University of Southern California Dissertations and Theses

The C9ORF72 repeat expansion impairs neurodevelopment

(USC Thesis Other)

The C9ORF72 repeat expansion impairs neurodevelopment

PDF

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content Copyright 2022 Eric Wade Hendricks
The C9ORF72 Repeat Expansion Impairs Neurodevelopment

by

Eric Wade Hendricks

A Dissertation Presented to the
FACULTY OF THE USC GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(NEUROSCIENCE)

August 2022

ii

Dedication
You know who you are
Just a small-town kid living in Gillespie, Illinois
It’s the simple life I’ve come to enjoy
Never thought I would contribute much
Let alone the marvels I would see and touch

You see I took the leap of faith and rode towards the sunset
To solve life’s mysteries for those less fortunate
Now I rise to the top with my goals achieved
And dedicate this work to the ones who believed

A lot has happened to get me here
Like the people I’ve met from far and near
I hope you feel the words from this bar
I give thanks to you, you know who you are

iii

Acknowledgements
I remember being pulled from my first-grade class and having a teacher explain to
me how my verbal fluency and reading comprehension were severely lacking in
comparison to my classmates. This was the beginning of a lifelong struggle in academia,
but I’ve had so much help along the way. My mother was raising two young kids at the
time (me and my older sister), working, and going to school yet she always took the time
to sit down and read with me even though she must have been drained. I remember being
a brat and when she would correct me when I stumbled on a word I would retort with a
“that’s what I said!”. Nevertheless, she was persistent in helping me overcome these
challenges. Even though she never showed it, she must have been exhausted and
frustrated with me, but her unwavering love and commitment to my success has made
me the person I am today, so I owe it all to you mom.
There’s a common saying: “It’s not what you know, it’s who you know.” Although
my mom was my biggest academic supporter helping me with the “what you know” part,
some would argue that “who you know” is often times more important to achieve success
throughout life’s journey. My ability to read a room, to fit in socially, and to be able to hold
a conversation with literally anyone to form genuine social connections is something I
learned from my father. Dad, I know you struggled with your demons throughout the
years, but you came out the other side victorious. Thank you for all your many lessons.
I’m fortunate to come from a family who have opened their doors and hearts to all
those in need. Specifically, my Grandma Betty and Grandpa Arnold taught me that family
runs deeper than blood. Through their love and kindness, I was able to meet one of the
most influential people in my life, Kevin Wathen. Some of my earliest memories of my
iv

cousin Kevin is of him complimenting me about how smart and clever I was for my age
even though I knew he was wrong, but his constant positive affirmations turned to reality.
He has played a significant role in all aspects of my life from teaching me financial literacy
at a very young age to learning just how to be a good dude. I am forever grateful for you
Kev and your wife Becky. Without you guys I would never have made it this far. I saw how
you built your empire from a very humble beginning. You have been and will always be
an inspiration to me. Love you guys.
I would like to thank Dr. Justin Ichida for taking on the risk of me joining his lab. I
certainly wasn’t the best candidate from all those who rotated at the time but for some
reason he welcomed me to his lab. Dr. Ichida has been attentive and ever so patient with
me during the years. I specifically remember a time when I was really struggling with
understanding a Southern blot assay. Dr. Ichida took the time to figure out the right
combination of words/dry erase board drawings to help me understand. These are some
of your best qualities Justin. Never change. I would like to thank all present and past
members of the Ichida lab. You guys taught me so much about science and life in general.
I would also like to thank my committee members Dr. Kathie Eagleson and Dr. Pat Levitt.
You both are very personable, and I felt like you have fought for me since the beginning
and for that I thank you.
I also have to give a huge shout out to my 2015 NGP cohort! Whether they realize
it or not they got me through some pretty tough times and have made this journey so
much more enjoyable, as well as, some of the people we adopted from other cohorts.
You know who you are. Thank you all so much for all the laughs and being my friends.
v

Lastly, I would like to thank my Uncle Manuel, my Aunt Jeannette, and my
Grandma Nena. I am so grateful that you let me stay with you while I was working towards
my degree. I know I wasn’t easy to live with, yet you gave me everything and asked for
nothing in return. I am so thankful to have gotten to know you better and to hear all your
life experiences and wisdom (especially Grandma, she is 99 at the time of writing so
there’s a lot of experiences and wisdom to be told!).
I am now joining the top 2% of the world’s revered elites with the highest obtainable
degree in learning: a PhD. I will never forget where I came from, the struggles I’ve endured
to get to this point, and the people who have helped me along the way; especially the
many not mentioned here in this document. Thank you to the village who raised this boy.

vi
Table of Contents
Dedication .......................................................................................................................... ii
Acknowledgements.......................................................................................................... iii
List of Tables ................................................................................................................... vii
List of Figures .................................................................................................................. viii
Abstract ............................................................................................................................. ix
Chapter 1: Introduction .................................................................................................... 1
1.1 C9ORF72 FTD/ALS Pathophysiology ............................................................................... 1
1.2 Frontotemporal Dementia Etiology .................................................................................. 2
1.3 Frontotemporal Dementia Disease Progression............................................................. 3
1.4 Amyotrophic Lateral Sclerosis Etiology .......................................................................... 5
1.5 Amyotrophic Lateral Sclerosis Disease Progression .................................................... 6
1.6 Neurodevelopmental Deficits Preceding Neurodegeneration....................................... 8
1.7 Our Approach .................................................................................................................... 10
Chapter 2: The C9ORF72 Repeat Expansion Affects Neural Stem Cell Proliferation
and Differentitaion In Vitro ............................................................................................. 11
2.1 C9ORF72 FTD/ALS neural stem cells exhibit poor self-renewal and precocious
differentiation .......................................................................................................................... 11
2.2 Poly(AP) and other C9ORF72 DPRs impair neural stem cell self-renewal ................ 15
2.3 Poly(AP) impairs neural stem cell maintenance through LRRC47 and TDP-43 ........ 22
2.4 C9ORF72 FTD/ALS neural stem cells exhibit DNA replication stalling and DNA
breaks ....................................................................................................................................... 30
Chapter 3: Effects of the C9ORF72 Repeat Expansion In Vivo ................................ 33
3.1 Identification of Gain-of-Function Pathology During Early Neurodevelopment ....... 33
3.2 Reductions in Brain Size Influence Onset of Motor Dysfunction ............................... 37
Chapter 4: Conclusions .................................................................................................. 43
Appendix I: Materials and Methods .............................................................................. 46
References ....................................................................................................................... 63

vii
List of Tables

Chapter 1 :
1.1. iPSC line donor information and karyotyping pg. 14

viii
List of Figures

Chapter 1 :
1.1. Proposed pathological mechanisms of the C9ORF72 repeat expansion pg. 1
1.2. Time-dependent progression of TDP-43 proteinopathy observed in ALS
patients pg. 5
1.3. Contiguous and network propagation mechanisms of disease progression
in ALS pg. 6

Chapter 2 :
2.1. Generation of isogenic lines and characterization of iPSC-derived neural stem
cells pg. 12
2.2. C9ORF72 FTD/ALS neural stem cells exhibit poor self-renewal and precocious
differentiation pg. 16
2.3. Generation of C9ORF72 knockout line and presence of endogenous dipeptide
repeat proteins pg. 18
2.4. Poly(AP) and other C9ORF72 DPRs impair neural stem cell self-renewal pg. 21
2.5. Poly(AP) impairs neural stem cell maintenance through
LRRC47 and TDP-43 pg. 27
2.6. The effects of AP(50)-GFP on LRRC47 and TDP-43 pg. 29
2.7. C9ORF72 FTD/ALS neural stem cells exhibit DNA replication stalling and DNA
breaks pg. 31

Chapter 3
3.1. The C9ORF72 repeat expansion reduces thalamic volume in
embryonic mice pg. 36
3.2. Assessment of DPR pathology in thalamic progenitor cells, the effects of the
C9ORF72 repeat expansion on embryonic body weight, and MRI analysis of
cortex pg. 39
3.3. Reducing brain volume triggers symptom onset in C9ORF72-BAC mice pg. 41
ix

Abstract
Genetic mutations that cause adult-onset neurodegenerative diseases are often
expressed during embryonic stages, yet it is unclear if they alter neurodevelopment
and how this might influence disease onset. Here, we show that the most common
cause of frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS), a
repeat expansion in C9ORF72, restricts neural progenitor cell proliferation and
reduces thalamic and cortical size in utero. Surprisingly, DNA replication stalling, and
a repeat expansion-derived dipeptide repeat protein (DPR) not known to reduce
neuronal viability play key roles in impairing neurodevelopment. Reducing brain
volumes during neurodevelopment using a small molecule approach increases the
susceptibility of C9ORF72 mice to motor defects. Thus, the C9ORF72 repeat
expansion stunts the development of the brain regions prominently affected in
C9ORF72 FTD/ALS patients.

1

Introduction

1.1 C9ORF72 FTD/ALS Pathophysiology
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease
that affects 2 in every 100,000 people globally.
1
Approximately 10% of these cases are
familial, which can be explained by a genetic component, whereas, the remaining 90%
are sporadic with the majority of cases having no known origin. To date, the most common
cause of familial ALS is due to a hexanucleotide repeat expansion (HRE) in the non-
coding region of a gene called chromosome 9 open reading frame 72 (C9ORF72).
2,3

Exactly how the HRE in C9ORF72 causes ALS is unknown, but continued research
efforts have identified a few proposed mechanisms that contribute to disease onset: a
loss and gain-of-function mechanism. The prior refers to decreased transcription and
therefore reductions in C9ORF72 protein levels which has been shown to be detrimental
to neuronal viability (Fig. 1.1A & B).
4
However, sometimes the C9ORF72 repeat
Figure 1.1 Proposed pathological
mechanisms of the C9ORF72 repeat
expansion. (A) Location of the
C9ORF72 repeat expansion on the
C9ORF72 locus. (B) Decreases in
transcription lead to loss of C9ORF72
protein. (C) The repeat expansion can
be transcribed and the transcripts can
aggregate to form neurotoxic RNA foci.
(D) Sometimes the repeat expansion
can be transcribed and translated
giving rise to 5 different dipeptide
repeat protein species. (modified from
Gitler & Tsuiji, 2016)
2

expansion can be transcribed and translated into RNA foci and neurotoxic dipeptide
repeat proteins, respectively (Fig. 1.1C & D). This is referred to as the gain-of-function
mechanism. Interestingly, in one of the largest meta-analyses of its kind, a group of
researchers from Dublin, Ireland revealed nearly 50% of C9ORF72 ALS patients
simultaneously develop frontotemporal dementia (FTD), but patients with other
genetically inherited forms of ALS, such as SOD1, TARDBP, or FUS, do so at a
significantly lower rate (12%).
5
ALS and FTD are two entirely different diseases that affect
different anatomical regions and are comprised of different symptomologies. Yet, the high
degree of co-morbidity caused by HRE-C9ORF72 inheritance reflects a convergent
pathway in disease etiology. The purpose of this chapter is to give a comprehensive
summary of the anatomical regions affected by ALS and FTD. In addition, I will give ample
evidence as to how these diseases progress anatomically, while comparing the
similarities and differences to non-C9ORF72 ALS and FTD cases.
1.2 Frontotemporal Dementia Etiology
Frontotemporal dementia (FTD), also known as Pick’s disease, is the second most
common form of dementia after Alzheimer’s disease.
6
FTD can be further refined into the
following two subgroups: primary progressive aphasia (PPA) and behavior variant
frontotemporal dementia (bvFTD). PPA refers to the loss of neurons primarily in the
language processing centers in the left cortical hemisphere consisting of the frontal,
temporal, insular, and parietal regions.
7
The clinical presentation of this patient population
is extremely heterogenous but the main symptoms include changes in speech cadence
and intonation (dysprosody), inability to verbally communicate grammatically correct
sentences, and severely reduced language-comprehension skills.
8
The other form of
3

FTD, bvFTD, is the most common subtype of FTD and refers to the loss of mainly cortical
neurons in the frontal lobe that dictate personality and behavioral traits. Thus, the main
symptoms associated with bvFTD are drastic changes in personality and behavior, as
well as, a large overlap with psychiatric diseases; however, both semantic and episodic
memory usually remain intact.
9
For example, most bvFTD patients experience behavioral
disinhibition and indulge in socially inappropriate behaviors, such as, attempting to kiss
strangers, increased verbal/physical aggression, or engaging in public nudity. In addition,
most bvFTD cases experience psychotic episodes. One study documented a patient who
was convinced he had mites burrowing in his ear lobe, but if he pinched his ear every 10
minutes he could stop the infestation. Another patient in this study believed his deceased
friends were contacting him by phone and mail, so he spent most of his evenings trying
to make plans with his dead friends.
10

1.3 Frontotemporal Dementia Disease Progression
As mentioned previously, the HRE-C9ORF72 not only causes ALS but it also
independently accounts for ~20% of all familial FTD cases. Non-invasive neuroimaging
techniques, as well as, histological staging studies have provided great insight into the
neuroanatomical regions affected in C9ORF72-FTD cases and how the disease
progresses. For example, in a study conducted by the Mayo clinic, researchers performed
neuropsychological and neuroimaging exams on individuals diagnosed with FTD caused
by the C9ORF72 HRE and on individuals with other heritable forms of FTD, including the
progranulin (GRN) mutation. GRN mutations describe nearly 20% of familial FTD cases,
and, even though there have been at least 69 disease causing mutations associated with
the GRN gene, all of these mutations cause disease through haploinsufficiency.
11

4

Interestingly, the cognitive, functional, and behavioral impairments observed were not
significantly different between HRE-C9ORF72 and GRN FTD patients, even though each
cohort had a different pattern of grey matter degeneration. Widespread and symmetrical
degeneration, particularly in the medial, dorsolateral, and orbitofrontal regions, was
observed in HRE-C9ORF72 patients, whereas, GRN patients displayed asymmetric
degeneration mainly in the inferior temporal lobe.
12
Histological examination of post-
mortem brain tissues from FTD patients at different stages of the disease have also
provided information into the order in which these neuroanatomical regions are affected.
In a study conducted by Broe et al., the brains from 24 FTD patients were acquired and
sectioned. Seven out of the 24 patients died prematurely, which allowed for a detailed
macroscopic investigation of how FTD progresses over time. It’s important to note that
genetic testing was not available for most of these patients; however, 3 out of the 24
cases had concurrent motor neuron disease, which is indicative of HRE-C9ORF72, but
not conclusive. Nevertheless, four pathological stages of FTD were identified. The first
signs of atrophy (defined as stage 1) occurred in the orbital and superior medial frontal
cortex paired with slight ventricle enlargement. Next, the disease spread to the temporal
pole, inferior temporal cortex and basal ganglia (Figure 1.2). Stage 3 progression included
further degeneration of the frontal and temporal regions previously described, as well as,
5

marked degeneration of white matter in these regions. Lastly, the disease progressed to
the thalamus and hippocampus (Figure 1.2).
13

1.4 Amyotrophic Lateral Sclerosis Etiology
Amyotrophic lateral sclerosis (ALS) is clinically diagnosed as the degeneration of
motor neurons. The specific site of degeneration varies on a patient-by-patient basis but
is typical classified into the following two categories: bulbar and limb onset. Bulbar onset
refers to the degeneration of motor neurons in the brain (brainstem & upper motor
neurons), whereas limb onset is defined as the degeneration of motor neurons in the
spinal cord (lower motor neurons). Interestingly, in a study conducted on a large French
cohort of ALS patients, individuals with the HRE-C9ORF72 had an increased likelihood
of being diagnosed with bulbar onset (40%) in comparison to non-C9ORF72 ALS cases
(SOD1 – 7%, TARDBP – 11%, FUS – 14%)
14
, but what regions of the brain are affected
by bulbar onset? “Bulbar”, in the context of ALS, refers to the medulla and pons of the
Figure 1.2. Time-dependent progression of TDP-43 proteinopathy observed in ALS patients.
Histological examination of TDP-43 pathology was examined in a cohort of 76 ALS patients. The
progression of TDP-43 pathology goes from left to right with the severity of disease denoted by color
intensity. Grey boxes are regions unaffected by TDP-43. (modified from Braak et al., 2013).
6

brainstem, as well as the cerebellum. Neuropathological assessment of post-mortem
brain tissue derived from both C9ORF72 and non-C9ORF72 ALS patients (bulbar onset)
typically display neuronal atrophy in the medullary pyramidal tracts, in cranial nerves V,
VII, X, XI, XII, and in Betz pyramidal cells of layer V in the motor cortex.
15,16
As a result,
the clinical presentation of this patient population includes reduction/loss of fine motor
skills, sustained muscle contractions (spasticity), over responsive reflexes (hyperreflexia),
speech irregularities, and difficulties swallowing.
Limb onset is much more common in ALS patients with the SOD1 or TARDBP
mutations compared to HRE-C9ORF72 patients, and typically displays a slower disease
progression compared to bulbar onset.
14,17
In limb onset motor neurons in the anterior
and/or lateral corticospinal tract are affected, and common symptomology includes
muscle weakness, muscle atrophy, frequent muscle twitches, also known as
fasciculation, and a weak reflex
response.
1.5 Amyotrophic Lateral
Sclerosis Disease Progression
Disease onset, as
mentioned above, begins
predominantly in either upper
motor neurons or lower motor
neurons, but eventually affects
both systems. It is known that
the initial neurodegenerative
Figure 1.3. Contiguous and network propagation mechanisms
of disease progression in ALS. (A) Focal point of
neurodegeneration is initiated in the cortex (red). (B-D) In a time-
dependent manner, the initial site of degeneration expands and
induces pathology to surrounding cells (yellow/orange). Motor
neurons in the spinal cord are also affected due to loss of synaptic
connections with upper motor neurons. (Modified from Ravits,
2014).
7

cascade begins at a central neuroanatomical region based on clinical observations of
patient symptoms in a time-dependent manner.
18
Exactly how it begins and where it starts
though (i.e. anterior corticospinal tract vs. hypoglossal nuclei, etc.) remains uncertain.
Nevertheless, clinical observations have elucidated the following two patterns of disease
progression: 1) contiguous and 2) network propagation. These forms of disease
progression have been observed in both C9ORF72 and non-C9ORF72 ALS cases.
19,20

