The characterization of SNAREs and rabs in lacrimal gland acinar cells

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Request accessible transcript

Transcript (if available)

Content

THE CHARACTERIZATION OF SNARES AND RABS
IN LACRIMAL GLAND ACINAR CELLS

by

Eunbyul Evans

____________________________________________________________________

A Dissertation Presented to the
FACULTY OF THE GRADUATE SCHOOL
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
(PHARMACEUTICAL SCIENCES)

August 2008

Copyright 2008 Eunbyul Evans

ii

Dedication
This dissertations is dedicated to my husand, Michael Evans, my soon-to-be born
daughter, Miya Evans, and my parents, Jai Suk and Mi Young Sou.
iii

Acknowledgements
First and foremost I would like to thank my advisor, Dr. Sarah Hamm-Alvarez,
for all her help and guidance over the years. She provided a lot of insight into the
experiments and helped me switch directions on projects when necessary. She also has
provided so much inspiration and motivation, supervising all the personnel in the lab,
guiding many graduate students, heading up the department, as well as managing family
life. I have learned so much from her in all aspects of life, and I have grown so much as
a person and researcher over the years. I could not have had a better experience as a
graduate student in her lab.
I would also like to thank Dr. Curtis Okamoto for all his help and guidance,
particularly with the rab3D-pIgR studies. I would like to thank my other committee
members, Dr. Clay Wang and Dr. Robert Chow, for all their kind help and guidance. I
would really like to thank all the committee members for all their generous advice
through the years.
I am very thankful to all my lab-mates for their friendship and scientific help. I
would particularly like to thank Francie Yarber for all her technical expertise on the
lacrimal gland acinar cell culturing and for accommodating all the preps to our schedules.
I would also like to thank her for kindness and friendship, helping me through the
difficult times in my life and difficult days in the lab. Life in the lab would not have been
the same without her. I would like to thank Dr. Kaijin Wu for all her help with the PCR
analysis and her expert advice on many other experiments. I am also thankful to Dr.
iv

Austin Mircheff and his lab for their assistance with the density gradients and analysis of
the data obtained from it.
Last, but not least, I cannot thank my family enough for all their love and support
over the years. My parents, Jai Suk and Mi Young Sou, always had the highest academic
standards for me and it was my Dad’s dream to achieve a doctorate. I also cannot thank
my husband enough. He moved across the country to Los Angeles to start a family with
me and to help support my academic endeavors. He has always been by my side, even
making trips into the lab on some weekends to help keep me company. I could not have
achieved all that I have without all the love and support of my parents and my husband.
v

Table of Contents

Dedication ii
Acknowledgements iii
List of Figures vii
Abbreviations x
Abstract xii
Chapter I. Introduction
The anatomy and physiology of the lacrimal gland 1
Regulated secretion in the lacrimal gland acinar cells 5
Secretory vesicle exocytosis in the lacrimal gland 7
SNAREs (soluble N-ethylmaleimide-sensitive factor attachment
protein receptor) involved in apical exocytosis in acinar cells 11
Table 1.1 SNAREs expressed in pancreatic and parotid acinar cells 13
Polymeric IgA receptor trafficking 15

Chapter II. Materials and Methods
Reagents 19
Lacrimal gland acinar cell isolation and primary culture 20
Adenoviral contructs and transduction 21
Production and purification of recombinant proteins 22
Confocal fluorescence microscopy 22
Antibody uptake immunofluorescence studies 24
Live cell imaging 24
Western blot analysis 25
Lacrimal gland acini membrane isolation 25
Subcellular fractionation analysis 25
RT-PCR analysis 26
Cleavage of VAMP with botulinum toxin B-light chain 27
Pull-down assays 28
Co-immunoprecipitation assays 29
Secretion assays 29

vi

Chapter III. The characterization of SNAREs in rabbit lacrimal
gland acinar cells
Expression of vesicle associated membrane proteins (VAMPs) in
LGACs 32
Expression of Q-SNAREs in LGACs 38
Subcellular fractionation analysis of SNARE proteins 42
Fusogenic ability of GFP-VAMP2-enriched secretory vesicles in
LGACs 44
Colocalization of GFP-VAMP2 and Q-SNAREs 50
Binding assays identifying SNARE interactions in LGACs 56
Effect of VAMP2 inhibition by botulinum toxin B-light chain in
LGACs 61
Secretory vesicle populations: VAMP2-enriched recruitable
secretory vesicles versus rab3D-enriched mature secretory vesicles 64

Chapter IV. The role of rab3d in pIgR trafficking in rabbit lacrimal
gland acinar cells
Is VAMP2 involved in the transcytotic trafficking of pIgR/SC in
LGACs? 66
Carbachol-stimulated trafficking of pIgR from the basolateral
surface in LGACs 69
Release of SC is similar to Syncollin-GFP, a mature secretory
vesicle marker 72
Carbachol-dependent changes in colocalization of pIgR and rab3D 77
Recombinant rab3D binds to pIgR in pull-down assays 80
Rab3D-pIgR interaction is sensitive to the GTP-bound state of
rab3D 81
Adenovirus-mediated overexpression of mutant rab3DT36N in
LGAC inhibits CCH-stimulated SC secretion 85
Acute treatment of cholinergic agonist abolishes rab3D-pIgR
binding 91

Chapter V. Discussion: The characterization of SNAREs involved in
regulated exocytosis in lacrimal gland acinar cells 93

Chapter VI. Discussion: The role of rab3D on pIgR trafficking in the
secretory pathway in lacrimal gland acinar cells 103

References 112

vii

List of Figures

Figure 1.1 Schematic diagram of the lacrimal gland secretory epithelium 3

Figure 1.2 Schematic diagram of reconstituted lacrimal gland acinar
cells 5

Figure 1.3 Schematic diagram of the secretory pathways identified in
the rabbit lacrimal gland acinar cells 10

Figure 3.1 Confocal microscopy of actin organization in reconstituted
rabbit LGACs 34

Figure 3.2 Immunofluorescence microscopy and Western blot analysis
of VAMP2 in rabbit LGACs 35

Figure 3.3 Immunofluorescence microscopy and Western blot analysis
of VAMP8 in rabbit LGACs 37

Figure 3.4 Western blot and PCR analsysis of Q-SNAREs in rabbit
LGACs 40

Figure 3.5 Confocal microscopy reveals the subcellular localization of
syntaxin 3 and SNAP-23 in rabbit LGACs 41

Figure 3.6 Subcellular fractionation analyses of SNARE proteins in
LGACs reveals the presence of various SNARE proteins on
distinct subcellular membrane compartments 43

Figure 3.7 Time-lapse images of live rabbit LGACs transduced with
Ad-GFP-VAMP2 reveals fusogenic ability of GFP-VAMP2-
enriched vesicles 46

Figure 3.8 Effect of adenovirus-mediated overexpression of GFP-
VAMP2 on various secretion markers 48

Figure 3.9 Confocal fluorescence microscopy reveals that GFP-VAMP2
behaves like endogenous VAMP2 in LGACs 49

Figure 3.10 Three dimensional reconstruction of acini transduced with
Ad-GFP-VAMP2 reveals colocalization of GFP-VAMP2
with syntaxin 3 at the apical plasma membrane 52

viii

Figure 3.11 GFP-VAMP2 colocalization with syntaxin 3 increases after
CCH-stimulation 53

Figure 3.12 GFP-VAMP2 colocalization with SNAP-23 increases after
CCH-stimulation 55

Figure 3.13 Binding assays identifying SNARE interactions in the rabbit
LGACs 57

Figure 3.14 Co-immunoprecipitation assays identifying SNARE
interactions in the rabbit LGACs 60

Figure 3.15 BotB-LC does not cleave VAMP2 in LGACs 63

Figure 3.16 Confocal microscopy reveals GFP-VAMP2 coated vesicles
represent a population of vesicles different than those
enriched in rab3D 65

Figure 4.1 Colocalization of VAMP2 and SC/pIgR in lacrimal gland
acini 67

Figure 4.2 Confocal micrographs of anti-SC antibody uptake after CCH-
stimulation reveal accumulation of pIgR in subapical region 71

Figure 4.3 SC released into the culture medium after carbachol
stimulation is similar to the release of syncollin-GFP, a
marker for the contents of a mature secretory vesicle 75

Figure 4.4 Colocalization of SC/pIgR and rab3D in CCH-stimulated
acini 78

Figure 4.5 Recombinant rab3DWT pull-down of pIgR 80

Figure 4.6 Effect of mutations and GTP binding on recombinant rab3D
pull-down of pIgR 83

Figure 4.7 Effect of adenovirus-mediated overexpression of rab3DWT
and rab3D mutants on SC release in LGAC 86

Figure 4.8 Western blot analysis of rab3DWT and mutant expression in
the soluble and membrane fractions of rabbit LGAC 89

ix

Figure 4.9 Effect of CCH on rab3D-pIgR interaction and content of
pIgR in CCH-stimulated lysate from LGAC 92

Figure 5.1 Comparison of the human (Homo sapien) and the rabbit
(Oryctolagus cuniculus) VAMP2 protein sequences 97

Figure 5.2 A schematic diagram depicting the relationship between
VAMP2-enriched rSVs and rab3D-enriched mSVs 100

Figure 6.1 A schematic diagram depicting the possible roles of rab3D in
the regulation of pIgR trafficking and SC secretion in LGACs 111
x

Abbreviations

1,4,5-IP
3
inositol triphosphate
Ad adenoviral
AE apical endosomes
APM apical plasma membrane
BE basolateral endosomes
βhex β-hexosaminidase
BLM basolateral plasma membrane
BotB-LC Botulinum toxin B – light chain
CCH carbachol
CON control
dIgA dimeric IgA
dPBS Dulbecco’s phosphate buffered solution
ER endoplasmic reticulum
GAP GTPase-activating protein
GEF guanine nucleotide exchange factor
GFP green fluorescent protein
GFP-VAMP2 GFP-tagged VAMP2
GM granular membranes
GST glutathione-S-transferase
ICM intracellular membrane
IgG immunoglobulin
LGAC lacrimal gland acinar cells
MDCK Madin-Darby canine kidney
MOI multiplicity of infection
mSV mature secretory vesicles
NEM N-ethylmaleimide
Pi membrane
pIgM pentameric IgM
pIgR polymeric IgA receptor
PIP

phosphatidylinositol bisphosphate
PKC protein kinase C
rab3DQL constitutively-active rab3DQ81L
rab3DTN dominant-negative rab3DT36N
rab3DWT wild-type rab3D
rSV recruitable secretory vesicles
RT-PCR reverse transcription polymerase chain reaction
SC secretory component
SCV Salmonella-containing vesicles
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
Si soluble
sIgA secretory IgA
xi

SNARE soluble N-ethylmaleimide-sensitive factor attachment
protein receptor
SV secretory vesicles
Syncollin-GFP GFP-tagged syncollin
TeTx Tetanus toxin
TGN trans-golgi network
TPβ b-isoform of the thromboxane A2 receptor
TRAPP transport protein particle
TRP transient receptor potential
VAMP vesicle associated membrane protein
VIP vasoactive intestinal peptide
WT wild type
ZG zymogen granule
xii

Abstract

The lacrimal gland secretes tear proteins and fluid to help maintain a healthy
ocular surface. Dry eye diseases are often characterized by decreased secretory function
of the lacrimal gland. Since the mechanisms of lacrimal gland secretion are poorly
understood, the molecular mechanisms involved in the exocytosis of secretory vesicles in
the lacrimal gland acinar cells (LGACs), the main secretory cells of the lacrimal gland,
were investigated. The first part of my research explored the role of soluble N-
ethylmaleimide-sensitive factor attachment receptor proteins (SNAREs) in apical
exocytosis in LGACs. Immunofluorescence studies revealed the subcellular localization
of VAMP2 and VAMP8 on potential secretory vesicles in the subapical region in resting
and/or carbachol (CCH)-stimulated acini. Syntaxin 3 and SNAP-23 were localized to the
apical plasma membrane (APM). Binding studies revealed VAMP2/syntaxin 3/SNAP-23
and VAMP8/syntaxin 3/SNAP-23 form a SNARE complex, presumably at the APM.
Immunofluorescence studies corroborated the data, showing the colocalization of GFP-
VAMP2, expressed utilizing an adenoviral construct, with syntaxin 3 and SNAP-23.
These studies identified the SNARE complexes that may be involved in secretory vesicle
exocytosis at the APM in LGACs.
The second part of my research explored the role of rab3D in the trafficking of
polymeric IgA receptor (pIgR) through the regulated secretory pathway in LGACs.
Immunofluorescence studies showed pIgR, characterized as mediating transcytosis of
polymeric immunoglobulins in epithelial cells, colocalizing with rab3D, a regulated
secretory vesicle marker, in LGACs. The release rate of secretory component (SC), the
xiii

proteolytically cleaved fragment of the extracellular region of the pIgR, was shown to be
very similar to syncollin, a regulated secretory protein marker. In pull-down assays,
recombinant wild-type rab3D (rab3DWT) and GDP-locked rab3DT36N pull-downed
pIgR from resting acini, however, the GTP-locked mutant rab3DQ81L did not.
Adenoviral-mediated expression of rab3DT36N in LGACs inhibited SC release with
CCH-stimulation. The pull-down of pIgR by rab3DWT and the colocalizaton of pIgR
with endogenous rab3D decreased upon CCH-stimulation, indicating that secretogogues
can modulate the interaction between rab3d and pIgR. These studies revealed a novel
localization of pIgR to regulated secretory vesicles in LGACs, and SC release from these
vesicles appears to be affected by its interaction with rab3D.

1

Chapter I: Introduction

The anatomy and physiology of the lacrimal gland

The tear film is essential for the maintenance of a healthy ocular surface by acting
as a mechanical and antimicrobial barrier and well as ensuring an optical refractive
surface. The tear film is composed of three distinct layers, a surface lipid layer (0.1 – 0.2
μm), a middle aqueous layer (7 – 8 μm thick), and an inner mucous layer (40 μm)
(Walcott B, 1998 and Ohasi Y, et al, 2006). The lipid layer is produced by the
meibomian gland. The aqueous layer is produced by the lacrimal glands and other
accessory glands. The mucous layer is produced by the goblet cells in the cornea and
conjunctiva. The lacrimal gland is of special interest because the acinar epithelial cells
that compose a majority of the gland are responsible for the regulated release of tear
proteins and fluid into the aqueous layer of the tear film. Besides water and electrolytes,
the tear fluid is composed of numerous proteins, including lysozymes (Bonavida B, et al,
1968; Fullard RT and Synder C, 1990), lipocalins (Delaire A, et al, 1992; Lassagne H and
Gachon AM, 1993; Redl B, 2000), lactoferrin (Fullard RT and Synder C, 1990; Kijlstra
A, et al, 1983; Yoshino, et al, 1996), transferrin (Salvatore MF, et al, 1999), growth
factors (van Setten G and Schultz G, 1994; Yoshino K, et al, 1996), secretory IgA and
secretory component (Fullard RT and Synder C, 1990; Kuizenga A, et al, 1990).
The lacrimal glands that are responsible for tear protein and fluid secretion are
comprised of tubular secretory epithelium organized into lobes that drain into ducts. The
ducts from different lobes converge to form larger ducts that finally drain onto the ocular
2

surface (Walcott B, 1998; Millar TJ, et al, 1996), see Figure 1.1. Two secretory cell
populations are present in the lacrimal gland: (1) the plasma cells of the immune system
and (2) the acinar and ductal cells of the secretory epithelium (Walcott B, 1998). The
plasma cells of the immune system, found in the interstitial spaces of the gland, secrete
immunoglobulin A (IgA), helping to protect the ocular surface from infection (Cameron
RG, et al, 1995; Franklin RM, 1989). The acinar cells, which account for 80% of the
cells present in the lacrimal gland, have several functions. One is to synthesize and
secrete tear-specific protein and another is to secrete water (Zoukhri D, 2006; Walcott B,
1998). The acinar cells are also responsible for transporting the IgA secreted by the
plasma cells from the interstitial compartment into the lumen of the gland (Walcott B,
1998).
3

The Lacrimal Gland Secretory Epithelium

Figure 1.1 Schematic diagram of the lacrimal gland secretory epithelium. The
diagram represents a lobe of the tubular secretory epithelium of the lacrimal gland.
Secretory proteins and fluid released into the lumens of multiple acini drain into ducts.
Ducts from different lobes converge to form larger ducts that finally drain onto the ocular
surface. (Walcott B, 1998; Millar TJ, et al, 1996)
4

Dry eye is characterized by tear deficiency or extreme tear evaporation and can
lead to injury of the ocular surface. Aqueous layer tear deficiency, the most common
cause of dry eye, is most commonly caused by a decrease or lack of the lacrimal gland
secretion (Zoukhri D, 2006; Stern ME, et al, 2004; Stern ME, et al, 1998). Even though
the mechanisms leading lacrimal gland dysfunction are poorly understood, there are
many potential mediators of lacrimal gland insufficiency. Apoptosis (Gao J, et al, 1998),
production of autoantibodies (Gao J, et al, 2004; Toda I, 2002), hormonal imbalance
(Sullivan DA, 2004; Shaumberg DA, et al, 2001), alterations in response to signaling
molecules (Zoukhri, et al, 1998), neural dysfunction, and increased levels of
proinflammatory cytokines may play a role in the dysfunction of the lacrimal gland
(reviewed in Zoukhri D, 2006). Since dry eye diseases are characterized by decreased
secretory function of the lacrimal gland, it would be interesting to determine if there is
altered trafficking or exocytotic activity in the lacrimal gland, in particular the acinar
cells that are responsible for tear protein and fluid secretion, under conditions associated
with disease.
The acinar cells are columnar with basally located nuclei and a large perinuclear
golgi apparatus (Walcott B, 1998). The acinar cells are joined by tight junctions located
on the lateral membranes near the cell apices that form a lumen surrounded by the apical
plasma membrane. Large vesicles of varying size fill the apical portion of the acinar
cells, (Rismondo V, et al, 1994; Wang Y, et al, 2003; Jerdeva GV, et al, 2005a and
2005b). Filamentous actin structures lie beneath the plasma membranes, but these are
particularly enriched underneath the apical plasma membrane (da Costa SR, et al, 1998;
5

Jerdeva GV, et al, 2005a). Primary lacrimal gland acinar cells, isolated from rabbit
lacrimal glands, are culture for 2-3 days. The cultured cells aggregate to form acinar
structures, in which the apical membranes gather to form lumens. Figure 1.2 illustrates
the morphology of the reconstituted lacrimal gland acinus.

The Lacrimal Gland Acinus

Figure 1.2 Schematic diagram of reconstituted lacrimal gland acinar cells. L –
lumen; APM – apical plasma membrane; BLM – basolateral plasma membrane; N –
nucleus. A dense cross-linked filamentous actin structure is illustrated in red underneath
the apical plasma membrane. A filamentous network of actin (in red) also exists
underneath the basolateral plasma membrane.

Regulated secretion in the lacrimal gland acinar cells

Fluid and protein secretion in the lacrimal gland acinar cells is tightly regulated by
growth factors and nerves. Growth factors generate a slower response, activating genes
6

and protein synthesis, but they can also elicit a quick secretory response (Chen LL, 2005;
Dartt DA, 2004; Dartt DA, 2001). Reflexes from the ocular surface and optic nerve can
trigger the nerves to provide rapid fluid and protein secretion from the lacrimal gland
through a neural reflex arc originating from the ocular surface (Botelho SY, 1964).
Stimuli on the ocular surface activate afferent sensory nerves on the cornea and the
conjunctiva and in turn activate the efferent sympathetic and parasympathetic nerves that
innervate the lacrimal gland (Zoukhri D, 2006; Dartt DA, 2001; Walcott B, 1998; Sibony
PA, et al, 1988). Neurotransmitters released by the nerves interact with muscarinic, α
1
-
adrenergic, β-adrenergic, and vasoactive intestinal peptide (VIP) receptors on the
basolateral membrane of the lacrimal gland acinar cells, activating various signaling
pathways to stimulate the release of secretory proteins contained in secretory vesicles at
the apical plasma membrane (Dartt DA, 2001; Hodges RR, et al, 1992).
In my experiments, a cholinergic agonist, carbachol (CCH), is mainly used to
stimulated secretion in the lacrimal gland acinar cells. Carbachol mimics acetylcholine
and thus activates the muscarinic receptor, in particular, the M3-subtype, which is the
only subtype of the known five that is present in the lacrimal gland (Dartt DA, 2001;
Mauduit P, et al, 1993). The muscarinic receptors are coupled to a G
αq
subtype of G
protein, which is linked to phospholipase Cβ (Μeneray MA and Fields TY, 2000;
Mauduit P, et al, 1993). Activation of phospholipase Cβ hydrolyzes phosphatidylinositol
bisphosphate (PIP
2
), generating diacylglycerol and 1,4,5-inositol triphosphate (1,4,5-IP
3
),
(reviewed by Dartt DA, 2001 and Berridge MJ, 1987; Dartt DA, et al, 1990). 1,4,5-IP
3

7

causes the endoplasmic reticulum to release intracellular stores of Ca
2+
, which stimulates
secretion in the lacrimal gland acinar cells (Dartt DA, et al, 1990). Diacylglycerol
activates members of the protein kinase C (PKC) family (reviewed by Dartt DA, 2001
and Berridge MJ, 1987). The lacrimal gland expresses five of the eleven known isoforms
of PKC and activation of the isoforms has distinct effects on secretion and Ca
2+
handling
in the lacrimal gland acinar cells (Zoukhri D, et al, 1997; Zoukhri D, et al, 1994; Zoukhri
D, et al, 1993).

