University of Southern California Dissertations and Theses

Identification of functional pathways altered in testis by in utero exposure to low doses of genistein and DEHP

(USC Thesis Other)

Identification of functional pathways altered in testis by in utero exposure to low doses of genistein and DEHP

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content

IDENTIFICATION OF FUNCTIONAL PATHWAYS ALTERED IN TESTIS BY IN UTERO
EXPOSURE TO LOW DOSES OF GENISTEIN AND DEHP

By

Casandra Patrice Walker

A Dissertation Presented to the
FACULTY OF THE SCHOOL OF PHARMACY
UNIVERSITY OF SOUTHERN CALIFORNIA
In Partial Fulfillment of the
Requirements for the Degree
DOCTOR OF PHILOSOPHY
MOLECULAR PHARMACOLOGY AND TOXICOLOGY

August 2022

Copyright 2022 Casandra Patrice Walker

ii

EPIGRAPH

“I did my best. And God did the rest”
Hattie McDaniel

iii

DEDICATION

I would like to dedicate this work to all young girls wondering if they are good enough to
pursue a career in STEM. I was once in your shoes. You are smart, you are capable, and your
work will change the world. Believe in yourself.

iv

ACKNOWLEDGEMENTS

I want to thank my family and friends for their support throughout this process. I want to
thank my parents, Casey and Andrea, for their constant prayers and support over the last 5
years. I want to thank my husband, David, for encouraging me every day. To all my friends,
thank you. Thank you for holding space for me to vent, especially Cyrina, Tracoyia, Haley,
Angel, Ruth, Stella, and Kat along with many others. Thank you for being understanding about
my absence at events. And thank you for staying loyal and by my side as I embarked on this
journey to obtaining this degree. I see each of you and I appreciate you. Thank you to all my
aunts, uncles, and in laws. I hope that through this work I have made you all proud by adding
another PhD to the Wynn Walker Kigundu family. Thank you for your support thus far.
To all past and present members of the Culty lab including Vanessa, Amy, Haoyi, Maia,
Renita, and Amina, thank you for supporting this work. I value all the skills I have learned from
each of you and will greatly treasure all our collaborations. To Lu, Yuchang, and Chantal thank
you for your willingness to help me troubleshoot any experiment. Working with you all has made
me a better scientist and for that I am truly grateful. To my co-advisor, Dr. Vasilios
Pappadopoulos, thank you for being an amazing mentor by helping me think critically about next
steps in the data and my career. Thank you for encouraging me to explore new concepts using
cutting-edge technology. Much of the work I completed during my dissertation was previously
unexplored and with your mentorship I felt confident in taking the leap to explore these topics
knowing that my findings would contribute to the field.
Finally, I would like to acknowledge my mentor and advisor, Dr. Martine Culty for her
extraordinary mentorship and guidance. Dr. Culty, you have encouraged me to walk boldly as a
scientist and professional. I will always be grateful that you encouraged us to pursue various
interests within and outside of the lab. Through this, I realized that no task is too much to handle
with the right support and guidance.

v

AUTHORSHIP
Published and in preparation works by the author incorporated into the dissertation

Walker C, Ghazisaeidi S, Collet B, Boisvert A, Culty M. In utero exposure to low doses of genistein
and di-(2-ethylhexyl) phthalate (DEHP) alters innate immune cells in neonatal and adult rat testes.
Andrology. 2020 Jul;8(4):943-964. doi: 10.1111/andr.12840. Epub 2020 Jul 3. PMID: 32533902.

Walker C, Garza S, Papadopoulos V, Culty M. Impact of endocrine-disrupting chemicals on
steroidogenesis and consequences on testicular function. Mol Cell Endocrinol. 2021 May
1;527:111215. doi: 10.1016/j.mce.2021.111215. Epub 2021 Feb 28. PMID: 33657436.

Walker C, Boisvert A, Culty M. Impact of endocrine-disrupting chemical mixtures on Foxa3 gene
and protein expression. Frontiers in Endocrinology. (manuscript in progress)

Walker C., Beyssac L., Boisvert A., Culty, M. Transgenerational effects of fetal exposure to low
dose genistein and DEHP mixtures on male rat reproduction: Can epigenetics provide answers?.
Environmental Epigenetics. (manuscript in progress).

Research Support

This work was supported in part by funds from a grant from the Canadian Institutes of Health
Research (CIHR) (Operating grant # MOP-133456) and funds from the USC School of Pharmacy
to MC. CW was supported by a School of Pharmacy Dean’s award.

vi

TABLE OF CONTENTS
Epigraph…………………………………………………………………………………………………..ii
Dedication………………………………………………………………………………………………..iii
Acknowledgements……………………………………………………………………………………..iv
Authorship………………………………………………………………………………………………..v
List of Tables……………………………………………………………………………………………..v
List of Figures……………………………………………………………………………………………vi
Abbreviations……………………………………………………………………………………………vii
Abstract…………………………………………………………………………………………………viii
Chapter I………………………………………………………………………………………………….1
Background……………………………………………………………………………………...1
Hypothesis and Specific Aims…………………………………………………………………6
Significance and Innovation……………………………………………………………………8
Research Design and Methods………………………………………………………………..9
Conclusion……………………………………………………………………………………...11
Chapter II………………………………………………………………………………………………..13
Introduction…………………………………………………………………………………….16
Materials and Methods…………………………………………………………………….....19
Results………………………………………………………………………………………….25
Discussion……………………………………………………………………………………...38
Conclusion……………………………………………………………………………………...47
Chapter III……………………………………………………………………………………………….48
Introduction…………………………………………………………………………..………...52
Materials and Methods………………………………………………………………….…....57
Results…………………………………………………………………….……………………60
Discussion……………………………………………………………………………………...66
Conclusion……………………………………………………………………………...………75
Chapter IV……………………………………………………………………………………………....76
Introduction…………………………………………………………………………..………...80
Materials and Methods………………………………………………………………………..83
Results………………………………………………………………………………………….88
Discussion…………………………………………………………………………………….114
Chater V…………………………………………………………………………………………….....126
References………………………………………………………………………………………………

vii

LIST OF TABLES

Table 1: List of primer sets used for qPCR (Chapter IV)
Table 2: Effects of fetal exposure to GEN and DEHP, alone or in mixture (GEN-DEHP mix) at
the doses of 0.1 and 10 mg/kg/day on reproductive parameters in rats.
Table 3: Innate Immunity related genes
Table 4: Macrophage related genes
Table 5: Genes related to innate immunity in PND3 rat testes

viii

LIST OF FIGURES

Figure 1. Experimental Design
Figure 2. EDCs Alter Testicular Morphology
Figure 3. Gene Array Analysis Workflow
Figure 4. Dose Dependent Differential Gene Expression Profiles
Figure 5. Foxa3 is the most downregulated DEG in rat testes exposed to 10mg/kg/day
Gen+DEHP mix.
Figure 6.Foxa3 is the most downregulated DEG in rat testes exposed to 10mg/kg/day
Gen+DEHP mix.
Figure 7. Foxa3 is Decreased in Rat Testes Exposed to 0.1 and 10mg/kg/day Gen+DEHP mix.
(A) Partek Flow was used to analyze RNA sequencing done on rat testes exposed to control or 0.1 or
10mg/kg/day of Gen+DEHP. N=4 to 6 rats from independent dams. (B) qPCR assessing Foxa3 mRNA
expression in rat testes exposed to Gen+DEHP mix.
Figure 8. MALDI-IMS Reveals Foxa3 Protein is Decreased by Exposure to the Gen+DEHP Mix.
Quantification of Foxa3 protein in control and 0.1mg/kg/day Gen+DEHP PND120 rat testis. Yellow dots
represent signal intensity Box plots show quantification of signal as normalized by surface unit.
Figure 9. In Silico Search for Foxa3 Interactions in Testis. Genes in the Ingenuity database with
relation to ‘Foxa3’ in rat testes exposed to (A) 0.1 or (B) 10mg/kg/day Gen+DEHP mix using IPA.
(C)TRANSFAC generated list of Foxa3 target genes.
Figure 10. Foxa3 protein is Decreased in Interstitial Cells in Rat Testes Exposed to 0.1 and
10mg/kg/day of Gen+DEHP. Immunofluorescence for Foxa3 in adult rat testes exposed in utero to 0.1
and 10mg/kg/day of Gen+DEHP mix. Images are merged with Foxa3 (green) and nuclear staining with
DAPI (blue). Representative photos shown here were taken at 10x objective.
Figure 11. Gen+DEHP mix Affects Steroidogenesis. (A). Differentially expressed genes in adult rat
testes exposed to 0.1mg/kg/day Gen+DEHP mix related to ‘steroidogenesis’ using IPA. (N=4,
green=downregulated, red=upregulated) Genes are listed in order of ascending fold change. P-value
<0.05. (B). qPCR for genes in the steroidogenic pathway are altered by exposure to Gen+DEHP. N=3-5.
(C). Immunofluorescence staining to detect differences in TSPO protein expression in rat testes exposed
in utero to 0.1 or 10mg/kg/day of Gen+DEHP mix.
Figure 12. EDCs Affect Testosterone Production in Adult Rat Testes Effect of in Utero exposure to
Genistein (G) DEHP (D) and the mixture (G+D) on adult rat testes treated with two doses of 0.1mg/kg/day
and 10mg/kg/day on Testosterone production in F1 rat testes.
Figure 13. EDCs Alter Testicular Morphology in F1 and F2 Adult Rat Testis. Effect of in Utero
exposure to Genistein (G) DEHP (D) and the mixture (G+D) on PND120 testes of rats exposed in utero
with doses of 10mg/kg/day on testis morphology in two generations (A) F1 rats were exposed in utero. (B)
F2 generation was exposed as fetal germ cells, which did eventually differentiate to form spermatozoa
that fertilized an egg. Representative examples are shown.
Figure 14. EDCs Affect Testosterone Production in Adult Rat Testis Inter and
Transgenerationally
Figure 15. EDC Exposure Alters 5methylcytosine in Adult Rat Testes. DNA methylation changes in
F1 rats from F0 dams gavaged with vehicle (Ctrl), GEN (G), DEHP (D) or GEN-DEHP mix (G+D) at 0.1 or
10 mg/kg/day. Patterns of 5meC signal show examples of abnormal phenotypes. Filled arrow: germ cell
sloughing in lumen;* tubules with Sertoli cell-only appearance; white arrow: reduced 5meC signal.↓ Arrow
pointing at decreased signal in the interstitium.
Figure 16. Gen+DEHP Alters Genes Related to DNA Methylation. Interaction Network from IPA
shows genes related to DNMT3A that are differentially expressed in F1 rat testes exposed in utero to
10mg/kg/day of Gen+DEHP mix.
Figure 17. 10mg/kg/day exposure of EDCs affect genes involved in Epigenetic processes.
Figure 18. Effect of in utero exposure to GEN (G) and DEHP (D) and their mixtures (G+D) at
doses of 0.1 and 10 mg/kg/day on general health and reproductive characteristics.
Figure 19. Effect of fetal exposure to Genistein (G) and DEHP (D), alone or in mixtures (G+D) at
0.1 and 10 mg/kg/day, on neonatal (PND3) and adult (PND120) rat testis morphology
ix

Figure 20. Identification of CD68+ and CD163+ testicular macrophages in control and EDC-
exposed rat testes. Macrophages (arrows) were visualized by immunohistochemical reactions
on testis sections from PND3 (A, B) and PND120 (C-E) in utero exposed to corn oil (Ctrl), GEN
(G), DEHP (D) or their mixture (G+D), at 0.1 (C) and 10 (A-D) mg/kg/day. Rb IgG: negative control
immunostaining with non-specific rabbit IgG performed on a control sample. The testes of at least 3 rats
from different dams per treatment were examined and representative pictures are shown. Scales are in
μm.
Figure 21. Effects of in utero exposure to GEN and DEHP alone or mixed, on gene expression
in PND3 and PND120 rat testes, using offspring from three dams per condition.
Figure 22. Effects of in utero exposure to GEN, DEHP or GEN-DEHP mix at 0.1 or 10
mg/kg/day on testicular myeloid cell markers in PND3 and PND120 testes.
Figure 23. Effects of in utero exposure to GEN, DEHP or their mixture on testicular macrophage
gene markers at PND3 and PND120.
Figure 24. Identification of CD68+ and CD163+ testicular macrophages in control and EDC-
exposed rat testes.
Figure 25. Effects of in utero exposure to GEN, DEHP or their mixture on interleukin 6 (IL6),
Tnfα and interleukin 10 ( IL10) cytokine expression in rat testes.
Figure 26. Changes in the expression of annexin A1 in the testes of rats exposed in utero to
GEN, DEHP or their mixture at PND3 and PND120.
Figure 27. Changes in the expression of collagen I and collagen IV in the testes of rats exposed
in utero to GEN, DEHP or their mixture at PND3 and PND120.
Figure 28. Functional networks altered in PND3 and PND120 rat testes uniquely altered by fetal
exposure to GEN-DEHP mix at 10 mg/kg/day.
Figure 29. Proposed testicular targets of fetal exposure to low doses of GEN and DEHP
mixtures, and cell-cell interactions.

x

ABBREVIATIONS
Genistein ……………………………………………………………………………………………...Gen
2-(diethylhexyl phthalate)……………………………………………………………………….....DEHP
Genistein and DEHP mixture………………………………………………………..Gen+DEHP or GD
0.1mg/kg/day …………………………………………………………………………………………..0.1
10mg/kg/day……………………………………………………………………………………………..10
Endocrine disrupting chemical………………………………………………………………..…….EDC
Forkhead Box A3…………………………………………………………………………….……..Foxa3
Androgen Receptor…………………………………………………………………………...………..AR
Estrogen Receptor………………………………………………………………………………..……ER
xi

ABSTRACT

Introduction. Infertility is a global problem affecting 8-12% of couples worldwide, with male factor
infertility accounting for 40-50% of infertility cases. Endocrine disrupting chemicals (EDCs) have
been identified as potential causative agents of infertility in males. EDCs altering sex steroid levels
or functions in perinatal life were shown to disrupt male reproductive functions, when used
individually, usually at doses exceeding human exposure levels. However, the effects of EDC
mixtures on male reproduction have not been fully elucidated. In previous studies, we examined
the effects of fetal exposure to a mixture of the EDCs di(2-ethylhexyl) phthalate (DEHP) and
genistein (Gen), given at doses relevant to human. DEHP is a phthalate plasticizer used in
commercial products and medical devices. Gen is a phytoestrogen abundant in baby soy formula
and vegetarian diets. These studies showed that in utero exposure to Gen+DEHP mixtures
resulted in abnormal testes development in adult rats. Our goal is to determine the molecular
basis of these long-term effects and subsequent consequences in future generations.
Materials and methods. Pregnant SD rats were gavaged from gestation day 14 to birth with corn
oil or Gen+DEHP mixtures at 0.1 or 10 mg/kg/day. These doses encompass exposure levels of
the general population and more susceptible populations such as hospitalized neonates fed soy
formula, respectively. Adult male offspring were sacrificed and RNA was extracted from the testes
for transcriptomic studies, while protein immunohistological analysis was performed on testis
paraffin sections.
Results. Gene expression of the transcription factor Fork head box protein 3 (Foxa3) was
identified as the most significantly downregulated gene in Gen+DEHP-exposed rat testes; but not
in rats exposed to individual Gen or DEHP. Foxa3 protein levels showed decreased signal in
testis sections from rats exposed to the highest dose EDC mixture. Foxa3 is an important
transcriptional regulator of Leydig cell differentiation and function, also expressed in spermatids.
Innate immune cells were also affected by in utero exposure to Gen+DEHP in neonatal and adult
xii

rat testes. We found that another member of the Forkhead Box A family was decreased by
exposure to Gen+DEHP, Foxa1. Foxa1 has also been found to bind to the promoter of DNMT3A,
an enzyme needed to carry out de novo methylation in gonocytes. Indeed, we also found that
DNA methylation patterns were altered in adult rat testes as well. We hypothesize that fetal
exposure to low doses of Gen+DEHP causes downregulation of Foxa3 in at least one adult
testicular cell type, in turn affecting spermatogenesis; that testis immunity is compromised
following exposure to EDCs, and that EDCs altar epigenetic process including DNA methylation
(possibly potentiated via Forkhead Box proteins) and histone modifications in F1, F2 and F3 adult
rat testes.
Conclusions. Identifying the cell types in which Foxa3 is targeted by the EDC mixtures will help
understanding its relationship to disrupted testicular function. Our findings also suggest that
Foxa3 could be used as sentinel gene to study EDC mixtures suspected of having adverse male
reproductive effects.

1
CHAPTER I
INTRODUCTION
Background
According to the World Health Organization, infertility is a global problem affecting 15% of
couples worldwide. Male factor infertility has been found to account for 40-50% of infertility cases.
Infertility can result from varying issues such as defects in sperm quality, low sperm count, ductal
obstruction or dysfunction, or hypothalamic-pituitary axis disturbances, which are among the four
main etiological categories of male infertility. Researchers have found that sperm counts have
declined in parts of the world, and that semen quality was decreased in certain geographical
regions. It has been hypothesized that these variations in semen quality across the world may be
due to socioeconomic, nutritional, and/or environmental differences. The decline in semen quality
was also found to coincide with increasing incidence rates in male genital tract abnormalities such
as cryptorchidism, a major risk factor for testicular cancer. Additionally, infertility and male
reproductive pathologies such as hypospadias and testicular cancer are on the rise in the western
world, and an estimated 10% of couples in the United States are classified as infertile.
The male reproductive system is one of the main targets of EDCs, because of the requirement
of sex hormones for its development and functioning, and the fact that many EDCs disrupt
androgen and estrogen production and/or signaling. While the fetal testis drives the development
of all male reproductive tissues, the adult testis is dedicated to androgen and spermatozoa
production, as well as regulating non-reproductive tissues. The testis is a complex and highly
plastic tissue that comprises germ cells at different stages of development and several types of
somatic cells. The main somatic cells are the Leydig cells that produce androgens critical for the
development and steady-state functions of the testes; the Sertoli cells regulating germ cell
development and survival; the peritubular myoid cells contributing to interstitium components and
2

germ cell regulation; and immune cells maintaining testis immune privilege and interacting with
other cell types.
The male reproductive system requires sex hormones for development and functioning and many
endocrine-disrupting chemicals (EDCs) have been shown to disrupt androgen and estrogen
production/signaling (Jones et al. 2016). EDCs alone and in combination with other EDC mixtures
have been shown to disrupt testis function and steroidogenesis. However this is dependent on
the EDCs used, the dose, and the stage of testis development (Table 2) (Jones et al., 2016,
Walker et al. 2020). The subsequent information in this review will cover testis morphology,
steroidogenesis focusing on the molecular mechanisms underlying Leydig cell development and
function, and the effect of EDCs alone and in mixtures on the dysregulation of steroidogenesis in
the testis.
EDCs have been identified as early as the 1930’s and their use in consumer goods continues
to grow throughout the world. EDCs disrupt endocrine function in males and females based on
their ability to alter androgen and estrogen hormone function or levels (Schug et al., 2011).
However, the exact effect that an EDC or a mixture of EDCs has on reproductive function is
dependent on the type of EDC(s) present, the time to exposure, and the dose. Traditional
toxicology studies have assessed the effects of EDCs on male and female reproduction by
typically using doses higher than human exposure levels and mostly one EDC at a time. Yet, the
Endocrine Society has documented hundreds of EDCs expressed ubiquitously in the
environment, including consumer products such as cosmetics, household appliances, childcare
products, medical equipment, food, and aquatic environments to name a few (Gore et al. 2015).
Humans and animals may be exposed to EDCs via inhalation, dermal absorption, and ingestion,
and EDC metabolites have also been found in urine, blood plasma, and amniotic fluid, which
shows that they can affect fetal developmental processes - which require a balance of androgens
and estrogens. A few studies have documented the effects of EDCs mixtures on steroidogenesis
3

in males, which I will discuss in Chapter II of this thesis.
The male reproductive system comprises various organs, including the prostate, epididymis,
penis, vas deferens, bulbourethral glands, seminal vesicles, and testes. The testes are arguably
the most critical organs in the male reproductive system since they are the site of
spermatogenesis and steroid hormone production. In mature, healthy, adult males the testes are
positioned in the scrotum, along with the epididymis and part of the vas deferens. Testes descent
from the abdominal cavity into the scrotum occurs in two phases during gestation, between
gestation weeks 15 and 35 in humans, under the control of testosterone and insulin-like hormone
3 (INSL3) produced by fetal Leydig cells (Hutson JM et al. 2015). Fetal testosterone and its
metabolite dihydrotestosterone (DHT) are essential for the development of internal and external
male genitalia, respectively, while estrogens modulate fetal Leydig cell function (Picut et al. 2018).
While the fetal testis drives the development of all male reproductive tissues, the adult testis is
dedicated to androgen and spermatozoa production and regulating non-reproductive tissues. This
process involves highly regulated hormonal function including androgen and estrogen production
and signaling at various stages of development during gestation through adulthood. Thus subtle
disturbances from anti-androgenic or estrogenic compounds such as EDCs can significantly affect
testicular development (Walker et al., 2020).
The testis is a complex and highly plastic tissue that comprises germ cells at different stages
of development and several types of somatic cells. The testis is made up of lobules demarcated
by connective tissue, each containing up to four seminiferous tubules surrounded by the
interstitium. Lining the inside of the tubules is the germinal epithelium, which comprises the Sertoli
cells and several layers thick of germ cells, defining well-characterized and tightly regulated
stages of the spermatogenic cycle (Griswold MD 2016). Sertoli cell functions include providing
nutrients to germ cells, phagocytosing byproducts from spermatid production, secreting hormones
including androgen-binding protein (ABP), inhibin, transferrin, and anti-mullerian hormone (AMH).
4

Sertoli cells also generate and maintain the blood-testis barrier, a dynamic ring of tight junction
proteins that form during pre-puberty, separating the tubules into two distinct compartments, the
basal compartment adjacent to the basement membrane and the adluminal compartment
surrounding the lumen where immature spermatozoa are released through the process of
spermiation. The basal compartment contains more immature germ cells, including
spermatogonial stem cells, spermatogonia, and preleptotene spermatocytes that have
progressed within the spermatogenic cycle. The spermatogonial stem cells receive regulatory
signals not only from Sertoli cells but also from peritubular myoid cells and macrophages, forming
a functional niche essential to the lifetime maintenance of male spermatogenesis (Griswold MD
2016). The adluminal compartment comprises more differentiated spermatogenic cells, from
meiotic spermatocytes to spermatids formed during spermiogenesis. The process of
spermatogenesis progresses in asynchronous waves supporting the constant production of
spermatozoa, which will become fully mature while moving through the epididymis.
Outside of the seminiferous epithelium, scattered throughout the connective tissue, are
interstitial Leydig cells. Leydig cells possess steroidogenic enzymes capable of producing various
androgens needed for testicular development, differentiation of the male genitalia, and
reproductive function (Zirkin and Papadopoulos, 2018). Leydig cells produce androgens via a
process called steroidogenesis, which requires a comprehensive network of protein-protein
interactions, enzymes, and cellular coordination. The disruption of these processes and
interactions results in issues that are reverberated throughout development and life, and are
demonstrated in this thesis.
Endocrine-disrupting chemicals (EDCs) are hypothesized to be causative agents of male
reproductive pathologies. Indeed, many studies, usually with individual EDCs given at doses
exceeding human exposure to pregnant dams, have shown the disruptive effects of EDCs on
male offspring reproductive functions. EDCs can be natural compounds, such as genistein (Gen),
5

a plant phytoestrogen found in soy products, baby soy formula and vegetarian diets, or artificial,
such as 2-diethylhexyl-phthalate (DEHP), a plasticizer with anti-androgenic properties found in
many consumer products. Gen acts as an estrogen-receptor agonist, mechanism at the basis of
its classification as a “phytoestrogen”. Gen was reported to be useful in the treatment of some
cancers and other chronic diseases by increasing apoptosis and differentiation. It was also shown
to alter early testicular germ cell development in rat (Thuillier et al. 2009, Thuillier et al. 2003,
Wang et al. 2004) and to delay puberty in male primates (Rozman et al. 2006). Gen inhibits ATP
utilizing enzymes such as specific tyrosine kinases in vitro. Additionally, it has been found to have
antioxidant effects and to inhibit angiogenesis. Of note is that some of these benefits only occur
after consumption of a soy-rich diet. Moreover, Genistein has been found to have low toxicity.
DEHP is a synthetic chemical used to increase the flexibility of plastics that has been used for
years in consumer goods such as household appliances, packaging, medical tubing, flooring and
other products. Over 98% of the United States population has detectable levels of DEHP and its
major metabolite, MEHP in urine. MEHP is also found in breastmilk. DEHP can reach the systemic
circulation through ingestion and absorption by the skin. DEHP is an anti-androgenic compound,
decreasing Leydig cell production of testosterone in males. It was also shown to decrease Sertoli
cell function. Some pathologies associated with high DEHP levels include decreased anogenital
distance, an androgen-dependent process, in male rodents and humans. Other studies have
shown a link between in utero DEHP exposure, elevated urinary DEHP levels and autism and
attention deficit hyper disorder (ADHD) in males, as well as increased anxiety and depression.
Additionally, there is a positive correlation between fast food consumption and DEHP levels in the
body.
Both Gen and DEHP have been shown to be linked to male reproductive pathologies.
However, the effects of EDC mixtures at environmentally relevant doses have not been well
characterized. This identifies a critical need to elucidate the effects of perinatal exposure to Gen-
6

DEHP mixtures at doses relevant to human exposure, to determine their impact on the fate of
male reproduction.
Hypothesis and Specific Aims
Our preliminary studies found that in utero exposure to mixtures of Gen and DEHP (Gen-DEHP
mix) at a dose mimicking the exposure level of the general population, and a higher dose
mimicking that of more susceptible populations (such as hospitalized neonates), resulted in
abnormal testes development in adult (PND120) male rats (Jones et al. 2015). Other investigators
reported similar responses to EDCs in germ cells from human and rat fetal/neonatal testes,
validating the use of the rat as model to study the impact of EDCs on early germ cell development
(Heger et al. 2012, Mitchell et al. 2012, Muczynski et al. 2012). Since disrupting perinatal germ
cells can hamper spermatogenesis and reproduction later in life, we hypothesize that fetal
exposures to Gen+DEHP mix at doses relevant to human impact the adult testis by disrupting the
developmental program of key testicular cell types and altering their adult functions. My goal was
to identify the functional pathways altered by Gen+DEHP mix exposures, the testicular cell types
in which these changes occur, and the mechanisms driving them, that could explain the adverse
reproductive effects observed. My hypothesis was tested using the following aims:

Aim 1. Identification of genes and pathways altered significantly by in utero exposure to
Gen+DEHP mixtures. I used bioinformatic software as tools to analyze microarray and RNA seq
gene expression data from the testes of in utero exposed adult rats. I used the environmentally
relevant doses of 0.1mg/kg/day, equivalent to the exposure of the general population, and
10mg/kg/day, aligning with the higher end of human exposure. This approach allowed me to
identify genes and functional pathways altered by Gen-DEHP mixtures that are related to
spermatogenesis or steroidogenesis; eventually providing answers on the etiology of the
observed phenotypes. This approach was extended by performing RNAseq analysis on more
samples, including testes from F2 to F3 rat generations.
7

Aim 2. Identify the testicular cell type(s) in which a Gen+DEHP target gene is decreased by
the mixture. Our previous in silico and functional studies analyzing whole testes extracts
identified Foxa3 as being decreased in adult (PND120) F1 rat testes exposed in utero to
10mg/kg/day Gen-DEHP. Using qPCR, immunofluorescence and MALDI Imaging Mass
Spectrometry, I confirmed Foxa3 mRNA downregulation and located Foxa3 protein expression in
cells from control and EDC-exposed rat testes. Additionally, I linked EDC-induced Foxa3
downregulation with target genes and effects on testicular functions.

Aim 3. Determine the epigenetic effect of EDCs in adult testis exposed in utero to
Gen+DEHP and future generations. The acquisition of epigenetic marks on histones and DNA
methylation specific patterns are involved in gene transcription regulation during development,
biological functions, pathologies, and transgenerational inheritance. I hypothesize that
epigenetics play a role in the observed phenotypes of adult male rats exposed in utero to the
Gen+DEHP mixture, leading to reproductive pathologies, and that these epigenetic changes can
be passed down to subsequent generations. I used microarray, RNA seq and
immunohistochemistry to determine whether there are alterations in DNA methylation patterns in
adult rat testis.

The results from the studies from Aims 1 to 3 have taken us further in determining the link between
EDC exposures and male reproductive pathologies such as infertility. Moreover, my project
addresses the critical need for elucidating the effects of EDC mixtures prevalent in our
environment at levels meaningful to humans on testicular function.

8

Significance and Innovation
The significance of this project lies in our labs experimental design. I am examining the effects of
fetal exposure to environmentally relevant doses of a mixture of endocrine-disrupting compounds,
and furthermore the effect of that mixture on the fate of adult testes. Traditionally, the effects of
endocrine-disrupting compounds have been studied using doses higher than the levels
encountered by humans, while the effects of mixtures have still not been well characterized. My
goal is to examine the effects of a mixture of genistein and DEHP, known to act as estrogen and
anti-androgen, respectively. Although DEHP has been phased out in child-care products, it is still
prominent in many commercial products and medical devices. Genistein exposure varies
according to the diet but is elevated in soy formula-fed babies. Comparable levels of genistein
and DEHP are found in human blood. Thus, we used mixtures containing both EDCs at the same
dose. This research is pertinent to understanding the effects of endocrine disruptors on male
infertility. Since it is not feasible or ethical to collect human testis to conduct our studies, using a
rat model is currently the best option to study how the endocrine-disrupting compounds Gen and
DEHP affect male reproductive development and function. We will not only study the effects on
the first generation (F1) exposed in utero to the EDCs, but we will also assess changes in the
lineage of these animals by including the study of epigenetic changes and transgenerational
inheritance in the F2 generation. This is particularly important because several endocrine-
disrupting compounds were found to affect the epigenome of the exposed generation and to lead
to the transfer of the epigenetic marks to subsequent generations (Manikkam et al. 2013). This
phenomenon was observed in our own preliminary studies, where increased incidence of infertility
or reproductive abnormalities were found at higher rates in F2 and F3 rats exposed to Gen+DEHP
mix than in F1 rats, even if there was only weak or no obvious phenotypes in the first generation.
9

Research Design and Methods
Perinatal exposures to EDCs altering sex steroid levels and/or functions in perinatal life have
been identified as potential causes of male reproductive symptoms and diseases, leading to the
concept of "testicular dysgenesis syndrome" (Sharpe et al. 2008). Most of these studies were
done with EDCs used individually and at doses exceeding human exposure levels. However, the
effects of EDC mixtures on male reproduction have not been fully clarified. My goal is to examine
whether fetal exposure to a mixture of Gen and DEHP given at doses relevant to human could
impact the adult testis (Figure 1).

Figure 1. Experimental Model.
Figure 1. Experiment design. Pregnant Sprague-Dawley rats were gavaged from gestation day 14 to
birth, with corn oil, 0.1mg/kg/day or 10mg/kg/day of Gen, DEHP or their mixture, Gen-DEHP. Offspring
were sacrificed and testis were collected at PND120.
10

My initial goal was to examine whether fetal exposure to a mixture of Gen and DEHP, given at
doses relevant to human, could impact the adult testis. The comparison of the testicular
morphology and reproductive function of Sprague Dawley rats exposed in utero to two doses of
Gen and DEHP, either alone or in mixture, confirmed deleterious effects of Gen+DEHP mix, which
occurred at higher rate than with individual EDCs (Figure 2). Thus, my goal is to unveil the
molecular and cellular mechanisms behind these adverse reproductive phenotypes by identifying
the targeted cell types, genes and pathways specifically altered by the Gen+DEHP mix.
We found that Gen+DEHP mixture increased infertility and the rate of abnormal testes in adult
(postnatal day (PND) 120) rats (Figure 2). One of the conspicuous anomaly was the lack of germ
cells in seminiferous tubules presenting a Sertoli cell-only phenotype, mainly observed in the
testes of Gen+DEHP exposed rats. Of importance to note is that this phenotypic effect was seen
at the lower dose of 0.1mg/kg/day, as well as at the higher dose of 10mg/kg/day. Both doses are
still considerably lower than those used in traditional toxicology studies, and yet they were
sufficient to disrupt the testicular environment. These data are at the basis of my first aim.
Ultimately, I want to explore the mechanisms by which Gen+DEHP mixtures disrupt the testis,
starting with analyzing testis transcriptome (Aim 1), then moving on to identifying specific targeted
cell types and mechanisms (Aim 2).

11

Conclusion
In chapter 1 I introduced male infertility as a global problem linked with increasing rates of sperm
quality defects, hypospadias, and cryptorchidism. Endocrine-disrupting chemicals such as
genistein and DEHP have been hypothesized to be causative agents of infertility in men.
Genistein is a soy isoflavone and EDC due to its estrogenic effects, while DEHP is an anti-
androgenic compound and plasticizer abundant in medical tubing and PVC plastics. Genistein
and DEHP have been associated with infertility however studies have not assessed Gen and
DEHP together using environmentally relevant doses. Indeed, previous findings from my study
found that genistein, DEHP and the Gen+DEHP mixture induced infertility and testis abnormalities
in F1 adult rat testis, suggesting that low dose mixtures of Gen+DEHP at levels below the
NOAEL/LOAEL for each compound can affect reproductive processes in adult rats (Mcclain et
Figure 2. EDCs Alter Testicular Morphology
Figure 2. Testicular morphology in adult F1 rats exposed in utero to either vehicle or Gen-DEHP
mixture at 0.1mg/kg/day. Hematoxylin-eosin staining. White arrow representing germ cell sloughing in
the lumen, Asterisk * demonstrating atrophied tubules and an apparent Sertoli only phenotype.

12

al., 2006). The next chapters will explore the mechanisms by which Gen+DEHP mixtures disrupt
the testis, starting with analyzing the transcriptome to identify specific genes and functional
pathways altered by Gen+DEHP mixtures, and then moving on to identifying specific targeted cell
types and mechanisms. I used Partek Genomics Suite and Partek Flow to analyze the gene
expression profile from microarrays and RNA sequencing of whole adult rat testes that were
exposed in utero to either 0.1mg/kg/day or 10 mg/kg/day of the Gen+DEHP mixtures (Figure 3).
Figure 3. Gene array analysis workflow. Pregnant Sprague-Dawley rats were gavaged from gestation day
14 to birth, with corn oil, 0.1mg/kg/day or 10mg/kg/day of Gen, DEHP or their mixture, Gen+DEHP. Adult
male offspring were sacrificed and RNA was extracted from their testes for gene array analysis using
Affymetrix 2.0 ST microarrays. Pathway analysis softwares (Partek Genomics Suite, DAVIDS, Ingenuity
Pathway Analysis, and KEGG) were used to identify differentially expressed genes and pathways altered
in rat testes exposed to Gen and DEHP, more specifically by the mixtures.

13

CHAPTER II
IMPACT OF FETAL EXPOSURE TO ENDOCRINE DISRUPTING CHEMICAL MIXTURES ON
FOXA3 GENE AND PROTEIN EXPRESSION IN ADULT RAT TESTIS
Walker C
1
, Boisvert A
2
, Culty M
1,2
1
Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of
Southern California, Los Angeles, CA USA;
2
The Research Institute of the McGill University
Health Centre and Department of Medicine, McGill University, Montreal, Quebec, Canada.
Keywords: endocrine disruptors; testis; reproduction; transcriptome; functional pathways;
Corresponding author: Martine Culty, School of Pharmacy; University of Southern California; 1985
Zonal Avenue; Los Angeles, California 90089-9121. Phone: 323-865-1677; e-mail:
culty@usc.edu
This work was supported in part by funds from a grant from the Canadian Institutes of Health
Research (CIHR) (Operating grant # MOP-133456) and funds from the USC School of Pharmacy
to MC. WC was supported by a School of Pharmacy Dean’s award.