Contiguous propagation refers to the spread of the initial neurodegenerative
cascade to neighboring cells via a mode of non-synaptic transmission. However, our
motor system is integrated into functional circuits that involve both upper and lower motor
neurons. Some evidence suggest that ALS pathology can spread from upper to lower
motor circuits and vice versa via axonal transmission.
21
This mode of progression is
called network propagation. For example, disease onset may begin at a focal point in
layer V of the motor cortex (red spot, Fig 1.3A), and, as the disease progresses (Fig 1.3B-
D), the initial site of degeneration expands to involve surrounding cells (yellow/orange
areas; contiguous propagation). As these cells degenerate, the lower motor neuron
counterpart also degenerates in a somatotopic-dependent manner (network
propagation), but what pathological mechanism(s) contributes to disease progression in
ALS? It is likely that the main cellular mechanism behind most ALS cases involves protein
misfolding and dysfunctional RNA regulation. To this end, one common pathological
hallmark observed in 97% of ALS cases including those with the C9ORF72 HRE, but not
seen in individuals with the SOD1 and FUS mutations, are protein aggregates that consist
mainly of Tar DNA-binding protein-43 kDa (TDP-43).
22
The endogenous role of TDP-43
in vivo is complex to say the least, but it is known to interact with over 6,000 RNA targets
8

in the mammalian brain to regulate RNA metabolism, splicing, transport, and translation.
23

Thus, the pathological inclusion of TDP-43 is capable of disrupting protein homeostasis,
which has been shown in a variety of animal models to induce neurodegeneration.
24–26
In
addition, the protein structure of TDP-43 contains a glycine-rich “prion-like” domain, which
has been shown in vitro to induce TDP-43 aggregates in healthy cells causing a
degenerative snowball effect
27
; however, this study utilized an overexpression vector to
infect non-neuronal cells, so these results, and its implication toward ALS disease
progression, should be interpreted cautiously. It’s should also be noted that not all HRE-
C9ORF72 ALS cases exhibit TDP-43 pathology, so it is important to consider the loss
and gain of functions associated with the repeat expansion to fully understand the
pathological initiation/progression of ALS in this cohort. Specifically, the accumulation of
transcribed DNA from the repeat expansion into RNA foci has also been shown to recruit
RNA-binding proteins, which is also capable of altering protein homeostasis; mimicking a
TDP-43-like pathology.
28
Protein aggregations and dysfunctional RNA regulation have
also been observed in SOD1 and FUS making this phenomenon a theme among most
ALS cases and may also be a mechanistic link to frontotemporal dementia.
29,30

1.6 Neurodevelopmental Deficits Preceding Neurodegeneration
Many genetic mutations that cause adult-onset neurodegenerative disease are
often expressed early in life, yet it remains unclear if they alter neurodevelopment and if
such changes impact disease onset in adulthood.
31,32
Recent studies show that the
Huntington’s disease-causing CAG repeat expansion in Huntingtin leads to reduced
neonatal brain volumes in mice and humans.
33,34
Moreover, transiently reducing
Huntingtin levels in mice until postnatal day 21 induces many of the same
9

neurodevelopmental phenotypes as mutant Huntingtin and leads to subsequent
neurodegeneration in adulthood.
34
These findings argue that the expression of
neurodegenerative disease-causing gene mutations during embryonic or neonatal
periods can alter neurodevelopment in ways that increase susceptibility to
neurodegenerative disease. This could greatly impact the design and efficacy of
treatment strategies and underscores the need to determine if this is an isolated example
or a mechanism relevant to other mutations and diseases. Since published data attribute
many of the neurodevelopmental effects of mutant Huntingtin to loss-of-function
mechanisms that are presumably specific to the function of Huntingtin, it is unclear if other
neurodegenerative disease-causing mutations, including other repeat expansions, alter
neurodevelopment.
34

Intriguingly, imaging studies indicate that C9ORF72 repeat expansion carriers
display reduced gray and white matter volumes in thalamic and frontal cortical regions at
least as early as the fourth decade of life, 10-20 years before the average age of disease
onset.
43,44
Presymptomatic C9ORF72 repeat expansion carriers also display prominent
connectivity deficits in salience and medial pulvinar thalamus-seeded networks,
suggesting the structural changes have functional consequences.
43-45
Importantly, the
gray matter deficits in presymptomatic repeat expansion carriers are topographically
similar to atrophied brain regions in C9ORF72 FTD patients, suggesting that the
presymptomatic structural changes have meaningful consequences for C9ORF72
patients.
A key question is whether the presymptomatic gray matter reductions in C9ORF72
repeat expansion carriers arise from altered development or early degeneration. If the
10

structural changes arise from altered development, the magnitude of these changes in a
given carrier may help to predict disease onset and progression years in advance. On the
other hand, if the gray matter reductions reflect presymptomatic neurodegeneration, it
would greatly elevate the importance of initiating therapeutic treatment much earlier,
perhaps before symptom onset if possible. Several lines of evidence suggest that the
structural changes might reflect altered neurodevelopment. First, gray and white matter
volumes decline with age at a similar rate between C9ORF72 repeat expansion carriers
and non-carriers, suggesting degeneration within the 10-20 year period preceding
disease onset does not cause the structural differences.
43
Second, while cerebrospinal
fluid (CSF) levels of the neurodegeneration biomarker Neurofilament Light Chain increase
in repeat expansion carriers after symptom onset, they remain low before disease onset,
suggesting there is limited neurodegeneration presymptomatically.
46
Third, C9ORF72 is
expressed in the nervous system during embryonic and neonatal periods in mice and
humans, indicating the repeat expansion could affect neurodevelopment.
47-50
However, it
remains unclear if the C9ORF72 repeat expansion alters neurodevelopment, how it might
elicit such effects, and how structural changes acquired during development affect
symptom onset.
1.7 Our Approach
To understand the involvement of the C9ORF72 repeat expansion on brain size
and its influence on disease onset and progression in FTD/ALS, we will focus on neural
stem cells (NSCs). During embryological development, NSCs residing in the ventricular
zone give rise to the lateral and radial expansion of the mammalian neocortex via
symmetric and asymmetric division, respectively. Inhibiting NSC proliferation early in
11

development via cell cycle arrest or increased differentiation has been shown to reduce
brain volumes in both mice and humans.
33
Therefore, altering NSC proliferation and
differentiation may be a potential mechanism to explain the decreases in brain volume
observed in C9ORF72 expansion carriers.
Here, we show that the C9ORF72 repeat expansion restricts neural stem cell
proliferation and reduces thalamic and cortical size in utero. Mechanistically, we find that
the loss of C9ORF72 function does not appreciably alter neural stem and progenitor cell
behavior. Unexpectedly, the non-neurotoxic DPR poly(alanine-proline)(AP) plays a key
role in reducing the number of neural stem and progenitor cells in C9ORF72 ALS/FTD
induced pluripotent stem cell (iPSC) cultures. Poly(AP) induces this effect in part by
binding to a ribosomal maturation factor called LRRC47 and lowering protein synthesis.
51

In addition, we observe DNA replication stalling at the repeat expansion that slows
proliferation of neural progenitor cells, suggesting that long repetitive regions like those
in C9ORF72 patients can impair neurodevelopment. Pharmacologically mimicking the
effects of the repeat expansion on neurodevelopment increases the frequency of motor
defects in C9ORF72 mice. Thus, the C9ORF72 repeat expansion impairs the
development of brain regions prominently affected in C9ORF72 FTD/ALS patients.

Chapter 2: The C9ORF72 Repeat Expansion Affects Neural Stem Cell
Proliferation and Differentiation In Vitro

2.1 C9ORF72 FTD/ALS neural stem cells exhibit poor self-renewal and precocious
differentiation
12

13

Figure 2.1 Generation of isogenic lines and characterization of iPSC-derived neural stem cells. (A)
Schematic of CRISPR-Cas9 strategy for removal of the repeat expansion in the C9ORF72 FTD/ALS 1 line.
Two sgRNAs flanking the repeat expansion were used to delete the repeat expansion. (B) Repeat-primed
PCR (RP-PCR) analysis to assess the presence or absence of the C9ORF72 repeat expansion for control,
C9ORF72 FTD/ALS, isogenic control (corrected), and C9ORF72
-/-
iPSC lines. A large sawtooth pattern
beyond 200 base pairs signals the presence of the repeat expansion. (C) Southern blot analysis showing
the CRISPR-Cas9-mediated removal of the C9ORF72 repeat expansion in the corrected line compared to
the parental C9ORF72 FTD/ALS 1 line. The non-expanded allele forms a band at 3kb, while the repeat
expanded allele shows lengths up to ~9kb. (D, E) Representative immunocytochemistry images (D) and
quantification (E) of the percentage of PAX6+/NESTIN+ cells in cultures PSA-NCAM+ MACS-sorted at day
10 of neural differentiation. Data points consist of 3 independent differentiations per line per group (4
control, 3 C9ORF72 FTD/ALS, and 1 corrected line). Each data point represents one independent
differentiation. Mean +/- s.e.m. One-way ANOVA showed no significant differences between groups. Scale
bars = 50 um. (F) RNA-seq analysis of day 10 PSA-NCAM+ MACS-sorted neural cultures showing
normalized gene counts for cortical stem cell, ventral and caudal stem cell, and pluripotent stem cell genes.
Data were acquired from 3 independent differentiations per line from 4 control lines, 3 C9ORF72 FTD/ALS,
and 1 corrected line. Each data point represents one independent differentiation. Mean +/- s.e.m. (G, H)
Representative immunocytochemistry images (G) and quantification of the percentage of cleaved caspase
3+ cells in PSA-NCAM+ MACS-sorted cells at day 15 of neural differentiation. Data points consist of 2
independent differentiations per line per group (4 control and 3 C9ORF72 FTD/ALS). Each data point
represents one independent differentiation. Mean +/- s.e.m. Mann-Whitney test. Scale bars = 25 µm.
To determine if the C9ORF72 repeat expansion alters neurodevelopment, we
derived neural stem and progenitor cells from control and C9ORF72 FTD/ALS patient
iPSC lines that we had previously used to identify neuronal changes induced by the repeat
expansion (Table 2.1).
38,41
In order to control for differences in genetic background, we
used CRISPR/Cas9 editing to generate an isogenic control, or “corrected” line by
removing the C9ORF72 repeat expansion from a patient line (Fig. 2.1A-C and Table 2.1).
Repeat-primed PCR analysis confirmed the presence of the C9ORF72 repeat expansion
in C9ORF72 FTD/ALS lines and its absence in controls, and we further verified removal
of the repeat expansion in the corrected line by southern blot (Fig. 2.1B, C). To generate
cortical neural stem and progenitor cells from iPSCs, we used a previously published
protocol that employed retinoid treatment and dual SMAD inhibition (Fig. 2.2A).
52
At day
10 of differentiation, we performed magnetic activated cell sorting (MACS) purification of
polysialic acid-neural cell adhesion molecule (PSA-NCAM)+ cells in order to enrich for
neural precursors (Fig. 2.2A).
53
As expected, bulk RNA-seq analysis showed that the
14

control, C9ORF72 FTD/ALS, and corrected PSA-NCAM+ cells expressed high levels of
cortical stem cell markers including PAX6, OTX1, OTX2, and SOX2 and low levels of
ventral and caudal neural stem cell markers and pluripotent stem cell markers (Fig. 2.1D,
4 control and 3 C9ORF72 FTD/ALS donors, 1 corrected line).
Table 2.1
iPSC line donor information and karyotyping

NINDS/Co
riell Code
Sample
Name
Mutation Disease Age
of
Onset
Age at
Sampling
Gender iPSC
Karyotype
ND03231 Control 1 Control N/A N/A 56 M Normal
ND03719 Control 2 Control N/A N/A 33 M Normal
ND00184 Control 3 Control N/A N/A 65 F Normal
ND05280 Control 4 Control N/A N/A 72 F Normal
ND06769 C9-FTD/ALS
1
C9ORF72 FTD/ALS 45 46 F Normal
ND12099 C9-FTD/ALS
2
C9ORF72 FTD/ALS 48 49 M Normal
ND10689 C9-FTD/ALS
3
C9ORF72 FTD/ALS 49 51 F Normal
ND06769 Corrected Isogenic
Corrected
N/A N/A 46 F Normal
ND03231 C9
-/-
C9ORF72
homozygou
s knockout
N/A N/A 56 F Normal

To assess the ability of MACS-purified neural stem cells to self-renew, we further cultured
them in EGF and FGF to promote maintenance of the neural stem cell and progenitor
states. After 5 or 20 days of additional culture with EGF and FGF (days 15 and 30 total),
we quantified the number of PAX6+ neural stem and progenitor cells or MAP2+ neurons,
respectively (Fig. 2.2A). At day 15, C9ORF72 FTD/ALS cultures showed striking
reductions in the percentages of PAX6+ and Ki67+ cells compared to the control and
corrected lines (Fig. 2.2B-D, 4 control and 3 C9ORF72 FTD/ALS donors, 1 corrected
line). In addition, C9ORF72 FTD/ALS lines exhibited significantly fewer rosette structures
15

compared to control and corrected cultures (Fig. 2.2E-G, 4 control and 3 C9ORF72
FTD/ALS donors, 1 corrected line). Cleaved Caspase-3 immunocytochemistry indicated
that these differences did not result from increased cell death in C9ORF72 FTD/ALS
cultures (Fig. 2.1G, H). In contrast, C9ORF72 FTD/ALS cultures possessed more
neurons than control and corrected cultures at day 30 (Fig. 2.2H-J, 4 control and 3
C9ORF72 FTD/ALS donors, 1 corrected line). Thus, C9ORF72 FTD/ALS neural stem
cells exhibited reduced self-renewal and increased differentiation into neurons in culture
conditions intended to promote neural stem cell maintenance.
2.2 Poly(AP) and other C9ORF72 DPRs impair neural stem cell self-renewal
We previously showed that reduced C9ORF72 function due to the repeat
expansion contributes to neurodegeneration in iPSC-derived motor neurons.
38
Since
C9ORF72 was highly-expressed in day 10 MACS-purified PSA-NCAM+ cells (top 15% of
all expressed genes), we determined whether the loss of C9ORF72 function accounted
for the impaired self-renewal of C9ORF72 FTD/ALS neural stem cells. We differentiated
neural cultures from a control line and an isogenic C9ORF72
-/-
line which we had
previously generated by using CRISPR/Cas9 editing to introduce frameshift mutations
into both copies of C9ORF72 (Fig. 2.3A, B).
38
Western blot analysis confirmed that these
mutations eliminated full-length C9ORF72 protein in day 10 MACS-purified PSA-NCAM+
cells derived from the C9ORF72
-/-
isogenic line (Fig. 2.3C, D). After culturing day 10
MACS-purified PSA-NCAM+ cells for 5 additional days in EGF and FGF, there were no
significant differences in the percentages of PAX6+ or Ki67+ cells between control and
C9ORF72
-/-
cultures (Fig. 2.4A, B). These results suggest that reduced C9ORF72 levels
do not account for the impaired self-renewal of C9ORF72 FTD/ALS neural stem cells.
16

17

Figure 2.2. C9ORF72 FTD/ALS neural stem cells exhibit poor self-renewal and precocious
differentiation. (A) Schematic diagram of neural stem and progenitor cell induction and timing of
immunocytochemistry analysis for PAX6, KI67, and MAP2. (B) Representative immunocytochemistry
images of the percentages of PAX6+ and KI67+ positive neural stem and progenitor cells in control,
C9ORF72 FTD/ALS, and isogenic control (corrected) lines after MACS-purification of PSA-NCAM+ cells at
day 10 of neural differentiation and 5 additional days of culture with EGF and FGF. Scale bars = 25 um. (C)
Quantification of the percentages of PAX6+ and KI67+ positive neural stem and progenitor cells in control
and C9ORF72 FTD/ALS lines 5 additional days of culture with EGF and FGF after MACS-purification of
PSA-NCAM+ cells at day 10 of neural differentiation. Mean +/- s.e.m. The data points for each group include
3 independent differentiations from each line (4 control lines and 3 C9ORF72 FTD/ALS lines). Each
independent differentiation was used as a data point. Unpaired t-test. (D) Quantification of the percentages
of PAX6+ and KI67+ positive neural stem and progenitor cells in an isogenic control line or C9ORF72
FTD/ALS line 1 5 additional days of culture with EGF and FGF after MACS-purification of PSA-NCAM+
cells at day 10 of neural differentiation. Mean +/- s.e.m. The data points for each group include 3
independent differentiations from each line (1 isogenic control line and 1 C9ORF72 FTD/ALS line). Each
independent differentiation was used as a data point. Unpaired t-test. (E) Representative
immunocytochemistry images of rosette-like structures of PAX6+ cells in control, C9ORF72 FTD/ALS, and
isogenic control lines after MACS-purification of PSA-NCAM+ cells at day 10 of neural differentiation and 5
additional days of culture with EGF and FGF. Scale bars = 100 um. (F) Quantification of the total number
of PAX6+ rosette-like structures formed in control or C9ORF72 FTD/ALS cultures after MACS-purification
of PSA-NCAM+ cells at day 10 of neural differentiation and 5 additional days of culture with EGF and FGF.
Mean +/- s.e.m. The data points for each group include 3 independent differentiations from each line (4
control and 3 C9ORF72 FTD/ALS lines). Each independent differentiation was used as a data point.
Unpaired t-test. (G) Quantification of the total number of PAX6+ rosette-like structures formed in isogenic
control or C9ORF72 FTD/ALS line 1 cultures after MACS-purification of PSA-NCAM+ cells at day 10 of
neural differentiation and 5 additional days of culture with EGF and FGF. Mean +/- s.e.m. The data points
for each group include 3 independent differentiations from each line (1 isogenic control line and 1 C9ORF72
FTD/ALS line). Each independent differentiation was used as a data point. Unpaired t-test. (H)
Representative immunocytochemistry images of the number of MAP2+ neurons in control, C9ORF72
FTD/ALS, and isogenic control line cultures after MACS-purification of PSA-NCAM+ cells at day 10 of
neural differentiation and 20 additional days of culture with EGF and FGF. Scale bars = 50 um. (I)
Quantification of the total number of MAP2+ neurons formed in control or C9ORF72 FTD/ALS cultures after
MACS-purification of PSA-NCAM+ cells at day 10 of neural differentiation and 20 additional days of culture
with EGF and FGF. Mean +/- s.e.m. The data points for each group include 3 independent differentiations
from each line (4 control lines and 3 C9ORF72 FTD/ALS lines). Each independent differentiation was used
as a data point. Unpaired t-test. (J) Quantification of the total number of MAP2+ neurons formed in isogenic
control or C9ORF72 FTD/ALS cultures after MACS-purification of PSA-NCAM+ cells at day 10 of neural
differentiation and 20 additional days of culture with EGF and FGF. Mean +/- s.e.m. The data points for
each group include 3 independent differentiations from each line (1 isogenic control line and 1 C9ORF72
FTD/ALS line). Each independent differentiation was used as a data point. Unpaired t-test.

