-converting enzyme
activity in rats. Jpn J Pharmacol 73:361-363.
Tang MX, Jacobs D, Stern Y, Marder K, Schofield P, Gurland B, Andrews H, Mayeux R
(1996) Effect of oestrogen during menopause on risk and age at onset of
Alzheimer's disease. Lancet 348:429-432.
Tang YP, Haslam SZ, Conrad SE, Sisk CL (2004) Estrogen increases brain expression of
the mRNA encoding transthyretin, an amyloid beta scavenger protein. J
Alzheimers Dis 6:413-420; discussion 443-419.
Teves ME, Barbano F, Guidobaldi HA, Sanchez R, Miska W, Giojalas LC (2006)
Progesterone at the picomolar range is a chemoattractant for mammalian
spermatozoa. Fertil Steril 86:745-749.
Thakur MK MS (2005) Estradiol regulates APP mRNA alternative splicing in the mice
brain cortex. Neurosci Lett 381:154-157.
Thomas P, Pang Y, Filardo EJ, Dong J (2005) Identity of an estrogen membrane receptor
coupled to a G protein in human breast cancer cells. Endocrinology 146:624-632.
Toran-Allerand CD (1996) Mechanisms of estrogen action during neural development:
mediation by interactions with the neurotrophins and their receptors? J Steroid
Biochem Mol Biol 56:169-178.
Toran-Allerand CD, Guan X, MacLusky NJ, Horvath TL, Diano S, Singh M, Connolly
ES, Jr., Nethrapalli IS, Tinnikov AA (2002) ER-X: a novel, plasma membrane-
195
associated, putative estrogen receptor that is regulated during development and
after ischemic brain injury. J Neurosci 22:8391-8401.
Tsutsui K (2008) Neurosteroids in the Purkinje cell: biosynthesis, mode of action and
functional significance. Mol Neurobiol 37:116-125.
Tsuzuki K, Fukatsu R, Yamaguchi H, Tateno M, Imai K, Fujii N, Yamauchi T (2000)
Transthyretin binds amyloid beta peptides, Abeta1-42 and Abeta1-40 to form
complex in the autopsied human kidney - possible role of transthyretin for abeta
sequestration. Neurosci Lett 281:171-174.
Udrisar DP, Wanderley MI, Porto RC, Cardodo CL, Barbosa MC, Canberos MC, Cresto
JC (2005) Androgen- and estrogen-dependent regulation of insulin-degrading
enzyme in subcellular fractions of rat prostate and uterus. Exp Biol Med
(Maywood) 230:479-486.
Vallejo G, Ballare C, Baranao JL, Beato M, Saragueta P (2005) Progestin activation of
nongenomic pathways via cross talk of progesterone receptor with estrogen
receptor beta induces proliferation of endometrial stromal cells. Mol Endocrinol
19:3023-3037.
Vassar R, Bennett BD, Babu-Khan S, Kahn S, Mendiaz EA, Denis P, Teplow DB, Ross
S, Amarante P, Loeloff R, Luo Y, Fisher S, Fuller J, Edenson S, Lile J, Jarosinski
MA, Biere AL, Curran E, Burgess T, Louis JC, Collins F, Treanor J, Rogers G,
Citron M (1999) Beta-secretase cleavage of Alzheimer's amyloid precursor
protein by the transmembrane aspartic protease BACE. Science 286:735-741.
Vegeto E SM, Wen DX, Goldman ME, O'Malley BW, McDonnell DP. (1993) Human
progesterone receptor A form is a cell- and promoter-specific repressor of human
progesterone receptor B function. Mol Endocrinol 7:1244-1255.
Vekrellis K, Ye Z, Qiu WQ, Walsh D, Hartley D, Chesneau V, Rosner MR, Selkoe DJ
(2000) Neurons regulate extracellular levels of amyloid beta-protein via
proteolysis by Insulin-degrading enzyme. J Neuroscience 10:1657-1665.
Vereide AB, Kaino T, Sager G, Arnes M, Orbo A (2006) Effect of levonorgestrel IUD
and oral medroxyprogesterone acetate on glandular and stromal progesterone
receptors (PRA and PRB), and estrogen receptors (ER-alpha and ER-beta) in
human endometrial hyperplasia. Gynecol Oncol 101:214-223.
Waddell BJ, Bruce NW (1989) Changes in the blood concentrations of progesterone and
20 alpha-hydroxypregn-4-en-3-one during late pregnancy in the conscious rat: a
specific role for metabolic clearance rate. Biol Reprod 40:1231-1236.
196
Wang DS, Dickson DW, Malter JS (2006) beta-Amyloid degradation and Alzheimer's
disease. J Biomed Biotechnol 2006:58406.
Watson CS, Campbell CH, Gametchu B (2002) The dynamic and elusive membrane
estrogen receptor-alpha. Steroids 67:429-437.
Watson H, Franks S, Bonney RC (1996) Regulation of epidermal growth factor receptor
synthesis by ovarian steroids in human endometrial cells in culture. J Reprod
Fertil 107:199-205.
Wen DX XY-F, Mais DE, Goldman ME, McDonnell DP (1994) The A and B isoforms of
the human progesterone receptor operate through distinct signaling pathways
within target cells. Mol Cell Biol 14:8356-8364.
Wilhelmus MM, de Waal RM, Verbeek MM (2007) Heat shock proteins and amateur
chaperones in amyloid-Beta accumulation and clearance in Alzheimer's disease.
Mol Neurobiol 35:203-216.
Wilson JD, Griffin JE, Russell DW (1993) Steroid 5 alpha-reductase 2 deficiency.
Endocr Rev 14:577-593.
Wiltbank MC, Knickerbocker JJ, Niswender GD (1989) Regulation of the corpus luteum
by protein kinase C. I. Phosphorylation activity and steroidogenic action in large
and small ovine luteal cells. Biol Reprod 40:1194-1200.
Woolley CS, McEwen BS (1993) Roles of estradiol and progesterone in regulation of
hippocampal dendritic spine density during the estrous cycle in the rat. J Comp
Neurol 336:293-306.
Xiao S, Findlay JK, Robertson DM (1990) The effect of bovine activin and follicle-
stimulating hormone (FSH) suppressing protein/follistatin on FSH-induced
differentiation of rat granulosa cells in vitro. Mol Cell Endocrinol 69:1-8.