14

Abstract
Introduction. Endocrine disrupting chemicals (EDCs) have been identified as potential causative
agents of infertility in males. EDCs altering sex steroid levels or functions in perinatal life were
shown to disrupt male reproductive functions, when used individually, usually at doses exceeding
human exposure levels. However, the effects of EDC mixtures on male reproduction have not
been fully characterized. In previous studies, we examined the effects of fetal exposure to a
mixture of the EDCs di(2-ethylhexyl) phthalate (DEHP) and genistein (Gen), given at doses
relevant to human. DEHP is a phthalate plasticizer used in commercial products and medical
devices. Gen is a phytoestrogen abundant in baby soy formula and vegetarian diets. These
studies showed that in utero exposure to Gen+DEHP mixtures resulted in abnormal testes
development in adult rats. My goal is to determine the molecular basis of these long-term effects.
Materials and methods. Pregnant SD rats were gavaged from gestation day 14 to birth with corn
oil or Gen+DEHP mixtures at 0.1 or 10 mg/kg/day. These doses encompass exposure levels of
the general population and more susceptible populations such as hospitalized neonates fed soy
formula, respectively. Adult male offspring were sacrificed and RNA was extracted from the testes
for transcriptomic studies, while protein immunohistological analysis was performed on testis
paraffin sections.
Results. Gene expression of the transcription factor Fork head box protein 3 (Foxa3) was
identified as the most significantly downregulated gene in Gen+DEHP-exposed rat testes; but not
in rats exposed to individual Gen or DEHP. Foxa3 protein levels showed decreased signal in
testis sections from rats exposed to the highest dose EDC mixture. Foxa3 is an important
transcriptional regulator of Leydig cell differentiation and function, also expressed in spermatids.
These data suggest that fetal exposure to low doses of Gen+DEHP causes downregulation of
Foxa3 in adult testicular cells, in turn affecting spermatogenesis.
15

Conclusions. Identifying the testicular cell types in which Foxa3 is targeted following fetal
exposure to EDC mixtures will help understanding its relationship to disrupted testicular function.
Our findings also suggest that Foxa3 could be used as a sentinel gene to study EDC mixtures
suspected of having adverse male reproductive effects.

16

Introduction
Infertility is a global problem in which male-factors were found to account for nearly half of the
cases. (Barratt et al., 2017). Male-factor infertility has been found to account for 40-50% of
infertility cases ((Krausz & Riera-Escamilla, 2018). Infertility can result from issues including
defects in sperm quality, low sperm count, ductal obstruction or dysfunction, or hypothalamic-
pituitary axis disturbances; which are among the four main etiological categories of male infertility
((Sharma, Minhas, Dhillo, & Jayasena, 2021; Sharma et al., 2020) . Researchers have found that
sperm counts have declined in parts of the world, and that semen quality was decreased in certain
geographical regions ((Barratt et al., 2017). It has been hypothesized that these variations in
semen quality across the world may be due to socioeconomic, nutritional, and/or environmental
differences. The decline in semen quality was also found to coincide with increasing incidence
rates in male genital tract abnormalities such as cryptorchidism, a major risk factor for testicular
cancer ((Heger et al., 2012; Sharpe & Skakkebaek, 2008). Additionally, infertility and male
reproductive pathologies such as hypospadias and testicular cancer are on the rise in the western
world, and an estimated 10% of couples in the United States are classified as infertile ((Sharma
et al., 2020).
The male reproductive system is one of the main targets of EDCs, because of the
requirement of sex hormones for its development and functioning, and the fact that many EDCs
disrupt androgen and estrogen production and/or signaling ((Jenardhanan, Panneerselvam, &
Mathur, 2016; Sidorkiewicz, Zarȩba, Wołczyński, & Czerniecki, 2017; Zhang et al., 2019). While
the fetal testis drives the development of all male reproductive tissues, the adult testis is
dedicated to androgen and spermatozoa production, as well as regulating non-reproductive
tissues. The testis is a complex and highly plastic tissue that comprises germ cells at different
stages of development and several types of somatic cells. The main somatic cells are the Leydig
cells that produce androgens critical for the development and steady-state functions of the
17

testes; the Sertoli cells regulating germ cell development and survival; the peritubular myoid
cells contributing to interstitium components and germ cell regulation; and immune cells
maintaining testis immune privilege and interacting with other cell types.
Endocrine-disrupting chemicals (EDCs) are hypothesized to be causative agents of male
reproductive pathologies. Indeed, many studies, usually with individual EDCs given at doses
exceeding human exposure to pregnant dams, have shown the disruptive effects of EDCs on
male offspring reproductive functions. EDCs can be natural compounds, such as genistein
(Gen), a plant phytoestrogen found in soy products, baby soy formula and vegetarian diets, or
artificial, such as 2- diethylhexyl-phthalate (DEHP), a plasticizer with anti-androgenic properties
found in many consumer products. Gen acts as an estrogen-receptor agonist, mechanism at
the basis of its classification as a “phytoestrogen” ((Walker, Garza, Papadopoulos, & Culty,
2021). Gen was reported to be useful in the treatment of some cancers and other chronic
diseases by increasing apoptosis and differentiation. It was also shown to alter early testicular
germ cell development in rat (Thuillier et al. 2009, Thuillier et al. 2003, Wang et al. 2004) and to
delay puberty in male primates (Rozman et al. 2006). Gen inhibits ATP utilizing enzymes such
as specific tyrosine kinases in vitro. Additionally, it has been found to have antioxidant effects
and to inhibit angiogenesis. Of note is that some of these benefits only occur after consumption
of a soy-rich diet. Moreover, Genistein has been found to have low toxicity.
DEHP is a synthetic chemical used to increase the flexibility of plastics that has been used
for years in consumer goods such as household appliances, packaging, medical tubing, flooring
and other products ((Buñay, Larriba, Moreno, & Del Mazo, n.d.; Zarean et al., n.d.). Over 98%
of the United States population has detectable levels of DEHP and its major metabolite, MEHP
in urine. MEHP is also found in breastmilk. DEHP can reach the systemic circulation through
ingestion and absorption by the skin. DEHP is an anti-androgenic compound, decreasing Leydig
cell production of testosterone in males. It was also shown to decrease Sertoli cell function.
18

Some pathologies associated with high DEHP levels include decreased anogenital distance,
an androgen-dependent process, in male rodents and humans. Other studies have shown a
link between in utero DEHP exposure, elevated urinary DEHP levels and autism and attention
deficit hyper disorder (ADHD) in males, as well as increased anxiety and depression.
Additionally, there is a positive correlation between fast food consumption and DEHP levels in
the body.
Both Gen and DEHP have been linked to male reproductive pathologies. However, the
effects of EDC mixtures at environmentally relevant doses have not been well characterized.
This identifies a critical need to evaluate the effects of perinatal exposure to Gen+DEHP
mixtures at doses relevant to human exposure, to determine their impact on the fate of male
reproduction. Our preliminary studies found that in utero exposure to mixtures of Gen and DEHP
(Gen+DEHP mix) at a dose mimicking the exposure level of the general population, and a
higher dose mimicking that of more susceptible populations (such as hospitalized neonates),
resulted in abnormal testes development in adult (PND120) male rats (Jones et al. 2015). Other
investigators reported similar responses to EDCs in germ cells from human and rat
fetal/neonatal testes, validating the use of the rat as model to study the impact of EDCs on early
germ cell development (Heger et al. 2012, Mitchell et al. 2012, Muczynski et al. 2012). Since
disrupting perinatal germ cells can hamper spermatogenesis and reproduction later in life, we
hypothesize that fetal exposures to Gen+DEHP mix at doses relevant to human impact the adult
testis by disrupting the developmental program of key testicular cell types and altering their
adult functions. My goal is to identify the functional pathways altered by Gen+DEHP mix
exposures, the testicular cell types in which these changes occur, and the mechanisms driving
them, that could explain the adverse reproductive effects observed ((Walker, Ghazisaeidi,
Collet, Boisvert, & Culty, 2020).

19

Materials and Methods
Animal Treatments and Tissue Collection
Animal treatments and tissue collection occurred as previously described from our lab
(Walker et al., 2020). Timed pregnant Sprague-Dawley rats were purchased from Charles Rivers
Laboratories (Saint-Constant, QC, CA) and switched to a casein-cornstarch–based,
phytoestrogen-free diet (casein diet) AIN-93G (Teklad diet; Envigo) from 2 days before gavage to
weaning, to avoid further dietary exposure to genistein. The rats were maintained on a 12L:12D
photoperiod with ad libitum access to food and water and handled according to protocols
approved by the McGill University Health Centre Animal Care Committee and the Canadian
Council on Animal Care. The pregnant rats were treated by gavage from gestational day 14
(GD14) to parturition with either vehicle (corn oil) alone or containing GEN or DEHP (abbreviated
as G and D in figures), or GEN+DEHP mix (abbreviated as G + D in figures), at the doses of 0.1
and 10 mg/kg/day (doses abbreviated as 0.1 and 10 in figures). The doses were adjusted to
changes in dam weights. These doses were selected based on our previous dose response
studies of in utero exposure to genistein or DEHP used separately and together. The inclusion in
the studies of control animals maintained on normal soy-based diet showed that there was no
significant difference in the general health and food consumption of dams fed with soy-based
chow or casein diet (data not shown). Moreover, the diets did not affect the health, reproductive
function, testis transcriptome and fertility of the offspring of control rats, suggesting no effect from
maternal diet alone (data not shown). Adult offspring were mated at PND90 to assess their fertility
and litter size when applicable. Offspring were weighed and euthanized at PND3, 90 or PND120.
Blood was collected via cardiac puncture, and the plasma was separated and stored at −80°C for
testosterone (T) and 17β-estradiol (E2) measurements. The testes were collected, weighed, and
either fixed in 4% paraformaldehyde or snap frozen to assess their development and function,
using morphological examination, and gene and protein expression analyses.
20

RNA extraction and quantitative real-time PCR
RNA was extracted from testes using Nucleospin XS Kit and digested with DNase I
(Takara Bio USA). Complementary DNA was synthesized using the transcriptor synthesis kit
(Roche Diagnostics). Quantitative real-time PCR (qPCR) was performed as previously described
with a LightCycler 480 using SYBR Green Supermix (BioRad), a Master Mix kit (Roche
Diagnostics). Glyceraldehyde-3-phosphate dehydrogenase was used as reference to normalize
gene expression. A minimum of 3-8 male offspring from different litters were assessed in triplicate.
The comparative Ct method was used to calculate relative gene expression. Primers specific for
the genes of interest were designed with the NCBI Primer Design Database.
Statistical analysis
Statistical analysis was performed using one-way ANOVA with post hoc Dunnett's test for
the analysis of general health parameters, or unpaired two-tailed Student's t test for qPCR data
analysis, using the statistical analysis functions in GraphPad Prism 7.04 program (GraphPad Inc).
Because the two chemicals used are structurally unrelated and are known to have different
molecular targets, they are not expected to have similar effects, and unpaired two-tailed Student's
t test was used to determine the statistical significance between each control-EDC pair for qPCR
analysis. Gene array analysis was performed on three independent N (one offspring used per
dam) per treatment condition, using the ANOVA application from the bioinformatics Partek
platform. General health parameters were determined on all rats. Fertility was assessed using 8
to 9 offspring from different litters per treatment condition. For qPCR analysis, the results are
presented as mean ± SEM of fold changes relative to vehicle control. Experimental points were
performed in triplicate for each sample, from 3 to 8 rats from different dams per treatment
condition. Histological assessment and IHC were done on at least three independent offspring
21

per treatment. Asterisks indicate a significant change relative to control, with P values ≤ .05
considered statistically significant.
Immunofluorescence
IF analysis were performed as previously described (Manku G and Culty M, 2016). Briefly,
Slides were first dewaxed and rehydrated using Citrisol and Trilogy (Cell Marque, Rocklin CA)
solution. Following treatment with Dako Target Antigen Retrieval Solution (DAKO), the sections
were incubated with PBS containing 10% BSA and 10% Donkey serum for one hour to block non-
specific protein interactions. The sections were then incubated with anti-Forkhead Box A3 (Foxa3)
antibody (SAB2108468, Sigma-Aldrich USA) (1:50 dilution), anti-Platelet-derived growth factor
receptor alpha (Pdgfrα) (sc-398206, Bioss USA) (1:50 dilution), or Translocator protein (TSPO)
(1:400 dilution) antibody diluted in PBS containing 10% BSA, 0.1% Triton-X, and donkey serum
overnight at 4 degree C. Once the overnight incubation was complete, slides were incubated with
a fluorescent goat anti-rabbit Alexa Flour 488 (Invitrogen) diluted in PBS containing 1% BSA for
one hour at room temperature. Nuclear staining for these slides was performed using nuclear
DAPI anti-fade and mounting medium (Vector Labs) and cover-slipped then imaged.
22

MALDI - Imaging Mass Spec.
PND120 adult rat testes were cryosectioned at 12uM thickness in -21C and thawed on
pre-cooled ITO-coated slides. Sections were then washed in 70% ethanol for 120 seconds two
times, followed by washing with 100% ethanol for 120 seconds. The MALDI matrix consisteing of
sinapic acid at 10mg/ml in 50% ACN/0.1%FA was sprayed on sections. Matrix-coated sections
were recrystallized using 50% formic acid at 80C for 10 min. Sections were then imaged using
Rapiflex at 100uM spatial resolution.
Slide Imaging
H&E and immunofluorescence slides were viewed using the appropriate filters on a Biotek
Cytation 5 slide imager.
Microarray
Microarray was conducted according to (Walker et al., 2020). Ultra-pure total RNA was
extracted with the PicoPure RNA isolation kit (Arcturus) from the testes of PND3 and PND120
rats, using off- spring from three different dams per treatment. The RNA samples were digested
with DNase, analyzed with NanoDrop device, and di- luted to 100 ng/μL. Gene array analysis
performed on Affymetrix 2.0 ST microarray chips by Genome Quebec, as previously de-
scribed.37,38 Preliminary data analysis including quality control inquiry, normalization,
abbreviation and dispersion analysis, differential analysis of gene expression, and gene set
enrichment were conducted as previously described.37,38 Data were then normalized, and
statistical analysis performed using the Partek Genomics Suite software, to identify differentially
expressed genes (DEGs) between the EDC treatments and control samples using ANOVA. The
data were filtered to exclude LOC and “blank” regions, resulting in 19,786 protein-coding genes
and microRNAs. Gene lists were then created to identify DEGs between each of the individual
treatments and control, using an unadjusted P value of .05 as cutoff for statistical significance.
23

An additional step of selection was performed by applying a fold-change cutoff of at least 40%
above or below the control values. The data were used to generate Venn diagrams and the lists
of genes significantly altered in the different conditions. The gene lists from Partek were then
analyzed for functional pathways and networks using the Ingenuity Pathway Analysis (IPA)
software, the Database for Association, Visualization and Integrated Discovery (DAVID)
software linked to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Omic
data analysis was performed with IPA to identify the most relevant signaling and metabolic
pathways, molecular networks and biological functions affected by the treatments. DAVID and
KEGG combination provided a comprehensive set of functional annotations used to identify
biological functions including genes significantly altered by the treatments. The two types of
analyses led to the generation of functional pathways and gene networks that were visualized
as tables or diagrams, indicating their respective P values and enrichment scores. Once DEGs
were identified, their expression levels, as indicated by their relative signal intensity on the
arrays, were also considered to prioritize genes of interest. The 2^log2 values of the signal
intensities (originally expressed as log2 values) were calculated, and genes expressed at a
relative intensity below 40 (representing 33% of all genes on the arrays) in all conditions were
not given priority. PubMed keyword searches were also used to validate gene and pathway
relevance to the study.
RNA sequencing
Transcriptomic RNA sequencing was performed at that the USC Norris Molecular
Genomics Core. Total RNA were isolated using Qiagen All prep Extraction kit following
manufacturer's protocol (Qiagen Cat#80284). Libraries were simultaneously prepared using
Illumina Truseq Stranded mRNA Library Preparation kit (Illumina Cat#20020594).
Transcriptomic RNAseq libraries were sequenced on Illumina Nextseq500 at 25 million reads
24

per sample at 2x75 read length. Data were trimmed normalized and analyzed using Partek
Flow. Gene lists were created to detect differentially expressed genes between
Steroid Quantification
The levels of circulating testosterone and estradiol in PND90 rats were quantified by
radioimmunoassay as previously described (n = 6 per condition) ((Jones, Boisvert, Francois,
Zhang, & Culty, 2015; Walker et al., 2020).

25

Results

The goal of this experiment was to determine the number of differentially expressed genes for
each treatment and each dose. These data show a dose dependent differential gene expression
profile with more differentially expressed genes at the 10mg dose for DEHP and the GD mix as
compared to the 0.1mg dose. We found that for the 10mg/kg/day dose Gen+DEHP had
significantly more differentially expressed genes (1184) than Gen (27) or DEHP (209) alone. The
goal was to compare DEG’s from each dose to determine differences in pathways affected by
each however due to the minimum number of genes needed to complete pathway analysis and
obtain statistical significance in Ingenuity Pathway Analysis and DAVID’s with KEGG we
continued with pathway analysis on all DEGs for Gen+DEHP at the 10mg/kg/day dose. (Figure
4).
Figure 3. Dose Dependent Differential Gene Expression Profiles in Testes from Rats Exposed In Utero
to Gen, DEHP or Gen+DEHP (GD). Partek Genomics Suite was used to create lists of genes that are
common and unique between each treatment at both doses. Statistical cut-offs of 40%-fold change with
an unadjusted p-value of 0.05 were used to obtain gene lists. Three to four pups were used per
treatment.
26

We imported the list of 1184 differentially expressed genes affected by Gen+DEHP at the
10mg/kg/day dose into The Database for Annotation, Visualization and Integrated Discovery
(DAVID) linked with the Kyoto Encyclopedia of Genes and Genomes (KEGG). The KEGG
pathway revealed that genes from our list were most related to Sertoli and germ cell pathways.
Hippo signaling pathway is a conserved growth control pathway that plays a role in regulating
proliferation of various cell types and has been found to be important for Sertoli cell function. Wnt
pathway in testis was found to promote spermatogonial stem cell maintenance by suppressing
apoptosis via the beta-catenin pathway. Beta-catenin mRNA and protein are predominant in the
seminiferous tubules of fetal mice and beta-catenin was found to be abundant in Sertoli cells.
Retinoic acid in testis has been found to be important for spermatogenesis and male fertility.
Additionally, retinoids are important for proliferation and differentiation of type A spermatogonia
and spermiogenesis. Adheren’s junctions are found between Sertoli cells and Sertoli and germ
Figure 4. In Utero Exposure to 10mg/kg/day Gen+DEHP mix Affects Sertoli and Germ Cell
Pathways. KEGG analysis reveals canonical pathways related to Sertoli and germ cells in rat
testes exposed to 10mg/kg/day of Gen+DEHP. N=3 rats, statistical cut-offs p-value < 0.05 and
fold change cut-off of 40%
27

cell regions which ensure the proper movement of germ cells from the basement membrane to
the lumen, and ensure nutrient transfer occurs from the Sertoli to the germ cells. Additionally, the
MAPK pathway has been found to regulate the dynamics of tight junctions and adherens
junctions, and is involved in the proliferation and meiosis of germ cells. These data suggest that
in utero exposure to Gen+DEHP affects cells within the seminiferous tubules of the testis, Sertoli
and germ cells.
Next, I was interested in determining the genes that were most affected by the Gen+DEHP
mixture at 10mg/kg/day. Here we show the top 10 most downregulated and top 10 most
upregulated genes out of the list of 1184 DEGs from Gen+DEHP mix listed in order of fold change.
We found that Forkhead Box A 3 (Foxa3) is the most downregulated gene in our dataset.
Additionally, it was the only transcription factor on our list of genes. Transcription factors are
proteins that bind to regions of DNA and affect transcription. When these bind to a promoter region
of a gene then they can affect gene expression. These data point to Foxa3 as a novel gene for
further evaluation in my study.
Figure 5. Foxa3 is the most downregulated DEG in rat testes exposed to 10mg/kg/day
Gen+DEHP mix.
28

Next, I conducted a comparison analysis in Ingenuity Pathway Analysis to determine
differentially expressed genes between Gen, DEHP and Gen+DEHP that are related to the search
category, ‘transcription’. We found that Foxa3 was differentially expressed only in the Gen+DEHP
exposed rat testis. Foxa3 is a transcription factor that has been previously reported as the only
Fox A family member identified in the testis. More specifically, it has been found to be expressed
in Leydig, Sertoli, and germ cells. A study from Behr and colleagues in 2007 found that mice that
are homozygous or heterozygous for the Foxa3 null allele exhibited reduced male fertility
Figure 6. Foxa3 is the most downregulated DEG in rat testes exposed to 10mg/kg/day Gen+DEHP
mix.
29

secondary to increased germ cell apoptosis. These data provide further rationale to exploring the
effects of EDC-induced Foxa3 downregulation on testicular functions.

RNA sequencing revealed that there were a higher number of differentially expressed
genes at the lower dose of 0.1mg/kg/day as compared to the higher dose of 10mg/kg/day for
Gen+DEHP (A). Previously we showed that the number of DEG’s identified from microarray for
the 0.1mg/kg/day dose were not enough to complete pathway analysis. RNA sequencing is a
newer, more robust method to determining gene expression. Here RNA sequencing shows that
Figure 7. Foxa3 is Decreased in Rat Testes Exposed to 0.1 and 10mg/kg/day Gen+DEHP mix. (A) Partek
Flow was used to analyze RNA sequencing done on rat testes exposed to control or 0.1 or 10mg/kg/day of
Gen+DEHP. N=4 to 6 rats from independent dams. (B) qPCR assessing Foxa3 mRNA expression in rat
testes exposed to Gen+DEHP mix.

Foxa3
0.1mg 10mg Ctrl
Reads per million (RPM)
F o x a3
1
7.6
7
4.3
3
1
T r ea tm en t
( m g /k g /d a y)
Ctrl 0.1mg 10mg
0
1
2
3
4
Foxa3 pooled
mg/kg/day
Gen+DEHP
Fold change/Ctrl
A B
30

Foxa3 is decreased at the 0.1mg/kg/day dose and the 10mg/kg/day dose which validates the
findings from microarray. RNA sequencing also identified more differentially expressed genes at
the 0.1mg/kg/day dose than the dose of 10mg/kg/day, which suggests a further need to evaluate
EDC mixtures below the currently document NOAEL’s (data not shown).
.

I then used MALDI Imaging Mass Spectrometry to quantify the amount of Foxa3 protein
in the Gen+DEHP samples. The Foxa3 protein is shown by yellow dots on the sections and the
histograms on the right show the intensity as signal quantification normalized by surface unit. We
see that there is a decrease in Foxa3 protein expression in adult rat testes exposed to
0.1mg/kg/day of the Gen+DEHP mix. Not shown, we also saw decreases in Foxa3 protein in
testes exposed to 10mg/kg/day of the Gen+DEHP mix. The results identified to this point show
that Foxa3 gene and protein are decreased in whole testes extracts exposed in utero to low dose
mixtures of Gen+DEHP. The testis is composed of several cell types working together in
concerted fashion to effectively carry out spermatogenesis and steroidogenesis. Next, I will
Figure 8. MALDI-IMS Reveals Foxa3 Protein is Decreased by Exposure to the Gen+DEHP Mix.
Quantification of Foxa3 protein in control and 0.1mg/kg/day Gen+DEHP PND120 rat testis. Yellow dots
represent signal intensity Box plots show quantification of signal as normalized by surface unit.
31

determine the cell type(s) which Foxa3 is decreased to determine how EDC-induced Foxa3
downregulation affects testicular functions.

In the previous figures I showed that in utero exposure to low doses of Gen+DEHP mix
affected the morphology of adult rat testes and that pathways related to testicular function are
Figure 9. In Silico Search for Foxa3 Interactions in Testis. Genes in the Ingenuity database with relation
to ‘Foxa3’ in rat testes exposed to (A) 0.1 or (B) 10mg/kg/day Gen+DEHP mix using IPA. (C)TRANSFAC
generated list of Foxa3 target genes.
A.
B.
C.
32

differentially expressed in these testes. Particularly I showed that Foxa3, a transcription factor
necessary for testicular function was downregulated in adult rat testes exposed in utero to the
Gen+DEHP mix at both doses. A study by Garon and colleagues found that mice that mice that
are homozygous for the Foxa3 -/- null allele were infertile. Another study found that Foxa3 binds
to the Pdgfr alpha
receptor in Leydig cells. Platelet-derived growth factor receptor alpha (Pdgfra) is necessary for
Leydig cell differentiation and embryonic development (Garon, Bergeron, Brousseau, Robert, &
Tremblay, 2017). To determine the effect of Foxa3 on testicular processes I wanted to identify
Foxa3 target genes. I used IPA and TRANSFAC, a transcription factor database, to do an in silico
search for predicted targets of Foxa3 within the testis. Since I used whole testis extracts it is
important to determine the specific cell type(s) where Foxa3 is decreased. Figure 9 shows that
Foxa3 target genes are located within Leydig, Sertoli, and germ cells, with many of these genes
found in the Leydig cells. These data along with previous findings furthermore suggest that Foxa3
may be significantly decreased in Leydig cells of the testis and that this decrease could affect
Foxa3 target genes necessary for steroidogenesis.

33

Figure 10. Foxa3 protein is Decreased in Interstitial Cells in Rat Testes Exposed to 0.1 and 10mg/kg/day
of Gen+DEHP. Immunofluorescence for Foxa3 in adult rat testes exposed in utero to 0.1 and 10mg/kg/day
of Gen+DEHP mix. Images are merged with Foxa3 (green) and nuclear staining with DAPI (blue).
Representative photos shown here were taken at 10x objective.

200
um
Pdgfrα
Foxa3
Merge
34

Next I wanted to determine where Foxa3 is localized within our EDC exposed testis
samples. It has been previously expressed in Leydig, Sertoli, and germ cells, all of which are
required to ensure normal spermatogenesis and steroidogenesis. I used immunofluorescence to
detect Foxa3 protein in adult rat testes exposed to control or 0.1 or 10mg/kg/day of the
Gen+DEHPmix. I did a co-localization with FOXA3 and Pdgfr alpha, which is a protein highly
expressed in Leydig cells. I found that Foxa3 is expressed in interstitial cells in control rat testis,
and that it appeared to be decreased in interstitial cells in Gen+DEHP at the 0.1 and 10mg/kg/day
doses while also being expressed in cells within the seminiferous tubules.

35

Figure 11. Gen+DEHP mix Affects Steroidogenesis. (A). Differentially expressed genes in adult rat testes
exposed to 0.1mg/kg/day Gen+DEHP mix related to ‘steroidogenesis’ using IPA. (N=4,
green=downregulated, red=upregulated) Genes are listed in order of ascending fold change. P-value <0.05.
(B). qPCR for genes in the steroidogenic pathway are altered by exposure to Gen+DEHP. N=3-5. (C).
Immunofluorescence staining to detect differences in TSPO protein expression in rat testes exposed in
utero to 0.1 or 10mg/kg/day of Gen+DEHP mix.
A.
B.
36

Here I used IPA to identify genes in my dataset that were related to the search term
‘steroidogenesis’. All genes identified were down or upregulated at least 2-fold in 0.1mg/kg/day
Gen+DEHP as compared to control. Growth hormone releasing hormone (GHRH) has been
reported to be present in interstitial cells and germ cells in rat testis (Fabbri et al. 1995). The same
study also found that GHRH secreted by Leydig cells in adult rats can also stimulate cAMP
formation via induction of luteinizing hormone (LH), and that it can regulate Sertoli cell function.
Cytochrome’s 7B1, 7A1 and 2R1 were also found to be decreased in my study. Cytochrome
P450’s in the testes are important for metabolizing cholesterol into testosterone (Zhu et al., 2019).
Cytochrome P450 family 7 subfamily B1 has been found to regulate 11beta-hydroxysteroid
dehydrogenase 1 (11b-HSD1) in rat Leydig cells (Zhu et al., 2019). CYP7A1 and CYP2R1 are
also apart of the cholesterol synthesis network. Translocator protein, TSPO, binds cholesterol
and transports it to the inner mitochondrial membrane for steroid biosynthesis to occur
(Pappadopoulos). The family of apolipoproteins (i.e APOA1) are also responsible for cholesterol
transport (Yang et al., 2021). Forkhead Box A1 (Foxa1) is a member of the Forkhead Box A family
that has been found to bind to the androgen receptor in the prostate (Teng et al., 2021). These
C.
37

data suggests that steroid biosynthesis is affected in Leydig cells of the testis, while a reduction
of GHRH could also suggest disturbances within the hypothalamic-pituitary axis thus affecting
testosterone feedback. Since these are lists of Foxa3 target genes, these data could suggest that
a reduction in Foxa3 results in a reduction of GHRH, CYP7B1, CYP7A1, CYP2CR1, TSPO,
FOXA1, and HSD17B1 while the opposite may occur for APOA1.
I also wanted to determine whether the mRNA expression of genes in the steroidogenic
pathway were also altered by in utero exposure to EDCs. I found that Star, TSPO, 3beta-HSD,
and Cyp17 were all altered by exposure to EDCs (Figure 11B). Additional studies will be needed
to determine whether these alterations are due to Foxa3 mediation or are a result of other
disturbances. TSPO is a well characterized protein that has been found to be critical for steroid
biosynthesis in the tests. My data also suggests that TSPO gene expression may be mediated by
Foxa3. I wanted to determine whether TSPO protein expression was also decreased by the
Gen+DEHP mix and found that TSPO appeared to be decreased in testes exposed to both doses
of the mixture, however this decrease appeared to be more dramatic at the lower dose of
0.1mg/kg/day. These data combined could suggest that Foxa3 may bind to and affect the
transcription of several genes important for steroid biosynthesis ultimately affecting
steroidogenesis in testis.

38

I then wanted to determine the effect of EDC exposure on testosterone function. I used
radioimmunoassay to detect circulating levels of serum testosterone from adult rats exposed in
utero to EDCs. I found that 0.1mg/kg/day of Gen+DEHP significantly decreased testosterone
production, while the mixture at 10mg/kg/day was shown to increase testosterone production.
Testosterone production in testes exposed to genistein alone and DEHP alone at both doses
was found to be altered however not significantly. Across all treatments testosterone production
was more significantly decreased in the lower dose of 0.1mg/kg/day while this effect appeared
to be recovered in the 10mg/kg/day. Testosterone is produced by the Leydig cells and is
needed for steady state function of the testis in the adult life. These data suggest that exposure
to a mixture of Gen+DEHP decreases testosterone production in adult rat, and furthermore
point to Gen+DEHP induced dysregulation in Leydig cells.

Figure 12.EDCs Affect Testosterone Production in Adult Rat Testes Effect of in Utero exposure to Genistein
(G) DEHP (D) and the mixture (G+D) on adult rat testes treated with two doses of 0.1mg/kg/day and
10mg/kg/day on Testosterone production in F1 rat testes.
39

Discussion
Overview of EDCs and the Effect of EDCs on Steroidogenesis
The adverse effects of environmental chemicals were first identified in the late 1930’s as
industrial development surged. Still, their potential risk to humans was recognized only in the
1960s by the book of Rachel Carson “Silent Spring”, denouncing the adverse effects of pesticides
on wildlife (Kwiatkowski et al. 2016). The concept of endocrine disruption and the term “endocrine
disruptor” were coined 30 years later by Theo Colborn and colleagues, leading to the study of
EDCs as a separate discipline in toxicology (Colborn, 2004; Kwiatkowski et al., 2016). Over the
years, many EDCs were found to have anti-androgenic and estrogenic properties and, therefore,
to have the potential of affecting steroidogenesis and Leydig cell development (Gore et al. 2015).
Subsequently, several definitions of EDCs were proposed by various regulatory and
governmental agencies, including the World Health Organization, the Environmental Protection
Agency, the Food and Drug Administration, and the Endocrine Society (Bergman et al. 2013). In
its simplest definition, an EDC is “an exogenous chemical, or mixture of chemicals that interferes
with any aspect of hormone action”. The male and female reproductive systems are targets of
EDCs due to their requirement for hormones for proper functioning. The male reproductive
system, in particular, has been found to be affected by classes of EDCs including bisphenols,
perfluoroalkyls, phthalates, and parabens, with most of them affecting steroid production and/or
the expression of enzymes and proteins of the steroidogenic cascade such as Hsd3b and the LH
receptor Lhcgr in testis (Boujrad et al., 2000; Martinez-Arguelles et al. 2013; Jones et al. ,2014;
Zhu Q et al., 2020, Rosenmai et al., 2016, Jones et al., 2016, Jambor T et al., 2019, Maske P et
al., 2020). Single EDCs and their effects on the endocrine and reproductive systems have been
studied extensively. However, the effects of EDC mixtures have been less well characterized.
Nonetheless, it has become clear that studying mixtures is critical to fully and accurately assess
the risk of exposure to the multiple chemicals encountered through the environment, diet, and
40

lifestyle activities (Lee 2018).
Phthalate plasticizers are used primarily to increase the flexibility of plastics and are found
in household appliances, medical tubing, and cosmetics, and have been linked to developmental
abnormalities in male genitalia, including reproductive tract malformation, cryptorchidism,
hypospadias, and decreased androgen production (Martinez-Arguelles et al., 2013; Jones et al.,
2016). In humans, maternal and umbilical cord plasma were found to contain monoesters of the
phthalate diesters DEHP, DEP, DnBP, DiBP, DBzP, and other metabolites (Kolatorova et al.,
2018). Phthalates are known as PPARα agonists, but the mechanisms by which they disrupt
cholesterol metabolism and suppress steroidogenesis throughout fetal development and beyond
are not fully understood (Wang et al., 2019). In 2015 the world's plastic production reached 381
million tons, and most humans are chronically exposed to phthalate plasticizers, particularly to
DEHP, the most abundant one. Because they are not covalently bound to the matrices and
various consumer products in which they are incorporated, phthalates are able to leach out into
the environment, increasing the chances of exposure of animals and humans (Martinez-Arguelles
et al., 2013; Barakat et al., 2020).
One of the most -studied phthalates is DEHP, commonly found in consumer goods, although
its use in childcare products has been phased out. DEHP can be absorbed into the body dermally,
orally, or by inhalation (Barakat et al., 2016). Studies have shown that DEHP and its major
bioactive metabolite Mono(2-ethylhexyl) Phthalate (MEHP) are found in urine ranging between 3-
30 ug/kg/day, in blood, including umbilical cord blood, at 0.1 mg/kg/day, as well as in breast milk
and amniotic fluid. DEHP and MEHP have known anti-androgenic effects in males independent
of the androgen receptor, and can disrupt testicular function (Kavlock et al. 2006; Frederiksen et
al. 2007). Previous in vivo studies in our laboratories demonstrated that in utero exposure to
DEHP at various doses disrupted fetal, neonatal, and adult testosterone production in rats by
different mechanisms, with perinatal effects mainly associated with decreases in the expression
41

of steroidogenesis-related genes. In contrast, in adult testis, the adverse effect of DEHP on
testosterone production was associated with a reduction of the mineralocorticoid receptor, which
was down-regualted by epigenetic mechanisms, but no change in LH levels (Culty et al., 2008;
Martinez–Arguelles et al. 2009). Subsequent studies revealed that in utero exposure to DEHP
affected both adrenals and testes, reducing simultaneously circulating levels of aldosterone and
testosterone, indicating that some of the effects observed in testis resulted from DEHP adverse
effects in the adrenal cortex (Martinez–Arguelles et al. 2011). More recently, we found a
decreasing trend in the expression of Cyp11a1, but a significant increase in the mRNA levels of
3β-HSD in the testes of postnatal day (PND) 3 rats exposed in utero to 10 mg/kg/day DEHP, a
dose relevant to human exposure. In the same study, treating organ cultures of PND3 rat testes
with 10 μM MEHP significantly increased basal testosterone production (Jones et al. ,2015). The
stimulatory effect of MEHP on basal steroidogenesis was further confirmed in an in vitro study
measuring progesterone production in the MA-10 mouse Leydig cell line (Jones et al., 2016).
Together, these data suggest a pro-androgenic effect of DEHP and MEHP on basal neonatal
androgen production. However, the same concentration of MEHP inhibited hCG-induced
progesterone production in MA-10 cells, as well as hCG-induced testosterone production in organ
culture of fetal rat testes, indicating opposite effects of these phthalates on basal and hormone-
induced steroidogenesis (Boisvert et al., 2016). MEHP was reported to have a biphasic effect in
vitro on MA-10 cells and adult rat Leydig cell hormone-induced steroid production, with lower
concentrations being stimulatory and higher concentrations being inhibitory (Fan et al., 2010).
Altogether, these data suggest that basal and hormone-regulated steroid production in Leydig
cells involve molecular mechanisms that are differentially affected by phthalates.
Adverse effects of MEHP on testosterone production were also observed on human fetal
Leydig cells by investigators using organ cultures of human fetal testes (Muczynski et al. 2012).
Interestingly, high doses of DBP, another ubiquitous and broadly studied phthalate that inhibits
42