Secretory vesicle exocytosis in the lacrimal gland
Several secretory vesicle populations that are mobilized by secretagogue stimulation
have been identified in the lacrimal gland. One of these secretory vesicle populations
that is being studied in the lacrimal gland has been characterized as a mature secretory
vesicle and is associated with rab3D, an isoform of the rab3 protein family. Rab proteins,
small GTPases of the ras superfamily, regulate each of the four major steps in membrane
traffic: 1) vesicle budding, 2) vesicle motility, 3) vesicle tethering, and 4) fusion of the
vesicle membrane to target compartments (Cai H, et al, 2007; Grosshans BL, et al, 2006;
Jordens J, et al, 2005; Pfeffer SR, 2001). More than 60 rab proteins have been identified
in mammalian cells and many of them display distinctive distributions on subcellular
membrane compartments (Grosshans BL, et al, 2006; Stenmark H and Olkkonen VM,
2001). Rab GTPaes regulate their activity by cycling between an activated, GTP-bound
state and an inactive, GDP-bound state. The switch between the two states is controlled
by guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs).
8

GEFs cause a nucleotide exchange, triggering the exchange of GDP for GTP, and GAPs
accelerate the hydrolysis of the GTP bound to the rab protein to GDP. In the activated
GTP-bound state, rab proteins interact with specific sets of effector proteins to regulate
the different steps in membrane traffic (Grosshans BL, et al, 2006; Wu K, et al, 2006;
Pfeffer SR, 2001; Stenmark H and Olkkonen VM, 2001).
Rab3A, rab3b, rab3C, and rab3D are highly homologous isoforms that have been
well characterized in cells with regulated secretory pathways (Durchen F and Goud B,
2000; Geppert M, 1998; Schlüter OM, et al, 2002). Rab3 proteins are associated with
secretory vesicles and are shown to have both positive and negative regulatory functions
in a number of steps in regulated secretion (Durchen F and Goud B, 2000; Schlüter OM,
et al, 2002). Of particular interest in the lacrimal gland is rab3D, which is present at
twice the concentration of rab3A in the brain, where rab3A is the most abundant rab
(Schlüter OM, 2002). Rab3D is primarily localized to secretory granules in pancreatic,
parotid, and lacrimal gland acinar cells (Ohnishi H, et al, 1996; Raffaniello RD, et al,
1999; Schlüter OM, et al, 2002; Wang, et al, 2003).
Functionally, rab3D has been mainly been associated with exocytosis in acinar cells,
although there is also evidence that rab3D is also involved in other secretory functions.
In pancreatic acinar cells, overexpression of wild-type rab3D in transgenic mice
stimulates amylase release (Ohnishi H, et al, 1997). The overexpression of dominant
negative rab3D, a form that cannot bind GTP, in pancreatic acinar cells inhibited amylase
release (Chen X, 2002, 2003). In rab3D knockout mice, changes in the release of
secretory protein from exocrine cells was not detected, but the study revealed the
9

presence of secretory granules in pancreatic and parotid acini that were twice as large as
those in wild-type cells, suggesting that rab3D may play a role in the biogenesis of
secretory granules (Riedel D, et al, 2002). Since the role of rab3D in regulated secretion
in exocrine cells is not yet well defined, the lacrimal gland acinar cells, with its
abundance of rab3D, represents a good model system to characterize the role of rab3D in
exocrine secretory vesicle trafficking and exocytosis.
Studies in lacrimal gland acinar cells so far have shown rab3D to be present on larger
mature secretory vesicles (mSVs). Indirect immunofluorescence studies by Wang Y, et
al (2003) demonstrated that the mSVs, enriched in rab3D, are localized in the subapical
region of the lacrimal gland acinar cells in the resting state. Upon CCH-stimualtion, the
mSVs fuse with the apical plasma membrane, releasing their contents into the lumen of
the acini. Wang Y, et al (2003) also demonstrated the presence of another secretory
population, identified as the recruitable secretory vesicles (rSVs). The rSVs are smaller
vesicles enriched in vesicle-associated membrane protein 2 (VAMP2) and dynein, and
they are dispersed throughout the cytosol. With CCH-stimulation the rSVs traffic to the
subapical region using microtubules. Figure 1.3 depicts the trafficking of the mSVs and
rSVs in the lacrimal gland acinar cells. Although these studies by Wang Y, et al (2003)
have characterized the subcellular localization of various secretory vesicle markers,
further investigation is necessary to further understand the roles of rab3D and VAMP2 in
the regulation of secretory vesicle trafficking and exocytosis.

10

Figure 1.3 Schematic diagram of the secretory pathways identified in the rabbit
lacrimal gland acinar cells. Through biochemical and morphological studies, two types
of secretory vesicle (SV) populations have been identified in lacrimal acinar cells that are
mobilized by secretagogue stimulation, recruitable secretory vesicles (rSV) and mature
(1-3 μM) secretory vesicles (mSV). rSVs are enriched in dynein and VAMP2 and are
dispersed throughout the cell in the resting state, but are recruited to the subapical region
with carbachol stimulation. Rab3D-associated mSVs are enriched in the subapical region
in the resting state but are exocytosed into the lumen upon carbachol stimulation. Further
studies are needed to determine whether rSVs are a precursor to mSVs, or whether rSVs
represent a distinct type of secretory vesicle.
?
?
11

SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptor)
involved in apical exocytosis in acinar cells

Soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs)
are membrane-associated proteins essential for membrane fusion, a process in which two
lipid bilayers of previously separate intracellular membrane compartments are physically
merged to promote content exchange (Söllner TH, 2003). SNARE proteins form a
superfamily of small proteins that have a characteristic SNARE motif, which comprises
of 60-70 amino acids arranged in a heptad repeat (Jahn R and Scheller RH, 2006; Ungar
D and Hughson FM, 2003). SNARE proteins are classified into Q-SNAREs (Qa, Qb, or
Qc), also known as the syntaxins or SNAP-25 subfamily, or R-SNAREs, also known as
vesicle-associated membrane proteins (VAMPs), to reflect the presence of glutamine (Q)
or arginine (R) residues in their core binding domains. An α-helical SNARE motif from
each of the Qa-, Qb-, Qc-, and R-SNAREs contribute to the formation of a highly stable
coiled-coiled structure, which is believed to provide the driving force for membrane
fusion (Chen YA, Scheller RH, 2001; Lin RC and Scheller, RH, 2000; Gerst GE, 2003,
Jahn R and Scheller RH, 2006). Every cell expresses a wide variety of SNARE proteins
which are distributed to distinct intracellular membrane compartments.
SNARE proteins were first identified and characterized in neuronal cells, where
syntaxin 1, SNAP-25, and VAMP2 were found to from a SNARE complex to mediate
neurotransmitter release from synaptic vesicles (Chen YA, Scheller RH, 2001). Since the
first discovery of the SNARE proteins, many others have been identified in a variety of
cell types. Of particular interest are the SNAREs that are present in exocrine cells, since
12

they are a good model system to study secretory events. SNARE proteins have been
identified and characterized in exocrine cells, such as the pancreatic and parotid acinar
cells. Pancreatic and parotid acinar cells are polarized epithelial cells that are used as a
model system to study secretory events in nonexcitable cells (Castle JD, 1990).
Studies in pancreatic acinar cells revealed that VAMP2, an 18-kDa protein, was
localized to secretory (zymogen) granules. When VAMP2 was cleaved with tetanus
toxin light chain, Ca
2+
-regulated pancreatic enzyme secretion was only partially inhibited
(Gaisano HY, et al, 1994), indicating that there may be other VAMP2-independent
mechanisms regulating exocytosis. Recently, VAMP8 was also identified to present on a
separate population of zymogen granules in pancreatic acinar cells. Weng N, et al (2007)
revealed that the acinar cells express VAMP2 and VAMP8 on separate populations of
zymogen granules and they coordinate constitutive and Ca
2+
-regulated secretory
pathways. Other studies revealed syntaxins 2-4 are expressed in pancreatic acinar cells.
Syntaxin 2 was localized in the apical plasma membrane, syntaxin 4 was localized in the
basolateral membranes, and syntaxin 3 was localized in granular compartments. These
studies also showed that SNAP-23was localized in the basolateral membrane (Gaisano
HY, et al, 1996; Hansen NJ, et al, 1999).
Studies in parotid acinar cells showed that VAMP2 was also expressed on zymogen
granules (Gaisano HY, et al, 1996). VAMP8 was also recently identified to present in the
apical region of the parotid acinar cells (Wang CC, et al, 2007). Q-SNAREs, syntaxins
2-4 and SNAP-23, were also identified in parotid acinar cells. Syntaxins 2 and 3 were
localized in the apical plasma membrane and syntaxin 4 in the basolateral membrane.
13

SNAP-23 was localized in the apical plasma membrane and intracellular membrane (Imai
A, et al, 2003). Immunoprecipitation studies revealed that no interaction between
syntaxins 2, 3, and 4 with VAMP2. The same studies however showed that syntaxin 3
interacts with VAMP8. SNAP-23 was also shown to interact with syntaxin 3, syntaxin 4,
VAMP2, VAMP3, and VAMP8 (Imai A, et al, 2003). These studies demonstrated that
these various SNARE interactions may play a role in apical exocytosis for salivary
secretion. A brief summary of the SNAREs expressed in pancreatic and parotid acinar
cells is shown in Table 1.1.
Pancreatic Acinar Cells Parotid Acinar Cells
Syntaxin 1 Undetectable Undectable
Syntaxin 2 APM APM
Syntaxin 3 GM APM
Syntaxin 4 BLM BLM
SNAP-23 BLM APM, ICM
SNAP-25 Undetectable Undetectable
VAMP2 ZG ZG
VAMP8 ZG ZG

Table 1.1 SNAREs expressed in pancreatic and parotid acinar cells. Brief summary
of the SNAREs expressed in pancreatic and parotid acinar cells that play a role in plasma
membrane exocytosis. APM, apical plasma membrane; BLM, basolateral plasma
membrane; GM, granular membranes, ICM, intracellular membrane; ZG, zymogen
granules.

14

Lacrimal gland acinar cells exhibit similar characteristics to those of pancreatic and
parotid acinar cells. VAMP2, a R-SNARE identified to be already present on zymogen
granules in pancreatic and parotid acinar cells, was also identified to be on secretory
vesicles in lacrimal gland acinar cells. The secretory vesicles enriched in VAMP2, which
has been identified as recruitable secretory vesicles (rSVs), were dispersed throughout the
resting acini and with carbachol stimulation, these secretory vesicles were recruited to the
subapical region (Wang Y, et al, 2003). It is not yet known whether these VAMP2-
enriched vesicles fuse directly with the apical plasma membrane or with other secretory
vesicles before fusing with the apical plasma membrane. Since constitutive and regulated
exocytosis play a crucial role in tear protein and fluid secretion, it is important to
determine which SNARE proteins in the lacrimal gland acinar cells play a role in apical
exocytosis.
Clostridial neurotoxins, tetanus and botulinum toxins, are great tools to study the
function of SNARE proteins. These toxins are synthesized by bacteria as a single
polypeptide chain, consisting of a heavy chain and a light chain (Sathyamoorthy V and
DasGupta BR, 1985). The heavy chain is responsible for binding to specific receptors on
the cell surface and transporting the protein into the cytosol of the cell (Zdanovskaia MV,
et al, 2000). The catalytic domain of the light chain acts as a zinc endopeptidase,
cleaving SNARE proteins (Zdanovskaia MV, et al, 2000; reviewd in Humeau Y, et al,
2000 and Anner-Hilger G and Bigalke H, 1995). The light chains from the different
serotypes of botulinum toxin cleave different SNARE proteins, so they can be utilized to
determine specific interactions of the different SNARE proteins with various proteins and
15

to determine the function of the SNARE protein in various fusogenic events. The light
chain of botulinum toxin B (BotB-LC) is of particular interest because it cleaves
VAMP2, a SNARE protein that is enriched on the rSVs in the lacrimal gland acinar cells
(Fujita-Yoshigaki J, et al, 1996; Tamori Y, et al, 1996). In parotid acinar cells, BotB was
shown to cleave VAMP2 and inhibit cAMP-dependent amylase secretion (Fujita-
Yoshigaki J, et al, 1996), so it would be interesting to see what effect inhibiting VAMP2
in the lacrimal gland acinar cells has on secretory vesicle exocytosis and other vesicle
populations.

Polymeric IgA receptor trafficking

The polymeric IgA receptor (pIgR) is expressed in a variety of mucosoal
epithelial cells, including small and large intestinal, nasal, tracheal and bronchial, cervical
and uterine epithelial cells (Hunziker W and Kraehenbuhl J-P, 1998). The lacrimal gland
acinar epithelial cells also express the pIgR (Qian L, et al, 2003). pIgR is a
transmembrane protein with five extracellular Ig homology domains and a long
cytoplasmic domain that contains signs for intracellular sorting and endocytosis
(Hunziker W and Kraehenbuhl JP, 1998; Kaetzel CS, 2001; Kaetzel CS, 2005; Mostov
KE, 1994). The pIgR mediates the transport of polymeric immunoglobulins (dimeric
IgA and pentameric IgM) across polarized epithelial cells, allowing the release of its
extracellular domain as free secretory component (SC) or as secretory IgA (sIgA) when
its ligand is bound (Hunziker W, Male P, and Mellman I, 1990; Kaetzel CS, 2001;
Kaetzel, 2005). Transport of pIgR across the epithelium is important, because SC and
16

sIgA play an important role in protecting the mucosal and ocular surfaces from
environmental pathogens (Hunziker W and Kraehenbuhl J-P, 1998; Kaetzel, 2005;
Phalipon A and Corthésy B, 2003).
Transcytotic trafficking of the pIgR has been thoroughly studied in epithelial
MDCK cells stably expressing pIgR. These studies in the MDCK cells have revealed a
model for pIgR trafficking, which starts in the rough endoplasmic reticulum, where pIgR
is synthesized. The receptor then is transported to the Golgi apparatus and sorted into
vesicles at the trans-Golgi network. These vesicles deliver pIgR to the basolateral surface
of the epithelial cell, where pIgR is exposed to its ligands, dimeric IgA (dIgA) and/or
pentameric IgM (pIgM) produced by plasma cells, mostly found in the lamina propria
underlying the epithelial cells. With or without its ligand bound, pIgR is endocytosed
and trafficked to basolateral early endosomes. The receptor with or without its ligand
bound is then transported to a common endosomal compartment and sorted into apical
recycling endosomes, from which it is delivered to the apical membrane (Apodaca G, et
al, 1994; Barroso M and Sztul ES, 1994). At the apical surface, the extracellular region
of pIgR is cleaved with or without its ligand bound to release sIgA or SC, respectively
(Kaetzel CS, et al, 2005).
Members of rab family of small GTPases play an important role in many steps of
membrane traffic. Several studies have shown that some rab proteins can directly interact
with certain proteins to regulate their traffic. One study by Hamelin E, et al (2005)
showed an interaction between rab11, a rab GTPase that regulates transport from early
endosomes to recycling endosomes, and the b-isoform of the thromboxane A2 receptor
17

(TPβ), in HEK293 cells. TPβ only interacted with rab11 in its GDP-bound form and
activation of the receptor with an agonist did not change the interaction, indicating that
rab11 may be involved in the trafficking of receptor following its constitutive
internalization. In another study, pIgR was shown to directly interact with rab3B in
MDCK cells (van IJzendoorn SCD, et al, 2002). In the study, rab3B was localized to
vesicular structures containing pIgR in the subapical region. pIgR was found to directly
interact with the GTP-bound form of rab3B; however, the binding of dIgA to the receptor
disrupted the interaction. The binding of dIgA to pIgR at the basolateral surface
stimulated the transcytotic trafficking of the receptor to the apical surface, but when the
GTP-locked form of rab3B was overexpressed, the dIgA-stimulated transcytosis of the
receptor was inhibited, indicating the interaction of pIgR with rab3B may be necessary
for controlling its trafficking. The two examples of rab proteins directly interacting with
cargo proteins show many differences, indicating that the interaction between rab and
cargo proteins may be differentially regulated. Further studies will have to reveal how
rab and cargo proteins interact to regulate the trafficking of the cargo protein.
Even though the trafficking of pIgR has been thoroughly studied, the trafficking
steps have mainly been elucidated in the epithelial MDCK cells transfected with pIgR. It
would be interesting to see if the trafficking of endogenously expressed pIgR in a more
physiologically relevant system, such as the lacrimal gland, is similar or different than the
trafficking mechanisms seen in the epithelial MDCK cells. Lacrimal gland acinar cells
are a good candidate for studying pIgR trafficking, since studies have shown that there is
a large concentration of SC in the tear fluid (Sullivan DA and Allansmith AR, 1984;
18

Sullivan DA, et al, 1984a), and the lacrimal gland acinar cells are the major source of SC
(Lambert RW, et al, 1994; Sullivan DA and Allansmith AR, 1984; Sullivan DA, et al,
1984b). Previous studies in our lab have shown that SC is produced in large amounts by
the rabbit lacrimal gland acinar cells (Jerdeva GV, et al, 2005b), so determining the
trafficking of pIgR and the regulation of SC secretion in the lacrimal gland acinar cells
may help us better understand the role of SC in tear fluid.

19

Chapter II: Materials and Methods

Reagents
Chemicals. Carbachol (CCH), nocodazole, GTP, GTPγS, GDP, GDPβS,
rhodamine phalloidin, methyumbelliferyl-α-D-glucosaminide, N-ethylmaleimide, and
other chemical reagents were obtained from Sigma-Aldrich (St. Louis, MO). Ni
2+
-
nitriloacetate (Ni-NTA) beads used to purify (His)
6
-tagged proteins were obtained from
Sigma-Aldrich (St. Louis, MO). His-select gel used in pull-down experiments was
obtained from Qiagen (Valencia, CA). Glutathione Uniflow Resin was obtained from
Clontech Laboratories, Inc (Mountain View, CA).
Antibodies. Anti-rab3D polyclonal antibodies were generated in rabbits against
recombinant (His)
6
-tagged wild-type rab3D expressed in E. coli and were purified by
affinity chromatography using protein A/G agarose columns (Antibodies Inc, Davis, CA;
Antagene Inc, Mountain View, CA). Anti-SC polyclonal antiserum was generated by a
commercial vendor in sheep against SC (Capralogics, Hardwick, MA) purified from
rabbit bile (Pel-Freeze, Rogers, AR) by preparative gel electrophoresis.
Rabbit polyclonal anti-VAMP2 antibodies were obtained from BD Transduction
Laboratories (Franklin Lakes, NJ). Rabbit polyclonal antiserum or purified antibodies of
anti-syntaxin 3 and anti-SNAP-23 were obtained from Synaptic Systems (Goettingen,
GERMANY). Rabbit anti-syntaxin 2, anti-syntaxin 3, and anti-syntaxin 4 antibodies
were generous gifts from Dr. J.M. Edwardson (University of Cambridge, Cambridge,
20

UK). Rabbit anti-VAMP8 polyclonal antibodies were a generous gift from Dr. W. Hong
from the Institute of Molecular and Cell Biology in Singapore.
Mouse anti-GFP monoclonal antibodies and rabbit anti-GFP polyclonal antibodies
were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Mouse anti-His(
6
)
monoclonal antibodies and rabbit anti-HA.11 polyclonal antibodies were obtained from
Covance (Richmond, CA). Mouse anti-actin monoclonal antibodies were obtained from
Chemicon (Temecula, CA).
For Western blots, secondary antibodies conjugated to either IRDye-700 or
IRDye-800 were obtained from Rockland Immunochemicals, Inc (Gilbertsville, PA). For
immunofluorescence studies, secondary goat anti-rabbit antibodies conjugated to
fluorescein isothiocyanate (FITC) were obtained from MP Biomedicals, Inc. (Solon,
OH). Secondary goat anti-mouse antibodies conjugated to FITC were obtained from
Sigma-Aldrich (St. Louis, MO). Secondary goat anti-rabbit, goat anti-mouse, donkey
anti-sheep antibodies conjugated to various Alexa Fluor dyes were obtained from
Molecular Probes (Eugene, OR).

Lacrimal gland acinar cell isolation and primary culture
Isolation of lacrimal gland acini from female New Zealand white rabbits (1.8-2.2
kg) obtained from Irish Farms (Norco, CA) was in accordance with the Guiding
Principles for Use of Animals in Research and approval from the institution’s IACUC.
Lacrimal acini were isolated as described in da Costa SR, et al (1998) and cultured for 2-
3 days. Cells prepared in such a manner aggregate to form acinar structures, in which the
21

apical membranes gather to form lumens. Individual cells within the acinar structures
display distinct apical and basolateral domains and maintain a robust secretory response
(da Costa SR, et al, 1998; da Costa SR, et al, 2003; Wang Y, et al, 2003).

Adenoviral constructs and transduction
Replication-defective adenoviral (Ad) constructs were used in these studies. Ad-
encoding green fluorescent protein (GFP) alone (Ad-GFP) was used as controls. Ad-
encoding GFP-tagged VAMP (Ad-GFP-VAMP2) was a kind gift from Dr. Serhan Karvar
(University of Southern California). Ad encoding (His)
6
-tagged wild-type rab3D
(rab3DWT) and GFP separately (Ad-rab3DWT), Ad encoding (His)
6
-tagged dominant-
negative rab3DT36N and GFP separately (Ad-rab3DTN), and Ad encoding (His)
6
-tagged
constitutively-active rab3DQ81L and GFP separately (Ad-rab3DQL) were kind gifts
from Dr. John A. Williams (University of Michigan, Ann Arbor, MI). Ad encoding a
syncollin-GFP fusion protein (Ad-syncollin-GFP) was a kind gift of Dr. Chris Rhodes
(University of Chicago).
Reconstituted rabbit LGAC cultured for 2 days were exposed to the Ad constructs
for 1-2 hours at a multiplicity of infection (MOI) of 5, then washed twice with
Dulbecco’s PBS (dPBS) (-Ca
2+
, -Mg
2+
) and incubated in fresh culture medium for 18-20
hours at 37ºC and 5% CO
2
. On day 3 of culture, transduction efficiency was determined
by observing the GFP fluorescence. Only lacrimal gland acinar cell cultures with at least
an ~80% efficiency of cellular transduction were routinely used for secretion studies.