Xiao ZM, Sun L, Liu YM, Zhang JJ, Huang J (2009) Estrogen regulation of the
neprilysin gene through a hormone-responsive element. J Mol Neurosci 39:22-26.
Xu H, Wang R, Zhang YW, Zhang X (2006) Estrogen, beta-amyloid
metabolism/trafficking, and Alzheimer's disease. Ann N Y Acad Sci 1089:324-
342.
Xu H, Gouras GK, Greenfield JP, Vincent B, Naslund J, Mazzarelli L, Fried G,
Jovanovic JN, Seeger M, Relkin NR, Liao F, Checler F, Buxbaum JD, Chait BT,
Thinakaran G, Sisodia SS, Wang R, Greengard P, Gandy S (1998) Estrogen
197
reduces neuronal generation of Alzheimer beta-amyloid peptides. Nat Med 4:447-
451.
Yan SD, Chen X, Fu J, Chen M, Zhu H, Roher A, Slattery T, Zhao L, Nagashima M,
Morser J, Migheli A, Nawroth P, Stern D, Schmidt AM (1996) RAGE and
amyloid-beta peptide neurotoxicity in Alzheimer's disease. Nature 382:685-691.
Yanase M, Gorski RA (1976) Sites of estrogen and progesterone facilitation of lordosis
behavior in the spayed rat. Biol Reprod 15:536-543.
Yang DS, Smith JD, Zhou Z, Gandy SE, Martins RN (1997) Characterization of the
binding of amyloid-beta peptide to cell culture-derived native apolipoprotein E2,
E3, and E4 isoforms and to isoforms from human plasma. J Neurochem 68:721-
725.
Yang S FZ, Gurates B, Tamura M, Miller J, Ferrer K, Bulun SE. (2001) Stromal PRs
mediate induction of 17beta-hydroxysteroid dehydrogenase type 2 expression in
human endometrial epithelium: a paracrine mechanism for inactivation of E2.
Mol Endocrinol 15:2093-2105.
Yao M, Nguyen TV, Pike CJ (2007) Estrogen regulates Bcl-w and Bim expression: role
in protection against beta-amyloid peptide-induced neuronal death. J Neurosci
27:1422-1433.
Yen SH, Liu WK, Hall FL, Yan SD, Stern D, Dickson DW (1995) Alzheimer
neurofibrillary lesions: molecular nature and potential roles of different
components. Neurobiol Aging 16:381-387.
Yi KD, Simpkins JW (2008) Protein phosphatase 1, protein phosphatase 2A, and
calcineurin play a role in estrogen-mediated neuroprotection. Endocrinology
149:5235-5243.
Yi KD, Cai ZY, Covey DF, Simpkins JW (2008) Estrogen receptor-independent
neuroprotection via protein phosphatase preservation and attenuation of persistent
extracellular signal-regulated kinase 1/2 activation. J Pharmacol Exp Ther
324:1188-1195.
Yue X, Lu M, Lancaster T, Cao P, Honda S, Staufenbiel M, Harada N, Zhong Z, Shen Y,
Li R (2005) Brain estrogen deficiency accelerates Abeta plaque formation in an
Alzheimer's disease animal model. Proc Natl Acad Sci U S A 102:19198-19203.
Zandi PP, Carlson MC, Plassman BL, Welsh-Bohmer KA, Mayer LS, Steffens DC,
Breitner JC (2002) Hormone replacement therapy and incidence of Alzheimer
disease in older women: the Cache County Study. Jama 288:2123-2129.
198
Zhang QG, Wang R, Khan M, Mahesh V, Brann DW (2008) Role of Dickkopf-1, an
antagonist of the Wnt/beta-catenin signaling pathway, in estrogen-induced
neuroprotection and attenuation of tau phosphorylation. J Neurosci 28:8430-8441.
Zhang S HY, Zhu Y-c, Yao T (2005) Estrogen stimulates release of secreted amyloid
precursor protein from primary rat cortical neurons via protein kinase C pathway.
Acta Pharmacologica Sinica 26:171-176.
Zhao L, Brinton RD (2007) Estrogen receptor alpha and beta differentially regulate
intracellular Ca(2+) dynamics leading to ERK phosphorylation and estrogen
neuroprotection in hippocampal neurons. Brain Res 1172:48-59.
Zhao L, Yao J, Mao Z, Chen S, Wang Y, Brinton RD (2010) 17beta-Estradiol regulates
insulin-degrading enzyme expression via an ERbeta/PI3-K pathway in
hippocampus: Relevance to Alzheimer's prevention. Neurobiol Aging.
Zhao L BR (2007) Estrogen receptor a and b differentially regulate intracellular Ca2+
dynamics leading to ERK phosphorylation and estrogen neuroprotection in
hippocampal neurons. Brain Res.
Zheng WH, Bastianetto S, Mennicken F, Ma W, Kar S (2002) Amyloid beta peptide
induces tau phosphorylation and loss of cholinergic neurons in rat primary septal
cultures. Neuroscience 115:201-211.
Zhu Y, Bond J, Thomas P (2003a) Identification, classification, and partial
characterization of genes in humans and other vertebrates homologous to a fish
membrane progestin receptor. Proc Natl Acad Sci U S A 100:2237-2242.
Zhu Y, Rice CD, Pang Y, Pace M, Thomas P (2003b) Cloning, expression, and
characterization of a membrane progestin receptor and evidence it is an
intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci U S A
100:2231-2236.
Zhuang YH, Saaristo R, Ylikomi T (2003) An in vitro long-term culture model for
normal human mammary gland: expression and regulation of steroid receptors.
Cell Tissue Res 311:217-226.
Zlokovic BV, Martel CL, Matsubara E, McComb JG, Zheng G, McCluskey RT,
Frangione B, Ghiso J (1996) Glycoprotein 330/megalin: probable role in receptor-
mediated transport of apolipoprotein J alone and in a complex with Alzheimer
disease amyloid beta at the blood-brain and blood-cerebrospinal fluid barriers.
Proc Natl Acad Sci U S A 93:4229-4234.
199
Zuo K, Yamaguchi H, Akatsu H, Sakamoto T, Ko M, Mizoguchi K, Gong J-S, Yu W,
Yamamoto T, Kosaka K, Yanagisawa K, Michikawa M (2007) Angiotensin-
converting enzy,e converts amyloid B-Protein 1-42 (Abeta.
Zwain IH, Yen SS (1999) Neurosteroidogenesis in astrocytes, oligodendrocytes, and
neurons of cerebral cortex of rat brain. Endocrinology 140:3843-3852.