Leydig cell steroidogenesis in rat, did not alter testosterone production by human fetal testis
xenografts, suggesting that human fetal Leydig cells are sensitive to DEHP but not to DBP
(Mitchell et al., 2012; Heger et al. 2012). Nonetheless, DEHP and DBP shared other adverse
effects, such as the induction of multinucleated gonocytes formation both in rat and human fetal
testis (Heger et al. 2012). Moreover, epidemiological studies showed that higher levels of
metabolites from DPB and DEHP, and diisononyl phthalate (DiNP), a phthalate increasingly
replacing DEHP, in maternal urine and blood was associated with the shortening of anogenital
distance and decreased androgen/estrogen ratio in babies, indicating that these phthalates all
disrupted androgen-responsive processes in human fetuses (Swan et al. 2005; Araki et al., 2014;
Bornehag et al., 2015).
Phthalate mixtures
The group of Earl Gray Jr. was among the first to examine the potential adverse effects of anti-
androgenic phthalate mixtures on the male reproductive system in rats (Howdeshell et al. 2008;
Rider et al. 2008; Howdeshell et al. 2017). Pregnant rats were exposed to different doses (from
65 to 1300 mg/kg/day) of a mixture of five anti-androgenic phthalates, DBP, DEHP, BBP,
diisobutyl phthalate (DiBP), and dipentyl phthalate (DPP). In the mixture, each compound was
dosed according to its potency at inhibiting fetal testosterone production as a single compound,
leading to DBP, DEHP, BBP and DiBP used at 300 mg/kg/day, and DPP used at 100 mg
DPP/kg/day. The study showed additive effects of phthalates on fetal testosterone production at
doses that were not expected to have deleterious effects (Howdeshell et al. 2008). In a
subsequent study, pregnant rats were treated with DEHP, DBP and BBP mixed with the AR
antagonists vinclozolin, procymidone, linuron, prochloraz, each used at 1⁄7th of the dose inducing
reproductive malformations in all male offspring (Rider et al. 2008). This and following studies
showed cumulative adverse effects of the mixtures on androgen-sensitive responses, including
reduced anogenital distance, infant areolae retention, decrease the weight of reproductive tract
43

tissues, hypospadias, gubernacular and epididymal agenesis, and testicular malformations, at
doses that induced none or minimal male reproductive effects with single chemicals (Howdeshell
et al. 2017).
In a recent study, F1 male mice exposed in utero to 20 μg/kg/day and 500 mg/kg/day of a
mixture of phthalates found in the urine of pregnant women, including DEHP, DiNP, DBP, DiBP,
BBP, and diethyl phthalate (DEP), were reported to have smaller reproductive organs including
gonads, prostate, and seminal vesicles, and lower adult serum testosterone levels (Barakat et al.,
2019). Their testes also presented decreased mRNA expression of Star and Cyp11a1 for the
dose of 20 ug/kg/day), and Cyp17 for the dose of 500 mg/kg/day, as well as impaired
spermatogenesis (Barakat et al., 2019). The decreases in adult testosterone levels suggested
that the phthalate mixtures exerted adverse effects on the progenitors of adult Leydig cells.
Although phthalate diesters are among the more well-studied EDCs, the effects of their
monoester metabolites on reproductive functions have not been as well characterized. An in vitro
study using the MLTC-1 mouse Leydig cell line tested the ability of 5 phthalate diesters and
monoester hydrolysis byproducts, individually or mixed, to disrupt androgen secretion and
steroidogenesis. First, the cells were found to hydrolyze efficiently short-chain diester DMP, DEP
and DBP, to poorly hydrolyze the long-chain DEHP, while DBzP (aromatic alkyl chain) was not
hydrolyzed by endogenous enzymes (Tian et al., 2019). Overall, the study found that the diesters
DBP, DBzP, and DEHP exerted biphasic effects, with low concentrations inducing progesterone
synthesis similarly to monoesters at higher concentrations, whereas diesters at high (100 μM)
concentration inhibited steroid production. By contrast, the monoester had only monotonic
androgenic effects. Treatment with 10-100 μM of DMP or DEP, but not their monoester
metabolites MMP or MEP, showed androgenic effects. Testosterone decrease was attributed to
the dysregulation of SR-B1, an integral membrane protein involved in HDL-cholesterol ester
uptake (Tian et al., 2019).
44

Another study examining a mixture of DBP with cadmium on fetal testis development in rats
found that their combined exposure decreased fetal Leydig cell number and worsened their
aggregation (Ma et al., 2020). Additionally, cadmium, DBP, and their mixture were all found to
decrease serum testosterone. Another study reported that a mixture of DBP and benzo(a)pyrene
increased Interleukin 1 beta, which inhibited testosterone production in adult rats (Zheng et al,.
2010).
Not only have phthalates, specifically DEHP, been shown to disrupt testis function in F1 males,
but adverse effects on testis disruption have also been observed in up to the F3 generation; a
concept known as transgenerational inheritance. Another study from Barakat and colleagues
found a decrease in serum testosterone levels along with an increase in gonad and body weight
in F3 male mice descendant of F1 male exposed in utero to 20ug of DEHP (Barakat et al., 2020).
A decrease in Star and 17βHsd gene expression was also observed, showing that DEHP can
affect steroidogenesis and testicular development transgenerationally.
Impact of Estrogenic and Anti-Androgenic Mixtures on Steroidogenesis
In our own studies, we examined the effects of genistein mixed with DEHP in vivo, or MEHP
in vitro, as a prototype of human co-exposure to estrogenic and anti-androgenic EDCs (Jones et
al. 2014, 2015; Walker et al. 2020). Exposure to the plant phytoestrogen genistein occurs mostly
via consuming soy-rich food and is higher in vegetarian/vegan diets and baby soy formula, and
therefore can be controlled. In contrast, exposure to DEHP is difficult to avoid as humans are
continuously exposed to DEHP released from various consumer products and medical devices
and to MEHP formed by the intestinal microflora (Green et al., 2005, Boisvert et al., 2016). While
comparable levels of genistein and DEHP/MEHP have been measured in human blood, they are
found at higher levels in babies fed with soy-formula and undergoing medical procedures,
respectively, compared to exposure levels of healthy adults (Rozman et al., 2006; Kavlock et al.,
2006). The effects of genistein and DEHP alone or in mixture were examined by gavaging
45

pregnant rats from GD14 to birth with genistein and DEHP at equal doses, using either 0.1 or 10
mg/kg/day, representing levels measured in humans. Exposure to 10 mg/kg/day of the genistein
and DEHP mixture induced both short- and long-term disruption in the gene and/or protein
expression of Leydig, Sertoli, and spermatogenic cells in rat testis (Jones et al. 2014; Jones et al.
2015). Interestingly, adult testosterone circulating levels were significantly decreased by the lower
dose of the genistein-DEHP mixture only, whereas estradiol levels were reduced by the lower
dose of DEHP only (Jones et al. 2014; Walker et al. 2020). These results indicate that a low dose
of the EDC mixture is enough to exert adverse effects on testicular steroidogenesis, and suggest
that genistein, DEHP and their mixture differentially target androgen and estrogen production.
Additionally, fetal exposure to the mixture at 0.1 mg/kg/day increased the incidence of abnormal
testis morphology in adult offspring. The study also revealed changes in testicular macrophage
populations at both doses, suggesting the involvement of inflammatory responses in the adverse
reproductive effects of genistein and DEHP (Walker et al. 2020).
The potential effects of Genistein-DEHP mixture on neonatal steroidogenesis were also
examined, showing that exposure to the mixture at 10 mg/kg/day, but not single EDCs, decreased
CYP11A1 expression in testes (Jones 2015). However, there was no difference between basal
or hormone-induced testosterone production in ex vivo culture of testes from control pups and
those exposed in utero to the mixture. Moreover, in vitro treatments of PND3 rat testis organ
cultures for 3 days with genistein and MEHP at 10 μM, corresponding to levels found in human
blood, showed no effect of the mixture on testosterone levels. In contrast, MEHP alone increased
basal testosterone production (Jones 2015). In the same study, fetal exposure to DEHP was
found to induce oxidative stress responses in PND3 testes normalized by genistein in rats
exposed to the mixture. These data are different from those we obtained in MA-10 mouse Leydig
cells, where Genistein-DEHP mixtures at 10 and 100 μM increased basal progesterone
production, whereas 100 μM of MEHP and the mixture both inhibited hormone-induced
46

progesterone production (Jones et al. 2016). The inhibitory effect of MEHP on hCG-induced
steroidogenesis was previously reported to occur in parallel to increased ROS levels in MA-10
Leydig cells (Fan et al. 2010). Taken together, these results suggest that MEHP differentially
affects the mechanisms regulating basal and hormone-controlled steroidogenesis and that ROS
may play different roles in fetal and adult-type Leydig cells.
Male reproductive pathologies, such as infertility and testicular cancer are on the rise in the
western world. Endocrine disrupting chemicals (EDCs) have been identified as potential
causative agents of sterility in males. EDCs altering sex steroid levels or functions in perinatal
life have been shown to disrupt male reproductive functions, when used individually, usually at
doses exceeding human exposure levels. My goal was to examine whether fetal exposure to a
mixture of the EDCs DEHP and genistein (Gen), given at doses relevant to human, could impact
the adult testis. DEHP is a phthalate plasticizer used in many commercial products and medical
devices. Gen is a phytoestrogen abundant in baby soy formula and vegetarian diets. Our
previous studies showed that Gen+DEHP mixture increased infertility and abnormal testis
development in adult (postnatal day (PND) 120) rats. The goal of this study was to identify
pathways, genes and functions that are altered in adult rat testes after in utero exposure to Gen
and DEHP alone or mixed to understand the etiology of the observed phenotypes.
I found that pathways that were altered were related to Sertoli and germ cell development
and function in rat testes exposed to the Gen+DEHP mixture, and I also identified Foxa3 as a
differentially expressed gene that was downregulated in testes exposed to the Gen+DEHP
mixture but not Gen alone or DEHP alone. Foxa3 is a transcription factor that has previously
been identified in Leydig, Sertoli and germ cells and is critical for testicular function ((Behr,
Sackett, Bochkis, Le, & Kaestner, 2007; Garon et al., 2017). Transcription factors are proteins
that bind to DNA and affect the expression of target genes. In the present study I showed that
Foxa3 mRNA was decreased in adult rat testes exposed to 0.1 and 10mg/kg/day of Gen+DEHP
47

mix, using both RNA seq and qPCR. Foxa3, was originally identified in the liver as one of three
members of the Forkhead Box A family. Forkhead Box A family members are winged helix
proteins that function as transcriptional regulators by binding to target sites on DNA ((Benayoun,
Caburet, & Veitia, 2011). Studies by Garon and Behr and colleagues previously reported Foxa3
as the only FoxA family member identified in the testis. Here we confirm that Foxa3 is indeed
expressed in the testis, yet upon a network interaction search in IPA, Foxa1 was found to have
a protein-DNA interaction with Foxa3 and was also found to be downregulated (-2.33 fold
change) in our dataset (Figure 11A). Foxa1 was also found to bind to the androgen receptor in
the prostate. These data suggest that Foxa1 is indeed present in the adult testis and may be
altered by exposure to EDCs either directly or through interactions with Foxa3. The results in
this study identify Foxa3 as a novel gene downregulated by in utero exposure to
environmentally relevant doses of Gen+DEHP mixtures. I also aimed to link the effect of Foxa3
downregulation on testicular function. Foxa3 has been reported in Leydig, Sertoli, and germ
cells ((Behr et al., 2007; Garon et al., 2017). I used TRANSFAC, a transcription factor database,
to identify Foxa3 target genes and their specific cell types (Figure 9C). I found genes associated
with Leydig cells including: HSD3b, APO (A-I), Pck, Nur77, and G6P. A network interaction
search on genes in our dataset related to ‘steroidogenesis’ also found that TSPO, HSD17B1,
FOXA1, GHRH, and a number of cytochrome P450’s were decreased. All of the aforementioned
genes are critical for the proper functioning of steroidogenesis ((Cargnelutti et al., 2020; Lymperi
& Giwercman, 2018). I then used qPCR to determine whether genes in the steroidogenic
pathway were altered by Gen+DEHP mix and we found that Cyp17, HSD3b, Cyp11a1 and
TSPO were decreased by Gen+DEHP mix at the 0.1mg/kg/day dose, and slight decreases at
the 10mg/kg/day dose. Additionally, I found that TSPO was decreased in rat testes exposed to
Gen+DEHP at both doses, however a more dramatic effect was observed at the dose of
0.1mg/kg/day (Figure 11C). TSPO is a translocator protein that plays a role in cholesterol
mediated transport from the outer to the inner mitochondrial membrane and is highly expressed
48

in and is well-cited as an important component of Leydig cells. Our lab has previously identified
TSPO as being expressed in pachytene spermatocytes and dividing spermatogonia in adult rat
testis ((Manku & Culty, n.d.; Midzak, Rone, Aghazadeh, Culty, & Papadopoulos, 2011). The
results from this experiment confirm that TSPO is decreased in the interstitial space within testis
exposed to Gen+DEHP mix which further suggests that steroidogenic function within the Leydig
cells of the testis is altered by exposure to EDCs, and that this decrease may be linked to EDC-
induced downregulation of Foxa3. Additionally, I also found that serum testosterone levels were
altered in rats exposed to EDCs, and that EDCs at the lower dose of 0.1mg/kg/day had more
dramatic effects on testosterone than those at the dose of 10mg/kg/day, however the only
statistically significant decrease occurred at 0.1mg/kg/day of the Gen+DEHP mix, suggesting
that exposure to EDC mixtures at doses lower than the NOAEL can affect steroidogenesis, a
key function of the testis.
Conclusion
In this study I found that in utero exposure to Gen+DEHP at environmentally relevant doses
altered the morphological phenotype of adult rat testis. I identified the transcription factor,
Foxa3, as a differentially expressed gene decreased by exposure to the mixtures of
Gen+DEHP, and has previously been found to bind to genes important for steroidogenesis,
including Pdgfra. Additionally, I found that steroidogenic genes and proteins are altered by in
utero exposure to EDCs and that testosterone production was also decreased. From this study
conclude that in utero exposure to low dose mixtures of Gen+DEHP can disrupt the
developmental program of key testicular cell types including Leydig cells by altering the
regulation of genes needed for steroidogenic function.

49

CHAPTER III

TRANSGENERATIONAL EFFECTS OF FETAL EXPOSURE TO LOW DOSE GENISTEIN AND
DEHP MIXTURES ON MALE RAT REPRODUCTION: CAN EPIGENETICS PROVIDE
ANSWERS?

Walker C
1
, Beyssac L
2#
, Boisvert A
2
, Culty M
1,2

1
Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of
Southern California, Los Angeles, CA USA;
2
The Research Institute of the McGill University
Health Centre and Department of Medicine, McGill University, Montreal, Quebec, Canada.

Keywords: endocrine disruptors; testis; reproduction; transcriptome; functional pathways;
epigenetics

Corresponding author: Martine Culty, School of Pharmacy; University of Southern California; 1985
Zonal Avenue; Los Angeles, California 90089-9121. Phone: 323-865-1677; e-mail:
culty@usc.edu

This work was supported in part by funds from a grant from the Canadian Institutes of Health
Research (CIHR) (Operating grant # MOP-133456) and funds from the USC School of Pharmacy
to MC. WC was supported by a School of Pharmacy Dean’s award.

50

In Chapter II I identified Foxa3 as a novel target gene and transcription factor in my study and
also identified Foxa3 targets. Foxa3 was previously reported to be the only FoxA family member
in the tests, however our study reports that Forkhead Box A 1 (Foxa1) is also present in adult rat
testes and is decreased by exposure to Gen+DEHP. Many of the studies on Foxa1 have been
done in liver and prostate. Previously I showed that Foxa1 was decreased in F1 adult rat testes
exposed to 0.1mg/kg/day of Gen+DEHP. A study by Jin and colleagues in 2013 found that Foxa1
helps the androgen receptor bind to low-affinity androgen response elements, which could
suggest that DEHP, an anti-androgenic compound, can disrupt this process (Stenz et al. 2019).
Another study found that Foxa1 binds to the promoter of DNA methyltransferase 3A (Dnmt3a)
(Wang et al., 2020). Dnmt3a is an enzyme responsible for the establishment of DNA methylation
patterns in germ cells. Studies have reported changes in the epigenome of the sperm of infertile
men, and that these changes may be passed down to subsequent generations. Such changes
may be associated with alterations in DNA methylation, histone modifications or chromatin
remodeling. These data combined suggest that epigenetics may play a role in the observed
phenotypes, and that these changes may be mediated by EDC-induced Foxa3/Foxa1
downregulation. In the following chapter I will explore the role of epigenetics in the etiology of F1
adult rat testes exposed in utero to gen, DEHP and their mixture, and will also examine testes
from F2 and F3 generations.

51

Abstract
Male reproductive disorders have been on the rise in the last four decades, including
developmental abnormalities usually repaired surgically in babies, such as hypospadias and
cryptorchidism, but also diseases occurring in adolescence or adulthood such as testicular cancer
and infertility. As proposed in the Testicular Dysgenesis Syndrome hypothesis, fetal exposures to
endocrine disrupting chemicals (EDCs) could be part of the original insults leading to these
phenotypes. Indeed, the deleterious effects of high doses of EDCs on rodent male reproductive
system are well-documented, and are supported by epidemiological studies reporting strong
association between maternal exposure levels to EDCs, in particular phthalate plasticizers, and
reproductive alterations in their infants, further emphasize the importance of studying the
toxicology of these chemicals. However, few studies have assessed the toxic effects of EDC
mixtures on male reproduction at doses relevant to humans. In previous studies, we found that
fetal exposure to mixtures of two chemicals known to disrupt androgen and estrogen
homeostasis, the plasticizer di-(2-ethylhexyl) phthalate (DEHP) and the phytoestrogen genistein
(GEN), at doses relevant to humans, exerted unique short- and long-term adverse effects on
testis development and function in F1 offspring, in Sprague Dawley rats. The present study
examined whether in utero exposure to GEN+DEHP mixtures altered epigenetic processes in the
testes of the F1, F2 and F3 offspring, in parallel to phenotypic changes in their testes and
reproductive function.
Pregnant SD rats fed with a casein-based diet were gavaged from gestation day 14 to birth, to
vehicle or two doses of GEN and DEHP alone or in mixture, revealing several abnormal adult
phenotypes in EDC-exposed F1 rats, including increased rates of infertility, atrophied testes and
small litters, which persisted in future generations. Overall, the effects were more pronounced
with the EDC mixtures, compared to individual chemicals. Alterations in the patterns of DNA
methylation were observed in the testes of F1 rats, supporting the idea that epigenetic alterations
took place in the testes of the EDC-exposed F1 rats. RNAseq and gene array coupled with
52

functional pathway analyses of F1 rat testes identified epigenetic-related genes and pathways
that were significantly altered by in utero exposure to GEN+DEHP mixtures in adult rats with
further decreases in F2 and a recovered effect in F3, suggesting that the epigenetic processes
examined might not be sufficient to explain the transgenerational effects observed.
Thus, these data highlight the need for more in-depth epigenetic studies, such as looking at
other types of epigenetic alterations and at changes taking place on the sperm of the EDC-
exposed rats. Overall, the data unveiled epigenetic changes that are likely part of the mechanisms
leading to adverse effects, but they provide only partial responses and highlight the need of
including the evaluation of low doses and mixtures, as well as the study of non-classical endpoints
in toxicology and risk assessment.

53

Introduction
Humans are exposed throughout life to multiple endocrine disrupting chemicals (EDCs), which
mimic hormones or alter their functions (Gore et al, 2015). Together, these chemicals induce
deleterious effects at low doses that otherwise may not have effects (Walker et al, 2020; Iwafuchi-
Doi et al, 2016). Due to placental transfer, developing fetuses are exposed to EDCs (Horisawa et
al. 2020). Epidemiological studies have shown strong correlations between perinatal exposure to
EDCs and subsequent male reproductive pathologies, including infertility (Schugg et al, 2016;
Sharpe et al., 2008). Alarmingly, sperm counts in otherwise healthy men around the world have
decreased steadily between 1973 and 2011 (Behr et al., 2007). Indeed, 40% of men are now
estimated to have sperm counts in the subfertile range. Perinatal exposures to environmental
chemicals are considered to play significant roles in this trend (Skakkebaek et al., 2016), Gore et
al., 2017; Lee, 2018; UNEP/WHO, 2013). Moreover, recent studies have demonstrated that
sperm can transfer epigenetic alterations to subsequent generations (Gore et al, 2015). Animal
model studies have advanced our understanding of the mechanisms mediating EDC effects.
However, most studies have used exposures to single chemical at doses far higher than those
encountered by humans, making their relevance to human health questionable. Thus, there is an
urgent need to study the impact of low dose EDC mixtures (mix). Studies have also reported
alterations in the epigenome of the sperm of infertile men exposed to EDCs and have linked this
to decreased fertility. Epigenetics is the study of heritable changes that occur to an organism that
affect the phenotype without affecting the underlying genotype ((Berger, Kouzarides, Shiekhattar,
& Shilatifard, 2009)). Epigenetic remodeling processes take place from PGCs to neonatal
gonocytes, with first the erasure of parental DNA methylation marks in PGCs, followed by active
DNA remethylation in fetal to neonatal gonocytes; conferring new and unique DNA methylation
patterns, regulating the silencing of transposons and genes, genomic imprinting and X inactivation
(Engel, et al., 2006; Latini et al., 2003). Extensive chromatin remodeling in histone methylation
and acetylation patterns is part of these early epigenetic changes, as well as the expression of
54

non-coding and piRNAs regulating transposon and gene expression (Latini et al., 2003; Silva et
al.,2004). Thus, early germ cells are sensitive to any disruption of the enzymes regulating these
processes and the sources of methyl or acetyl groups (Latini et al., 2003). I will use morphological
parameters and gene expression patterns (Manikkam et al, 2013; Chang et al., 2000; Culty et al.,
2013; Manku et al., 2015; Motallebipour et al., 2009; Yaman et al., 2006) to determine the impact
of EDC on germ cells.

Effects of exposure to single EDC on testis development and function. The association between
estrogenic or anti-androgenic EDCs and reproductive disorders in wildlife and experimental
animal models has been known for years (Gore et al, 2015; Schugg et al, 2016; Sharpe et al.,
2008; Skakkebaek et al., 2016; Yang et al., 2015). In animal studies, perinatal exposure to high
estrogen affects reproductive tract development (Sharpe et al., 2008; Ni et al, 2016; Pattabiraman
et al., 2015; Mu et al., 2017). Neonatal exposure to GEN delayed spermatogenesis and induced
infertility in rats (Mu et al., 2017). Poor sperm quality in subfertile Japanese men correlated with
higher levels of soy isoflavone urinary metabolites, suggesting a link between soy product
exposure and low sperm quality (Tang et al, 2011). GEN was shown to impair T production by
fetal Leydig cells via Erα (Singh et al., 1975), and to behave as an androgen receptor (AR)
modulator in testis (Degen et al., 2002). Using the Sprague Dawley (SD) rats, we showed that
fetal exposure to GEN and to bisphenol A (BPA) induced short-term increases in PDGFR
signaling and HSP90 in neonatal gonocytes, and altered prepubertal spermatogenesis and Leydig
cells (Reagan-Shaw et al., 2007; Bose et al., 2017; Fok et al., 2017). GEN and BPA mimicked E2
in neonatal gonocyte proliferation in vitro (Rajapakse et al., 2002). Both EDCs can affect histone
methyl transferase via different nongenomic ER signaling in female reproductive tissues (Manku
et al., 2016). These studies suggest that GEN could alter signaling pathways and reprogram the
epigenome in the testis, potentially changing cell responses to other EDCs. It should be noted
that data on GEN’s reproductive effects suggest that low levels alone will not induce long-term
55

effects on male reproduction (Rozman et al., 2006).
Phthalate plasticizers are omnipresent in the environment and human biological fluids (Nardelli
et al., 2017). Epidemiological reports suggest a causative relationship between phthalate
exposure and reproductive disorders in children of women exposed in utero (Hermo et al., 2010,
Johnston et al., 2008; Siril et al., 2000). We and others reported that perinatal exposures to high
phthalate doses exert short and long-term effects in male, disrupting the function and
development of Leydig, Sertoli and germ cells (O’Flaherty et al., 2012; Prentice et al., 2019;
Lagarrigue et al., 2011; Sakai et al., 2015; Manku et al., 2015). Despite their anti-androgenic
properties, phthalates do not bind to AR; and while some phthalates have weak estrogenic
properties, this is not the case for DEHP (Nardelli et al., 2017). We found that, in the fetus,
phthalate-induced decrease in T formation is mediated by reduced expression of steroidogenesis-
related genes, but not in the delayed effect found in the adult (O’Flaherty et al., 2012; Prentice et
al., 2019; Sakai et al., 2015)). At high doses, DEHP also induce epigenetic alterations in mouse,
associated with cryptorchidism in F1, F2, but with return to normal testis phenotype in F3 and 4
(Manku et al., 2015).
A study using organ cultures of human fetal testes reported deleterious effects of the DEHP
metabolite MEHP on fetal Leydig cell T production (Patel et al., 2010). However, high doses of di-
butyl-phthalate (DBP) did not alter T production by human fetal testis xenografts implanted in
nude mice, suggesting that, unlike DEHP, human fetal Leydig cells are not sensitive to DBP (Lu
et al., 2019; Chou et al., 2019). DBP and DEHP induce different changes in the gene expression
profiles and morphology of fetal testes although they both repress fetal T production, suggesting
that they act through different mechanisms (Lagarrigue et al., 2011; Brouard et al., 2019). As with
DEHP in rat, DBP induces the formation of multinucleated gonocytes both in human and rat
xenografts (Chou et al., 2019). These data suggest that DEHP effects on germ cells and T
production are distinct (Horisawa et al., 2020). The xenoestrogen diethylstilbestrol (DES) did not
affect T production by human fetal Leydig cells in testis xenografts implanted into nude mice
56

(Manku et al., 2012). Similarly, DES did not affect T levels in organ cultures of human fetal testes,
in stark contrast to the inhibitory effects of BPA on T and INSL3 levels, indicating that human fetal
Leydig cells are sensitive to BPA but not DES (Wang et al., 2012). These studies suggest that
the deleterious effects of DES on the human male reproductive system (Schug et al., 2016) are
independent of fetal T levels. Our in vivo studies showed that GEN and BPA at 0.1 and
1mg/kg/day respectively exerted comparable and transient effects on gene expression and
signaling pathways in germ cells (Rajapakse et al., 2002, Reagan-Shaw et al., 2007; Bose et al.,
2017; Fok et al., 2017). GEN and BPA impaired junctional proteins through different mechanisms,
leading to impaired fertility (Papadopoulos et al., 1985; Zhang et al., 2016). These studies
highlight how related EDCs can induce the same functional outcomes through different
mechanisms,
Effects of perinatal exposure to EDC mix on male reproductive system. Exposure from
conception to adulthood to the combination of GEN and the AR antagonist pesticide vinclozolin
(1 mg/kg/day each) induced changes in gene expression different from exposure to chemical
alone (Li et al., 1997). Fetal exposures to anti-androgenic mixtures (AR antagonists and
phthalates) exerted cumulative effects on male reproductive development, leading to
hypospadias and gubernacular and epididymal agenesis, events not observed, or minimal, with
single compounds (Manku et al., 2012). Chronic co-exposure to GEN and vinclozolin reduced
epididymal sperm numbers and litter sizes (Papadopoulos et al., 1997). A mixture of BPA, DEHP
and DBP induced reproductive disease and obesity in a transgenerational manner (Manku et al.,
2016). We showed that GEN and BPA mix affected in vitro gonocyte proliferation (Rajapakse et
al., 2002). In yeast, xenoestrogen mix enhanced E2 effects (Marcon et al., 2011). Cumulative
effects also apply to antiandrogenic chemicals, inducing reproductive effects at doses that were
not expected to have deleterious effects (Culty et al., 2009).
57

Our previous studies on fetal exposure to low dose EDCs revealed adverse testicular phenotypes
supporting the hypothesis that both somatic and germ cells are targeted by EDC mix, likely
disrupting their interactions and subsequently perturbing spermatogenesis, resulting in infertility
(Jones et al., 2014; Jones et al., 2019) Levels of circulating testosterone and 17β-estradiol were
measured in adult PND90 male rat testis. We found that testosterone was decreased by 35% in
testes exposed to a mixture of genistein and DEHP (Gen+DEHP) at 0.1mg/k/day, and
testosterone at 10mg/kg/day showed an increasing trend (Walker et al., 2020). These data
suggest that fetal exposure to Gen+DEHP mix results in alteration of Leydig cells in the adult.
In the present study, we examined the reproductive functions of F1, F2 and F3 generations
and the possibility of epigenetic changes in their testes. Compared to control and single EDC
exposure, we observed increased infertility, higher number of abnormal testes and small litters
sired by the F1 rats exposed to GEN+DEHP mix, and by their descendants, more pronounced in
F2 and F3 generations. There was no difference between control rats from mothers fed with soy-
based or casein-based rat chows (not shown), suggesting no effect from maternal diet alone. Out
of all F1 to F3 controls in both diets from several cohorts (66 rats), only 2 F2 rats (3%) were
infertile with one abnormal testis. These results indicated worse outcomes following exposures to
GEN+DEHP mix, and stronger phenotypes with the lower dose of 0.1 mg/kg/day for infertility. The
retention of reproductive adverse phenotypes in F2 (intergenerational) and F3 (transgenerational)
generations suggests germline-transmitted epigenetic remodeling in EDC exposed rats. The
results identified several epigenetic-related processes altered in F1 rats, but most were
normalized in F2 and F3 generations. Thus, the study provides partial responses, indicating that
more studies will be needed to establish clear mechanistic relationships between the alterations
observed in F1 offspring and similar phenotypes found in subsequent generations.

58

Materials and Methods
Animal Treatments and Tissue Collection
Timed pregnant Sprague-Dawley rats were purchased from Charles Rivers Laboratories
(Saint-Constant, QC, CA) and switched to a casein-cornstarch–based, phytoestrogen-free diet
(casein diet) AIN-93G (Teklad diet; Envigo) from 2 days before gavage to weaning, to avoid further
dietary exposure to genistein. The rats were maintained on a 12L:12D photoperiod with ad libitum
access to food and water and handled according to protocols approved by the McGill University
Health Centre Animal Care Committee and the Canadian Council on Animal Care. The pregnant
rats were treated by gavage from gestational day 14 (GD14) to parturition with either vehicle (corn
oil) alone or containing GEN or DEHP (abbreviated as G and D in figures), or GEN-DEHP mix
(abbreviated as G + D in figures), at the doses of 0.1 and 10 mg/kg/day (doses abbreviated as
0.1 and 10 in figures). The doses were adjusted to changes in dam weights. These doses were
selected based on our previous dose response studies of in utero exposure to genistein or DEHP
used separately and together.32-36 The inclusion in the studies of control animals maintained on
normal soy-based diet showed that there was no significant difference in the general health and
food consumption of dams fed with soy-based chow or casein diet (data not shown). Moreover,
the diets did not affect the health, reproductive function, testis transcriptome and fertility of the
offspring of control rats, suggesting no effect from maternal diet alone (data not shown). Adult
offspring were mated at PND90 to assess their fertility and litter size when applicable. Offspring
were weighed and euthanized at PND3, 90 or PND120. Blood was collected via cardiac puncture,
and the plasma was separated and stored at −80°C for testosterone (T) and 17β-estradiol (E2)
measurements. The testes were collected, weighed, and either fixed in 4% paraformaldehyde or
snap frozen to assess their development and function, using morphological examination, and
gene and protein expression analyses.
59

Steroid Quantification
The levels of circulating testosterone and estradiol in PND90 rats were quantified by
radioimmunoassay as previously described (n = 6 per condition)
Immunohistochemistry
Testes fixed in 4% paraformaldehyde were embedded in paraffin and cut into sections of
5 μm, used for histological and immunohistochemical analysis as previously described.39,40
Briefly, tissue slides were dewaxed, rehydrated, and treated for target antigen retrieval (Dako
products by Agilent), and processed for immunostaining using primary antibody incubation
overnight at 4°C, followed by an incubation with the appropriate secondary antibodies. Non-
specific IgG was used as negative control. Primary antibodies for 5-methylcytosine (Epigentek),
and H3K9me3 (Millipore) were used at a dilution 1:100. The secondary antibodies were Biotin
Goat Anti-Rabbit (BD Pharmingen) and Biotin Goat Anti-Mouse (BD Pharmingen). Next, the slides
were incubated with streptavidin coupled horseradish peroxidase (HRP) (Invitrogen Thermo
Fisher Scientific) and a final colorimetric reaction with AEC Chromogen solution (Thermo Fisher),
producing red precipitates at the target protein location. The sections were counterstained with
Mayer's hematoxylin (Invitrogen), coverslips were applied, and pictures were taken with an
Olympus microscope. Morphological observations were performed on sections stained with
hematoxylin and eosin solution (Vector Laboratories Inc), as well as by observing the tissue
morphology of sections used for IHC analysis.
RNA extraction and quantitative real-time PCR
RNA was extracted from testes using a Nucleospin RNA XS Kit (Takara Bio USA) and
digested with DNase I (Qiagen). Complementary DNA was synthesized using the transcriptor
synthesis kit (Roche Diagnostics). Quantitative real-time PCR (qPCR) was performed as
60

previously described with a LightCycler 480 using SYBR Green Supermix (BioRad), a Master Mix
kit (Roche Diagnostics). Glyceraldehyde-3-phosphate dehydrogenase was used as reference to
normalize gene expression. A minimum of three to eight male offspring from different litters were
assessed in triplicate. The comparative Ct method was used to calculate relative gene expression.
Primers specific for the genes of interest were designed with the NCBI Primer Design Database.
Statistical analysis
Statistical analysis was performed using one-way ANOVA with post hoc Dunnett's test for
the analysis of general health parameters, or unpaired two-tailed Student's t test for qPCR data
analysis, using the statistical analysis functions in GraphPad Prism 7.04 program (GraphPad Inc).
Because the two chemicals used are structurally unrelated and are known to have different
molecular targets, they are not expected to have similar effects, and unpaired two-tailed Student's
t test was used to determine the statistical significance between each control-EDC pair for qPCR
analysis. Gene array analysis was performed on three independent N (one offspring used per
dam) per treatment condition, using the ANOVA application from the bioinformatics Partek
platform. General health parameters were determined on all rats. Fertility was assessed using 8
to 9 offspring from different litters per treatment condition. For qPCR analysis, the results are
presented as mean ± SEM of fold changes relative to vehicle control. Experimental points were
performed in triplicate for each sample, from 3 to 6 rats from different dams per treatment
condition. Histological assessment and IHC were done on at least three independent offspring
per treatment. Asterisks indicate a significant change relative to control, with P values ≤ .05
considered statistically significant.

61

Results

Previously we reported that F1 adult rat testes exposed in utero to Gen+DEHP had
phenotypic abnormalities including small testis and infertility ((Walker et al., 2020). In the same
study we found that rates of infertility were increased in the F2 generation with most of the infertility
observed in rat testis exposed to the Gen+DEHP mix and DEHP alone. Here we observe that F1
testis exposed in utero and F2 testis exposed as germ cells within the F1 testis, are altered by
exposure to 10mg/kg/day of EDCs. Specifically, we see that the interstitial space is perturbed in
F1 testis exposed to genistein and in F2 testis this effect was more dramatic in that the interstitial
space is perturbed in addition to the shape of the tubules being altered along with the apparent
absence of the lumen. Here we also show that F1 testes exposed in utero to DEHP show an
apparent Sertoli only phenotype along with the Gen+DEHP mix. Though F2 testis were exposed
indirectly, here we observe that the Gen+DEHP mix resulted in infertility as shown by a lack of
germ cells and interstitial space. These data suggest that EDCs can adversely affect F1 and F2
rat testis. Not shown, we also saw altered morphology in F1 and F2 testis exposed to
Figure 13. EDCs Alter Testicular Morphology in F1 and F2 Adult Rat Testis. Effect of in Utero
exposure to Genistein (G) DEHP (D) and the mixture (G+D) on PND120 testes of rats exposed in
utero with doses of 10mg/kg/day on testis morphology in two generations (A) F1 rats were exposed
in utero. (B) F2 generation was exposed as fetal germ cells, which did eventually differentiate to
form spermatozoa that fertilized an egg. Representative examples are shown.
A
B
62

0.1mg/kg/day which further points to a need to study the effect of low dose EDC mixtures on
transgenerational inheritance.

We used radioimmunoassay to assess the levels of serum testosterone in F1, F2, and F3
rat testis exposed directly or indirectly with EDCs. While decreases from control were observed
for F1 rat testes exposed to EDCs at the lowest dose of 0.1mg/kg/day, we found that the only
statistically significant decrease was observed for the Gen+DEHP mix. In F2 rat testes we
observed more dramatic decreases with Gen, DEHP and the mix being statistically significantly
decreased at the lowest dose of 0.1mg/kg/day. However, this effect appeared to be recovered in
F3 rat testes.

Figure 14. EDCs Affect Testosterone Production in Adult Rat Testis Inter and Transgenerationally. Effect of in
Utero exposure to Genistein(G) DEHP (D) and the mixture (G+D) on PND90 testes treated with two doses of
0.1mg/kg/day and 10mg/kg/day on Testosterone production in three generations RIA, A) rats were exposed in
utero F1, B) F2 generation is exposed as a germ cell in F1 rats C) F3 exposed indirectly via the F2.
A. B.
C.
63

Next, we wanted to determine the role of epigenetics in the transgenerational EDC-
induced testicular alterations in my samples. 5methylcytosine is used as a marker for
modifications of genomic DNA. Here we used immunohistochemistry to determine whether DNA
methylation patterns were altered in F1 adult rat testis. We found that rat testes exposed to DEHP
at the 0.1mg/kg/day dose had a decreased signal whereas DEHP at the 10mg/kg/day dose had
an increased signal in germ cells sloughing in the lumen. The Gen+DEHP mix at the 0.1mg/kg/day
dose appeared to have slight decreases in cells of the seminiferous tubules whereas Gen+DEHP
at the 10mg/kg/day dose was infertile. I also found that Gen at the 10mg/kg/day had a decreased
signal. These data suggest that DNA methylation patterns are altered in testis exposed in utero
to EDCs.

Figure 15. EDC Exposure Alters 5methylcytosine in Adult Rat Testes. DNA methylation changes in F1 rats
from F0 dams gavaged with vehicle (Ctrl), GEN (G), DEHP (D) or GEN-DEHP mix (G+D) at 0.1 or 10
mg/kg/day. Patterns of 5meC signal show examples of abnormal phenotypes. Filled arrow: germ cell
sloughing in lumen;* tubules with Sertoli cell-only appearance; white arrow: reduced 5meC signal.↓ Arrow
pointing at decreased signal in the interstitium.
64

Figure 16. Gen+DEHP Alters Genes Related to DNA Methylation. Interaction Network from IPA shows
genes related to DNMT3A that are differentially expressed in F1 rat testes exposed in utero to
10mg/kg/day of Gen+DEHP mix.
65

In the previous figure I showed that 5meC patterns were altered in testis exposed in utero
to EDCs (Figure 15). I then wanted to determine whether genes related to DNA methylation were
also altered. DNA methyltransferase enzymes including DNMT3a, DNMT3B, DNMT1 and DNMTL
are responsible for catalyzing DNA methylation within germ cells. DNMT3a and DNMT3b are
responsible for de novo methylation with the establishment of epigenetic marks in gonocytes at
GD13. I used Ingenuity Pathways Analysis to generate a network of genes that are related to
DNMT3a. While DNMT3a was not specifically found to be differentially expressed in my dataset,
I did find that 18 genes related to DNMT3A in my dataset were altered. I found that TET
Methylcytosine Dioxygenase 1 (TET1) was the most upregulated gene in the dataset. The family
of TET enzymes are responsible for DNA demethylation ((Rasmussen & Helin, 2016). TET
enzymes are hypothesized to be critical for the development of the sperm methylome and it was
found that dysregulation of proper mRNA and protein expression levels of TET1 throughout
spermatogenesis have been associated with male infertility (Ni et al.). These data combined
further confirm my hypothesis that DNA methylation is altered upon exposure to EDCs in the F1
generation. This alteration of DNA methylation patterns in the F1 may also contribute to the
increased dysregulation shown in the F2 generation.

66

F1
F2
F3
Figure 17. 10mg/kg/day exposure of EDCs affect genes involved in Epigenetic processes. qPCR assessing
genes involved in DNA methylation, histone modifications and chromatin remodeling. N=3 rats per treatment.
67

Discussion
While most studies on EDC mixtures used chemicals targeting the same signaling pathway or
downstream biological response, such as those targeting androgen function, a few studies
explored the consequences of simultaneously disrupting estrogen and androgen homeostasis.
Among those, the chronic exposure of rats from conception to adulthood to a mixture of the
phytoestrogen genistein and the antiandrogen pesticide vinclozolin at 1 mg/kg/day each was
reported to alter gene expression differently from each EDC alone and to reduce epididymal
sperm numbers and litter sizes (Eustache et al. 2009). More recently, intraperitoneal injections
from gestation day (GD) 8 to 14 of a mixture of three plastic-derived EDCs, BPA, DEHP, and DBP
(at 50, 750, and 66 mg/kg/day respectively) was shown to induce reproductive disease in the F3
generation males, including decreased seminal vesicle weight indicating developmental androgen
deficit, azoospermia, atretic or vacuolized seminiferous tubules, spermatogenic cells sloughing
and increased apoptosis, as well as increased obesity, along with changes in the DNA methylation
profile in sperm (Manikkam et al., 2013). Even though the effects of the individual EDCs were not
evaluated and DEHP was used at a high dose, these findings highlighted the importance of
including transgenerational studies when evaluating EDC toxicity on male reproduction
In previous studies, we examined the effects of GEN and DEHP mix at 10 mg/kg/day, a dose
corresponding to the high range of human exposure for both chemicals (6,81,90), and at a dose
of 0.1 mg/kg/day (Walker Andrology 2020). These studies showed that GEN+DEHP mix exerted
effects distinct from those of single EDCs on the testicular transcriptome, targeting somatic and
germ cell genes in neonatal and adult testis (8,9). We then tested a lower dose of 0.1 mg/kg/day
of GEN and DEHP, using a casein-based diet to prevent additional exposure to GEN from the
diet. This study revealed how even at a 100-times lower dose, the mixture of GEN+DEHP was
capable of exerting adverse effects on male reproduction and testicular function, including
testicular macrophages ((Walker et al., 2020)).
68

DNA Methylation (TET1 and DNMT3A)
Epigenetics is the study of heritable changes that affect an organism without changes to the
underlying DNA sequence. A few epigenetic processes include DNA methylation, histone
modifications and chromatin remodeling. DNA methylation is a process which occurs when
enzymes known as DNA methyltransferases add cytosines to CpG dinucleotides. DNA
methylation is a highly regulated process that is needed for proper acquisitioning of epigenetic
marks throughout germ cell development leading to normal spermatogenesis. DNA methylation
patterns are erased during early embryogenesis and are reset after implantation (Wu et al). De
novo DNA methylation begins in gonocytes before birth and ends before the end of the pachytene
stage occurring during the spermatogenic cycle (Xu et al). DNA methylation patterns must be
maintained throughout mitosis occurring in spermatogonia and spermatocytes. X chromosome
inactivation, transposon silencing and genomic imprinting are all processes that rely on proper
DNA methylation in the male (Wu et al). There are a number of DNA methyltransferase enzymes
that play a role in ensuring this process is carried out efficiently, including DNMT1 responsible for
maintaining epigenetic marks, DNMTL which has no catalytic activity but is required as a cofactor
for DNMT3a and 3b which are catalytic enzymes.
DNMT3a has been found to be the main catalytic enzyme involved in de novo methylation and
critical for normal spermatogenesis and reproductive function of testes. Spermatogenesis is the
process by which male germ cells undergo meiosis to produce mature sperm. Sperm epigenetic
marks are acquired during early spermatogenesis and are crucial for DNA to be packaged and
processed in order to be passed down to the subsequent generation. The erasure of epigenetic
marks and subsequent de novo methylation is critical to ensuring that DNA is packaged correctly
in order for this process to occur. DNA methylation and histone modifications are key epigenetic
processes required for the gene silencing and activation needed for epigenetic reprogramming.
DNA methylation is a process by which a methyl group is added to a DNA molecule. When this
69

occurs within the promoter sequence of a gene, such as the addition of a methyl group to a CpG
island it is said to be hypermethylated and can alter the state of transcription. There are a number
of DNA methyltransferase enzymes which aid in the process that catalyze the methylation of
cytosines located within CpG islands of promoter regions of genes including DNMT1 which is a
maintenance enzyme and DNMT3a and 3b which are associated with de novo methylation
(Nettersheim). The process of DNA methylation is widely accepted however the process of
demethylation is not as well understood. DNA demethylation is needed first in order for de novo
DNA methylation to occur (Ni et al).
Two genes that have been identified as important for DNA methylation that we have identified
in our study include DNMT3a and TET1. Currently, DNA methyltransferase 3a (Dnmt3a) has been
identified as a member of the DNA methyltransferase 3 family that is responsible for de novo DNA
methylation at unmethylated cytosines occurring during embryonic development (Xu et al). Wu
and colleagues found that in rat Dnmt3a gene expression was abundant before birth and had
highest expression at 18 days post coitum. They also noted that Dnmt3a protein expression in rat
was most abundant in newborn pups and gradually decreased after birth. Immunolocalization
showed that Dnmt3a was expressed weaker in germ cells than in somatic cells in fetal testis, yet
in adult testis Dnmt3a was detected in spermatogonia and spermatocytes. There are two
identified transcripts for Dnmt3a including Dnmt3a1 and Dnmt3a2. Dnmt3a1 may play a role in
affecting genes at promoter sequences and silencing chromosomal domains while Dnmt3a2 may
be responsible for de novo global methylation. Overall, Dnmt3a was found to have high
expression during the perinatal period in rat which occur between 15dpp and birth (during the
time when male germ cells undergo global methylation) (Xu et al). After studies in germ cells,
Yaman and colleagues found that Dnmt3a was needed for meiosis in the male. Further studies
have identified a delay in the onset of meiosis in mice homozygous null for the Dnmt3a allele. In
these mice some of the cells were able to enter meiosis, yet get delayed at a checkpoint and then
70

can proceed through the rest of the process normally (Yaman et al). Previous studies have also
found that Dnmt3a Cre floxed adult mice testes lacked spermatocytes (Yaman et al). Furthermore,
abnormal DNA methylation occurring in the H19 gene region (a paternally imprinted region)
induced male infertility (Zheng et al). It has also been shown that environmental factors can play
a role in altering DNA methylation and other epigenetic patterns, and that these can be passed
on to subsequent generations (Zheng et al). However, it is not clear exactly how this process
occurs. Shi and colleagues found that bisphenol exposure stimulated Dnmt3a and Dnmt3b in
neonatal testes, but this effect was not seen in the adult testes. Wei and colleagues found that
bisphenol A (BPA) exposure reduced the mRNA expression levels of Dnmt3a in weaning and
sexually mature offspring. Although many studies have shown the effects of various endocrine-
disrupting compounds on epigenetic regulation in the testis, few have elucidated these effects on
testes exposed in utero to EDC mixtures at environmentally relevant doses. Our data show that
DNMT3a mRNA expression was decreased in F1 adult rat testes exposed in utero to 10mg/kg/day
of a mixture of Genistein and DEHP. This effect was also seen in testes exposed to genistein
alone yet it was not as dramatic as in the mixture. However, in F2 adult rat testes exposed in
utero to 10mg/kg/day there was an increasing trend from control which could suggest a
compensatory mechanism occurring from the decrease that was shown in the F1. In F3 adult
testes, DNMT3a gene expression from any treatment did not vary significantly from control. Based
on our findings in the F1, F2 and F3 adult testes these data suggest that intergenerational
inheritance may be involved in EDC-induced DNMT3a expression, however transgenerational
inheritance of EDC-induced DNMT3A pattern alterations may be less likely.
Ten-eleven translocation 1 (TET1) plays an important role in DNA methylation and epigenetic
modifications (Zheng). Tet family members 1-3 were first identified for their role in converting 5-
methylcytosine into 5-hydroxymethyl aiding in the process of active DNA demethylation and TET1
has been found to be the main enzyme responsible for catalyzing this process (Nettersheim).
71

TET1 is expressed in numerous cell types including embryonic stem cells, neuronal cells, brain
tissue and primordial germ cells where it plays an important role in the erasure of epigenetic marks
(Zheng). Tet enzymes are hypothesized to be critical for the development of the sperm
methylome. Dysregulation of proper mRNA and protein expression levels of TET1 throughout
spermatogenesis have been associated with male infertility (Ni et al.). TET1 mRNA was identified
in pachytene spermatocytes and in Stage I round spermatids up to Stage IV elongating
spermatids in human (Ni et al). Ni and colleagues also identified Tet family members (including
TET1 RNA and protein) in sperm ejaculate and identified that levels of Tet family members mRNA
were decreased in sub-fertile men. Additionally, TET1 is associated with H3K9 and H3K27, two
histone marks needed for gene repression (Zheng). Through qRT-PCR the Zheng group found
that dairy goat testis expressed low levels of TET1 and through immunocytochemistry they were
able to localize TET1 in the seminiferous tubules of adolescent and adult goats (signal was weak),
however TET1 protein expression was found abundantly in adult goat spermatogonia.
Furthermore, their study identified changes and similar expression patterns between TET1 and
its derivative 5-hydroxymethylcytosine in goat testis across different ages, which further confirms
the major role of TET1 in the process of DNA demethylation as testicular maturation and
spermatogenesis occur. Tet dioxygenases have been identified as playing a critical role in
initiating active DNA demethylation, and decreased expression in Tet genes can lead to DNA
hypermethylation (Benesova et al). High TET1 and TET2 expression have been identified in
primordial germ cells that are undergoing migration, and TET1 and 5-hydroxymethylcytosine have
been found to play an extensive role in DNA demethylation required for epigenetic programming
in gonadal primordial germ cells. (Benesova).
We have identified TET1 as a gene that is upregulated in adult F1 rat testis exposed in utero
to 10mg/kg/day of a mixture of Genistein and DEHP. Few studies have elucidated the effects of
endocrine-disrupting compounds on epigenetic processes however these were not done with
72

EDC mixtures at environmentally relevant doses. Upregulation of TET1 in rat testes by Gen-
DEHP may be indicative of changes in DNA methylation patterns in adult rat testis. Our IPA data
show that TET1 is also related to POU class 5 homeobox 1 (POU5F1) also known as Oct3/4
which is an important transcription factor needed for maintaining pluripotency of germ cells in the
gonads. In our dataset POU5F1 was decreased by 40% according to IPA in Gen+DEHP exposed
adult F1 rat testes while TET1 was increased 2-fold. These data suggest that Gen+DEHP in utero
exposure may induce an inverse relationship between TET1 and POU5F and further point to
changes in the epigenetic state of germ cells in the adult testis.
Histone Modifications (BRWD1 and Ezh1)
Histone modifications are another type of epigenetic mechanism. Histones are a family of
proteins that wrap around DNA to form a nucleosome. These processes are needed in order to
compact the DNA so that it can fit into the nucleus. When histones are wrapped tightly around
DNA it is said to be in a heterochromatic state. Whereas, when histones are bound loosely in a
relaxed state it is referred to as euchromatin. In order for transcription to occur histones and DNA
must be in the euchromatic state. Four main types of histones have been identified including H2A,
H2B, H3 and H4, each of which can be modified in at least one of the following ways: methylation,
acetylation, phosphorylation, ubiquitylation or sumoylation. Each of these modifications results in
either gene activation or repression. Additionally, it has been found that histone methylation is
crucial during spermatogenesis. In the present study we have identified two genes related to
histone modifications that have been disrupted by low dose EDC mixtures and may play a role in
testicular morphology. The two genes we have identified include Brwd1 and Ezh1.
Bromodomain-containing proteins have been found to interact with regions of chromatin that
are hyperacetylated at lysine residues. Brwd1 is a part of the bromodomain-containing proteins
and its elimination has been shown to disrupt gametogenesis (Pattabiraman et al. 2015). Based
on the qPCR data from our current study we found that in F1 adult rat testes exposed at
73

10mg/kg/day of a mixture of genistein and DEHP that Brwd1 mRNA expression was decreased.
This effect was not seen for genistein alone or DEHP alone. For the F2 adult rat testes at the
same dose we found an increasing trend from each of the treatments as compared to the control.
As for the F3 adult testes, Brwd1 mRNA expression showed increases in Gen-DEHP mixture and
DEHP alone, whereas genistein was decreased from control. These data could suggest that EDC
exposure affects at least one member of the bromodomain-containing family in turn altering
histone modifications in testis. Furthermore, since our study was done on whole testis extracts
and it has been previously been shown that Brwd1 knockout can affect gametogenesis, the data
presented in this study could point to EDC alterations and changes in histone acetylation in germ
cells.
Ezh1 is a gene that codes for the Ezh1 protein which has been identified as being involved in
the polycomb repressive complex 2 in the testes and is partly responsible for catalyzing the
methylation of histone H3 lysine 27 (Mu et al 2017). This epigenetic mark has been found to be
important for spermatogenesis. A study by Mu et al found that Ezh1 was highly expressed in adult
testis tissues specifically in mitotic germ cells and pachytene spermatocytes. In Ezh1 knockout
mice meiotic arrest was apparent in addition to depletion of spermatocytes in seminiferous tubules
(Mu et al). Studies have also found that although Ezh1 works in complex with Ezh2 that Ezh1 is
sufficient to establish and maintain the epigenetic repressive marks needed to silence somatic
cells and stages of germ cells in the testis. Our data show that in F1 testis exposed in utero to our
EDC’s in this study that Ezh1 was decreased in testis exposed to the Gen-DEHP mix, genistein
and DEHP alone however the most significant decrease was with Gen-DEHP mix. Ezh1 mRNA
expression in F2 testis expressed a similar trend as was observed in the F1 with Gen-DEHP mix
expressing the most significant decrease from control whereas there was no difference between
genistein and control, and an increase seen in DEHP compared to control. However, in the F3
testis we observed that Ezh1 gene expression was increased in Gen-DEHP and DEHP testis but
74

was significantly decreased in genistein testis. These data suggest that EDC exposure in a parent
generation can affect genes involved in the regulation of histone marks and can thus affect
spermatogenesis in offspring.
Chromatin Remodeling (ATRX and MOV10L1)
Chromatin remodeling is another well described epigenetic mechanism. Two differentially
expressed genes identified in our dataset that are related to chromatin remodeling include ATRX
and MOV10L1. The alpha thalassemia, mental retardation, X-linked gene (ATRX) codes for a
protein that has been found to associate with DNMT3L and DNMT3a to form a plant
homeodomain that is found in chromatin-associated proteins (Bagheri-Fam et al). ATRX may play
a number of roles in the testis including involvement in steroidogenesis and cell division. ATRX
protein is expressed throughout development and ATRX syndrome is characterized by a defect
in development mostly affecting male children and young adults. Phenotypic anomalies
associated with ATRX syndrome include mental retardation and genital abnormalities, small
penis, and hypospadias (Tang et al, Bagheri-Fam et al). Testes histology from ATRX-syndrome
affected testes show poor formation of testis tissue and scattered seminiferous tubules lacking
germ cells. Studies from Bagheri-Fam et al showed that after immunohistochemistry for ATRX
studying mouse testicular development found that ATRX protein is present in all testicular cells at
embryonic day 14.5 however the strongest expression was in Sertoli cells. As they followed
mouse testis development, they found that ATRX protein continued to be expressed in Sertoli
cells throughout sexual maturation and adulthood, however ATRX expression in germ cells was
decreased after E17.5. ATRX has been found in the nuclei of Sertoli and peritubular myoid cells,
slightly in Leydig cells and in early stages of germ cells but not in larger pachytene spermatocytes
or post-meiotic cells.
Analysis of testis from an ATRX patient showed decreased numbers of seminiferous tubules
expressing a majorly Sertoli cell phenotype, and completely lacking germ cells (Tang et al). These
75

data suggest that ATRX protein expression ceases as meiosis progresses (Tang et al). More
studies suggest that ATRX may be important for testicular development due to the fact that
patients with ATRX syndrome do not fully masculinize. Previously it has been found that a large
proportion of mutations in the ATRX gene are associated with genital abnormalities including
undescended testis and ambiguous genitalia. In patients with ATRX syndrome, ATRX protein has
been found highly expressed in Leydig cells and may have an adverse effect here seeing as that
patients with pseudohermaphroditism fail to produce normal amounts of testosterone. This
suggests that ATRX may be associated with steroidogenesis (Tang et al). ATRX has been found
to play a role in both somatic and germ cells in the adult testis and was found to colocalize with
chromatin, however the exact mechanism of action linking ATRX to previously described
phenotypes is unclear. In testis, ATRX may be associating with testis-specific transcription factors
working together to affect chromatin. Endocrine disruptors have been found to play a role in
abnormal testis development. The current study outlines the effects of in utero exposure to
10mg/kg/day of Gen-DEHP mix in F1, F2 and F3 rat testis. Gene expression data from our study
found that for ATRX in F1 testis exposed in utero to 10mg/kg/day of genistein and DEHP alone
were decreased from control, and testis exposed to Gen-DEHP mix had the most significant
decrease from control. In F2 testis, ATRX gene expression was decreased in testis exposed to
genistein alone and Gen-DEHP mix. In F3 testis, there was no difference in ATRX gene
expression between any of the treatments and control. These data suggest that EDC’s can
contribute to ATRX downregulation in F1 rat testis. However this effect was decreased as testis
were further removed from the initial exposure.
Moloney leukemia virus 10 like 1 (MOV10L1) has been identified in germ cells and pachytene
spermatocytes (yet absent in spermatids) and was found to be important for spermatogenesis
(Zhu et al). MOV10L1 gene expression was similar to that of the Mili gene when studied in
postnatal mouse testis. Mili and MOV10L1 are critical for piRNA synthesis and function and
76

encoding an RNA helicase. MOV10L1 male knockout mice were sterile due to the absence of the
MOV10L1 protein. These testis also exhibited reduced testis size and weight. MOV10L1 has also
been found to be associated with retrotransposon repression. piRNA’s have been found to be
associated with biogenesis genes and infertility however piwi and piRNA complexes have yet to
be elucidated. MOV10L1 is needed for piRNA’s and spermatogenesis so therefore its presence
in testis is critical. Our data show that EDC’s can disrupt MOV10L1 gene expression most likely
in germ cells, in turn affecting the gene regulatory network necessary for the proper functioning
of spermatogenesis. Our data show that MOV10L1 was decreased in F1 rat testis exposed in
utero to 10mg/kg/day of DEHP. There was no significant decreased in MOV10L1 gene activity for
F1 testis exposed in utero to genistein however there was a visible decrease in testis exposed to
Gen-DEHP mix. In the F2 generation, testis exposed to DEHP alone and Gen-DEHP mix via their
fathers had decreased gene expression of MOV10L1, yet the decrease with Gen-DEHP mix was
more dramatic. In F3 testis, there was no difference in gene expression of MOV10L1 from control.
Conclusion
In conclusion for this chapter, I found that in utero exposure to EDCs induces epigenetic
alterations including DNA methylation in adult rat testes. DNA methylation is important for
expression of inherited genes and for establishing new methylation marks. The data from this
study suggest that low dose EDC mixtures can indeed affect epigenetic processes in men, and
that these changes can be passed down to subsequent generations.
To this point I have highlighted the fact that proper functioning of each testicular cell type during
development are important for proper functioning in adult life. In the next chapter I will discuss
another key testicular cell type which are macrophages. Testicular macrophages are responsible
for maintaining the immune privilege of the testes by phagocytizing testicular invaders.

77

CHAPTER IV
In-utero Exposure to Low Doses of Genistein and Di-(2-ethylhexyl) Phthalate (DEHP) Alters
Innate Immune Cells in Neonatal and Adult Rat Testis

Casandra Walker
1#
, Shahrzad Ghazisaeidi
2#
, Berenice Collet
2
, Annie Boisvert
2
and Martine
Culty
1,2,3*

1
Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of
Southern California, Los Angeles, CA USA,
2
The Research Institute of the McGill University
Health Centre and
3
Department of Medicine, McGill University, Montreal, Quebec, Canada.
# contributed equally to the study

*Corresponding author: Martine Culty, School of Pharmacy; University of Southern California; Los
Angeles, CA 90089-9121. Phone: 323-865-1677; e-mail: culty@usc.edu

Summary sentence: Adverse reproductive effects and disruption of innate immune cells in the
testes of neonatal and adult rats exposed in utero to genistein and DEHP mixtures at doses found
in humans.

Keywords: testis, endocrine disruptors, genistein, DEHP, transcriptome, innate immune cells,
macrophages

78

Funding: This work was supported by funds from a grant from the Canadian Institutes of Health
Research (CIHR) (Operating grant # MOP-133456) and by funds from the USC School of
Pharmacy to MC.
79

Abstract
Background: Although humans are exposed to mixtures of endocrine disruptor chemicals, few
studies have examined their toxicity on male reproduction. We previously found that fetal
exposure to a mixture of the phytoestrogen genistein (GEN) and the plasticizer di(2-ethylhexyl)
phthalate (DEHP) altered gene expression in adult rat testes.
Objectives: Our goal was to investigate the effects of fetal exposure to GEN-DEHP mixtures at
two doses relevant to humans on testicular function and transcriptome in neonatal and adult rats.
Materials and methods: Pregnant SD rats were gavaged with vehicle, GEN or DEHP, alone or
mixed at 0.1 and 10 mg/kg/day, from gestation-day 14 to birth. Fertility, steroid levels and testis
morphology were examined in neonatal and adult rats. Testicular transcriptomes were examined
by gene-array and functional pathway analyses. Cell specific genes/proteins were determined by
quantitative real-time PCR and immunohistochemistry.
Results: GEN-DEHP mixtures increased the rates of infertility and abnormal testes in adult rats.
Gene array analysis identified more genes exclusively altered by the mixtures than individual
compounds. Altered top canonical pathways included urogenital/reproductive developmental and
inflammatory processes. GEN-DEHP mixtures increased innate immune cells and macrophages
markers at both doses and ages, more strongly and consistently than DEHP or GEN alone. Genes
exclusively increased by the mixture in adult testis related to innate immune cells and
macrophages included Kitlg, Rps6ka3 (Rsk2), Nr3c1, Nqo1, Lif, Fyn, Ptprj (Dep-1), Gpr116, Pfn2
and Ptgr1.
Discussion and conclusion: These findings demonstrate that GEN-DEHP mixtures at doses
relevant to human induce adverse testicular phenotypes, concurrent with age-dependent and
non-monotonic changes in testicular transcriptomes. The involvement of innate immune cells
such as macrophages suggest immediate and delayed inflammatory responses which may
80

contribute to testicular dysfunction. Moreover, these effects are complex and likely involve
multiple interactions between immune and non-immune testicular cell types that will entail further
studies.

81

Introduction
“The developmental origins of adult disease (Barker) hypothesis” proposes that early life
adverse events lead to long-lasting alterations in the physiology of organs and predispose adults
to later disease (Barker, 2004). Previous studies have shown that maternal exposure to endocrine
disruptor chemicals (EDCs) can cause male reproductive tract defects and diseases, such as
testicular cancer, decreased sperm quality and numbers, hypospadias and undescended testis.
These conditions are part of the testicular dysgenesis syndrome (TDS), believed to stem from
alterations in fetal androgen and estrogen levels, and the compromised development of testicular
cells during a fetal reproductive window of susceptibility (Schug et al., 2016; Gore et al., 2015;
Yang et al., 2015; Sharpe et al., 2008; Skakkebaek et al., 2016; Jeng et al., 2014; Scott et al.,
2009). Because of its utmost dependency on a tightly regulated sequence of molecular and
cellular events leading to the production of androgens by the fetal testis (Wilhelm et al., 2007),
the development of the male reproductive system is sensitive to endocrine disrupting agents
exerting anti-androgenic effects (Kavlock et al., 2006). This process can also be disrupted by
exposure to inappropriate signals from chemicals with estrogenic properties (De Falco et al.,
2015; Salian et al., 2009).
While most toxicological studies are still based on testing the effects of single chemicals
at doses greater than those encountered by humans, the need for studying the potential toxicity
of chemical mixtures, and using lower doses meaningful for human exposure has started to be
recognized in recent years (Vandenberg et al., 2012; Futran et al., 2015; Sharma et al., 2017).
Exposures to combinations of xenoestrogens or antiandrogen mixtures were both shown to affect
the male reproductive system (Rajapakse et al., 2007; Howdeshell et al., 2017). In previous
studies, we found that fetal exposure to a mixture of the phytoestrogen genistein (GEN) and the
anti-androgenic plasticizer di(2-ethylhexyl) phthalate (DEHP), at 10 mg/kg/day, a dose below the
NOAEL of both chemicals (Kavlock et al., 2006; Rozman et al., 2006), induced alteration in
82

neonatal and adult rat testes that were different from the effects of the individual compounds (19,
20). In particular, changes in the expression of genes and proteins specific of Leydig, Sertoli and
germ cells were observed in adult rats exposed in utero to GEN and DEHP mixture (GEN-DEHP
mix) (19), while GEN exerted a normalizing effect against the oxidative effects of DEHP in
neonatal testis (20). We also found that fentomolar concentrations of genistein and the
xenoestrogen bisphenol A (BPA) in mixture exerted synergetic effects on the proliferation of
isolated neonatal gonocytes in the presence of low serum levels, demonstrating that chemical
mixtures could induce effects not observed with individual compounds (21). A study on adult rats
exposed chronically to a low dose of genistein combined with the antiandrogen vinclozolin
reported deleterious effects on testicular gene expression, sperm quality and counts, indicating
that the reproductive risks associated with exposure to chemical mixtures disrupting
androgen/estrogen homeostasis is not limited to fetal/perinatal exposure, but can also affect adult
reproductive function (22).
The overall goal of the present study was to explore the effect of GEN and DEHP mixtures
at two low doses equivalent to exposure levels in humans, on testicular parameters and fertility,
and identify testicular cells altered by these EDC mixtures. The exposure paradigm was based
on the recognition that humans expose themselves to genistein through their diet, by consuming
soy products in processed foods and vegetarian/vegan diets, and using baby formulas (18, 23),
while they are exposed unwillingly to DEHP through multiple sources, from consumer products,
cosmetics and medical devices to maternal milk (10, 24-25). Moreover, both GEN and DEHP can
cross the placenta and are found in amniotic fluid (26-28). Therefore, babies are exposed to these
compounds from fetal life to infancy, periods critical for early germ cell development from
gonocytes to spermatogonia, and for the establishment of the pool of spermatogonia stem cells
that will support spermatogenesis later on (29-31). Thus, the purpose of this study is to elucidate
the cocktail effect of in-utero exposure to these two common EDCs on male reproduction, in
83

comparison to the effects of the individual compounds. In previous studies using fetal exposures
to either GEN or DEHP alone, we had found that GEN induced transient effects on testicular
functions and signaling pathways at doses of 0.1, 1 and 10 mg/kg/day, while DEHP at doses
ranging from 100 to 1000 mg/kg/day induced permanent testicular alterations (Thuillier et al.,
2003; Wang et al., 2004; Culty et al., 2008; Thuillier et al., 2009; Martinez-Arguelles et al., 2009).
In the present study, we treated pregnant rats with GEN and DEHP at two doses
meaningful to human exposures: a dose of 0.1 mg/kg/day, equivalent to 0.016 mg/kg/day in
human after species conversion (Manku et al., 2012), level in the range of normal human
exposure to Gen and DEHP; and a dose of 10 mg/kg/day, corresponding in human to 1.6-2.0
mg/kg/day. The highest dose of GEN and DEHP is in the range of exposures found in babies fed
with soy formula and undergoing medical interventions in NICU respectively, reaching 10 to 100-
fold higher levels than in the general population (Kavlock et al., 2006; Rozman et al., 2006; Jones
et al., 2015). The study reports deleterious reproductive short- and long-term effects that were
not expected at the doses of GEN and DEHP used and unveils changes in innate immune cells
that may play a role in the adverse reproductive phenotypes observed. These data emphasize
the need for more studies of low dose EDC mixtures, to understand the molecular and cellular
mechanisms targeted by the EDCs and perform more reliable risk assessment studies in the
future.

84

Materials and methods
Animal Treatments and Tissue Collection
Timed pregnant Sprague Dawley rats were purchased from Charles Rivers Laboratories
(Saint-Constant, QC, CA) and switched to a casein-cornstarch based, phytoestrogen-free diet
(casein diet) AIN-93G (Teklad diet; Envigo, Indianapolis, IN) from 2 days before gavage to
weaning, to avoid further dietary exposure to genistein. The rats were maintained on a 12L:12D
photoperiod with ad libitum access to food and water, and handled according to protocols
approved by the McGill University Health Centre Animal Care Committee and the Canadian
Council on Animal Care. The pregnant rats were treated by gavage from Gestational Day 14
(GD14) to parturition with either vehicle (corn oil) alone or containing GEN or DEHP (abbreviated
as G and D in figures), or GEN-DEHP mix (abbreviated as G+D in figures), at the doses of 0.1
and 10 mg/kg/day (doses abbreviated as 0.1 and 10 in figures). The doses were adjusted to
changes in dam weights. These doses were selected based on our previous dose-response
studies of in-utero exposure to genistein or DEHP used separately and together (32-36). The
inclusion in the studies of control animals maintained on normal soy-based diet showed that there
was no significant difference in the general health and food consumption of dams fed with soy-
based chow or casein diet (data not shown). Moreover, the diets did not affect the health,
reproductive function, testis transcriptome and fertility of the offspring of control rats, suggesting
no effect from maternal diet alone (data not shown). Adult offspring were mated at PND90 to
assess their fertility and litter size when applicable. Offspring were weighed and euthanized at
PND3, 90 or PND120. Blood was collected via cardiac puncture, the plasma separated and
stored at -80°C for testosterone (T) and 17β-estradiol (E2) measurements. The testes were
collected, weighed, and either fixed in 4% paraformaldehyde or snap frozen in order to assess
their development and function, using morphological examination, and gene and protein
expression analyses.
85

RNA Extraction and Quantitative Real-Time PCR
RNA was extracted from testes using RNeasy Plus Mini kit (Qiagen, Valencia, CA, USA)
and digested with DNase I (Qiagen). Complementary DNA was synthesized using the transcriptor
synthesis kit (Roche Diagnostics; Indianapolis, IN). Quantitative Real- Time PCR (qPCR) was
performed previously described with a LightCycler 480 using SYBR Green Supermix (BioRad;
Hercules, CA), a Master Mix kit (Roche Diagnostics) (37). Alpha tubulin was used as reference to
normalize gene expression. A minimum of six male offspring from different litters were assessed
in triplicate. The comparative Ct method was used to calculate relative gene expression. Primers
specific for the genes of interest were designed with the Assay Design Center on the Roche
University Probe Library website (Table 1).