22

Production and purification of recombinant proteins
GST-tagged proteins. Plasmids encoding GST-tagged forms of the cytoplasmic
domains of VAMP2 and VAMP8 were gifts from Dr. S. Karvar (University of Southern
California, Los Angeles, CA) and Dr. W. Hong (Institute of Molecular and Cell Biology,
Singapore), respectively. They were expressed in Escherichia coli (E. coli) and purified
on glutathione beads.
(His)
6
epitope-tagged proteins. Plasmids encoding (His)
6
epitope-tagged forms
of wild-type rab3D (rab3DWT), constitutively active mutant Q81L (rab3DQ81L), and
dominant-negative T36N (rab3DT36N) mutant were gifts from Dr. John A. Williams
(University of Michigan, Ann Arbor, MI). They were expressed in E. coli and purified
on Ni-NTA beads.

Confocal fluorescence microscopy
Reconstituted rabbit lacrimal acini cultured on Matrigel-coated coverslips were
processed as described (da Costa SR, et al, 1998; da Costa SR, et al, 2003; Wang Y, et al,
2003). The acini were briefly rinsed with dPBS, fixed and permeabilized with ice-cold
ethanol at -20°C for 5 minutes, rehydrated in dPBS, and blocked with 1% bovine serum
albumin. Acini were incubated with appropriate primary and fluorophore-conjugated
secondary antibodies and fluorophore-conjugated phalloidin. The coverslips were
mounted onto glass slides with Prolong Antifade mounting medium (Molecular Probes,
Eugene, OR).
23

Most confocal images were obtained with a Zeiss LSM 510 Meta NLO imaging
system (Germany) equipped with Argon, red and green HeNe lasers mounted on a
vibration-free table and attached to an incubation chamber controlling temperature,
humidity and CO
2
. The ability of this system to acquire fluorescence emission signals
resolved within narrow ranges in multitrack mode, and the use of singly labeled control
samples ensured the validity of co-localization studies by assessing lack of signal bleed-
through.
Analysis of the extent of colocalization between rab3D and SC/pIgR was
determined using similar to the methods described in (Jerdeva GV, et al, 2005b). With
the Enhanced Colocalization tool available with the Zeiss LSM510 software, the
thresholding function was used to establish background intensity, then a region of interest
was selected around the luminal area that was less than 2.0 μm beneath the apical actin.
The channel representing SC/pIgR, syntaxin 3, or SNAP-23 were used to calculate the
colocalization coefficient, c, which was calculated as follows: c = colocalizing
pixels/total pixels. The coefficient represents the ratio of the sum of intensities of
colocalizing pixels with the overall sum of pixel intensities above threshold. The values
range from 0 to 1 with 0 representing no colocalization and 1 representing complete
colocalization. Panels of images were compiled in Adobe Photoshop 7.0 (Adobe
Systems Inc, Mountain View, CA).

24

Antibody uptake immunofluorescence studies
Reconstituted rabbit lacrimal acini cultured on Matrigel-coated coverslips were
rinsed with warm dPBS and incubated with fresh media for 2 hours on day 3 of culture.
Afterwards, sheep anti-SC antibody (100 μg/ 2x10
6
cells) with or without 10X mouse
immunoglobulin G (IgG) was added to the media and was chilled on ice for 2 hours. The
acini were then incubated with or without 100 μM CCH at 37°C, 5% CO
2
for 60 minutes.
Resting and CCH-stimulated acini were fixed and processed as described under
“Confocal fluorescence microscopy.” The acini were incubated with secondary donkey
anti-sheep antibody conjugated to Alex Fluor 680 and rhodamine phalloidin. The
coverslips were mounted onto glass slides with Prolong Antifade mounting medium.

Live cell imaging
Lacrimal gland acini were grown on 35-mm glass bottom dishes coated with
matrigel. The acini were transduced with adenoviral constructs on day 2 of the acinar
cell culture and were imaged on day 3. Confocal images were obtained with a Zeiss LSM
510 Meta NLO imaging system equipped with Argon, red HeNe and green HeNe lasers
mounted on a vibration-free table and for live cell imaging. The stage was attached to an
incubation chamber controlling temperature, humidity and CO
2
.

Western blot analysis
Proteins separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS-PAGE) were transferred onto nitrocellulose membrane (Whatman, Dassel,
25

Germany). The membranes were blocked with blocking buffer (Li-Cor, Lincoln, NE;
Rockland Immunochemicals, Inc., Gilbertsville, PA) and probed with appropriate
primary antibodies and secondary antibodies conjugated to either IRDye-700 or IRDye-
800. Blots were quantified using the Li-Cor Odyssey Scanning Infrared Fluorescence
Imaging System (Lincoln, NE). For image panels, the fluorescent signals were converted
digitally to black and white images.

Lacrimal gland acini membrane isolation
Lacrimal gland acini were rinsed and resuspended in PMEE buffer (35 mM
PIPES, 5 mM MgSO
4
, 1 mM EGTA, 0.5 mM EDTA, pH 7.2) with protease inhibitors
and 1mM DTT. The resuspended cells were gently lysed with a balch press (20 passes)
and centrifuged. The supernatant was ultracentrifuged at 100,000 x g for 30 minutes at 4
ºC in a Beckman S120AT2-0140 rotor. The supernatant was saved as Si (soluble)
fraction. The pellet was resuspended in PMEE buffer and saved as Pi (membrane)
fraction.

Subcellular fractionation analysis
Lacrimal gland acini were rinsed and resuspended in 5% sorbitol cell lysis buffer,
lysed, and centrifuged. The pellet was resuspended, homogenized, and centrifuged again.
Supernatants mixed with 87.5% sorbitol were loaded onto preformed sorbitol density
gradients, which were then centrifuged at 100,000 x g for five hours at 4 ºC in a Beckman
SW28 rotor. The gradients were collected in 12 fractions, diluted with sorbitol lysis
26

buffer, and centrifuged at 250,000 x g for 90 min. Resulting pellets were resuspended in
5% sorbitol lysis buffer. Biochemical analyses were conducted as previously described
(Wang et al, 2003). Differences were evaluated with Student’s t-test with p ≤ 0.05.

RT-PCR analysis
The lacrimal gland was isolated from female New Zealand white rabbits and
homogenized with the Polytron PT-2100 tissue homogenizer (Kinematics, Inc, Newark,
NJ) in the lysis buffer provided in the Total RNA Purification Kit for Cells and Tissues
(Gentra Systems, Minneapolis, MN). The protocol provided by the company was used to
prepare total RNA. Reverse transcription (RT) was carried out using a protocol provided
in the Advantage RT-for-PCR Kit (BD Biosciences, San Jose, CA). RT was conducted
with total RNA at a concentration of 1 μg per 20 ul of reaction at 42 ºC for 1 hour and 94
ºC for 5 min and placed on ice. The PCR reaction was set up using a kit from Invitrogen
(Carlsbad, CA). Primer pairs specific for syntaxin 1
(5’GGTCCAAGCTGAAGAGCATT and 5’TGGTCGCTCCTTGACCTTC), syntaxin 3
(5’GTCCGGAACAAGCTGAAGAG and 5’AGTAGCTGAGGGTCTAAAGG),
syntaxin 4 (5’CAAACAGTTGGGAAGGGAGA and
5’CTCGACAGNGCCTTCAAACAC) were used. PCR was set up in a GeneAmp PCR
system from 9700 from ABI (Foster City, CA). PCR conditions were programmed in the
order of 5 cycles as cycle 1: 94 ºC for 3 min, 1X cycle; cycle 2: 94ºC for 30 sec, 50ºC for
30 sec, 72ºC for 30 sec, 10X cycles; cycle 3: 94ºC for 30 sec, 58ºC for 30 sec, 72ºC for
27

30 sec, 20X cycles; cycle 4: 72 ºC for 5 min, 1X cycle; and cycle 5: 4 ºC overnight, 1X.
These PCR DNAs were checked by gel electrophoresis using a 2% agarose gel.

Cleavage of VAMP2 with bolutinum toxin B – light chain
Electroporation. 3.6×10
7
resting LGAC were gently pelleted and resuspended in
500 μl fresh medium. The resuspended cells were placed into a cuvette for
electroporation (Gene Pulser Cuvette, Biorad, Hercules, CA) with 120 nM botulinum
toxin B-light chain (BotB-LC) or β-galactosidase. The electroporation conditions were
as follows: electrode gap, 0.4 cm; 250V; 960 μF capacitance. Pulse lengths ranged from
11-20 ms. Electroporation efficiency (>80% in each assay) was confirmed with β-
galactosidase, and phase microscopy to detect the colorimetric production with 5-bromo-
4-chloro-3-indolyl-β-D-galactoside as substrate. After electroportation, cells were kept
on ice for 10 min and then lysed in RIPA buffer (150 mM NaCl, 50 mM Tris-Cl, 0.5%
NaDeoxycholate, 0.5 mM EDTA, 0.1% Tx-100, 1% NP-40) with protease inhibitors.
The proteins in the lysate were separated by SDS-PAGE and the cleavage of VAMP2 by
the BotB-LC was determined by Western blot analysis.
Memrane treatment with BotB-LC. Membranes of LGAC were prepared as
described in “lacrimal gland acini membrane isolation.” Membrane (Pi) fractions (285
μg) were treated with 40 nM or 120 nM BotB-LC for 1 or 3 hours in a 37°C waterbath.
After the BotB-LC treatment, the Pi fractions were separated by SDS-PAGE and the
cleavage of VAMP2 by the BotB-LC was determined by Western blot analysis.
28

Pull-down assays
GST-pulldown assays. GST-, GST-VAMP2 (cytosolic domain), and GST-
VAMP8 were expressed in E.coli and purified on glutathione agarose bead columns.
7.2×10
7
resting or CCH-stimulated (100 μM, 15 min) LGAC were solubilized in binding
buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM EGTA, 0.1 mM MgCl
2
, 1% Tx-
100). In some experiments, the cells were treated with 25 μM N-ethylmaleimide for 60
minutes in a 37°C shaking water bath. The acinar cell lysate was incubated with 35-40
μg of recombinant GST, GST-VAMP2, or GST-VAMP8 bound to glutathione agarose
beads (overnight, 4 ºC). The proteins eluted from the beads were separated by SDS-
PAGE and analyzed by Western blotting.
(His)
6
-pulldown assays. (His)
6
epitope-tagged forms of rab3DWT, the
constitutively active mutant, rab3DQ81L, and the dominant-negative mutant,
rab3DT36N, were expressed in E. coli and purified on Ni-NTA bead columns. 3.6×10
7

resting or CCH-stimulated LGACs were solubilized in a buffer containing 1% Triton X-
100, 20 mM Na-HEPES, pH 7.4, and 50 mM KCl, and incubated overnight at 4°C with
40 μg of recombinant wild-type or mutant rab3D. In some experiments, the cells were
stimulated with 100 μM CCH for time points up to 60 minutes. In other experiments, the
lysate was supplemented with 10 μM nonhydrolyzable GTPγS, 10 μM nonhydrolyzable
GDPβS, or 0.5 mM GTP. Rab3D was recovered from the lysates by incubation with His-
Select Nickel Affinity Gel beads for 1 hour at room temperature and washed. Rab3D and
29

any interacting proteins were eluted from the beads with SDS-PAGE sample buffer,
separated by SDS-PAGE, and analyzed on Western blots.

Co-immunoprecipitation assays
Lacrimal gland acini were rinsed and treated with N-ethylmalameide (NEM, 25
mM) as previously described by Galli (1998). Acini were spun down and then incubated
with fresh warm media with or without carbachol (100 mM, 15 min). Acini were then
spun down and resuspended in a suspension buffer (50 mM Tris-HCl, pH 8, 150 mM
NaCl, 10 mM EDTA, 1% Tx-100), lysed, and centrifuged. Resulting supernatants were
incubated (2 hours, 4 ºC) with anti-syntaxin 3, anti-SNAP-23, or anti-VAMP2 antibodies,
upon which Protein A/G agarose beads were added to incubate overnight at 4 ºC. The
proteins were eluted from the beads with SDS-PAGE sample buffer, separated by SDS-
PAGE, and analyzed by Western blotting.

Secretion assays
Syncollin-GFP release. Rabbit lacrimal gland acini were seeded on Matrigel-
coated 12-well plates. The acinar cells were transduced on day 2 with Ad-Syncollin-
GFP. On day 3 of culture, the transduced lacrimal acini were stimulated with CCH (100
μM) and the media was collected at time points up to 30 min. The cell pellets were
dissolved in 0.5 N NaOH. Equal volumes of the media were concentrated in YM-10
Microcons (Millipore, Bedford, MA) and resolved by SDS-PAGE. Syncollin-GFP was
detected by Western blotting with an antibody against GFP and an appropriate
30

fluorophore-conjugated sedondary antibody. Signal intensities were quantitated and
normalized to pellet protein for each sample.
Secretory component release. Rabbit lacrimal gland acini seeded on Matrigel-
coated 12-well plates. In some experiments, the acinar cells were transduced on day 2
with Ad-GFP, Ad-rab3DWT, Ad-rab3DTN, or Ad-rab3DQL. On day 3 of culture,
untransduced or transduced lacrimal acini were stimulated with CCH (100 μM) and the
media was collected at time points up to 30 min. The cell pellets were dissolved in 0.5 N
NaOH. Equal volumes of the media were concentrated in YM-10 Microcons (Millipore,
Bedford, MA) and resolved by SDS-PAGE. SC was detected by Western blotting.
Signal intensities were quantitated and normalized to pellet protein for each sample.
Bulk protein release. Rabbit lacrimal gland acini seeded on Matrigel-coated 12-
well plates. On day 3 of culture, the untransduced and/or transduced lacrimal acini were
stimulated with CCH (100 μM) and the media was collected at time points up to 30 min.
The cell pellets were dissolved in 0.5 N NaOH. Media collected from various secretion
experiments were analyzed for bulk protein release by detecting overall protein
concentration with the Bio-Rad Protein Assay Dye (Bio-Rad Laboratories, Inc., Hercules,
CA). The assays were prepared in clear flat bottom 96-well plates (Thermo, Mildord,
MA). The dye was incubated with the media for 5-10 minutes and the absorbance was
read at 570nm on a plate reader (Tecan, Austria). The bulk protein values were
normalized to pellet protein for each sample.
Beta-hexosaminidase release. Rabbit lacrimal gland acini seeded on Matrigel-
coated 12-well plates. On day 3 of culture, the untransduced and/or transduced lacrimal
31

acini were stimulated with CCH (100 μM) and the media was collected at time points up
to 30 min. The cell pellets were dissolved in 0.5 N NaOH. Media collected from various
secretion experiments were analyzed for beta-hexosaminidase release by using
methyumbelliferyl-α-D-glucosaminide as a substrate. The substrate was dissolved in a
buffer containing 133 mM NaCitrate and 133 mM NaCl with pH adjusted to 4.3. The
reactions were prepared in black flat-bottom 96-well plates (Thermo, Milford, MA) and
incubated for 18-24 hours. The product of the reaction, methyl-umbelliferone, was
detected with a fluorescence plate reader (Tecan, Austria) using an excitation wavelength
of 360 nm and an emission wavelength of 465 nm. The beta-hexosaminidase values were
normalized to pellet protein for each sample.

32

Chapter III: The characterization of SNAREs in rabbit lacrimal gland acinar cells

Expression of vesicle associated membrane proteins (VAMPs) in rabbit lacrimal
gland acinar cells
“Professional” secretory epithelial cells, such as the pancreatic, parotid, and
lacrimal gland acinar cells, synthesize and store a variety of proteins and release them
when necessary. In pancreatic and parotid acinar cells, secretory vesicles involves in
regulated exocytosis are stored in large dense-core secretory granules ( Gorr SU, et al,
2005; Wäsle B and Edwardson MJ, 2002), Pancreatic acianr cells store a variety of
digestive enzymes, such as chymotrypsin, trypsin, and amylase, in zymogen granules
located in the subapical area (Wäsle B and Edwardson MJ, 2002). Parotid acinar cells
also have secretory granules stored in the subapical region and these granules store major
secretory proteins such as amylase, proline-rich proteins, and parotid secretory porteins
(Gorr SU, et al, 2005). These large dense-core secretory granules in pancreatic and
parotid acinar cells are involved in regulated secretion, where they undergo stimulated
secretion in response to extracellular stimuli (Gorr SU, et al, 2005; Wäsle B and
Edwardson MJ, 2002).
The secretory vesicle populations involved in regulated secretion in lacrimal
gland acinar cells seem to differ from the parotid and pancreatic acinar cells in that they
appear to be more heterogeneous, varying in size and densities (Rismondo V, et al, 1994;
Qian L, et al, 2003). The contents and trafficking effector proteins of the different
populations of secretory vesicles have yet to be well characterized in the lacrimal gland
33

acinar cells. Previous studies in our lab have suggested the presence of two distinct
secretory vesicle populations that are mobilized by secretagogue stimulation. One
population of vesicles, known as recruitable secretory vesicles (rSVs), is enriched in
VAMP2 and dynein. In resting acinar cells, rSVs appear to be dispersed throughout the
acinar cells but upon CCH-stimulation, they become enriched beneath the APM (Wang
Y, et al, 2003). The other vesicle population represent a larger secretory vesicle
population (1-3 μm) enriched with rab3D. These vesicles, known as mature secreotry
vesicles (mSVs), are located beneath the apical plasma membrane (APM) in resting
acinar cells and are discharged immediately in response to secretagogue stimulation
(Wang Y, et al, 2003). Sorbitol density gradient analysis and confocal fluorescence
microscopy data supports the hypothesis that rSV and mSV are distinct secretory vesicle
population (Wang Y, et al, 2003). Further characterization of the SNARE proteins
present on the rSVs and other secretory vesicle populations will help determine if there is
any relationship between the many different secretory vesicle populations, particularly
the rSVs and mSVs.
To further characterize the rSV population, I first confirmed the expression of
VAMP2 in the LGAC by immunofluorescence and Western blot analysis. For the
immunofluorescence studies, the lumens of the LGACs were identified by staining for
actin, which is highly enriched underneath the APM (da Costa SR, et al, 1998 and 2003;
Jerdeva GV, et al, 2005) In confocal images of LGAC in which actin has been
fluorescently labeled, the lumen was identified by the thick filamentous actin (Figure
3.1). The expression of VAMP2 was confirmed by immunofluorescence. In Figure
34

3.2A, the VAMP2 expression is dispersed throughout the cells in the resting acini. With
CCH-stimulation, the VAMP2 becomes more enriched in the subapical region as reported
previously. Since VAMP2 is a membrane protein, soluble (Si) and membrane (Pi)
fractions were prepared from LGACs and VAMP2 expression was determined by
Western blot analysis. Figure 3.2B shows that in resting and in CCH-stimulated VAMP2
expression is mainly in the membrane fractions.

Figure 3.1 Confocal micrscopy of actin organization in reconstituted rabbit
LGACs. Actin is labeled with a fluorescently labeled phalloidin, such as rhodamine
phalloidin, as shown in a confocal fluorescence image in the left panel. The lumens
(denoted by *) can be identified by the enriched filamentous actin network that lies
beneath the apical plasma membrane. Schematic diagram depicts the outline of actin
corresponding to the confocal image on the left. The thicker lines represent apical actin.
Bar, 5 μm.
35

Figure 3.2 Immunofluorescence microscopy and Western blot analysis of VAMP2 in
rabbit LGACs. A. The distribution of VAMP2 (green) in control and carbachol (CCH;
100 μM, 5 min) – stimulated acini was investigated by confocal fluorescence
microscopy. F-actin organization (red) was probed in parallel in each sample using
rhodamine-phalloidin. Apical/lumenal regions are identified by the enrichment of F-
actin, denoted by (*). In resting acini, VAMP2 is dispersed throughout the cells.
However, in carbachol-stimulated acini, VAMP2 becomes more enriched in the subapical
region, as shown by the arrows. Bar, 5 μm. B. Western blot analysis of soluble (Si) and
membrane (Pi) fractions of lacrimal gland acinar cells treated with or without CCH (100
μM, 15 min) reveals the presence of VAMP2 mainly in the membrane fractions.

B.
A.
36

Recently VAMP8 was identified to play a major role in regulated exocytosis.
VAMP8 was shown to be expressed in a variety of exocrine tissues, including the
lacrimal gland (Wang CC, et al, 2007). Secretagogue-stimulated secretion from
pancreatic fragments from VAMP8 null mice was completely abolished and the number
of secretory vesicles in pancreatic acinar cells from VAMP8 null mice was increased
three-fold (Wang CC, et al, 2004). An accummulation of secretory vesicles was also
observed in the parotid and lacrimal gland acinar cells of VAMP8-null mice (CC, et al,
2007). Since, it looked like VAMP8 might play a role in apical exocytosis of secretory
vesicles, I wanted to further characterize the role of VAMP8 in rabbit lacrimal gland
acinar cells. Immunofluorescence studies determined that the VAMP8 enriched on
vesicles are mainly present in the subapical region in resting cells. With CCH-
stimulation, these VAMP8-enriched vesicles remain the subapical region, perhaps even
fusing with the APM (Figure 3.3A). Since VAMP8 is a membrane protein, soluble (Si)
and membrane (Pi) fractions were prepared from rabbit LGAC and VAMP8 expression
was determined by WB analysis. Figure 3.3B shows that in both resting and CCH-
stimulated lacrimal gland acinar cells, VAMP8 expression is mainly in the membrane
fractions.