18

19

Figure 2.3. Generation of C9ORF72 knockout line and presence of endogenous dipeptide repeat
proteins. (A) Schematic of CRISPR-Cas9-based strategy to induce loss-of-function frameshift mutations
in exon 2 of the C9ORF72 gene in a control line. (B) Frameshift mutations generated by CRISPR-Cas9-
editing in C9ORF72 exon 2 of the Control 1 iPSC line to generate the C9ORF72
-/-
line. (C, D) Western blot
images (C) and quantification (D) showing C9ORF72 protein levels (normalized to total protein) in day 15
control, C9ORF72 FTD/ALS, isogenic corrected, and C9ORF72
-/-
PSA-NCAM+ MACS-purified neural stem
and progenitor cells. Data points consist of 2 independent differentiations from 4 control lines, 3 C9-
FTD/ALS lines, 1 corrected line, and 1 C9ORF72
-/-
line. Each data point represents one independent
differentiation. Mean +/- s.e.m. One-way ANOVA. (E-G) Representative immunocytochemistry images (E)
and quantification (F, G) of the number of endogenous poly(GR)+ punctae in day 15 control, C9ORF72
FTD/ALS, and isogenic corrected PAX6+, PSA-NCAM MACS-purified neural stem and progenitor cells.
Data points consist of 2 independent differentiations from 4 control lines, 3 C9ORF72 FTD/ALS lines, and
1 corrected line. (F) shows the comparison between 4 control lines and 3 C9ORF72 FTD/ALS lines, and
(G) shows the comparison between the isogenic corrected line and C9ORF72 FTD/ALS line 1. Data points
consist of 2 independent differentiations from 4 control lines, 3 C9ORF72 FTD/ALS lines (F) or from 3
independent differentiations of C9ORF72 FTD/ALS line 1 and the corrected line (G). Each data point
represents one independent differentiation. Mean +/- s.e.m. Unpaired t-test. Scale bar: 25 um. (H-J)
Representative immunocytochemistry images (H) and quantification (I, J) of the number of endogenous
poly(PR)+ punctae in day 15 control, C9ORF72 FTD/ALS, and isogenic corrected PAX6+, PSA-NCAM
MACS-purified neural stem and progenitor cells. Data points consist of 2 independent differentiations from
4 control lines, 3 C9ORF72 FTD/ALS lines, and 1 corrected line. (I) shows the comparison between 4
control lines and 3 C9ORF72 FTD/ALS lines, and (J) shows the comparison between the isogenic corrected
line and C9ORF72 FTD/ALS line 1. Data points consist of 2 independent differentiations from 4 control
lines, 3 C9ORF72 FTD/ALS lines (I) or from 3 independent differentiations of C9ORF72 FTD/ALS line 1 and
the corrected line (J). Each data point represents one independent differentiation. Mean +/- s.e.m. Unpaired
t-test. Scale bar: 25 um.

In addition to reducing C9ORF72 protein function, the repeat expansion induces
gain-of-function processes including the production of 5 different DPR species through
repeat-associated non-AUG translation of the sense and antisense C9ORF72
transcripts.
37,54
We previously found that among the 5 DPRs, poly(GR) and poly(PR)
caused severe neurotoxicity when overexpressed individually, whereas poly(AP),
poly(glycine-alanine(GA)), and poly(glycine-proline(GP)) did not significantly affect
neuronal survival.
37
Immunocytochemistry using knockout- or previously-validated
antibodies showed that day 10 PAX6+ neural stem cells from C9ORF72 FTD/ALS
patients possessed DPRs derived from both the sense and antisense C9ORF72
transcripts, including poly(AP), poly(GR), and poly(PR) (Fig. 2.4C-E and Fig. 2.3E-J).
41,55-
58
In contrast, PAX6+ neural stem cells from the corrected line and non-isogenic controls
20

did not (Fig. 2.4C-E and Fig. 2.3E-J, 4 control and 3 C9ORF72 FTD/ALS donors, 1
corrected line). While poly(GR) and poly(PR) showed punctate staining patterns, poly(AP)
appeared more diffuse in the neural stem cells (Fig. 2.4C-E and Fig. 2.3E-J). These DPR
staining patterns were consistent with results from a previously published cell culture
study.
58
These results indicate that day 10 PAX6+ C9ORF72 FTD/ALS neural stem cells
possess DPRs.
To determine if DPRs impair neural stem cell self-renewal, we overexpressed 50-
repeat versions of each DPR in day 10 MACS-purified PSA-NCAM+ cells derived from
control lines. These 50-repeat DPR constructs were equivalent to the ones we and others
previously tested in neurons.
37,38
After 5 days of additional culture with EGF and FGF, we
quantified the percentage of PAX6+ and Ki67+ neural stem cells in each DPR condition
in 4 different control lines. Similar to their negligible effects in neuronal survival assays in
a previous study, poly(GA) and poly(GP) did not affect the percentage of PAX6+ neural
stem cells or Ki67+ dividing cells (Fig. 2.4F-H, 4 control donors).
37
In contrast, the
neurotoxic poly(GR) and poly(PR) DPRs significantly reduced the percentage of Ki67+
dividing cells, while leading to a slight reduction in the percentage of PAX6+ cells (Fig.
2.4F-H, 4 control donors). These results may reflect the ability of poly(GR) and poly(PR)
to activate p53 activity.
59
Surprisingly, while poly(AP) was previously shown to be non-
toxic

21

22

Figure 2.4. Poly(AP) and other C9ORF72 DPRs impair neural stem cell self-renewal. (A)
Representative images of the percentages of PAX6+ cells in control and C9ORF72-/- cultures after MACS-
purification of PSA-NCAM+ cells at day 10 of neural differentiation and 5 additional days of culture with
EGF and FGF. Scale bars = 25 um. (B) Quantification of the percentages of PAX6+ and KI67+ positive
neural stem and progenitor cells in control and C9ORF72-/- cultures after MACS-purification of PSA-
NCAM+ cells at day 10 of neural differentiation and 5 additional days of culture with EGF and FGF. Mean
+/- s.e.m. The data points for each group include 3 independent differentiations from each line (4 control
lines and 3 C9ORF72 FTD/ALS lines). Each independent differentiation was used as a data point. Unpaired
t-test. n.s. = not significant. (C) Representative immunocytochemistry images of poly(AP) levels in control,
C9ORF72 FTD/ALS, or isogenic control cultures at day 10 of neural differentiation. Scale bars = 30 um. (D)
Quantification of immunocytochemical analysis of poly(AP) intensity normalized to cell area in PAX6+ cells
in control or C9ORF72 FTD/ALS cultures at day 10 of neural differentiation. Mean +/- s.e.m. The data points
for each group include 3 independent differentiations from each line (4 control lines and 3 C9ORF72
FTD/ALS lines). Each independent differentiation was used as a data point. Unpaired t-test. (E)
Quantification of immunocytochemical analysis of poly(AP) intensity normalized to cell area in PAX6+ cells
in isogenic control or C9ORF72 FTD/ALS line 1 cultures at day 10 of neural differentiation. Mean +/- s.e.m.
The data points for each group include 3 independent differentiations from each line (1 isogenic control line
and 1 C9ORF72 FTD/ALS line). Each independent differentiation was used as a data point. Unpaired t-
test. (F) Representative immunocytochemistry images of the percentages of PAX6+ and Ki67+ cells in
control line cultures after MACS-purification of PSA-NCAM+ cells at day 10 of neural differentiation,
transduction with GFP, GA(50)-GFP, AP(50)-GFP, GR(50)-GFP, PR(50)-GFP, or (GP)50-GFP, and 5
additional days of culture with EGF and FGF. Outlines depict cells that are PAX6 negative or KI67 negative
in cells transduced with AP(50)-GFP and PR/GR(50)-GFP, respectively. Scale bars = 25 um. (G, H)
Quantification of immunocytochemical analysis of the percentages of PAX6+ (G) and Ki67+ (H) cells in
control line cultures after MACS-purification of PSA-NCAM+ cells and transduction with GFP or DPR-GFP
lentiviruses at day 10 of neural differentiation, and 5 additional days of culture with EGF and FGF. Mean
+/- s.e.m. The data points for each group include 3 independent differentiations per line per condition (4
control lines). Each independent differentiation was used as a data point. Two-way ANOVA.

to neurons, it significantly reduced the percentage of PAX6+ cells and slightly lowered
the fraction of Ki67+ dividing cells (Fig. 2.4F-H, 4 control donors).
37
These results suggest
that DPRs impair neural stem cell self-renewal, and they do so in different ways. While
poly(GR) and poly(PR) reduce the number of dividing cells, poly(AP) more potently
reduces the number of PAX6+ neural stem cells. Interestingly, poly(AP) severely impacts
neural stem cell maintenance even though its overexpression does not affect neuronal
survival.
37

2.3 Poly(AP) impairs neural stem cell maintenance through LRRC47 and TDP-43
Since poly(AP) most severely reduced the percentage of PAX6+ neural stem cells
over 5 days of culture in EGF and FGF, we investigated the mechanisms through which
it mediated this effect. To identify interactors of poly(AP), we overexpressed 50-repeat
23

poly(AP)(AP(50)-GFP) or GFP alone in day 10 MACS-purified PSA-NCAM+ cells from 3
control lines, immunoprecipitated AP(50)-GFP or GFP using an anti-GFP antibody, and
analyzed the co-immunoprecipitated proteins by mass spectrometry. This experiment
identified 3 proteins that significantly co-immunoprecipitated with AP(50)-GFP to a greater
extent than GFP alone. These proteins included Glucose-6-phosphate isomerase (GPI),
Aldehyde Dehydrogenase 16 Family Member A1 (ALDH16A1), and Leucine Rich Repeat
Containing 47 (LRRC47). Of these top candidate proteins, co-immunoprecipitation
experiments with candidate-specific antibodies verified that LRRC47 bound AP(50)-GFP
significantly more than GFP alone (Fig. 2.5A, B).
A recent cryo-electron microscopy study showed that LRRC47 participates in
ribosomal maturation in human cells and binds to pre-40S ribosomes in the late stages
of small ribosomal subunit formation.
51
To determine if poly(AP) interferes with the ability
of LRRC47 to interact with the pre-40S ribosome, we measured the amount of the 40S
subunit Ribosomal Protein S6 (RPS6) that co-immunoprecipitated with an LRRC47-
FLAG-mCherry fusion protein in the presence or absence of poly(AP). While RPS6 clearly
co-immunoprecipitated with the LRRC47-FLAG-mCherry fusion protein when
immunoprecipitated from GFP-overexpressing cells with a FLAG-specific antibody, it did
not co-immunoprecipitate with FLAG-mCherry alone, indicating that it interacted with
LRRC47 but not FLAG-mCherry (Fig. 2.5C, D). Importantly, compared to GFP
overexpression, AP(50)-GFP significantly reduced the amount of endogenous RPS6 that
co-immunoprecipitated with LRRC47-FLAG-mCherry, suggesting that poly(AP) interfered
with the ability of LRRC47 to interact with the pre-40S ribosome (Fig. 2.5C, D). We
determined if this impacted protein synthesis in day 15 PSA-NCAM MACS-purified neural
24

stem and progenitor cells by using L-homopropargylglycine (HPG), a methionine analog
that contains an alkene moiety that enables covalent linkage to a dye after incorporation
into proteins during translation.
60
Indeed, AP(50)-GFP expression significantly reduced
HPG incorporation in control PAX6+ neural stem and progenitor cells compared to GFP
alone, suggesting that poly(AP) lowered protein synthesis (Fig. 2.5E, F, 4 control donors).
These results suggest that poly(AP) interferes with the ability of LRRC47 to interact with
the pre-40S ribosome and reduces protein synthesis in neural stem and progenitor cells.
We next asked if LRRC47 activity modulates neural stem cell self-renewal by
reducing LRRC47 expression using antisense oligonucleotides (ASOs). Indeed, ASO-
mediated suppression of LRRC47 in day 10 MACS-purified PSA-NCAM+ cells from
control individuals significantly reduced the percentage of PAX6+ cells after 5 days of
culture with EGF and FGF (Fig. 2.5G, H, 4 control donors). Conversely, we determined if
increasing LRRC47 expression could mitigate the loss of neural stem and progenitor cells
in C9ORF72 FTD/ALS lines or control lines overexpressing AP(50)-GFP. Transducing
day 10 PSA-NCAM+ cells with a lentivirus encoding LRRC47-mCherry significantly
increased the number of PAX6+ neural stem and progenitor cells in C9ORF72 FTD/ALS
lines and control lines overexpressing AP(50)-GFP compared mCherry alone (Fig. 2.5I-
L, 3 C9ORF72 FTD/ALS donors and 4 control donors + AP(50)-GFP). These data suggest
that LRRC47 activity modulates neural stem cell self-renewal, as lowering LRRC47
expressing compromises neural stem cell self-renewal in control lines. Importantly,
overexpressing LRRC47 mitigates defects in neural stem cell maintenance caused by
poly(AP) and the C9ORF72 repeat expansion.
25

To determine how poly(AP)’s effect on LRRC47 activity impacts neural stem cell
self-renewal, we transduced day 10 MACS-purified PSA-NCAM+ cells from 4 control lines
with AP(50)-GFP or GFP alone, FACS-purified GFP+ cells after 5 days in EGF/FGF
culture medium, and performed RNA-seq analysis (2 control donors). Since transcription
factors can drive cell fate decisions, we used Enrichr to search public datasets to identify
transcription factor perturbations that induce similar gene expression changes to AP(50)-
GFP overexpression.
61
This analysis showed that gene expression changes caused by
AP(50)-GFP overexpression closely resembled those that can result from loss of TDP-43
function (Fig. 2.6B). Consistent with this, immunoblotting and immunocytochemistry
confirmed that AP(50)-GFP overexpression reduced TDP-43 levels in control PAX6+
neural stem and progenitor cells (Fig. 2.5M, N and Fig. 2.6C, D, 4 control donors).
Moreover, PAX6+ neural stem and progenitor cells from C9ORF72 FTD/ALS lines
displayed lower TDP-43 levels than controls, indicating this effect is relevant to patient
cells (Fig. 2.6E, F and Fig. 2.6H, I, 4 control and 3 C9ORF72 FTD/ALS donors). In
contrast to TDP-43 protein levels, AP(50)-GFP overexpression did not alter TARDBP
mRNA levels and C9ORF72 FTD/ALS neural stem and progenitor cells did not display
lower TARDBP expression than controls (Fig. 2.6J, K, 4 control and 3 C9ORF72 FTD/ALS
donors). This suggests that the reduction in TDP-43 occurred post-transcriptionally and
may result from the reduction in protein synthesis caused by poly(AP).
Since a previous study showed that TARDBP suppression impaired the
proliferation of neural stem cells in the mouse cortex, we wondered whether TDP-43
levels similarly modulated the behavior of human iPSC-derived cortical neural stem and
progenitor cells.
62
Indeed, administration of TARDBP ASOs at day 10 suppressed
26

TARDBP expression in control neural stem and progenitor cells and significantly reduced
the percentage of PAX6+ neural stem and progenitor cells after 5 days of culture in EGF
and FGF (Fig. 2.5O, P and Fig. 2.6G, 4 control donors). Together, these data indicate
that poly(AP) binds to ribosome maturation factor LRRC47, impairs LRRC47’s ability to
interact with the pre-40S ribosome, reduces protein synthesis, and lowers TDP-43 levels,
which is sufficient to restrict neural stem cell self-renewal.
27

Figure 2.5 Poly(AP) impairs neural stem cell maintenance through LRRC47 and TDP-43. (A)
Representative western blot image of endogenous LRRC47 co-immunoprecipitated with GFP or AP(50)-
GFP when immunoprecipitated from HEK293T cells using an anti-GFP antibody. Endogenous LRRC47
was detected using an anti-LRRC47 antibody. The GFP-transfected samples possessed a faint band at
~50 kDa that is consistent with a limited amount of dimerization of GFP, which can occur under physiological
conditions. (B) Quantification of western blot analysis of LRRC47 levels co-immunoprecipitated with GFP
or AP(50)-GFP using an anti-GFP antibody. Data are shown as the amount of LRRC47 co-
immunoprecipitated normalized to the amount of GFP immunoprecipitated for each sample. Data points for
each group consist of 3 independent transfections. LRRC47 levels were normalized to total protein for each
sample. Mean +/- s.e.m. Unpaired t-test. (C) Representative western blot image of endogenous RPS6 co-
immunoprecipitated with a LRRC47-FLAG-mCherry fusion protein in HEK293T cells overexpressing GFP
or AP(50)-GFP. Co-immunoprecipitation with FLAG-mCherry was used as a control for any potential
interaction between RPS6 and FLAG-mCherry. LRRC47 levels were detected using an anti-LRRC47
28

antibody and RPS6 levels were detected using an anti-RPS6 antibody. (D) Quantification of western blot
analysis of the RPS6 levels co-immunoprecipitated with LRRC47-FLAG-mCherry in HEK293T cells
overexpressing GFP or AP(50)-GFP. Co-immunoprecipitation with FLAG-mCherry was used as a control
for any potential interaction between RPS6 and FLAG-mCherry. Data points for each group consist of 3
independent transfections. Each independent differentiation was used as a data point. RPS6 levels were
normalized to total protein for each sample. Mean +/- s.e.m. One-way ANOVA. (E) Representative images
of homopropargylglycine-alexa fluor 594 (HPG) incorporation into control MACS-purified PSA-NCAM+ cells
after transduction with GFP or AP(50)-GFP lentiviruses and further culture for 5 days with EGF and FGF.
Scale bar = 10 um. (F) Quantification of homopropargylglycine (HPG)-alexa fluor 594 incorporation into
newly synthesized proteins in control MACS-purified PSA-NCAM+ cells after transduction with GFP or
AP(50)-GFP lentiviruses and further culture for 5 days with EGF and FGF. For each group, data points
consist of 2 independent differentiations from 4 different control lines. Each independent differentiation was
used as a data point. Mean +/- s.e.m. Unpaired t-test. Scale bar: 10 µm. (G, H) Representative
immunocytochemistry images (G) and quantification (H) of the percentage of PAX6+ cells in control line
cultures after MACS-purification of PSA-NCAM+ cells and treatment with scrambled or LRRC47-
suppressing ASOs at day 10 of neural differentiation, and 5 additional days of culture with EGF and FGF.
Mean +/- s.e.m. The data points for each group include 2 independent differentiations per line per condition
(4 control lines). Each independent differentiation was used as a data point. One-way ANOVA. Scale bars
= 25 um. (I, J) Representative immunocytochemistry images (I) and quantification (J) of the percentage of
PAX6+ cells in control or C9ORF72 FTD/ALS cultures after MACS-purification of PSA-NCAM+ cells and
transduction with mCherry- or LRRC47-mCherry-encoding lentiviruses at day 10 of neural differentiation,
and 5 additional days of culture with EGF and FGF. Mean +/- s.e.m. The data points for each group include
2 independent differentiations per line per condition (4 control and 3 C9ORF72 FTD/ALS lines). Each
independent differentiation was used as a data point. Unpaired t-test. Scale bars = 15 um. (K, L)
Representative immunocytochemistry images (K) and quantification (L) of the percentage of PAX6+ cells
in control line cultures after MACS-purification of PSA-NCAM+ cells and transduction with lentiviruses
encoding AP(50)-GFP and either LRRC47-mCherry, mCherry alone, or no additional lentivirus at day 10 of
neural differentiation, and 5 additional days of culture with EGF and FGF. The data points for each group
include 3 independent differentiations per line per condition (4 control lines). Each independent
differentiation was used as a data point. Mean +/- s.e.m. One-way ANOVA. Scale bars = 25 um. (M, N)
Representative immunocytochemistry images (M) and quantification (N) of nuclear TDP-43 levels in PAX6+
cells in control line cultures after MACS-purification of PSA-NCAM+ cells and transduction with lentiviruses
encoding GFP or AP(50)-GFP at day 10 of neural differentiation, and 5 additional days of culture with EGF
and FGF. The data points for each group include 3 independent differentiations per line per condition (4
control lines). Each independent differentiation was used as a data point. Mean +/- s.e.m. Unpaired t-test.
Scale bars = 20 um. (O, P) Representative immunocytochemistry images (O) and quantification of the
percentage of PAX6+ (P) in control line cultures after MACS-purification of PSA-NCAM+ cells and treatment
with a scrambled or TARDBP-suppressing ASO at day 10 of neural differentiation, and 5 additional days of
culture with EGF and FGF. The data points for each group include 3 independent differentiations per line
per condition (4 control lines). Each independent differentiation was used as a data point. Mean +/- s.e.m.
Unpaired t-test. Scale bars = 25 um.