86

Table 1. List of primer sets used for quantitative real-time PCR.
Gene
Symbol
Accession
number
Forward primer (5’-3’) Reverse primer (3’-5’)
Anxa1 NM_012904.
2
TCTAACCAGCAAATCAGAGAGAT
TAC
CGAGAGCAAGCAAGGCATTA
Cd13 NM_013127 CACTCCGGCACCTAACATCG CGCAACCACCAGGTACTCCGTG
CG
Cd33 XM_002728
749
CGGATACTGTGGAAAGAACCATC
CG
GCCCAAGAATCAGGAGCTTGAC
Cd38 NM_031012 CACTCCGGCACCTAACATCG CGCAACCACCAGGTACTCCGTG
CG
Cd68 NM_001031
638.1
CTCCTCACCCTGGTGCTCATT CGACAGGCTGGTAGGTTGATTG
TCG
Cd163 NM_001107
887.1
CGGACCAATTTGGCTTGACAGT CGGCCTTACACTCCCAAAGAGC
CG
Col1a1 NM_053304.
1
CTCAGGGTGCTCGTGGATTG CGGAAAACCTCTGTGTCCCTTC
ATTCCG
Col4a1 NM_001135
009.1
CACCATGCCCTTCCTCTTCTG CGCCGAGTAGTCGTTCCTGGAG
GCG
Il-6 NM_012589.
2
CCTGGAGTTTGTGAAGAACAACT GGAAGTTGGGGTAGGAAGGA
Il-10 NM_012854.
2
TCATGGCCTTGTAGACACCTT AGTGGAGCAGGTGAAGAATGA
TNF- α NM_012675.
3
GGGCTCCCTCTCATCAGTTCC CGAGTGGGCTACGGGCTTGTCA
CTC
Tuba1a BC062238 CGGGGGAGAGTTCTCTGAGGCCC
G
CAGAATCCACACCAACCTCCTC

Gene Expression Array Analysis
Ultra-pure total RNA was extracted with the PicoPure RNA isolation kit (Arcturus,
Mountain View, CA) from the testes of PND3 and PND120 rats, using offspring from three different
dams per treatment. The RNA samples were digested with DNase, analyzed with Nanodrop
device, and diluted to 100ng/µl. Gene array analysis performed on Affymetrix 2.0 ST microarray
chips by Genome Quebec, as previously described (37, 38). Preliminary data analysis including
87

quality control inquiry, normalization, abbreviation and dispersion analysis, differential analysis of
gene expression and gene set enrichment were conducted as previously described (37, 38). Data
were then normalized and statistical analysis performed using the Partek Genomics Suite
software, to identify differentially expressed genes (DEGs) between the EDC treatments and
control samples using ANOVA. The data were filtered to exclude LOC and "blank" regions,
resulting in 19,786 protein coding genes and microRNAs. Gene lists were then created to identify
DEGs between each of the individual treatments and control, using an un-adjusted p value of 0.05
as cut-off for statistical significance. An additional step of selection was performed by applying a
fold-change cut-off of at least 40% above or below the control values. The data were used to
generate Venn diagrams and the lists of genes significantly altered in the different conditions.
The gene lists from Partek were then analyzed for functional pathways and networks using the
Ingenuity Pathway Analysis (IPA) software, the Database for Association, Visualization and
Integrated Discovery (DAVID) software linked to the Kyoto Encyclopedia of Genes and Genomes
(KEGG) database. Omic data analysis was performed with IPA to identify the most relevant
signaling and metabolic pathways, molecular networks and biological functions affected by the
treatments. DAVID and KEGG combination provided a comprehensive set of functional
annotations used to identify biological functions including genes significantly altered by the
treatments. The two types of analyses led to the generation of functional pathways and gene
networks that were visualized as tables or diagrams, indicating their respective p values and
enrichment scores. Once DEGs were identified, their expression levels, as indicated by their
relative signal intensity on the arrays, were also considered to prioritize genes of interest. The
2^
log2
values of the signal intensities (originally expressed as log2 values) were calculated, and
genes expressed at a relative intensity below 40 (representing 33 % of all genes on the arrays)
in all conditions were not given priority. Pubmed keyword searches were also used to validate
gene and pathway relevance to the study.
88

Immunohistochemistry
Testis fixed in 4% paraformaldehyde were embedded in paraffin and cut in sections of 5
μm, used for histological and immunohistochemical analysis as previously described (39-40).
Briefly, tissue slides were dewaxed, rehydrated, and treated for target antigen retrieval (Dako
products by Agilent; Carpinteria, CA), and processed for immunostaining using primary antibody
incubation overnight at 4
o
C, followed by an incubation with the appropriate secondary antibodies.
Non-specific IgG was used as negative control. Primary antibodies for CD68 (Abcam; Cambridge,
MA) and CD163 (Santa Cruz Biotechnology; Santa Cruz, CA) were used at a dilution 1:100. The
secondary antibodies were Biotin Goat Anti Rabbit (BD Pharmingen; Franklin Lakes, NJ) and
Biotin Goat Anti Mouse (BD Pharmingen). Next, the slides were incubated with streptavidin-
coupled horseradish peroxidase (HRP) (Invitrogen Thermo Fisher Scientific; Carlsbad CA) and a
final colorimetric reaction with AEC Chromogen solution (Thermo Fisher), producing red
precipitates at the target protein location. The sections were counterstained with Mayer’s
hematoxylin (Invitrogen), coverslips were applied, and pictures taken with an Olympus
microscope. Morphological observations were performed on sections stained with Hematoxylin
and eosin solution (Vector Laboratories Inc; Burlingame, CA), as well as by observing the tissue
morphology of sections used for IHC analysis.
Steroid Quantification
The levels of circulating Testosterone and Estradiol in PND90 rats were quantified by
radioimmunoassay as previously described (n=6 per condition) (34, 39).
Statistical Analysis
Statistical analysis was performed using one way ANOVA with post-hoc Dunnett's test for
the analysis of general health parameters, or unpaired two-tail Student’s t-test for qPCR data
analysis, using the statistical analysis functions in GraphPad Prism 7.04 program (GraphPad Inc.,
89

San Diego, CA, USA). Because the two chemicals used are structurally unrelated and are known
to have different molecular targets, they are not expected to have similar effects, and unpaired
two-tail Student’s t-test was used to determine the statistical significance between each control -
EDC pair for qPCR analysis. Gene array analysis was performed on three independent N (one
offspring used per dam) per treatment condition, using the ANOVA application from the
bioinformatics Partek platform. General health parameters were determined on all rats. Fertility
was assessed using 8 to 9 offspring from different litters per treatment condition. For qPCR
analysis, the results are presented as mean ± SEM of fold changes relative to vehicle control.
Experimental points were performed in triplicate for each sample, from 5-8 rats from different
dams per treatment condition. Histological assessment and IHC were done on at least three
independent offspring per treatment. Asterisks indicate a significant change relative to control,
with p values ≤0.05 considered statistically significant.

90

Results
Effects of in-utero exposure to GEN and DEHP on general health and reproductive parameters.

Figure 18. Effect of in utero exposure to GEN (G) and DEHP (D) and their mixtures (G+D) at doses of
0.1 and 10 mg/kg/day on general health and reproductive characteristics. Neonates and adults average
body weights (BW) (A, B); individual testis weights (TW) normalized to 100g body weight (C, D); and
anogenital distance (AGD) normalized to body weight (E, F) are shown. Data are presented as mean ±
SEM of the offspring from 7-12 dams per treatment. Statistical significance was determined using one
way ANOVA with Dunnett's post-hoc test. *p ≤ 0.05.

91

BW (g)
5
1
0
1
5
0
20
0
40
0
60
0
80
0
100
0
0
BW
(g)
AGD / BW (mm/100
g)
2
0
3
0
4
0
5
0
0
10
0
20
0
30
0
40
0
0
50
0
TW / BW (mg/100
g)
2
0
4
0
6
0
0
TW / BW (mg/100 g)
8
0
*
2
4
6
8
0
AGD / BW (mm/100
g)
PN D
3
PN D 12
0
A
C D
B
E F
92

The examination of body weight and anogenital distances (AGD) of PND3 and PND120
offspring showed no significant differences between control and treated animals (Figure 1).
Individual testis weights were normalized to body weights in PND120 rats, and the values for
both testes were plotted to consider asymmetrical weight changes in the testes of some rats
(Supplemental Figure 1). Despite a trend to larger testis weights in EDC-exposed neonatal
rats, the only significant change at PND3 was an increase in rats exposed to GEN 10. In adult
rats, there was no significant change in the mean testis weights between controls and EDC
exposures, although there were more testes with low weights (values lower by at least 1 SD
than control level) in rats exposed to GEN 10 and GEN-DEHP mixtures. GEN-DEHP mix at
dose 0.1 resulted in the most outliers (+ or - 1 SD of control level) and in atrophied testes (40
to 50 % decrease in weight) or hypertrophied testes (≥ 30 % increase in weight). The numbers
of dams with at least one offspring presenting abnormal testes or small litters (< 5 pups), were
combined as an assessment of reproductive anomalies, to reflect inter-litter variability (Table
2). Globally, the strongest effects were observed following exposure to GEN-DEHP mix at
doses 10. These effects were not observed in control rats.

93

Table 2. Effects of fetal exposure to GEN and DEHP, alone or in mixture (GEN-DEHP mix) at the doses of
0.1 and 10 mg/kg/day on reproductive parameters in rats. Infertility frequency, abnormal testis morphology
(atrophied or hypertrophied) and small size litters (less than 5 pups) were determined in adult offspring.
Data for each condition correspond to the number of dams having at least one offspring presenting an
abnormal phenotype. Data are presented as frequency and percent of total dams per condition.

Treatment
(mg/kg/day)
Control GEN DEHP GEN-DEHP mix Total
EDC altered rats 0 0.1 10 0.1 10 0.1 10
Infertility frequency
x/N and (%)
0/8
(0)
1/8
(13)
2/9
(22)
0/8
(0)
0/8
(0)
1/8
(13)
1/8
(13)
5/49
(10)
Atrophied or
hypertrophied testes;
litter < 5 pups
x/N and (%)
0/8
1/8
(13)
1/9
(11)
2/8
(25)
1/8
(13)
2/8
(25)
3/8
(38)
10/49
(20)

While there was no control or DEHP-exposed dams with infertile offspring, there were infertile
rats both in GEN-DEHP mix and GEN exposed rats (Table 2). It should be noted that several of
the dams treated with EDCs had more than one male offspring infertile. Taken together, these
results suggest that fetal exposure to doses of GEN-DEHP mix and GEN corresponding to levels
found in humans were sufficient to disrupt testicular development and increase the rates of
infertility, whereas DEHP had milder adverse effects.
These data were further confirmed by the morphological analysis of adult testis sections,
which showed a normal morphology in all control rat sections but revealed major damages in the
testes of rats exposed to GEN-DEHP mix at both doses, consisting principally of Sertoli cell-only
tubules (Figure 1). Germ cell sloughing was also present in the lumen of some tubules with active
spermatogenesis in rats exposed to GEN 10 and DEHP 10 (22 ± 8 % and 28 ± 10 % of the tubules
respectively, versus in 6 ± 3 % in control rat testes), but these changes were not statistically
significant. There was high variability in germ cell sloughing between DEHP 0.1 rats, and in the
rats exposed to the mixtures that had retained active spermatogenesis. Interestingly, the testis
94

of a rat exposed to GEN 0.1 presented a mixed phenotype, containing both tubules with active
spermatogenesis and degenerated tubules (Figure 1), and this particular rat was found to be
fertile. In contrast, neonatal rat testes did not contain noticeable morphological abnormalities,
except for the rare occurrence of oversized gonocytes in sections from DEHP 10 exposed rats
(Figure 1, left panel).

95

Figure 19. Effect of fetal exposure to Genistein (G) and DEHP (D), alone or in mixtures (G+D) at 0.1 and
10 mg/kg/day, on neonatal (PND3) and adult (PND120) rat testis morphology. Examples of testis
morphology in H&E stained sections are shown. Testis sections of at least 3 rats from different dams per
treatment were examined, and representative pictures are shown. The morphology of PND3 testes (left
box) was normal, except for the rare occurrence of oversized gonocytes (white arrow) in G+D treated rats.
The main panel presents low magnifications of adult testis morphology, complemented by enlarged views
below each of them. Abnormal adult testicular phenotypes in EDC-exposed rats included germ cell
sloughing in the lumen of seminiferous tubules (white arrows) and atrophied tubules (*) with Sertoli cell-
only phenotype, with deformed and atrophied tubules found at higher rate in rats exposed to the mixtures.
Note the mixed tubule phenotype, with normal shaped (n) and atrophied (*) tubules in a G 0.1 sample.
Scales are in μm.

Next, the levels of circulating testosterone and 17β-estradiol were measured in PND90 rats.
Testosterone levels were significantly decreased by 35% of the control levels in rats exposed
to GEN-DEHP 0.1, but not the higher dose, which showed an increasing trend, suggesting a
non-monotonic response to the mixture (Figure 2A). GEN 0.1 and DEHP 0.1 and 10 treatments
showed non-significant decreasing trends (20-30% decreases). As expected in male rats, the
96

levels of circulating 17β-estradiol were 10-fold lower than those of testosterone, and showed
a 43% significant decrease by DEHP 0.1, whereas GEN 0.1, DEHP 10 and GEN-DEHP mix at
both doses induced 24 to 29 % decreasing trends (Figure 2B). These data indicate that fetal
exposure to low doses of GEN, DEHP and their mixtures induced some long-term alterations
in adult Leydig cell function, but the exposed rats still produced substantial amounts of
testosterone and 17β-estradiol.
Figure 20. Effect of fetal exposure to Genistein (G) and DEHP (D) alone or in mixture (G+D) at 0.1 and 10
mg/kg/day, on Testosterone (A) and 17β-estradiol (B) circulating levels in adult rats. Steroids were
measured in the blood of 7 to 8 rats from different dams per treatment. Data are shown as mean ± SEM
of levels measured in ng/ml of plasma. Statistical significance (* p ≤ 0.05) was determined by unpaired
two-tail Student’s t-test.

Fetal exposures to GEN-DEHP mixtures alter more genes than single compounds, including
reproductive and inflammatory processes, in neonatal and adult rat testes.
To identify molecular processes targeted by GEN-DEHP mix, which could explain the
increased rates of adverse phenotypes observed in adult rats, we performed gene array
analysis of testes from PND3 and PND120 rats exposed to GEN-DEHP mix in comparison to
97

single exposures to GEN or DEHP at the dose of 10mg/kg/day; and at the dose of 0.1
mg/kg/day in PND120 rats. As shown in the Venn diagrams, there were more genes altered in
adult rat testes than in neonatal rat testes for DEHP and GEN-DEHP mix at 10 mg/kg/day (364
vs 157 and 1184 vs 243, respectively) (Figure 3A, B). Surprisingly, this was the opposite in
rats exposed to GEN 10 alone, with 182 DEGs at PND3, but only 27 at PND120. The
transcriptomes of adult rat testes showed classical dose-responses patterns for GEN-DEHP
mix and DEHP, with 7 times less DEGs and 40 times less DEGs with DEHP and GEN-DEHP
mix, respectively, at the dose of 0.1 than at the dose of 10 mg/kg/day (Figure 3B, C). However,
in the case of GEN-exposed rats, GEN 0.1 induced 3 times more DEGs than the higher dose
considering all genes altered by GEN, and when looking at genes unique to the GEN exposures
(Figure 3B, C).
Overall, there were similar numbers of up- and down-regulated genes for all exposure
types combined, with a total of 392 genes up-regulated and 288 down-regulated at PND3, and
a total of 869 genes up-regulated and 849 down-regulated at PND120. In PND3 testes, GEN-
DEHP mix 10 up-regulated 152 genes and down-regulated 91. GEN 10 alone up-regulated 81
genes and down-regulated 101 genes. DEHP 10 alone up-regulated 159 genes and down-

98

regulated 96 genes. In PND120 testes, GEN-DEHP mix 10 upregulated 598 genes and
downregulated 586 genes. GEN 10 upregulated 14 genes and downregulated 13 genes. DEHP
upregulated 169 genes and downregulated 195 genes. In the testes of adult rats exposed to
the dose of 0.1, GEN up-regulated 44 genes and down-regulated 31; DEHP up-regulated 20
genes and down-regulated 34; while GEN-DEHP mix up-regulated 24 and down-regulated 18.
Figure 21. Effects of in utero exposure to GEN and DEHP alone or mixed, on gene expression in PND3
and PND120 rat testes, using offspring from three dams per condition. GEN and DEHP were used at 0.1
mg/kg/day (C) and 10 mg/kg/day (A, B, D, E). The transcriptomes of testes from PND3 (A, D) and PND120
(B, C, E) rats were determined by gene array using Affymetrix Rat Gene 2.0 ST MicroArray chips. (A-C)
Venn diagrams representing the total number of significantly altered genes (unadjusted p-value ≤ 0.05) in
each treatment, relative to control rats, using a cut-off of 40% fold-change, obtained using Partek Genomic
Suite. (D, E) Number of genes significantly altered by exposure to GEN-DEHP mix in PND3 (D) and
PND120 (E) rat testes in major functional groups, as determined by KEGG GO_TERM analysis (fold change
cut-off of 25%). Count: number of genes in a category; %: percentage represented by a group of genes in
the transcriptome; P-Values were determined by the applications of the platforms.

99

Another striking finding is that in PND3 rat testes, there were more common DEGs
between GEN and the mixture, GEN and DEHP, and DEGs common to the three treatments
than in adult rat testes. The larger numbers of overlapping DEGs at PND3 suggested that these
treatments shared more early-response target genes and pathways than in the adult. This
could also reflect the more simple composition of the neonatal testes, particularly for germ
cells, which include only neonatal gonocytes, while adult testes comprise multiple types of
spermatogenic cells at different stage of differentiation (Manku et al., 2015, Hermo et al., 2010).
When comparing the lists of DEGs for each treatment at dose 10 between the two ages,
there was no common DEG in GEN exposed rats. This was different in DEHP-exposed rats,
with 40 genes in common between neonatal and adult ages, including three genes altered in
opposite directions; and in rats exposed to the mixture, with 19 genes in common, including
one altered in opposite direction. These results suggest that there are conserved pathways
between the short-term and long-term targets of DEHP in testis and to a lesser extend for the
mixture too. The situation appears more complex for GEN, which induced 6 times more DEGs
at PND3 than at PND120, but with no common target gene, and induced more DEGs at the
dose of 0.1 than at the dose of 10 mg/kg/day. Yet, fetal exposure to GEN also led to increased
rates of infertility and abnormal testes compared to control rats (Table 2).
Since GEN-DEHP mix induced the most DEGs at dose 10, we performed an initial
functional pathway analysis for that dose at both ages, using DAVID’S functional annotation
and KEGG GO_TERM database and an unadjusted p-value ≤ 0.05. A lower initial cut-off of 25%
fold-change was used to take into account the complexity and multicellularity of the testes from
which RNA was isolated. This analysis identified two common functional pathways among the
top pathways presenting DEGs in testis, which were “inflammatory processes” “reproductive
development process”/”urogenital system development”, comprising together close to 100
DEGs at each age, with p values between 0.001and 0.005 (Figure 3D, E). While disruptions of
100

genes related to reproductive development was expected at both ages in view of the adult
adverse testicular phenotypes observed, the data suggested a new category of affected genes,
those associated with inflammatory processes, in both short- and long-term responses to GEN-
DEHP mix fetal exposure.
Fetal exposure to low doses of GEN, DEHP and GEN-DEHP mix alters gene markers of myeloid
immune cells, including macrophages in neonatal and adult rat testes, with the mixture inducing
the strongest effects.
Considering the predominance of inflammatory processes among the affected functional
pathways in testes exposed to GEN-DEHP mix, we examined a panel of gene markers for myeloid
progenitors, monocytes and granulocytes, including macrophage populations, in testes from rats
exposed to the mixture or individual chemicals at both doses, in neonatal and adult offspring, in
comparison to control rat testes. As shown in Figure 4, there was a 2- to 3-fold increase in three
myeloid markers, the Aminopeptidase N Cd13, the transmembrane receptor Cd33, and the cell
surface glycoprotein Cd38, which could represent mature mast cells as well as macrophages
(42,43), in the testes of adult rats exposed to GEN-DEHP mix at dose 10 (Figure 4 B, D, F). DEHP
induced a smaller increase, while genistein had no effect alone. Similar effects were found for the
lower dose of 0.1 mg/kg/day at PND120 (Figure 4 A, C, E). However, the effects were different at
PND3, where GEN-DEHP mix had no effect at the dose of 10 mg/kg/day. GEN 10 exerted a
repressive effect on the expression of these markers in PND3 testes, suggesting an anti-
inflammatory effect of genistein at this age. This contrasted with the inducing effects of DEHP 0.1
on these genes in neonatal testes. Moreover, in neonates, the responses to the 0.1 mg/kg/day
dose at PND3 were different from the responses to dose 10, with DEHP increasing gene
101

expression, while the mixture showed a normalizing trend.
Next, we measured the mRNA expression of two macrophage markers, CD68, a cell surface
marker for tissue resident macrophages, more frequently associated with pro-inflammatory (M1)
cytokine profile (Gieri et al., 2002; Shapouri-Moghaddam et al., 2018), and the anti-inflammatory
(M2) scavenger receptor CD163 (Galli et al., 2011; Winnall et al., 2011; Mossadegh-Keller et al.,
C d 1 3
D o s e : 0 .1 m g /k g /d a y
F o ld c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
***
*
*
*
P N D 3 P N D 1 2 0
*
C d 1 3
D o s e : 1 0 m g /k g /d a y
F o ld c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
4
***
***
***
*
P N D 3 P N D 1 2 0
C d 3 3
D o s e : 0 .1 m g /k g /d a y
F o ld c h a n g e
C
G
D
G + D
C
G
D
G + D
0 .0
0 .5
1 .0
1 .5
2 .0
*
*** ***
P N D 3 P N D 1 2 0
C d 3 3
D o s e : 1 0 m g /k g /d a y
F o ld c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
**
***
P N D 3 P N D 1 2 0
C D 3 8
D o s e : 0 .1 m g /k g /d a y
F o ld c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
4
5
**
**
*
*
***
P N D 3 P N D 1 2 0
C d 3 8
D o s e : 1 0 m g /k g /d a y
F o ld c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
4
***
***
***
P N D 3 P N D 1 2 0
A B
C
D
E F
Figure 22. Effects of in utero exposure to GEN, DEHP or GEN-DEHP mix at 0.1 or 10 mg/kg/day on
testicular myeloid cell markers in PND3 and PND120 testes. Changes in mRNA expression were
determined by qPCR analysis. (A, B) Cd13; (C, D) Cd33; (E, F) Cd38. Results are expressed as fold change
of controls. Data were normalized to α-tubulin (N = 5-7 rats from different dams per condition). Asterisks
indicate a significant difference relative to control, using unpaired two-tail Student’s t-test. * p ≤ 0.05, ** p ≤
0.01, ***p ≤ 0.001.

102

20187). At PND120, the rats exposed to GEN-DEHP mix at dose 10 showed consistent increases
in both the expression of Cd68 and CD163, while there was no effect in adult rats exposed to
GEN or DEHP alone (Figure 5 B, D). However, the dose 10 mixture had opposite effects on both
genes at PND3. At the low dose of 0.1 mg/kg/day, the single compounds and GEN-DEHP all
increased CD68 and CD163 expression in adult offspring, as well as CD68 in PND3 rat testes
(Figure 5 A, C). Interestingly, the highest changes were found in CD163 expression for the low
dose in adult rats, with 3- to 5-fold increases (Figure 5 C).

C D 6 8
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
* * *
*
P N D 3 P N D 1 2 0
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
3
4
5
6
7
8
C D 1 6 3
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
* * *
* * *
* * *
*
P N D 3 P N D 1 2 0
C D 1 6 3
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
* *
*
P N D 3 P N D 1 2 0
C D 6 8
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
* *
* *
* * *
* * *
P N D 3 P N D 1 2 0
A
B
C
D
Figure 23. Effects of in utero exposure to GEN, DEHP or their mixture on testicular macrophage gene
markers at PND3 and PND120. GEN and DEHP were used at 0.1 (A, C) or 10 (B, D) mg/kg/day. Relative
mRNA expression of the pro- and anti-inflammatory macrophage markers Cd68 (A, B) and Cd163 (C, D)
was measured by qPCR. The results were normalized to α-tubulin and are expressed as fold change of
controls (N = 5-7 rats from different dams per condition). Asterisks indicate a significant difference relative
to control (unpaired two-tail Student’s t-test): * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.
103

The increased expression of these genes likely corresponded to a higher number of macrophages
in the testes, as shown by more CD68- and CD163- positive macrophages in testis sections from
exposed to GEN-DEHP mix at dose 10 for both ages (Figure 6A, B, C, D). A striking difference
was the presence of larger macrophages with strong positive signal following EDC exposures,
especially in the case of GEN-DEHP at dose 10, in comparison with smaller cells with weaker
signal in control testes (Figure 6C). CD68-positive and CD163-positive cells also appeared more
numerous in neonatal testes in utero exposed to GEN-DEHP 10 (Figure 6A, B). Taken together,
the mRNA and protein results confirmed that GEN-DEHP mix at 10 mg/kg/day showed stronger
effects than individual EDCs in adult offspring on M1 and M2 macrophages populations in testis.
104

Figure 24. Identification of CD68+ and CD163+ testicular macrophages in control and EDC-exposed rat
testes. Macrophages (arrows) were visualized by immunohistochemical reactions on testis sections from
PND3 (A, B) and PND120 (C-E) in utero exposed to corn oil (Ctrl), GEN (G), DEHP (D) or their mixture
(G+D), at 0.1 (C) and 10 (A-D) mg/kg/day. Rb IgG: negative control immunostaining with non-specific rabbit
IgG performed on a control sample. The testes of at least 3 rats from different dams per treatment were
examined and representative pictures are shown. Scales are in μm.

105

However, it also revealed complex responses in these innate immune cell populations at a 100-
time lower dose than previously reported (jones et al., 2014), and between neonatal and adult
ages.

Fetal exposure to low doses of GEN, DEHP and GEN-DEHP mix differentially alters the
expression of pro- and anti-inflammatory cytokine genes in neonatal and adult rat testes
In view of elevated myeloid lineage and macrophage markers in the testes of rats exposed
to both doses of GEN-DEHP mix, we examined the mRNA expression of Il6 and TNFa, two
cytokines generally associated with pro-inflammatory macrophage activity, and Il10, an anti-
inflammatory cytokine (Loveland et al., 2017). The data revealed complex profile changes in these
cytokines, with differential dose and age effects (Figure 7). The only significant changes observed
for Il6 were increases in adult rats exposed to DEHP at the 0.1 dose, and in neonatal rats exposed
to DEHP at the 10 dose (Figure 7 A, B). By contrast, Tnfα mRNA expression was increased as
excepted, following fetal exposure to GEN-DEHP mix at 10 mg/kg/day at both ages, and it was
also increased in adult testes by DEHP at dose 10 (Figure 7 C, D). However, the dose of 0.1
mg/kg/day induced an extensive downregulation of TNFa in adult testes from rats exposed in
utero to GEN-DEHP mix and individual EDCs, while TNFa was not altered in neonatal testis.
Concerning IL10, its mRNA levels were increased by GEN at 0.1 mg/kg/day in both ages, but not
by GEN-DEHP mix, suggesting a normalizing effect of DEHP on GEN effects (Figure 7 E, F).
DEHP and the mixture at both doses and GEN 10 had no effect on Il10 transcript levels.

106

I L 6
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0
1
2
3
4
5
* *
P N D 3 P N D 1 2 0
I L 6
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
*
P N D 3 P N D 1 2 0
I L 1 0
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
* * * * *
P N D 3 P N D 1 2 0
I L 1 0
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
P N D 3 P N D 1 2 0
T N F 
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0 0 0
0 . 0 0 5
0 . 0 1 0
0 . 0 1 5
0 . 0 2 0
0 . 8
1 . 0
1 . 2
1 . 4
P N D 3 P N D 1 2 0
* * *
* * *
* * *
T N F 
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
* *
* *
* *
P N D 3 P N D 1 2 0
A B
C D
E F
Figure 25. Effects of in utero exposure to GEN, DEHP or their mixture on interleukin 6 (IL6), Tnfα
and interleukin 10 ( IL10) cytokine expression in rat testes. GEN, DEHP or GEN-DEHP-mix were
used at 0.1 (A, C, E) and 10 (B, D, F) mg/kg/day. Relative mRNA expression was determined by qPCR,
normalized to α-tubulin, and the results are expressed as fold change of controls (N = 5-7 rats from different
dams per condition). Asterisks indicate a significant difference relative to control (unpaired two-tail
Student’s t-test): * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.

107

Differential effects of fetal exposure to GEN, DEHP and GEN-DEHP mix at 0.1 and 10 mg/kg/day
on annexin A1 expression in neonatal and adult rat testes
Next, we examined the expression of Annexin A1 (Anxa1) (previously called Lipocortin
1), a known anti-inflammatory protein by virtue of its inhibiting effect on phospholipase A2, the
first enzymatic step in pro-inflammatory prostaglandin synthesis (Parente et al., 2004; Yang et al.,
2009). Anxa1 expression was greatly reduced by all EDC treatments at the dose of 0.1 mg/kg/day
in neonatal and adult testes (Figure 8A). By contrast, at the dose of 10 mg/kg/day, Anxa1
expression was increased by GEN-DEHP mix and DEHP in the adult, and only by the mixture in
neonatal testis, while GEN had no effect (Figure 8B). Thus, the EDC treatments on Anxa1
expression induced non-monotonic effects. This could be due to its expression in different cell
types, such as macrophages, neutrophils and progenitor Leydig cells (Silva et al., 2019; Lim et
al., 2007; Ge et al., 2005), which might have different sensitivities to these EDCs.

A n x a 1
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
* *
* *
* *
P N D 3 P N D 1 2 0
A n x a 1
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
* * *
* * *
* * *
* * *
* * *
* * *
P N D 3 P N D 1 2 0
A B
Figure 26. Changes in the expression of annexin A1 in the testes of rats exposed in utero to GEN, DEHP or their
mixture at PND3 and PND120. GEN (G) and DEHP (D) were used at 0.1 (A) or 10 (B) mg/kg/day. Gene
expression was determined by qPCR, using α-tubulin for data normalization. Results are expressed as fold
change of controls (N = 5-7 rats from different dams per condition).
108

Differential effects of fetal exposure to GEN, DEHP and GEN-DEHP mix at 0.1 and 10 mg/kg/day
on collagen types I and IV expression in neonatal and adult rat testes
The expression of collagen I (Col1) and IV (Col4) was examined because of the role of
collagens in fibrosis and the relationship between inflammation and testicular fibrosis (Apa et al.,
2002). GEN-DEHP mix and DEHP at 10 mg/kg/day increased both collagen types in the adult,
suggestive of testicular fibrosis formation, but decreased them in neonatal testis (Figure 9 B, D).
At the lower dose, the only effect of the mixture was to increase Col4 expression at PND120, while
having no effect Col1 (Figure 9 A, C). DEHP had no effect at the low dose. GEN had repressive
effects on Col1 expression, significantly decreasing it at 10 mg/kg/day in the adult and at 0.1
mg/kg/day at
both ages (Figure 9 A, B), but it did not have significant effects on Col4 expression (Figure 9 C,
D).
109

Fetal exposures to GEN-DEHP mix induce unique changes in the expression of genes related
to inflammation, innate immunity and macrophages in adult rat testes.
We then focus our studies on the inflammation-related genes exclusively altered by GEN-
DEHP mix in PND120 rat testes, which induced the most DEGs and the strongest responses.
First, genes that were significantly altered in a unique manner by only one of the treatment types
relative to control rats were identified by ANOVA analysis, using an unadjusted p-value ≤ 0.05;
and a cut-off of 40 % in fold-changes between control and GEN-DEHP mix-exposed rats. This
was followed by Partek gene ontology enrichment for biological processes, to search genes
related to the key term "inflammatory processes", using Partek Genomic Suite. The list of DEGs
C o l l a g e n 1
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
* * *
P N D 3 P N D 1 2 0
C o l l a g e n 1
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
* * *
* * *
*
* *
*
P N D 3 P N D 1 2 0
C o l l a g e n 4
D o s e : 0 . 1 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
2 . 5
*
P N D 3 P N D 1 2 0
C o l l a g e n 4
D o s e : 1 0 m g / k g / d a y
F o l d c h a n g e
C
G
D
G + D
C
G
D
G + D
0 . 0
0 . 5
1 . 0
1 . 5
2 . 0
* *
*
*
P N D 3 P N D 1 2 0
A
C
D
B
Figure 27. Changes in the expression of collagen I and collagen IV in the testes of rats exposed in utero
to GEN, DEHP or their mixture at PND3 and PND120. GEN (G) and DEHP (D) were used at 0.1 (A, C) or
10 (B, D) mg/kg/day. Gene expression in collagen I (A, B) and collagen IV (C, D) was determined as
described in previous figures. Results are expressed as fold change of controls (N = 5-7 rats from
different dams per condition). Asterisks indicate a significant difference relative to control (unpaired two-
tail Student’s t-test): * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001.
110

unique for GEN-DEHP mix related to inflammatory processed was further analyzed by comparing
it to an IPA database for "diseases and functions", searching for the categories "innate immune
cell", "macrophage" and inflammatory responses (Tables 3-5). The IPA database included too
many molecules associated with the term "macrophages", and required the selection of sub-
categories within the category "macrophage". The resulting lists of DEGs were further processed
to remove genes presenting low expression, represented by a signal intensity below 30 in all
treatment conditions. Signal intensities in the arrays (expressed as e^
log2 values
) showed that 24 %
of genes had intensities below 30, 54 % from 30 to 300, and 22% between 300 to the highest
expressed gene, ribosomal Rn18S at 9091, with genes with signal intensities between 2000 and
9091 representing less than 3% than all genes.
There were 22 DEGs altered uniquely by GEN-DEHP mix related to innate immunity, 8
downregulated and 14 upregulated (Table 3). The highest DEG, close to 2-fold increase, was the
Nr3c1 glucocorticoid receptor, followed by the Src tyrosine kinase Fyn, the tyrosine phosphatase
Ptprj (Dep-1) and the interferon gamma receptor (Ifngr1), increased by 1.8 to 1.66-fold, mitogen-
activated protein kinase kinase kinase 7 (Map3k7) and conserved helix-loop-helix ubiquitous
kinase (Chuk) increased by more than 1.5-fold. At the opposite end of the spectrum, the most
downregulated gene in this functional category was CD300 molecule like family member b
(Cd300lb), decreased by nearly 50% of its level in control testes, followed by cathelicidin
antimicrobial peptide (Camp) and dihydroxyacetone kinase 2 homolog (Dak/Tkfc). Some of the
up- and down-regulated genes were expressed at very high levels, including from the highest to
the lowest G6pc3, Dak, Dhx9, Ankrd17, Macf1, Ipo7, with signal intensity ranking from 4000 to
350. Most other genes had intensities between 100 to 300, with only few expressed at low levels
(Camp, Trim58, Trim9, Tirap). Some of these genes were also identified as part of the
macrophage categories.