37

Figure 3.3 Immunofluorescence micrscopy and Western blot analysis of VAMP8 in
rabbit LGACs. A. The distribution of VAMP8 (green) in control and carbachol (CCH;
100 μM, 15 min) – stimulated acini was investigated by confocal fluorescence
microscopy. F-actin organization (red) was probed in parallel in each sample using
rhodamine-phalloidin. Apical/lumenal regions are identified by the enrichment of F-
actin, denoted by (*). In resting acini, VAMP8 appears to be localized to the subapical
region. With CCH stimulation, VAMP8 stays enriched in the subapical region, as shown
by the arrows, and some may even associate with the apical plasma membrane. Bar, 5
μm. B. Western blot analysis of soluble (Si) and membrane (Pi) fractions of lacrimal
gland acinar cells treated with or without CCH (100 μM, 15 min) reveals the presence of
VAMP8 mainly in the membrane fractions.
B.
A.
38

Expression of Q-SNAREs in rabbit LGAC
Since at least two R-SNAREs (VAMPs 2 and 8) were determined to be expressed
in rabbit LGAC and localized on populations which might prospectively be secretory
vesicles, I wanted to determine which Q-SNAREs are being expressed in the LGAC to
identify the SNARE complexes being formed at the APM. In neuronal cells, VAMP2
forms a complex with syntaxin 1 and SNAP-25 (reviewed in Kavalali ET, 2002).
Western blot analysis of rabbit lacrimal gland acinar cell lysate and membrane fractions
determined that these two Q-SNAREs are not expressed in the lacrimal gland acinar cells
(Figure 3.4A). PCR analysis also confirmed that syntaxin 1 is not expressed in the
lacrimal gland acinar cells (Figure 3.4C). In parotid and pancreatic acinar cells, syntaxins
2 and/or 3 were localized to the APM, and syntaxin 4 was localized to the BLM, so
expression of syntaxins 2-4 in the lacrimal gland acinar cells were examined by Western
blot and PCR analysis. Expression of SNAP-23, which has also been found to be
expressed in the parotid and pancreatic acinar cells, was also examined by Western blot
and PCR analysis. Lysate and membrane fractions prepared from rabbit lacrimal gland
acinar cells were analyzed by Western blot analysis and syntaxins 2 and 3 and SNAP-23
were determined to be expressed in the lacrimal gland acinar cells (Figure 3.4B).
Syntaxin 4 expression in the lacrimal gland acinar cells could not be confirmed by
Western blot analysis (data not shown). The results from a PCR analysis in Figure 3.4C
confirm the expression of syntaxin 3 in the lacrimal gland acinar cells. PCR analysis also
helped determine the expression of syntaxin 4 in the LGACs. Primers for syntaxins 1, 3,
and 4 were designed from sequences already identified from rabbit, but no rabbit
39

sequence was available for syntaxin 2, so several degenerate primers were designed from
human and mouse sequences for syntaxin 2. None of these degenerate primers provided
positive result in the rabbit lacrimal gland acinar cells (data not shown). Since the
expression of syntaxin 2-4 and SNAP-23 were confirmed by Western blot and/or PCR
analysis, immunofluorescence studies were performed to determine their subcellular
localization. Unfortunately, the antibodies available for syntaxins 2 did not work for
immunofluorescence studies and the antibodies available for syntaxin 4 either did not
work or cross-reacted with syntaxin 3 (data not shown), so their subcellular localization
could not be determined. However, immunofluorescence studies with syntaxin 3 and
SNAP-23 were successful. In figure 3.5A, syntaxin 3 expression was mainly seen at the
APM in both resting and CCH-stimulated lacrimal gland acinar cells. SNAP-23 was
mainly enriched at the BLM, but also was expressed at the APM in resting and CCH-
stimulated cells (Figure 3.5B).
40

Figure 3.4 Western blot and PCR analysis of Q-SNAREs in rabbit LGACs. A.
Lysates from rabbit (r) LGAC and mouse (m) brain were prepared. Membrane from
rabbit (r) LGACs were also isolated. Western blot analysis revealed no presence of
synaptic SNAREs, syntaxin 1 and SNAP-25, in rabbit LGAC. B. Western blot analysis
revealed the presence of syntaxins 2 and 3 and SNAP-23 in rabbit LGAC lysate and
membrane. Syntaxins 2 and 3 also appear to be expressed in mouse brain, but not SNAP-
23. C. Expression of syntaxins 3 and 4, but not syntaxin 1, in rabbit lacrimal glands was
confirmed by PCR analysis of cDNA prepared from rabbit lacrimal gland.
A.
B.
C.
41

Figure 3.5 Confocal microscopy reveals the subcellular localization of syntaxin 3
and SNAP-23 in rabbit LGAC as. The distribution of syntaxin 3 and SNAP-23 (both in
green) in control and carbachol (CCH; 100 μM, 15 min) – stimulated acini was
investigated by confocal fluorescence microscopy. F-actin organization (red) was probed
in parallel in each sample using rhodamine-phalloidin. Apical/lumenal regions are
identified by the enrichment of F-actin, denoted by (*). A. In resting and carbachol-
stimulated acini, syntaxin 3 is enriched in the apical membrane, as indicated by its
colocalization with F-actin at the lumenal region (arrows). B. SNAP-23, on the other
hand, is enriched at the basolateral membrane (arrowheads) with some at the apical
membrane (arrows) in resting and carbachol-stimulated acini. Bar, 5 μm.
B.
A.
42

Subcellular fractionation analysis of SNARE proteins in lacrimal gland acinar cells
After determining the expression of different SNARE proteins in the rabbit
lacrimal gland acinar cells, I wanted to determine if any of the SNARE proteins were
expressed in the same membrane compartments. Previous subcellular fractionation
analysis of cell homogenate from rabbit lacrimal gland acinar cells has led to a working
hypothesis for the compartment identities of subcellular membranes (Figure 3.6A) (Qian
L, et al, 2003 and 2004). In my research, I wanted to identify the membrane
compartments associated with the various SNARE proteins already identified in the
rabbit lacrimal gland acinar cells, so cell homogenates were prepared from resting
(control) and CCH-stimulated (100 μM, 15 min) acini and analyzed by centrifugation
over isopycnic sorbitol density gradients. Western blot analysis of the subcellular
fractionations determined that VAMP2 is distributed in TGN-associated membranes
(fractions 4-9) in resting acini. With CCH-stimulation, VAMP2 distribution increases
mainly in the recycling endosomes (fractions 3-4) and decreases in the TGN-associated
membranes (fractions 6-9), see Figure 3.6B. Syntaxin 3 is widely distributed in resting
acini, but interestingly with CCH-stimulation, a portion of it becomes restributed to
compartments enriched in recycling endosomes (fractions 4-5), see Figure 3.6B. SNAP-
23 distribution is mainly in the basolateral membrane-related TGN-domain or possibly in
the late endosomes (fractions 4-6) and CCH-stimulation does not change its distribution,
see Figure 3.6B.
43

Figure 3.6 Subcellular fractionation analsyses of SNARE proteins in LGACs
reveals the presence of various SNARE proteins on distinct subcellular membrane
compartments. A. Working hypothesis for the compartment identities of subcellular
membranes isolated by isopycnic sorbitol density gradient centrifugation. B. Cell
homogenate from resting (control) and carbachol-stimulated (CCH, 100 μM, 15 min)
acini analyzed by centrifugation over isopycnic sorbitol density gradients show the
distribution of VAMP2, Syntaxin 3, and SNAP-23. VAMP2 is widely distributed in
TGN–associated membranes (fractions 4-9). With carbachol stimulation, there is some
indication that VAMP2 becomes associated with the apical plasma membrane (fraction
1), but VAMP2 distribution mainly increases in recycling endosomes (3-4) and decreases
in TGN-associated membranes (fractions 6-9). Syntaxin 3 is also redistributed to
compartments enriched in recycling endosomes upon carbachol stimulation. However,
SNAP-23 demonstrates no change in distribution with carbachol stimulation.
0
10
20
30
12 34 56 7 8 9 101112 P
0
10
20
30
12 34 56 7 8 9 101112 P
-10
-5
0
5
10
123 4 5 6789 101112 P
0
10
20
30
12 34 56 7 8 9 101112 P
0
10
20
30
12 34 56 7 8 9 101112 P
-10
-5
0
5
10
123 4 5 6789 101112 P
0
10
20
30
12 34 56 7 8 9 101112 P
0
10
20
30
12 34 56 7 8 9 101112 P
-10
-5
0
5
10
123 4 5 6789 101112 P
Control CCH 15min Change
SNAP-23
n=3
Syntaxin 3
n=3
VAMP2
n=3
B.
A.
44

Fusogenic ability of GFP-VAMP2-enriched secretory vesicles in lacrimal gland
acinar cells

The subcellular localizations of syntaxin 3 and SNAP-23 determined by confocal
immunofluorescence microscopy revealed that they are localized at the apical plasma
membrane, indicating that they would be the ideal Q-SNAREs to form a complex with
any R-SNAREs present on secretory vesicles fusing with the apical plasma membrane.
Initial studies in the lab have indicated that VAMP2 present on rSVs are recruited to the
subapical region of the acinar cells, so further studies with VAMP2 were performed to
determine its relation with syntaxin 3 and SNAP-23. In order to perform colocalization
studies with VAMP2, syntaxin 3 and SNAP-23, GFP-VAMP2 constructs had to be
introduced into the LGACs, since the antibodies to VAMP2, syntaxin 3 and SNAP-23
were all produced in the same host, making it difficult to perform colocalization studies
with just the antibodies. Replication-defective adenoviral constructs expressing GFP-
VAMP2 (Ad-GFP-VAMP2), a generous gift from Dr. Serhan Karvar (University of
Southern California, Los Angeles, CA), was utilized to transduce the rabbit LGACs.
Before conducting the colocalization studies, I wanted to determine if the overexpressed
GFP-VAMP2 present on the secretory vesicles were fusion competent. Previous studies
by Karvar S, et al (2002) demonstrated that GFP-VAMP2, expressed from an Ad-
construct, translocated from the cytoplasm to apical plasma membrane in gastric parietal
cells, indicating that GFP-VAMP2 is indeed functional, To confirm the fusogenic ability
of secretory vesicles coated with GFP-VAMP2 in LGACs, time-lapse confocal images of
live acinar cells transduced with the Ad-GFP-VAMP2 construct were taken. Figure
45

3.7A shows that in resting lacrimal gland acinar cells, GFP-VAMP2 labeled vesicles are
relatively static. The arrows in the images point out stationary vesicles in the subapical
region. After carbachol stimulation, the GFP-VAMP2 labeled vesicles become more
active and at various time points, a number of these vesicles fuse with the apical plasma
membrane as pointed out by the arrows in Figure 3.7B. Interestingly, some of the
vesicles labeled with GFP-VAMP2 appear to fuse and remain associated with apical
plasma membrane (arrowheads in Figure 3.7B). The live cell time-lapse images of GFP-
VAMP2 enriched vesicles indicate that they are indeed fusion competent.
46

Figure 3.7 Time-lapse images of live rabbit LGACs transduced with Ad-GFP-
VAMP2 reveals fusogenic ability of GFP-VAMP2-enriched vesicles. A. In resting
acinar cells, GFP-VAMP2 labeled vesicles are relatively static. The arrows point out
stationary vesicles that appear in the subapical region of the acinar cells. B. In acini
stimulated with CCH (100 μM), GFP-VAMP2 labeled vesicles become much more
active and at various time points, groups of these vesicles appear to fuse with the APM as
pointed out by the arrows. The arrowheads point out veislces that appear to fuse and
remain associated with the APM. Bar, 5 μm.
A.
B.
47

Even though the live cell images revealed that the GFP-VAMP2 enriched vesicles
are fusogenic, further biochemical studies were necessary to confirm this data. If GFP-
VAMP2 enriched vesicles are fusion competent, its overexpression in the lacrimal gland
acinar cells should perhaps increase the secretion of some secretory proteins from the
acinar cells or it may not have functional effects at all. Analysis of bulk protein release
from lacrimal gland acini transduced with Ad-GFP-VAMP2 revealed that GFP-VAMP2
overexpression in general does not have much of an effect on bulk protein secretion after
CCH-stimulation, although at 5 min of stimulation release of bulk protein is significantly
increased compared to that of Ad-GFP transduced acini (Figure 3.8A). There was no
statistically significant differences in the release of β-hexosaminidase between the acini
transduced with Ad-GFP and those transduced with Ad-GFP-VAMP2 (Figure 3.8B).
The lack of effect on CCH-stimulated release of some secretory markers by the
overexpression of GFP-VAMP2 shows that secretion is not inhibited, but also it does not
seem to enhance secretion.
48

Figure 3.8 Effect of adenovirus-mediated overexpression of GFP-VAMP2 on
various secretion markers. A. Release of bulk protein into the culture medium in the
presence of 100 μM CCH for 0, 5, 10, 15, and 30 min of LGAC, transduced with either
Ad-GFP or Ad-GFP-VAMP2, was determined. Bulk protein values were normalized to
total protein. Percent control secretion was calculated by comparing all the values to SC
released by unstimulated, untransduced cells. B. Release of β-hexosaminidase (βhex)
into the culture medium in the presence of 100 μM CCH for 0, 5, 10, 15, and 30 min of
LGAC, transduced with either Ad-GFP or Ad-GFP-VAMP2, was determined. β-
hexvalues were normalized to total protein. Percent control secretion was calculated by
comparing all the values to β-hex released by unstimulated, untransduced cells.
A.
B.
0%
50%
100%
150%
200%
250%
300%
350%
400%
0 5 10 15 20 25 30 35
%

C
o
n
t
r
o
l

(
n
o

A
d
)
Time (min)
≅hex release
GFP
GFP-V AMP2
0%
50%
100%
150%
200%
250%
300%
350%
400%
0 5 10 15 20 25 30 35
%

C
o
n
t
r
o
l

(
n
o

A
d
)
Time (min)
Bulk protein
GFP
GFP-V AMP2
*
49

Since colocalization studies with GFP-VAMP2 involve the fixation of the acini
transduced with Ad-GFP-VAMP2, the subcellular distribution of GFP-VAMP2 in fixed
acini was examined. Confocal micrscopy of acini transduced with Ad-GFP-VAMP
revealed that vesicles labeled with GFP-VAMP2 behave like secretory vesicles enriched
with endogenous VAMP2 (Figure 3.9). In resting acini, the GFP-VAMP2 is dispersed
throughout the cytoplasm of the acini with some even appearing to be docked at beneath
the apical plasma membrane. Upon CCH-stimulation, GFP-VAMP2 becomes more
concentrated at the apical plasma membrane.

Figure 3.9 Confocal fluorescence microscopy reveals that GFP-VAMP2 behaves like
endogenous VAMP2 in LGACs. In resting lacrimal gland acinar cells, GFP-VAMP2 is
dispersed throughout the cytoplasm. Some VAMP2-GFP coated vesicles even appear to
be docked beneath the apical plasma membrane (arrows). Upon carbachol stimulation
(CCH; 100 mM, 15 min), GFP-VAMP2 appears to be extensively colocalized with actin
at the apical plasma membrane. (Bar, 5 mm; *, lumen)
50

Colocalization of GFP-VAMP2 and Q-SNAREs
Since the functional studies with GFP-VAMP2 overexpressed lacrimal gland
acini suggested that GFP-VAMP2-enriched vesicles are fusion competent, GFP-VAMP2
was utilitzed in colocalization studies with syntaxin 3 and SNAP-23, potential binding
partners of VAMP2 at the apical plasma membrane. To better visualize the localization
of GFP-VAMP2 and syntaxin in the lacrimal gland acini, serial sections of Ad-GFP-
VAMP2 transduced acini immunostained for syntaxin 3 were acquired. A three-
dimensional reconstruction of the serial secretions revealed that GFP-VAMP2 and
syntaxin 3 colocalize at the apical plasma membrane (Figure 3.10). Interestingly, the
colocalization between GFP-VAMP2 and syntaxin 3 was observed in both resting and
CCH-stimulated acini, indicating that some of the GFP-VAMP2-enriched vesicled may
be fusing with the apical plasma membrane in resting acini as well as CCH-stimulated
acini. Further colocalization studies were conducted to determine the extent of
colocalization between GFP-VAMP2 and syntaxin 3. Confocal fluorescence microscopy
images of Ad-GFP-VAMP2 transduced acini immunostained for syntaxin 3 were
quantitated. Images in Figure 3.11A show that in resting acini, even with most of the
GFP-VAMP2 dispersed throughout the cytoplasm, some of the GFP-VAMP2 in the
apical region colocalizes with syntaxin 3. With CCH-stimulation, GFP-VAMP2 is
recruited to the apical plasma membrane, increasing the colocalization between syntaxin
3 and GFP-VAMP2. To quantify the colocalization of apical GFP-VAMP2 and syntaxin
3, the extent of colocalization of syntaxin 3 pixels with GFP-VAMP2 pixels as
percentage of total syntaxin 3 pixels was measured (Figure 3.11B). Although some
51

colocalization was observed in resting acini (colocalization coefficient, 0.53 ± 0.004),
CCH-stimulation caused an increase, although not significant, in the colocalization
between syntaxin 3 and GFP-VAMP2 in the lumenal region (colocalization coefficient,
0.67 ± 0.089).
52

Figure 3.10 Three dimensional reconstruction of acini transduced with Ad-GFP-
VAMP2 reveals colocalization of GFP-VAMP2 with syntaxin 3 at the apical plasma
membrane. Three dimensional (3-D) projections of resting (CON) and CCH-stimulated
(100 μM, 15 min) lacrimal gland acinar cells transduced with Ad-GFP-VAMP2 (green),
immunostained for syntaxin 3 (red) and labeled for actin (violet) with Alexa Flour-647
phalloidin are shown. Images were acquired at z-intervals of 0.5 μm and were
reconstructed into a 3D movie file that could be rotated to demonstrate the structure
viewed at different angles. Selected frames are presented at 22.5° intervals. Areas of
colocalization between GFP-VAMP2 and syntaxin 3 are depicted in yellow. The straight
arrows indicate the areas of colocalization at the apical plasma membrane. The curved
arrows indicate the direction of the rotation of the acinar projection; asterisks indicate
luminal regions. Bar, 5 μm.
53

Figure 3.11 GFP-VAMP2 colocalization with syntaxin3 increases with after CCH-
stimulation. A. Confocal micrographs of resting (CON) and CCH-stimulated (100 μM,
15 min) LGACs transduced with Ad-GFP-VAMP2, immunostained for syntaxin 3, and
labeled for actin with Alex Fluor-647 phalloidin. Arrows indicate areas of high
colocalization between GFP-VAMP2 and sytnaxin 3. Asterisks mark the lumena of the
acini. Bar, 5 μm. B. Colocalization between GFP-VAMP2 and syntaxin 3 around the
subapcial region (< 1.5 μm beneath the lumen) was calculated. Values graphed are
coloclaization coefficients for syntaxin 3 and reflect the relative numbers of colocalizing
pixels, compared with the overall sum of pixel intensities above threshold and in that
channel. The values range from 0 to 1, in which 0 indicates no colocalization, and 1
indicates that all pixels colocalize.
0.00
0.20
0.40
0.60
0.80
1.00
015
Colocalization coefficient
Time (min)
A.
B.
54

Colocalization of GFP-VAMP2 and SNAP-23 was also examined. Confocal
fluorescence microscopy images of Ad-GFP-VAMP2 transduced acini immunostained
for SNAP-23 were examined and quantitated. Images in Figure 3.12A show that the
pattern of SNAP-23 colocalization with GFP-VAMP2 is similar to that of syntaxin 3.
CCH-stimulation appears to increase the colocalization between SNAP-23 and GFP-
VAMP2 in the luminal region. The extent of colocalization of SNAP-23 pixels with
GFP-VAMP2 pixels as a percentage of total SNAP-23 pixels was measured (Figure
3.12B). Some colocalization was observed in resting acini (colocalization coefficient,
0.52 ± 0.12), however, with CCH-stimulation, an increase, although not significant, in
the colocalization between SNAP-23 and GFP-VAMP2 was observed in the lumenal
region (colocalization coefficient, 0.67 ± 0.07).

55

Figure 3.12 GFP-VAMP2 colocalization with SNAP-23 increases with after CCH-
stimulation. A. Confocal micrographs of resting (CON) and CCH-stimulated (100 μM,
15 min) lacrimal gland acinar cells transduced with Ad-GFP-VAMP2, immunostained for
SNAP-23, and labeled for actin with Alex Fluor-647 phalloidin. Arrows indicate areas of
high colocalization between GFP-VAMP2 and SNAP-23. Asterisks mark the lumena of
the acini. Bar, 5 μm. B. Colocalization between GFP-VAMP2 and SNAP-23 around the
subapcial region (< 1.5 μm beneath the lumen) was calculated. Values graphed are
coloclaization coefficients for SNAP-23 and reflect the relative numbers of colocalizing
pixels, compared with the overall sum of pixel intensities above threshold and in that
channel. The values range from 0 to 1, in which 0 indicates no colocalization, and 1
indicates that all pixels colocalize.
A.
B.
0.00
0.20
0.40
0.60
0.80
1.00
015
Colocalization Coefficient
Time (min)
56

Binding assays identifying SNARE interactions in lacrimal gland acinar cells
Colocalization studies with GFP-VAMP2 strongly indicated there could be an
interaction between VAMP2 and syntaxin 3 and between VAMP2 and SNAP-23.
Binding assays were performed to determine if these SNARE proteins indeed form a
SNARE complex at the APM. A GST-pulldown assay using GST-VAMP2 and lysate
prepared from rabbit lacrimal gland tissue revealed that SNAP-23 binds to VAMP2
(Figure 3.13A). Pull-down assays using GST-VAMP2 and lysate prepared from cultured
primary rabbit lacrimal gland acini confirmed the interaction between SNAP-23 and
VAMP2 (Figure 3.13B). The pull-down assays also revealed that syntaxin 3 binds to
VAMP2 in lacrimal gland acinar cells (Figure 3.13D).
VAMP8-enriched secretory vesicles were also observed in the subapical region,
so they could potentially interact with Q-SNAREs present on the apical plasma
membrane. Pulldown assays using GST-VAMP8 and lysate prepared from rabbit
LGACs revealed that VAMP8 does indeed interact with SNAP-23 (Figure 3.13C). An
interaction between syntaxin 3 and VAMP8 was also discovered in the pull-down assays
(Figure 3.13D).