29

Figure 2.6 The effects of AP(50)-GFP on LRRC47 and TDP-43. (A) Quantitative real-time PCR (qRT-
PCR) analysis of LRRC47 mRNA expression in day 15 control PSA-NCAM+ MACS-purified neural stem
and progenitor cells treated with scrambled or LRRC47 ASOs. Data points consist of 2 independent
differentiations of 4 different control lines. Each data point represents one independent differentiation. Mean
+/- s.e.m. One-way ANOVA. (B) Top 5 categories in the transcription factor loss-of-function (TF LOF)
analysis function in Enrichr that show the most similarity to the gene expression changes induced in day
15 PSA-NCAM+ MACS-purified neural stem and progenitor cells by AP(50)-GFP transduction. Input was
the differentially expressed gene list identified by DESeq2 when comparing bulk RNA-seq samples from 2
different control lines overexpressing GFP or AP(50)-GFP. Data were generated from 3 independent
differentiations per line per condition. (C, D) Western blot image (C) and quantification (D) of TDP-43 levels
(normalized to total protein) in day 15 control PSA-NCAM+ MACS-purified neural stem and progenitor cells
overexpressing GFP or AP(50)-GFP. Data points consist of 2 independent differentiations of 4 control lines.
Each data point represents one independent differentiation. Mean +/- s.e.m. Unpaired t-test. (E, F) Western
blot image (E) and quantification (F) of TDP-43 levels (normalized to total protein) in day 15 control PSA-
NCAM+ MACS-purified neural stem and progenitor cells derived from control or C9ORF72 FTD/ALS lines.
Data points consist of 2 independent differentiations of 4 control and 3 C9ORF72 FTD/ALS lines. Each data
point represents one independent differentiation. Mean +/- s.e.m. Unpaired t-test. (G) Quantitative real-
30

time PCR (qRT-PCR) analysis of relative TARDBP mRNA levels (normalized to ß-actin) in day 15 control
PSA-NCAM+ MACS-purified neural stem and progenitor cells treated with a scrambled or TARDBP ASO.
Data points consist of 2 independent differentiations of 4 different control lines. Each data point represents
one independent differentiation. Mean +/- s.e.m. One-way ANOVA. (H, I) Representative
immunocytochemistry images (H) and quantification (I) of nuclear TDP-43 levels in day 15 PSA-NCAM+
MACS-purified neural stem and progenitor cells from control and C9ORF72 FTD/ALS lines. Data points
consist of cultures from 4 different control lines and 3 different C9-FTD/ALS lines. Each data point
represents one independent differentiation. Mean +/- s.e.m. Unpaired t-test. Scale bar: 25 um. (J) TARDBP
gene counts from bulk RNA-seq data of control day 15 PSA-NCAM+ MACS-purified neural stem and
progenitor cells overexpressing either GFP or AP(50)-GFP. Data points consist of 3 independent
differentiations and 2 different control lines per condition. Each data point represents one independent
differentiation. Counts were normalized to the GFP condition. Mean +/- s.e.m. Unpaired t-test. (K) TARDBP
gene counts from bulk RNA-seq data of control and C9ORF72 FTD/ALS day 15 PSA-NCAM+ MACS-
purified neural stem and progenitor cells. Data points consist of 3 independent differentiations and 4
different control and 3 C9ORF72 FTD/ALS lines. Each data point represents one independent
differentiation. Counts were normalized to the control lines. Mean +/- s.e.m. Unpaired t-test.

2.4 C9ORF72 FTD/ALS neural stem cells exhibit DNA replication stalling and DNA
breaks
To further understand the mechanisms that impair C9ORF72 FTD/ALS neural
stem cell self-renewal, we examined their cell cycle dynamics. If C9ORF72 FTD/ALS
neural stem and progenitor cells simply exited the cell cycle prematurely and
differentiated into postmitotic neurons, we would have expected to observe a large
increase in the fraction of cells in the G0 phase of the cell cycle compared to control
cultures. However, we found that day 10 C9ORF72 FTD/ALS PSA-NCAM+ MACS-
purified cultures displayed a large increase in the fraction of cells in G2/M phase
compared to controls, suggesting that additional disease mechanisms might be involved
(Fig. 2.7A-C, 4 control and 3 C9ORF72 FTD/ALS donors). In certain contexts, DNA
repeat expansions can form secondary structures that stall local DNA replication forks
31

Figure 2.7. C9ORF72 FTD/ALS neural stem cells exhibit DNA replication stalling and DNA breaks.
(A) Representative images of cell cycle analysis using propidium iodide of control and C9ORF72 FTD/ALS
cells after MACS-purification of PSA-NCAM+ cells at day 10 of neural differentiation and 5 additional days
of culture with EGF and FGF. (B, C) Quantification of the percentage of control or C9ORF72 FTD/ALS cells
in G1/G0 phase (B) or G2/M phase (C) of the cell cycle after MACS-purification of PSA-NCAM+ cells at day
10 of neural differentiation and 5 additional days of culture with EGF and FGF. The data points for each
group include one differentiation per line for 4 control and 3 C9ORF72 FTD/ALS lines. Each independent
differentiation was used as a data point. Mean +/- s.e.m. Unpaired t-test. (D) Schematic diagram of qPCR
assay to determine DNA replication efficiency at upstream and downstream sites proximal (<100 bps) or
distal (150 kb) to the C9ORF72 repeat expansion. Cells were PSA-NCAM MACS-purified at day 10,
cultured for an additional 5 days in EGF and FGF, and harvested for qPCR analysis. Red rectangles
32

represent approximate forward and reverse qPCR primer binding regions for each proximal or distal site.
Two pairs of qPCR primers were tested for each proximal or distal site. (E) Quantification of qPCR analysis
to determine DNA replication efficiency at upstream and downstream genomic sites proximal (<100 bps) or
distal (150 kb) to the C9ORF72 repeat expansion. Two sets of PCR primers were used for each site. Data
points consist of 3 independent cultures per line per primer set for each genomic site. 4 control and 3
C9ORF72 FTD/ALS lines were used. Each independent differentiation was used as a data point. Mean +/-
s.e.m. One-way ANOVA. (F, G) Representative images (F) and quantification (G) of dCTP-biotin
incorporation into control or C9ORF72 FTD/ALS PSA-NCAM+ cells by terminal deoxynucleotidyl
transferase (TdT) as measured by streptavidin-alexa flour 594 intensity. Cells were PSA-NCAM MACS-
purified at day 10, cultured for an additional 5 days in EGF and FGF, and utilized for the TdT-dCTP-biotin
incorporation assay. Data points consist of 2 independent differentiations per line from 4 control and 3
C9ORF72 FTD/ALS lines. Each independent differentiation was used as a data point. Mean +/- s.e.m.
Unpaired t-test. Scale bars = 10 um

and elongate G2/M phase as a result.
63,64
Previous studies have shown that the
C9ORF72 hexanucleotide repeat expansion forms G-quadraplex structures and that a
short, 41-repeat C9ORF72 hexanucleotide repeat expansion caused replication fork
stalling on plasmid DNA.
65,66
However, no studies have examined the efficiency of DNA
replication at endogenous C9ORF72 repeat expansions. We reasoned that if DNA
replication stalled at the C9ORF72 repeat expansion, quantitative PCR (qPCR) would
detect less template DNA at genomic sites immediately flanking the repeat expansion
compared to further distances away that are synthesized by replication origins not
encumbered by the repeat region. Indeed, qPCR analysis showed that day 10 C9ORF72
FTD/ALS PSA-NCAM+ MACS-purified cultures possessed significantly less genomic
DNA within 5-100 bps flanking either side of the C9ORF72 repeat region compared to
controls (Fig. 2.7D, E). These data suggest that DNA replication at or through the
C9ORF72 repeat region is less efficient in C9ORF72 FTD/ALS neural stem cells than
controls.
Previous studies have shown that DPRs can increase the number of genomic DNA
strand breaks by inhibiting several forms of DNA repair.
67,68
The presence of unresolved
DNA strand breaks can trigger a DNA damage checkpoint that holds cells in G2/M phase
33

to enable DNA repair.
69
To detect the presence of free 3’-hydroxyls in genomic DNA,
which would indicate the presence of DNA strand breaks, we employed a terminal
deoxynucleotide transferase (TdT) assay in which TdT adds biotin-labeled dUTP to free
3’ ends in DNA.
70
Consistent with the notion that the C9ORF72 repeat expansion inhibits
DNA repair, day 10 C9ORF72 FTD/ALS PSA-NCAM+ MACS-purified cultures
incorporated significantly higher levels of labeled dUTP compared to controls (Fig. 4F,
G). The diffuse fluorescence pattern of the incorporated dUTP throughout the nucleus
suggested the DNA breaks were present in many sites across the genome rather than
just in the repeat expansion region, which is consistent with inhibition of DNA repair
pathways (Fig. 2.7F). Together, these data suggest that in addition to displaying lower
levels of protein synthesis and TDP-43, C9ORF72 FTD/ALS neural stem cells exhibit
DNA replication stalling and increased DNA strand breaks and accumulate in G2/M phase
of the cell cycle.

Chapter 3: Effects of the C9ORF72 Repeat Expansion In Vivo
3.1 The C9ORF72 repeat expansion reduces thalamic and cortical size in
embryonic mice
C9ORF72 repeat expansion carriers display reduced thalamic and cortical
volumes many years or even decades before the average age of disease onset.
43-45
Since
our in vitro experiments indicated that patient-derived neural stem and progenitor cells
display limited self-renewal capacity, we wondered whether the C9ORF72 repeat
expansion impairs neurodevelopment in vivo. To determine this, we examined transgenic
mice harboring a bacterial artificial chromosome (BAC) containing a patient-derived
34

C9ORF72 repeat expansion.
71.72
Although the extent of neurodegenerative phenotypes
in these mice has varied in different colonies, multiple studies have confirmed the
presence of DPRs and the repeat expansion, the two key drivers of impaired neural stem
cell self-renewal in our study.
71-73
To assess the presence of DPRs in developing
C9ORF72-BAC embryos, we performed immunohistochemical analysis on tissue from
embryonic day 9.5-11.5 (E9.5-11.5) mice using knockout- or previously-validated DPR
antibodies.
41, 55-58
Since human imaging studies indicated that cortical and thalamic
regions showed some of the largest reductions in brain volume in presymptomatic
C9ORF72 repeat expansion carriers, we examined DPR levels in the cortex and thalamus
and using PAX6 and OLIG2 to identify cortical and thalamic neural progenitor cells,
respectively.
74,75
This analysis confirmed the presence of poly(AP)+, poly(GR)+, and
poly(PR)+ punctae in cortical and thalamic progenitor cells in C9ORF72-BAC embryos
but not controls (Fig. 3.1A-F and Fig. 3.2A-F)). Similar to our in vitro findings and
published work, while poly(AP) formed some punctae, its staining pattern was more
diffuse than poly(GR) and poly(PR).
58
Thus, cortical and thalamic neural progenitor cells
in C9ORF72-BAC mice possess DPRs.
We next examined E18.5 embryos to investigate any developmental differences
induced by the C9ORF72 repeat expansion. E18.5 C9ORF72-BAC embryos weighed
about 5-10% less than non-transgenic controls, suggesting that the repeat expansion
impacted development beyond the nervous system (Fig. 3.2G). This is consistent with the
multi-tissue expression pattern of C9ORF72 (proteinatlas.org). Magnetic resonance
imaging showed that when normalized to body weight, there was no difference in total
brain volume between C9ORF72-BAC and control embryos (Fig. 3.1G, H). However, we
35

observed a 50% reduction in thalamic volume relative to total brain volume in C9ORF72-
BAC embryos (Fig. 3.1G, I). Immunohistochemical analysis of the thalamus confirmed
these findings and showed a similar 50% decrease in thalamic size in C9ORF72-BAC
embryos (Fig. 3.1J, K). In addition, assessment of the mid-rostral neocortex by
immunohistochemistry and magnetic resonance imaging indicated that cortical thickness
relative to total brain area was reduced by about 20% in C9ORF72-BAC embryos (Fig.
3.1L, M and Fig. 3.2H, I). These results bear a striking resemblance to the pronounced
reductions in thalamic and cortical volumes observed in presymptomatic C9ORF72
repeat expansion carriers and suggest that the reduced brain volume observed in
presymptomatic carriers may result from impaired neurodevelopment.
43-45
36

37

Figure 3.1. The C9ORF72 repeat expansion reduces thalamic and cortical size in embryonic mice.
(A, B) Representative immunocytochemistry images (A) and quantification (B) of the number of poly(AP)+
punctae in PAX6+ cortical progenitor cells in E9.5 control or C9ORF72-BAC embryos. Data points consist
of the average number of poly(AP)+ punctae per progenitor cell in 3 control and 3 C9ORF72-BAC embryos.
Outlines depict PAX6+ cells and the arrows point towards poly(AP) punctae. Each data point represents
one embryo. Approximately 20 progenitor cells were quantified per embryo. Mean +/- s.e.m. Unpaired t-
test. Scale bars = 15 um. (C, D) Representative immunocytochemistry images (C) and quantification (D) of
the number of poly(GR)+ punctae in PAX6+ cortical progenitor cells in E9.5 control or C9ORF72-BAC
embryos. Outlines depict PAX6+ cells and the arrows point towards poly(GR) punctae. Data points consist
of the average number of poly(GR)+ punctae per progenitor cell in 3 control and 3 C9ORF72-BAC embryos.
Approximately 20 progenitor cells were quantified per embryo. Mean +/- s.e.m. Unpaired t-test. Scale bars
= 15 um. (E, F) Representative immunocytochemistry images (E) and quantification (F) of the number of
poly(PR)+ punctae in PAX6+ cortical progenitor cells in E9.5 control or C9ORF72-BAC embryos. Outlines
depict PAX6+ cells and the arrows point towards poly(PR) punctae. Data points consist of the average
number of poly(PR)+ punctae per progenitor cell in 3 control and 3 C9ORF72-BAC embryos. Each data
point represents one embryo. Approximately 20 progenitor cells were quantified per embryo. Mean +/-
s.e.m. Unpaired t-test. Scale bars = 15 um. (G) Representative 3D renderings of magnetic resonance
imaging of E18.5 control and C9ORF72-BAC embryos showing total brain and thalamic volume. The brains
are oriented from a ventral perspective with the olfactory bulbs on the left. Purple outlines the brain and the
thalamic regions are colored green. Scale bars = 1 mm. (H) Quantification of total brain volume normalized
to body weight for E18.5 control and C9ORF72-BAC embryos. Magnetic resonance imaging was used for
quantification. Each data point represents the relative ratio of total brain volume normalized to body weight
for one embryo (n=6 control and 11 C9ORF72-BAC embryos). Mean +/- s.e.m. Unpaired t-test. (I)
Quantification of thalamic volume normalized to total brain volume for E18.5 control and C9ORF72-BAC
embryos. Magnetic resonance imaging was used for quantification. Each data point represents the relative
ratio of thalamic brain volume to total brain volume for one embryo (n=6 control and 6 C9ORF72-BAC
embryos). Mean +/- s.e.m. Unpaired t-test. (J, K) Representative images (J) and quantification (K) of relative
thalamic area in E18.5 control and C9ORF72-BAC embryos using immunohistochemistry. Data points
represent the relative ratio of thalamic area in 3 control and 3 C9ORF72-BAC embryos. Each data point
represents one embryo. The average area of the thalamus was determined starting at the appearance of
the hippocampus followed by an additional 3 sections at 28 um each for a total of 4 sections per embryo.
Mean +/- s.e.m. Unpaired t-test. Scale bars = 1 mm. (L, M) Representative images (L) and quantification
(M) of relative cortical thickness in E18.5 control and C9ORF72-BAC embryos using immunohistochemistry.
Data points represent the relative ratio of cortical thickness in one embryo for 3 control and 3 C9ORF72-
BAC embryos. The average cortical thickness for each embryo was determined from 10 evenly spaced line
measurements ranging from layer 1 to layer 6 across 3 different 28 um sections. Mean +/- s.e.m. Unpaired
t-test. Scale bars = 1 mm.