Abstract (if available)

Abstract The depletion of estrogen and progesterone in postmenopausal women is associated with increased risk for several disorders in the cardiovascular, skeletal and nervous system. To reduce this risk, hormone therapy containing estrogens and a synthetic progestagen has been used but with little success. For example, the Women’s Health Initiative clinical trial showed that hormone therapy was associated with reduced incidence of hip fractures associated with osteoporosis but unexpectedly increased incidences of both stroke and dementia. The disparities between basic research studies that demonstrate neuroprotective effects of estrogen and progesterone and recent clinical findings that report adverse neural effects of hormone therapy indicate the need for a more complete understanding of estrogens and progesterone interactions in brain and other tissues. One important issue that is not well understood is how neural effects of estrogens are affected by progestagens. Recent experimental evidence shows that prolonged progesterone exposure often represses estradiol function. The mechanism by which progesterone inhibits estrogen action in the brain is unclear. We hypothesize that progesterone might oppose estrogen activity by regulating the expression and or function of estrogen receptors, ERα and ERβ, thereby affecting ER-dependent transcriptional activity and E2-mediated neuroprotection. My thesis work involved testing these hypotheses and in the following chapters, I provide the experimental evidence for the same. Chapter 1 is a comprehensive introduction to a number of topics that are relevant to my research area. Chapter 2 describes the effects of progesterone on the expression of estrogen receptors both in primary neuron cultures as well as in rat brains.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Estrogen and progesterone-based hormone therapy and the development of Alzheimer's disease