57

A.
B.
C.
D.
58

Figure 3.13 Binding assays identifying SNARE interactions in the rabbit LGACs.
A. GST- or GST-VAMP2 bound to glutathione beads was incubated with rabbit lacrimal
gland tissue lysate overnight at 4°C. Western blot analysis of the eluants with rabbit anti-
SNAP-23 antibodies revealed an interaction between the VAMP2 fusion protein and
SNAP-23 in rabbit lacrimal gland tissue. B. GST- or GST-VAMP2 bound to glutathione
agarose beads was incubated with rabbit LGAC lysate treated with or without carbachol
(100 μM, 15 min). Western blot analysis of the eluants with rabbit anti-VAMP2 and
rabbit anti-SNAP-23 antibodies revealed an interaction between the VAMP2 fusion
protein and SNAP-23 in rabbit LGACs. C. GST- or GST-VAMP8 bound to glutathione
agarose beads was incubated with rabbit LGAC lysate. Western blot analysis of the
eluants with goat anti-GST and rabbit anti-SNAP-23 antibodies revealed an interaction
between the VAMP8 fusion protein and SNAP-23 in rabbit LGACs. D. GST-, GST-
VAMP8, or GST-VAMP2 bound to glutathione agarose beads was incubated with rabbit
LGAC lysate. Western blot analysis of the eluants with rabbit anti-syntaxin 3 antibodies
revealed an interaction between VAMP8 and syntaxin 3 and between VAMP2 and
syntaxin 3 in rabbit LGACs.
59

To confirm the data obtained from the pull-down assay, co-immunoprecipitation
experiments with various SNARE antibodies were conducted. When antibodies against
syntaxin 3 were incubated with lysate prepared from lacrimal gland acini, SNAP-23 was
co-immunoprecipitated (Figure 3.14), revealing that there is an interaction between
syntaxin 3 and SNAP-23. N-ethylmaleimide was utilized to stabilize SNARE complex
formation in the co-immunoprecipitation experiments; however, it does not appear to
have an effect on the interaction between GFP-VAMP2 and SNAP-23 with or without
CCH-stimulation. Co-immunoprecipitation experiments with antibodies against SNAP-
23 and lysate from lacrimal gland acini were also performed. The results, seen in Figure
3.14, show that there is interaction between SNAP-23 and VAMP2, even though the
VAMP2 Western blot signal is only slightly above background, but it confirms the data
from the pull-down assays that VAMP2 binds to SNAP-23.
60

Figure 3.14 Co-immunoprecipitation assays identifying SNARE interactions in the
rabbit LGAC. Rabbit LGAC lysate treated with or without N-ethylmalameide (NEM)
and stimulated with or without CCH (100 μM, 15 min) was incubated with rabbit anti-
syntaxin 3 or rabbit anti-SNAP-23 antibodies bound to Protein A/G agarose beads.
Western blot analysis of eluants from the beads reveal an interaction between syntaxin 3
and SNAP-23 and between SNAP-23 and VAMP2.
61

Effect of VAMP2 inhibition by Botulinum toxin B – light chain in lacrimal gland
acini

The colocalization and binding assays suggest that there is a SNARE complex
being formed by VAMP2, syntaxin 3, and SNAP-23 at the apical plasma membrane in
the LGACs, but this still leaves open a lot of questions about the function of VAMP2-
enriched secretory vesicles. What kind of content is being transported by these vesicles?
Which trafficking pathways are the VAMP2-enriched secretory vesicles being
transported along? Are the so-called “recruitable secretory vesicles” precursors to other
types of vesicles, such as the mature secretory vesicles enriched with rab3D? To answer
some of these questions, it would be important to somehow inhibit VAMP2 to determine
its function in the lacrimal gland acinar cells. One of the tools available to inhibit
VAMP2 function is the botulinum toxin B – light chain (BotB-LC), which cleaves
VAMP2, preventing it from forming any SNARE complexes. BotB-LC is about a 50
kDa protein (Humeau Y, et al, 2000), so electroporation was used to introduce it into the
lacrimal gland acini. Electroporation efficiency, confirmed with β-galactosidase, and
phase microscopy to detect the colorimetric production with 5-bromo-4-chloro-3-indolyl-
β-D-galactoside as substrate, was greater than 80% in each assay (data not shown),
indicating that BotB-LC should have been successfully introduced into the acini.
Lysates prepared from acini treated with BotB-LC were analyzed by Western blot
(Figure 3.15A), but unfortunately, the BotB-LC was unsuccessful in cleaving VAMP2 in
the acini.
62

To determine if the BotB-LC, rather than the electroporation method of
introducing BotB-LC into the acini, was ineffective in cleaving VAMP2 in the acini,
membrane fractions were prepared from lacrimal gland acini and treated with BotB-LC.
Different concentrations (40 nM and 120 nM) of BotB-LC, as well as different incubation
periods (1 hr and 3 hr), were used to treat the membrane fractions, but the various
treatments with BotB-LC had no effect on the cleavage of VAMP2 on the membranes
(Figure 3.15B). Unfortunately, these experiments made it apparent that BotB-LC was not
going to be useful in inhibiting VAMP2 function in the LGACs. Some other method of
inhibiting VAMP2 will have to be investigated to further determine the role of VAMP2-
enriched secretory vesicles in the LGACs.
63

Figure 3.15 BotB-LC does not cleave VAMP2 in LGACs. A. Lysate was prepared
from rabbit LGACs treated with BotB-LC. Proteins were separated by SDS-PAGE.
Cleavage of VAMP2 was determined by Western blot analysis. Equal protein loading
was determined by Western blot analysis of actin. B. Membranes isolated from LGACs
were treated with BotB-LC. Proteins were separated by SDS-PAGE. Cleavage of
VAMP2 was determined by Western blot analysis. Equal protein loading was
determined by Western blot analysis of actin.
A.
B.
64

Secretory vesicles populations: VAMP2-enriched recruitable secretory vesicles
versus rab3D-enriched mature secretory vesicles

One of the roles of VAMP2 I wanted to investigate was whether VAMP2-
enriched vesicles are precursors of the rab3D-enriched mature secretory vesicles or the
two secretory vesicle populations are two completely different populations of vesicles.
Inhibition studies with the BotB-LC would have been a big help to understand the
relationship between the two secretory vesicle populations, but since the BotB-LC
studies were ineffective in the lacrimal gland acini, I performed a confocal microscopy
experiment to observe their localization in relation to each other. Figure 3.16 shows an
confocal image of an unstimulated lacrimal gland acini transduced with Ad-GFP-VAMP2
and immunostained for endogenous rab3D. Although there are some GFP-VAMP2-
enriched vesicles in the subapical region, there appears to be very little colocalization of
GFP-VAMP2 with rab3D, which is highly enriched in the subapical region. This
preliminary experiment, along with the evidence that VAMP2-enriched vesicles fuse
directly with the apical plasma membrane, suggests that VAMP2- and rab3D-enriched
secretory vesicles are different populations of vesicles, but further studies will have to be
performed to confirm the relationship between the two vesicle populations.

65

Figure 3.16 Confocal microscopy reveals GFP-VAMP2 coated vesicles represent a
population of vesicles different than those enriched in rab3D. Rab3D, which coats a
population of mature secretory vesicles enriched in the subapical region in resting
lacrimal gland acini, appear to represent a population of vesicles different that those
enriched in GFP-VAMP2 in resting lacrimal gland acini. Some of the GFP-VAMP2
coated vesicles that seem to be docked at the apical plasma membrane are localized with
or adjacent to the population of rab3D coated vesicles, whereas others are more diffuse in
the cytosplasm. Asterisks mark the lumena of the acini. Bar, 5 μm.

66

Chapter IV: The role of rab3D in pIgR trafficking in rabbit lacrimal gland acinar
cells

Is VAMP2 involved in the transcytotic trafficking of pIgR/SC in LGAC?
While investigating the role of VAMP2 in vesicle trafficking, the question was
raised whether VAMP2 may be involved in the transcytotic trafficking of pIgR.
Colocalization studies of VAMP2 and pIgR/SC shows that there was not much
colocalization between the two proteins as shown in Figure 4.1A. Quantitation of the
pIgR pixels overlapping with the VAMP2 pixels in the whole acinar cells reveals that the
colocalization coefficients were only 0.451 ± 0.653, 0.533 ± 0.053, and 0.453 ± 0.041 in
resting (control), 5 minute CCH-, and 30 minute CCH-stimulated LGAC, respectively
(Figure 4.1B). These colocalization coefficients confirm that the colocalization between
pIgR/SC and VAMP2 was relatively low. However, the confocal images reveal there is
enriched pIgR immunofluorescence in the subapical region of the LGAC (depicted by
arrows in Figure 4.1A), indicating that a pool of pIgR/SC may exist in secretory vesicles
in the subapical region. This subapical pool of pIgR/SC suggested that there could be
pIgR/SC localized in mSVs, so further studies were performed to determine the
characteristics of the pool of pIgR/SC in the secretory vesicles underneath the apical
plasma membrane.
67

A.
B.
68

Figure 4.1 Colocalization of VAMP2 and SC/pIgR in lacrimal gland acini. A.
Confocal micrographs of control and 100 μM CCH-stimulated (5 and 30 min) LGAC.
VAMP2 (red), SC/pIgR (green), and actin (violet) are displayed as separate signals and
as merged images. Arrows indicate localization of SC/pIgR in the subapical region in
control LGAC. Asterisks mark the lumena of the acini. Bar, 5 μm. B. Colocalization
between VAMP2 and SC/pIgR in the LGAC was calculated. Values graphed are
colocalization coefficients for SC/pIgR and reflect the relative numbers of colocalizing
pixels, compared with the overall sum of pixel intensities above threshold and in that
channel. The values range from 0 to 1, in which 0 indicates no colocalization and 1
indicates all pixels colocalize. Results were obtained from n=3 separate preparations (6-8
acini/preparation).
69

Carbachol-stimulated trafficking of pIgR from the basolateral surface in LGAC
To study the trafficking of the pIgR in a cell system, it is important to characterize
the trafficking of pIgR with its ligand, dIgA, bound, as well as the trafficking of pIgR
under conditions which stimulate secretory trafficking. Since dIgA was not available for
the former studies, I investigated whether secretagogue-induced signaling pathways could
affect the trafficking of the receptor without its ligand bound. This was relevant since it
appeared that pIgR/SC was enriched in what appeared to be a secretory vesicle pool.
Carbachol, a cholinergic agonist that evokes apical release of the contents of mature
secretory vesicles, was used to stimulate the trafficking of the pIgR in rabbit LGAC. A
binding and internalization study with an antibody was performed to follow the
trafficking of pIgR after carbachol-stimulation. In the study, sheep anti-rabbit SC
antibody that labels the pIgR but that does not promote internalization was incubated
with rabbit LGAC on ice for 2 hours to promote binding of the antibodies to the receptor
without internalization. The antibodies were then washed off and the internalization of
the receptor bound to antibody was induced by incubating the acini at 37°C for 60
minutes with or without carbachol. After 60 minutes, the cells were fixed and prepared
for immunofluorescence studies. Confocal images in Figure 4.2 show that in the resting
state (CON 0 min), before internalization of the pIgR is induced, the pIgR is situated at
the basolateral surface, as pointed out by the arrows. When internalization is promoted
without carbachol (CON 60 min), internalization of the pIgR occurs even with some
accumulating at the APM, see figure 4.2 (arrowheads). With carbachol-stimulation (100
μM CCH 60 min), internalization of the pIgR is significantly enhanced and a majority of
70

the receptor accumulates in the subapical region, as pointed out by the tailed arrows in
Figure 4.2. The binding and internalization studies with the sheep anti-SC antibody
show that carbachol elicits the internalization of the pIgR from the basolateral membrane
and promotes the accumulation of the receptor without its ligand in the subapical region.
71

Figure 4.2 Confocal micrographs of anti-SC antibody uptake after CCH-
stimulation reveal accumulation of pIgR in subapical region. Rabbit LGACs were
incubated with sheep anti-SC antibody and mouse IgG on ice for 120 min. The LGACs
were then incubated for 0 or 60 min at 37°C and fixed with ethanol. The fixed cells were
incubated AF488-conjugated goat anti-guinea pig antibody (green) and rhodamine
phalloidin (red). Arrows identify pIgR enriched on the basolateral membrane.
Arrowheads show some of the pIgR/SC accumulating at the APM after internalization
without CCH-stimulation. Tailed arrows identify pIgR/SC accumulating in the subapical
region after internalization with CCH-stimulation. Asterisks mark the lumena of the
acini. Bar, 5 μm.
72

Release of SC is similar to Syncollin-GFP, a mature secretory vesicle marker
Syncollin is a luminal protein in the zymogen granules of pancreatic acinar cells
(An SJ, et al, 2000; Hodel A, et al, 2001). Previous studies in our lab have shown that
rabbit lacrimal gland acinar cells do not endogenously express syncollin. It was neither
detectable by Western blot analysis nor immunofluoroescence staining. However,
syncollin can be expressed in the lacrimal gland acinar cells by transducing the acini with
an adenoviral construct expressing syncollin-GFP. Characterization of the exogenously
syncollin-GFP by live cell time-lapse confocal fluorescence microscopy and
immunofluorescence microscopy revealed that it is expressed in larger apparent mature
secretory vesicles underneath the apical plasma membrane (Jerdeva GV, et al, 2005a;
Jerdeva GV, et al, 2005b). In live cell time-lapse confocal images, syncollin-GFP
appeared to be secreted from the larger vesicles in the subapical region into the lumen
after CCH stimulation. A specific content of the mature secretory vesicles in the rabbit
lacrimal gland acinar cells has not yet been identified, however, these recent studies in
the lab indicated that syncollin-GFP is a content of a subapical pool of mature secretory
vesicles and its release into the lumen appears to occur in a regulated manner. Since the
lumena are open to the culture medium in our reconstituted acinar cultures, its secretion
can be measured by collection of the culture medium and detection of syncollin-GFP by
Western blotting.
With evidence that syncollin-GFP is a mature secretory vesicle marker, a closer
look at the release kinetics of syncollin-GFP from the rabbit lacrimal gland acinar cells
was necessary. The release of syncollin-GFP into the culture medium was followed for
73

30 minutes after carbachol stimulation. The medium was collected, concentrated, and
analyzed by Western blotting with an anti-GFP antibody and an appropriate secondary
antibody conjugated to either IRDye-700 or IRDye-800. The syncollin-GFP signal was
quantitated, normalized to total cellular protein, and graphed as a percentage of total
syncollin-GFP released at 30 minutes after CCH-stimulation. As seen in the graph in
Figure 4.3A, there is a rapid burst of syncollin-GFP within the first 5 minutes of CCH-
stimulation, followed by a slower rate of release between 5 and 15 minutes CCH-
stimulation. After 15 minutes, another rapid burst of release is apparent. So with
syncollin-GFP, two phases of rapid release appear to occur with a slower phase of release
in between. This pattern of release is most likely due to the subapical pool of syncollin-
GFP being rapidly released upon CCH-stimulation, followed by a recovery phase when
more syncollin-GFP is being synthesized and sorted into new secretory vesicles. The
latter rapid phase of release may be a result of the newly synthesized syncollin-GFP
being rapidly released.
SC has been shown to be present in high concentrations in tears and since the
lacrimal gland is the major source of SC, I wanted to characterize the release kinetics of
SC. Confocal images indicated that pIgR/SC may be localized in mSVs, so once
syncollin-GFP was characterized as a mSV marker, I wanted to compare the release
kinetics of SC to the newly identified mSV marker. If the release profile of SC was
similar to syncollin-GFP, it would indicate that SC is a content of the mSV, otherwise SC
is probably a content of a different population of vesicles. Secretion studies, similar to
that of syncollin-GFP, revealed SC showed a rapid burst of release within the first 5
74

minutes of CCH-stimualtion like syncollin-GFP (Figure 4.3B). SC also showed a slower
phase of release between 5 and 10 minutes of CCH-stimulation. There was also a second
rapid phase of release between 10 and 15 minutes of CCH-stimulation. The similarities
in release patterns upon CCH-stimulation between SC and syncollin-GFP indicated that
there could be a pool of SC in a pool of mSVs. The difference in the time span in the
second phase of release, 10-30 minutes for SC and 15-30 minutes for syncollin-GFP,
could be due to SC not having to be newly synthesized since it’s a cleavage product of
the pIgR. Since pIgR is transcytosed from the basolateral surface, the second rapid
release phase could be due to some of the SC released from pIgR transcytosed to the
apical surface.

75

A.
B.
76

Figure 4.3 SC released into the culture medium after carbachol stimulation is
similar to the release of syncollin-GFP, a marker for the contents of a mature
secretory vesicle. A. Western blots showing release of syncollin-GFP into culture
medium in presence of 100 μM CCH for 0, 5, 10, 15, and 30 min in lacrimal gland acini
transduced with Ad-syncollin-GFP. Rabbit anti-GFP antibody combined with a goat
anti-rabbit IRDye800-conjugated secondary antibody was used to detect syncollin-GFP.
Signals for syncollin-GFP (~40 kDa) were quantified and background intensity values
subtracted. The quantitated intensity values were then normalized to pellet protein.
Percent total was calculated by subtracting the baseline secretion of syncollin-GFP (t = 0
min) from each value, and then all values were compared to syncollin-GFP released after
30 min of CCH stimulation. Results are representative of six independent experiments.
B. Western blots showing release of SC into culture medium in the presence of 100 μM
CCH for 0, 5, 10, 15, and 30 min in untransduced lacrimal gland acini. Sheep anti-SC
antibody combined with a donkey anti-sheep IRDye700-conjugated secondary antibody
was used to detect SC. Signals for SC (~70 kDa) were quantitated and background
intensity values were subtracted. The quantitated intensity values were then normalized
to total protein. Percent total was calculated in the same manner as for syncollin-GFP.
The results shown are representative of six independent experiments.

77

Carbachol-dependent changes in colocalization of pIgR and rab3D
Secretion studies revealed that pIgR or SC may be a content of the mature
secretory vesicle marker, so immunofluorescence studies were conducted to determine if
pIgR colocalizes with rab3D, a well characterized mSV marker (Wang Y, et al, 2003).
Qualitative confocal microscopic observations show a majority of the pIgR in the
subapical area colocalizes with rab3D in the resting (unstimulated) state (Figure 4.4 A
and B). Upon 5 minutes of CCH stimulation, rab3D starts dispersing and the
colocalization of rab3D and pIgR slightly decreases in the subapical region (Figure 4.4B).
After 30 minutes of CCH stimulation, most of the rab3D is dispersed and the
colocalization of rab3D and pIgR in the subapical region is significantly decreased
(Figure 4.4B).

78

A.
B.
79

Figure 4.4 Colocalization of SC/pIgR and rab3D in CCH-stimulated acini. A.
Confocal micrographs of control and 100 μM CCH-stimulated (5 and 30 min) LGAC.
Rab3D (red), SC/pIgR (green), and actin (blue) are displayed as separate signals and as
merged images. Arrows indicate areas of high colocalization between rab3D and
SC/pIgR. Asterisks mark the lumena of the acini. Bar, 5 μm. B. Colocalization
between rab3D and SC/pIgR around the subapical region (<2 μm beneath the lumen) was
calculated. Values graphed are colocalization coefficients for SC/pIgR and reflect the
relative numbers of colocalizing pixels, compared with the overall sum of pixel
intensities above threshold and in that channel. The values range from 0 to 1, in which 0
indicates no colocalization and 1 indicates all pixels colocalize. Results were obtained
from 41 (control, 0 min), 39 (CCH, 5 min), 31 (CCH, 30 min) lumens imaged randomly
over n = 3 separate preparations (6-15 lumena/preparaton). *Significant at p ≤ 0.05.
80

Recombinant rab3D binds to pIgR in pull-down assays
The significant colocalization between pIgR/SC and rab3D in the subapical region
could be due to an interaction between rab3D and pIgR, in which rab3D regulates pIgR
localization to regulated secretory vesicles or pIgR/SC secretion therefrom. To
determine if there was an interaction between rab3D and pIgR/SC, pull-down assays with
recombinant (His)
6
-tagged rab3DWT were performed. In the pull-down assays, different
concentrations (10 μg, 20 μg and 40 μg) of recombinant rab3D were incubated with
resting LGAC. Recombinant rab3DWT successfully pulled down pIgR from the lysate,
indicating there is an association between rab3D and pIgR (Figure 4.5).

Figure 4.5 Recombinant rab3DWT pull-down of pIgR. Different concentrations of
(His)
6
-tagged rab3DWT recombinant proteins (10, 20, or 40 μg) were used in pull-down
assays with lysates from resting rabbit LGAC. Rab3DWT proteins were recovered from
lysates with incubations with His-select gel and any interacting proteins were eluted from
the beads with SDS-PAGE sample buffer. Western blot analysis was performed using
primary anti-SC and anti-(his)
6
antibodies and appropriate secondary antibodies
conjugated with IRDye-700 or -800.

81

Rab3D-pIgR interaction is sensitive to the GTP-bound state of rab3D
If the interaction between rab3D and pIgR is functionally significant, the GTP-
bound state of rab3D should affect its interaction with pIgR. To examine how the GTP-
bound state of rab3D influences the rab3D-pIgR interaction, pull-down assays with
recombinant rab3DWT and mutated rab3D proteins were performed to determine how
they interact with pIgR. Although there was background binding of pIgR to the His-
select beads, pull-down of pIgR from resting LGAC lysate with recombinant rab3DWT
was significantly higher. Pull-down of pIgR with the putative dominant-negative
rab3DT36N, deficient in guanine nucleotide binding (Chen X, et al, 2002 and 2003), was
even greater than with rab3DWT (Figure 4.6A). Quantitation of the binding of pIgR, in
which the pIgR signal was normalized to the rab3D signal and then calculated as a
percentage of the pIgR pulled-down from rab3DWT, revealed that rab3DT36N bound
36% ± 19% more pIgR (S.E.M., n=3 independent experiments) than the amount of pIgR
bound to rab3DWT. The constitutively active rab3DQ81L, deficient in GTP hydrolysis
(Chen X, et al, 2002; Némoz-Gaillard E, et al 2001), did not bind to pIgR (Figure 4.6A)
with only 4% ± 4% (S.E.M., n=3 independent experiments) of the amount of pIgR
binding to rab3DQL compared to rab3DWT (Figure 4.6B). Further analysis of the effect
of the GTP-bound state of rab3D was performed by supplementing lysates with GTP and
GDP nucleotides in pull-down assays with rab3DWT. Figures 4.6A and 4.6B show that
when 10 μM nonhydrolyzable GTPγS or 0.5 mM GTP is added to the lysates, binding of
pIgR to rab3DWT is significantly inhibited with only 9% ± 5% (S.E.M., n=7 independent
experiments) and 25% ± 8% (S.E.M., n=9 independent experiments), respectively, of the
82

amount of pIgR bound to rab3DWT. Interestingly, when lysate is supplemented with
nonhydrolyzable GDPβS in pull-down assays with rab3DWT, pull-down of pIgR is
completely inhibited (Figures 4.6C and D). From these pull-down assays, the GTP-
bound state of rab3D was determined to play an important role its interaction with pIgR.
The GTP-bound form, whether induced by a mutation or by the addition of GTP γS or
GTP, appears to be incapable of binding to pIgR. The interaction of pIgR with the GDP-
bound form of rab3D is more complex with the mutant rab3DT36N binding pIgR more
efficiently than the wild-type rab3D and the addition of GDPβS to wild-type rab3D
completely abolishing its interaction to pIgR.

83

A.
B.
D.
C.
84

Figure 4.6 Effect of mutations and GTP binding on recombinant rab3D pull-down
of pIgR. A. Rab3DWT, constitutively active rab3DQ81L, and dominant-negative
rab3DT36N expressed as (His)
6
-tagged proteins in E. coli were purified and 40 g of
each used in pull-down assays with lysates from resting LGAC. In some cases, the lysate
was supplemented with 10 μM GTPγS or 0.5 mM GTP. The binding of pIgR to rab3D
was visualized by Western blot. B. Data are plotted as a percentage of pIgR binding to
rab3DWT (±S.E.M., n=3-9). C. Recombinant (His)
6
-tagged rab3DWT protein was used
in pull-down assays with lysates from resting LGAC, which in some cases were
supplemented with 10 μM GTPγS or 10 μM GDPβS. The binding of pIgR to rab3D was
visualized by Western blot. D. Data are plotted as a percentage of pIgR binding to
rab3DWT (±S.E.M., n=4). (Data was obtained in collaboration with Wenzheng Zhang,
Ph.D., Department of Pharmaceutical Sciences, USC)
85

Adenovirus-mediated overexpression of mutant rab3DT36N in LGAC inhibits
CCH-stimulated SC secretion

If the GTP-bound state of rab3D is important in its interaction with pIgR, it could
play a functional role on pIgR trafficking and SC secretion. Since SC secretion appears
to be stimulated by CCH, overexpression of rab3D or its mutants should affect CCH-
stimulated SC secretion. Analysis of SC released into media from lacrimal gland acini
transduced with Ad-rab3D constructs reveal that in acini overexpression the mutant
rab3DT36N, the release of SC attributed to only CCH stimulation (i.e. the basal rate of
SC is subtracted) is significantly inhibited after 15 min of stimulation compared to that of
Ad-GFP transduced acini (Figure 4.7B). There were no statistically significant
differences in SC secretion between acini transduced with Ad-GFP and those transduced
with Ad-rab3DWT or rab3DQ81L. There were also no significant effects of rab3D
overexpression on basal SC secretion (data not shown). Nonetheless, inhibition of CCH-
stimulated SC secretion by rab3DT36N is consistent with a role for rab3D in regulating
pIgR trafficking and SC release through the regulated secretory pathway.

86

A.
B.
C.
87

Figure 4.7 Effect of adenovirus-mediated overexpression of rab3DWT and rab3D
mutants on SC release in LGAC. A. Western blots of SC released into culture medium
in the presence or absence of 100 μM CCH for 0, 5, 10, 15, and 30 min from LGAC,
transduced with either Ad-GFP or Ad-rab3DWT were quantitated. Quantitated
intensities were normalized to total protein. Percent total secretion was calculated by
subtracting baseline secretion of SC (at t = 0 min) from each value and compared to SC
released by 30 min CCH-stimulation of untransduced cells. Unstimulated values were
then subtracted from CCH-stimulated values at each time point and graphed as Δ(CCH-
CON). B. Comparison of SC released into culture medium in LGAC transduced with
either Ad-GFP or dominant-negative Ad-rab3DT36N. SC release was analyzed as
mentioned above. C. Comparison of SC release into culture medium in LGAC
transduced with Ad-GFP or constitutively active Ad-rab3DQ81L. SC release was
analyzed as mentioned above. Results are from six to eight independent experiments
±S.E.M. *Significant at p ≤ 0.05.
88

The lack of clear-cut functional effects from the overexpression of rab3D,
particularly the mutants, suggests that the regulation of SC release by rab3D may be more
complex than acting as a binary switch or that perhaps other isoforms of rab3, such as
rab3A, may be compensating for the compromised function of rab3D. The lack of
functional effects may also be due to the fact that the majority of the overexpressed
rab3D is expressed in the soluble fraction, whereas a majority of endogenous rab3D is
expressed in the membrane fraction (Figure 4.8A and B), indicating that perhaps not
enough of the overexpressed rab3D constructs, particularly rab3DWT and rab3DQ81L,
are expressed in the membranes to have a functional effect on SC secretion.

89

B.
A.
90

Figure 4.8 Western blot analysis of rab3D WT and mutant expression in the
soluble and membrane fractions of rabbit LGAC. A. Soluble (Si) and membrane
(Pi) fractions were prepared from LGAC transduced with adenovirus constructs
expressing HA-tagged rab3D-WT, -TN, or –QL. 1% of the total Si fractions and 13.3%
of the total Pi fractions were separated by SDS-PAGE. Western blot analysis with
primary anti-HA antibody and appropriate secondary antibodies were performed. Signals
for HA-rab3D was quantitated. % Total was calculated as a ratio of total signals of Si or
Pi to the sum of the Si and Pi. B. Soluble (Si) and membrane (Pi) fractions were prepared
from LGAC transduced with adenovirus constructs expressing GFP, HA-tagged rab3D-
WT, -TN, or –QL. 1% of the total Si fractions and 13.3% of the total Pi fractions were
separated by SDS-PAGE. Western blot analysis with primary anti-rab3D antibody and
appropriate secondary antibodies were performed. Signals for rab3D was quantitated. %
Total was calculated as a ratio of total signals of Si or Pi to the sum of the Si and Pi.
91

Acute treatment of cholinergic agonist abolishes rab3D-pIgR binding
Since secretion studies have revealed that CCH stimulates the release of SC
(Figure 4.3B) in LGAC, it is possible that CCH could regulate the interaction between
pIgR and rab3D, ultimately regulating SC release from LGAC. To determine the effect
of CCH on the pIgR-rab3D interaction, lysates prepared from 30 min or 60 min CCH-
stimulated (100 μM) LGAC were incubated with recombinant rab3DWT in pull down
assays. Results reveal decreased binding of pIgR to rab3D from 100% (0 min) to 43% ±
15% (30 min) and 26% ± 13% (60 min) (S.E.M., n=5 independent preparations) (Figures
4.9A and B). To determine if the decreased binding of pIgR could be due to decreased
pIgR content in the lysate after CCH stimulation, the expression of pIgR in CCH-
stimulated (100 μM, 30 min or 60 min) lysate was analyzed. Although there is a
decrease in pIgR content in LGAC after CCH stimulation (Figures 4.9C and D), the
magnitude and time of this decrease is different than those observed in the pull-down
assays, indicating that the overall decrease in pIgR content in the acini does not appear to
account for the decrease in pIgR binding to rab3D in the pull-down assays with CCH-
stimulated lysate. The CCH-dependent loss of interaction between pIgR and rab3D could
provide a mechanism for the observed stimulation of SC secretion in LGAC, particularly
if the rab3D-interaction negatively regulates the terminal steps in SC release.
92

Figure 4.9 Effect of CCH on rab3D-pIgR interaction and content of pIgR in CCH-
stimulated lysate from LGAC. A. Lysates from unstimulated (0 min) or 100 μM CCH-
stimulated (30 or 60 min) LGAC were incubated with recombinant rab3DWT in pull-
down assays. Binding of pIgR to rab3D was visualized by Western blot. B. The ratio of
pIgR to rab3D was calculated and normalized to that from resting LGAC (% of binding
at 0 min). Results shown are from five independent experiments ±S.E.M. (Data was
obtained in collaboration with Wenzheng Zhang, Ph.D., Department of Pharmaceutical
Sciences, USC) C. Lysates from unstimulated (0 min) or 100 μM CCH-stimulated (30 or
60 min) LGAC were prepared, resolved by SDS-PAGE and transferred to nitrocellulose.
Expression of pIgR and actin was visualized by Western blot analysis. D. The ratio of
pIgR to actin was calculated and normalized to that from resting LGAC (% at 0 min).
Results are from three independent experiments ±S.E.M. *Significant at p ≤ 0.05.
A. B.
C.
D.
93

Chapter V. Discussion: The characterization of SNAREs involved in regulated
exocytosis in lacrimal gland acinar cells

The lacrimal gland acinar cells play an important role in tear and protein secretion
and since the secretory process is tightly regulated, it is important to examine the
exocytic machinery at the apical plasma membrane. The SNARE machinery involved in
regulated exocytosis has not yet been examined in the lacrimal gland acinar cells. Since
the roles of SNAREs are not clearly understood in the lacrimal glands, it is important to
determine the intracellular localization of SNAREs and SNARE-related proteins to help
determine the biological function of SNAREs and their involvement in the regulation of
membrane trafficking.
The only SNAREs that have been identified in the lacrimal gland acinar cells are
R-SNAREs, particularly VAMP2 and VAMP8. Previous studies in our lab have shown
that there is a pool of rSVs enriched in VAMP2 in the lacrimal gland acinar cells that
appear to be involved in regulated exocytosis at the apical plasma membrane (Wang Y, et
al, 2003). VAMP8-enriched secretory vesicles have also been identified to be involved
the exocytic process at the apical plasma membrane in lacrimal gland acinar cells (Wang
CC, et al, 2007). Immunofluorescence studies confirmed the presence of VAMP2 in
vesicles throughout resting acini and its recruitment to the subapical area in CCH-
stimulated acini. Subcellular localization of VAMP8 was determined to be in the
subapical area in resting and CCH-stimulated acini. The subcellular localization of
VAMP2 and VAMP8 in lacrimal gland acini makes them good candidates to be the R-
94

SNAREs involved in apical exocytosis and since they have been reported to be involved
in regulated exocytosis in the LGACs, these R-SNAREs are likely to be involved in
forming a SNARE complex at the APM.
To be able to determine the molecular machinery involved in the SNARE
complex, the expression of Q-SNAREs in the lacrimal gland needed to be examined.
Some studies have already investigated the intracellular localization of SNAREs,
particularly syntaxins, in polarized epithelial cells. Syntaxins 2 and 3 have been reported
to be primarily expressed on the apical plasma membrane and syntaxin 4 on the
basolateral membrane. In my studies, syntaxins 2, 3, and 4 were determined to be
expressed in the rabbit LGACs by Western blot and/or PCR analysis.
Immunofluorescence studies only revealed the subcellular localization of one of the
syntaxins, syntaxin 3, which was determined to be expressed at the APM. Since I was
particularly interested in uncovering the SNARE complex being formed at APM,
discovering the expression of syntaxin 3 at the APM was of great interest.
So far I have uncovered several SNAREs that may be involved in forming a
complex at the APM, but the expression of another Q-SNARE, a SNAP-25 isoform, at
the APM is necessary to form a complete SNARE complex. SNAP-25 is primarily
expressed in the nervous system and in neuroendocrine cells (Bark IC, et al, 2005), but an
isoform of SNAP-25, SNAP-23, is broadly expressed in non-neuronal tissues. In
pancreatic and parotid acinar cells, SNAP-23 is expressed on the BLM and/or APM
(Gaisano HY, et al, 1997; Imai A, et al, 2003). In my experiments, SNAP-23 and not
SNAP-25 was determined to be expressed in the LGACs. Immunofluorescence studies
95

revealed the subcellular localization of SNAP-23 at the APM and the BLM, indicating
SNAP-23 is likely to be involved in forming a SNARE complex at the APM. The
localization of SNAP-23 at the APM was interesting, since its localization overlaps with
syntaxin 3, indicating that they may be involved in forming a SNARE complex at the
APM.
A variety of SNARE complexes are postulated to regulate exocytosis in non-
neuronal cells. In gastric parietal cells, SNARE complexes composed of VAMP2,
syntaxin 3, and SNAP-25 have been shown to be involved in regulated exocytosis (Liu Y,
et al, 2007). In pancreatic acinar cells, studies have proposed that SNARE complexes
composed of VAMP8, syntaxin 2, and SNAP-23 are involved in the fusion of zymogen
granules to the plasma membrane (Pickett JA, et al, 2007). SNARE complexes
composed of VAMP2, syntaxin 4 and SNAP-23 have been shown to mediate the insulin-
dependent trafficking of glucose-transporter 4 to the plasma membrane in adipocytes
(Kawanishi M, et al, 2000). Pull-down studies in LGACs revealed that VAMP2/syntaxin
3/SNAP-23 and VAMP8/syntaxin 3/SNAP-23 appear to form a complex, presumably at
the APM since immunofluorescence studies showed the localization of these SNAREs at
the subapical region or at the APM. Immunofluorescence studies involving LGACs
transduced with Ad-GFP-VAMP2, showed colocalization between GFP-VAMP2 and
syntaxin and between GFP-VAMP2 and SNAP-23 at the APM, especially after CCH-
stimulation, also indicating that VAMP2/syntaxin 3/SNAP-23 may form a SNARE
complex at the APM in LGACs.
96

An attempt to determine the functional role of VAMP2 on regulated exocytosis
was made by inhibiting VAMP2. Botulinum neurotoxins are potent inhibitors of
neurotransmitter release, cleaving various SNARE proteins, depending on the serotype
(Zdanovska MV, et al, 2000; Humeau Y, et al, 2000; and Anner-Hilger G and Bigalke H,
1995). Botulinum neurotoxin B – light chain (BotB-LC) was used in my studies to cleave
VAMP2 to render it nonfunctional in the cells. In the rabbit LGACs, however, the BotB-
LC was not successful in cleaving VAMP2 (Figure 3.15). First, I thought the rabbit
VAMP2 protein sequence may be different from other species, such as humans, and
perhaps lacked the cleavage site, but comparing the rabbit VAMP2 protein sequence with
the human VAMP2 sequence revealed that the rabbit VAMP2 sequence was 100%
homologous to the human VAMP2 sequence in the region critical for BotB-LC binding
and cleavage (figure 5.1) (Fang H, et al, 2006). Since the cleavage site exists, it could be
possible that the cleavage site is not accessible to BotB-LC due to VAMP2 being
complexed to an undefined SNARE protein, hence rendering the VAMP2 uncleavable
(Gaisano HY, et al, 1996; Hayashi T, et al, 1994). There has been evidence that certain
Clostridum neurotoxins, such as Tetanus toxin (TeTx), have no effect on the fast phase of
neurotransmitter release, possibly due to docked vesicles, but inhibits the slow phase of
release, suggesting that vesicles that are docked and have assembled SNARE complexes
previous to TeTx action are component to fuse and are not sensitive to TeTx (Hayashi T,
et al, 1994). Further analysis on the unavailability of the BotB-LC cleavage site on
VAMP2 due to protein binding in rabbit LGACs will have to be further examined.
97

Figure 5.1 Comparison of the human (Homo sapien) and the rabbit (Oryctolagus
cuniculus) VAMP2 protein sequences. The protein sequences of (1) Homo sapien and
(2) Oryctolagus cuniculus critical for BotB-LC binding and cleavage are depicted. The
sequences enclosed in brackets are the minimum sequence necessary for efficient BotB-
LC. The slashes indicate the BotB-LC cleavage site. Sequences in italics are part of the
probable transmembrane domain. (Fang H, et al, 2006).
98

Initially, the relationship of VAMP2-enriched rSVs and rab3D-enriched mSVs
was to be explored by inhibiting VAMP2 with BotB-LC. Rab3D is an isoform of the
rab3 protein family, which has been well characterized in cells with regulated secretory
pathways (Durchen F and Goud B, 2000; Geppert M, 1998; Schlüter OM, et al, 2002).
Rab proteins regulate multiple steps in membrane trafficking. Of particular interest are
the vesicle tethering and fusion steps in which rab3D and VAMP2 could possibly work
together to regulate secretory vesicle exocytosis. Rab proteins are known to recruit
tethering factors to start the interaction between a vesicle and its target membrane, after
which SNARE proteins can form a complex to promote fusion of the membranes (Cai H,
et al, 2007). A study by Martincic I, et al (1997) identified a protein, prenylated Rab
acceptor protein (PRA1), which can bind to prenylated Rab GTPases and VAMP2. This
particular study showed that prenylated rab3A and VAMP2 can bind to PRA1, however
the interaction of PRA1 is not specific toward different rab proteins but highly specific
for VAMP2. The interaction of PRA1 with rab GTPases and VAMP2 indicates that
PRA1 may be a factor linking vesicle docking and fusion. PRA1’s interaction with
VAMP2 may prevent VAMP2 from forming premature SNARE complexes and its
recruitment of the rab GTPase could then disrupt the interaction between PRA1 and
VAMP2, thus allowing VAMP2 to interact with Q-SNAREs to form a SNARE
complexes. It is also possible that rab3D could regulate a step prior to fusion, motor-
based vesicle transport. Host cells infected by Salmonella leads to the formation of
specialized membrane-bound compartments called Salmonella-containing vacuoles
(SCVs). These SCVs require Rab7 for its maturation (Meresse S, et al, 1999; Jordens I,
99

et al, 2005). One study by Guigonot J, et al (2004) showed that the recruitment of dynein
to SCVs is dependent on rab7 activity, suggesting that certain rab proteins can participate
in motor-based vesicle transport.
Since BotB-LC was unsuccessful in cleaving VAMP2, BotB-LC could not be
utilized to examine the relationship between the VAMP2-enriched rSV and rab3D-
enriched mSV populations. However, immunofluorescence microscopy studies of
LGACs transduced with Ad-GFP-VAMP2 revealed that GFP-VAMP2 and rab3D appear
to label separate vesicles in resting acini. Time-lapse microscopy of live LGACs
transduced with Ad-GFP-VAMP2 also revealed that GFP-VAMP2-enriched vesicles fuse
directly with the APM and not with larger secretory vesicles, also suggesting that the
VAMP2-enriched rSVs and rab3D-enriched mSVs are separate vesicle populations.
Figure 5.2 depicts the relationship between VAMP2-enriched rSVs and rab3D-enriched
mSVs in rabbit LGACs. Additional experiments will have to be conducted to further
determine the relationship between VAMP2 and rab3D. It could be possible that
VAMP2 and rab3D could have no relationship. Perhaps, rab3D and the more recently
discovered secretory vesicle marker VAMP8, which has actually been shown to be
labeling SVs in the subapical region like rab3D (Figure 3.3A), could be mediating the
tethering and fusion steps of vesicle trafficking of the mSVs at the APM. Since BotB-
LC was unsuccessful in inhibiting VAMP2, the role of VAMP2 and 8 and rab3D in
secretory vesicle trafficking in LGACs will have to be further examined by other means.
Perhaps, siRNA studies, inhibiting VAMP2 and/or VAMP8, could provide some insight
into what role the two R-SNAREs have on vesicle trafficking.
100

Resting
Carbachol stimulated (100 μM, 15 min)
VAMP2
rab3D
syntaxin 3
SNAP-23
recycling endosome
101

Figure 5.2 A schematic diagram depicting the relationship between VAMP2-
enriched rSVs and rab3D-enriched mSVs. In control acini, larger rab3D-enriched
mSVs reside in the subapical region, whereas the VAMP2-enriched rSVs are more
dispersed in the cytoplasm of the acini. In CCH-stimulated acini, the VAMP2-enriched
rSVs and rab3D-enriched mSVs separately fuse with the APM.
102

In summary, my studies have characterized the SNARE proteins involved in
exocytosis at the APM in rabbit LGACs. VAMP2/syntaxin 3/SNAP-23 and
VAMP8/syntaxin 3/SNAP-23 were determined to form SNARE complexes. Also,
preliminary studies revealed that VAMP2 and rab3D are likely to be localized to separate
vesicle populations and the two vesicle populations may have no relation to each other.
There are still many more experiments to be performed to determine what role VAMP2,
VAMP8 and rab3D have in the various steps of vesicle trafficking and what trafficking
pathways these proteins may be regulating.
103