111

Table 3. Innate immunity-related genes uniquely altered by in utero exposure to GEN-DEHP mix at 10
mg/kg/day in the testes of PND120 rats. Gene expression was determined using Affymetrix Rat Gene 2.0
ST Micro Arrays on total RNA from the testes of offspring of three dams per treatment. Genes that were
significantly altered only by the mixture of GEN-DEHP (unadjusted p-value ≤ 0.05), but not by the single
compounds relative to control rats, were identified using the key term “innate immunity” on the IPA database
and ANOVA analysis from Partek Genomic Suite. A cut-off of 40 % fold-change was used, and a cut-off
signal intensity of 30 in at least one condition. *Tkfc: Triokinase And FMN Cyclase.
Symbol Entrez Gene Name Fold Change p value
CD300LB CD300 molecule like family member b -1.64 0.00816
Camp cathelicidin antimicrobial peptide -1.59 0.00206
Dak (TKFC) dihydroxyacetone kinase 2 homolog* -1.57 0.02488
TRIM58 tripartite motif containing 58 -1.49 0.01238
CAPG capping actin protein, gelsolin like -1.45 0.01160
G6PC3 glucose-6-phosphatase catalytic subunit 3 -1.44 0.01214
TRIM9 tripartite motif containing 9 -1.42 0.00159
TGFB1 transforming growth factor beta 1 -1.42 0.01040
MSH2 mutS homolog 2 1.42 0.04096
DHX9 DExH-box helicase 9 1.44 0.00057
ANKRD17 ankyrin repeat domain 17 1.44 0.00999
TIRAP TIR domain containing adaptor protein 1.44 0.04398
Wasl N-WASP, TRS4, Wiskott-Aldrich syndrome-like (human) 1.44 0.02494
Macf1 microtubule-actin crosslinking factor 1 1.45 0.02854
IPO7 importin 7 1.48 0.01445
FCGR1A Fc fragment of IgG receptor Ia 1.49 0.03672
CHUK conserved helix-loop-helix ubiquitous kinase 1.51 0.00615
MAP3K7 mitogen-activated protein kinase kinase kinase 7 1.56 0.00340
IFNGR1 interferon gamma receptor 1 1.66 0.03994
PTPRJ protein tyrosine phosphatase, receptor type J 1.73 0.03931
FYN FYN proto-oncogene, Src family tyrosine kinase 1.78 0.04816
NR3C1 nuclear receptor subfamily 3 group C member 1 1.87 0.03991

112

Kit ligand (Kitlg) was the gene showing the greatest increase in expression in some
macrophage categories, with 2.26-fold increase in GEN-DEHP mix compared to control (Control:
52 ± 5; GEN-DEHP mix: 137 ± 56) (Table 4). It was followed by galactosidase alpha (Gla) and
ribosomal protein S6 kinase A3 (Rps6ka3) increased by 2.14- and 2-fold respectively, ranging
from 50-300 in expression levels, in macrophage categories (Table 4). Other macrophage- and
inflammatory response-related genes increased between 1.9- to 1.5-fold listed only for
macrophages included Nqo1, Il17rb, Lif, Ptprj, Gpr116 (Adgrf5), Pfn2, Bmpr1a, Sema3a, Gja1,
Lox, Dgcr8 and Cbfb, ranging from 50-500 in expression levels (Table 4).
Table 4. Genes related to macrophages uniquely altered by in utero exposure to GEN-DEHP mixture at
10 mg/kg/day in the testes of PND120 rats. Gene expression was determined as described in Table 3.
The data show DEGs selected from relevant gene categories and sub-categories searching the term
“macrophage” on the IPA database.
Macrophages - Inflammatory Responses
Symbol Entrez Gene Name
Fold
Change
p value
Mt1 metallothionein 1 -1.70 0.00475
CAMP cathelicidin antimicrobial peptide -1.59 0.00206
MMP9 matrix metallopeptidase 9 -1.47 0.01597
B4GALNT1 beta-1,4-N-acetyl-galactosaminyltransferase 1 -1.47 0.01705
CAPG capping actin protein, gelsolin like -1.45 0.01160
CXCL17 C-X-C motif chemokine ligand 17 -1.45 0.03744
G6PC3 glucose-6-phosphatase catalytic subunit 3 -1.44 0.01214
NDRG1 N-myc downstream regulated 1 -1.43 0.00006
ADM2 adrenomedullin 2 -1.41 0.00249
NKX2-3 NK2 homeobox 3 -1.41 0.00317
PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1.42 0.03292
TIRAP TIR domain containing adaptor protein 1.44 0.04398
Wasl Wiskott-Aldrich syndrome-like (human) 1.44 0.02494
113

Macf1 microtubule-actin crosslinking factor 1 1.45 0.02854
GNAI1 G protein subunit alpha i1 1.46 0.01876
FCGR1A Fc fragment of IgG receptor Ia 1.49 0.03672
DGCR8 DGCR8 microprocessor complex subunit 1.52 0.00085
LOX lysyl oxidase 1.54 0.02327
GJA1 gap junction protein alpha 1 1.59 0.03630
IFNGR1 interferon gamma receptor 1 1.66 0.03994
SEMA3A semaphorin 3A 1.68 0.02316
PFN2 profilin 2 1.70 0.02818
GPR116 adhesion G protein-coupled receptor F5 (ADGRF5) 1.73 0.04958
PTPRJ protein tyrosine phosphatase receptor type J 1.73 0.03931
FYN FYN proto-oncogene, Src family tyrosine kinase 1.78 0.04816
LIF LIF interleukin 6 family cytokine 1.78 0.00475
IL17RB interleukin 17 receptor B 1.81 0.04050
NQO1 NAD(P)H quinone dehydrogenase 1 1.85 0.01711
NR3C1 nuclear receptor subfamily 3 group C member 1 1.87 0.03991
RPS6KA3 ribosomal protein S6 kinase A3 2.00 0.03825
GLA galactosidase alpha 2.14 0.03680
114

Macrophages - Cell to Cell Signaling and Interactions
Symbol Entrez Gene Name Fold Change p value
MAPT microtubule associated protein tau -1.61 0.01843
CAMP cathelicidin antimicrobial peptide -1.59 0.00206
MMP9 matrix metallopeptidase 9 -1.47 0.01597
EDN2 endothelin 2 -1.46 0.00846
CAPG capping actin protein, gelsolin like -1.45 0.01160
G6PC3 glucose-6-phosphatase catalytic subunit 3 -1.44 0.01214
PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1.42 0.03292
Wasl N-WASP, TRS4, Wiskott-Aldrich syndrome-like (human) 1.44 0.02494
Macrophages - Cellular Development
Symbol Entrez Gene Name Fold Change p value
CAMP cathelicidin antimicrobial peptide -1.59 0.00206
PAX5 paired box 5 -1.51 0.00023
NKX2-3 NK2 homeobox 3 -1.41 0.00317
PROK1 prokineticin 1 -1.40 0.03715
FIP1L1 factor interacting with PAPOLA and CPSF1 1.42 0.00180
PTPN2 protein tyrosine phosphatase non-receptor type 2 1.46 0.01955
RAPGEF4 Rap guanine nucleotide exchange factor 4 1.47 0.00063
VEGFA vascular endothelial growth factor A 1.49 0.04997
DGCR8 DGCR8 microprocessor complex subunit 1.52 0.00085
MAP3K7 mitogen-activated protein kinase kinase kinase 7 1.56 0.00340
IFNGR1 interferon gamma receptor 1 1.66 0.03994
SEMA3A semaphorin 3A 1.68 0.02316
BMPR1A bone morphogenetic protein receptor type 1A 1.69 0.04012
LIF LIF interleukin 6 family cytokine 1.78 0.00475
NR3C1 nuclear receptor subfamily 3 group C member 1 1.87 0.03991
KITLG KIT ligand 2.26 0.02253
115

Macf1 microtubule-actin crosslinking factor 1 1.45 0.02854
FCGR1A Fc fragment of IgG receptor Ia 1.49 0.03672
PELI1 pellino E3 ubiquitin protein ligase 1 1.51 0.01840
GJA1 gap junction protein alpha 1 1.59 0.03630
IFNGR1 interferon gamma receptor 1 1.66 0.03994
PFN2 profilin 2 1.70 0.02818
GPR116 adhesion G protein-coupled receptor F5 (ADGRF5) 1.73 0.04958
PTPRJ protein tyrosine phosphatase receptor type J 1.73 0.03931
FYN FYN proto-oncogene, Src family tyrosine kinase 1.78 0.04816
LIF LIF interleukin 6 family cytokine (NM_022196) 1.78 0.00475
NR3C1 nuclear receptor subfamily 3 group C member 1 1.87 0.03991
Macrophages - Tissue Development
Symbol Entrez Gene Name Fold Change p-value
CAMP cathelicidin antimicrobial peptide -1.59 0.00206
Hmga2 high mobility group AT-hook 2 -1.51 0.01682
PAX5 paired box 5 -1.51 2.26E-04
NKX2-3 NK2 homeobox 3 -1.41 0.00316
PROK1 prokineticin 1 -1.40 0.03715
FIP1L1 factor interacting with PAPOLA and CPSF1 1.42 0.00179
PTPN2 protein tyrosine phosphatase non-receptor type 2 1.46 0.01954
CBFB core-binding factor subunit beta 1.50 0.03057
DGCR8 DGCR8 microprocessor complex subunit 1.52 8.51E-04
IFNGR1 interferon gamma receptor 1 1.66 0.03994
SEMA3A semaphorin 3A 1.68 0.02315
BMPR1A bone morphogenetic protein receptor type 1A 1.69 0.04011
LIF LIF interleukin 6 family cytokine 1.78 0.00474
KITLG KIT ligand 2.26 0.02253

116

Another gene that was increased by more than 2-fold in adult rats exposed to GEN-DEHP
mix at 10 mg/kg/day was prostaglandin reductase 1 (Ptgr1). This gene was not included in the
tables due to one of the three exposed rats presenting a greater increase in Ptgr1 than the two
other rats, leading to a large standard error preventing statistical significance (Control: 75 ± 8;
GEN-DEHP mix: 164 ± 56). Ptgr1 was part of a functional pathway including the upregulated gene
Nr3c1 (Control: 70 ± 9; GEN-DEHP mix: 145 ± 51), classified in innate immunity and macrophage
categories (Tables 3, 4), and the downregulated genes Srf and Pax7 not included in the tables.
Similarly to Ptgr1, the expression of peroxiredoxin 1 (Prdx1) was increased by more than 2-fold
in all rats treated with GEN-DEHP mix at 10 mg/kg/day, but the same outlier rat presented a larger
increase resulting in a large standard error (Control: 163 ± 33; GEN-DEHP mix: 418 ± 186). This
was also the case for two other highly expressed genes, Rab1a and St3gal4, which were
increased by 1.7- and 3.6-fold respectively. These three genes were part of a functional network
including other DEGs reported in tables 3-4, comprising several enzymes, transporters and
transcriptional regulators, (Figure 10A). Among macrophage-related genes downregulated by
more than 50% listed only in table 4 were microtubule associated protein tau (Mapt) and paired
box 5 (Pax5) in the 50-100 intensity range (Table 4).

Figure 28. Functional networks altered in PND3 and PND120 rat testes uniquely altered by fetal
exposure to GEN-DEHP mix at 10 mg/kg/day. Lists of DEGs uniquely altered by GEN-DEHP mix were
generated from the statistical analysis of gene arrays using an unadjusted p-value ≤ 0.05 and a cut-off
fold-change of 40% relative to controls. The lists were then examined for functional network using the
IPA platform, selecting only genes with a fold change ≥ 1.5 and a p-value ≤ 0.05. Direct and indirect
relationships are indicated by lines between genes. The different shapes distinguish different functional
classes of molecules. Red symbol: upregulation; green symbol: downregulation. (A) Functional network
related to the terms “Cell-mediated immune response”, “Cellular compromise”, and “Cellular
development”, involved in protein-protein interactions, gene expression and protein activation among
the most common functions, in PND120 rat testes. (B) Functional network identified with the search
term “inflammation” in PND3 rat testes, including genes related to macrophage functions and leukocyte
accumulation.
117

Regarding the rat exposed to GEN-DEHP mix at dose 10 that presented exacerbated responses,
it is interesting to note that its transcriptome followed the same trends, but with larger amplitudes,
as the other rats exposed to the same treatment. These heightened responses were observed in
some but not all genes. While we randomly picked samples among the offspring of 8 to 9 dams
per treatment for gene array analysis, we found afterward that this particular rat with aggravated
A
B
118

DEGs was infertile. Similarly, one of the rats exposed to GEN-DEHP mix at dose 0.1 mg/kg/day
that was used in gene arrays was found to be infertile. Functional pathway analysis of both rats
identified "inflammation" as an enriched category, positioning inflammatory processes as major
alterations in these infertile rats (Walker et al., 2019). Moreover, the intensified DEGs in the testis
of the rat exposed to dose 10 clustered in two metabolic pathways, one related to glycan
biosynthesis and metabolism (glycosphingolipids, glycosaminoglycan biosynthesis and
metabolism), and the other to lipid metabolism (glycophospholipid biosynthesis, fatty acids
synthesis and metabolism, arachidonic acid metabolism); but none in carbohydrate, animo acid
or energy metabolism (data not shown). This suggests that this rat developed exacerbated
inflammatory responses involving lipid metabolism. The fact that the SD rat strain is outbred might
play a role in the variability in response intensities observed among rats from different litters. Yet,
all rats within a treatment group showed the same increasing or decreasing patterns, despite
difference in amplitudes, suggesting conserved mechanisms of action for GEN-DEHP mixtures.
When applying the same strategy to analyze the list of DEGs unique to GEN-DEHP mix
at dose 10 in PND3 rat testes, only few genes were identified as related to innate immunity and
macrophages, all increased by 1.4 to 1.53-fold (Table 5). The gene syntaxin 4 (Stx4) was
expressed at high level (300-400 range), while Stab1, Trpm4 and Tyk2 had signal intensities
ranging from 50 to 80, the remaining genes being in the 30s intensity range. Some of these genes
were included in functional networks related to macrophage migration and leukocyte
accumulation in neonatal testis (Figure 10B). Among members of these pathways not included in
the tables, two were highly expressed in testis and increased by ~30%, Mylk (Control: 163 ± 11;
GEN-DEHP mix: 216 ± 4) and Mapk13 (Control: 243 ± 34; GEN-DEHP mix: 314 ± 9).

119

Table 5 Genes related to innate immunity or macrophages uniquely altered by in utero exposure to GEN-
DEHP mix at 10 mg/kg/day in the testes of PND3 rats. Gene expression was determined as described in
Table 3.
Symbol Gene Name Fold
Change
p value
Innate immunity
TYK2 tyrosine kinase 2 1.41 0.00678
SH2D1B SH2 domain containing 1B 1.53 0.02255
AGER advanced glycosylation end-product specific receptor 1.52 0.01319
Immune responses of macrophages
AGER advanced glycosylation end-product specific receptor 1.52 0.01319
Tissue Morphology and Development related to Macrophages
STAB1 stabilin 1 1.41 0.01872
TRPM4 transient receptor potential cation channel subfamily M member 4 1.43 0.00025

Comparing the expression levels of genes increased by the mixture in adult testes to their levels
in neonatal testes showed that none of them was significantly altered at PND3. However, the
basal expression level of some of these genes was much higher in neonatal compared to adult
testes. Particularly, Fyn expression was 14 times higher in neonatal testis. Ptgr1 was 4.5 times
higher in PND3 testes than in adult (340 ± 5 in neonate vs 75 ± 8 in adult). Similarly, Kitlg, Gla,
Rps6ka3, Nr3c1, Ptprj and Gpr116 were 3, 2, 3, 4, 2 and 2 times higher respectively in neonatal
testes than in adult testes. Nqo1 and Il17rb were expressed at similar levels at both ages, Pfn2
was 50% higher and Lif was 50% lower at PND3 than in adult. Overall, there was less DEGs
related to inflammation, innate immunity, and macrophages in neonatal testes than in the adult,
despite a stronger expression level for some of these genes in neonatal testes. These data
suggest that the contribution of inflammatory and innate immunity processes to the adult
phenotypes occurs at later ages or progressively during the postnatal development of the testis.
120

Discussion
The current study was undertaken to determine whether fetal exposure to the mixture of
two common EDCs, GEN and DEHP, used at doses relevant to human exposure, would have
different effects on testicular morphology, transcriptome, function and fertility, than exposure to
individual compounds. GEN and DEHP were chosen because they individually disrupt estrogen
and androgen homeostasis and target different nuclear receptor pathways. While GEN is a
phytoestrogen binding on estrogen receptors (Rozman et al., 2006; Breinholt et al., 2000), DEHP
is a Peroxisome proliferator-activated receptor (PPAR) agonist (Maloney et al., 1999) that exerts
anti-androgenic properties without binding androgen receptors (Kavlock et al., 2006). The study
revealed that in utero exposure to a mixture of GEN and DEHP at two doses equivalent to
exposure levels in human (Kavlock et al., 2006, Rozman et al., 2006,), led to cases of infertility
and abnormal testicular phenotypes, mainly atrophy and Sertoli cell-only seminiferous tubules,
which were not observed in control rats. Moreover, the rate of abnormal testes was higher in rats
exposed to the GEN-DEHP mix at both doses than in rats exposed to only GEN or DEHP,
supporting the idea that EDC mixtures might be more deleterious than expected from studies
using individual EDCs.
Gene array data further reinforced this idea by unveiling higher numbers of differentially
expressed genes in the testes of rats exposed in utero to GEN-DEHP mix at 10 mg/kg/day, in
comparison to individual EDCs. This dose corresponds to a human equivalent of 1.6 mg/kg/day,
an exposure level found in humans for both genistein and DEHP, through vegetarian/vegan diets,
and soy formula-fed babies in the case of genistein; and mainly via medical interventions or
occupational exposures for DEHP (Kavlock et al., 2006, Rozman et al., 2006). Functional pathway
analysis of the differentially expressed genes (DERs) positioned inflammatory processes as a top
altered canonical pathway, while cell-type targeted mRNA analysis confirmed an increase in
macrophages in testes, greater in rats exposed to the mixture. More importantly, this was also
true in rats exposed to a hundred-time lower dose of 0.1 mg/kg/day, a dose closer to exposure
121

levels found in the general population. Further analysis of the lists of DERs unique to GEN+DEHP
mixtures using IPA database pinpointed at genes associated to innate immunity and
macrophages, as dysregulated in testis. The finding that fetal exposure to GEN and DEHP
mixtures at doses pertinent to human triggers inflammatory responses in testis concurrent to long-
term phenotypic reproductive changes suggest a causative relationship between these
processes.
The study revealed not only the reproductive toxicity of GEN-DEHP mixtures, but also that
long-term effects could result from fetal exposure to low doses equivalent to levels found in
humans, below the doses previously reported to induce adult adverse reproductive effects.
Although GEN and DEHP have generated numerous animal studies over the last decades, to our
knowledge, none had look at the effects of fetal exposure to their combination at the low dose of
0.1 mg/kg/day before. In our previous studies, the rats were maintained on soy-based chow
providing a basal level of dietary genistein in all treatment conditions, estimated to be ~ 16
mg/kg/day based on the composition of the rat chow (Jones et al., 2014; Jones et al., 2015). The
present study was performed with a soy-free, casein-based diet, insuring that the only genistein
given to the rats was from the treatments. Yet, the dose of 0.1 mg/kg/day of genistein, a 100-
times lower than the dose provided to new born babies fed soy-based formula (Rozman et al.,
2006), was capable of inducing morphological testicular alterations not observed in any of the
control rats. Interestingly, at the 0.1 dose, GEN was found to induce a mixed testicular phenotype
in some rats, which were fertile despite exhibiting a partial Sertoli cell-only tubules phenotype.
This illustrates how rats can tolerate a certain levels of testicular dysgenesis before experiencing
infertility. The most intriguing adult phenotype was an increased incidence of atrophied testes with
Sertoli cell-only phenotype and misshapen seminiferous tubules in the rats exposed in utero to
GEN-DEHP mix at both doses. While we and others reported severe morphological alterations
with very high doses of DEHP, we did not expect to find so much damages with these small doses
122

of EDCs. There was a clear aggravation of the phenotype in rats exposed to the mixture as
compared to individual compounds, confirming a unique and deleterious effect of the mixture.
This type of cocktail effect is reminiscent of a study performed in rats chronically exposed from
conception to adulthood to genistein mixed with the anti-androgen vinclozolin at 1 mg/kg/day,
which reported decreases in sperm counts and quality, as well as in litter size (Eustache et al.,
2009).
The finding that GEN-DEHP mix at the dose of 0.1, but not 10 mg/kg/day, significantly
decreased testosterone levels in adult rats, suggest that fetal exposure to the mixture had
prompted changes leading to functional alterations in adult Leydig cells. Taken together with the
lack of effect of GEN or DEHP alone, these data suggest that the mixture at 0.1 mg/kg/day exerts
unique effects on fetal precursors of Leydig cells or another cell type regulating the developmental
program of Leydig cells, resulting in partially impaired adult Leydig cells. This possibility is
supported by our previous study conducted in the mouse MA-10 Leydig cell line in which GEN-
DEHP mix was found to alter several Leydig cell genes (Jones et al., 2016). However, these
effects were not extensive enough to deplete testosterone to levels that would compromise
spermatogenesis, since most of the EDC-exposed rats were still fertile. Moreover, the decreased
estradiol levels found in rats exposed to 0.1 mg/kg/day of DEHP, in absence of testosterone
decrease, suggest that DEHP fetal exposure might have altered the developmental program of
Sertoli cells, which express aromatase and are a main source of estrogen in testis.
Gestational exposure to high doses of DEHP (e.g. 500 mg/kg/day) was reported by us
and others to suppress testosterone production in fetal, neonatal and adult testis through different
mechanisms, to induce reproductive tract abnormalities, testicular atrophy, Leydig and Sertoli cell
functional alterations and changes in sperm parameters in a dose dependent manner (Kavlock et
al., 2006; Culty et al., 2008; Martinez-Arguelles et al., 2009; Martinez-Arguelles et al., 2013; Albert
et al., 2014; Andrade et al., 2006; Parks et al., 2000). Several epidemiological studies reported
123

strong associations between the levels of DEHP and its metabolites in maternal urine and cord
blood, and the incidence of hypospadias, shortened anogenital distance, both reflecting androgen
deficiency, and altered ratio of androgen to estrogen in babies (Bornehag et al., 2015; Araki et
al., 2014; Botta et al., 2014). These findings are important in supporting the extrapolation from
animals to humans. Conversely, the reproductive effects of genistein, usually examined at lower
and more meaningful doses, were more variable and transitory than those of DEHP, including
transient changes in signaling molecules and germ cell populations in testis and decreased fetal
testosterone production (Rozman et al., 2006; Thuillier et al., 2003; Wang et al., 2004; Thuillier et
al., 2009; Lehraiki et al., 2011). While a study using dietary exposure to a genistein-rich soy diet
reported decreases in epididymal sperm counts and litter size in mice (Cederroth et al., 2010),
another study in mouse found no effect of genistein exposure from gestation to lactation at doses
from 0.1 to 10 mg/kg/day (Fielden et al., 2003). Thus, our finding of increased rates of infertility
in rats exposed to GEN-DEHP mixture and GEN at 0.1 mg/kg/day was surprising. A slight
increase in infertility with GEN at the higher dose of 10 mg/kg/day was expected, in view of a
previous study where we had found small rates of infertility (10 to 16%) in rats exposed to GEN
(Thuillier et al., 2009). The lack of DEHP effect on fertility was in line with a study in Wistar rats
treated with DEHP doses from 3 to 900 mg/kg/day, which reported decreased anogenital
distances and increased nipple retention at the dose of 10 mg/kg/day, but no effect on fertility
(Christiansen et al., 2010). The only phenotype observed at 3 mg/kg/day in this study was a
significant increase in mild external genital dysgenesis, leading the authors propose a lower
sensitivity of the Wistar rat strain to EDCs as compared to SD rats. In our own study using SD
rats, 10 mg/kg/day DEHP had no effect on anogenital distance normalized to rat body weight.
However, our treatment paradigm was devoid of genistein, while the study on Wistar rats was
done using conventional soy-based rat chow, providing a significant amount of dietary genistein.
Thus, the DEHP effects they reported on anogenital distances could be cocktail effects of dietary
genistein and DEHP.
124

A comparative gene array analysis revealed that there were more common DEGs between
the different exposure types in neonatal testis than in adult testis, suggesting that GEN and DEHP
shared more downstream target genes and pathways in neonatal than in adult testis. Indeed,
despite binding on different receptors and activating different signaling pathways, GEN and DEHP
have also been shown to interact on each other's pathways. In addition to its classical effect
mediated by binding on estrogen receptors (Thuillier et al., 2010; Lehraiki et al., 2011), GEN also
exerts various biological effects by binding on the response element of peroxisome proliferator-
activated receptors (PPARs) in the promoter of PPAR gene targets (Patel et al., 2010). It can also
act as scavenger of reactive oxygen species (Patel et al., 2010). We found that its interaction with
platelet-derived growth factor activates the mitogen-activated protein kinase (MAPK) pathway
signaling in neonatal testicular gonocytes (Thuillier et al., 2010). GEN was also shown to alter
DNA methylation in mice (Day et al., 2002). Similarly, beyond binding PPARs, DEHP was reported
to activate antioxidant genes in fetal and neonatal testis (Jones et al., 2015, Liu et al., 2005), to
alter sperm motility via alterations of DNA methylation (Tian et al., 2019), and to induce the
PPARa-dependent repression of estrogen receptor alpha (Esr1) gene expression in ovary
(Meineke et al., 2000). Thus, our data support the possibility that GEN and DEHP act on common
or intersecting molecular pathways in perinatal testis. This is not the case in adult rats exposed
to the same dose, where GEN and DEHP affected distinct sets of genes.
GEN-DEHP mix induced mostly unique DERs, especially in adults exposed to the higher
dose, sharing only 12% of its DEGs with DEHP, and less than 10 genes with GEN. These data
demonstrate that the concomitant exposure of the testis to GEN and DEHP affect testicular cells
in a distinct manner and emphasize the importance of studying EDC mixtures and their
mechanisms of action. Functional pathway analysis of Gen-DEHP mix-induced DEGs highlighted
inflammatory processes as a major target of this EDC mixture, in agreement with our previous
study in soy diet-fed rats (Jones et al., 2014). Next, we found that fetal exposure to GEN-DEHP
125

mix at both doses increased simultaneously the expression of Cd13, Cd33 and Cd38, genes
found in myeloid progenitors, monocytes and macrophages, mast cells and granulocytes
(Teodosio et al., 2015; Amici et al., 2018), and CD68, a marker for tissue-resident macrophages
often associated with increased pro-inflammatory cytokines, together with an increase of CD68
+

macrophages in testis sections. Overall, GEN-DEHP mixtures were the only treatments inducing
consistent responses in innate immune cell markers, supporting the idea that fetal exposure to
these low dose mixtures may lead to the long-term recruitment and/or activation of innate immune
cells, particularly pro-inflammatory macrophages, potentially contributing to adverse
consequences in adult testis. These effects might be indicative of inflammation, a process related
to abnormal spermatogenesis and infertility in man (Apa et al., 2002). The fact that GEN and
DEHP used alone targeted CD68
+
testicular macrophages only at the lower dose suggest that
they have non-monotonic effects on testicular cells. Furthermore, the finding that their mixture
increases CD68
+
macrophages at both doses is one more indication that the mixture triggers
unique effects in these cells.
Macrophage are critical for the maintenance of testicular immune privilege, provided by a
balance between two types of testicular macrophages, the M1 pro-inflammatory type, and the M2,
alternative, anti-inflammatory type, identified using the marker CD163 (Galli et al., 2011; Gieri et
al., 2002; Shapouri-Moghaddam et al., 2018; Winnall et al., 2011; Mossadegh-Keller et al., 2018).
Thus, our finding that in utero exposure to GEN-DEHP mix at both doses triggered simultaneous
increases in gene expression of the anti-inflammatory marker CD163, and in CD163+
macrophages in both neonatal and adult rats may represent compensatory reactions by anti-
inflammatory macrophages, to counter the activation of inflammatory responses in testis at both
ages. Studies have shown that CD163
+
macrophages tend to be more abundant in the testis than
Cd68
+
macrophages (Winnall et al., 2011; Mossadegh-Keller et al., 2018; Loveland et al., 2017).
All resident macrophages are believed to be CD68
+
, and a subset of these cells will undergo
126

polarization toward the CD163
+
M2 phenotype (Mossadegh-Keller et al., 2018; Loveland et al.,
2017). Thus, the increased mRNA levels of Cd68 likely represent both an increase in M1 polarized
macrophages and in non-polarized resident macrophages.
While we were expecting increases in pro-inflammatory cytokines such as IL6 and Tnfa in
parallel with pro-inflammatory macrophage markers, the elevated population of CD163
+
macrophages predicted a concomitant increase in IL10. However, the only response consistent
with inflammation was an increase in Tnfa by GEN-DEHP mix at 10 mg/kg/day, which could
originate from M1 activated macrophages (Teodosio et al., 2015; Arango et al., 2014). The
concurrent increases by GEN-DEHP mix of innate immune cell markers and Tnfa, which could
activate fibroblasts and peritubular myoid cells to produce fibrosis-related collagens (Parente et
al., 2004; Mayerhofer et al., 2013), supports the occurrence of inflammation in the testes of adult
rats exposed to GEN-DEHP mix 10. This was further suggested by simultaneous increases in
Collagen I and IV expression (Parente et al., 2004). Interestingly, Collagen IV was shown to be
secreted by adult Leydig cells, and to downregulate their steroidogenesis (Diaz et al., 2005). Thus,
the increase in Collagen IV observed in the testes of rats exposed to GEN-DEHP mix at 0.1
mg/kg/day could be related to the concomitant decrease in testosterone observed in the same
condition. The differential effects found on the expression of IL6, Tnfa and IL10 in total testis
extracts likely reflect the fact that Il6 and Il10 are produced not only by immune cells, but also by
Leydig, Sertoli, peritubular myoid and germ cells, while TNFa is also produced by Sertoli and
germ cells (Parente et al., 2004). Moreover, the possibility that IL6 may not act only as a pro-
inflammatory cytokine, but that it might also participate to anti-inflammatory or regenerative
processes cannot not be excluded (Scheller et al., 2011). Thus, a better understanding of the role
of these cytokines and the contribution of M1 macrophages within the CD68
+
macrophage
population altered by GEN-DEHP mix will require further experiments. Particularly, it will be
interesting to identify the testicular cell type in which TNFa was dramatically decreased by the low
127

doses of GEN, DEHP and their mixture.
As expected in pro-inflammatory conditions, GEN-DEHP mix at 0.1 mg/kg/day at both
ages reduced the expression levels of Anxa1, a gene expressed by macrophages, where it acts
as a negative regulator of inflammation through the inhibition of phospholipase A2 (PLA2) or via
glucocorticoid-dependent repression of IL6 and TNFa production (Yang et al., 2009; Silva et al.,
2019; Lim et al., 2007). However, Anxa1 was increased by the mixture at dose 10. This dichotomy
of effects might be explained by the fact that Anxa1 is not only expressed in M1 macrophages,
but also in M2 macrophages, where it is involved in phagocytosis (Silva et al., 2019), and in Leydig
cell progenitors and a Leydig cell line (Ge et al., 2005; Fan et al., 2010), and was shown to inhibit
testosterone production (Cover et al., 2002). These data further illustrate the complexity of the
responses to EDCs that take place in the testis, due to the multiple cell types present, and the
possibility that they might be differently affected by the same EDC or that their interactions might
be altered.
A detailed analysis of the list of genes uniquely altered by GEN-DEHP mix 10 in relation
to inflammation and innate immunity unveiled several genes that were upregulated in the testis
and known to play a role in macrophage functions. Among them was Kit ligand (Kitlg/Scf), which
was found expressed in cardia myeloid precursors and proposed to play a role in the renewal of
cardiac resident macrophages (Leinonen et al., 2016). An increase in Kit ligand in testis will likely
have consequences on spermatogonial differentiation, since its receptor c-Kit (CD117) is one of
proteins involved in spermatogonial differentiation (Manku et al., 2015). One of the other
upregulated gene was Fyn, a Src protein that interacts with Kit upon ligand binding. The
upregulation of these two genes by GEN-DEHP mix suggest that they may act together here.
Another gene of interest was Rps6ka3 (Rsk2), which was found to mediate cell division, the
activation of transcription factors in response to stress, and TLR4-induced pinocytosis in LPS-
stimulated dendritic cells (Zaal et al., 2017). Interestingly, genistein was reported to exert anti-
128

inflammatory effects by suppressing the TLR4-mediated activation in LPS-stimulated microglia
(Jeng et al., 2014). Other interacting upregulated genes likely involved in macrophage activation
were Nr3c1, a glucocorticoid receptor participating to the priming of innate immune cells to
infection or injury by stress-induced sensitization of pro-inflammatory immune responses in
microglia (Frank et al., 2013), and Ptgr1, an enzyme involved in the inactivation of leukotriene B4
(Kakinoki et al., 2020). Ptprj (Dep-1/CD148) is a positive regulator of Src in macrophage,
regulating immunoreceptor signaling in these cell as well as B cells (88). The upregulation of the
cytokine LIF (Gp190), which induces hematopoietic cell differentiation may represent changes in
macrophage function (Pascual-Garcia et al., 2019). Lif has other functions in testis, such as a role
in gonocytes survival and SSC proliferation, and its production by peritubular myoid and Sertoli
cells can be altered by Tnfa and by inflammatory triggers (Wang et al., 2014; Piquet-Pellorce et
al., 2000). Moreover, Lif was shown to increase steroid production by immature rat Leydig cells
and may play a role in DEHP-driven Leydig cells aggregation at a high DEHP dose (Wang et al.,
2016; Lin et al., 2008). Thus, the increased expression of Lif in response to Gen-DEHP mix could
alter the behavior of several cell types within the testis. Another upregulated gene related to
inflammatory responses and cell to cell signaling in macrophages was the orphan G protein-
coupled receptor Gpr116 (Adgrf5/Ig-Hepta). This gene was shown to be a negative regulator of
pro-inflammatory alveolar macrophages, suggesting that its increase in our model could be
attributed to M2 anti-inflammatory macrophage activity (Ariestanti et al., 2015). Taken together,
the upregulation of Prdx1 and Nqo1 in adult testes suggests the induction of long-term antioxidant
responses following fetal exposure to GEN-DEHP mix. The upregulation in pro-inflammatory
macrophages of Pfn2 (Profilin 2) could affect the innate immune response of germ cells,
particularly spermatids, via the induction of Toll-like receptor 11 (TLR11), as shown in the testes
and isolated germ cells from mice treated with Profilin or uropathogenic E. coli e-coli (Chen et al.,
2014). These genes represent those with the highest fold-changes in response to GEN-DEHP
129

mix, but other genes altered at lower levels in whole testis might play critical roles, as suggested
by the multiple functional pathways altered in testis.
In summary, this study revealed that gestational exposure to a mixture of two common
EDCs, GEN and DEHP, at low doses within the range of human exposure, increases the rates of
infertility and abnormal testicular morphology, while altering the testicular transcriptome and
innate immune cells, particularly macrophages, in a unique manner. The study also pointed out
to distinct effects of Gen, particularly its stronger effects at the lowest dose, suggesting non-
monotonic effects. Moreover, GEN greater effects on neonatal testicular transcriptome suggests
that its reproductive effects in adult likely originate from the perinatal disruption of developmental
programs in the testis. Conversely, DEHP shared several altered genes with GEN-DEHP mixture,
implying that some of its effects were retained in rats co-exposed to GEN, simultaneously with
genes altered exclusively by the mixture. Moreover, our study unveiled the upregulation of genes
related to inflammatory and anti-inflammatory processes in macrophages specifically altered by
fetal exposure to the EDC mixture in adult rat testis, likely mediating a variety of effects on multiple
testicular cell types. Some of the altered factors may be produced by multiple testicular cell types
and exert their effects on several cell types. Thus, the probable target cells of GEN and DEHP
mixture, direct or indirect, include germ cells, Leydig, myoid and Sertoli cells, as well as
macrophages, highlighting the complex interactions taking place within the testis, and the multiple
possible targets of GEN and DEHP mixtures in this tissue (Figure 11).