PDF

Estrogen, progesterone and BDNF interactions: roles in neuroprotection

PDF

Estrogen and progesterone interaction on synaptic transmission and LTP in rodent hippocampus

PDF

Estrogen regulation of bioenergetics and mitochondrial function: implications for Alzheimer's disease risk and therapeutics

PDF

Estradiol regulation of cerebral metabolism: implications for neuroprotection and mitochondrial bioenergetics

PDF

Age-related androgen depletion and the development of Alzheimer's disease

PDF

From risk mitochondrial and metabolic phenotype towards a precision medicine approach for Alzheimer's disease

PDF

Memory abnormalities in Alzheimer's disease and anxiety models

PDF

Neuroinflammation and ApoE4 genotype in at-risk female aging: implications for Alzheimer's disease

PDF

The role of inflammation in mediating effects of obesity on Alzheimer's disease

PDF

Gonadal hormone regulation of neurogenesis and therapeutic implications for neurodegenerative diseases

PDF

Perimenopausal transition increases blood brain permeability: implications for neurodegenerative diseases

PDF

Gonadal steroid hormones promote neuroplasticity in models of health and disease

PDF

Blood-brain barrier pathophysiology in cognitive impairment and injury

PDF

TREM2 and C1q signaling regulates immunoproteostasis in Alzheimer's disease

PDF

The role of estrogen receptors and nociceptive signaling pathway of primary sensory neurons

PDF

Role of oxidative stress in age-associated mild cognitive impairment and Alzheimer's disease

PDF

Sex hormones and atherosclerosis in postmenopausal women

PDF

Insulin sensitivity in cognition, Alzheimer's disease and brain aging

PDF

Alzheimer’s disease: dysregulated genes, ethno-racial disparities, and environmental pollution

Asset Metadata

Creator Jayaraman, Anusha (author)

Core Title Estrogen and progesterone interactions in neurons: implications for Alzheimer's disease-related pathways

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Neuroscience

Publication Date 08/05/2010

Defense Date 06/14/2010

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag Alzheimer's disease,Estrogen,neuron,OAI-PMH Harvest,progesterone

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Pike, Christian J. (committee chair), Baudry, Michel (committee member), Brinton, Roberta Diaz (committee member), Rayudu, Gopalakrishna (committee member)

Creator Email ajayaram@usc.edu,anujay.ganguly@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m3298

Unique identifier UC1317941

Identifier etd-Jayaraman-3898 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-375673 (legacy record id),usctheses-m3298 (legacy record id)

Legacy Identifier etd-Jayaraman-3898.pdf

Dmrecord 375673

Document Type Dissertation

Rights Jayaraman, Anusha

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email cisadmin@lib.usc.edu