Chapter VI. Discussion: The role of rab3D on pIgR trafficking in the secretory
pathway in lacrimal gland acinar cells
Rab3 isoforms, members of the Rab GTPase family, are highly homologous and
are well characterized in cells with regulated secretory pathways (Durchen F and Goud B,
2000; Geppert M, 1998; Schlüter OM, et al, 2002). In particular, rab3D has been mainly
been associated with regulated secretory pathways. Rab3D is primarily localized to
secretory granules in pancreatic acinar cells (Ohnishi H, et al, 1996; Valentijn JA, et al,
1996), parotid acinar cells (Ohnishi H, et al, 1996; Raffaniello RD, et al, 1999), lacrimal
gland acinar cells (Ohnishi H, et al, 1996; Wang Y, et al, 2003), and gastric parietal cells
(Raffaniello RD, et al, 1996; Tang LH, et al, 1996). Functionally, rab3D has mainly
been associated with regulated exocytosis, but there is also evidence that rab3d may play
a role in the biogenesis of secretory granules (Chen X, et al, 2002 and 2003; Ohnishi H,
et al, 1997; Riedel D, et al, 2002). Previous studies in our lab have shown evidence for
the involvement of rab3D in regulated exocytosis (Wang Y, et al, 2003), but its function
is not yet well understood. From my studies, in collaboration with Zhang W., Ph.D., we
have shown novel evidence for the function of rab3D. Immunofluorescence studies show
the localization of pIgR in rab3D-enriched mature secretory vesicles (Figure 4.4). There
is also evidence that endogenous rab3D directly interacts with endogenous pIgR (Evans
E, et al, 2008). Pull-down assays revealed that the interaction between rab3D and pIgR is
sensitive to the GTP-bound state of rab3D, where GTP-bound rab3D could not bind to
pIgR (Figure 4.6). The interaction also appears to be regulated by a physiological
signaling pathway stimulated by CCH, an acetylcholine agonist, as indicated by
104

immunofluorescence studies showing decreased colocalization between rab3D and pIgR
with CCH-stimulation (Figure 4.4) and by pull-down assays showing a loss of pIgR
binding to rab3D (Figure 4.9 A and B). CCH-stimulation also results in the release of SC
from LGACs, so along with data showing the CCH-dependent changes in the localization
of endogenous rab3D and its interaction with pIgR, rab3D appears to be involved in
either the localization or retention of pIgR in mSVs. The data could also be suggesting
that pIgR is involved in the targeting of rab3D to mSVs.
Interestingly, the data from the pull-down assays suggest that pIgR is acting as a
guanine nucleotide exchange factor (GEF), a protein that triggers the exchange of GDP
for GTP on rab GTPase proteins, for rab3D. Studies involving the interaction between
small GTPases and its GEFs have shown that GEF binds better to nucleotide-free form of
small GTPase proteins compared with either the GTP- or GDP-bound forms. Examples
of such cases include Ras binding to its GEF, son of sevenless, (Vetter IR and
Wittinghofer A, 2001) and the yeast rab GTPase, Ypt1, binding to transport protein
particle (TRAPP), a multiprotein complex that regulates vesicle trafficking from the
endoplasmic reticulum to the Golgi apparatus (Wang W, et al, 2000). Several crystal
structures of nucleotide-free small GTPases with their GEFs as stable binary complexes
have also been determined. These studies show the interaction between EF-Tu with EF-
Ts, Ras with son of sevenless, and Arf with Geα2 (Vetter IR and Wittinghofer A, 2001).
Another study indicating that GEFs bind well to nucleotide-free forms of GTPase
proteins involved a rab3A mutant. In the study by Bernstin ES, et al (1992), rab3AT36N,
a mutant that does not bind GTP, was shown to bind GDP but had a high dissociation rate
105

for GDP, up to 60 times higher than that of WT Rab3A, suggesting that the mutant
spends a significant time in the nucleotide-free form. The same study also showed that
rab3AT36N has a 10-fold higher affinity for the rab3A GEF (rab3A-guanine nucleotide-
exchange factor) compared with rab3A.
Considering the data indicating that GEFs bind better to nucleotide-free forms of
small GTPases, if pIgR is functioning as a GEF for rab3D and if rab3DT36N behaves
similarly to rab3AT36N, then the binding assays in my experiments should indicate that
pIgR binds better to the nucleotide-free forms of rab3D. In the pull-down assays, (1) the
binding of pIgR to rab3DWT was shown to be inhibited in the presence of either GTP or
GDP (Figure 4.6), and (2) the binding of pIgR to rab3DT36N was better than that to
rab3DWT (Figure 4.6 A and B). In vivo experiments showed inhibition of SC secretion
in LGACs transduced with Ad-rab3DT36N, also suggesting that pIgR is interacting better
with the rab3DT36N mutant to prevent SC secretion.
The in vivo effect of rab3DT36N on SC secretion in LGACs could also be
explained by a study suggesting that rab3DT36N inhibits GDP/GTP exchange on
endogenous rab3D. The study by Chex X, et al (2003) showed that the rab3DT36N
inhibits early phase of amylase release in pancreatic acinar cells and reduces the level of
GTP-bound endogenous rab3D. In the same study, the expression of WT or
constitutively active rab3D81L did not alter levels of GTP-bound endogenous rab3D and
did not affect amylase secretion. The expression of these proteins in pancreatic acinar
cells may be due to the effects on GDP/GTP exchange on endogenous rab3D. Since
similar results on secretion were observed in LGACs were observed, where SC secretion
106

was not affected in the LGACs witn WT and rab3DQ81L expression but was inhibited
with rab3DT36N expression (Figure 4.7), the effect of the rab3D mutants may be due to a
similar mechanism as in the pancreatic acinar cells. The variable effects of the
overexpression of rab3D mutants may also just be due to rab3D regulating multiple steps
of pIgR trafficking along the merocrine secretory pathway.
Since the data from pull-down assays suggests that pIgR is acting as a GEF for
rab3D, the amino acid sequence of rabbit pIgR was analyzed to determine if it contained
a GEF domain. Numberous GEFs have been identified for rho and rac GTPases, but only
a few have been identified for rab GTPases. A couple of GEFs for rab3A have been
isolated from rat brains and are known as rab3GEP (Wada M, et al, 1997) and GRAB
(Luo HR, et al, 2001). GRAB (GI: 130200) displays considerable homology to Sec2p,
which is a GEF for Sec4p, a yeast GTPase that regulates secretory vesicle trafficking
(Luo HR, et al, 2001; Sato Y, et al, 2007). GRAB and Sec2p bind to their respective
GTPases through a coiled-coil domain (Luo HR, et al, 2001; Sato Y, et al, 2007). Amino
acids 70-160 of GRAB form the coiled-coil domain (Luo HR, et al, 2001). A comparison
of the amino acid sequences of pIgR with GRAB and rab3GEP, the two of which share
more than a 50% amino acid sequence homology (Luo, et al, 2001), and several other
GEFs with rabbit pIgR showed no significant similarity. A lot of variation exists
amongst the GEFs. A Sec7 domain is found in a family of Arf-GEFs (Shin H-W and
Nakayama K, 2004), a Dbl homology domain is found in a family of rho-GEFs (Erickson
JW and Cerione RA, 2004), and a Vps9 domain is found in GEFs for rab5 (Delprato A, et
al, 2004). The many variations that exist could explain why pIgR does not share any
107

similarities with rab3GEP and GRAB. There could be a domain in pIgR that associates
with rab3D that has yet to be identified. Since pIgR prefers to bind to nucleotide-free
rab3D, the type of GEF domain that binds to the rab3D GTPase could be different from
rab3GEP and GRAB. To determine whether pIgR is actually a GEF, it will be important
to determine if it exhibits GEF activity, causing the dissociation of GDP and enhancing
GTP binding on rab3D.
A study in MDCK cells revealed an interaction between rab3B and pIgR (van
Ijzendoorn SCD, et al, 2002). However, the rab3D and pIgR interaction observed in the
LGACs differs from the study in MDCK cells in many ways. The finding in the study by
Ijzendorn SCD, et al, revealed the interaction between rab3D and pIgR was sensitive to
the GTP-bound state of rab3D and to the binding of the pIgR ligand, dIgA. In contrast to
the results of the binding assays in the LGACs, the pIgR bound to the GTP-bound form
of rab3B in MDCK cells (van Ijzendoorn SCD, et al, 2002). The differences in the
interactions of rab3B and rab3D with pIgR may reflect the different functional roles they
have in different cells types in which these rabs and pIgR are expressed. Since the rab3B
isoform is not expressed in LGAC (Evans E, et al, 2008), the interaction between rab3D
and pIgR cannot be verified in LGACs. It would be interesting to determine if rab3D
expressed in MDCK cells would bind to pIgR in a manner similar to rab3B. Since rab3D
is an isoform that is not endogenously expressed in MDCK cells, it would have to be
transiently transfected or stably expressed. The subcellular localization of rab3D in
MDCK cells will be of interest, since they do not have mature secretory vesicles. Will
rab3D create mature secretory vesicles in MDCK cells? When synaptophysin, a synaptic
108

vesicle protein, was expressed by transfection in MDCK cells, it was directed to both
basolateral and apical recycling compartments of the cell (Cameron P, et al, 1993). In
isolated hippocampal neurons in primary culture, synaptophysin was concentrated on
synaptic vesicles in the axons, but not excluded from dendrites, so it parallels the
distribution in MDCK cells with axons representing the apical side and the dendrites
representing the basolateral side (Cameron P, et al, 1993). Even though MDCK cells do
not contain synaptic vesicles, synaptic vesicle proteins are still directed to its appropriate
pole (Cameron P, et al, 1993). Since MDCK cells do not contain mature secretory
vesicles, rab3D may still be apically targeted but may not be expressed on mature
secretory vesicles, rather it may just be present on vesicles similar to the ones with rab3B
in the apical region. There may be an apical targeting signal present on rab3D to target it
to an apical compartment, but that remains to be determined. Once rab3D is successfully
expressed in MDCK cells with pIgR, it would be interesting to determine its relationship
with pIgR. Will rab3D interact with pIgR and if it does, how will the presence of GDP
and GTP on rab3D affect the interaction?
Despite the differences between the rab3B/pIgR and the rab3D/pIgR interaction,
there are some similarities. The first is the interaction between the rab GTPase and it
putatitive cargo. There are a few other studies that have reported a direct interaction
between a rab protein and a cargo protein. Some examples are rab11 interacting with
TPβ in HEK293 cells (Hamelin E, et al, 2005), rab11a interacting with the transient
receptor potential (TRP)V5 and TRPV6 Ca2+ channels (van de Graff SFJ, et al, 2006),
and rab5A interacting with the angiotensin-1 receoptor (Seachrist JL, et al, 2002).
109

Another similarity is that the interaction between the rab3 isoforms and pIgR is
dependent on the GTP-binding state of the rab3 isoforms, indicating that the interactions
are functional ones. The last similarity is that the interaction between the rab3 isoforms
and pIgR is sensitive to physiological stimuli. In the case of rab3B, the stimulus was
dIgA, and in the case of rab3D, the stimuli was CCH. Since dIgA was not available to be
used in studies with the LGAC, it will be interesting to see how dIgA affects the
interaction between rab3D and pIgR and how dIgA affects the secretion of SC from the
LGACs.
The localization of pIgR to mSVs in LGACs suggests that pIgR has a motif that
targets it to the regulated secretory pathway. However, the intracellular route taken by
pIgR on its way to mSVs has yet to be characterized. The pIgR could be directly
delivered to mSVs from the trans-golgi network, similar to other tear proteins (Wu K, et
al, 2006). Otherwise, there could be a novel route to the mSVs from the transcytotic
pathway, as seen in Figure 6.1. The second theory may seem more likely, considering
that when the LGACs cells are stimulated with CCH, the pIgR is trafficked from the
BLM to the subapical area as seen in the SC antibody uptake studies (Figure 4.2);
however, nascent pIgR may still be trafficked from the trans-golgi network to the
subapcial region. From these studies, since the LGACs are not cultured in the presence
of dIgA, it can also be concluded that dIgA is not necessary for the trafficking of pIgR to
the SVs.
In summary, the studies in the LGACs have shown a novel localization of pIgR
and/or SC to mSVs and a novel, functional interaction between pIgR and rab3D in a
110

physiologically relevant system. From the data that has been discussed, rab3D may be
regulating a novel pathway that trafficks pIgR to the regulated secretory pathway, either
directly from the trans-golgi network or directly from the transcytotic pathway. The data
also suggests that the pIgR may be regulating the function of rab3D as its GEF.
There are still many questions to be investigated about the function of the rab3D
and pIgR interaction in LGACs. Since dIgA plays a significant role in the trafficking of
pIgR in epithelial cells (Apodaca G, et al, 1994; Barroso M and Sztul ES, 1994), it will
be important to determine the effects of dIgA on the trafficking of pIgR/SC and the
effects of dIgA on the interaction on the pIgR and rab3D interaction. Another issue is to
determine the function of the pool of pIgR/SC in the secretory granules. Since sIgA and
free SC are highly abundant in tear film (Lambert RW, et al, 1994; Sullivan DA and
Allansmith AR, 1984; Sullivan DA, et al, 1984b) and since most of the sIgA and free SC
are produced by the lacrimal glands (Sullivan DA and Allansmith AR, 1984; Sullivan
DA, et al, 1984a), the large pools of pIgR/SC may provide a secure source for a quick
generation of free SC and sIgA in the presence of a physiological stimuli to help protect
the musical and ocular surfaces from environmental pathogens (Hunziker W and
Kraehenbuhl J-P, 1998; Kaetzel, 2005; Phalipon A and Corthesy B, 2003).
111

Figure 6.1 A schematic diagram depicting the possible roles of rab3D in the
regulation of pIgR trafficking and SC secretion in LGACs. If pIgR is trafficked
through the merocrine secretory pathway (pink arrows), pIgR synthesized in the
endoplasmic reticulum (ER) exits from the trans-golgi network (TGN) and sorts secretory
vesicles (SVs) in the subapical region with the help of rab3D. If pIgR is trafficked
through the constitutive transcytotic pathway (black arrows), pIgR synthesized in the ER
exits from the TGN and is transported to the basolateral membrane (BLM). From the
BLM, the pIgR is endocytosed and transported through a series of endosomal
compartments. When pIgR reaches the apical endosomes (AE), pIgR may then be sorted
into SVs in the subapical region (orange arrow) with the help of rab3D or pIgR may
continue to be trafficked directly to the apical membrane (APM). BE, basolateral
endosomes; dIgA, dimeric IgA; SC, secretory component; sIgA, secretory IgA.
(Diagram adapted from Evans E, et al, 2003)
112

References

Ahnert-Hilger G and Bigalke H. Molecular aspects of tetanus and botulinum neurotoxin
poisoning. Prog Neurobiol. 46: 83-96 (1995).
An SJ, Hansen NJ, Hodel A, Jahn R, Edwardson JM. Analysis of the association of
syncollin with the membrane of the pancreatic zymogen granule. J Biol Chem. 275:
11306-11 (2000).
Apodaca G, Katz LA, and Mostov KE. Receptor-mediated transcytosis of IgA in MDCK
cells is via apical recycling endosomes. J Cell Biol. 125: 67-86 (1994).
Bark IC, Hahn KM, Rayabinin AE, and Wilson MC. Differential expression of SNAP-25
protein isoforms during divergent vesicle fusion events of neural development. Proc Natl
Acad Sci USA. 92: 1510-1514 (1995).
Barroso M and Sztul ES. Basolateral to apical transcytosis in polarized cells is indirect
and involves BFA and trimeric G-protein sensitive passage through the apical
endosomes. J Cell Biol. 124: 83-100 (1994).
Berridge MJ. Inositol trisphosphate and diacylglycerol: two interacting second
messengers. Ann Rev Biochem. 56: 159-193 (1987).
Bonavida B, Sapse AT, and Sercarz EE. Rabbit tear proteins. I. Detection and
quantitation of lysozyme in nonstimulated tears. Invest Ophthalmol. 7: 435-40 (1968).
Botelho SY. Tears and the lacrimal gland. Sci Am. 211: 78-86 (1964).
Burstein ES, Brondyk WH, and Macara IG. Amino acid residues in the ras-like GTPase
Rab3A that specify sensitivity to factors that regulate GTP/GDP cycling of Rab3A. J
Biol Chem. 267: 22715-22718 (1992).
Cai H, Reinisch K, and Ferro-Novick S. Coats, tethers, rabs, and SNAREs work together
to mediate the intracellular destination of a transport vesicle. Dev Cell. 12: 671-682
(2007).
Cameron P, Mundigl O, and De Camilli P. Traffic of synaptic vesicle proteins in
polarized and nonpolarized cells. J Cell Sci Suppl. 17: 93-100 (1993).

113

Cameron RH, Walcott B, Claros N, Mendel K, and Brink PR. Cholinergic modulation of
immunoglobulin secretion from avian plasma cells: the role of cyclic mononucleotides. J
Neuroimmunol. 61: 223-230 (1995).
Castle JD. Sorting and secretory pathways in exocrine cells. Am J Respir Cell Molec
Biol. 2: 119-26 (1990).
Chen LL, Johansson JK, Hodges RR, Zoukhri D, Ghinelli E, Rios JD, and Dartt DA.
Differential effects of the EGF family of growth factors on protein secretion, MAPK
activation, and intracellular calcium concentration in rat lacrimal gland. Exp Eye Res.
80: 379-389 (2005).
Chen X, Edwards JA, Logsdon CD, Ernst SA, and Williams JA. Dominant negative
rab3D inhibits amylase release from mouse pancreatic acini. J Biol Chem. 277: 18002-
18009 (2002).
Chen X, Ernst SA, and Williams JA. Dominant negative rab3D mutants reduce GTP-
bound endogenous rab3D in pancreatic acini. J Biol Chem. 278: 50053-50060 (2003).
Chen YA and Scheller RH. SNARE-mediated membrane fusion. Nat Rev Mol Cell
Biol. 2: 98-106 (2001).
da Costa SR, Yarber FA, Zhang L, Sonee M, and Hamm-Alvarez SF. Microtubules
facilitate the stimulated secretion of b-hexosaminidase in lacrimal gland acinar cells. J.
Cell Sci. 111: 1267-1276 (1998).
da Costa SR, Sou E, Yarber FA, Okamoto CT, Pidgeon M, Kessels MM, Mirchefff AK,
Schecter J, Qualmann B, and Hamm-Alvarez SF. Impairing actin filament or syndapin
functions promotes accumulation of clathrin-coated vesicles at the apical plasma
membrane of polarized cells. Mol Biol Cell. 14: 4397-4413 (2003).
Darchen F and Goud B. Multiple aspects of rab protein action in the secretory pathway:
focus on rab3 and rab 6. Biochimie. 82: 375-384 (2000).
Dartt DA. Interaction of EGF family growth factors and neurotransmitters in regulating
lacrimal gland secretion. Exp Eye Res. 78: 337-345 (2004).
Dartt DA. Regulation of lacrimal gland secretion by neurotransmitters and the EGF
family of growth factors. Exp Eye Res. 73: 741-752 (2001).
114

Dartt DA, Dicker DM, Ronco LV, Kjeldsen IM, Hodges RR, and Murphy SA. Lacrimal
gland inositol trisphosphate isomer and inositol tetrakisphosphate production. Am J
Physiol. 259: G274-281 (1990).
Delaire A, Lassagne H, and Gachon AM. New members of the lipocalin family in human
tear fluid. Exp Eye Res. 55: 645-647 (1992).

Delprado A, Merithew E, and Lambright DG. Structure, exchange determinants, and
family-wide specificity of the tandem-helical bundle and Vps9 domains of rabex-5. Cell.
118: 607-617 (2004).

Erickson JW and Cerione RA. Structural elements, mechanism, and evolutionary
convergence of rho protein-guanine nucleotide exchange factor complexes. Biochem. 43:
837-842 (2004).

Evans E, Zhang W, Jerdeva G, Chen C-Y, Chen X, Hamm-Alvarez SF, and Okamoto C.
Direct interaction between Rab3D and polymeric immunoglobulin receptor and
trafficking through regulated secretory vesicles in lacrimal gland acinar cells. Am J
Physiol Cell Physiol. 294: Epub ahead of print (2008).
Feng H, Luo W, Henkel J, Barbieri J, and Green N. A yeast assay probes the interaction
between botulinum neurotoxin serotype B and its SNARE substrate. Proc Natl Acad Sci
USA. 103: 6958-6963 (2006).
Franklin RM. The ocular secretory immune system: a review. Curr Eye Res. 8: 599-606
(1989).
Fullard RJ, Snyder C. Protein levels in nonstimulated and stimulated tears of normal
human subjects. Invest Ophthalmol Vis Sci. 31: 1119-26 (1990).
Fujita-Yoshigaki J, Dohke Y, Hara-Yokoyama M, Kamata Y, Kozaki S, Furuyama S, and
Sugiya H. Vesicle-associated membrane protein 2 is essential for cAMP-regulated
exocytosis in rat parotid acinar cells. The inhibition of cAMP-dependent amylase release
by botulinum neurotoxin B. J Biol Chem. 271: 13130-13134 (1996).
Gaisano HY, Sheu L, Foskett JK, and Trimble WS. Tetanus toxin light chain cleaves a
vesicle-associated membrane protein (VAMP) Isoform 2 in rat pancreatic zymogen
granules and inhibits enzyme secretion. J Biol Chem. 269: 17062-17066 (1994).
115

Gaisano HY, Ghai M, Malkus PN, Sheu L, Bouquillon A, Bennett MK, and Trimble WS.
Distinct cellular locations of the syntaxin family of proteins in rat pancreatic acianr cells.
Mol Biol Cell. 7: 2019-2027 (1996).
Gao J, Cha S, Jonsson R, Opalko J, and Peck AB. Dectection of anti-type 3 muscarinic
acetylcholine receptor autoantibodies in the sera of Sjogren’s syndrome patients by use of
a transfected cell line assay. Arthritis Rheum. 50: 2615-2621 (2004).

Gao J, Schwalb TA, Addeo JV, Ghosn CR, and Stern ME. The role of apoptosis in the
pathogenesis of canine keratoconjuctivitis sicca: the effect of topical Cyclosporin A
therapy. Cornea. 17: 654-663 (1998).
Geppert M. Rab3 and synaptotagmin: the yin and yang of synaptic membrane fusion.
Annu Rev Neurosci. 21: 75-95 (1998).
Gerst JE. SNARE regulators: matchmakers and matchbreakers. Biochim Biophys Acta.
1641: 99-110 (2003).
Gevrey JC, Laurent S, Saurin JC, Némoz-Gaillard E, Regazzi R, Chevrier AM,
Chayvialle JA, and Abello J. Rab3a controls exocytosis in cholecystokinin-secreting
cells. FEBS let. 503: 19-24 (2001).
Gorr SU, Venkatesh SG, and Darling DS. Parotid secretory granules: crossroads of
secretory pathways and protein storage. J Dent Res. 84: 500-509 (2005).
Grosshans BL, Ortiz D, and Novick P. Rabs and their effectors: achieving specificity in
membrane traffic. PNAS. 103: 11821-11827 (2006).
Guignot J, Caron E, Beuzon C, Bucci C, Kagan J, Roy C, and Holden DW. Microtubule
motors control membrane dynamics of Salmonella-containing vesicles. J Cell Sci. 117:
1033-1045 (2004).
Hamelin E, Thériault C, Laroche G, and Parent J-C. The intracellular trafficking of the G
protein-coupled receptor TPβ depends on a direct interaction with rab11. J Biol Chem.
280: 36195-205 (2005).
Hansen NJ, Antonin W, and Edwardson JM. Indentification of SNAREs involved in
regulated exocytosis in the pancreatic acinar cell. J Biol Chem. 274: 22871-22876 (1999).
116

Hayashi T, McMahon H, Yamasaki S, Binz T, Hata Y, Südhof TC, and Niemann H.
Synaptic vesicle membrane fusion complex: action of clostridial neurotoxins on
assembly. EMBO J. 13: 5051-5061 (1994).
Hodel A, An SJ, Hansen NJ, Lawrence J, Wäsle B, Schrader M, Edwardson JM.
Cholesterol-dependent interaction of syncollin with the membrane of the pancreatic
zymogen granule. Biochem J. 356: 843-50 (2001).
Hodges RR, Dicker DM, Rose PE, and Dartt DA. α
1
-adrenergic and cholinergic agonists
use separate signal transduction pathways in lacrimal gland. Am J Physiol. 262: G1087-
1096 (1992).
Humeau Y, Doussau F, Grant NJ, and Poulain B. How botulinum and tetanus
neurotoxins block neurotransmitter release. Biochimie. 82: 427-446 (2000).
Hunziker W and Kraehenbuhl JP. Epithelial transcytosis of immunoglobulins. J
Mammary Gland Biol Neoplasia. 3: 287-302 (1998).
Imai A, Nashida T, Yoshie S, and Shimomura H. Intracellular localisation of SNARE
proteins in rat parotid acinar cells: SNARE complexes on the apical plasma membrane.
Arch Oral Biol. 48: 597-604 (2003).
Ingrid J, Marije M, Kuijl C, and Neefjes J. Rab proteins, connecting transport and vesicle
fusion. Traffic. 6: 1070-1077 (2005).
Jahn R and Scheller RH. SNAREs – engines for membrane fusion. Nat Rev Mol Cell
Biol. 7: 631-643 (2006).
Jerdeva GV, Wu K, Yarber FA, Rhodes CJ, Kalman D, Schecter JE, and Hamm-Alvarez
SF. Actin and non-muscle myosin II facilitate apical exocytosis of tear proteins in rabbit
lacrimal acinar epithelial cells. J Cell Sci. 118: 4797-4812 (2005a).
Jerdeva GV, Yarber FA, Trousdale MD, Rhodes CJ, Okamoto CT, Dartt DA, and Hamm-
Alvarez SF. Dominant-negative PKC-epsilon impairs apical actin remodeling in parallel
with inhibition of carbachol-stimulated secretion in rabbit lacrimal gland acini. Am J
Physiol Cell Physiol. 289: C1052-C1068 (2005b).
Jordens I, Marsman M, Kuijl C, and Neefjes J. Rab proteins, connecting transport, and
veicle fusion. Traffic. 6: 1070-1077 (2005).
117

Kaetzel CS. Polymeric Ig receptor: defender of the fort or Trojan Horse? Curr Biol.
11:R35-38 (2001).
Kaetzel CS. The polymeric immunoglobulin receptor: bridging innate and adaptive
immune responses at mucosal surfaces. Immunol Rev. 206: 83-99 (2005).
Karvar S, Yao X, Duman JG, Hybiske K, Liu Y, and Forte JG. Intracellular distribution
and functional importance of vesicle-associated membrane protein 2 in gastric parietal
cells. Gastroenterology. 123: 281-290 (2002).
Kavalali ET. SNARE interactions in membrane trafficking: a perspective from
mammalian central synapses. Bioessays. 24: 926-936 (2002).
Kawanishi M, Yoshikazu T, Okazawa H, Araki S, Shinoda H, and Kasuga M. Role of
SNAP-23 in insulin-induced translocation of GLUT4 in 3T3-L1 adipocytes. J Biol
Chem. 275: 8240-8247 (2000).
Kijlstra A, Jeurissen SH, Koning KM. Lactoferrin levels in normal human tears.
Br J Ophthalmol. 67: 199-202 (1983).
Kuizenga A, Stolwijk TR, van Agtmaal EJ, van Haeringen NJ, Kijlstra A. Detection of
secretory IgM in tears of IgA deficient individuals. Curr Eye Res. 9: 997-1005 (1990).
Lambert RW, Kelleher RS, Wickham LA, Vaerman JP, and Sullivan DA.
Neuroendocrinimmune modulation of secretory component production by rat lacrimal,
salivary, and intestinal epithelial cells. Invest Ophthalmol Vis Sci. 35: 1192-1201 (1994).
Lassagne H and Gachon AM. Cloning of a human lacrimal lipocalin secreted in tears.
Exp. Eye Res. 55: 605-609 (1993).

Lin RC and Scheller RH. Mechanisms of synaptic vesicle exocytosis. Annu Rev Cell
Dev Biol. 16: 19-49 (2000).
Liu Y, Ding X, Wang D, Deng H, Feng M, Wang M, Yu X, Jiang K, Ward T,
Aikhionbare F, Guo Z, Forte JG, Yao X. A mechanism of Munc18b-syntaxin 3-SNAP25
complex assembly in regulated epithelial secretion. FEBS Lett. 581: 4318-4324 (2007).
Luo HR, Saiardi A, Nagata E, Ye K, Yu H, Jung TS, Luo X, Jain S, Sawa A, and Snyder
SH. GRAB: a physiologic guanine nucleotide exchange factor for Rab3A, which
interacts with inositol hexakisphosphate kinase. Neuron. 31: 439-451 (2001).
118

Manduit P, Jammes H, and Rossignol B. M3 muscarinic acetylcholine receptor coupling
to PLC in rat exorbital lacrimal gland acinar cells. Am J Physiol. 264: C1550-60 (1993).
Meneray MA and Fields TY. Adrenergic stimulation of lacrimal protein secretion is
mediated by G(q/11) alpha and G(s) alpha. Curr Eye Res. 21: 602-607 (1997).
Meresse S, Steele-Mortimer O, Finlay BB, and Gorvel JP. The rab7 GTPase controls the
maturation of Salmonella typhimurium-containing vacuoles in Hela cells. EMBO J. 18:
4394-4403 (1999).
Millar TJ, Herok G, Koutavas H, Martin DK, and Anderton PJ. Immunohistochemical
and histochemical characterization of epithelial cells of rabbit lacrimal glands in tissue
sections and cell cultures. Tissue Cell. 28: 301-312 (1996).
Mostov KE. Transepithelial transport of immunoglobulins. Annu Rev Immunol. 12: 63-
84 (1994).
Ohashi Y, Dogru M, and Tsubota K. Laboratory findings in tear fluid analysis. Clin
Chim Acta. 369: 17-28 (2006).
Ohnishi H, Ernst SA, Wys N, McNiven M, and Williams JA. Rab3D localized to
zymogen granules in rat pancreatic acini and other exocrine glands. Am J Physiol. 271:
G531-G538 (1996).
Ohnishi H, Samuelson LC, Yule DI, Ernst SA, and Williams JA. Overexpression of
rab3D enhances regulated amylase secretion from pancreatic acini of transgenic mice. J
Clin Invest. 100: 3044-3052 (1997).
Pfeffer SR. Rab GTPases: specifying and deciphering organelle identity and function.
Trends Cell Biol. 11: 487-91 (2001).
Phalipon A and Corthésy B. Novel functions of the polymeric Ig receptor: well beyond
transport of immunoglobulins. Trends Immunol. 24: 55-58 (2003).
Pickett JA, Campos-Toimil M, Thomas P, and Edwardson JM. Identification of SNAREs
that mediate zymogen granule exocytosis. Biochem Biophys Res Commun. 359: 599-
603 (2007).
Qian L, Wang Y, Xie J, Rose CM, Yang T, Nakamura T, Sandberg M, Zeng H, Schechter
JE, Chow RH, Hamm-Alvarez SF, Mircheff AK. Biochemical changes contributing to
119

functional quiescence in lacrimal gland acinar cells after chronic ex vivo exposure to a
muscarinic agonist. Scand J Immunol. 58: 550-65 (2003).
Qian L, Xie J, Rose CM, Sou E, Zeng H, Hamm-Alvarez SF, Mircheff AK. Altered traffic
to the lysosome in an ex vivo lacrimal acinar cell model for chronic muscarinic receptor
stimulation. Exp Eye Res. 79: 665-675 (2004).
Raffaniello RD, Lin J, Schwimmer R, and Ojakian GK. Expression and localization of
rab3D in rat parotid gland. Biochim Biophys Acta. 1450: 352-363 (1999).
Raffaniello RD, Lin J, wang F, and Raufman JP. Expression of rab3D in dispersed chief
cells from guinea pig stomach. Biochim Biophys Acta. 1311: 111-116 (1996).
Redl B. Human tear lipocalin. Biochim Biophys Acta. 1482: 241-8 (2000).
Riedel D, Antonin W, Fernandez-Chacon R, Alvarez de Toledo G, Jo T, Geppert M,
Valentijn JA, Valentijn K, Jamieson JD, Südhof TC, and Jahn R. Rab3D is not required
for exocrine exocytosis but for maintenance of normally sized secretory granules. Mol
Cell Biol. 22: 6487-6497 (2002).
Rismondo V, Gierow JP, Lambert RW, Golchini K, Feldon SE, and Mircheff AK.
Rabbit lacrimal acinar cells in primary culture: morphology and acute responses to
cholinergic stimulation. Invest Ophthalmol Vis Sci. 35: 1176-83 (1994).
Salvatore MF, Pedroza L, Beuerman RW. Denervation of rabbit lacrimal gland increases
levels of transferrin and unidentified tear proteins of 44 and 36 kDa. Curr Eye Res. 18:
455-66 (1999).
Sathyamoorthy V and DasGupta BR. Separation, purification, and partial
characterization of the heavy and light chains of botulinum toxin types A, B, and E. J
Biol Chem. 260: 10461-6 (1985).
Sato Y, Shirakawa R, Horiuchi H, Dohmae N, Fukai S, and Nureki O. Assymetric
coiled-coil structure with guanine nucleotide exchange activity. Structure. 15: 245-252
(2007).
Schaumberg DA, Buring JE, Sullivan DA, and Dana MR. Hormone replacement therapy
and dry eye syndrome. JAMA. 286: 2114-2119 (2001).
Schlüter OM, Khvotchev M, Jahn R, and Südhof TC. Localization versus function of
rab3 proteins. J Biol Chem. 277: 40919-40929 (2002).
120

Seachrist JL, Laporte SA, Dale LB, Babwah AV, Caron MG, Anborgh PH, and Ferguson
SS. Rab5 association with the angiotensin II type 1A receptor promotes Rab5 GTP
binding and vesicular fusion. J Biol Chem. 277: 679-685 (2002).
Shin H-W and Nakayama K. Guanine nucleotide-exchange factors for Arf GTPases:
their diverse functions in membrane traffic. J Biochem. 136: 761-767 (2004).
Sibony PA, Walcott B, McKeon C, and Jakobiek FA. Vasoactive intensitinal polypeptide
and the innervation of the human lacrimal gland. Arch Ophthalmol. 106: 1085-1088
(1988).
Söllner TH. Regulated exocytosis and SNARE function. Mol Membr Biol. 20: 209-220
(2003).
Stenmark H and Olkkonen VM. The Rab GTPases family. Genome Biol. 2: Reviews
3007 (2001).
Stern ME, Beuerman RW, Fox RI, Gao J, Mircheff AK, and Pflugfelder SC. The
pathology of the dry eye: the interaction between the ocular surface and lacrimal glands.
Cornea. 17: 584-589 (1998).
Stern ME, Jianping Gao, Siemasko KF, Beuerman RW, and Pflugfelder SC. The role of
the lacrimal functional unit in the pathophysiology of dry eye. Exp Eye Res. 74: 409-416
(2004).
Sullivan DA. Tearful relationships? Sex, hormones, the lacrimal gland, and aqueous-
deficient dry eye. Ocul Surf. 2: 92-123 (2004).
Sullivan DA and Allansmith MR. Source of IgA in tears of rats. Immunol. 53:791-799
(1984).
Sullivan DA, Bloch KJ, and Allansmith MR. Hormonal influence on the secretory
immune system of the eye: androgen control of secretory component production by the
exorbital gland. Immunol. 52: 239-246 (1984a).
Sullivan DA, Bloch KJ, and Allansmith MR. Hormonal influence on the secretory
immune system of the eye: androgen regulation of secretory component levels in rat
tears. J Immunol. 132: 1130-1135 (1984b).
Takuma T, Arakawa T, and Tajima Y. Interaction of SNARE proteins in rat parotid
acinar cells. Arch Oral Biol. 45: 369-375 (2000).
121

Tamori Y, Hashiramoto M, Araki S, Kamata Y, Takahashi M, Kozaki S, Kasuga M.
Cleavage of vesicle-associated membrane protein (VAMP)-2 and cellubrevin on GLUT4-
containing vesicles inhibits the translocation of GLUT4 in 3T3-L1 adipocytes. Biochem
Biophys Res Commun. 220: 740-5 (1996).
Tang LH, Gumkowski FD, Sengupta D, Modlin IM, and Jamieson JD. Rab3D proteins is
a specific marker for zymogen granules in gastric chief cells of rats and rabbits.
Gastroenterology. 110: 809-820 (1996).
Toda I. Autoantigens and Sjogren’s syndrome. Cornea. 21: S13-16 (2002).
Ungar D and Hughson FM. SNARE protein structure and function. Annu Rev Cell Dev
Biol. 19: 493-517 (2003).
van de Graaf SFJ, Chang Q, Mensenkamp AR, Hoenderop JGJ, and Bindels RJM. Direct
interaction with rab11a targets the epithelial Ca
2+
channels TRPV5 and TRPV6 to the
plasma membrane. Mol Cell Biol. 26: 303-312 (2006).
van Ijzendoorn SCD, Tuvim MJ, Wiembs T, Dickey BF, and Mostov KE. Direct
interaction between rab3b and the polymeric immunoglobulin receptor controls ligand-
stimulated transcytosis in epithelial cells. Dev Cell. 2: 219-228 (2002).
van Setten G, Schultz G. Transforming growth factor-alpha is a constant component of
human tear fluid. Graefes Arch Clin Exp Ophthalmol. 232: 523-6 (1994).
Vetter IR and Wittinghofer A. The guanine nucleotide-binding switch in three
dimension. Science. 294: 1299-1304 (2001).
Walcott B. The lacrimal gland and its veil of tears. News Physiol Sci. 13: 97-103
(1998).
Wang CC, Ng CP, Lu L, Atlashkin V, Zhang W, Seet LF, Hong W. The regulation of
exocytosis in the pancreatic acinar cell. Dev Cell. 7:359-71 (2004).
Wang CC, Shi H, Guo K, Ng CP, Li J, Gan BQ, Chien Liew H, Leinonen J, Rajaniemi H,
Zhou ZH, Zeng Q, and Hong W. VAMP8/endobrevin as a general vesicular SNARE for
regulated exocytosis of the exocrine system. Mol Biol Cell. 18: 1056-1063 (2007).
Wang W, Sacher M, and Ferro-Novick S. TRAPP stimulates guanine nucleotide
exchange on Ytp1p. J Cell Biol. 152: 289-295 (2000).
122

Wang Y, Jerdeva G, Yarber FA, da Costa SR, Xie J, Qian L, Rose CM, Mazurek C,
Kasahara N, Mircheff AK, and Hamm-Alvarez SF. Cytoplasmic dynein participates in
apically targeted stimulated secretory traffic in primary rabbit lacrimal gland acinar
epithelial cells. J Cell Sci. 116: 2051-2065 (2003).
Wäsle B and Edwardson MJ. Regulation of exocytosis in the pancreatic acinar cell. Cell
Signal. 14: 191-197 (2002).
Weng N, Thomas DDH, and Groblewski GE. Pancreatic acinar cells express vesicle-
associated membrane protein 2- and 8-specific populations of zymogen granules with
distinct and overlapping roles in secretion. J Biol Chem. 282: 9635-9645 (2007).
Yoshino K, Monroy D, and Pflugfelder SC. Cholinergic stimulation of lactoferrin and
epidermal growth factor secretion by the human lacrimal gland. Cornea. 15: 617-21
(1996).
Zdanovskaia MV, Los G, and Zdanovsky AG. Recombinant derivatives of clostridial
neurotoxins as delivery vehicles for proteins and small organic molecules. J Prot Chem.
19: 699-707 (2000).
Zhou L, Beuerman RW, Foo Y, Liu S, Ang LP, Tan DT. Characterisation of human tear
proteins using high-resolution mass spectrometry. Ann Acad Med Singapore. 35: 400-7
(2006).
Zoukhri D. Effect of inflammation on lacrimal function. Exp Eye Res. 82: 885-98
(2006).
Zoukhri D, Hodges RR, Dicker DM, and Dartt DA. Role of protein kinase C in
cholinergic stimulation of lacrimal gland protein secretion. FEBS Lett. 351: 67-72
(1994).
Zoukhri D, Hodges RR, Rawe IM, and Dartt DA. Ca2+ signaling by cholinergic and
alpha1-adrenergic agonists is up-regulated in lacrimal and submandibular glands in a
murine model of Sjogren’s syndrome. Clin Immunol Immunopathol. 89: 134-140 (1998).
Zoukhri D, Hodges RR, Willert S, and Dartt DA. Immunolocalization of lacrimal gland
PKC isoforms. Effect of phorbol esters and cholinergic agonists on their cellular
distribution. J Membr Biol. 157: 169-75 (1997).
Zoukhri D, Sergheraert C, and Rossignol B. Phorbol ester-stimulated exocytosis in
lacrimal gland: PKC might not the sole effector. Am J Physiol. 264: C1045-50 (1993).

Asset Metadata

Creator Evans, Eunbyul (author)

Core Title The characterization of SNAREs and rabs in lacrimal gland acinar cells

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Pharmaceutical Sciences

Publication Date 07/28/2008

Defense Date 03/27/2008

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag acinar cells,OAI-PMH Harvest,pIgR,rab gtpases,Rab3D,SNAREs,vesicle trafficking

Language English

Advisor Hamm-Alvarez, Sarah F. (committee chair), Chow, Robert HP (committee member), Okamoto, Curtis Toshio (committee member), Wang, Clay C. C. (committee member)

Creator Email esou@usc.edu

Permanent Link (DOI) https://doi.org/10.25549/usctheses-m1426

Unique identifier UC1293645

Identifier etd-Evans-20080728 (filename),usctheses-m40 (legacy collection record id),usctheses-c127-197418 (legacy record id),usctheses-m1426 (legacy record id)

Legacy Identifier etd-Evans-20080728.pdf

Dmrecord 197418

Document Type Dissertation

Rights Evans, Eunbyul

Type texts

Source University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Repository Name Libraries, University of Southern California

Repository Location Los Angeles, California

Repository Email uscdl@usc.edu

Abstract (if available)

Abstract The lacrimal gland secretes tear proteins and fluid to help maintain a healthy ocular surface. Dry eye diseases are often characterized by decreased secretory function of the lacrimal gland. Since the mechanisms of lacrimal gland secretion are poorly understood, the molecular mechanisms involved in the exocytosis of secretory vesicles in the lacrimal gland acinar cells (LGACs), the main secretory cells of the lacrimal gland, were investigated. The first part of my research explored the role of soluble Nethylmaleimide-sensitive factor attachment receptor proteins (SNAREs) in apical exocytosis in LGACs. Immunofluorescence studies revealed the subcellular localization of VAMP2 and VAMP8 on potential secretory vesicles in the subapical region in resting and/or carbachol (CCH)-stimulated acini. Syntaxin 3 and SNAP-23 were localized to the apical plasma membrane (APM). Binding studies revealed VAMP2/syntaxin 3/SNAP-23 and VAMP8/syntaxin 3/SNAP-23 form a SNARE complex, presumably at the APM. Immunofluorescence studies corroborated the data, showing the colocalization of GFPVAMP2, expressed utilizing an adenoviral construct, with syntaxin 3 and SNAP-23. These studies identified the SNARE complexes that may be involved in secretory vesicle exocytosis at the APM in LGACs.