3.2 Reducing brain volume triggers symptom onset in C9ORF72-BAC mice
Given the repeat expansion-driven neurodevelopmental changes we observed, we
wondered whether impaired neurodevelopment reduces the ability of the nervous system
to cope with neurodegenerative processes caused by the C9ORF72 repeat expansion.
To investigate this, we used a vasoactive intestinal peptide (VIP) antagonist during
gestation to impair neurodevelopment in control and C9ORF72-BAC mice. During
38

pregnancy, VIP is secreted from maternal lymphocytes, crosses the placental barrier, and
exerts a major growth effect on the central nervous system.
76
Intraperitoneal injection of
pregnant mice with a peptide VIP antagonist containing only the receptor-binding portion
of VIP but not the signaling component can block VIP signaling in developing
embryos.
77,78
VIP antagonist treatment during neurogenesis from E9.5-E11.5 disrupts
neuroepithelial progenitor proliferation and promotes cell cycle exit and precocious
neuronal differentiation.
78
In resulting progeny, this treatment reduces cortical thickness
by about 20-40% while preserving cortical structure and cell type composition.
78
In
contrast to their reduced cortical thickness, VIP antagonist-treated neonates have normal
body weight.
78
Therefore, VIP antagonist treatment from E9.5-E11.5 provides a tool for
modifying neurodevelopmental trajectory and determining how this affects the timing of
C9ORF72 disease onset in vivo.
To examine the effect of impairing neurodevelopment on disease phenotypes in
C9ORF72-BAC mice, we treated pregnant dams with vehicle or VIP antagonist from E9.5-
E11.5. Consistent with published results, mice exposed to the VIP antagonist displayed
a ~10% reduction in brain mass (Fig. 3.3A, B).
78
Immunohistochemical analysis confirmed
that VIP antagonist treatment reduced cortical thickness by 30-40% in both control and
C9ORF72-BAC embryos at E18.5 (Fig. 3.3C, D). Since C9ORF72-BAC embryos already
possessed thinner cortices due to the repeat expansion, in utero VIP antagonist treatment
of these embryos resulted in severely reduced cortical thicknesses (Fig. 3.3, D). Although
this reduction was beyond that caused by the repeat expansion alone, it nevertheless
allowed us to determine how the severity of neurodevelopmental impairment affects
symptom onset. To assess this, we measured motor function by hanging wire and open
39

Figure 3.2. Assessment of DPR pathology in thalamic progenitor cells, the effects of the C9ORF72
repeat expansion on embryonic body weight, and MRI analysis of cortex. (A, B) Representative
immunocytochemistry images (A) and quantification (B) of the number of poly(AP)+ punctae in OLIG2+
thalamic progenitor cells in E9.5 control or C9ORF72-BAC embryos. Data points consist of the average
number of poly(AP)+ punctae per progenitor cell in 3 control and 3 C9ORF72-BAC embryos. Outlines depict
OLIG2+ cells and the arrows point towards poly(AP) punctae. Each data point represents one embryo.
Approximately 20 progenitor cells were quantified per embryo. Mean +/- s.e.m. Unpaired t-test. Scale bars
= 15 um. (C, D) Representative immunocytochemistry images (C) and quantification (D) of the number of
poly(GR)+ punctae in OLIG2+ thalamic progenitor cells in E9.5 control or C9ORF72-BAC embryos. Outlines
depict OLIG2+ cells and the arrows point towards poly(GR) punctae. Data points consist of the average
number of poly(GR)+ punctae per progenitor cell in 3 control and 3 C9ORF72-BAC embryos. Each data
40

point represents one embryo. Approximately 20 progenitor cells were quantified per embryo. Mean +/-
s.e.m. Unpaired t-test. Scale bars = 15 um. (E, F) Representative immunocytochemistry images (E) and
quantification (F) of the number of poly(PR)+ punctae in OLIG2+ thalamic progenitor cells in E9.5 control
or C9ORF72-BAC embryos. Outlines depict OLIG2+ cells and the arrows point towards poly(PR) punctae.
Data points consist of the average number of poly(PR)+ punctae per progenitor cell in 3 control and 3
C9ORF72-BAC embryos. Each data point represents one embryo. Approximately 20 progenitor cells were
quantified per embryo. Mean +/- s.e.m. Unpaired t-test. Scale bars = 15 um. (G) Quantification of average
body weight of E18.5 control and C9ORF72-BAC embryos. Data points consist of 32 control and 41
C9ORF72-BAC embryos. Each data point represents one embryo. Mean +/- s.e.m. Unpaired t-test. (H)
Magnetic resonance imaging showing cortical area (outlined in red) in E18.5 control and C9ORF72-BAC
embryos (coronal view). Scale bars = 3 mm. (I) Quantification of cortical thickness normalized to total brain
volume in E18.5 WT and C9ORF72-BAC embryos. Quantification was derived from magnetic resonance
imaging. Each data point represents the relative ratio of cortical thickness to total brain volume for one
embryo (n=9 control and 15 C9ORF72-BAC embryos). Mean +/- s.e.m. Unpaired t-test.

field tests at 2 months of age. No published studies have observed motor dysfunction in
C9ORF72-BAC mice at this young age.
71-73
Consistent with these studies, vehicle-treated
2 month-old C9ORF72-BAC mice showed no motor dysfunction compared to vehicle-
treated controls (Fig. 3.3E, F). In contrast, VIP antagonist-treated C9ORF72-BAC mice
displayed a markedly shorter latency to fall in the hanging wire test and a significantly
shorter distance traveled in a timed open field test compared to vehicle-treated
C9ORF72-BAC mice (Fig. 3.3E, F). VIP antagonist-treated control mice showed no
differences from vehicle-treated controls in these experiments (Fig. 3.3E, F). These
experiments nevertheless suggest that increasing the severity of neurodevelopmental
impairment increases the penetrance of the C9ORF72 repeat expansion or accelerates
symptom onset in vivo.

41

42

Figure 3.3. Reducing brain volume triggers symptom onset in C9ORF72-BAC mice. (A)
Representative images of brains of 2-month-old mice exposed to vehicle or 2 ug/g VIP antagonist from
E9.5-11.5. (B) Quantification of brain mass in 2-month-old mice that were treated with either vehicle or VIP
antagonist from E9.5-11.5. Each data point represents the brain mass of one mouse (n=9 vehicle and n=8
VIP antagonist). Mean +/- s.e.m. Unpaired t-test. (C, D) Representative images (C) and quantification (D)
of cortical thickness in E18.5 control and C9ORF72-BAC embryos treated with either vehicle or 2 ug/g VIP
antagonist using immunohistochemistry. Each data point represents the average cortical thickness in one
embryo (n=3 control and 3 C9ORF72-BAC embryos). The average cortical thickness for each embryo was
determined from 10 evenly spaced line measurements ranging from layer 1 to layer 6 across 3 different 28
um sections. Mean +/- s.e.m. One-way ANOVA. Scale bars = 1 mm. (E) Quantification of time to fall in a
hanging wire test for 2-month-old control and C9ORF72-BAC mice treated with vehicle or VIP antagonist
from E9.5-11.5. Each data point represents the average time to fall for one mouse (control + vehicle (n=11
mice), control + VIP antagonist (n=10 mice), C9ORF72-BAC + vehicle (n=10 mice), C9ORF72-BAC + VIP
antagonist (n=16 mice)). Mean +/- s.e.m. Kruskal-Wallis test. (F) Quantification of total distance traveled
during an open field test for 2-month-old control and C9ORF72-BAC mice treated with vehicle or VIP
antagonist from E9.5-11.5. Each data point represents the total distance traveled for one mouse (control +
vehicle (n=11 mice), control + VIP antagonist (n=10 mice), C9ORF72-BAC + vehicle (n=10 mice),
C9ORF72-BAC + VIP antagonist (n=16 mice)). Mean +/- s.e.m. Two-way ANOVA.

43

Chapter 4: Conclusions

4.1 Discussion
Our data indicate that the C9ORF72 repeat expansion impairs neurodevelopment in
mice and human stem cell cultures. Embryonic C9ORF72-BAC mice displayed large
reductions in thalamic size and cortical thickness, which bears striking resemblance to
published observations in presymptomatic human C9ORF72 repeat expansion carriers.
43-
46
The magnitude of thalamic and cortical size reductions we observed in embryonic
C9ORF72-BAC mice are consistent with the possibility that neurodevelopmental changes
could explain why C9ORF72 repeat expansion carriers display reduced thalamic and
cortical volumes decades before disease onset.
Surprisingly, our data indicate that poly(AP), a DPR not known to affect
neurodegeneration, plays a key role in restricting neural stem and progenitor cell self-
renewal. Our investigation uncovered a novel interaction between poly(AP) and ribosomal
maturation factor LRRC47. Poly(AP) significantly reduced the ability of LRRC47 to
interact with the 40S ribosome protein RPS6 and lowered total protein synthesis rates in
neural stem and progenitor cell cultures. Reducing LRRC47 in control neural stem and
progenitor cells impaired self-renewal and overexpressing LRRC47 increased self-
renewal when poly(AP) was ectopically expressed and in C9ORF72 FTD/ALS neural
stem and progenitor cells. One potential mechanism to explain these findings is that
poly(AP) reduced TDP-43 levels in neural stem and progenitor cells and C9ORF72
FTD/ALS cultures also showed lowering of TDP-43. Our findings are consistent with
changes in the translation of TDP-43 since TARDBP mRNA levels were not altered by
44

poly(AP) or in C9ORF72 FTD/ALS neural stem and progenitor cells, although we cannot
rule out changes in TDP-43 stability. Nevertheless, forced reduction of TDP-43 levels by
ASO treatment recapitulated the impaired neural stem cell self-renewal, confirming the
significance of lowered TDP-43 levels in these cells. In contrast, poly(AP) does not cause
overt neurotoxicity in neurons.
37
We surmise this may be because lowering TDP-43 could
help mitigate TDP-43 gain-of-function toxicity and TDP-43 pathology. This would be
consistent with model systems such as TAR4/4 mice in which overexpression of TDP-43
drives TDP-43 pathology and neurodegeneration.
79
Altogether, these results
demonstrated that poly(AP)’s effect on LRRC47 function greatly impacts neural stem cell
self-renewal.
Inspection of cell cycle dynamics showed that the C9ORF72 repeat expansion caused
a striking accumulation of neural stem and progenitor cells in G2/M phase. Consistent
with these findings, C9ORF72 FTD/ALS cultures displayed inefficient DNA replication
within 100 base pairs of the repeat expansion, whereas the copying of regions 150
kilobases away that would be synthesized by different replication forks were unaltered. In
addition, C9ORF72 FTD/ALS neural stem and progenitor cells displayed a large increase
in free 3’ ends throughout the nucleus, suggesting they harbored elevated levels of DNA
damage throughout the genome. These factors likely combine with DPR mechanisms to
further impair C9ORF72 FTD/ALS neural stem cell self-renewal.
Importantly, our VIP antagonist experiments in mice indicate that increasing the extent
of neurodevelopmental impairment can greatly accelerate the emergence of ALS-like
symptoms caused by the C9ORF72 repeat expansion in vivo. This may have significant
implications for our understanding of disease onset in C9ORF72 repeat expansion
45

carriers. The penetrance of the C9ORF72 repeat expansion is incomplete and age of
disease onset varies widely, ranging from 40-90 years of age.
80
The reasons for the
incomplete penetrance and varied disease onset are unclear, but the reductions in brain
volume in presymptomatic C9ORF72 repeat expansion carriers are also
heterogeneous.
43-46
Our results suggest that repeat expansion carriers with greater
developmental reductions in thalamic or cortical volume may be more susceptible to
disease onset and likely to display symptoms earlier in life. Confirming such a link
between presymptomatic brain volume and disease onset will require further study, but if
substantiated, it could greatly improve our ability to predict disease onset and treat
C9ORF72 carriers at early stages of disease.
46

Appendix I: Materials and Methods
Statistical analysis
Statistical analyses were performed using Prism Origin (GraphPad software). A test of
normality was conducted for each experiment to determine whether parametric or non-
parametric should be used. Differences between two groups were analyzed with either
an unpaired t-test for parametric data or a Mann-Whitney test for non-parametric data.
Differences between more than two groups were analyzed with a one-way ANOVA with
Tukey correction for post hoc analyses. Significance was determined at p < 0.05. Error
bars represent the standard error of the mean.

CRISPR/Cas9 genome editing of iPSCs
CRISPR/Cas9-mediated genome editing was performed in human iPSCs as previously
described (49). To generate isogenic control iPSCs by removing the repeat expansion,
single guide RNAs (sgRNAs) targeting both sides of the C9ORF72 intronic
hexanucleotide repeat expansion were designed (Table S2, http://crispr.mit.edu) and
cloned into an empty gRNA cloning vector (Addgene ID: 31824). The donor plasmid for
homologous recombination was generated by PCR-amplifying left and right homology
arms (588 bp and 1149 bp, respectively) from control genomic DNA into the pUC19 vector
with an added puror cassette. 2 x 106 C9ORF72 ALS/FTD line 1 iPSCs were transfected
with human codon-optimized Cas9 (Addgene ID: 31825), the appropriate gRNA
constructs by nucleofection (Lonza) according to the manufacturer’s protocol, and the
homologous recombination donor vector. The cells were replated on wells precoated with
Geltrex (Life Technologies) in mTeSR1 medium supplemented with 10 µm Y-27632
(Selleck). Y-27632 was removed on the next day followed by puromycin selection (7.5
47

ug/ml) for 48 h. On day 7 after transfection, the surviving colonies were manually picked
and genotyped by sequencing the targeted genomic site. Colonies showing removal of
the repeat expansion were clonally purified by plating 1000 iPSCs on a 10-cm dish of
irradiated MEF feeders in human ESC medium (DMEM/F12, 20% knockout serum
replacement, 1% non-essential amino acids, 1% Glutamax, 1X penicillin/streptomycin (all
Life Technologies), 0.1% beta mercaptoethanol (Sigma), and 10 ng/ml bFGF
(Peprotech)) and re-picking of the resulting colonies. Normalization of C9ORF72 was
verified by southern blotting.
C9ORF72 Southern Blotting
A 241-bp digoxigenin (DIG)-labeled probe was generated from 100 ng control genomic
DNA (gDNA) by PCR reaction using Q5® High-Fidelity DNA Polymerase (NEB) with
primers shown in Table S2. Genomic DNA was harvested from control and patient iPSCs
using cell lysis buffer (100 mM Tris-HCl pH 8.0, 50 mM EDTA, 1% w/v sodium dodecyl
sulfate (SDS)) at 55ºC overnight and performing phenol:chloroform extraction. A total of
25 µg of gDNA was digested with AflII at 37 ºC overnight, run on a 0.8% agarose gel,
then transferred to a positive charged nylon membrane (Roche) using suction by vacuum
and UV-crosslinked at 120 mJ. The membrane was pre-hybridized in 25 ml DIG EasyHyb
solution (Roche) for 3 h at 47 ºC then hybridized at 47 ºC overnight in a shaking incubator,
followed by two 5-min washes each in 2X Standard Sodium Citrate (SSC) and in 0.1%
SDS at room temperature, and two 15-min washes in 0.1x SSC and in 0.1% SDS at 68
ºC. Detection of the hybridized probe DNA was carried out as described in DIG System
User’s Guide. CDP-Star® Chemilumnescent Substrate (Sigma-Aldrich) was used for
48

detection and the signal was developed on X-ray film (Genesee Scientific) after 20 to 40
min.
Repeat Primed PCR (RP-PCR)
To provide a quantitative measure of the (GGGGCC)n hexanuceotide expansion in
C9ORF72, 20 ng/µl of genomic DNA was isolated with a DNeasy blood & tissue kit
(Qiagen, cat. no. 69504) and amplified by PCR in a 20-µl PCR reaction consisting of 1
µM primer 1 (FAM-tgtaaaacgacggccagtCAAGGAGGGAAACAACCGCAGCC), 1 µM
primer 2
(caggaaacagctatgaccGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGG), 1
µM primer 3 (caggaaacagctatgacc), 1x Qiagen buffer (Qiagen, cat. no. 201203), 2.5 units
Taq polymerase (Qiagen, cat. no. 201203), 0.25 mM dCTP, 0.25 mM dATP, 0.25 mM
dTTP, 0.25 mM 7-deaza-2-deoxy GTP (NEB, cat. no. N0445S), 5% DMSO, 1 M betaine
(Sigma, cat. no. B0300-1VL). The PCR protocol was as follows: [98°C 10 min], 1 cycle;
[97°C 35 sec, 64°C 2 min, 68°C 8 min], 10 cycles; [97°C 35 sec, 64°C 2 min, 68°C 8-16
min], 25 cycles with an additional 20 sec added to the extension step each cycle. The
PCR products were directly analyzed using an ABI3730 DNA Analyzer and Peak
Scanner™ Software v1.0 (Life Technologies).
Conversion of iPSCs to neural stem and progenitor cells
iPSCs were initially seeded in mTesr1 with the addition of rock inhibitor (Selleckchem,
cat. no. S1049) on 6-well plates (7 x 105 cells/well) that were coated with geltrex (1:100
dilution) for 1 h at 37°C (day 0). Directed differentiation began when the cells reached
85% confluency by performing a half media change with a knockout serum replacement
49

media containing DMEM/F12 (Thermo Fisher Scientific, cat. no. 11320033), 15% KOSR
(Thermo Fisher Scientific, cat. no. 10828028), 1x NEAA (Thermo, cat. no. 11140050), 1x
glutamax (Thermo, cat. no. 35050061), 10 µM SB 431542 (Cayman chemical, cat. no.
13031), and 100 nM LDN-193189 (Cayman chemical, cat. no. 11802). A full media
change with the knockout serum replacement media described above was performed on
day 3 and day 4. On day 5 and day 6, the media was switched to an N2 media containing
DMEM/F12, 1x NEAA, 1x glutamax, 1x N2 supplement (Thermo Fisher, cat no. 17502-
048), 10 µM SB 431542, and 100 nM LDN-193189. A media change using N2 media
without the dual SMAD inhibitors (SB 431542 and LDN-193189) was performed on days
7-9. Cells were passaged with accutase (Thermo, cat. no. A1110501) and PSA-NCAM
MACS purified on day 10 or 15 and were maintained with daily media changes containing
DMEM/F12, 1x B27 supplement (Thermo Fisher, cat no. 17504044), 1x N2 supplement,
1x NEAA, 1x Glutamax, 10 ng/ml EGF (R&D Systems, cat. no. 236-EG-200), and 10
ng/ml FGF (R&D Systems, cat. no. 3718-FB-025).
Magnetic-activated cell sorting of PSA-NCAM+ neural stem and progenitor cells
Day 10 neural stem cell cultures were passaged with accutase and centrifuged for 5 min
at 1000 rpm in DMEM. The supernatant was removed, and the cell pellets were
resuspended (100 µl per 10 x 106 cells) in staining media containing 1% BSA in PBS and
incubated on ice for 10 min. After this initial incubation, 20 µl of anti-PSA-NCAM magnetic
microbeads (Miltenyi, cat. no. 130-092-966) were added to the suspension and incubated
on ice for 15 min. The suspension was washed with 3 ml of staining media and centrifuged
at 1000 rpm for 5 min. The supernatant was removed, and the cell pellet was resuspended
in 500 µl of staining media. LS columns (Miltenyi, cat. no. 130-042-401) were placed on
50

a MACS multi-stand (Miltenyi, cat. no. 130-042-303) and equilibrated with 3 ml of staining
media. After equilibration, the 500 µl cell suspension was added to the column and
washed 3 times with 3 ml of staining media by gravity filtration. Next, the LS column was
removed from the MACS multi-stand, 7 ml of staining media was added to the column,
and the PSA-NCAM+ cells were plunged into a clean 15 ml conical tube. The suspension
was centrifuged at 1000 rpm for 5 min and resuspended in neural stem cell maintenance
media containing rock inhibitor.
Immunocytochemistry
Cells were fixed in 4% paraformaldehyde (PFA) for 30 min at room temperature,
permeabilized with 0.5% PBS-triton x-100 for 15 min at room temperature, blocked with
10% FBS in 0.1% PBS-T at room temperature for 1 h, and incubated with primary
antibodies at 4 ºC overnight. Cells were then washed with 0.1% PBS-T and incubated
with Alexa Fluor® secondary antibodies (Life Technologies, 1:500) in blocking buffer for
1 h at room temperature. To visualize nuclei, cells were stained with DAPI (Invitrogen,
1:1000) then mounted on slides with Vectashield® (Vector Labs). Images were acquired
on an LSM 800 confocal microscope (Zeiss). The following primary antibodies were used:
mouse anti-PAX6 (Thermo Fisher Scientific, cat. No. MA1-109, 1:500), rabbit anti-KI67
(GeneTex, cat no. GTX16667, 1:500), chicken anti-MAP2 (Abcam, cat. No. ab5392,
1:1000), rabbit anti-caspase 3 (Abcam, cat. no. ab13847, 1:500) rabbit anti-PolyAP
(Proteintech, cat. no. 24493-1-AP, 1:500), rabbit anti-PolyPR (Proteintech, cat. no.
23979-1-AP, 1:500), rabbit anti-PolyGR (Proteintech, cat. no. 23978-1-AP, 1:500), rabbit
anti-TDP43 (Proteintech, cat. no. 10782-2-AP, 1:500).
Quantification of PAX6 and KI67 immunocytochemistry
51