130

Leydig cell Sertoli cell
Germ cells
Macrophage
Myoid
cell
GEN+DEHP
Mast cell
Spermatogenesis
SSC formation
GEN+DEHP
GEN+DEHP
T, E
2

GEN+DEHP
M1 M2
E
2

GEN+DEHP
Figure 29. Proposed testicular targets of fetal exposure to low doses of GEN and DEHP mixtures, and
cell-cell interactions. Based on the present data and the literature, we propose that testicular
macrophages and their interactions with other testicular cell types are altered as a result of fetal exposure
to GEN and DEHP mixtures. While the results show that innate immune cells and in particular testicular
macrophages were affected by fetal exposure to GEN and DEHP mixtures, There are multiple examples
in the literature of physiological interactions between testicular macrophages with germ, Leydig, Sertoli,
mast and peritubular myoid cells. Independent of being direct or indirect effects on macrophages, the
existence of such interactions clearly suggest that GEN+DEHP-driven changes in testicular macrophages
could contribute to some of the observed adverse effects of these EDCs on testicular development and
male reproduction.
131

Acknowledgements: The authors would like to thank the Southern California Clinical and
Translational Science Institute (SC CTSI) Biostatistics Core and the Norris Library Bioinformatics
Support Center (USC Health Science Campus; Los Angeles, CA, USA) for the assistance
provided to CW with the platforms used for Statistical and functional pathway analysis.

132

Chapter V
DISCUSSION

Key Findings
Here I have showed that in utero exposure to low doses of genistein and DEHP mixtures
affects the developmental programming of key testicular cell types in adult rat testes. I found
that pathway analysis revealed alterations in pathways related to Sertoli and germ cells. I also
found that the transcription factor, Foxa3, was decreased in PND120 rat testes exposed to low
dose mixtures of Gen+DEHP. Foxa3 has been identified in Sertoli, germ and Leydig cells and
has been found to be important for fertility. Since Foxa3 was decreased in whole testes extracts
for my project, I then wanted to determine the specific cell type(s) where Foxa3 was decreased.
In silico studies using TRANSFAC and Ingenuity Pathway Analysis found that Foxa3 has been
reported to bind to genes that are related to Leydig cells and steroidogenesis. I further did qPCR
for genes related to steroidogenesis and found genes altered by in utero exposure to
Gen+DEHP mixtures, further suggesting that steroidogenesis is affected by low doses of
Gen+DEHP. Another interesting finding is that another FoxA family member, Foxa1, was also
found to be decreased by low doses of Gen+DEHP, is a target of Foxa3, and related to
steroidogenesis. Furthermore, Foxa1 has been found to bind to DNA methyltransferase,
DNMT3A. DNMT3a is an enzyme responsible for de novo methylation establishing new DNA
methylation marks in the developing embryo. EDCs have been found to affect this process and
data from Chapter 3 of this thesis show that DNA methylation patterns are also altered by in
utero exposure to low dose mixtures of Gen+DEHP. Lastly, we also found that innate immune
cells were also affected by low doses of EDCs with more dramatic effects in the mixtures than
for Gen or DEHP alone. Taken together, these data suggest that in utero exposure to low dose
EDC mixtures affect Sertoli, germ, and Leydig cells within the testis and can alter the program of
these cell types.
133

Future Research
Furthermore, I would like to identify targets of Foxa3 in our samples, and determine how
Foxa3 regulations expression of downstream targets such as Pdgfra. I aim to do this through
the use of Chromatin Immunoprecipitation (ChIP) coupled with Next Generation Sequencing to
identify gene targets of this transcription factor. ChIP is a method used to determine whether a
given protein binds to or is localized to a specific DNA sequence in vivo. I would first crosslink
Foxa3 transcription factor protein to the DNA in control and Gen+DEHP exposed rat testes.
Next, I will shear the DNA into fragments small enough to be sequenced. The product from the
sequencing will reveal the genes that Foxa3 is bound to. After I will use bioinformatics software
to identify the function(s) of each gene while specifically focusing on genes relating to testes
development and function. I will then assess the mRNA expression level in these target genes
that are related to testes development and function by conducting qPCR in control and
Gen+DEHP exposed rat testes. Through these experiments I expect to find target genes of
Foxa3 that are critical for the development and functioning of the testis, and differences in the
mRNA expression for these genes in control and Gen+DEHP rat testes. I would also like to use
laser capture microscopy to extract cells from our testes samples and conduct pathway analysis
in these cell types.
I would like to extend this approach the epigenetics study. Here I showed that DNA methylation
patterns were altered in F1 adult rat testes, however I also found alterations in histone
modifications as well. Not shown in this thesis, I found that the gene expression of six genes
related to epigenetic processes were significantly reduced in GEN+DEHP exposed F1 rats,
Dnmt3a, Brwd1, Ezh1, Atrx, Tet1 and Mov10l1. However, in F2 rats, the transcripts of these genes
had returned to control levels, except for Mov10l1 that showed a clear decreasing trend with the
mixture (p=0.055). In F3 rats, GEN was the only treatment showing significant decreases in
Brwd1, Ezh1, and a decreasing trend in Tet1. However, adverse reproductive phenotypes were
134

clearly visible in F2 and F3 generations. Additionally, I would like to use CHiP-seq to identify
altered histone-DNA interactions between control and EDCs-exposed rats from first generation
(F1), F2, and F3. I also would like to search for differentially methylated regions in the DNA of
testes from control and EDCs-exposed rats using a PCR-based Bisulfite-modified DNA analysis
of whole testis DNA.

Another interesting area of research for this project include how Gen+DEHP induces
downregulation of Foxa3. Not shown, I also found that there is a CpG island in the promoter region
of Foxa3, and that the Foxa3 gene contains an ERalpha binding site. This could suggest that
genistein could directly bind to the Foxa3 gene, however, we would need to determine how DEHP
also plays a role in Foxa3’s downregulation. I would also like to do bisulfite sequencing of CpG
islands in the promoters of Foxa3 for testes from control and in utero exposed rats.

Limitations
I am limited in the model used for the study. It is ideal in most research to include human
samples, however due to ethical concerns we would not be able to obtain testicular samples.

Conclusion
This study identifies a critical need to determine new toxicological endpoints in evaluating
reproductive toxicology. The doses used in this study are below the doses used in traditional
toxicology studies and are also below the L/NOAEL for genistein and DEHP. However, the data
presented here show that environmentally relevant doses of genistein and DEHP mixtures has
adverse reproductive effects on neonatal and adult rat testes which can be translated to
adverse effects in humans.

135

REFERENCES
Barratt, C. L. R., Björndahl, L., De Jonge, C. J., Lamb, D. J., Martini, F. O., Mclachlan, R., …
Tournaye, H. (2017). The diagnosis of male infertility: an analysis of the evidence to
support the development of global WHO guidance-challenges and future research
opportunities. Human Reproduction Update, 23(6), 660–680.
https://doi.org/10.1093/humupd/dmx021
Behr, R., Sackett, S. D., Bochkis, I. M., Le, P. P., & Kaestner, K. H. (2007). Impaired male
fertility and atrophy of seminiferous tubules caused by haploinsufficiency for Foxa3.
Developmental Biology, 306(2), 636–645. https://doi.org/10.1016/j.ydbio.2007.03.525
Benayoun, B. A., Caburet, S., & Veitia, R. A. (2011, June). Forkhead transcription factors: Key
players in health and disease. Trends in Genetics, Vol. 27, pp. 224–232.
https://doi.org/10.1016/j.tig.2011.03.003
Berger, S. L., Kouzarides, T., Shiekhattar, R., & Shilatifard, A. (2009). An operational definition
of epigenetics. Genes and Development, 23(7), 781–783.
https://doi.org/10.1101/GAD.1787609
Buñay, J., Larriba, E., Moreno, R. D., & Del Mazo, J. (n.d.). Chronic low-dose exposure to a
mixture of environmental endocrine disruptors induces microRNAs/isomiRs deregulation in
mouse concomitant with intratesticular estradiol reduction OPEN.
https://doi.org/10.1038/s41598-017-02752-7
Cargnelutti, F., Di Nisio, A., Pallotti, F., Sabovic, I., Spaziani, M., Grazia Tarsitano, M., …
Foresta, C. (2020). Effects of endocrine disruptors on fetal testis development, male
puberty, and transition age. Endocrine, 72, 358–374. https://doi.org/10.1007/s12020-020-
02436-9
Garon, G., Bergeron, F., Brousseau, C., Robert, N. M., & Tremblay, J. J. (2017). FOXA3 is
expressed in multiple cell lineages in the mouse testis and regulates Pdgfra expression in
leydig cells. Endocrinology, 158(6), 1886–1897. https://doi.org/10.1210/en.2016-1736
Heger, N. E., Hall, S. J., Sandrof, M. A., Mcdonnell, E. V., Hensley, J. B., McDowell, E. N., …
Boekelheide, K. (2012). Human fetal testis xenografts are resistant to phthalate-induced
endocrine disruption. Environmental Health Perspectives, 120(8), 1137–1143.
https://doi.org/10.1289/ehp.1104711
Jenardhanan, P., Panneerselvam, M., & Mathur, P. P. (2016). Effect of environmental
contaminants on spermatogenesis. Seminars in Cell and Developmental Biology, 59, 126–
140. https://doi.org/10.1016/j.semcdb.2016.03.024
Jones, S., Boisvert, A., Francois, S., Zhang, L., & Culty, M. (2015). In Utero Exposure to Di-(2-
Ethylhexyl) Phthalate Induces Testicular Effects in Neonatal Rats That Are Antagonized by
Genistein Cotreatment 1. BIOLOGY OF REPRODUCTION, 93(4), 92–93.
https://doi.org/10.1095/biolreprod.115.129098
Krausz, C., & Riera-Escamilla, A. (2018). Genetics of male infertility. Nature Reviews Urology.
https://doi.org/10.1038/s41585-018-0003-3
Lymperi, S., & Giwercman, A. (2018). Endocrine disruptors and testicular function. Metabolism:
Clinical and Experimental, 86, 79–90. https://doi.org/10.1016/J.METABOL.2018.03.022
Manku, G., & Culty, M. (n.d.). Regulation of Translocator Protein 18 kDa (TSPO) Expression in
136

Rat and Human Male Germ Cells. International Journal of Molecular Sciences Article.
https://doi.org/10.3390/ijms17091486
Midzak, A., Rone, M., Aghazadeh, Y., Culty, M., & Papadopoulos, V. (2011). Mitochondrial
protein import and the genesis of steroidogenic mitochondria. Molecular and Cellular
Endocrinology, 336(1–2), 70–79. https://doi.org/10.1016/J.MCE.2010.12.007
Rasmussen, K. D., & Helin, K. (2016). Role of TET enzymes in DNA methylation, development,
and cancer. https://doi.org/10.1101/gad.276568
Sharma, A., Minhas, S., Dhillo, W. S., & Jayasena, C. N. (2021). Male infertility due to testicular
disorders. The Journal of Clinical Endocrinology & Metabolism, 106(2), 442–459.
https://doi.org/10.1210/clinem/dgaa781
Sharma, A., Mollier, J., Richard, |, Brocklesby, W. K., Caves, C., Jayasena, C. N., & Minhas, S.
(2020). | INTRODUC TI ON Endocrine-disrupting chemicals and male reproductive health.
Reprod Med Biol, 19, 243–253. https://doi.org/10.1002/rmb2.12326
Sharpe, R. M., & Skakkebaek, N. E. (2008, February). Testicular dysgenesis syndrome:
mechanistic insights and potential new downstream effects. Fertility and Sterility, Vol. 89.
https://doi.org/10.1016/j.fertnstert.2007.12.026
Sidorkiewicz, I., Zarȩba, K., Wołczyński, S., & Czerniecki, J. (2017). Endocrine-disrupting
chemicals - Mechanisms of action on male reproductive system. Toxicology and Industrial
Health, 33(7), 601–609. https://doi.org/10.1177/0748233717695160
Walker, C., Garza, S., Papadopoulos, V., & Culty, M. (2021). Impact of endocrine-disrupting
chemicals on steroidogenesis and consequences on testicular function. Molecular and
Cellular Endocrinology, 527. https://doi.org/10.1016/j.mce.2021.111215
Walker, C., Ghazisaeidi, S., Collet, B., Boisvert, A., & Culty, M. (2020). In utero exposure to low
doses of genistein and di-(2-ethylhexyl) phthalate (DEHP) alters innate immune cells in
neonatal and adult rat testes. Andrology, 8(4). https://doi.org/10.1111/andr.12840
Zarean, M., Keikha, M., Poursafa, P., Khalighinejad, P., Amin, M., & Kelishadi, R. (n.d.). A
systematic review on the adverse health effects of di-2-ethylhexyl phthalate. Environmental
Science and Pollution Research. https://doi.org/10.1007/s11356-016-7648-3
Zhang, S., Mo, J., Wang, Y., Ni, C., Li, X., Zhu, Q., & Ge, R. S. (2019). Endocrine disruptors of
inhibiting testicular 3β-hydroxysteroid dehydrogenase. Chemico-Biological Interactions,
303, 90–97. https://doi.org/10.1016/J.CBI.2019.02.027

Aguilera O, Fernandez AF, Munoz A, Fraga MF 2010 Epigenetics and environment: a complex
relationship. J Appl Physiol, 109:243-251
Albert O, Jegou B. (2014) A critical assessment of the endocrine susceptibility of the human
testis to phthalates from fetal life to adulthood. Hum Reprod Update 20, 231-49.
Amici SA, Young NA, Narvaez-Miranda J, Jablonski KA, Arcos J, Rosas L, Papenfuss TL,
Torrelles JB, Jarjour WN, Guerau-de-Arellano M.(2018) CD38 is robustly induced in human
macrophages and monocytes in inflammatory conditions. Front Immunol 9, 1593.
Andrade AJ, Grande SW, Talsness CE, Gericke C, Grote K, Golombiewski A, Sterner-Kock A,
137

Chahoud I. (2006) A dose response study following in utero and lactational exposure to di-(2-
ethylhexyl) phthalate (DEHP): reproductive effects on adult male offspring rats. Toxicology 228,
85-97.
Apa DD, Cayan S, Polat A, Akbay E. (2002) Mast cells and fibrosis on testicular biopsies in
male infertility. Arch Androl 48, 337-344.
Araki A, Mitsui T, Miyashita C, Nakajima T, Naito H, et al. (2014) Association between Maternal
Exposure to di(2-ethylhexyl) Phthalate and Reproductive Hormone Levels in Fetal Blood: The
Hokkaido Study on Environment and Children’s Health. PLoS ONE 9(10): e109039
Araki A, Mitsui T, Miyashita C, Nakajima T, Naito H, et al. (2014) Association between Maternal
Exposure to di(2-ethylhexyl) Phthalate and Reproductive Hormone Levels in Fetal Blood: The
Hokkaido Study on Environment and Children’s Health. PLoS ONE 9, e109039.
Arango Duque G, Descoteaux A. (2014) Macrophage cytokines: involvement in immunity and
infectious diseases. Front Immunol 5, 491.
Ariestanti DM, Ando H, Hirose S, Nakamura N. (2015) Targeted Disruption of Ig-Hepta/Gpr116
Causes Emphysema-like Symptoms That Are Associated with Alveolar Macrophage Activation.
J Biol Chem 290, 11032-11040.
Ariyaratne HB, Chamindrani Mendis-Handagama S 2000 Changes in the testis interstitium of
Sprague Dawley rats from birth to sexual maturity. Biol Reprod, 62:680-690
Atanassova N, McKinnell C, Turner KJ, Walker M, Fisher JS, Morley M, Millar MR, Groome NP,
Sharpe RM 2000 Comparative effects of neonatal exposure of male rats to potent and weak
(environmental) estrogens on spermatogenesis at puberty and the relationship to adult testis
size and fertility: Evidence for stimulatory effects of low estrogen levels. Endocrinology,
141:3898-3907
Barker D. (2004) The developmental origins of adult disease. Journal of the American College
of Nutrition 23, 588S-595S.
Basciani S, De Luca G, Dolci S, Brama M, Arizzi M, Mariani S, Rosano G, Spera G, Gnessi L
2008 Platelet-derived growth factor receptor beta-subtype regulates proliferation and migration
of gonocytes. Endocrinology, 149:6226-6235
Behr R, Sackett SD, Bochkis IM, Le PP, Kaestner KH 2007 Impaired male fertility and atrophy
of seminiferous tubules caused by haploinsufficiency for Foxa3. Dev Biol 306:636-645
Boisvert A, Jones S, Issop L, Erythropel HC, Papadopoulos V, Culty M 2016 In vitro Functional
screening as a means to identify new plasticizers devoid of reproductive toxicity. Environ Res,
150:496-512
Boisvert A, Jones S, Issop L, Erythropel HC, Papadopoulos V, Culty M. (2016) In vitro
Functional screening as a means to identify new plasticizers devoid of reproductive toxicity.
Environ Res 150, 496-512.
Bornehag CG, Carlstedt F, Jönsson BA, Lindh CH, Jensen TK, Bodin A, Jonsson C, Janson S,
Swan SH. 2015. Prenatal phthalate exposures and anogenital distance in Swedish boys.
Environ Health Perspect 123:101-107
138

Bornehag CG, Carlstedt F, Jönsson BA, Lindh CH, Jensen TK, Bodin A, Jonsson C, Janson S,
Swan SH. (2015) Prenatal phthalate exposures and anogenital distance in Swedish boys.
Environ Health Perspect 123, 101-107.
Bose R, Sheng K, Moawad AR, *Manku G, O'Flaherty C, Taketo T, Culty M, Fok KL, Wing SS.
2017 Ubiquitin Ligase Huwe1 Modulates Spermatogenesis by Regulating Spermatogonial
Differentiation and Entry into Meiosis. Scientific Reports, 7(1):17759.
Botta S, Cunha GR, Baskin LS. (2014) Do endocrine disruptors cause hypospadias? Transl
Androl Urol 3, 330-339.
Breinholt V, Hossaini A, Svendsen GW, Brouwer C, Nielsen E. (2000) Estrogenic activity of
flavonoids in mice. The importance of estrogen receptor distribution, metabolism and
bioavailability. Food Chem Toxicol 38, 555-564.
Brouard V, Cui H, Mahin S, Tran A, Culty M. 2019 In vitro effects of genistein and mono-(2-
ethylhexyl) phthalate (MEHP) on Macrophage inflammatory responses and Spermatogonial
functions. Abstracts from the 44nd American Society of Andrology Annual Meeting, 6-9 April
2019, Chicago, IL. Andrology, 7(S1):45
Cederroth CR, Zimmermann C, Beny JL, Schaad O, Combepine C, Descombes P, Doerge DR,
Pralong FP, Vassalli JD, Nef S. (2010) Potential detrimental effects of a phytoestrogen-rich diet
on male fertility in mice. Mol Cell Endocrinol 321, 152-160.
Chang HC, Churchwell MI, Delclos KB, Newbold RR, Doerge DR 2000 Mass spectrometric
determination of Genistein tissue distribution in diet-exposed Sprague-Dawley rats. J Nutr
130:1963-1970
Chang HC, Churchwell MI, Delclos KB, Newbold RR, Doerge DR. (2000) Mass spectrometric
determination of Genistein tissue distribution in diet-exposed Sprague-Dawley rats. J Nutr 130,
1963-1970.
Chen J, Wu S, Wen S, Shen L, Peng J, Yan C, Xining Cao, Yue Zhou, Chunlan Long, Tao Lin,
Dawei He, Yi Hua, Guanghui Wei. 2015 The Mechanism of Environmental Endocrine Disruptors
(DEHP) Induces Epigenetic Transgenerational Inheritance of Cryptorchidism. PLoS ONE 10(6):
e0126403
Chen JJ, Lukyanenko Y, Hutson JC. 2002 25-hydroxycholesterol is produced by testicular
macrophages during the early postnatal period and influences differentiation of Leydig cells in
vitro. Biol Reprod; 66(5):1336-41
Chen Q, Zhu W, Liu Z, Yan K, Zhao S, Han D. (2014) Toll-Like Receptor 11-Initiated Innate
Immune Response in Male Mouse Germ Cells. Biol Reprod 90, 38.
Chou CK, Huang HW, Yang CF, Dahms HU, Liang SS, Wang TN, Kuo PL, Hsi E, Tsai EM, Chiu
CC. 2019 Reduced camptothecin sensitivity of estrogen receptor ‐positive human breast cancer
cells following exposure to di(2 ‐ethylhexyl)phthalate (DEHP) is associated with DNA methylation
changes. Environ Toxicol. 2019 Apr;34(4):401-414.
Christiansen S, Boberg J, Axelstad M, Dalgaard M, Vinggaard AM, Metzdorff SB, Hass U.
(2010) Low-dose perinatal exposure to di(2-ethylhexyl) phthalate induces anti-androgenic
effects in male rats. Reprod Toxicol 30, 313-321.
139

Cover PO, Baanah-Jones F, John CD, Buckingham JC. (2002) Annexin 1 (lipocortin 1) mimics
inhibitory effects of glucocorticoids on testosterone secretion and enhances effects of
interleukin-1beta. Endocrine 18, 33-39.
Culty M 2009 Gonocytes, the forgotten cells of the germ cell lineage. Birth Defects Research
Part C; 87:1-26
Culty M 2013 Gonocytes, from the Fifties to the Present: Is There a Reason to Change the
Name? Biol Reprod, 89:46, 1-6
Culty M, Thuillier R, Li W, Wang Y, Martinez-Arguelles DB, Gesteira Benjamin C, Triantafilou
KM, Zirkin BR, and Papadopoulos V 2008 In utero exposure to di-(2-ethylhexyl) phthalate exerts
both short-term and long-lasting suppressive effects on testosterone production. Biol Reprod,
78:1018-1028
Culty M, Thuillier R, Li W, Wang Y, Martinez-Arguelles DB, Gesteira Benjamin C, Triantafilou
KM, Zirkin BR, and Papadopoulos V. (2008) In utero exposure to di-(2-ethylhexyl) phthalate
exerts both short-term and long-lasting suppressive effects on testosterone production. Biol
Reprod 78, 1018-1028.
Culty M. (2009) Gonocytes, the forgotten cells of the germ cell lineage. Birth Defects Res C
Embryo Today 87, 1-26.
Culty M. (2013) Gonocytes, from the Fifties to the Present: Is There a Reason to Change the
Name? Biol Reprod 89, 46, 1-6.
Dahl C, Hoffmann HJ, Saito H, Schiøtz PO. (2004) Human mast cells express receptors for IL-3,
IL-5 and GM-CSF;a partial map of receptors on human mast cells cultured in vitro. Allergy 59,
1087-1096.
Day JK, Bauer AM, DesBordes C, Zhuang Y, Kim BE, Newton LG, Nehra V, Forsee KM,
MacDonald RS, Besch-Williford C, Huang TH, Lubahn DB. (2002) Genistein alters methylation
patterns in mice. J Nutr. 132, 2419S-2423S.
De Falco, Forte MM, Laforgia V. (2015) Estrogenic and anti-androgenic endocrine disrupting
chemicals and their impact on the male reproductive system. Frontiers in Environmental
Science 3, 3.
DeFalco T, Potter SJ, Williams AV, Waller B, Kan MJ, Capel B. 2015 Macrophages Contribute
to the Spermatogonial Niche in the Adult Testis. Cell Reports 12:1107–1119
Degen GH, Janning P, Diel P, Bolt HM 2002 Estrogenic isoflavones in rodent diets. Toxicol Lett.
128(1-3):145-57
Diaz ES, Pellizzari E, Casanova M, Cigorraga SB, Denduchis B. (2005) Type IV Collagen
Induces Down-Regulation of Steroidogenic Response to Gonadotropins in Adult Rat Leydig
Cells Involving Mitogen-Activated Protein Kinase. Mol Reprod Dev 72, 208-215.
Dietrich D, Lesche R, Tetzner R, Krispin M, Dietrich J, Haedicke W, Schuster M, Kristiansen G.
Analysis of DNA Methylation of Multiple Genes in Microdissected Cells From Formalin-fixed and
Paraffin-embedded Tissues. J Histochem Cytochem. 2009 May; 57(5): 477-489
Engel SM, Levy B, Liu Z, Kaplan D, Wolff MS 2006 Xenobiotic phenols in early pregnancy
140

amniotic fluid. Reproductive Toxicology, 21:110-112
Eustache F, Mondon F, Canivenc-Lavier MC, Lesaffre C, Fulla Y, Berges R, Cravedi JP,
Vaiman D, Auger J 2009 Chronic dietary exposure to a low-dose mixture of genistein and
vinclozolin modifies the reproductive axis, testis transcriptome, and fertility. Environ Health
Perspect, 117:1272-1279
Eustache F, Mondon F, Canivenc-Lavier MC, Lesaffre C, Fulla Y, Berges R, Cravedi JP,
Vaiman D, Auger J. (2009) Chronic dietary exposure to a low-dose mixture of genistein and
vinclozolin modifies the reproductive axis, testis transcriptome, and fertility. Environ Health
Perspect 117, 1272-1279.
Fan J, Traore K, Li W, Amri H, Huang H, Wu C, Chen H, Zirkin B, Papadopoulos V. (2010)
Molecular mechanisms mediating the effect of mono-(2-ethylhexyl) phthalate on hormone-
stimulated steroidogenesis in MA-10 mouse tumor Leydig cells. Endocrinology 151, 3348-3362.
Fayomi AP, Orwig KE. 2018 Spermatogonial stem cells and spermatogenesis in mice, monkeys
and men. Stem Cell Res; 29:207-214
Fielden MR, Samy SM, Chou KC, Zacharewski TR. (2003) Effect of human dietary exposure
levels of genistein during gestation and lactation on long-term reproductive development and
sperm quality in mice. Food Chem Toxicol 41, 447-454.
Fok KL, Bose R, Sheng K, Chang CW, Katz-Egorov M, Culty M, Su S, Wang M, Ruan YC, Chan
HC, Iavarone A, Lasorella A, Cencic R, Pelletier J, Nagano M, Xu W, Wing SS. 2017 Huwe1
Regulates the Establishment and Maintenance of Spermatogonia by Suppressing DNA Damage
Response. Endocrinology. 158(11):4000-4016
Foster PMD 2006 Disruption of reproductive development in male rat offspring following in utero
exposure to phthalate esters. International Journal of Andrology, 29:140-147
Foster WG, Chan S, Platt L, Hughes CL Jr 2002 Detection of phytoestrogens in samples of
second trimester human amniotic fluid. Toxicology Letters, 129:199-205
Foster WG, Chan S, Platt L, Hughes CL Jr. (2002) Detection of phytoestrogens in samples of
second trimester human amniotic fluid. Toxicology Letters 129, 199-205.
França LR, Hess RA, Dufour JM, Hofmann MC, Griswold MD. 2016 The Sertoli cell: one
hundred fifty years of beauty and plasticity. Andrology; 4(2): 189-212
Frank MG, Watkins LR, Maier SF. (2013) Stress-induced glucocorticoids as a neuroendocrine
alarm signal of danger. Brain, Behavior, and Immunity 33, 1-6.
Futran Fuhrman V, Tal A, Arnon S. (2015) Why endocrine disrupting chemicals (EDCs)
challenge traditional risk assessment and how to respond. J Hazardous Materials 286, 589-611.
Futran Fuhrman V, Tal A, Arnon S. Why endocrine disrupting chemicals (EDCs) challenge
traditional risk assessment and how to respond. Journal of Hazardous Materials 286 (2015)
589–611
Galli SJ, Borregaard N, Wynn TA. (2011) Phenotypic and functional plasticity of cells of innate
immunity: macrophages, mast cells and neutrophils. Nat Immunol 12, 1035-1044.
141

Garon G, Bergeron F, Brousseau C, Robert NM, Tremblay JJ. 2017 FOXA3 Is Expressed in
Multiple Cell Lineages in the Mouse Testis and Regulates Pdgfra Expression in Leydig Cells.
Endocrinology.;158(6):1886-1897
Ge RS, Dong Q, Sottas CM, Chen H, Zirkin BR, Hardy MP. (2005) Gene Expression in Rat
Leydig Cells During Development from the Progenitor to Adult Stage: A Cluster Analysis. Biol
Reprod 72, 1405-1415.
Gieri MB, Calandra RS, Lustig L, Meineke V, Köhn FM, Vogt HJ, Mayerhofer A 2002 Number,
distribution pattern, and identification of macrophages in the testes of infertile men. Fertil Steril,
78:298-306
Gieri MB, Calandra RS, Lustig L, Meineke V, Köhn FM, Vogt HJ, Mayerhofer A. (2002) Number,
distribution pattern, and identification of macrophages in the testes of infertile men. Fertil Steril
78, 298-306.
Goertz MJ, Wu Z, Gallardo TD, Hamra FK, Castrillon DH. 2011 Foxo1 is required in mouse
spermatogonial stem cells for their maintenance and the initiation of spermatogenesis. J Clin
Invest, 121:3456-3466
Gore AC, Chappell VA, Fenton SE, Flaws JA, Nadal A, Prins GS, Toppari J, Zoeller RT. 2015
EDC-2: The Endocrine Society's Second Scientific Statement on Endocrine-Disrupting
Chemicals. Endocr Rev; 36(6):E1-E150
Gore AC, Chappell VA, Fenton SE, Flaws JA, Nadal A, Prins GS, Toppari J, Zoeller RT. (2015)
EDC-2: The Endocrine Society's Second Scientific Statement on Endocrine-Disrupting
Chemicals. Endocr Rev 36, E1-E150.
Greathouse KL, Bredfeldt T, Everitt JI, Lin K, Berry T, Kannan K, Mittelstadt ML, Ho SM, Walker
CL 2012 Environmental estrogens differentially engage the histone methyltransferase EZH2 to
increase risk of uterine tumorigenesis. Mol Cancer Res,10:546-557
Griswold MD. 2016 Spermatogenesis: the commitment to meiosis. Physiol Rev 96: 1-17
Gu H, Smith ZD, Bock C, Boyle P, Gnirke A, Meissner A. 2011 Preparation of reduced
representation bisulfite sequencing libraries for genome-scale DNA methylation profiling. Nature
Protocols, 6:468-481
Heger NE, Hall SJ, Sandrof MA, McDonnell EV, Hensley JB, McDowell EN, Martin KA, Gaido
KW, Johnson KJ, Boekelheide K. 2012 Human Fetal Testis Xenografts Are Resistant to
Phthalate-Induced Endocrine Disruption. Environ Health Perspect.120:1137-1143
Heindel JJ, McAllister KA, Worth L Jr., Tyson FL 2006 Environmental Epigenomics, Imprinting
and Disease Susceptibility. Epigenetics 1:1-6
Hermann BP, Cheng K, Singh A, Roa-De La Cruz L, Mutoji KN, Chen IC, Gildersleeve H, Lehle
JD, Mayo M, Westernströer B, Law NC, Oatley MJ, Velte EK, Niedenberger BA, Fritze D, Silber
S, Geyer CB, Oatley JM, McCarrey JR. 2018 The Mammalian Spermatogenesis Single-Cell
Transcriptome, from Spermatogonial Stem Cells to Spermatids. Cell Rep; 25(6):1650-1667
Hermo L, Pelletier R-M, Cyr DG, Smith CE 2010 Surfing the Wave, Cycle, Life History, and
Genes/Proteins Expressed by Testicular Germ Cells. Part 1: Background to Spermatogenesis,
142

Spermatogonia, and Spermatocytes. Microsc. Res. Tech. 73:243-278
Hermo L, Pelletier R-M, Cyr DG, Smith CE. (2010) Surfing the Wave, Cycle, Life History, and
Genes/Proteins Expressed by Testicular Germ Cells. Part 1: Background to Spermatogenesis,
Spermatogonia, and Spermatocytes. Microsc Res Tech 73, 243-278.
Horisawa K, Udono M, Ueno K, Ohkawa Y, Nagasaki M, Sekiya S, Suzuki A. 2020 The
Dynamics of Transcriptional Activation by Hepatic Reprogramming Factors. 2020, Molecular
Cell 79, 660–676
Howdeshell KL, Hotchkiss AK, Gray LE Jr. (2017) Cumulative effects of antiandrogenic
chemical mixtures and their relevance to human health risk assessment. Int J Hyg Environ
Health 220, 179-188.
Howdeshell KL, Hotchkiss AK, Gray LE Jr. 2017 Cumulative effects of antiandrogenic chemical
mixtures and their relevance to human health risk assessment. Int J Hyg Environ Health. 2017
Mar;220(2 Pt A):179-188
Iwafuchi-Doi M, Donahue G, Kakumanu A, Watts JA, Mahony S, Pugh BF, Lee D, Kaestner KH,
Zaret KS. 2016 The Pioneer Transcription Factor FoxA Maintains an Accessible Nucleosome
Configuration at Enhancers for Tissue-Specific Gene Activation. 2016, Molecular Cell 62, 79–91
J, Lee H, Han M, Kim G, Kim W, Choi Y. (2014) Anti-inflammatory effects of genistein via
suppression of the toll-like receptor 4-mediated signaling pathway in lipopolysaccharide-
stimulated BV2 microglia. Chem Biol Interact 212, 30-39.
Jarrell J, Foster WG, Kinniburgh DW 2012 Phytoestrogens in human pregnancy. Obstet
Gynecol Int. 2012: article ID 850313:1-7
Jeng HA (2014) Exposure to endocrine disrupting chemicals and male reproductive health.
Frontiers in public health 2, 55.
Johnston DS, Wright WW, DiCandeloro P, Wilson E, Kopf GS, Jelinsky SA 2008 Stage-
specific gene expression is a fundamental characteristic of rat spermatogenic cells and Sertoli
cells. PNAS, 105:8315-8320
Jones S, Boisvert A, Duong T, Francois S, Thrane P, Culty M 2014 Disruption of Rat Testis
Development Following Combined In-Utero Exposure to the Phytoestrogen Genistein and Anti-
Androgenic Plasticizer Di-(2-Ethylhexyl) Phthalate. Biology of Reproduction,
http://www.ncbi.nlm.nih.gov/pubmed/?term=jones%2C+culty 91(3):64
Jones S, Boisvert A, Duong T, Francois S, Thrane P, Culty M. (2014) Disruption of rat testis
development following combined in utero exposure to the phytoestrogen genistein and
antiandrogenic plasticizer di-(2-ethylhexyl) phthalate. Biol Reprod 91, 64, 1-14.
Jones S, Boisvert A, Francois S, Zhang L, Culty M 2015 Testicular Effects of Di-(2-Ethylhexyl)
Phthalate Are Antagonized by Genistein in Young Rats Exposed In Utero. Biology of
Reproduction, 93(4):92
Jones S, Boisvert A, Francois S, Zhang L, Culty M. (2015) Testicular Effects of Di-(2-Ethylhexyl)
Phthalate Are Antagonized by Genistein in Young Rats Exposed In Utero. Biol Reprod 93, 92,
1-14.
143

Jones S, Boisvert A, Naghi A, Hullin−Matsuda F, Greimel P, Kobayashi T, Papadopoulos V,
Culty M 2016 Stimulatory effects of combined endocrine disruptors on MA-10 Leydig cell
steroid production and lipid homeostasis. Toxicology, 355:21-30
Jones S, Boisvert A, Naghi A, Hullin−Matsuda F, Greimel P, Kobayashi T, Papadopoulos V,
Culty M. (2016) Stimulatory effects of combined endocrine disruptors on MA-10 Leydig cell
steroid production and lipid homeostasis. Toxicology 355-356, 21-30.
Kakinoki A, Kameo T, Yamashita S, Furuta K, Tanaka S. (2020) Establishment and
Characterization of a Murine Mucosal Mast Cell Culture Model. Int J Mol Sci 21, E236.
Kavlock R, Barr D, Boekelheide K, Breslin W, Breysse P, Chapin R, Gaido K, Hodgson E,
Marcus M, Shea K, Williams P 2006 NTP-CERHR. Expert Panel update on the reproductive and
developmental toxicity of Di(2-ethylhexyl)phthalate. Reprod Toxicol, 22:291-399
Kavlock R, Barr D, Boekelheide K, Breslin W, Breysse P, Chapin R, Gaido K, Hodgson E,
Marcus M, Shea K, Williams P (2006) NTP-CERHR. Expert Panel update on the reproductive
and developmental toxicity of Di(2-ethylhexyl)phthalate. Reprod Toxicol 22, 291-399.
Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Totoki Y, Toyoda A, Ikawa M, Asada N, Kojima
K, Yamaguchi Y, Ijiri TW, Hata K, Li E, Matsuda Y, Kimura T, Okabe M, Sakaki Y, Sasaki H,
Nakano T. 2008 DNA methylation of retrotransposon genes is regulated by Piwi family members
MILI and MIWI2 in murine fetal testes. Genes Dev, 22:908-917
Lagarrigue M, Becker M, Lavigne R, Deininger SO, Walch A, Aubry F, Suckau D, Pineau C.
2011 Revisiting rat spermatogenesis with MALDI imaging at 20-microm resolution. Mol Cell
Proteomics;10(3):M110.005991
Latini G, De Felice C, Presta G, Del Vecchio A, Paris I, Ruggieri F, Mazzeo P 2003 In utero
exposure to di-(2-ethylhexyl)phthalate and duration of human pregnancy. Environ Health
Perspect, 111:1783-1785
Latini G, Del Vecchio A, Massaro M, Verrotti A, DE Felice C.(2006). In utero exposure to
phthalates and fetal development. Curr Med Chem 13, 2527-2534.
Lee DH and Jacobs Jr. DR. 2019 Firm human evidence on harms of endocrine-disrupting
chemicals was unlikely to be obtainable for methodological reasons. J Clinical Epidemiology
107: 107-115
Lee DH. 2018 Evidence of the Possible Harm of Endocrine-Disrupting Chemicals in Humans:
Ongoing Debates and Key Issues. Endocrinol Metab. 33:44-52
Lehraiki A, Chamaillard C, Krust A, Habert R, Levacher C. (2011) Genistein impairs early
testosterone production in fetal mouse testis via estrogen receptor alpha. Toxicol In Vitro 25,
1542-1547.
Lehraiki A, Chamaillard C, Krust A, Habert R, Levacher C. 2011 Genistein impairs early
testosterone production in fetal mouse testis via estrogen receptor alpha. Toxicol In
Vitro,25:1542-1547
Leinonen JV, Korkus-Emanuelov A, Wolf Y, Milgrom-Hoffman M, Lichtstein D, Hoss S, Lotan C, Tzahor E,
Jung S, Beeri R. Macrophage Precursor Cells From the Left Atrial Appendage of the Heart
144

Spontaneously Reprogram Into a C-kit+/CD45- Stem Cell-Like Phenotype. Int J Cardiol. 2016 Apr
15;209:296-306.
Levine H, Jørgensen N, Martino-Andrade A, Mendiola J, Weksler-Derri D, Mindlis I, Pinotti R,
Swan SH 2017 Temporal trends in sperm count: a systematic review and meta-regression
analysis. Hum Reprod Update. 23(6):646-659
Li H, Papadopoulos V, Vidic B, Dym M, Culty M 1997 Regulation of rat testis gonocyte
proliferation by PDGF and estradiol: Identification of signaling mechanisms involved.
Endocrinology, 138:1289-1298
Li X, Strauss L, Kaatrasalo A, Mayerhofer A, Huhtaniemi I, Santti R, Makela S, Poutanen M
2006 Transgenic Mice Expressing P450 Aromatase as a Model for Male Infertility Associated
with Chronic Inflammation in the Testis. Endocrinology, 147:1271-1277
Lim LH, Pervaiz S. (2007) Annexin 1: the new face of an old molecule. FASEB J 21, 968-975.
Lin H, Ge RS, Chen GR, Hu GX, Dong L, Lian QQ, Hardy DO, Sottas CM, Li XK, Hardy MP.
(2008) Involvement of testicular growth factors in fetal Leydig cell aggregation after exposure to
phthalate in utero. Proc Natl Acad Sci U S A 105, 7218-7222.
Liu K, Lehmann KP, Sar M, Young SS, Gaido K 2005 Gene expression profiling following in
utero exposure to phthalate esters reveals new gene targets in the etiology of testicular
dysgenesis. Biol Reprod, 73:180-192
Liu K, Lehmann KP, Sar M, Young SS, Gaido KW. (2005) Gene expression profiling following in
utero exposure to phthalate esters reveals new gene targets in the etiology of testicular
dysgenesis. Biol Reprod 73, 180-192.
Loveland KL, Klein B, Pueschl D, Indumathy S, Bergmann M, Loveland BE, Hedger MP,
Schuppe HC.(2017) Cytokines in Male Fertility and Reproductive Pathologies:
Immunoregulation and Beyond. Front Endocrinol (Lausanne) 8, 307.
Lu R, Zheng Z, Yin Y, Jiang Z. 2019 Effect of Genistein on Cholesterol Metabolism ‐Related
Genes in HepG2 Cell. J Food Sci; 84(8):2330-2336.
Lucifero D, Mertineit C, Clarke HJ, Bestor TH, Trasler JM. 2002 Methylation Dynamics of
Imprinted Genes in Mouse Germ Cells. Genomics, 79:530-538
Maloney EK, Waxman DJ. (1999) trans-Activation of PPARalpha and PPARgamma by
structurally diverse environmental chemicals. Toxicol Appl Pharmacol 161, 209-218.
Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner MK 2013 Plastics derived endocrine
disruptors (BPA, DEHP and DBP) induce epigenetic transgenerational inheritance of obesity,
reproductive disease and sperm epimutations. PLoS One, 8:e55387
Manku G, Culty M 2015 Dynamic changes in the expression of apoptosis-related genes in
differentiating gonocytes and in seminomas. Asian Journal of Andrology, 17:403-414
Manku G, Culty M 2016 Regulation of Translocator Protein 18 kDa (TSPO) Expression in Rat
and Human Male Germ Cells. Int J Mol Sci, 17(9): 1486
Manku G, Culty M. (2015) Mammalian gonocyte and spermatogonia differentiation: recent
145

advances and remaining challenges. Reproduction 149, R139-157.
Manku G, Culty M. 2015 Mammalian gonocyte and spermatogonia differentiation: recent
advances and remaining challenges Reproduction, 149(3):R139-157
Manku G, Hueso A, Brimo F, Chan P, Gonzalez-Peramato P, Jabado N, Gayden T, Bourgey M,
Riazalhosseini Y, Culty M. 2016 Changes in the expression profiles of claudins during gonocyte
differentiation and high expression in seminomas. Andrology, 4(1):95-110
Manku G, Hueso A, Brimo F, Chan P, Gonzalez-Peramato P, Jabado N, Gayden T, Bourgey M,
Riazalhosseini Y, Culty M. (2016) Changes in the expression profiles of claudins during
gonocyte differentiation and high expression in seminomas. Andrology 4, 95-110.
Manku G, Mazer M and Culty M. 2012 Neonatal testicular gonocytes isolation and processing
for immunocytochemical analysis. Methods in Molecular Biology, 825: 17-29.
Manku G, Papadopoulos P, Boisvert A, Culty M. (2019) Cyclooxygenase 2 (COX2) Expression
and prostaglandin synthesis in Neonatal Rat Testicular Germ Cells: Effects of Acetaminophen
and Ibuprofen. Andrology [Epub ahead of print].
Manku G, Wang Y, Merkbaoui V, Boisvert A, Ye X , Blonder J, Culty M 2015 Role of Retinoic
Acid and Platelet-Derived Growth Factor Receptor crosstalk in the regulation of neonatal
gonocyte and embryonal carcinoma cell differentiation. Endocrinology, 1(1):346-359
Manku G, Wing SS, Culty M. 2012 Expression of the ubiquitin proteasome system in neonatal
rat gonocytes and spermatogonia: role in gonocyte differentiation. Biol Reprod, 87:44, 1-18
Manku G, Wing SS, Culty M. (2012) Expression of the ubiquitin proteasome system in neonatal
rat gonocytes and spermatogonia: role in gonocyte differentiation. Biol Reprod 87, 44.
Marcon L, Zhang X, Hales BF, Robaire B, Nagano MC. 2011 Effects of chemotherapeutic
agents for testicular cancer on rat spermatogonial stem/progenitor cells. J Androl. 32:432-443
Marczylo EL, Jacobs MN, Gant TW. 2016 Environmentally induced epigenetic toxicity: potential
public health concerns. Crit Rev Toxicol; 46(8):676-700
Martinez-Arguelles DB, Campioli E, Culty M, Zirkin BR, Papadopoulos V 2013 Fetal origin of
endocrine dysfunction in the adult: The phthalate model. J Steroid Biochem Mol Biol. 137:5-17
Martinez-Arguelles DB, Campioli E, Culty M, Zirkin BR, Papadopoulos V. (2013) Fetal origin of
endocrine dysfunction in the adult: the phthalate model. J Steroid Biochem Mol Biol 137, 5-17.
Martinez-Arguelles DB, Culty M, Zirkin BR, Papadopoulos V 2009 In utero exposure to di-(2-
ethylhexyl) phthalate decreases mineralocorticoid receptor expression in the adult testis.
Endocrinology, 150:5575-5585
Martinez-Arguelles DB, Culty M, Zirkin BR, Papadopoulos V. (2009) In utero exposure to di-(2-
ethylhexyl) phthalate decreases mineralocorticoid receptor expression in the adult testis.
Endocrinology 150, 5575-5585.
Martinez-Arguelles DB, Guichard T, Culty M, Zirkin BR, Papadopoulos V 2011 In utero
exposure to the antiandrogen di-(2-ethylhexyl) phthalate decreases adrenal aldosterone
production in the adult rat. Biol Reprod, 85:51-61
146

Mayerhofer A. (2013) Human testicular peritubular cells: more than meets the eye.
Reproduction 145, R107-R116.
Mayerhofer A. 2013 Human testicular peritubular cells: more than meets the eye. Reproduction
145: R107–R116
Meineke V, Frungieri MB, Jessberger B, Vogt H, Mayerhofer A. (2000) Human testicular mast
cells contain tryptase: increased mast cell number and altered distribution in the testes of
infertile men. Fertil Steril 74, 239-244.
Meinhardt A, Hedger MP 2011 Immunological, paracrine and endocrine aspects of testicular
immune privilege. Molecular and Cellular Endocrinology, 335:60-68
Mitchell RT, Childs AJ, Anderson RA, van den Driesche S, Saunders PTK, McKinnell C,
Wallace WHB, Kelnar CJH, Sharpe RM 2012 Do Phthalates Affect Steroidogenesis by the
Human Fetal Testis? Exposure of Human Fetal Testis Xenografts to Di-n-Butyl Phthalate. J Clin
Endocrinol Metab, 97:E341–E348
Mitchell RT, Sharpe RM, Anderson RA, McKinnell C, Macpherson S, Smith LB, Wallace WH,
Kelnar CJ, van den Driesche S. 2013 Diethylstilboestrol exposure does not reduce testosterone
production in human fetal testis xenografts. PLoS One, 8:e61726
Mossadegh-Keller N, Sieweke MH. (2018) Testicular macrophages: Guardians of fertility. Cell
Immunol 330, 120-125.
Motallebipour M, Ameur A, Reddy Bysani MS, Patra K, Wallerman O, Mangion J, Barker MA,
McKernan KJ, Komorowski J, Wadelius C. 2009 Differential binding and co-binding pattern of
FOXA1 and FOXA3 and their relation to H3K4me3 in HepG2 cells revealed by ChIP-seq.
Genome Biol; 10(11):R129
Mu W, Starmer J, Shibatahttps://pubmed.ncbi.nlm.nih.gov/28254491/ - affiliation-1 Y, Yee D,
Magnuson T. 2017 EZH1 in germ cells safeguards the function of PRC2 during
spermatogenesis. Dev Biol 2017 Apr 15;424(2):198-207.
Muczynski V, Cravedi JP, Lehraiki A, Levacher C, Moison D, Lecureuil C, Messiaen S, Perdu E,
Frydman R, Habert R, Rouiller-Fabre V. 2012 Effect of mono-(2-ethylhexyl) phthalate on
human and mouse fetal testis: In vitro and in vivo approaches. Toxicol Appl Pharmacol, 261:97-
104
Nardelli TC, Albert O, Lalancette C, Culty M, Hales BF, Robaire B 2017 In Utero and
Lactational Exposure Study in Rats to Identify Replacements for Di(2-ethylhexyl) Phthalate. Sci
Rep; 7(1):3862
Ni K, Dansranjavin T, Rogenhofer N, Oeztuerk N, Deuker J, Bergmann M, Schuppe H-C,
Wagenlehner F, Weidner W, Steger K, Schagdarsurengin U. 2016 TET enzymes are
successively expressed during human spermatogenesis and their expression level is pivotal for
male fertility. Human Reproduction, 31:1411-1424
N'Tumba-Byn T, Moison D, Lacroix M, Lecureuil C, Lesage L, Prud'homme SM, Pozzi-Gaudin
S, Frydman R, Benachi A, Livera G, Rouiller-Fabre V, Habert R. 2012 Differential effects of
bisphenol A and Diethylstilbestrol on Human, Rat and Mouse Fetal Leydig Cell Function. PLoS
ONE 7(12): e51579
147

Oatley MJ, Kaucher AV, Racicot KE, Oatley JM. 2011 Inhibitor of DNA binding 4 is expressed
selectively by single spermatogonia in the male germline and regulates the self-renewal of
spermatogonial stem cells in mice. Biol Reprod,85:347-56
O'Flaherty CM, Chan PT, Hales BF, Robaire B. 2012 Sperm chromatin structure components
are differentially repaired in cancer survivors. J Androl; 33(4):629-636.
Papadopoulos V, Carreau S, Drosdowsky MA. 1985 Effect of phorbol ester and phospholipase
C on LH-stimulated steroidogenesis in purified rat Leydig cells. FEBS Lett 1985 Sep
2;188(2):312-316.
Parente L, Solito E. (2004) Annexin 1: more than an anti-phospholipase protein. Inflamm Res
53, 125-132.
Parks LG, Ostby JS, Lambright CR, Abbott BD, Klinefelter GR, Barlow NJ, Gray LE Jr. (2000)
The plasticizer diethylhexyl phthalate induces malformations by decreasing fetal testosterone
synthesis during sexual differentiation in the male rat. Toxicol Sci 58, 339-349.
Pascual-García M, Bonfill-Teixidor E, Planas-Rigol E, Rubio-Perez C, Iurlaro R, Arias A, et al. et
Seoane J. (2019) LIF regulates CXCL9 in tumor-associated macrophages and prevents CD8+ T
cell tumor infiltration impairing anti-PD1 therapy. Nature Communications 10, 2416.
Patel RP, Barnes S. (2010) Isoflavones and PPAR Signaling: A Critical Target in
Cardiovascular, Metastatic, and Metabolic Disease. PPAR Res 2010:153252.
Pattabiraman S, Baumann C, Guisado D, Eppig JJ, Schimenti JC, De La Fuente R. 2015 Mouse
BRWD1 is critical for spermatid postmeiotic transcription and female meiotic chromosome
stability. J. Cell Biol. Vol. 208 No. 1 53–69
Pihlajamaa P, Zhang FP, Saarinen L, Mikkonen L, Hautaniemi S, Jänne OA. 2011 The
phytoestrogen genistein is tissue-specific androgen receptor modulator. Endocrinology,
152:4395-4405
Piquet-Pellorce C, Dorval-Coiffec I, Pham MD, Jégou B. (2000) Leukemia Inhibitory Factor
Expression and Regulation within the Testis. Endocrinology 141, 1136-1141.
Prentice BM, McMillen JC, Caprioli RM. 2019 Multiple TOF/TOF Events in a Single Laser Shot
for Multiplexed Lipid Identifications in MALDI Imaging Mass Spectrometry. Int J Mass Spectrom;
437:30-37
Rajapakse N, Silva E, Kortenkamp A (2002) Combining xenoestrogens at levels below
individual no-observed-effect concentrations dramatically enhances steroid hormone action.
Environ Health Perspect 110, 917-921.
Rajapakse N, Silva E, Kortenkamp A 2002 Combining xenoestrogens at levels below individual
no-observed-effect concentrations dramatically enhances steroid hormone action. Environ
Health Perspect, 110:917-921
Reagan-Shaw S, Nihal m, Ahmad n 2007 Dose translation from animal to human studies
revisited. FASEB J, 22:659-661
Rider CV, Wilson VS, Howdeshell KL, Hotchkiss AK, Furr JR, Lambright CR, Gray LE Jr 2009
Cumulative effects of in utero administration of mixtures of "antiandrogens" on male rat
148

reproductive development. Toxicol Pathol, 37:100-113
Rozman KK, Bhatia J, Calafat AM, Chambers C, Culty M, Etzel RA, Flaws JA, Hansen DK,
Hoyer PB, Jeffery EH, Kesner JS, Marty S, Thomas JA, Umbach D 2006 NTP-CERHR expert
panel report on the reproductive and developmental toxicity of genistein. Birth Defects
Research B Dev Reprod Toxicol, 77:485-638
Rozman KK, Bhatia J, Calafat AM, Chambers C, Culty M, Etzel RA, Flaws JA, Hansen DK,
Hoyer PB, Jeffery EH, Kesner JS, Marty S, Thomas JA, Umbach D. (2006) NTP-CERHR expert
panel report on the reproductive and developmental toxicity of soy formula. Birth Defects Res B
Dev Reprod Toxicol 77, 280-397.
Sakai M, Martinez-Arguelles DB, Patterson NH, Chaurand P, Papadopoulos V. 2015 In Search
of the Molecular Mechanisms Mediating the Inhibitory Effect of the GnRH Antagonist Degarelix
on Human Prostate Cell Growth. PLoS One;10(3):e0120670
Salian S, Doshi T, Vanage G. (2009) Neonatal exposure of male rats to Bisphenol A impairs
fertility and expression of Sertoli cell junctional proteins in the testis. Toxicology 265, 56-67.
Schagdarsurengin U, Western P, Steger K, Meinhardt A. 2016 Developmental origins of male
subfertility: role of infection, inflammation, and environmental factors. Semin Immunopathol
38:765-781
Scheller J, Chalaris A, Schmidt-Arras D, Rose-John S. (2011) The pro- and anti-inflammatory
properties of the cytokine interleukin-6. Biochim Biophys Acta 1813, 878-888.
Schug TT, Janesick A, Blumberg B, Heindel JJ. 2011 Endocrine disrupting chemicals and
disease susceptibility. Journal of Steroid Biochemistry & Molecular Biology 127; 204-215
Schug TT, Johnson AF, Birnbaum LS, Colborn T, Guillette LJ Jr, Crews DP, Collins T, Soto AM,
Vom Saal FS, McLachlan JA, Sonnenschein C, Heindel JJ. 2016 Minireview: Endocrine
Disruptors: Past Lessons and Future Directions. Mol Endocrinol. 30(8):833-47
Schug TT, Johnson AF, Birnbaum LS, Colborn T, Guillette LJ Jr, Crews DP, Collins T, Soto AM,
Vom Saal FS, McLachlan JA, Sonnenschein C, Heindel JJ. (2016) Minireview: Endocrine
Disruptors: Past Lessons and Future Directions. Mol Endocrinol 30, 833-847.
Scott HM, Mason JI, Sharpe RM. (2009) Steroidogenesis in the fetal testis and its susceptibility
to disruption by exogenous compounds. Endocr Rev 30, 883-925.
Shapouri-Moghaddam A, Mohammadian S, Vazini H, Taghadosi M, Esmaeili SA, Mardani F,
Seifi B, Mohammadi A, Afshari JT, Sahebkar A. (2018) Macrophage plasticity, polarization, and
function in health and disease. J Cell Physiol 233, 6425-6440.
Sharma RP, Schuhmacher M, Kumar V. (2017) Review on crosstalk and common mechanisms
of endocrine disruptors: Scaffolding to improve PBPK/PD model of EDC mixture. Environ Int 99,
1-14.
Sharma RP, Schuhmacher M, Kumar V. 2017 Review on crosstalk and common mechanisms
of endocrine disruptors: Scaffolding to improve PBPK/PD model of EDC mixture. Environ Int;
99:1-14
Sharpe RM 2012 Sperm counts and fertility in men: a rocky road ahead. EMBO reports; 13(5):
149

398-403
Sharpe RM and Skakkebaek NE. (2008) Testicular dysgenesis syndrome: mechanistic insights
and potential new downstream effects. Fertil Steril 89, e33-38.
Silva JMD, Silva HALD, Zelenski C, Souza JAM, Hueb M, Damazo AS. (2019) Analysis of
macrophage subtypes and annexin A1 expression in lesions of patients with cutaneous
leishmaniasis. Rev Soc Bras Med Trop 52, e20190361.
Silva MJ, Reidy JA, Herbert AR, Preau Jr. JL, Needham LL. (2004) Detection of Phthalate
Metabolites in Human Amniotic Fluid. Bull Environ Contam Toxicol 72, 1226-1231.
Singh AR, Lawrence WH, Autian J 1975 Maternal-fetal transfer of 14C-di-2-ethylhexyl phthalate
and 14Cdiethyl phthalate in rats. J. Pharm. Sci 64:1347–1350
Siril Ariyaratne HB, Chamindrani Mendis-Handagama SML. 2000 Changes in the Testis
Interstitium of Sprague Dawley Rats from Birth to Sexual Maturity. Biology of Reproduction 62,
680-690
Skakkebaek NE, Rajpert-De Meyts E, Buck Louis GM, Toppari J, Andersson A-M, Eisenberg
ML, Kold Jensen T, Jørgensen N, Swan SH, Sapra KJ, Ziebe S, Priskorn L, Juul A. 2016 Male
Reproductive Disorders and Fertility Trends: Influences of Environment and Genetic
Susceptibility. Physiol Rev 96: 55-97
Skakkebaek NE, Rajpert-De Meyts E, Buck Louis GM, Toppari J, Andersson A-M, Eisenberg
ML, Kold Jensen T, Jørgensen N, Swan SH, Sapra KJ, Ziebe S, Priskorn L, Juul A. (2016) Male
Reproductive Disorders and Fertility Trends: Influences of Environment and Genetic
Susceptibility. Physiol Rev 96, 55-97.
Spinnler K, Köhn FM, Schwarzer U, Mayerhofer A 2010 Glial cell line-derived neurotrophic
factor is constitutively produced by human testicular peritubular cells and may contribute to the
spermatogonial stem cell niche in man. Hum Reprod, 25:2181-2187
Suzuki T, Hara H 2011 Role of flavonoids in intestinal tight junction regulation. J Nutr Biochem,
22:401-408
Swan SH, Main KM, Liu F, Stewart SL, Kruse RL, Calafat AM, Mao CS, Redmon JB, Ternand
CL, Sullivan S, Teague JL 2005 Study for future families research team. Decrease in anogenital
distance among male infants with prenatal phthalate exposure. Environ Health Perspect,
113:1056-1061
Tang L, Rodriguez-Sosa JR, Dobrinski I. Germ cell transplantation and testis tissue xenografting
in mice. J Vis Exp. 2012 Feb 6;(60):3545.
Tang P, Argentaro A, Pask AJ, O'Donnell L, Marshall-Graves J, Familari M, Harley VR. 2011
Localization of the chromatin remodelling protein, ATRX in the adult testis. J Reprod Dev
57:317-321.
Teodosio C, Mayado A, Sánchez-Muñoz L, Morgado JM, Jara-Acevedo M, Álvarez-Twose I,
García-Montero AC, Matito A, Caldas C, Escribano L, Orfao A. (2015) The immunophenotype of
mast cells and its utility in the diagnostic work-up of systemic mastocytosis. J Leukoc Biol 97,
49-59.
150

Thuillier R, Manku G, Wang Y, Culty M 2009 Changes in MAPK pathway in neonatal and adult
testis following fetal estrogen exposure and effects on rat testicular cells. Microscopy Research
and Techniques. Microsc Res Tech, 72:773-786
Thuillier R, Mazer M, Manku G, Boisvert A, Wang Y, Culty M 2010 Interdependence of PDGF
and estrogen signaling pathways in inducing neonatal rat testicular gonocytes proliferation. Biol
Reprod, 82:825-836
Thuillier R, Wang Y, Culty M 2003 Prenatal exposure to estrogenic compounds alters the
expression pattern of PDGF receptors  and  in neonatal rat testis: Identification of gonocytes
as targets of estrogen exposure. Biol Reprod, 68:867-880
Thuillier R, Wang Y, Culty M. (2003) Prenatal exposure to estrogenic compounds alters the
expression pattern of platelet-derived growth factor receptors alpha and beta in neonatal rat
testis: identification of gonocytes as targets of estrogen exposure. Biol Reprod 68, 867-880.
Tian M, Liu L, Zhang J, Huang Q, Shen H. (2019) Positive association of low-level
environmental phthalate exposure with sperm motility was mediated by DNA methylation: A pilot
study. Chemosphere 220, 459-467.
Toshima H, Suzuki Y, Imai K, Yoshinaga J, Shiraishi H, Mizumoto Y, Hatakeyama S, Onohara
C, Tokuoka S. 2012 Endocrine disrupting chemicals in urine of Japanese male partners of
subfertile couples: a pilot study on exposure and semen quality. Int J Hyg Environ Health,
215:502-506
UNEP/WHO. 2013 State of the Science of Endocrine Disrupting Chemicals-2012. An
assessment of the state of the science of endocrine disruptors prepared by a group of experts
for the United Nations Environment Programme (UNEP) and World Health Organization (WHO).
Bergman, A., Heindel, J.J., Jobling, S., Kidd, K.A., Zoeller, R.T. (Eds.)
Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR Jr, Lee DH, Shioda T, Soto AM,
vom Saal FS, Welshons WV, Zoeller RT, Myers JP. 2012 Hormones and endocrine-disrupting
chemicals: low-dose effects and nonmonotonic dose responses. Endocr Rev. 33(3):378 – 455
Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR Jr, Lee DH, Shioda T, Soto AM,
vom Saal FS, Welshons WV, Zoeller RT, Myers JP. (2012) Hormones and endocrine-disrupting
chemicals: low-dose effects and nonmonotonic dose responses. Endocr Rev 33, 378-455.
Vineis P, Khan AE, Vlaanderen J, Vermeulen R 2009 The impact of new research technologies
on our understanding of environmental causes of disease: the concept of clinical vulnerability.
Environmental Health, 8:54 pp 1-10
Virtanen HE, Toppari J 2008 Epidemiology and pathogenesis of cryptorchidism. Human
Reproduction Update, 14:49-58
Walker C, Boisvert A, Culty M. (2019) Functional pathway analysis of testis transcriptome from
adult rats exposed in utero to a low dose mixture of genistein (Gen) and Di-(2-ethylhexyl)
phthalate (DEHP) identifies significant changes in signaling transduction pathways. Andrology,
Supplement, 45, 47.
Walker C, Ghazisaeidi S, Collet B, Boisvert A, Culty M. 2020 In-utero Exposure to Low Doses of
Genistein and Di-(2-ethylhexyl) Phthalate (DEHP) Alters Innate Immune Cells in Neonatal and
151

Adult Rat Testis. Andrology. 8 (4), 943-964
Wang P, Suo LJ, Wang YF, Shang H, Li GX, Hu JH, Li QW. (2014) Effects of GDNF and LIF on
mouse spermatogonial stem cells proliferation in vitro. Cytotechnology 66, 309-316.
Wang Y and Culty M. 2012 Preparation of enriched mouse syncitia-free pachytene
spermatocyte cell suspensions. Methods in Molecular Biology, 825: 67-74.
Wang Y, Thuillier R, Culty M 2004 Prenatal estrogen exposure differentially affects estrogen
receptor-associated proteins in rat testis gonocytes. Biol Reprod, 71:1652-1664
Wang Y, Yuan K, Li X, Su Z, Li X, Guan H, Su Y, Ge HS, Ge RS. (2016) Leukemia inhibitory
factor stimulates steroidogenesis of rat immature Leydig cells via increasing the expression of
steroidogenic acute regulatory protein. Growth Factors 34, 166-176.
Wilhelm D, Palmer S, Koopman P. (2007) Sex Determination and Gonadal Development in
Mammals. Physiological Reviews 87, 1-28.
Williams K, McKinnell C, Saunders PT, Walker M, Fisher JS, Turner KJ, Atanassova N, Sharpe
M 2001 Neonatal exposure to potent and environmental oestrogens and abnormalities of the
male reproductive system in the rat: evidence for importance of the androgen-oestrogen
balance and assessment of the relevance to man. Hum Repr Update, 7:236-247
Winnall WR, Muir JA, Hedger MP. (2011) Rat resident testicular macrophages have an
alternatively activated phenotype and constitutively produce interleukin-10 in vitro. J Leukoc
Biol 90, 133-143.
Yaman R, Grandjean V. 2006 Timing of Entry of Meiosis Depends on a Mark Generated by
DNA Methyltransferase 3a in Testis. Mol Reprod Dev 73:390-397
Yang O, Kim HL, Weon JI, Seo YR. (2015) Endocrine-disrupting Chemicals: Review of
Toxicological Mechanisms Using Molecular Pathway Analysis. J Cancer Prev 20, 12-246.5.
Yang O, Kim HL, Weon JI, Seo YR. 2015 Endocrine-disrupting Chemicals: Review of
Toxicological Mechanisms Using Molecular Pathway Analysis. J Cancer Prev. 20(1):12-24
Yang YH, Aeberli D, Dacumos A, Xue JR, Morand EF. (2009) Annexin-1 regulates macrophage
IL-6 and TNF via glucocorticoid-induced leucine zipper. J Immunol 183, 1435-1445.
Yeh JR, Zhang X, Nagano MC. 2007 Establishment of a short-term in vitro assay for mouse
spermatogonial stem cells. Biol Reprod; 77(5):897-904
Yoshida S, Sukeno M, Nakagawa T, Ohbo K, Nagamatsu G, Suda T, Nabeshima YI 2006 The
first round of mouse spermatogenesis is a distinctive program that lacks the self-renewing
spermatogonia stage. Development, 133:1495-1505
Zaal A, Nota B, Moore KS, Dieker M, van Ham SM, Ten Brinke A. (2017) TLR4 and C5aR
crosstalk in dendritic cells induces a core regulatory network of RSK2, PI3Kβ, SGK1, and FOXO
transcription factors. J Leukoc Biol 102, 1035-1054.
Zhang T, Oatley J, Bardwell VJ, Zarkower D. 2016 DMRT1 Is Required for Mouse
Spermatogonial Stem Cell Maintenance and Replenishment. PLoS Genet.;12(9):e1006293
Zhu J, Phillips SP, Feng YL, Yang X. (2006) Phthalate esters in human milk: concentration
152

variations over a 6-month postpartum time. Environ Sci Technol 40, 5276-5281.
Zhu JW, Brdicka T, Katsumoto TR, Lin J, Weiss A. (2008) Structurally distinct phosphatases
CD45 and CD148 both regulate B cell and macrophage immunoreceptor signaling. Immunity 28,
183-196.

Abstract (if available)

Abstract Introduction: Infertility is a global problem affecting 8-12% of couples worldwide, with male factor infertility accounting for 40-50% of infertility cases. Endocrine disrupting chemicals (EDCs) have been identified as potential causative agents of infertility in males. EDCs altering sex steroid levels or functions in perinatal life were shown to disrupt male reproductive functions, when used individually, usually at doses exceeding human exposure levels. However, the effects of EDC mixtures on male reproduction have not been fully elucidated. In previous studies, we examined the effects of fetal exposure to a mixture of the EDCs di(2-ethylhexyl) phthalate (DEHP) and genistein (Gen), given at doses relevant to human. DEHP is a phthalate plasticizer used in commercial products and medical devices. Gen is a phytoestrogen abundant in baby soy formula and vegetarian diets. These studies showed that in utero exposure to Gen+DEHP mixtures resulted in abnormal testes development in adult rats. Our goal is to determine the molecular basis of these long-term effects and subsequent consequences in future generations.
Materials and methods: Pregnant SD rats were gavaged from gestation day 14 to birth with corn oil or Gen+DEHP mixtures at 0.1 or 10 mg/kg/day. These doses encompass exposure levels of the general population and more susceptible populations such as hospitalized neonates fed soy formula, respectively. Adult male offspring were sacrificed and RNA was extracted from the testes for transcriptomic studies, while protein immunohistological analysis was performed on testis paraffin sections.
Results: Gene expression of the transcription factor Fork head box protein 3 (Foxa3) was identified as the most significantly downregulated gene in Gen+DEHP-exposed rat testes; but not in rats exposed to individual Gen or DEHP. Foxa3 protein levels showed decreased signal in testis sections from rats exposed to the highest dose EDC mixture. Foxa3 is an important transcriptional regulator of Leydig cell differentiation and function, also expressed in spermatids. Innate immune cells were also affected by in utero exposure to Gen+DEHP in neonatal and adult rat testes. We found that another member of the Forkhead Box A family was decreased by exposure to Gen+DEHP, Foxa1. Foxa1 has also been found to bind to the promoter of DNMT3A, an enzyme needed to carry out de novo methylation in gonocytes. Indeed, we also found that DNA methylation patterns were altered in adult rat testes as well. We hypothesize that fetal exposure to low doses of Gen+DEHP causes downregulation of Foxa3 in at least one adult testicular cell type, in turn affecting spermatogenesis; that testis immunity is compromised following exposure to EDCs, and that EDCs altar epigenetic process including DNA methylation (possibly potentiated via Forkhead Box proteins) and histone modifications in F1, F2 and F3 adult rat testes.
Conclusions: Identifying the cell types in which Foxa3 is targeted by the EDC mixtures will help understanding its relationship to disrupted testicular function. Our findings also suggest that Foxa3 could be used as sentinel gene to study EDC mixtures suspected of having adverse male reproductive effects.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Fetal exposure to genistein and DEHP mixtures alters the expression of genes involved in critical testicular functions in adult rats

PDF

Disruption of immature Sertoli cell functions by endocrine disruptors and analgesic drugs

PDF

Effects of endocrine disrupting chemicals and pharmaceuticals on rodent immature Sertoli cell functions

PDF

Effect of acetaminophen and ibuprofen on spermatogenesis and cell signaling mechanisms

PDF

Eicosanoid regulation of spermatogonial stem cell development

PDF

Effect of a mixture of two environmental chemicals on the interactions between macrophages and spermatogonia

PDF

Mitochondrial dynamics regulate Leydig cell health and integrity

PDF

Reevaluation of the pregnenolone biosynthesis pathway in the human brain

PDF

Role of steroidogenic acute regulatory protein (STAR) and sterol carrier protein-x (SCPx) in the transport of cholesterol and other lipids

PDF

The role of translocator protein (TSPO) in mediating the effects of mitotane in human adrenocortical carcinoma cells

PDF

Role of the NF-κB-CXCL1 signaling pathway in the development of metabolic dysfunction-associated steatohepatitits

PDF

Effect of vicrostatin (an integrin based therapy) on canine osteosarcoma

PDF

Genome engineering of filamentous fungi for efficient novel molecule production

PDF

Proinsulin-transferrin recombinant fusion protein: mechanism of activation and potential application in diabetes treatment

PDF

Exploring the impact of elevated bile acids in metabolic dysfunction- associated steatotic liver disease in vitro

PDF

MAO a deficient mice exhibit an altered immune system in the brain and prostate

PDF

Metabolic shift in lung alveolar cell mitochondria after exposure to environmental toxicants

PDF

Characterization of the interaction of nucleotide-binding oligomerization domain, leucine-rich repeat and pyrin domain-containing protein 12 (Nlrp12) with hematopoietic cell kinase (Hck)

PDF

The role of ATAD3A in the progression of non-alcoholic fatty liver disease (NAFLD)

PDF

Harnessing environmental and culture conditions to alter fungal ‘omics’

Asset Metadata

Creator Walker, Casandra Patrice (author)

Core Title Identification of functional pathways altered in testis by in utero exposure to low doses of genistein and DEHP

School School of Pharmacy

Degree Doctor of Philosophy

Degree Program Molecular Pharmacology and Toxicology

Degree Conferral Date 2022-08

Publication Date 07/01/2024

Defense Date 04/28/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag endocrine disruptors,epigenetics,functional pathways,innate immunity,OAI-PMH Harvest,Reproduction,Testis,transcriptome

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Wang, Clay (committee chair), Culty, Martine (committee member), Papadopoulos, Vassilios (committee member)

Creator Email casandrw@usc.edu,cassiepw94@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC111352085

Unique identifier UC111352085

Legacy Identifier etd-WalkerCasa-10783

Document Type Dissertation

Format application/pdf (imt)

Rights Walker, Casandra Patrice

Type texts

Source 20220706-usctheses-batch-950 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu