University of Southern California Dissertations and Theses

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

(USC Thesis Other)

The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

PDF

Download

Open document

Flip pages

Download a page range

Download transcript

Copy asset link

Request this asset

Transcript (if available)

Content The Role of Nuclear GRP78 in regulation of EGFR expression in lung cancer By Guanlin Liu A Thesis Presented to the FACULTY OF THE USC KECK SCHOOL OF MEDICINE UNIVERSITY OF SOUTHERN CALIFORNIA In Partial Fulfillment of the Requirements for the Degree MASTER OF SCIENCE (BIOCHEMISTRY AND MOLECULAR MEDICINE) August 2022 Copyright 2022 Guanlin Liu ii Acknowledgements I would like to express my deepest gratitude to my research advisor and thesis committee chair, Dr. Amy S. Lee for her patient guidance and persistent support of my graduate study at USC over the past two years. I especially appreciate her for teaching me critical thinking skills which will be extremely helpful in my future career. Besides, I must also thank the other committee members, Dr. Wei Li and Dr. Baruch Frenkel for showing me the right direction and giving me invaluable suggestions for this thesis. In addition, this project would not have been possible without Dr. Ze Liu whose preliminary study laid a concrete foundation for this project. Serving as my mentor, he helped me overcoming technical issues and gave me professional advice throughout this project. Also, as my good friend, he gave me a lot of help and support in my daily life. I would like to express my appreciation to Dr. Yi Shi in Nankai University for providing me the research opportunity and giving me research training when I was not able to come to the US because of the pandemic. I’d also like to acknowledge the help of Dr. Peggy Farnham and my friend Yao Liu for helping me with the ChIP-qPCR assay. I would also like to thank other Lee lab members: Dat Ha, Vicky Yamamoto, Bo Huang, John Johnson, Barry Wang, and former lab member Anthony Carlos for their helpful discussions and useful suggestions on my thesis. Finally, I’d like to express my deepest thanks to my parents who gave me unconditional love and help throughout my life. iii Table of Contents Acknowledgements ........................................................................................................ ii List of Figures ............................................................................................................... iv Abstract .......................................................................................................................... v Chapter I: Introduction ................................................................................................... 1 Chapter II: Materials and Methods ................................................................................ 6 2.1 Plasmids ................................................................................................................... 6 2.2 Cell Culture .............................................................................................................. 8 2.3 Transfection condition ............................................................................................. 8 2.4 Immunoblot analysis ................................................................................................ 9 2.5 Luciferase reporter assay ......................................................................................... 9 2.6 Immunofluorescence ................................................................................................ 9 2.7 Live cell imaging ................................................................................................... 10 2.8 ChIP-qPCR ............................................................................................................ 10 Chapter III: Results ...................................................................................................... 13 3.1 High GRP78 expression is a poor prognostic marker for LUAD and correlates with EGFR expression. ................................................................................................ 13 3.2 EGFR promoter luciferase reporter vector was constructed and verified .............. 15 3.3 GRP78 NLS mutant clone was constructed and verified ....................................... 18 3.4 Ectopically expressed GRP78 can bind to the EGFR promoter ............................ 23 Chapter IV: Discussion ................................................................................................ 26 Chapter V: Conclusion ................................................................................................. 29 References .................................................................................................................... 31 iv List of Figures Figure. 1-1 Re-localization of GRP78 to different cellular compartments and potential roles of nuclear-localized GRP78 .................................................................................. 5 Figure. 3-1 GRP78 is a poor prognostic marker for LUAD and positively correlate with EGFR expression in human lung cell lines .......................................................... 14 Figure 3-2 Construction and validation of EGFR promoter luciferase reporter clone 17 Figure 3-3-1 Construction and validation of NLS mutant clones ................................ 21 Figure 3-3-2 NLS sequence is important for GRP78 localization in the nucleus ........ 22 Figure 3-4 GRP78 interacts with the EGFR promoter ............................................... 25 v Abstract The 78 kilodalton glucose-regulated protein (GRP78) is a stress‐inducible endoplasmic reticulum (ER) chaperone in the heat shock protein family that promotes folding and assembly of nascent proteins. Although typically regarded as an ER lumenal chaperone, overexpression of GRP78 in cancers could lead to the re-localization of GRP78 to other subcellular organelles including the nucleus. In our study, we found that knockdown of GRP78 reduced the mRNA and protein levels of EGFR in several lung cancer cell lines. To further investigate the mechanism of this phenomenon, we constructed a luciferase reporter construct driven by the EGFR promoter and demonstrated that GRP78 knockdown suppressed the EGFR promoter activity. Moreover, we uncovered a potential nuclear localization signal (NLS) sequence on GRP78 and performed site- directed mutagenesis to generate two NLS-defective GRP78 expression vectors. Utilizing these constructs, we further discovered that nuclear GRP78 is the major contributor for the transcriptional regulation of EGFR upon GRP78 overexpression. Finally, we demonstrated GRP78 binding to the EGFR promoter and identified potential binding region via ChIP-qPCR assay. Overall, this study reveals a novel function of nuclear GRP78 as a regulator of EGFR expression in lung cancer. 1 Chapter I Introduction The endoplasmic reticulum (ER) is a type of membrane-enclosed organelle in eukaryotic cells for the synthesis and folding of secretory and membrane proteins, which account for about one third of the cell’s proteins (Zhang & Kaufman, 2008). Perturbations of the ER can lead to an imbalance between the demand for protein folding and the capacity of the ER for protein folding, thereby causing ER stress. Consequently, unfolded or misfolded proteins accumulate in ER lumen (Lin et al., 2008). In order to re-establish homeostasis, the cell triggers the Unfolded Protein Response (UPR), which activates the inositol-requiring enzyme 1 (IRE1), protein kinase RNA-like ER kinase (PERK) and activating transcription factor 6 (ATF6) signaling pathways, resulting in expression of pro-survival genes, translational attenuation, and enhanced ER-associated degradation of malfolded proteins (Lee, 2001; Ma & Hendershot, 2004). The 78 kilodalton glucose-regulated protein (GRP78), also referred to as immunoglobulin heavy chain binding protein BiP or HSPA5, was discovered as a cellular protein inducible by glucose starvation in 1977 (Shiu et al., 1977). As a chaperone protein, GRP78 contains an ATPase domain and a substrate-binding domain, which involved in the nascent peptides folding in the ER (Ni & Lee, 2007). It also involves in the proteasome degradation of misfolded proteins, and the activation of transmembrane ER stress sensors by its binding to Ca 2+ (Hendershot, 2004; Li et al., 2011). Under ER stress, GRP78 disassociates from three UPR signaling control 2 proteins (PERK, IRE1, and ATF6), activates these pathways and triggers UPR (Lee, 2014). Although the activation of UPR is initially prosurvival, cellular apoptotic response would be activated if UPR cannot re-establish homeostasis of the cell (Clarke et al., 2012). In cancer, it is widely observed that the overexpression of GRP78 is associated with the promotion of tumor proliferation, metastasis, drug resistance, and apoptosis (Huang et al., 2012; Thornton et al., 2013; Wu et al., 2014). Although GRP78, traditionally regarded as an ER chaperone, has the KDEL ER-retention signal, the saturation of KDEL receptors or defects in the protein sorting system might cause the inability to retrieve GRP78 to the ER lumen, especially in cells with GRP78 overexpression. Recently, the Lee lab has demonstrated that during ER stress, the oncoprotein SRC is activated and facilitates the relocalization of GRP78 to the cell surface (Tsai et al., 2019). Additionally, GRP78 can also translocate to the cytosol, and nucleus, and interact with several molecules to regulate different biochemical pathways. Recent study showed that cell surface GRP78 (CS‐GRP78) could activate downstream signaling factors (NF‐κB, STAT3, SMAD, c‐Myc or YAP/TAZ) and promote target gene transcription (Gopal & Pizzo, 2021; Ni et al., 2011). For nuclear GRP78, one of the studies showed that GRP78 knockdown sensitizes cells to UVC-induced cell death, primarily due to an impaired DNA repair capacity (Zhai et al., 2005). A proteomics study to isolate and identify proteins involved in irradiation-induced DNA protein cross-linking in mammalian cells identified GRP78 as being cross-linked to DNA in the nucleus (Barker et al., 2005). However, the function and mechanism of the nuclear form of GRP78 remain to be fully elucidated and require further study. Whether nuclear 3 GRP78 could regulate target gene transcription by binding to their promoters remains to be further investigated (Figure. 1-1). Lung cancer is the leading cause of cancer-related mortality both in men and women in the US. In 2021, an estimated 235,760 people were diagnosed with lung cancer, and 131,880 people died of the disease, with an overall 5-year survival rate of approximately 21% (Siegel et al., 2021). Lung cancer is divided into small-cell lung cancer (SCLC) and non-small-cell lung cancer (NSCLC) according to its cell origin, and the latter is further divided into lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) (Thandra et al., 2021) Depending on its type and stage, lung cancer may be treated with surgery, chemotherapy, radiation therapy, targeted therapies, immunotherapy, or combinations of these treatments (Force et al., 2021). In LUAD treatment, EGFR mutations account for the majority of druggable targets (Tumbrink et al., 2021). First (gefitinib, erlotinib), second (afatinib and dacomitinib) and third generation (osimertinib) EGFR tyrosine kinase inhibitors (TKIs) show improved progression-free survival (PFS) compared with standard chemotherapy in clinical trials. TKIs inhibit EGFR autophosphorylation and downstream signal transduction by binding to its ATP pocket (Passaro et al., 2021). Epidermal Growth Factor Receptor (EGFR) is a receptor tyrosine kinase with fundamental roles in development and normal physiology of epithelial cells, including stimulation of cell proliferation, differentiation, and motility (Lemmon & Schlessinger, 2010). Overexpression and hyperactivation of EGFR are predictors of poor prognosis in many cancers and could drive tumor initiation and progression (Mendelsohn & 4 Baselga, 2006). The tyrosine kinase activity of EGFR may be dysregulated by several oncogenic mechanisms, including gene mutation, increased gene copy number, and protein overexpression. Given that more than 60% of NSCLCs express EGFR, it has become a major therapeutic target for the treatment of NSCLC patients (Da Cunha Santos et al., 2011). Despite these significant therapeutic advances and a deep understanding of the genetic determinants, patients develop resistance through multiple routes, including acquired EGFR mutations such as T790M, resulting in disease progression and death (Vaclova et al., 2021). Therefore, further investigations are required in order to find a treatment that has a superior effect on anti-EGFR therapies for lung cancer. Studies have shown that GRP78 mediates the drug resistance of lung cancer cells through UPR (Xia et al., 2021). Besides, our previous study showed that knockdown of GRP78 by shRNA reduced the EGFR protein level in human head and neck cancer cell SCC-351 and human embryonic kidney cell HEK293T (Shen et al., 2017). This study aimed to investigate the role of GRP78 in regulation of EGFR in lung cancer. 5 Figure. 1-1 Re-localization of GRP78 to different cellular compartments and potential role of nuclear-localized GRP78 in gene transcription. GRP78 is traditionally recognized as a major ER chaperone facilitating protein maturation and degradation. Beyond the ER, GRP78 can re-localize to other organelles including the nucleus. Nuclear form of GRP78 has been linked to DNA damage repair. However, it is still unclear whether nuclear GRP78 could regulate target gene transcription by interaction with their promoters (Lee, 2014). 6 Chapter II Materials and Methods 2.1 Plasmids The luciferase reporter plasmids containing 1136 bp of the EGFR promoter DNA (- 1123 to +13 of EGFR gene transcription start site) were constructed by PCR amplification and were inserted into the pGL4.17 (luc2/Neo) vector (Promega, E672A) between KpnI and XhoI restriction endonuclease cleavage sites. The EGFR promoter DNA was PCR amplified using the 2× Hieff Canace Gold PCR Master Mix (Yeasen Biotech, 10149ES01), following the manufacturer’s instructions and genomic DNA from HEK293T cells was used as the DNA template. Two primers were designed to construct the plasmid, EGFR-promoter-F was the forward primer and EGFR-promoter- R was the reverse primer. Agarose gel electrophoresis was performed to check the success of PCR reactions using 20 μL of PCR products. DNA was purified by using QIAquick Gel Extraction Kit (QIAGEN). Restriction Endonuclease KpnI (NEB, R3142S) and XhoI (NEB, R0146S) was added into the purified DNA and pGL4.17 (luc2/Neo) vector and incubated at 37° C for two hours. Ligation of the EGFR promoter DNA and vector was performed using T4 DNA Ligase (NEB, M0202) at room temperature for one hour. Transformation of the ligated DNA products was performed using the 5-alpha Competent E. coli (NEB, C2987H). Colonies were picked next morning and incubated at 37°C overnight in 8 mL cultures (LB broth + ampicillin). QIAprep Spin Miniprep Kit (QIAGEN) was used to purify plasmid from the bacteria. Then plasmid samples were sent to Sangon Biotech (Shanghai, China) for sequencing. 7 EGFR-promoter-F 5’-TAGGGTACCTTGCTCCCCTTCAGAGAC-3’ EGFR-promoter-R 5’-TAGCTCGAGCTGCCCGGACGTCTAG-3’ For generation of the nuclear localization signal mutant clones, three lysine were mutated into alanine (K276A, K280A, K287A). Two mutant clones were performed by PCR using Q5® High-Fidelity DNA Polymerase (NEB, M0491) following the manufacturer’s instructions. One of the templates FLAG-GRP78 (F-GRP78) that has a FLAG-tag inserted after the ER signal peptide (aa 1–18) of full length human GRP78 (aa 1-654) was made previously in our lab (Zhang et al., 2010). Six primers were used for the mutagenesis. After PCR, DpnI restriction enzyme (NEB, R0176L) was used to cleave the template methylated DNA at 37°C for one hour. After transformation and plasmid miniprep, samples were sent to GENEWIZ for sequencing. FGRP78-K276A-F 5’-GACGGGCGCAGATGTCAGG-3’ FGRP78-K276A-R 5’-CTATTGTCTGCCCTGACATCTGCG-3’’ FGRP78-K280A-F 5’- GATGTCAGGGCAGACAATAGAG -3’ FGRP78-K280A-R 5’- CAGCTCTATTGTCTGCCCTG -3’ FGRP78-K287A-F 5’-GAGCTGTGCAGGCACTCC -3’ FGRP78-K287A-R 5’-GCCGGAGTGCCTGCAC -3’ Another DNA template GRP78-GFP was kindly provided by Dr. Erik Lee Snapp from Janelia Research Campus (Ashburn, VA). Six primers were designed for the site- directed mutagenesis on GRP78-GFP. The plasmids were sent to GENEWIZ for sequencing. 8 GRP78-K276A-F 5’-CTGTACAAAAAGAAAACTGGGGCAGAC-3’ GRP78-K276A-R 5’-GTTGTCTGCTCTAACGTCTGCC-3’ GRP78-K280A-F 5’-GAAAGACGTTAGAGCAGACAAC-3’ GRP78-K280A-R 5’-GCTCTGTTGTCTGCTCTAAC-3’ GRP78-K287A-F 5’-CAGAGCTGTGCAGGCACTTC-3’ GRP78-K287A-R 5’-CCTCACGACGAAGTGCCTG-3’ The GRP78 construct G227D has have already been generated in the lab (Tsai et al., 2015). The sequencing results from Sangon Biotech or GENEWIZ of all the constructs were verified. 2.2 Cell culture The human embryonic kidney cells HEK293AD cells were cultivated in Dulbecco’s Modified Eagle Medium (DMEM) (Fisher Scientific, MT15017CV) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin antibiotics. Cells were grown at 37° C in a humidified atmosphere of 5% CO2 and 95% air. 2.3 Transfection condition The constructs were transfected into 293AD cells in 6 well plates at 60%-80% confluence using the transfection reagent Lipofectamine 3000 (Thermo Fisher Scientific, L3000015) following the manufacturer’s instructions. Cells were collected after 48 hours of transfection. 9 2.4 Immunoblot analysis Cells were lysed in cold lysis buffer (0.5% NP-40, 50 mm Tris-HCl, pH 7.5, 100 mm NaCl, 0.1 mm EDTA, 10% glycerol and 1 mm dithiothreitol) supplemented with 1× protease inhibitor cocktail and the lysate was subjected to 10% SDS-PAGE. Proteins were transferred onto nitrocellulose membranes at 4° C at 35V overnight. For protein detection, the following primary antibodies were used: GRP78 (Bip, 1:1000, BD Biosciences, 610978), GAPDH (1:5000, Santa Cruz Biotechnology, sc-32233), anti- FLAG M2 mouse antibody (1:1000, Sigma-Aldrich, F1804). The secondary antibodies used in this study are described as follows: m-IgGκ BP-HRP (1:5000, Santa Cruz Biotechnology, sc-516102). 2.5 Luciferase reporter assay After transfection, 293AD cell extracts were prepared using Dual-Luciferase® Reporter Assay System (Promega). Luciferase activity was detected by luminometer (BMG LabTech FLUOstar OPTIMA) when Firefly substrate LAR II was added. The experiment was performed in triplicate. 2.6 Immunofluorescence Wild type F-GRP78 and NLS mutant F-GRP78 transfected 293AD cells were grown on Millicell EZ SLIDE (MilliporeSigma, PEZGS0816) fixed with 4% paraformaldehyde and permeabilized in 0.25% Triton X-100 for 10 min at room temperature. After incubation with blocking buffer (5% BSA, 0.1% Tween-20, PBS) 10 for 1 h, cells were incubated at 4 ° C overnight with anti-FLAG M2 mouse antibody (1:200, Sigma-Aldrich, F1804). Cells were washed three times before a 1 h incubation at room temperature with secondary antibodies (1:500, goat anti-mouse IgG antibodies conjugated with Alexa488, Santa Cruz Biotechnology, sc-516102). Cells were then washed and stained with 0.1 μg/mL 4,6-diamidino-2-phenylindole (DAPI, Sigma- Aldrich) and mounted with cover slips. Cell images were acquired with Leica SP8 LIGHTNING Confocal Microscope using a 63× oil objective. 2.7 Live cell imaging GRP78-GFP transfected 293AD cells were cultured with 10 μM Hoechst 33342 Solution (ThermoFisher Scientific, 62249) for 1 hour at 37 °C, and then imaged in phenol red-free RPMI supplemented with 10 mm HEPES, 5 mm glutamine and 10% fetal bovine serum. Live cells were imaged on Leica SP8 LIGHTNING Confocal Microscope with 63× oil objective. 2.8 ChIP-qPCR 1 × 10 7 293AD cells were cross-linked with 1% formaldehyde and harvested in cell lysis buffer [5 mM (pH 8.0) PIPES, 85 mM KCl, 5 mM EDTA and 0.5% NP-40] with 1× protease inhibitor cocktail. Then nuclear lysis buffer [50 mM (pH 8.1) Tris, 10 mM EDTA and 1% SDS] supplemented with 1× protease inhibitor cocktail was added. Sonication was carried out to shear the chromatin to yield DNA fragment sizes of 300 to 600 bp. Chromatin quality control was performed on 1.5% agarose gel. Raw 11 sonicated samples were cleared by centrifuging at 12,000g for 10 min at 4 ° C and separated into two groups, part of the samples was used as input. Incubated the sample with 15 μg of anti-FLAG M2 mouse antibody (Sigma-Aldrich, F1804) or mouse IgG antibody (Biolegend, 401404) at 4°C on a rotating platform overnight. Then, samples were incubated with 50 μL of Dynabeads™ Protein G (Thermo Fisher Scientific, 10004D) at 4°C for 2 hours. Antibody/chromatin complex were eluted by ChIP elution buffer (1 M NaHCO3 and 20% SDS). 15 μL of the complex in each IP group and input was treated with DNase I (Roche) for 30 minutes at 37°C and immunoblot analysis was performed to ensure the efficiency of transfection and immunoprecipitation. Rest of the samples were reverse cross-linked with 20 μL 5M NaCl at 67 °C overnight. QIAquick PCR Purification Kit (QIAGEN) was used for DNA purification. 5 groups of primers were designed covered 1136 bp of the EGFR promoter. EGFR-1-F 5’-CCTTGCTCCCCTTCAGAGAC-3’ EGFR-1-R 5’-CTGAGCTTTTTTGGGCTGCAG-3’ EGFR-2-F 5’-GTGGACTTGCCAAAGGAATATAGC-3' EGFR-2-R 5’-CGAAATCATCTGAAATGAGGGCAC-3’ EGFR-3-F 5’-GTCTCTGCACCCGGAGTTG-3’ EGFR-3-R 5’-GAGCCTTAGAGCCAGCGTC-3’ EGFR-4-F 5’-GACCCGAATAAAGGAGCAGTTTC-3’ EGFR-4-R 5’-GGTGCCCTGAGGAGTTAATTTCC-3’ EGFR-5-F 5’-GTCCAGAGGGGCAGTGCTG-3’ EGFR-5-R 5’-CTGCCCGGACGTCTAGCTC-3’ 12 PCR and agarose gel analysis was performed to ascertain the specificity of the primers. Quantitative real-time PCR analysis of the EGFR promoter DNA was performed using SsoAdvanced Universal SYBR Green Supermix (BIO-RAD, 1725270) and detected by the Stratagene MX3000P Real-Time QPCR System (Agilent) with the following PCR conditions (40 cycles, 15s at 95° C, 15s at 55° C, 30s at 72° C). Statistical analysis was performed with 2-tailed Student’s t-test. 13 Chapter III Results 3.1 High GRP78 expression is a poor prognostic marker for LUAD and correlates with EGFR expression. The standard method for estimating survival is the Kaplan-Meier plot (KM-plot). As demonstrated by Figure. 3-1 A-C, GRP78 is a poor prognostic marker for lung cancer (**p<0.01), especially LUAD (***p<0.001) but not in LUSC (p>0.05). LUAD patients with high GRP78 expression level have worse survival probability comparing to patients with low GRP78 expression level. Thus, we concentrate our focus on LUADs in lung cancer. Moreover, we conducted gene expression correlation analysis in DepMap data explorer and found that GRP78 expression has medium correlation with EGFR expression in human lung cancer cell lines (0.3<R<0.5) (Figure. 3-1 D). To examine the effect of GRP78 deficiency on EGFR protein and mRNA levels, Dr. Ze Liu in the Lee lab performed Western blot and RT-qPCR assay in GRP78 knockdown lung cancer cells. The results showed that GRP78 knockdown via siRNA reduced EGFR mRNA and protein levels in several lung cancer cell lines with or without EGFR mutation. We also observed the reduction of EGFR protein and mRNA levels in HEK293AD cell line after GRP78 knockdown similar to the lung cancer cell lines and we started using this cell line as our model system taking advantage of its high transfection efficiency. 14 Figure. 3-1 High GRP78 expression is a poor prognostic marker for LUAD and positively correlates with EGFR expression in human lung cell lines. A, B, C. Kaplan–Meier plots and hazard ratio analysis of GRP78 reveal a positive correlation with survival probability of all lung cancer patients (n=1925) and in LUAD patients (n=524). There is no correlation in LUSC patients (n=524). Patient samples were divided into two halves as “low-expression” (black)” and “high-expression” (red) sets for in the analysis. D. Scatterplot for GRP78 and EGFR expression levels in all cancer (n=1377) and lung cancer (n=205) cell lines obtained from DepMap portal. 15 3.2 EGFR promoter luciferase reporter vector was constructed and verified. One explanation for the downregulation of EGFR could be that EGFR mRNA stability is affected by knockdown of GRP78. Thus, Dr. Ze Liu performed Actinomycin D mRNA stability assay to test the mRNA stability of EGFR after GRP78 knockdown. However, the results showed that EGFR mRNA stability was not affected by GRP78 knockdown. Another explanation could be that GRP78 regulates EGFR transcription by interaction with its promoter. Thus, we created a luciferase reporter construct driven by the EGFR promoter to investigate the transcriptional regulation of EGFR by GRP78. To demonstrate the EGFR promoter, schematic illustration with transcription factor binding sites was made (Figure 3-2 A). Based on previous reports, the region approximately ~1000 bp upstream of the transcription start site (TSS) on EGFR possesses essential promoter activity, which can be modulated via Specificity Protein- 1(SP1), Activator Protein 1 (AP1), p53, Yin Yang 1 (YY1), Nuclear Factor kappa B (NFκB), Interferon Regulatory Factor 1 (IRF-1), and other transcription factors (Johnson et al., 2000; Tao et al., 2004; Tsai et al., 2019). To analyze the regulation of GRP78 on the EGFR promoter, EGFR promoter luciferase construct was created (Figure 3-2 A). First, 1136 bp of human wild type EGFR promoter was amplified by PCR using genomic DNA of 293T cells as template. Then, PCR reaction products was analyzed by agarose gel electrophoresis and three paralleled experimental groups showed similar bands near 1000 bp (Figure 3-2 B), proved that the PCR amplification was a success. Next, we purified DNA of 1000 bp 16 bands from agarose gel and inserted into the pGL4.17 (luc2/Neo) vector between KpnI and XhoI restriction sites. The construct was verified by sanger sequencing. To test the luciferase activity of the construct, we performed luciferase reporter assay. EGFR promoter luciferase construct was transfected into 293AD cells along with control groups which were transfected with pGL4.17 vector. Cell extracts were prepared after 48 hours of transfection. After Firefly substrate addition, luciferase activity was detected by luminometer. As demonstrated by Figure 3-2 C, the luciferase intensity of EGFR promoter luciferase construct transfected groups were significantly greater than control groups (***p<0.001). Collectively, the ability of the EGFR promoter to drive expression of the luciferase gene was verified, providing validation of the reporter construct as designed. To further investigate the regulation of the EGFR promoter by GRP78, dual- luciferase reporter assay was performed by Dr. Ze Liu in GRP78 knockdown cells. The results showed that knockdown of GRP78 by siRNA targeting the 3’ UTR of GRP78 mRNA suppressed the EGFR promoter activity. Moreover, we designed rescue experiment by transfection of FLAG-GRP78 (F-GRP78) in GRP78 knockdown cells. The results suggested that the suppression of the EGFR promoter activity could be rescued by overexpression of exogeneous F-GRP78. 17 Figure 3-2 Construction and validation of EGFR promoter luciferase reporter construct. A. Schematic of 1.1 kbp of human EGFR promoter with putative transcription factor binding sites shown. This fragment was inserted into the luciferase reporter plasmid pGL4.17. Primers used to amplify the promoter are shown. The insertion site was between KpnI and XhoI. Sequence in gray is part of the backbone of pGL4.17, no common cis-acting element in this region that could regulate the firefly luciferase. C. Agarose gel confirmation of the PCR products of 293T cells gDNA from three paralleled experimental groups. The most prominent bands are around 1000 bp. D. 293AD cells were transfected with either 1 μg EGFR promoter luciferase vector (n=3) or pGL4.17 vector (n=3). Luciferase activity was measured 48 h post- transfection. Data are presented as mean ± SE, ***p < 0.001. 18 3.3 GRP78 NLS mutant clone was constructed and verified. GRP78 has been observed in the nucleus when it is ectopically overexpressed or induced by ER stress. (Ni et al., 2011). However, the function and mechanism of nuclear GRP78 still need further investigation. To determine whether EGFR is regulated by nuclear GRP78, we performed site-directed mutagenesis to create nuclear localization signal (NLS) mutant GRP78 clone. First, we used NLStradamus (Nguyen Ba et al., 2009) to predict the NLS on GRP78 amino acid sequence (Figure 3-3-1 A). A single cluster composed of 16 amino acids between 275 and 297 was predicted to be an NLS sequence which has an NLS score for ~ 75. The sequence contains 7 positively charged residues, that is, arginine (R) or lysine (K). Then the crystal structure of GRP78 (6HAB) on Research Collaboratory for Structural Bioinformatics Protein Data Bank (RCSB PDB) was retrieved, and 3 arginine (K276, K280, K287) in the NLS sequence were found on the surface of the protein (Figure 3-3-1 B). These residues may have the ability to guide GRP78 into the nucleus. Moreover, the sequence is highly conserved in Homo sapiens and Cricetulus griseus (Chinese hamster) by alignment analysis. Thus, we planned to mutate K276, K280 and K287 into alanine which does not have positive charge to create NLS mutant GRP78 constructs using F-GRP78 and GRP78-GFP as templates. These constructs could help us study the function and mechanism of nuclear GRP78. We analyzed the sequence on NLStradamus after mutation, the peak of the NLS score dramatically drop to ~18 (Figure 3-3-1 A). Since the NLS sequence is located at the end of the ATPase domain of GRP78 19 (Figure 3-3-1 C), we need to prove the catalytic function of GRP78 is unaffected after NLS mutation. For this purpose, protein refolding assay was performed by Dr. Ze Liu. The protein folding activity of NLS mutant GRP78 recovered after heat shock comparing with the ATPase domain mutant GRP78 (G227D) that did not recover. The expression level of GRP78 were confirmed between F-GRP78 (WT) and F-GRP78 (NLS Mut) transfection groups by immunoblot analysis (Figure 3-3-1 D). To identify the NLS activity of GRP78 and validate the NLS mutation on GRP78 clones, 293AD cells transfected with either GRP78 (WT)-GFP or GRP78 (NLS Mut)- GFP were examined by confocal microscopy. Representative images are shown in Figure 3-3-2 A. In addition to being present in the ER, wild-type GFP-tagged GRP78 fusion protein can also be distributed to the nucleus while the NLS sequence mutation impaired the ability of GRP78 translocate into the nucleus. Moreover, we validated our finding by immunofluorescent staining. 293AD cells transfected with either the expression vector for F-GRP78 (WT) or the expression vector for F-GRP78 (NLS Mut) were immunostained with anti-FLAG antibody and examined by confocal microscopy. The use of GRP78 tagged with the FLAG epitope allowed the use of highly specific anti-FLAG antibody to detect GRP78 expression in cells. We observed that transfection of F-GRP78 (WT) in the cells led to GRP78 expression in the nucleus while transfection of F-GRP78 (NLS-Mut) in the cells did not (Figure 3-3-2 B). Collectively, these results showed that the predicted NLS sequence in GRP78 is important to direct nuclear localization and mutation of the sequence changed the subcellular localization of GRP78 protein. 20 To further investigate the regulation of EGFR transcription by GRP78 NLS mutant, Dr. Ze Liu overexpressed F-GRP78 (NLS-Mut) in GRP78 knockdown 293AD cells and performed dual-luciferase reporter assay to test the EGFR promoter activity. pcDNA3 vector transfected cells were used as negative control. We observed that overexpression of the NLS mutant GRP78 could not rescue the suppression of the EGFR promoter activity. Collectively, these results suggest that the transcriptional regulation of EGFR by GRP78 requires nuclear localization of GRP78. 21 Figure 3-3-1 Construction and validation of NLS mutant clones. A. Prediction of NLS motif on wild type and NLS mutant GRP78 amino acid sequence using NLStradamus. One putative NLS motif was found to be present in wild type GRP78, spanning amino acid residues 275 to 297 (NLS score > 60). B. Crystal structure of GRP78 (PDB: 6HAB). 3 lysine (red) in the predicted NLS motif were on the surface of GRP78. C. Schematic illustration of the wild type and NLS mutant GRP78. The ER signal peptide, ATPase domain, substrate binding domain, and KDEL motif are indicated. Lysine at position 276, 280, 287 were exchanged to alanine. D. 293AD cells were transfected with either F-GRP78 (WT) or F-GRP78 (NLS Mut) for 48 h. Cells transfected with pcDNA3 vector served as control. Total cell lysate was prepared and subjected to Western blot analysis. The protein levels of total GRP78 (GRP78) and exogenous GRP78 [Flag (GRP78)]; and GAPDH, which served as loading control, are shown. 22 Figure 3-3-2 NLS sequence is important for GRP78 localization in the nucleus. A. 293AD cells transfected with either GRP78 (WT)-GFP or GRP78 (NLS Mut)-GFP for 48 h. Live cells were imaged using confocal microscopy. The green signal corresponds to GRP78-GFP. Arrows indicate nuclear GRP78. Scale bar: 10 µ m. B. 293AD cells were transfected with either F-GRP78 (WT) or F-GRP78 (NLS-Mut) and were subjected to immunofluorescent staining for the F-GRP78 (green) and DAPI (blue). Arrows indicate nuclear GRP78. Scale bar: 10 µ m. The results in Figure. 3-3-2 were obtained from Dr. Ze Liu. 23 3.4 Ectopically expressed GRP78 can bind to the EGFR promoter. To further investigate whether GRP78 regulates EGFR transcription by binding to its promoter, we performed ChIP-qPCR assay in F-GRP78 transfected 293AD cells. 5 groups of primers were designed for qPCR which covered 1136 bp of the EGFR promoter region and overlapped with each other. Each group of the primers covered 200~300 bp (Figure 3-4 A). Then, we performed PCR and agarose gel electrophoresis assay using 293AD cell genomic DNA as template to check the specificity of these primers. As shown in Figure 3-4 B, primer group 2 (306 bp covered) and 4 (244 bp covered) were specific to the input template around 300~600 bp, while primer group 1, 3 and 5 had nonspecific bindings. Thus, we decided to use primer group 2 and 4 for the ChIP-qPCR assay. In ChIP assay, F-GRP78 was transfected at a dose of 18 μg into 293AD cells cultured in 150mm dish at 60~80% confluence. The use of F-GRP78 allowed us to immunoprecipitate GRP78 with high specificity and affinity using FLAG M2 antibody. After cross-linked with 1% formaldehyde, cells were harvested and sonicated. The chromatin fragment size was analyzed on a 1.5% agarose gel. As shown in Figure 3-4 C, the average size was of 300 to 600 bp which was optimal for PCR amplifying 200~300 bp fragments. Next, immunoprecipitation was performed with anti-FLAG antibody in sonicated chromatin samples. Isotype IgG was used as negative control. An aliquot of the eluted sample was used for Western blot analysis. The result showed that the transfection of F-GRP78 was a success and GRP78 was pulled down by anti-FLAG antibody but not anti-IgG antibody (Figure 3-4 D). Then we obtained the 24 immunoprecipitated chromatin sample after reverse cross-link and DNA purification. To test whether GRP78 interacts with the EGFR promoter, qPCR assay was performed using primer group 2 and 4. As demonstrated in Figure 3-4 E, the binding of GRP78 on the EGFR promoter was validated with both primer group 2 and primer group 4. We observed ~12-fold (p<0.01) increase of enrichment of primer group 2 covered EGFR promoter in IP-FLAG groups comparing with IgG groups. In line with this, IP-FLAG groups showed ~20-fold (p<0.01) increase of enrichment of primer group 4 covered EGFR promoter comparing with IgG groups. Therefore, we conclude that ectopically expressed GRP78 can bind to the EGFR promoter and regulate its transcription. 25 Figure 3-4 Ectopically expressed GRP78 interacts with the EGFR promoter. A. Schematic illustration of the 5 primer groups covering 1.1 kbp of the EGFR promoter. B. Agarose gel confirmation of the specificity of 5 primer groups. The size of the products should be 200~300 bp. C. Agarose gel confirmation of sonicated chromatin from ChIP assay. The average size was 300~600 bp. D. Samples from IP were subjected to Western blot and tested by GRP78 antibody along with Input serving as positive control. E. Bar graph plotted the relative DNA enrichment level of IP-FLAG (n=3) against IgG (n=3) from IP samples, evaluated using real-time PCR. Data are presented as mean ± SE, **p < 0.01. 26 Chapter IV Discussion The role of GRP78 in tumor biology is becoming increasingly evident. As the main UPR regulatory protein, GRP78 is highly expressed in a variety of tumor cells including lung cancer and plays an important role in tumor growth, proliferation, and metastasis (Xia et al., 2021). Overexpression of GRP78 leads to the promotion of GRP78 translocation from the ER lumen to other subcellular organelles including the nucleus. It was reported that knockdown of GRP78 sensitizes cells to UVC-induced cell death and GRP78 plays a protective role against UVC-induced cell death via nucleotide excision repair in human RSa cells (Zhai et al., 2005). A proteomics study to isolate and identify proteins involved in ionizing radiation-induced DNA-protein cross-links identified GRP78 as being cross-linked to DNA by ionizing radiation (Barker et al., 2005; Zhai et al., 2005). However, limited research has been conducted investigating the function and mechanism of nuclear GRP78. Here, we revealed a novel function of nuclear GRP78 in lung cancer. We found that nuclear GRP78 could regulate EGFR transcription and ectopically expressed GRP78 could bind to the EGFR promoter. EGFR, as a receptor tyrosine kinase with fundamental roles in development and normal physiology of epithelial cells, is overexpressed and hyperactivated in many cancers especially in lung cancer (Tan et al., 2016). EGFR is an important therapeutic target for the treatment of lung cancer patients (Mendelsohn & Baselga, 2006). It has been reported in our previous studies that knockdown of GRP78 reduced EGFR protein level in several cell lines (Shen et al., 2017). In this study, we constructed a luciferase 27 reporter construct driven by the EGFR promoter and discovered that knockdown of GRP78 by siRNA could inhibit the EGFR promoter activity and the inhibition could be rescued by exogenous overexpressed F-GRP78. We next predicted the NLS sequence on GRP78 which is required for its nuclear translocation. Then, two NLS mutant clones were constructed using F-GRP78 and GRP78-GFP as templates. The constructs were verified by confocal microscopy. We found that mutations on NLS sequence perturbed the translocation of GRP78 to the nucleus. Interestingly, overexpression of the NLS mutant GRP78 could not rescue the suppression of the EGFR promoter activity by GRP78 knockdown. This finding suggested that the transcriptional regulation of GRP78 on EGFR is mainly due to the expression of nuclear form of GRP78. In this thesis, we cannot rule out the possibilities that GRP78 outside nucleus can interact with other signaling pathways and indirectly regulate the EGFR promoter activity. We still need further literature search and experiments to address this question. To investigate the regulation of ectopically expressed GRP78 on EGFR transcription, ChIP-qPCR assay was performed using F-GRP78 transfected cells. We identified a GRP78 binding region on the EGFR promoter. Collectively, ectopically expressed GRP78 could interact with the EGFR promoter and regulate its transcription. Through this study, we found that ectopically expressed GRP78 have interaction with the EGFR promoter and regulate its transcription. The underlying mechanism is still under investigation, since GRP78 is not regarded as a transcription factor, it does not have a traditional DNA binding motif. One of the possible mechanisms would be 28 nuclear GRP78 have multiple DNA binding sites on the EGFR promoter. We could use Electrophoretic mobility shift assay (EMSA) to test this hypothesis. Another possibility is that nuclear GRP78 could interact with other transcription factor and act as a scaffold in the complex to regulate EGFR transcription. In this case, one of the binding regions for the GRP78-transcription factor complex on the EGFR promoter should between - 923 ~ -222 of the TSS corresponding to the result of ChIP-qPCR assay. Overall, this study uncovered a novel research field of ER stress protein act as a transcriptional regulator of target genes. To fully understand the function of nuclear GRP78 in transcriptional regulation, it is necessary to conduct in-depth and comprehensive analysis of the DNA binding mechanism of GRP78. 29 Chapter V Conclusion Given that dysregulation of EGFR is predictor of poor prognosis in NSCLCs, it has become an important therapeutic target for the treatment of NSCLC patients (Da Cunha Santos et al., 2011). Since knockdown of GRP78 reduced EGFR mRNA and protein levels in multiple lung cancer cell lines, we performed further investigation on the mechanism of this process. To understand the regulation of GRP78 on EGFR transcription, we constructed EGFR promoter luciferase vector. Based on this, we further demonstrated that GRP78 knockdown by siRNA suppressed the EGFR promoter activity. Moreover, the suppression could be rescued by overexpression of F- GRP78. Besides, we predicted NLS sequence on GRP78 and performed site-directed mutagenesis to generate NLS defect GRP78 clones. Our mutational studies provide new evidence that the regulation on EGFR transcription is by nuclear form of GRP78. Finally, we identified a possible binding region for GRP78 on the EGFR promoter. These studies still have several limitations and merit further investigation. Firstly, all of the experiments in this study were performed with ectopically expressed GRP78 constructs. However, whether endogenous GRP78 have a similar mechanism on gene transcriptional regulation is still unclear and remains further examination. Secondly, mechanism studies were performed in 293AD cells which normally do not have cancer pathology and ER stress. Mechanism studies in lung and other cancer cells, with or without ER stress may be required in the future study. Thirdly, ChIP-qPCR assay was performed with ectopically expressed wild type 30 GRP78. In order to investigate whether nuclear GRP78 bind to the EGFR promoter, we need to perform ChIP-qPCR assay in NLS mutant GRP78 transfected cells. Finally, there can be other mechanisms for nuclear GRP78 to regulate gene transcription, such as binding with other modifiers of gene transcription, and indirectly affect a wide array of genes. Further interactome study would reveal a more comprehensive understanding of nuclear GRP78 on regulation of gene transcription. Collectively, this study provides a novel function of nuclear GRP78 as a regulator of EGFR transcription in lung cancer. Future investigations on the role and mechanism of nuclear GRP78 in transcriptional regulation of target genes in cancer pathogenesis may provide novel treatment strategies for lung cancer. 31 References Barker, S., Weinfeld, M., Zheng, J., Li, L., & Murray, D. (2005). Identification of mammalian proteins cross-linked to DNA by ionizing radiation. J Biol Chem, 280(40), 33826-33838. https://doi.org/10.1074/jbc.M502477200 Clarke, R., Cook, K. L., Hu, R., Facey, C. O., Tavassoly, I., Schwartz, J. L., Baumann, W. T., Tyson, J. J., Xuan, J., Wang, Y ., Warri, A., & Shajahan, A. N. (2012). Endoplasmic reticulum stress, the unfolded protein response, autophagy, and the integrated regulation of breast cancer cell fate. Cancer Res, 72(6), 1321- 1331. https://doi.org/10.1158/0008-5472.CAN-11-3213 Da Cunha Santos, G., Shepherd, F. A., & Tsao, M. S. (2011). EGFR Mutations and Lung Cancer. Annual Review of Pathology: Mechanisms of Disease, 6(1), 49- 69. https://doi.org/10.1146/annurev-pathol-011110-130206 Force, U. S. P. S. T., Krist, A. H., Davidson, K. W., Mangione, C. M., Barry, M. J., Cabana, M., Caughey, A. B., Davis, E. M., Donahue, K. E., Doubeni, C. A., Kubik, M., Landefeld, C. S., Li, L., Ogedegbe, G., Owens, D. K., Pbert, L., Silverstein, M., Stevermer, J., Tseng, C. W., & Wong, J. B. (2021). Screening for Lung Cancer: US Preventive Services Task Force Recommendation Statement. JAMA, 325(10), 962-970. https://doi.org/10.1001/jama.2021.1117 Gopal, U., & Pizzo, S. V . (2021). Cell surface GRP78 signaling: An emerging role as a transcriptional modulator in cancer. J Cell Physiol, 236(4), 2352-2363. https://doi.org/10.1002/jcp.30030 Hendershot, L. M. (2004). The ER function BiP is a master regulator of ER function. Mt Sinai J Med, 71(5), 289-297. https://www.ncbi.nlm.nih.gov/pubmed/15543429 Huang, L. W., Lin, C. Y ., Lee, C. C., Liu, T. Z., & Jeng, C. J. (2012). Overexpression of GRP78 is associated with malignant transformation in epithelial ovarian tumors. Appl Immunohistochem Mol Morphol, 20(4), 381-385. https://doi.org/10.1097/PAI.0b013e3182434113 Johnson, A. C., Murphy, B. A., Matelis, C. M., Rubinstein, Y ., Piebenga, E. C., Akers, L. M., Neta, G., Vinson, C., & Birrer, M. (2000). Activator protein-1 mediates induced but not basal epidermal growth factor receptor gene expression. Molecular medicine (Cambridge, Mass.), 6(1), 17-27. https://pubmed.ncbi.nlm.nih.gov/10803405 32 Lee, A. S. (2001). The glucose-regulated proteins: stress induction and clinical applications. Trends Biochem Sci, 26(8), 504-510. https://doi.org/10.1016/s0968-0004(01)01908-9 Lee, A. S. (2014). Glucose-regulated proteins in cancer: molecular mechanisms and therapeutic potential. Nat Rev Cancer, 14(4), 263-276. https://doi.org/10.1038/nrc3701 Lemmon, M. A., & Schlessinger, J. (2010). Cell signaling by receptor tyrosine kinases. Cell, 141(7), 1117-1134. https://doi.org/10.1016/j.cell.2010.06.011 Li, X., Zhang, K., & Li, Z. (2011). Unfolded protein response in cancer: the physician's perspective. J Hematol Oncol, 4, 8. https://doi.org/10.1186/1756-8722-4-8 Lin, J. H., Walter, P., & Yen, T. S. (2008). Endoplasmic reticulum stress in disease pathogenesis. Annu Rev Pathol, 3, 399-425. https://doi.org/10.1146/annurev.pathmechdis.3.121806.151434 Ma, Y ., & Hendershot, L. M. (2004). The role of the unfolded protein response in tumour development: friend or foe? Nat Rev Cancer, 4(12), 966-977. https://doi.org/10.1038/nrc1505 Mendelsohn, J., & Baselga, J. (2006). Epidermal Growth Factor Receptor Targeting in Cancer. Seminars in Oncology, 33(4), 369-385. https://doi.org/https://doi.org/10.1053/j.seminoncol.2006.04.003 Nguyen Ba, A. N., Pogoutse, A., Provart, N., & Moses, A. M. (2009). NLStradamus: a simple Hidden Markov Model for nuclear localization signal prediction. BMC Bioinformatics, 10, 202. https://doi.org/10.1186/1471-2105-10-202 Ni, M., & Lee, A. S. (2007). ER chaperones in mammalian development and human diseases. FEBS Lett, 581(19), 3641-3651. https://doi.org/10.1016/j.febslet.2007.04.045 Ni, M., Zhang, Y ., & Lee, A. S. (2011). Beyond the endoplasmic reticulum: atypical GRP78 in cell viability, signalling and therapeutic targeting. Biochem J, 434(2), 181-188. https://doi.org/10.1042/BJ20101569 Passaro, A., Janne, P. A., Mok, T., & Peters, S. (2021). Overcoming therapy resistance in EGFR-mutant lung cancer. Nat Cancer, 2(4), 377-391. https://doi.org/10.1038/s43018-021-00195-8 33 Shen, J., Ha, D. P., Zhu, G., Rangel, D. F., Kobielak, A., Gill, P. S., Groshen, S., Dubeau, L., & Lee, A. S. (2017). GRP78 haploinsufficiency suppresses acinar-to-ductal metaplasia, signaling, and mutant Kras-driven pancreatic tumorigenesis in mice. Proc Natl Acad Sci U S A, 114(20), E4020-E4029. https://doi.org/10.1073/pnas.1616060114 Shiu, R. P., Pouyssegur, J., & Pastan, I. (1977). Glucose depletion accounts for the induction of two transformation-sensitive membrane proteinsin Rous sarcoma virus-transformed chick embryo fibroblasts. Proc Natl Acad Sci U S A, 74(9), 3840-3844. https://doi.org/10.1073/pnas.74.9.3840 Siegel, R. L., Miller, K. D., Fuchs, H. E., & Jemal, A. (2021). Cancer Statistics, 2021. CA Cancer J Clin, 71(1), 7-33. https://doi.org/10.3322/caac.21654 Tan, X., Lambert, P. F., Rapraeger, A. C., & Anderson, R. A. (2016). Stress-Induced EGFR Trafficking: Mechanisms, Functions, and Therapeutic Implications. Trends Cell Biol, 26(5), 352-366. https://doi.org/10.1016/j.tcb.2015.12.006 Tao, Y . G., Tan, Y . N., Liu, Y . P., Song, X., Zeng, L., Gu, H. H., Tang, M., Li, W., Yi, W., & Cao, Y . (2004). Epstein-Barr virus latent membrane protein 1 modulates epidermal growth factor receptor promoter activity in a nuclear factor kappa B- dependent manner. Cell Signal, 16(7), 781-790. https://doi.org/10.1016/j.cellsig.2003.12.001 Thandra, K. C., Barsouk, A., Saginala, K., Aluru, J. S., & Barsouk, A. (2021). Epidemiology of lung cancer. Contemp Oncol (Pozn), 25(1), 45-52. https://doi.org/10.5114/wo.2021.103829 Thornton, M., Aslam, M. A., Tweedle, E. M., Ang, C., Campbell, F., Jackson, R., Costello, E., Rooney, P. S., Vlatković, N., & Boyd, M. T. (2013). The unfolded protein response regulator GRP78 is a novel predictive biomarker in colorectal cancer [https://doi.org/10.1002/ijc.28137]. International Journal of Cancer, 133(6), 1408-1418. https://doi.org/https://doi.org/10.1002/ijc.28137 Tsai, C. N., Tsai, C. L., Yi, J. S., Kao, H. K., Huang, Y ., Wang, C. I., Lee, Y . S., & Chang, K. P. (2019). Activin A regulates the epidermal growth factor receptor promoter by activating the PI3K/SP1 pathway in oral squamous cell carcinoma cells. Sci Rep, 9(1), 5197. https://doi.org/10.1038/s41598-019-41396-7 Tsai, Y .-L., Zhang, Y ., Tseng, C.-C., Stanciauskas, R., Pinaud, F., & Lee, A. S. (2015). Characterization and Mechanism of Stress-induced Translocation of 78- Kilodalton Glucose-regulated Protein (GRP78) to the Cell Surface. Journal of Biological Chemistry, 290(13), 8049-8064. https://doi.org/10.1074/jbc.m114.618736 34 Tumbrink, H. L., Heimsoeth, A., & Sos, M. L. (2021). The next tier of EGFR resistance mutations in lung cancer. Oncogene, 40(1), 1-11. https://doi.org/10.1038/s41388-020-01510-w Vaclova, T., Grazini, U., Ward, L., O'Neill, D., Markovets, A., Huang, X., Chmielecki, J., Hartmaier, R., Thress, K. S., Smith, P. D., Barrett, J. C., Downward, J., & de Bruin, E. C. (2021). Clinical impact of subclonal EGFR T790M mutations in advanced-stage EGFR-mutant non-small-cell lung cancers. Nat Commun, 12(1), 1780. https://doi.org/10.1038/s41467-021-22057-8 Wu, C.-T., Wang, W.-C., Chen, M.-F., Su, H.-Y ., Chen, W.-Y ., Wu, C.-H., Chang, Y .-J., & Liu, H.-H. (2014). Glucose-regulated protein 78 mediates hormone- independent prostate cancer progression and metastasis through maspin and COX-2 expression. Tumor Biology, 35(1), 195-204. https://doi.org/10.1007/s13277-013-1024-4 Xia, S., Duan, W., Liu, W., Zhang, X., & Wang, Q. (2021). GRP78 in lung cancer. J Transl Med, 19(1), 118. https://doi.org/10.1186/s12967-021-02786-6 Zhai, L., Kita, K., Wano, C., Wu, Y ., Sugaya, S., & Suzuki, N. (2005). Decreased cell survival and DNA repair capacity after UVC irradiation in association with down-regulation of GRP78/BiP in human RSa cells. Exp Cell Res, 305(2), 244- 252. https://doi.org/10.1016/j.yexcr.2005.01.002 Zhang, K., & Kaufman, R. J. (2008). From endoplasmic-reticulum stress to the inflammatory response. Nature, 454(7203), 455-462. https://doi.org/10.1038/nature07203 Zhang, Y ., Liu, R., Ni, M., Gill, P., & Lee, A. S. (2010). Cell surface relocalization of the endoplasmic reticulum chaperone and unfolded protein response regulator GRP78/BiP. J Biol Chem, 285(20), 15065-15075. https://doi.org/10.1074/jbc.M109.087445

Abstract (if available)

Abstract The 78 kilodalton glucose-regulated protein (GRP78) is a stress‐inducible endoplasmic reticulum (ER) chaperone in the heat shock protein family that promotes folding and assembly of nascent proteins. Although typically regarded as an ER lumenal chaperone, overexpression of GRP78 in cancers could lead to the re-localization of GRP78 to other subcellular organelles including the nucleus. In our study, we found that knockdown of GRP78 reduced the mRNA and protein levels of EGFR in several lung cancer cell lines. To further investigate the mechanism of this phenomenon, we constructed a luciferase reporter construct driven by the EGFR promoter and demonstrated that GRP78 knockdown suppressed the EGFR promoter activity. Moreover, we uncovered a potential nuclear localization signal (NLS) sequence on GRP78 and performed site-directed mutagenesis to generate two NLS-defective GRP78 expression vectors. Utilizing these constructs, we further discovered that nuclear GRP78 is the major contributor for the transcriptional regulation of EGFR upon GRP78 overexpression. Finally, we demonstrated GRP78 binding to the EGFR promoter and identified potential binding region via ChIP-qPCR assay. Overall, this study reveals a novel function of nuclear GRP78 as a regulator of EGFR expression in lung cancer.

Linked assets

University of Southern California Dissertations and Theses

Conceptually similar

PDF

Utilizing novel small molecules to modulate GRP78 expression and activity in cancer

PDF

The role of GRP78 in the regulation of apoptosis and prostate cancer progression

PDF

The role of endoplasmic reticulum chaperone glucose-regulated 78-kilodalton (GRP78) in lung cancer

PDF

The role of endoplasmic reticulum chaperone protein GRP78 in breast cancer

PDF

Role of GRP78 and its novel cytosolic isoform GRP78va in regulating the unfolded protein response in cancer

PDF

Creating a multiple micrornia expression vector to target GRP78, an ER chaperone and signaling regulator in cancer

PDF

Cell surface translocation and therapeutic targeting of GRP78

PDF

The role of endoplasmic reticulum protein GRP78 in normal hematopoeises and PTEN-null leukemogenesis

PDF

Cell surface translocation mechanism of stress-inducible GRP78 in human cancer

PDF

Role of endoplasmic reticulum chaperones GRP78 and GRP94 in regulating unfolded protein response and cell survival

PDF

The role of glucose-regulated proteins in endometrial and pancreatic cancers

PDF

The role of endoplasmic reticulum proteins GRP78 and IP3R1 in regulation of glucose homeostasis and acute pancreatitis

PDF

The molecular mechanism of GRP78 translocation from the endoplasmic reticulum to the cell surface

PDF

The transcriptional regulation of the pro-survival protein Grp78 by activating transcription factors and chromatin-modifying enzymes: its upregulation in response to HDAC-inhibitor treatment and ...

PDF

The role of endoplasmic reticulum chaperones in adipogenesis, liver cancer and mammary gland development

PDF

Molecular mechanisms of chemoresistance in breast cancer

PDF

The roles of endoplasmic reticulum chaperones in regulating liver homeostasis and tumorigenesis

PDF

Examination of the effect of oleandrin on head and neck cancer cells

PDF

Mechanisms for regulating the expression of the TATA-binding protein

PDF

The role of endoplasmic reticulum chaperones in regulating hematopoietic stem cells and hematological malignancies

Asset Metadata

Creator Liu, Guanlin (author)

Core Title The role of nuclear GRP78 in regulation of EGFR expression in lung cancer

School Keck School of Medicine

Degree Master of Science

Degree Program Biochemistry and Molecular Medicine

Degree Conferral Date 2022-08

Publication Date 06/30/2022

Defense Date 05/28/2022

Publisher University of Southern California (original), University of Southern California. Libraries (digital)

Tag EGFR,lung cancer,nuclear GRP78,OAI-PMH Harvest,transcriptional regulation

Format application/pdf (imt)

Language English

Contributor Electronically uploaded by the author (provenance)

Advisor Lee, Amy (committee chair), Frenkel, Baruch (committee member), Li, Wei (committee member)

Creator Email guanlin@usc.edu,guanlinliu58@gmail.com

Permanent Link (DOI) https://doi.org/10.25549/usctheses-oUC111352072

Unique identifier UC111352072

Legacy Identifier etd-LiuGuanlin-10800

Document Type Thesis

Format application/pdf (imt)

Rights Liu, Guanlin

Type texts

Source 20220706-usctheses-batch-950 (batch), University of Southern California (contributing entity), University of Southern California Dissertations and Theses (collection)

Access Conditions The author retains rights to his/her dissertation, thesis or other graduate work according to U.S. copyright law. Electronic access is being provided by the USC Libraries in agreement with the author, as the original true and official version of the work, but does not grant the reader permission to use the work if the desired use is covered by copyright. It is the author, as rights holder, who must provide use permission if such use is covered by copyright. The original signature page accompanying the original submission of the work to the USC Libraries is retained by the USC Libraries and a copy of it may be obtained by authorized requesters contacting the repository e-mail address given.

Repository Name University of Southern California Digital Library

Repository Location USC Digital Library, University of Southern California, University Park Campus MC 2810, 3434 South Grand Avenue, 2nd Floor, Los Angeles, California 90089-2810, USA

Repository Email cisadmin@lib.usc.edu