A batch processing script in ImageJ was used to automate the detection of DAPI, PAX6,
and KI67 to determine percentages of positive cells. The brightness and contrast were
optimized using a control line and then utilized to process all samples. The script code is
available upon request.
Quantification of rosette formation
Day 10 MACS-purified neural stem and progenitor cells were seeded at a density of
30,000 cells per well of a 96-well plate and cultured for an additional 5 days in the
presence of 10 ng/ml EGF and FGF. The cells were fixed with 4% PFA for 30 min at room
temperature and stained with a mouse anti-PAX6 (Thermo Fisher Scientific, cat. No.
MA1-109, 1:500) following our immunocytochemistry protocol listed above. Samples
were imaged using a Molecular Device Imagexpress at 10x magnification. Rosettes were
manually identified based on a apicobasal polarity cytoarchitectural organization of PAX6.
Production of lentiviruses
HEK293T cells were transfected at 80–90% confluency with viral vectors containing
mCherry (Genecopoeia, cat. no. EX-NEG-Lv216), LRRC47-mCherry (Genecopoeia, cat.
no. EX-T4416-Lv216), GFP, GA(50)-GFP, GP(50)-GFP, PR(50)-GFP, GR(50)-GFP
AP(50)-GFP (GFP-containing constructs were gifted from the Trotti Laboratory); and viral
packaging plasmids pPAX2 and VSVG using polyethylenimine (PEI)(Sigma-Aldrich). The
medium was changed 24 h after transfection. Viruses were harvested at 48 h and 72 h
after transfection. Viral supernatants were filtered with 0.45 µM filters, incubated with
Lenti-X concentrator (Clontech) for 24 h at 4 ºC, and centrifuged at 1,500 x g at 4ºC for
45 min. The pellets were resuspended in 100 µl of DMEM and stored at −80 ºC.
52

Bulk RNA sequencing
Day 10 PSA-NCAM+ MACS-purified cells (5 x 105) were lysed in RLT buffer (Qiagen,
cat. no. 79216) and sent to Amaryllis Nucleics for library preparation and sequencing. All
FASTQ files were analyzed by Ji Informatics using FastQC (version 0.11.5) and aligned
using the HISAT2 (v2-2.1.0). The resulting transcripts were tested for differential
expression using DEseq2 (version 1.18.1). Pathway enrichment analysis was performed
using Enrichr.
AP(50)-GFP and GFP co-immunoprecipitation with endogenous LRRC47
HEK293T cells were transfected with GFP and AP(50)-GFP lentiviral constructs in 10 cm
dishes according to our transfection protocol described above. Cells were lysed in 500 ul
of ice-cold Pierce IP lysis buffer (ThermoFisher, cat. no. 87787) containing 1x protease
inhibitor cocktail (Sigma, cat. no. 4693132001) 5 days post-transfection. Lysates were
incubated on ice for 1 h with periodic mixing by inversion and subsequently centrifuged
at 14,000 g for 15 min at 4°C. The resulting supernatants were transferred to new
Eppendorf tubes and the co-IP was performed following the manufacturers protocol for
the SDS elution using the GFP-trap magnetic particles M-270 kit (Chromotek, cat. no.
gtdk-20). Briefly, 200 µl of cell lysate was diluted with 300 µl of the provided dilution buffer
and 25 µl of equilibrated GFP-trap magnetic beads was added. The solution was
incubated overnight at 4°C with end-over-end rotation. Next, the beads were washed
three times with the provided wash buffer, resuspended in 80 µl of 2x SDS-sample buffer,
boiled for 5 min at 95°C, and analyzed via Western Blot using anti-GFP (Aves, cat. no.
GFP-1010, 1:1000) and anti-LRRC47 antibodies rabbit anti-LRRC47 (Proteintech, cat.
53

no. 23217-1-AP, 1:500). LRRC47 protein detected was endogenous LRRC47. Images
were acquired using a LI-COR Odyssey CLx.
Co-immunoprecipitation of LRRC47-FLAG-mCherry and endogenous RPS6
HEK293T cells plated in 10 cm dishes were transfected with lentiviral DNA constructs
encoding an LRRC47-FLAG-mCherry fusion protein and GFP, LRRC47-FLAG-mCherry
and AP(50)-GFP, or FLAG-mCherry alone, and an untransfected sample group was also
included. Cells were lysed in 500 ul of ice-cold Pierce IP lysis buffer (ThermoFisher, cat.
no. 87787) containing 1x protease inhibitor cocktail (Sigma, cat. no. 4693132001) 5 days
post-transfection. Lysates were incubated on ice for 1 h with periodic mixing by inversion
and subsequently centrifuged at 14,000 g for 15 min at 4°C. The resulting supernatants
were transferred to new Eppendorf tubes. Since the LRRC47 lentiviral construct contains
a FLAG tag, anti-FLAG M2 magnetic beads (Sigma, cat. no. M8823) were used to
immunoprecipitate LRRC47-FLAG-mCherry or FLAG-mCherry to determine its
interaction with RPS6. First, 20 µl of beads were equilibrated by washing twice with 200
µl of 1x TBS on a magnetic stand. The entire sample lysate was added to the beads and
incubated overnight at 4°C with end-over-end rotation. After this incubation, the beads
were washed 3x with 500 µl of 1x TBS. The samples were eluted with 50 µl of 3x FLAG
peptide (150 ng/µl)(Sigma, cat. no. F4799). The samples were placed on a magnetic
stand after a 30 min incubation at room temperature with the 3x FLAG peptide and the
supernatants were transferred to clean Eppendorf tubes. Western blots were performed
with an anti-LRRC47 antibody (Proteintech, cat. no. 23217-1-AP, 1:500) to detect
LRRC47-FLAG-mCherry and an anti-RPS6 antibody (Thermofisher, cat. no. MA5-15123,
1:500) to detect endogenous RPS6.
54

Homopropargylglycine protein synthesis assay
Neural stem and progenitor cells overexpressing AP(50)-GFP or GFP alone were
assayed for protein synthesis 5 days post-infection using the manufacturers protocol for
the Click-iT™ HPG Alexa Fluor™ 594 protein synthesis assay kit (ThermoFisher, cat. no.
C10429). In short, the cells were cultured with L-homopropargylglycine (HPG) in neural
stem cell media devoid of L-methionine for 30 min at 37°C on coverslips. Cells were fixed
with 4% paraformaldehyde for 15 min at room temperature. Cells were washed twice with
3% BSA in PBS and permeabilized with 0.5% Triton® X-100 in PBS for 20 min at room
temperature. HPG signal was detected using Click-IT chemistry detected via Alexa
Fluor® 594 azide. Images were acquired using a Zeiss LSM800 confocal microscope.
Propidium iodide cell cycling assay
One confluent well of a 6-well plate for day 10 MACs purified healthy controls and C9-
FTD/ALS PSA-NCAM+ neural stem and progenitor cells were passaged and the cell
pellets were resuspended in ice-cold 70% ethanol added in a dropwise manner while
vortexing. The resulting suspension was incubated on ice for 30 min, washed twice with
2 ml of PBS, the pellet was resuspended in PBS containing 50 µg/ml of propidium iodide,
and incubated for 15 min on ice. The suspension was directly analyzed using an LSRII
and FlowJo.
Quantitative real time PCR
Total RNA was extracted from MACs purified PSA-NCAM+ neural stem and progenitor
cells at day 15 with an RNeasy plus mini kit (Qiagen, cat. no. 74136) and reverse
transcribed with an Oligo dT primer using ProtoScript II First Strand Synthesis Kit (NEB,
55

cat. no. 102855-124). RNA concentration and purity was checked using the NanoDrop
One (ThermoFisher). Real-time PCR was performed with iTaq Universal SYBR Green
Supermix (Bio-Rad) using primers shown in Table S2.
Antisense oligonucleotide (ASO) administration
Antisense oligonucleotides (ASOs) were synthesized by Integrated DNA Technologies.
A concentration of 9 µM was administered with treatment lasting 5 days for all ASO
experiments. Knockdown efficiency was determined by qRT-PCR. ASO sequences are
shown in Table S2.
Terminal deoxynucleotidyl transferase assay
Healthy control and C9-FTD/ALS MACs purified PSA-NCAM+ neural stem and progenitor
cells were seeded onto coverslips in a 24-well plate (5 x 105 cells per well). After 5-7
days, cells were fixed in 4% PFA for 30 min at room temperature. The cells were
permeabilized with 0.1% Triton x-100 for 10 min at room temperature, washed 3 times
with PBS, and treated with 10 µg/µl of RNase H (VWR) for 1 h at 37°C. The cells were
washed 3 times with PBS and incubated in 50 µl of terminal deoxynucleotidyl transferase
(TdT) buffer containing 5 ul TdT buffer (10x), 5 µl CoCl2 (2.5 mM), 0.5 µl dCTP-biotin (10
mM), 0.5 µl transferase (10 units), and 39 µl of distilled water for 1 h at 37°C. The cells
were washed 3 times with 0.1% PBS-T, blocked with 10% FBS in PBS-T for 1 h at room
temperature, and incubated with a streptavidin alexa fluor 594 conjugate for 1 h at room
temperature. To visualize nuclei, cells were stained with Hoechst (Invitrogen) then
mounted on slides with Vectashield® (Vector Labs). Images were acquired on an LSM
800 confocal microscope (Zeiss).
56

Mass spectrometry
A total of three 10 cm dishes of MACs purified PSA-NCAM+ neural stem and progenitor
cells from two healthy controls overexpressing AP(50)-GFP or GFP alone were lysed in
500 ul of ice-cold Pierce IP lysis buffer (ThermoFisher, cat. no. 87787) containing 1x
protease inhibitor cocktail (Sigma, cat. no. 4693132001) 5 days post-infection for each
condition. Lysates were incubated on ice for 1 h with periodic mixing by inversion and
subsequently centrifuged at 14,000 g for 15 min at 4°C. The resulting supernatants were
transferred to new Eppendorf tubes and GFP was pulled down using GFP-trap magnetic
particles M-270 kit (Chromotek, cat. no. gtdk-20). The entire 500 µl cell lysate for each
condition was used for the pulldown by adding 50 µl of equilibrated GFP-trap magnetic
beads to the lysates. The solution was incubated overnight at 4°C with end-over-end
rotation. Next, the beads were washed three times with the provided wash buffer,
resuspended in 80 µl of 2x SDS-sample buffer, boiled for 5 min at 95°C, and an in-gel
digestion was performed with trypsin. Standard desalting and peptide enrichment was
performed and the samples were run on a Thermo Easy nLC Q-Exactive at the Beckman
Institute Proteome Exploration Lab at Caltech (Pasadena, CA).
Western blot
MACs-sorted PSA-NCAM+ neural stem and progenitor cells from healthy controls and
C9-FTD/ALS patients were collected in RIPA buffer (Sigma-Aldrich) with a protease
inhibitor cocktail (Roche). Protein quantity was measured by the BCA assay (Pierce) and
samples were run on a 10% SDS gel at room temperature in with compatible loading
buffers for the LI-COR Odyssey CLx. The gel was transferred onto a nitrocellulose
membrane (VWR) via a semi-dry transfer. The membrane was blocked with intercept
57

blocking buffer (Licor, cat. no. 927-60010) for 1 h at room temperature, incubated with
primary antibodies overnight at 4 °C, washed three times with 0.1% PBS-T, then
incubated with the appropriate IRDye (Licor, 1:5000) for 1 h at room temperature. After
five washes with PBS, blots were visualized using a LI-COR Odyssey CLx. Sample
signals were normalized based on the revert 700 total protein stain (Licor). The following
primary antibodies were used: rabbit anti-TDP43 (Proteintech, cat. no. 10782-2-AP,
1:1000), rabbit anti-LRRC47 (Proteintech, cat. no. 23217-1-AP, 1:500), chicken anti-GFP
(Aves, cat. no. GFP-1010, 1:1000), rabbit anti-C9ORF72 (Proteintech, cat. no. 22637-1-
AP, 1:500), and ribosomal protein S6 (Thermofisher, cat. no. MA5-15123, 1:500).
Animal care and breeding
Wild-type FVB/NJ (strain: 001800) and FVB/NJ-Tg(C9orf72)500Lpwr/J (strain: 029099)
were purchased from Jackson Laboratories (The Jackson Laboratory, Bar Harbor, USA).
Mice were housed in standard conditions with food and water ad libitum in the
conventional vivarium at the University of Southern California. Heterozygous male mice
harboring the repeat expansion were used to breed with wild-type female mice. Mice were
genotyped following the standard PCR assay for Tg(C9ORF72*)500Lp on Jackson
Laboratory’s website (Protocol 30889; primers listed in table 2). All animal use and care
were in accordance with local institution guidelines of the University of Southern California
and the IACUC board of the University of Southern California (Los Angeles, USA) under
protocol number 11938.
E9.5 mouse embryo immunohistochemistry and quantification
58

Control pregnant dams crossed with male C9ORF72-BAC were identified based on
vaginal plugs (E0). The dams were euthanized 9.5 days after plug identification and the
embryos were extracted and fixed for 1 h in 4% PFA at 4°C. Cryoprotection occurred in
30% sucrose. After snap freezing, the tissue was sectioned by cryostat at 28 µm thickness
and stained with the following primary antibodies: Pax6 (Thermo Fisher Scientific, cat. no.
MA1-109, 1:100; Abcam, cat. no. ab78545, 1:100), Olig2 (R&D Systems, cat. no. AF2418,
1:100), Poly(AP) (Proteintech, cat. no. 24493-1-AP, 1:100), Poly(GR) (Proteintech, cat.
no. 23978-1-AP, 1:100), and Poly(PR) (Proteintech, cat. no. 23979-1-AP, 1:100). Images
were collected using a Zeiss LSM800 confocal microscope. Nuclear puncta of poly(AP),
poly(GR), and poly(PR) were quantified in Pax6 and Olig2+ cells in ImageJ.
VIP antagonist administration
Pregnant dams were identified by the presence of vaginal plugs, which was used to
calculate the timing of vasoactive intestinal peptide (VIP) receptor antagonist injections.
Pregnant dams were administered intraperitoneal (IP) injections of 2 ug/g body weight of
the VIP receptor antagonist compound (Tocris, cat. no. 3054) once a day at E9.5, E10.5,
and E11.5. The effect of VIP receptor antagonism on brain size was assessed at E18.5
and 2 months of age.
Magnetic resonance imaging of E18.5 embryos
E18.5 embryos were imaged using a 7 Tesla PET-MR system (MR Solutions Ltd.,
Guildford, UK) housed at the Zilkha Neurogenetic Institute Functional Biological Imaging
Core, with a bore size of ~24 cm, up to 600 mT/m maximum gradient, and a 20 mm
internal diameter quadrature birdcage coil. To increase our signal to noise ratio we
59

incubated the embryos in ProHance (10:1 vol/vol saline/Prohance) overnight prior to
imaging. A three dimensional (3D) T2-weighted Fast Spin Echo (FSE) sequence was
used with the following parameters: repetition time (TR) = 300 ms, echo time (TE) = 48
ms, field of view (FOV) = 18 mm x 18 mm x 18 mm, matrix size = 256 x 256 x 256,
isotropic voxel size = 70.3125 um, number of averages (NA) = 18, echo train length = 17,
and flip angle (FA) = 90. Total acquisition time was approximately 14 hours. We used
VivoQuant software to manually quantify the thalamus from coronal slices derived from
the 3D scan and an embryo atlas was used as a guide to verify thalamic specificity
(https://sectional-anatomy.org/mouse-embryo/). Approximately 12 sections of the total
brain scanned overlapped with the thalamus. Total brain volumes were acquired in a
similar manner for each embryo to normalize thalamic volume (thalamic volume/total
brain volume). The normalized values were then calculated to represent the relative
changes in volume compared to control embryos. 3D rendering of the images was
performed in Imaris.
E18.5 mouse embryo immunohistochemistry and quantification of thalamic area
and cortical thickness
Control pregnant dams crossed with male C9ORF72-BAC were identified based on
vaginal plugs (E0). The dams were euthanized 18.5 days after plug identification and the
embryos were extracted and fixed for 24 h in 4% PFA at 4°C. Cryoprotection occurred in
30% sucrose. After snap freezing, the tissue was sectioned by cryostat at 28 µm thickness
and stained with DAPI (Invitrogen, 1:1000) and Neurotrace (Thermo Fisher Scientific, cat.
no. N21480, 1:100) for 20 min at room temperature. Tissue sections were washed 5 times
with PBS and mounted using Vectashield. Images were taken using a Zeiss Axiozoom
60

microscope. Thalamic area was outlined in ImageJ from 4 sections per embryo beginning
with the emergence of the hippocampus and 3 subsequent sections 28 µm apart. These
values were averaged for each embryo in both genotypes and the values were
represented as the relative ratio. Cortical thickness was measured by extending a vertical
line in ImageJ from layer1 to layer 6 in 10 different regions along the mid-rostral neocortex
in 3 different sections per embryo. These values were averaged and represented as either
relative ratios (Figure 5) or raw values (Figure 6).
Open field test and hanging wire assay
At 2 months of age, VIP antagonist receptor treated and PBS treated mice for both control
and C9ORF72-BAC were placed in the designated behavioral room for 30 min prior to
the open field test in order to acclimate to the testing room environment. After acclimation,
mice were placed in a 44 cm x 44 cm x 30.5 cm clear plastic box and total distance was
tracked over 15 min via the Noldus Ethovision software. The open field boxes were
cleaned before and after each trial with 70% ethanol.
Motor function was also assessed for each treatment group via hanging wire. To begin,
the mice were placed on a cage top elevated approximately 20 cm above the cage floor.
The top was inverted and the latency to fall was recorded. Test performance was
averaged for 3 separate trials for each mouse.
Cortical thickness quantification of MRI images
MRI images were converted from DICOM to NIFTI format using an open source software
described in Li et al. (50). Orientations of the converted MRI images were adjusted to be
in the transverse orientation using a reorientation software described by Heuer et al. 2020
61

for E18.5 control (n=8) and C9ORF72-BAC (n=15) embryos. Cortical thickness was
averaged using ImageJ across ten subsections with 6 measurements for each subsection
between the pineal gland and 4th ventricle. The cortical thickness measurements were
normalized to the average total brain area across the ten subsections for each embryo.
The scientist performing the cortical thickness quantification was blinded to the genotypes
of the samples.
List of primers used in study
Gene Target Forward Reverse
TARDBP ASO /52MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErC/*/i2MOErT/*A*T*C*C*A
*A*A*A*G*A*/i2MOErT/*/i2MOErA/*/i2MOErA/*/i2MOErC/*/32MOEr
A/

LRRC47 ASO 1 /52MOErA/*/i2MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErG/*T*
G*G*C*A*C*T*
T*G*T*/i2MOErT/*/i2MOErA/*/i2MOErC/*/i2MOErT/*/32MOErT/

LRRC47 ASO 2 /52MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErT/*/i2MOErC/*C*
A*G*C*A*C*T*
G*G*G*/i2MOErA/*/i2MOErT/*/i2MOErT/*/i2MOErC/*/32MOErG/

CRISPRs
sgRNA-1
targeting
upstream of
repeat
expansion

GUAACCUACGGUGUCCCGCU
CRISPR sgRNA-
2b targeting
downstream of
repeat
expansion (–
strand)

ACCCCAAACAGCCACCCGCC
Scramble ASO /52MOErG/*/i2MOErC/*/i2MOErG/*/i2MOErA/*/i2MOErC/*T*
A*T*A*C*G*C*
G*C*A*/i2MOErA/*/i2MOErT/*/i2MOErA/*/i2MOErT/*/32MOErG/

RP-PCR primer
1
FAM-TGTAAAACGACGGCCAGTCAAGGAGGGAAACAACCGCAGCC
RP-PCR primer
2
CAGGAAACAGCTATGACCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCC
GG

RP-PCR primer
3
CAGGAAACAGCTATGACC
C9ORF72
Southern blot
probe
AGAACAGGACAAGTTGCC AACACACACCTCCTAAACC
LRRC47 GAGCAGAGGAAGCAGAAGAAG CATCCACAAGACACGGGTAAT
TARDBP ATGGGTGGTGGGATGAACTTT CGATGGGCCTGACTGGTTCT
62

Distal
upstream 1
TGACTCATTGCCGGGTCAGG
TTTGCTTGTGCAGTCCAGCC
Distal
upstream 2
GCTCTGTGCCCTTTTCTGGC AGCCTGGGAGACTGGAAA
GT
Distal
downstream 1
AAGCTGACTGCTCATGGGGG
TCTGCAACTCACGTCAGCC
A
Distal
downstream 2
GATGCCACGGGGTGTCTCTG
TTGTGCCAATGTCCCCTCC
A
Proximal
upstream 1
TGAGGGTGAACAAGAAAAGA

GCGCGACTCCTGAGTTCCAG

Proximal
upstream 2
TCTCCCCACTACTTGCTCTCAC
TGCGGTTGTTTCCCTCCTT
GTT
Proximal
downstream 1
CGTGGTCGGGGCGGGCCC

CTCACCCACTCGCCACCG

Proximal
downstream 2
TCGACCTCGAAATTCTACCGGG
CTGCTAAAGCGCATGCTCC
A
C9ORF72-BAC
TCGAAATGCAGAGAGTGGTG
CTTCCTTTCCGGATTATAT
GTG
Internal
genotyping
control
CTGTCCCTGTATGCCTCTGG
AGATGGAGAAAGGACTAG
GCTACA

63

References
1. Jones P. ALS Association. Epidemiology of ALS and suspected clusters.
http://www.alsa.org/als-care/resources/publications-
videos/factsheets/epidemiology.html?referrer=https://www.google.com/. Published
2017.
2. DeJesus-Hernandez M, Mackenzie IR, Boeve BF, et al. Expanded GGGGCC
Hexanucleotide Repeat in Noncoding Region of C9ORF72 Causes Chromosome
9p-Linked FTD and ALS. Neuron. 2011;72(2):245-256.
doi:10.1016/j.neuron.2011.09.011
3. Renton AE, Majounie E, Waite A, et al. A hexanucleotide repeat expansion in
C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron.
2011;72(2):257-268. doi:10.1016/j.neuron.2011.09.010
4. Shi Y, Lin S, Staats KA, et al. Haploinsufficiency leads to neurodegeneration in
C9ORF72 ALS/FTD human induced motor neurons. Nat Med. 2018.
doi:10.1038/nm.4490
5. Byrne S, Elamin M, Bede P, et al. Cognitive and clinical characteristics of patients
with amyotrophic lateral sclerosis carrying a C9orf72 repeat expansion: A
population-based cohort study. Lancet Neurol. 2012;11(3):232-240.
doi:10.1016/S1474-4422(12)70014-5
6. Ratnavalli E, Brayne C, Dawson K, Hodges J. The prevalence of frontotemporal
dementia. Neurology. 2002;58(11):1615-1621.
7. Rosen HJ, Kramer JH, Gorno-Tempini ML, Schuff N, Weiner M, Miller BL.
Patterns of cerebral atrophy in primary progressive aphasia. Am J Geriatr
64

Psychiatry. 2002;10(1):89-97. doi:10.1097/00019442-200201000-00011
8. Lanata SC, Miller BL. The behavioural variant frontotemporal dementia (bvFTD)
syndrome in psychiatry. J Neurol Neurosurg Psychiatry. 2016;87(5):501-511.
doi:10.1136/jnnp-2015-310697
9. McKhann GM, Albert MS, Grossman M, Miller B, Dickson D, Trojanowski JQ.
Clinical and pathological diagnosis of frontotemporal dementia: report of the Work
Group on Frontotemporal Dementia and Pick’s Disease. Arch Neurol.
2001;58(11):1803-1809. doi:10.1001/archneur.58.11.1803
10. Snowden JS, Rollinson S, Thompson JC, et al. Distinct clinical and pathological
characteristics of frontotemporal dementia associated with C9ORF72 mutations.
Brain. 2012;135(3):693-708. doi:10.1093/brain/awr355
11. Rademakers R, Neumann M, Mackenzie IR. Advances in understanding the
molecular basis of frontotemporal dementia. Nat Rev Neurol. 2012.
doi:10.1038/nrneurol.2012.117
12. Whitwell JL, Weigand SD, Boeve BF, et al. Neuroimaging signatures of
frontotemporal dementia genetics: C9ORF72, tau, progranulin and sporadics.
Brain. 2012;135(3):794-806. doi:10.1093/brain/aws001
13. Broe M, Hodges JR, Schofield E, Shepherd CE, Kril JJ, Halliday GM. Staging
disease severity in pathologically confirmed cases of frontotemporal dementia.
Neurology. 2003;60(6):1005-1011. doi:10.1212/01.WNL.0000052685.09194.39
14. Millecamps S, Boillée S, Le Ber I, et al. Phenotype difference between ALS
patients with expanded repeats in C9ORF72 and patients with mutations in other
ALS-related genes. J Med Genet. 2012;49(4):258-263. doi:10.1136/jmedgenet-
65

2011-100699
15. Murray ME, Dejesus-Hernandez M, Rutherford NJ, et al. Clinical and
neuropathologic heterogeneity of c9FTD/ALS associated with hexanucleotide
repeat expansion in C9ORF72. Acta Neuropathol. 2011;122(6):673-690.
doi:10.1007/s00401-011-0907-y
16. Brettschneider J, Del Tredici K, Toledo JB, et al. Stages of pTDP-43 pathology in
amyotrophic lateral sclerosis. Ann Neurol. 2013;74(1):20-38.
doi:10.1002/ana.23937
17. Turner MR, Brockington A, Scaber J, et al. Pattern of spread and prognosis in
lower limb-onset ALS. Amyotroph Lateral Scler. 2010;11(4):369-373.
doi:10.3109/17482960903420140
18. Ravits J, Paul P, Jorg C. Focality of upper and lower motor neuron degeneration
at the clinical onset of ALS. Neurology. 2007;68(19):1571-1575.
doi:10.1212/01.wnl.0000260965.20021.47
19. Kanouchi T, Ohkubo T, Yokota T. Can regional spreading of amyotrophic lateral
sclerosis motor symptoms be explained by prion-like propagation? J Neurol
Neurosurg Psychiatry. 2012;83(7):739-745. doi:10.1136/jnnp-2011-301826
20. Seeley WW, Crawford RK, Zhou J, Miller BL, Greicius MD. Neurodegenerative
Diseases Target Large-Scale Human Brain Networks. Neuron. 2009;62(1):42-52.
doi:10.1016/j.neuron.2009.03.024
21. Braak H, Brettschneider J, Ludolph AC, Lee VM, Trojanowski JQ, Tredici K Del.
Amyotrophic lateral sclerosis—a model of corticofugal axonal spread. Nat Rev
Neurol. 2013;9(12):708-714. doi:10.1038/nrneurol.2013.221
66

22. Scaber J, Talbot K. What is the role of TDP-43 in C9orf72-related amyotrophic
lateral sclerosis and frontemporal dementia? Brain. 2016;139(12):3057-3059.
doi:10.1093/brain/aww264
23. Ling SC, Polymenidou M, Cleveland DW. Converging mechanisms in als and
FTD: Disrupted RNA and protein homeostasis. Neuron. 2013;79(3):416-438.
doi:10.1016/j.neuron.2013.07.033
24. Wegorzewska I, Bell S, Cairns NJ, Miller TM, Baloh RH. TDP-43 mutant
transgenic mice develop features of ALS and frontotemporal lobar degeneration.
Proc Natl Acad Sci. 2009;106(44):18809-18814. doi:10.1073/pnas.0908767106
25. Ash PEA, Zhang YJ, Roberts CM, et al. Neurotoxic effects of TDP-43
overexpression in C. elegans. Hum Mol Genet. 2010;19(16):3206-3218.
doi:10.1093/hmg/ddq230
26. Miguel L, Frébourg T, Campion D, Lecourtois M. Both cytoplasmic and nuclear
accumulations of the protein are neurotoxic in Drosophila models of TDP-43
proteinopathies. Neurobiol Dis. 2011;41(2):398-406.
doi:10.1016/j.nbd.2010.10.007
27. Furukawa Y, Kaneko K, Watanabe S, Yamanaka K, Nukina N. A seeding reaction
recapitulates intracellular formation of sarkosyl-insoluble transactivation response
element (TAR) DNA-binding protein-43 inclusions. J Biol Chem.
2011;286(21):18664-18672. doi:10.1074/jbc.M111.231209
28. Wojciechowska M, Krzyzosiak WJ. Cellular toxicity of expanded RNA repeats:
Focus on RNA foci. Hum Mol Genet. 2011;20(19):3811-3821.
doi:10.1093/hmg/ddr299
67

29. Neumann M, Rademakers R, Roeber S, Baker M, Kretzschmar HA, Mackenzie
IRA. Frontotemporal lobar degeneration with FUS pathology. Brain. 2009:2922-
2931. doi:10.1093/brain/awp214
30. Grad LI, Guest WC, Yanai A, et al. Intermolecular transmission of superoxide
dismutase 1 misfolding in living cells. Proc Natl Acad Sci. 2011;108(39):16398-
16403. doi:10.1073/pnas.1102645108
31. N. F. Schor, D. W. Bianchi, Neurodevelopmental Clues to Neurodegeneration.
Pediatr. Neurol. 123, 67–76 (2021).
32. C. Deneubourg, M. Ramm, L. J. Smith, O. Baron, K. Singh, S. C. Byrne, M. R.
Duchen, M. Gautel, E.-L. Eskelinen, M. Fanto, H. Jungbluth, The spectrum of
neurodevelopmental, neuromuscular and neurodegenerative disorders due to
defective autophagy. Autophagy, 1–22 (2021).
33. M. Barnat, M. Capizzi, E. Aparicio, S. Boluda, D. Wennagel, R. Kacher, R.
Kassem, S. Lenoir, F. Agasse, B. Y. Braz, J.-P. Liu, J. Ighil, A. Tessier, S. O.
Zeitlin, C. Duyckaerts, M. Dommergues, A. Durr, S. Humbert, Huntington’s
disease alters human neurodevelopment. Science. 369, 787–793 (2020).
34. E. E. Arteaga-Bracho, M. Gulinello, M. L. Winchester, N. Pichamoorthy, J. R.
Petronglo, A. D. Zambrano, J. Inocencio, C. D. De Jesus, J. O. Louie, S. Gokhan,
M. F. Mehler, A. E. Molero, Postnatal and adult consequences of loss of
huntingtin during development: Implications for Huntington’s disease. Neurobiol.
Dis. 96, 144–155 (2016).
35. M. DeJesus-Hernandez, I. R. Mackenzie, B. F. Boeve, A. L. Boxer, M. Baker, N.
J. Rutherford, A. M. Nicholson, N. A. Finch, H. Flynn, J. Adamson, N. Kouri, A.
68

Wojtas, P. Sengdy, G.-Y. R. Hsiung, A. Karydas, W. W. Seeley, K. A. Josephs, G.
Coppola, D. H. Geschwind, Z. K. Wszolek, H. Feldman, D. S. Knopman, R. C.
Petersen, B. L. Miller, D. W. Dickson, K. B. Boylan, N. R. Graff-Radford, R.
Rademakers, Expanded GGGGCC hexanucleotide repeat in noncoding region of
C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron. 72, 245–256
(2011).
36. A. E. Renton, E. Majounie, A. Waite, J. Simón-Sánchez, S. Rollinson, J. R. Gibbs,
J. C. Schymick, H. Laaksovirta, J. C. van Swieten, L. Myllykangas, H. Kalimo, A.
Paetau, Y. Abramzon, A. M. Remes, A. Kaganovich, S. W. Scholz, J. Duckworth,
J. Ding, D. W. Harmer, D. G. Hernandez, J. O. Johnson, K. Mok, M. Ryten, D.
Trabzuni, R. J. Guerreiro, R. W. Orrell, J. Neal, A. Murray, J. Pearson, I. E.
Jansen, D. Sondervan, H. Seelaar, D. Blake, K. Young, N. Halliwell, J. B.
Callister, G. Toulson, A. Richardson, A. Gerhard, J. Snowden, D. Mann, D. Neary,
M. A. Nalls, T. Peuralinna, L. Jansson, V.-M. Isoviita, A.-L. Kaivorinne, M. Hölttä-
Vuori, E. Ikonen, R. Sulkava, M. Benatar, J. Wuu, A. Chiò, G. Restagno, G.
Borghero, M. Sabatelli, ITALSGEN Consortium, D. Heckerman, E. Rogaeva, L.
Zinman, J. D. Rothstein, M. Sendtner, C. Drepper, E. E. Eichler, C. Alkan, Z.
Abdullaev, S. D. Pack, A. Dutra, E. Pak, J. Hardy, A. Singleton, N. M. Williams, P.
Heutink, S. Pickering-Brown, H. R. Morris, P. J. Tienari, B. J. Traynor, A
hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-
linked ALS-FTD. Neuron. 72, 257–268 (2011).
37. X. Wen, W. Tan, T. Westergard, K. Krishnamurthy, S. S. Markandaiah, Y. Shi, S.
Lin, N. A. Shneider, J. Monaghan, U. B. Pandey, P. Pasinelli, J. K. Ichida, D.
69

Trotti, Antisense proline-arginine RAN dipeptides linked to C9ORF72-ALS/FTD
form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death.
Neuron. 84, 1213–1225 (2014).
38. Y. Shi, S. Lin, K. A. Staats, Y. Li, W.-H. Chang, S.-T. Hung, E. Hendricks, G. R.
Linares, Y. Wang, E. Y. Son, X. Wen, K. Kisler, B. Wilkinson, L. Menendez, T.
Sugawara, P. Woolwine, M. Huang, M. J. Cowan, B. Ge, N. Koutsodendris, K. P.
Sandor, J. Komberg, V. R. Vangoor, K. Senthilkumar, V. Hennes, C. Seah, A. R.
Nelson, T.-Y. Cheng, S.-J. J. Lee, P. R. August, J. A. Chen, N. Wisniewski, V.
Hanson-Smith, T. G. Belgard, A. Zhang, M. Coba, C. Grunseich, M. E. Ward, L.
H. van den Berg, R. J. Pasterkamp, D. Trotti, B. V. Zlokovic, J. K. Ichida,
Haploinsufficiency leads to neurodegeneration in C9ORF72 ALS/FTD human
induced motor neurons. Nat. Med. 24, 313–325 (2018).
39. C. J. Donnelly, P.-W. Zhang, J. T. Pham, A. R. Haeusler, N. A. Mistry, S.
Vidensky, E. L. Daley, E. M. Poth, B. Hoover, D. M. Fines, N. Maragakis, P. J.
Tienari, L. Petrucelli, B. J. Traynor, J. Wang, F. Rigo, C. Frank Bennett, S.
Blackshaw, R. Sattler, J. D. Rothstein, RNA Toxicity from the ALS/FTD C9ORF72
Expansion Is Mitigated by Antisense Intervention. Neuron. 80 (2013), p. 1102.
40. C. Lagier-Tourenne, M. Baughn, F. Rigo, S. Sun, P. Liu, H.-R. Li, J. Jiang, A. T.
Watt, S. Chun, M. Katz, J. Qiu, Y. Sun, S.-C. Ling, Q. Zhu, M. Polymenidou, K.
Drenner, J. W. Artates, M. McAlonis-Downes, S. Markmiller, K. R. Hutt, D. P.
Pizzo, J. Cady, M. B. Harms, R. H. Baloh, S. R. Vandenberg, G. W. Yeo, X.-D.
Fu, C. F. Bennett, D. W. Cleveland, J. Ravits, Targeted degradation of sense and
antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration.
70

Proc. Natl. Acad. Sci. U. S. A. 110, E4530–9 (2013).
41. Y. Shi, S.-T. Hung, G. Rocha, S. Lin, G. R. Linares, K. A. Staats, C. Seah, Y.
Wang, M. Chickering, J. Lai, T. Sugawara, A. P. Sagare, B. V. Zlokovic, J. K.
Ichida, Identification and therapeutic rescue of autophagosome and glutamate
receptor defects in C9ORF72 and sporadic ALS neurons. JCI Insight. 5 (2019),
doi:10.1172/jci.insight.127736.
42. M. E. McCauley, J. G. O’Rourke, A. Yáñez, J. L. Markman, R. Ho, X. Wang, S.
Chen, D. Lall, M. Jin, A. K. M. G. Muhammad, S. Bell, J. Landeros, V. Valencia,
M. Harms, M. Arditi, C. Jefferies, R. H. Baloh, C9orf72 in myeloid cells
suppresses STING-induced inflammation. Nature. 585, 96–101 (2020).
43. S. E. Lee, A. C. Sias, M. L. Mandelli, J. A. Brown, A. B. Brown, A. M. Khazenzon,
A. A. Vidovszky, T. P. Zanto, A. M. Karydas, M. Pribadi, D. Dokuru, G. Coppola,
D. H. Geschwind, R. Rademakers, M. L. Gorno-Tempini, H. J. Rosen, B. L. Miller,
W. W. Seeley, Network degeneration and dysfunction in presymptomatic
C9ORF72 expansion carriers. Neuroimage Clin. 14, 286–297 (2017).
44. A. Bertrand, J. Wen, D. Rinaldi, M. Houot, S. Sayah, A. Camuzat, C. Fournier, S.
Fontanella, A. Routier, P. Couratier, F. Pasquier, M.-O. Habert, D. Hannequin, O.
Martinaud, P. Caroppo, R. Levy, B. Dubois, A. Brice, S. Durrleman, O. Colliot, I.
Le Ber, Predict to Prevent Frontotemporal Lobar Degeneration and Amyotrophic
Lateral Sclerosis (PREV-DEMALS) Study Group, Early Cognitive, Structural, and
Microstructural Changes in Presymptomatic C9orf72 Carriers Younger Than 40
Years. JAMA Neurol. 75, 236–245 (2018).
45. J. De Vocht, J. Blommaert, M. Devrome, A. Radwan, D. Van Weehaeghe, M. De
71

Schaepdryver, J. Ceccarini, A. Rezaei, G. Schramm, J. van Aalst, A. Chiò, M.
Pagani, D. Stam, H. Van Esch, N. Lamaire, M. Verhaegen, N. Mertens, K.
Poesen, L. H. van den Berg, M. A. van Es, R. Vandenberghe, M. Vandenbulcke,
J. Van den Stock, M. Koole, P. Dupont, K. Van Laere, P. Van Damme, Use of
Multimodal Imaging and Clinical Biomarkers in Presymptomatic Carriers of
C9orf72 Repeat Expansion. JAMA Neurol. 77, 1008–1017 (2020).
46. L. H. H. Meeter, T. F. Gendron, A. C. Sias, L. C. Jiskoot, S. P. Russo, L. Donker
Kaat, J. M. Papma, J. L. Panman, E. L. van der Ende, E. G. Dopper, S. Franzen,
C. Graff, A. L. Boxer, H. J. Rosen, R. Sanchez-Valle, D. Galimberti, Y. A. L.
Pijnenburg, L. Benussi, R. Ghidoni, B. Borroni, R. Laforce Jr, M. Del Campo, C. E.
Teunissen, R. van Minkelen, J. C. Rojas, G. Coppola, D. H. Geschwind, R.
Rademakers, A. M. Karydas, L. Öijerstedt, E. Scarpini, G. Binetti, A. Padovani, D.
M. Cash, K. M. Dick, M. Bocchetta, B. L. Miller, J. D. Rohrer, L. Petrucelli, J. C.
van Swieten, S. E. Lee, Poly(GP), neurofilament and grey matter deficits in
C9orf72 expansion carriers. Ann Clin Transl Neurol. 5, 583–597 (2018).
47. R. A. K. Atkinson, C. M. Fernandez-Martos, J. D. Atkin, J. C. Vickers, A. E. King,
C9ORF72 expression and cellular localization over mouse development. Acta
Neuropathol Commun. 3, 59 (2015).
48. Y. Zhang, S. A. Sloan, L. E. Clarke, C. Caneda, C. A. Plaza, P. D. Blumenthal, H.
Vogel, G. K. Steinberg, M. S. B. Edwards, G. Li, J. A. Duncan 3rd, S. H. Cheshier,
L. M. Shuer, E. F. Chang, G. A. Grant, M. G. H. Gephart, B. A. Barres, Purification
and Characterization of Progenitor and Mature Human Astrocytes Reveals
Transcriptional and Functional Differences with Mouse. Neuron. 89, 37–53
72

(2016).
49. M. L. Bennett, F. C. Bennett, S. A. Liddelow, B. Ajami, J. L. Zamanian, N. B.
Fernhoff, S. B. Mulinyawe, C. J. Bohlen, A. Adil, A. Tucker, I. L. Weissman, E. F.
Chang, G. Li, G. A. Grant, M. G. Hayden Gephart, B. A. Barres, New tools for
studying microglia in the mouse and human CNS. Proc. Natl. Acad. Sci. U. S. A.
113, E1738–46 (2016).
50. Y. Zhang, K. Chen, S. A. Sloan, M. L. Bennett, A. R. Scholze, S. O’Keeffe, H. P.
Phatnani, P. Guarnieri, C. Caneda, N. Ruderisch, S. Deng, S. A. Liddelow, C.
Zhang, R. Daneman, T. Maniatis, B. A. Barres, J. Q. Wu, An RNA-sequencing
transcriptome and splicing database of glia, neurons, and vascular cells of the
cerebral cortex. J. Neurosci. 34, 11929–11947 (2014).
51. M. Ameismeier, I. Zemp, J. van den Heuvel, M. Thoms, O. Berninghausen, U.
Kutay, R. Beckmann, Structural basis for the final steps of human 40S ribosome
maturation. Nature. 587, 683–687 (2020).
52. Y. Shi, P. Kirwan, J. Smith, H. P. C. Robinson, F. J. Livesey, Human cerebral
cortex development from pluripotent stem cells to functional excitatory synapses.
Nature Neuroscience. 15 (2012), pp. 477–486.
53. D.-S. Kim, D. R. Lee, H.-S. Kim, J.-E. Yoo, S. J. Jung, B. Y. Lim, J. Jang, H.-C.
Kang, S. You, D.-Y. Hwang, J. W. Leem, T. S. Nam, S.-R. Cho, D.-W. Kim, Highly
pure and expandable PSA-NCAM-positive neural precursors from human ESC
and iPSC-derived neural rosettes. PLoS One. 7, e39715 (2012).
54. I. Kwon, S. Xiang, M. Kato, L. Wu, P. Theodoropoulos, T. Wang, J. Kim, J. Yun,
Y. Xie, S. L. McKnight, Poly-dipeptides encoded by the C9orf72 repeats bind
73

nucleoli, impede RNA biogenesis, and kill cells. Science. 345, 1139–1145 (2014).
55. K. Zhang, J. G. Daigle, K. M. Cunningham, A. N. Coyne, K. Ruan, J. C. Grima, K.
E. Bowen, H. Wadhwa, P. Yang, F. Rigo, J. P. Taylor, A. D. Gitler, J. D.
Rothstein, T. E. Lloyd, Stress Granule Assembly Disrupts Nucleocytoplasmic
Transport. Cell. 173, 958–971.e17 (2018).
56. Y. Davidson, A. C. Robinson, X. Liu, D. Wu, C. Troakes, S. Rollinson, M. Masuda-
Suzukake, G. Suzuki, T. Nonaka, J. Shi, J. Tian, H. Hamdalla, J. Ealing, A.
Richardson, M. Jones, S. Pickering-Brown, J. S. Snowden, M. Hasegawa, D. M.
A. Mann, Neurodegeneration in frontotemporal lobar degeneration and motor
neurone disease associated with expansions in C9orf72 is linked to TDP-43
pathology and not associated with aggregated forms of dipeptide repeat proteins.
Neuropathol. Appl. Neurobiol. 42, 242–254 (2016).
57. J. Cooper-Knock, A. Higginbottom, M. J. Stopford, J. R. Highley, P. G. Ince, S. B.
Wharton, S. Pickering-Brown, J. Kirby, G. M. Hautbergue, P. J. Shaw, Antisense
RNA foci in the motor neurons of C9ORF72-ALS patients are associated with
TDP-43 proteinopathy. Acta Neuropathol. 130, 63–75 (2015).
58. J. Bennion Callister, S. Ryan, J. Sim, S. Rollinson, S. M. Pickering-Brown,
Modelling C9orf72 dipeptide repeat proteins of a physiologically relevant size.
Hum. Mol. Genet. 25, 5069–5082 (2016).
59. M. Maor-Nof, Z. Shipony, R. Lopez-Gonzalez, L. Nakayama, Y.-J. Zhang, J.
Couthouis, J. A. Blum, P. A. Castruita, G. R. Linares, K. Ruan, Others, p53 is a
central regulator driving neurodegeneration caused by C9orf72 poly (PR). Cell.
184, 689–708 (2021).
74

60. K. E. Beatty, J. C. Liu, F. Xie, D. C. Dieterich, E. M. Schuman, Q. Wang, D. A.
Tirrell, Fluorescence visualization of newly synthesized proteins in mammalian
cells. Angew. Chem. Int. Ed Engl. 45, 7364–7367 (2006).
61. E. Y. Chen, C. M. Tan, Y. Kou, Q. Duan, Z. Wang, G. V. Meirelles, N. R. Clark, A.
Ma’ayan, Enrichr: interactive and collaborative HTML5 gene list enrichment
analysis tool. BMC Bioinformatics. 14, 128 (2013).
62. M. A. Vogt, Z. Ehsaei, P. Knuckles, A. Higginbottom, M. S. Helmbrecht, T.
Kunath, K. Eggan, L. A. Williams, P. J. Shaw, W. Wurst, T. Floss, A. B. Huber, V.
Taylor, TDP-43 induces p53-20 mediated cell death of cortical progenitors and
immature neurons. Sci. Rep. 8, 8097 (2018).
63. J. Gerhardt, A. D. Bhalla, J. S. Butler, J. W. Puckett, P. B. Dervan, Z. Rosenwaks,
M. Napierala, Stalled DNA Replication Forks at the Endogenous GAA Repeats
Drive Repeat Expansion in Friedreich’s Ataxia Cells. Cell Rep. 16, 1218–1227
(2016).
64. R. Sundararajan, C. H. Freudenreich, Expanded CAG/CTG repeat DNA induces a
checkpoint response that impacts cell proliferation in Saccharomyces cerevisiae.
PLoS Genet. 7, e1001339 (2011).
65. A. R. Haeusler, C. J. Donnelly, G. Periz, E. A. J. Simko, P. G. Shaw, M.-S. Kim,
N. J. Maragakis, J. C. Troncoso, A. Pandey, R. Sattler, J. D. Rothstein, J. Wang,
C9orf72 nucleotide repeat structures initiate molecular cascades of disease.
Nature. 507 (2014), pp. 195–200.
66. R. G. Thys, Y.-H. Wang, DNA Replication Dynamics of the GGGGCC Repeat of
the C9orf72 Gene. J. Biol. Chem. 290, 28953–28962 (2015).
75

67. N. S. Andrade, M. Ramic, R. Esanov, W. Liu, M. J. Rybin, G. Gaidosh, A.
Abdallah, S. Del’Olio, T. C. Huff, N. T. Chee, S. Anatha, T. F. Gendron, C.
Wahlestedt, Y. Zhang, M. Benatar, C. Mueller, Z. Zeier, Dipeptide repeat proteins
inhibit homology-directed DNA double strand break repair in C9ORF72 ALS/FTD.
Mol. Neurodegener. 15, 13 (2020).
68. M. A. Farg, A. Konopka, K. Y. Soo, D. Ito, J. D. Atkin, The DNA damage response
(DDR) is induced by the C9orf72 repeat expansion in amyotrophic lateral
sclerosis. Hum. Mol. Genet. 26, 2882–2896 (2017).
69. A. Campos, A. Clemente-Blanco, Cell Cycle and DNA Repair Regulation in the
Damage Response: Protein Phosphatases Take Over the Reins. Int. J. Mol. Sci.
21 (2020), doi:10.3390/ijms21020446.
70. W. Gorczyca, J. Gong, Z. Darzynkiewicz, Detection of DNA strand breaks in
individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and
nick translation assays. Cancer Res. 53, 1945–1951 (1993).
71. Y. Liu, A. Pattamatta, T. Zu, T. Reid, O. Bardhi, D. R. Borchelt, A. T. Yachnis, L.
P. W. Ranum, C9orf72 BAC Mouse Model with Motor Deficits and
Neurodegenerative Features of ALS/FTD. Neuron. 90, 521–534 (2016).
72. L. Nguyen, L. A. Laboissonniere, S. Guo, F. Pilotto, O. Scheidegger, A.
Oestmann, J. W. Hammond, H. Li, A. Hyysalo, R. Peltola, A. Pattamatta, T. Zu,
M. H. Voutilainen, H. A. Gelbard, S. Saxena, L. P. W. Ranum, Survival and Motor
Phenotypes in FVB C9-500 ALS/FTD BAC Transgenic Mice Reproduced by
Multiple Labs. Neuron. 108, 784–796.e3 (2020).
73. D. A. Mordes, B. M. Morrison, X. H. Ament, C. Cantrell, J. Mok, P. Eggan, C. Xue,
76

J.-Y. Wang, K. Eggan, J. D. Rothstein, Absence of Survival and Motor Deficits in
500 Repeat C9ORF72 BAC Mice. Neuron. 108, 775–783.e4 (2020).
74. L. Wang, K. K. Bluske, L. K. Dickel, Y. Nakagawa, Basal progenitor cells in the
embryonic mouse thalamus - their molecular characterization and the role of
neurogenins and Pax6. Neural Dev. 6, 35 (2011).
75. D. W. Hagey, D. Topcic, N. Kee, F. Reynaud, M. Bergsland, T. Perlmann, J.
Muhr, CYCLIN-B1/2 and -D1 act in opposition to coordinate cortical progenitor
self-renewal and lineage commitment. Nature Communications. 11 (2020), ,
doi:10.1038/s41467-020-16597-8.
76. P. Gressens, J. M. Hill, I. Gozes, M. Fridkin, D. E. Brenneman, Growth factor
function of vasoactive intestinal peptide in whole cultured mouse embryos.
Nature. 362, 155–158 (1993).
77. J. M. Hill, J. M. Hauser, L. M. Sheppard, D. Abebe, I. Spivak-Pohis, M. Kushnir, I.
Deitch, I. Gozes, Blockage of VIP during mouse embryogenesis modifies adult
behavior and results in permanent changes in brain chemistry. J. Mol. Neurosci.
31, 183–200 (2007).
78. S. Passemard, V. El Ghouzzi, H. Nasser, C. Verney, G. Vodjdani, A. Lacaud, S.
Lebon, M. Laburthe, P. Robberecht, J. Nardelli, S. Mani, A. Verloes, P. Gressens,
V. Lelièvre, VIP blockade leads to microcephaly in mice via disruption of Mcph1-
Chk1 signaling. J. Clin. Invest. 121, 3071–3087 (2011).
79. H. Wils, G. Kleinberger, J. Janssens, S. Pereson, G. Joris, I. Cuijt, V. Smits, C.
Ceuterick-de 35 Groote, C. Van Broeckhoven, S. Kumar-Singh, TDP-43
transgenic mice develop spastic paralysis and neuronal inclusions characteristic
77

of ALS and frontotemporal lobar degeneration. Proceedings of the National
Academy of Sciences. 107, 3858–3863 (2010).
80. N. A. Murphy, K. C. Arthur, P. J. Tienari, H. Houlden, A. Chiò, B. J. Traynor, Age-
related penetrance of the C9orf72 repeat expansion. Sci. Rep. 7, 2116 (2017).
81. F. A. Ran, P. D. Hsu, J. Wright, V. Agarwala, D. A. Scott, F. Zhang, Genome
engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308 (2013).
82. X. Li, P. S. Morgan, J. Ashburner, J. Smith, C. Rorden, The first step for
neuroimaging data 5 analysis: DICOM to NIfTI conversion. J. Neurosci. Methods.
264, 47–56 (2016).

Abstract (if available)

Abstract Genetic mutations that cause adult-onset neurodegenerative diseases are often expressed during embryonic stages, yet it is unclear if they alter neurodevelopment and how this might influence disease onset. Here, we show that the most common cause of frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS), a repeat expansion in C9ORF72, restricts neural progenitor cell proliferation and reduces thalamic and cortical size in utero. Surprisingly, DNA replication stalling, and a repeat expansion-derived dipeptide repeat protein (DPR) not known to reduce neuronal viability play key roles in impairing neurodevelopment. Reducing brain volumes during neurodevelopment using a small molecule approach increases the susceptibility of C9ORF72 mice to motor defects. Thus, the C9ORF72 repeat expansion stunts the development of the brain regions prominently affected in C9ORF72 FTD/ALS patients.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Functional study of C9ORF72 and its implication in the pathogenesis of amyotrophic lateral sclerosis

PDF

C9orf72 deficiency exacerbates motor deficits in C9ALS/FTD mouse models

PDF

Identification of therapeutic targets for neurons and microglia in amyotrophic lateral sclerosis

PDF

Identification of therapeutic targets in human cerebral brain organoid models of neurodegeneration

PDF

The role of vascular dysfunction in cognitive impairment

PDF

Dynamic processes underlying cerebral cortical development with lifespan impact

PDF

ROOT: a novel pharmacotranscritomic pipeline for rescuing age-associated functional decline of hippocampal adult neurogenesis

PDF

The impact of genetic pleiotropy on heterogeneity in the developing forebrain and hindbrain

PDF

Alzheimer’s disease: dysregulated genes, ethno-racial disparities, and environmental pollution

PDF

The autism-associated gene SYNGAP1 regulates human cortical neurogenesis

PDF

Signaling networks in complex brain disorders

PDF

An iPSC-based biomarker strategy to identify neuroregenerative responders to allopregnanolone

PDF

Negative valence neurons in the larval zebrafish pallium

PDF

Understanding human nephrogenesis and scaling synthesis of organoids facilitate modeling of kidney development and disease

PDF

Transcriptomic maturation of developing human cone precursors in fetal and 3D hESC-derived tissues

PDF

Deciphering heterogeneity of preleukemic clonal expansion

PDF

The role of inflammation in mediating effects of obesity on Alzheimer's disease

PDF

Mapping multi-scale connectivity of the mouse posterior parietal cortex

PDF

Anemia and white matter: a diffusion MRI analysis of the human brain

PDF

Neuroimaging markers of risk & resilience to brain aging and dementia

Asset Metadata

Creator Hendricks, Eric (author)

Core Title The C9ORF72 repeat expansion impairs neurodevelopment

School College of Letters, Arts and Sciences

Degree Doctor of Philosophy

Degree Program Neuroscience

Degree Conferral Date 2022-08

Publication Date 07/18/2023

Defense Date 04/19/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag amyotrophic lateral sclerosis,C9ORF72,frontotemporal dementia,induced pluripotent stem cells,neural stem cells,neurodevelopment,OAI-PMH Harvest

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Eagleson, Kathie (committee chair), Ichida, Justin (committee member), Levitt, Pat (committee member)

Creator Email ewhendri@usc.edu,ewhendricks08@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC111373175

Unique identifier UC111373175

Legacy Identifier etd-HendricksE-10854

Document Type Dissertation

Format application/pdf (imt)

Rights Hendricks, Eric

Type texts

Source 20220719-usctheses-batch-955 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu